Combined hairpin-antisense compositions and methods for modulating expression
Shanklin, John; Nguyen, Tam
2014-08-05
A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.
Combined hairpin-antisense compositions and methods for modulating expression
Shanklin, John; Nguyen, Tam Huu
2015-11-24
A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.
Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.
Faragher, S G; Meek, A D; Rice, C M; Dalgarno, L
1988-04-01
The nucleotide sequence of the genomic RNA of a mouse-avirulent strain of Ross River virus, RRV NB5092 (isolated in 1969), has been determined and the corresponding sequence for the prototype mouse-virulent strain, RRV T48 (isolated in 1959), has been completed. The RRV NB5092 genome is approximately 11,674 nucleotides in length, compared with 11,853 nucleotides for RRV T48. RRV NB5092 and RRV T48 have the same genome organization. For both viruses an untranslated region of 80 nucleotides at the 5' end of the genome is followed by a 7440-nucleotide open reading frame which is interrupted after 5586 nucleotides by a single opal termination codon. By homology with other alphaviruses, the 5586-nucleotide open reading frame encodes the nonstructural proteins nsP1, nsP2, and nsP3; a fourth nonstructural protein, nsP4, is produced by read-through of the opal codon. The RRV nonstructural proteins show strong homology with the corresponding proteins of Sindbis virus and Semliki Forest virus in terms of size, net charge, and hydropathy characteristics. However, homology is not uniform between or within the proteins; nsP1, nsP2, and nsP4 contain extended domains which are highly conserved between alphaviruses, while the C-terminal region of nsP3 shows little conservation in sequence or length between alphaviruses. An untranslated "junction" region of 44 nucleotides (for RRV NB5092) or 47 nucleotides (for RRV T48) separates the nonstructural and structural protein coding regions. The structural proteins (capsid-E3-E2-6K-E1) are translated from an open reading frame of 3762 nucleotides which is followed by a 3'-untranslated region of approximately 348 nucleotides (for RRV NB5092) or 524 nucleotides (for RRV T48). Excluding deletions and insertions, the genomes of RRV NB5092 and RRV T48 differ at 284 nucleotides, representing a sequence divergence of 2.38%. Sequence deletions or insertions were found only in the noncoding regions and include a 173-nucleotide deletion in the 3'-untranslated region of RRV NB5092, compared with RRV T48. In the coding regions, most of the nucleotide differences are silent; there are 36 amino acid differences in the nonstructural proteins and 12 in the structural proteins. The distribution of amino acid differences between the two RRV strains correlates with the location of domains which are poorly conserved in sequence between alphaviruses. The possible role of amino acid differences in envelope glycoproteins E1 and E2 in determining the different antigenic and biological properties of RRV NB5092 and RRV T48 is discussed.
Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue
2016-01-01
DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962
Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC
2006-01-01
Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935
Rasmussen, C.; Purcell, M.K.; Gregg, J.L.; LaPatra, S.E.; Winton, J.R.; Hershberger, P.K.
2010-01-01
The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of ~740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).
Dietary nitrogen alters codon bias and genome composition in parasitic microorganisms.
Seward, Emily A; Kelly, Steven
2016-11-15
Genomes are composed of long strings of nucleotide monomers (A, C, G and T) that are either scavenged from the organism's environment or built from metabolic precursors. The biosynthesis of each nucleotide differs in atomic requirements with different nucleotides requiring different quantities of nitrogen atoms. However, the impact of the relative availability of dietary nitrogen on genome composition and codon bias is poorly understood. Here we show that differential nitrogen availability, due to differences in environment and dietary inputs, is a major determinant of genome nucleotide composition and synonymous codon use in both bacterial and eukaryotic microorganisms. Specifically, low nitrogen availability species use nucleotides that require fewer nitrogen atoms to encode the same genes compared to high nitrogen availability species. Furthermore, we provide a novel selection-mutation framework for the evaluation of the impact of metabolism on gene sequence evolution and show that it is possible to predict the metabolic inputs of related organisms from an analysis of the raw nucleotide sequence of their genes. Taken together, these results reveal a previously hidden relationship between cellular metabolism and genome evolution and provide new insight into how genome sequence evolution can be influenced by adaptation to different diets and environments.
Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O
2004-01-01
Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko
2009-10-01
A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.
Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A
2012-05-01
The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.
[Study on the genetic difference of SEO type Hantaviruses].
Zhang, X; Zhou, S; Wang, H; Hu, J; Guan, Z; Liu, H
2000-10-01
To understand the genetic type of Hantaviruses and the difference between them caused by rodents in Beijing and to furhter explore the source of the infectious factors. Hantavirus RNA, isolated from lungs of rodents captured in Beijing and positive with Hantavirus antigens with frozen sectioning and Immunofluorescent assay, were reverse-transcribed and amplified with PCR with Hantavirus-specific primers. Five of the PCR amplifications were discovered and sequenced with 300 bp sequence data of M segments (from 2003 - 2302nt according cDNA of seoul 8039 strain). Nucleotide sequence homology showed that they were sequences of SEO-type Hantavirus. Compared with SEO type Hantavirus, the nucleotide sequence homology of these samples was more than 94% while the homology of amonia acid sequence was more than 98%. When compared with HNT type Hantavirus, the homology of nucleotide sequence became less than 72% with the homology of amonia acid sequence less than 81%. Similar to other Hantavirus of SEO type, their nucleotide sequences and deduced amino acid sequences were highly preserved. Phylogenetic tree analysis showed that the five viruses could be divided into at least 4 branches. It was quite likely that there were at least two sub-type SEO viruses with 4 branches that were circulating in Beijing.
Szilágyi, András; Zachar, István; Szathmáry, Eörs
2013-01-01
Models of competitive template replication, although basic for replicator dynamics and primordial evolution, have not yet taken different sequences explicitly into account, neither have they analyzed the effect of resource partitioning (feeding on different resources) on coexistence. Here we show by analytical and numerical calculations that Gause's principle of competitive exclusion holds for template replicators if resources (nucleotides) affect growth linearly and coexistence is at fixed point attractors. Cases of complementary or homologous pairing between building blocks with parallel or antiparallel strands show no deviation from the rule that the nucleotide compositions of stably coexisting species must be different and there cannot be more coexisting replicator species than nucleotide types. Besides this overlooked mechanism of template coexistence we show also that interesting sequence effects prevail as parts of sequences that are copied earlier affect coexistence more strongly due to the higher concentration of the corresponding replication intermediates. Template and copy always count as one species due their constraint of strict stoichiometric coupling. Stability of fixed-point coexistence tends to decrease with the length of sequences, although this effect is unlikely to be detrimental for sequences below 100 nucleotides. In sum, resource partitioning (niche differentiation) is the default form of competitive coexistence for replicating templates feeding on a cocktail of different nucleotides, as it may have been the case in the RNA world. Our analysis of different pairing and strand orientation schemes is relevant for artificial and potentially astrobiological genetics. PMID:23990769
The nucleotide sequence and genome organization of Plasmopara halstedii virus.
Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar
2011-03-17
Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates. Insignificant viral sequence variation indicated that the virus did not account for differences in pathogenicity of the oomycete P. halstedii.
Composition for nucleic acid sequencing
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2008-08-26
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Method for sequencing nucleic acid molecules
Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu
2006-06-06
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Method for sequencing nucleic acid molecules
Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu
2006-05-30
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Labeled nucleotide phosphate (NP) probes
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2009-02-03
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Krishnan, Neeraja M; Seligmann, Hervé; Stewart, Caro-Beth; De Koning, A P Jason; Pollock, David D
2004-10-01
Reconstruction of ancestral DNA and amino acid sequences is an important means of inferring information about past evolutionary events. Such reconstructions suggest changes in molecular function and evolutionary processes over the course of evolution and are used to infer adaptation and convergence. Maximum likelihood (ML) is generally thought to provide relatively accurate reconstructed sequences compared to parsimony, but both methods lead to the inference of multiple directional changes in nucleotide frequencies in primate mitochondrial DNA (mtDNA). To better understand this surprising result, as well as to better understand how parsimony and ML differ, we constructed a series of computationally simple "conditional pathway" methods that differed in the number of substitutions allowed per site along each branch, and we also evaluated the entire Bayesian posterior frequency distribution of reconstructed ancestral states. We analyzed primate mitochondrial cytochrome b (Cyt-b) and cytochrome oxidase subunit I (COI) genes and found that ML reconstructs ancestral frequencies that are often more different from tip sequences than are parsimony reconstructions. In contrast, frequency reconstructions based on the posterior ensemble more closely resemble extant nucleotide frequencies. Simulations indicate that these differences in ancestral sequence inference are probably due to deterministic bias caused by high uncertainty in the optimization-based ancestral reconstruction methods (parsimony, ML, Bayesian maximum a posteriori). In contrast, ancestral nucleotide frequencies based on an average of the Bayesian set of credible ancestral sequences are much less biased. The methods involving simpler conditional pathway calculations have slightly reduced likelihood values compared to full likelihood calculations, but they can provide fairly unbiased nucleotide reconstructions and may be useful in more complex phylogenetic analyses than considered here due to their speed and flexibility. To determine whether biased reconstructions using optimization methods might affect inferences of functional properties, ancestral primate mitochondrial tRNA sequences were inferred and helix-forming propensities for conserved pairs were evaluated in silico. For ambiguously reconstructed nucleotides at sites with high base composition variability, ancestral tRNA sequences from Bayesian analyses were more compatible with canonical base pairing than were those inferred by other methods. Thus, nucleotide bias in reconstructed sequences apparently can lead to serious bias and inaccuracies in functional predictions.
Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan
2014-01-01
The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084
The CD8α gene in duck (Anatidae): cloning, characterization, and expression during viral infection.
Xu, Qi; Chen, Yang; Zhao, Wen Ming; Huang, Zheng Yang; Duan, Xiu Jun; Tong, Yi Yu; Zhang, Yang; Li, Xiu; Chang, Guo Bin; Chen, Guo Hong
2015-02-01
Cluster of differentiation 8 alpha (CD8α) is critical for cell-mediated immune defense and T-cell development. Although CD8α sequences have been reported for several species, very little is known about CD8α in ducks. To elucidate the mechanisms involved in the innate and adaptive immune responses of ducks, we cloned CD8α coding sequences from domestic, Muscovy, Mallard, and Spotbill ducks using reverse transcription polymerase chain reaction (RT-PCR). Each sequence consisted of 714 nucleotides and encoded a signal peptide, an IgV-like domain, a stalk region, a transmembrane region, and a cytoplasmic tail. We identified 58 nucleotide differences and 37 amino acid differences among the four types of duck; of these, 53 nucleotide and 33 amino acid differences were between Muscovy ducks and the other duck species. The CD8α cDNA sequence from domestic duck consisted of a 61-nucleotide 5' untranslated region (UTR), a 714-nucleotide open reading frame, and an 849-nucleotide 3' UTR. Multiple sequence alignments showed that the amino acid sequence of CD8α is conserved in vertebrates. RT-PCR revealed that expression of CD8α mRNA of domestic ducks was highest in the thymus and very low in the kidney, cerebrum, cerebellum, and muscle. Immunohistochemical analyses detected CD8α on the splenic corpuscle and periarterial lymphatic sheath of the spleen. CD8α mRNA in domestic ducklings was initially up-regulated, and then down-regulated, in the thymus, spleen, and liver after treatment with duck hepatitis virus type I (DHV-1) or the immunostimulant polyriboinosinic polyribocytidylic acid (poly I:C).
Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same
Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.
1999-01-19
The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.
Nucleic acid analysis using terminal-phosphate-labeled nucleotides
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2008-04-22
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Nucleotide sequence of a resistance breaking mutant of southern bean mosaic virus.
Lee, L; Anderson, E J
1998-01-01
SBMV-S is a resistance-breaking mutant of an Arkansas isolate of the bean strain of southern bean mosaic virus (SBMV-BARK) that is able to move systemically in Phaseolus vulgaris cvs. Pinto and Great Northern, whereas the wild-type SBMV-BARK causes local necrotic lesions and is restricted to the inoculated leaves of these hosts. Sequence analysis of the 4136 nucleotide genomes of SBMV-BARK and SBMV-S revealed seven nucleotide differences, but only four deduced amino acid changes. A single amino acid change occurred in the C-terminal region of the putative RNA-dependent RNA polymerase and three differences were identified in the N-terminal portion of the virus coat protein. SBMV-BARK and SBMV-S were compared with other sobemoviruses and were found to contain a high level of nucleotide sequence identity (91.3%) to SBMV-B. Unlike SBMV-B however, SBMV-BARK and SBMV-S contained four putative overlapping open reading frames, making them more similar in genome organization to the cowpea strain, SBMV-C. The possibility exists that mutations or even errors, that resulted in mis-identification of open reading frames, occurred in previously published information on nucleotide sequence and genomic organization for SBMV-B.
Molecular identification of Trichuris vulpis and Trichuris suis isolated from different hosts.
Cutillas, Cristina; de Rojas, Manuel; Ariza, Concepción; Ubeda, José Manuel; Guevara, Diego
2007-01-01
Trichuris suis was isolated from the cecum of two different hosts (Sus scrofa domestica -- swine and Sus scrofa scrofa -- wild boar) and Trichuris vulpis from dogs in Sevilla, Spain. Genomic DNA was isolated and internal transcribed spacers (ITS)1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced using polymerase chain reaction techniques. The sequence of T. suis from both hosts was 1,396 bp in length while that of T. vulpis was 1,044 bp. ITS1 of both populations isolated of T. suis was 661 nucleotides in length, while the ITS2 was 534 nucleotides in length. Furthermore, the ITS1 of T. vulpis was 410 nucleotides in length, while the ITS2 was 433 nucleotides in length. One hundred fifty-four nucleotides were observed along the 5.8S gene of T. suis and T. vulpis. Intraindividual and intraspecific variations were detected in the rDNA of both species. The presence of microsatellites was observed in all the individuals assayed. Sequence analysis of the ITSs and the 5.8S gene has demonstrated no sequence differences between T. suis isolated from both hosts (S. scrofa domestica -- swine and S. scrofa scrofa -- wild boar). Nevertheless, clear differences were detected between the ITS1 and ITS2 of T. suis and T. vulpis. Furthermore, a comparative molecular analysis between both species and the previously published ITS1-5.8S-ITS2 sequence data of Trichuris ovis, Trichuris leporis, Trichuris muris, Trichuris arvicolae, and Trichuris skrjabini was carried out. A common homology zone was detected in the ITS1 sequence of all species of trichurids.
The complete sequence of Cymbidium mosaic virus from Vanilla fragrans in Hainan, China.
He, Zhen; Jiang, Dongmei; Liu, Aiqin; Sang, Liwei; Li, Wenfeng; Li, Shifang
2011-06-01
The complete nucleotide sequence of Cymbidium mosaic virus (CymMV) isolated from vanilla in Hainan province, China was determined for the first time. It comprised 6,224 nucleotides; sequence analysis suggested that the isolate we obtained was a member of the genus Potexvirus, and its sequence shared 86.67-96.61% identities with previously reported sequences. Phylogenetic analysis suggested that CymMV from vanilla fragrans was clustered into subgroup A and the isolates in this subgroup displayed little regional difference.
Molecular characterization of the vitamin D receptor (VDR) gene in Holstein cows.
Ali, Mayar O; El-Adl, Mohamed A; Ibrahim, Hussam M M; Elseedy, Youssef Y; Rizk, Mohamed A; El-Khodery, Sabry A
2018-06-01
Vitamin D plays a vital role in calcium homeostasis, growth, and immunoregulation. Because little is known about the vitamin D receptor (VDR) gene in cattle, the aim of the present investigation was to present the molecular characterization of exons 5 and 6 of the VDR gene in Holstein cows. DNA extraction, genomic sequencing, phylogenetic analysis, synteny mapping and single nucleotide gene polymorphism analysis of the VDR gene were performed to assess blood samples collected from 50 clinically healthy Holstein cows. The results revealed the presence of a 450-base pair (bp) nucleotide sequence that resembled exons 5 and 6 with intron 5 enclosed between these exons. Sequence alignment and phylogenetic analysis revealed a close relationship between the sequenced VDR region and that found in Hereford cattle. A close association between this region and the corresponding region in small ruminants was also documented. Moreover, a single nucleotide polymorphism (SNP) that caused the replacement of a glutamate with an arginine in the deduced amino acid sequence was detected at position 7 of exon 5. In conclusion, Holstein and Hereford cattle differ with respect to exon 5 of the VDR gene. Phylogenetic analysis of the VDR gene based on nucleotide sequence produced different results from prior analyses based on amino acid sequence. Copyright © 2018 Elsevier Ltd. All rights reserved.
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
Faragher, S G; Dalgarno, L
1986-07-20
The 3' untranslated (UT) sequences of the genomic RNAs of five geographic variants of the alphavirus Ross River virus (RRV) were determined and compared with the 3' UT sequence of RRV T48, the prototype strain. Part of the 3' UT region of Getah virus, a close serological relative of RRV, was also sequenced. The RRV 3' UT region varies markedly in length between variants. Large deletions or insertions, sequence rearrangements and single nucleotide substitutions are observed. A sequence tract of 49 to 58 nucleotides, which is repeated as four blocks in the RRV T48 3' UT region, occurs only once in the 3' UT region of one RRV strain (NB5092), indicating that the existence of repeat sequence blocks is not essential for RRV replication. However, the precise sequence of the 3' proximal copy of the repeat block and its position relative to the poly(A) tail were identical in all RRV isolates examined, suggesting that it has an important role in RRV replication. Nucleotide substitutions between RRV variants are distributed non-randomly along the length of the 3' UT region. The sequence of 120 to 130 nucleotides adjacent to the poly(A) tail is strongly conserved. Getah virus RNA contains three repeat sequence blocks in the 3' UT region. These are similar in sequence to those in RRV RNA but differ in their arrangement. Homology between the RRV and Getah 3' UT sequences is greatest in the 3' proximal repeat sequence block that shows three differences in 49 nucleotides. The 3' proximal repeat in Getah RNA occurs at the same position, relative to the poly(A) tail, as in all RRV variants. The RRV and Getah virus 3' UT sequences show extensive homology in the region between the 3' proximal repeat and the poly(A) tail but, apart from the repeat blocks themselves, they show no significant homology elsewhere.
Barkan, A; Mertz, J E
1981-02-01
The nucleotide sequences of 10 viable yet partially defective deletion mutants of simian virus 40 were determined. The deletions mapped within, and, in many cases, 5' to, the predominant leader sequence of the late viral mRNA's. They ranged from 74 to 187 nucleotide pairs in length. Six of the mutants had lost the sequence that corresponds to the "cap" site (5' terminus) of the most abundant class of 16S mRNA's. One of these mutants had a deletion that extended 103 nucleotide pairs into the region preceding this primary cap site and, therefore, was missing many secondary cap sites as well. A seventh mutant lacked the entire major 16S leader sequence except for the first six nucleotides at its 5' end and the last nine at its 3' end. Although these mutants differed in the size and position of their deletions, we were unable to discover any simple correlations between their growth characteristics and their DNA sequences. This finding indicates that the secondary structures of the RNA transcripts may play a more important role than the exact nucleotide sequence of the RNAs in determining how they function within the cell.
Aspergillus and Penicillium identification using DNA sequences: Barcode or MLST?
USDA-ARS?s Scientific Manuscript database
Current methods in DNA technology can detect single nucleotide polymorphisms with measurable accuracy using several different approaches appropriate for different uses. If there are even single nucleotide differences that are invariant markers of the species, we can accomplish identification through...
Mandl, C W; Holzmann, H; Kunz, C; Heinz, F X
1993-05-01
The complete nucleotide sequence of the positive-stranded RNA genome of the tick-borne flavivirus Powassan (10,839 nucleotides) was elucidated and the amino acid sequence of all viral proteins was derived. Based on this sequence as well as serological data, Powassan virus represents the most divergent member of the tick-borne serocomplex within the genus flaviviruses, family Flaviviridae. The primary nucleotide sequence and potential RNA secondary structures of the Powassan virus genome as well as the protein sequences and the reactivities of the virion with a panel of monoclonal antibodies were compared to other tick-borne and mosquito-borne flaviviruses. These analyses corroborated significant differences between tick-borne and mosquito-borne flaviviruses, but also emphasized structural elements that are conserved among both vector groups. The comparisons among tick-borne flaviviruses revealed conserved sequence elements that might represent important determinants of the tick-borne flavivirus phenotype.
Correlation approach to identify coding regions in DNA sequences
NASA Technical Reports Server (NTRS)
Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.
1994-01-01
Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.
Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.
Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook
2014-11-01
As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Dasgupta, R; Kaesberg, P
1982-01-01
The nucleotide sequences of the subgenomic coat protein messengers (RNA4's) of two related bromoviruses, brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV), have been determined by direct RNA and CDNA sequencing without cloning. BMV RNA4 is 876 b long including a 5' noncoding region of nine nucleotides and a 3' noncoding region of 300 nucleotides. CCMV RNA 4 is 824 b long, including a 5' noncoding region of 10 nucleotides and a 3' noncoding region of 244 nucleotides. The encoded coat proteins are similar in length (188 amino acids for BMV and 189 amino acids for CCMV) and display about 70% homology in their amino acid sequences. Length difference between the two RNAs is due mostly to a single deletion, in CCMV with respect to BMV, of about 57 b immediately following the coding region. Allowing for this deletion the RNAs are indicate that mutations leading to divergence were constrained in the coding region primarily by the requirement of maintaining a favorable coat protein structure and in the 3' noncoding region primarily by the requirement of maintaining a favorable RNA spatial configuration. PMID:6895941
Chapell, J D; Goral, M I; Rodgers, S E; dePamphilis, C W; Dermody, T S
1994-01-01
To better understand genetic diversity within mammalian reoviruses, we determined S2 nucleotide and deduced sigma 2 amino acid sequences of nine reovirus strains and compared these sequences with those of prototype strains of the three reovirus serotypes. The S2 gene and sigma 2 protein are highly conserved among the four type 1, one type 2, and seven type 3 strains studied. Phylogenetic analyses based on S2 nucleotide sequences of the 12 reovirus strains indicate that diversity within the S2 gene is independent of viral serotype. Additionally, we found marked topological differences between phylogenetic trees generated from S1 and S2 gene nucleotide sequences of the seven type 3 strains. These results demonstrate that reovirus S1 and S2 genes have distinct evolutionary histories, thus providing phylogenetic evidence for lateral transfer of reovirus genes in nature. When variability among the 12 sigma 2-encoding S2 nucleotide sequences was analyzed at synonymous positions, we found that approximately 60 nucleotides at the 5' terminus and 30 nucleotides at the 3' terminus were markedly conserved in comparison with other sigma 2-encoding regions of S2. Predictions of RNA secondary structures indicate that the more conserved S2 sequences participate in the formation of an extended region of duplex RNA interrupted by a pair of stem-loops. Among the 12 deduced sigma 2 amino acid sequences examined, substitutions were observed at only 11% of amino acid positions. This finding suggests that constraints on the structure or function of sigma 2, perhaps in part because of its location in the virion core, have limited sequence diversity within this protein. PMID:8289378
Molecular identification based on ITS sequences for Kappaphycus and Eucheuma cultivated in China
NASA Astrophysics Data System (ADS)
Zhao, Sufen; He, Peimin
2011-11-01
The systematic classification of the Eucheumatoideae is difficult because of their variable morphology and interpretation of reproductive structures. Kappaphycus and Eucheuma specimens cultivated on the Hainan and Fujian coast of China were introduced from Vietnam, the Philippines and Indonesia. Combined with morphological characteristics, all Kappaphycus and Eucheuma cultivated strains were identified by internal transcribed spacer (ITS) sequences. The phylogenetic tree was constructed using neighbor-joining and maximum likelihood methods. The results indicate that different ITS sequence lengths occurred in the different genera and species. An obvious difference in morphology could be found in the protuberance shape between Kappaphycus and Eucheuma. The protuberance in Eucheuma was thorn-like and in Kappaphycus was wartlike or papillate. Their ITS sequence lengths differed significantly in nucleotide variation rates up to 58.55%-63.90%. All nucleotide variations occurred in the ITS1 and ITS2 regions except for five nucleotide transversions in the 5.8S rDNA region. In addition, the difference was at the branches among congeneric species. Kappaphycus sp. had branches with small buds, while K. alvarezii did not have such a feature. The nucleotide variation rates varied from 7.02% to 7.48% among species; within the same species of the clades it was <1.20%. Eucheumatoideae algae cultivated in China consisted of three clades, K. alvarezii, Kappaphycus sp., and E. denticulatum. The results indicate that ITS sequence analysis was an effective way for identification of interspecies and intraspecies phylogenetic relationships and might provide a clue for molecular identification of algal Eucheumatoideae.
Schuster, W; Wissinger, B; Unseld, M; Brennicke, A
1990-01-01
A number of cytosines are altered to be recognized as uridines in transcripts of the nad3 locus in mitochondria of the higher plant Oenothera. Such nucleotide modifications can be found at 16 different sites within the nad3 coding region. Most of these alterations in the mRNA sequence change codon identities to specify amino acids better conserved in evolution. Individual cDNA clones differ in their degree of editing at five nucleotide positions, three of which are silent, while two lead to codon alterations specifying different amino acids. None of the cDNA clones analysed is maximally edited at all possible sites, suggesting slow processing or lowered stringency of editing at these nucleotides. Differentially edited transcripts could be editing intermediates or could code for differing polypeptides. Two edited nucleotides in an open reading frame located upstream of nad3 change two amino acids in the deduced polypeptide. Part of the well-conserved ribosomal protein gene rps12 also encoded downstream of nad3 in other plants, is lost in Oenothera mitochondria by recombination events. The functional rps12 protein must be imported from the cytoplasm since the deleted sequences of this gene are not found in the Oenothera mitochondrial genome. The pseudogene sequence is not edited at any nucleotide position. Images Fig. 3. Fig. 4. Fig. 7. PMID:1688531
Characterization of the repetitive DNA elements in the genome of fish lymphocystis disease viruses.
Schnitzler, P; Darai, G
1989-09-01
The complete DNA nucleotide sequence of the repetitive DNA elements in the genome of fish lymphocystis disease virus (FLDV) isolated from two different species (flounder and dab) was determined. The size of these repetitive DNA elements was found to be 1413 bp which corresponds to the DNA sequences of the 5' terminus of the EcoRI DNA fragment B (0.034 to 0.052 m.u.) and to the EcoRI DNA fragment M (0.718 to 0.736 m.u.) of the FLDV genome causing lymphocystis disease in flounder and plaice. The degree of DNA nucleotide homology between both regions was found to be 99%. The repetitive DNA element in the genome of FLDV isolated from other fish species (dab) was identified and is located within the EcoRI DNA fragment B and J of the viral genome. The DNA nucleotide sequence of one duplicate of this repetition (EcoRI DNA fragment J) was determined (1410 bp) and compared to the DNA nucleotide sequences of the repetitive DNA elements of the genome of FLDV isolated from flounder. It was found that the repetitive DNA elements of the genome of FLDV derived from two different fish species are highly conserved and possess a degree of DNA sequence homology of 94%. The DNA sequences of each strand of the individual repetitive element possess one open reading frame.
OrthoANI: An improved algorithm and software for calculating average nucleotide identity.
Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik
2016-02-01
Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.
Newton, L A; Chilton, N B; Beveridge, I; Gasser, R B
1998-02-01
Genetic differences among Nematodirus spathiger, Nematodirus filicollis, Nematodirus helvetianus and Nematodirus battus in the nucleotide sequence of the second internal transcribed spacer (ITS-2) of ribosomal DNA ranged from 3.9 to 24.7%. Pairwise comparisons of their ITS-2 sequences indicated that the most genetically similar species were N. spathiger and N. helvetianus. N. battus was the most genetically distinct species, with differences ranging from 22.8 to 24.7% with respect to the other three species. Some of the nucleotide differences among species provided different endonuclease restriction sites that could be used in restriction fragment length polymorphism studies. The ITS-2 sequence data may prove useful in studies of the systematics of molineid nematodes.
37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.
Code of Federal Regulations, 2011 CFR
2011-07-01
... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...
SENCA: A Multilayered Codon Model to Study the Origins and Dynamics of Codon Usage
Pouyet, Fanny; Bailly-Bechet, Marc; Mouchiroud, Dominique; Guéguen, Laurent
2016-01-01
Gene sequences are the target of evolution operating at different levels, including the nucleotide, codon, and amino acid levels. Disentangling the impact of those different levels on gene sequences requires developing a probabilistic model with three layers. Here we present SENCA (site evolution of nucleotides, codons, and amino acids), a codon substitution model that separately describes 1) nucleotide processes which apply on all sites of a sequence such as the mutational bias, 2) preferences between synonymous codons, and 3) preferences among amino acids. We argue that most synonymous substitutions are not neutral and that SENCA provides more accurate estimates of selection compared with more classical codon sequence models. We study the forces that drive the genomic content evolution, intraspecifically in the core genome of 21 prokaryotes and interspecifically for five Enterobacteria. We retrieve the existence of a universal mutational bias toward AT, and that taking into account selection on synonymous codon usage has consequences on the measurement of selection on nonsynonymous substitutions. We also confirm that codon usage bias is mostly driven by selection on preferred codons. We propose new summary statistics to measure the relative importance of the different evolutionary processes acting on sequences. PMID:27401173
Dynamics of actin evolution in dinoflagellates.
Kim, Sunju; Bachvaroff, Tsvetan R; Handy, Sara M; Delwiche, Charles F
2011-04-01
Dinoflagellates have unique nuclei and intriguing genome characteristics with very high DNA content making complete genome sequencing difficult. In dinoflagellates, many genes are found in multicopy gene families, but the processes involved in the establishment and maintenance of these gene families are poorly understood. Understanding the dynamics of gene family evolution in dinoflagellates requires comparisons at different evolutionary scales. Studies of closely related species provide fine-scale information relative to species divergence, whereas comparisons of more distantly related species provides broad context. We selected the actin gene family as a highly expressed conserved gene previously studied in dinoflagellates. Of the 142 sequences determined in this study, 103 were from the two closely related species, Dinophysis acuminata and D. caudata, including full length and partial cDNA sequences as well as partial genomic amplicons. For these two Dinophysis species, at least three types of sequences could be identified. Most copies (79%) were relatively similar and in nucleotide trees, the sequences formed two bushy clades corresponding to the two species. In comparisons within species, only eight to ten nucleotide differences were found between these copies. The two remaining types formed clades containing sequences from both species. One type included the most similar sequences in between-species comparisons with as few as 12 nucleotide differences between species. The second type included the most divergent sequences in comparisons between and within species with up to 93 nucleotide differences between sequences. In all the sequences, most variation occurred in synonymous sites or the 5' UnTranslated Region (UTR), although there was still limited amino acid variation between most sequences. Several potential pseudogenes were found (approximately 10% of all sequences depending on species) with incomplete open reading frames due to frameshifts or early stop codons. Overall, variation in the actin gene family fits best with the "birth and death" model of evolution based on recent duplications, pseudogenes, and incomplete lineage sorting. Divergence between species was similar to variation within species, so that actin may be too conserved to be useful for phylogenetic estimation of closely related species.
Khan, A S
1984-01-01
The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017
Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W
1993-12-01
Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...
A Bioluminometric Method of DNA Sequencing
NASA Technical Reports Server (NTRS)
Ronaghi, Mostafa; Pourmand, Nader; Stolc, Viktor; Arnold, Jim (Technical Monitor)
2001-01-01
Pyrosequencing is a bioluminometric single-tube DNA sequencing method that takes advantage of co-operativity between four enzymes to monitor DNA synthesis. In this sequencing-by-synthesis method, a cascade of enzymatic reactions yields detectable light, which is proportional to incorporated nucleotides. Pyrosequencing has the advantages of accuracy, flexibility and parallel processing. It can be easily automated. Furthermore, the technique dispenses with the need for labeled primers, labeled nucleotides and gel-electrophoresis. In this chapter, the use of this technique for different applications is discussed.
Santagati, Vito Davide; Sestili, Francesco; Lafiandra, Domenico; D'Ovidio, Renato; Rogniaux, Helene; Masci, Stefania
2016-07-01
Wheat high molecular weight glutenin subunit variation is important because of its great influence on glutenin polymer structure, that is related to dough technological properties. Among the different subunits, the pair Bx20 and By20 is known to have a negative effect on quality, but the reasons are not clear: Bx20 has two cysteines, which theoretically make this subunit a chain extender of the glutenin polymer, just like the other Bx subunits, showing four cysteines, two of which should be involved in intra-molecular disulfide bonds. By20 has never been characterized so far at molecular level. Here we report the nucleotide sequences of Bx20 and By20 genes isolated from the durum wheat cultivar 'Lira 45' and the validation of the corresponding deduced amino acid sequences by using MALDI-TOF and LC-MS/MS. Four nucleotide differences were identified in the Bx20 gene with respect to the deduced sequence present in NCBI, causing two amino acid substitutions. For the By20 subunit, nucleotide and amino acid sequences revealed a great similarity to By15, both at gene and protein levels, showing five nucleotide changes generating two amino acid differences. No evidence of post-translational modifications has been found. Hypotheses are formulated in regard to relationships with technological quality. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Hughes, M. S.; Hoey, E. M.; Coyle, P. V.
1993-01-01
Ten coxsackievirus B4 (CVB4) strains isolated from clinical and environmental sources in Northern Ireland in 1985-7, were compared at the nucleotide sequence level. Dideoxynucleotide sequencing of a polymerase chain reaction (PCR) amplified fragment, spanning the VP1/P2A genomic region, classified the isolates into two distinct groups or genotypes as defined by Rico-Hesse and colleagues for poliovirus type 1. Isolates within each group shared approximately 99% sequence identity at the nucleotide level whereas < or = 86% sequence identity was shared between groups. One isolate derived from a clinical specimen in 1987 was grouped with six CVB4 isolates recovered from the aquatic environment in 1986-7. The second group comprised CVB4 isolates from clinical specimens in 1985-6. Both groups were different at the nucleotide level from the prototype strain isolated in 1950. It was concluded that the method could be used to sub-type CVB4 isolates and would be of value in epidemiological studies of CVB4. Predicted amino acid sequences revealed non-conservation of the tyrosine residue at the VP1/P2A cleavage site but were of little value in distinguishing CVB4 variants. PMID:8386098
The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus.
Gustafson, G; Armour, S L
1986-01-01
The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus (BSMV) has been determined. The sequence is 3289 nucleotides in length and contains four open reading frames (ORFs) which code for proteins of Mr 22,147 (ORF1), Mr 58,098 (ORF2), Mr 17,378 (ORF3), and Mr 14,119 (ORF4). The predicted N-terminal amino acid sequence of the polypeptide encoded by the ORF nearest the 5'-end of the RNA (ORF1) is identical (after the initiator methionine) to the published N-terminal amino acid sequence of BSMV coat protein for 29 of the first 30 amino acids. ORF2 occupies the central portion of the coding region of RNA beta and ORF3 is located at the 3'-end. The ORF4 sequence overlaps the 3'-region of ORF2 and the 5'-region of ORF3 and differs in codon usage from the other three RNA beta ORFs. The coding region of RNA beta is followed by a poly(A) tract and a 238 nucleotide tRNA-like structure which are common to all three BSMV genomic RNAs. Images PMID:3754962
Modular and configurable optimal sequence alignment software: Cola.
Zamani, Neda; Sundström, Görel; Höppner, Marc P; Grabherr, Manfred G
2014-01-01
The fundamental challenge in optimally aligning homologous sequences is to define a scoring scheme that best reflects the underlying biological processes. Maximising the overall number of matches in the alignment does not always reflect the patterns by which nucleotides mutate. Efficiently implemented algorithms that can be parameterised to accommodate more complex non-linear scoring schemes are thus desirable. We present Cola, alignment software that implements different optimal alignment algorithms, also allowing for scoring contiguous matches of nucleotides in a nonlinear manner. The latter places more emphasis on short, highly conserved motifs, and less on the surrounding nucleotides, which can be more diverged. To illustrate the differences, we report results from aligning 14,100 sequences from 3' untranslated regions of human genes to 25 of their mammalian counterparts, where we found that a nonlinear scoring scheme is more consistent than a linear scheme in detecting short, conserved motifs. Cola is freely available under LPGL from https://github.com/nedaz/cola.
Sorimachi, Kenji; Okayasu, Teiji; Ohhira, Shuji
2015-04-01
Normalized nucleotide and amino acid contents of complete genome sequences can be visualized as radar charts. The shapes of these charts depict the characteristics of an organism's genome. The normalized values calculated from the genome sequence theoretically exclude experimental errors. Further, because normalization is independent of both target size and kind, this procedure is applicable not only to single genes but also to whole genomes, which consist of a huge number of different genes. In this review, we discuss the applications of the normalization of the nucleotide and predicted amino acid contents of complete genomes to the investigation of genome structure and to evolutionary research from primitive organisms to Homo sapiens. Some of the results could never have been obtained from the analysis of individual nucleotide or amino acid sequences but were revealed only after the normalization of nucleotide and amino acid contents was applied to genome research. The discovery that genome structure was homogeneous was obtained only after normalization methods were applied to the nucleotide or predicted amino acid contents of genome sequences. Normalization procedures are also applicable to evolutionary research. Thus, normalization of the contents of whole genomes is a useful procedure that can help to characterize organisms.
Karaulov, Alexander; Aleshkin, Vladimir; Slobodenyuk, Vladimir; Grechishnikova, Olga; Afanasyev, Stanislav; Lapin, Boris; Dzhikidze, Eteri; Nesvizhsky, Yuriy; Evsegneeva, Irina; Voropayeva, Elena; Afanasyev, Maxim; Aleshkin, Andrei; Metelskaya, Valeria; Yegorova, Ekaterina; Bayrakova, Alexandra
2010-01-01
Based on the results of the comparative analysis concerning relatedness and evolutional difference of the 16S-23S nucleotide sequences of the middle ribosomal cluster and 23S rRNA I domain, and based on identification of phylogenetic position for Chlamydophila pneumoniae and Chlamydia trichomatis strains released from monkeys, relatedness of the above stated isolates with similar strains released from humans and with strains having nucleotide sequences presented in the GenBank electronic database has been detected for the first time ever. Position of these isolates in the Chlamydiaceae family phylogenetic tree has been identified. The evolutional position of the investigated original Chlamydia and Chlamydophila strains close to analogous strains from the Gen-Bank electronic database has been demonstrated. Differences in the 16S-23S nucleotide sequence of the middle ribosomal cluster and 23S rRNA I domain of plasmid and nonplasmid Chlamydia trachomatis strains released from humans and monkeys relative to different genotype groups (group B-B, Ba, D, Da, E, L1, L2, L2a; intermediate group-F, G, Ga) have been revealed for the first time ever. Abnormality in incA chromosomal gene expression resulting in Chlamydia life development cycle disorder, and decrease of Chlamydia virulence can be related to probable changes in the nucleotide sequence of the gene under consideration.
Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F
2009-07-14
In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.
Arias-Pulido, Hugo; Peyton, Cheri L; Torrez-Martínez, Norah; Anderson, D Nelson; Wheeler, Cosette M
2005-07-20
While HPV 16 variant lineages have been well characterized, the knowledge about HPV 18 variants is limited. In this study, HPV 18 nucleotide variations in the E2 hinge region were characterized by sequence analysis in 47 control and 51 tumor specimens. Fifty of these specimens were randomly selected for sequencing of an LCR-E6 segment and 20 samples representative of LCR-E6 and E2 sequence variants were examined across the L1 region. A total of 2770 nucleotides per HPV 18 variant genome were considered in this study. HPV 18 variant nucleotides were linked among all gene segments analyzed and grouped into three main branches: Asian-American (AA), European (E), and African (Af). These three branches were equally distributed among controls and cases and when stratified by Hispanic and non-Hispanic ethnicities. Among invasive cervical cancer cases, no significant differences in the three HPV variant branches were observed among ethnic groups or when stratified by histopathology (squamous vs. adenocarcinoma). The Af branch showed the greatest nucleotide variability when compared to the HPV 18 reference sequence and was more closely related to HPV 45 than either AA or E branches. Our data also characterize nucleotide and amino acid variations in the L1 capsid gene among HPV 18 variants, which may be relevant to vaccine strategies and subsequent studies of naturally occurring HPV 18 variants. Several novel HPV 18 nucleotide variations were identified in this study.
Chiusano, M L; D'Onofrio, G; Alvarez-Valin, F; Jabbari, K; Colonna, G; Bernardi, G
1999-09-30
We investigated the relationships between the nucleotide substitution rates and the predicted secondary structures in the three states representation (alpha-helix, beta-sheet, and coil). The analysis was carried out on 34 alignments, each of which comprised sequences belonging to at least four different mammalian orders. The rates of synonymous substitution were found to be significantly different in regions predicted to be alpha-helix, beta-sheet, or coil. Likewise, the nonsynonymous rates also differ, although expectedly at a lower extent, in the three types of secondary structure, suggesting that different selective constraints associated with the different structures are affecting in a similar way the synonymous and nonsynonymous rates. Moreover, the base composition of the third codon positions is different in coding sequence regions corresponding to different secondary structures of proteins.
Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang
2009-01-01
The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.
Hunt, C; Morimoto, R I
1985-01-01
We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075
Federal Register 2010, 2011, 2012, 2013, 2014
2012-10-29
... DEPARTMENT OF COMMERCE Patent and Trademark Office Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request... Patent applications that contain nucleotide and/or amino acid sequence disclosures must include a copy of...
Srinivasan, A R; Yathindra, N
1977-01-01
A novel description of the conformational characteristics of all the individual nucleotides and the phosphodiesters in tRNAs is presented in the form of a circular plot. This representation furnishes information of the base sequence with the folding patterns of the polynucleotide chain as one traverses along the circumference and with the individual nucleotide and phosphodiester linkage torsions along the radii. The circular plot obtained for yeast tRNAPhe strikingly distinguishes the helical and the loop regions. The variation of the different nucleotide torsions along the entire chain length and their effect on the secondary helical and tertiary loop regions become readily apparent. PMID:339206
Cytogenetic Diversity of Simple Sequences Repeats in Morphotypes of Brassica rapa ssp. chinensis
Zheng, Jin-shuang; Sun, Cheng-zhen; Zhang, Shu-ning; Hou, Xi-lin; Bonnema, Guusje
2016-01-01
A significant fraction of the nuclear DNA of all eukaryotes is comprised of simple sequence repeats (SSRs). Although these sequences are widely used for studying genetic variation, linkage mapping and evolution, little attention had been paid to the chromosomal distribution and cytogenetic diversity of these sequences. In this paper, we report the distribution characterization of mono-, di-, and tri-nucleotide SSRs in Brassica rapa ssp. chinensis. Fluorescence in situ hybridization was used to characterize the cytogenetic diversity of SSRs among morphotypes of B. rapa ssp. chinensis. The proportion of different SSR motifs varied among morphotypes of B. rapa ssp. chinensis, with tri-nucleotide SSRs being more prevalent in the genome of B. rapa ssp. chinensis. We determined the chromosomal locations of mono-, di-, and tri-nucleotide repeat loci. The results showed that the chromosomal distribution of SSRs in the different morphotypes is non-random and motif-dependent, and allowed us to characterize the relative variability in terms of SSR numbers and similar chromosomal distributions in centromeric/peri-centromeric heterochromatin. The differences between SSR repeats with respect to abundance and distribution indicate that SSRs are a driving force in the genomic evolution of B. rapa species. Our results provide a comprehensive view of the SSR sequence distribution and evolution for comparison among morphotypes B. rapa ssp. chinensis. PMID:27507974
Cytogenetic Diversity of Simple Sequences Repeats in Morphotypes of Brassica rapa ssp. chinensis.
Zheng, Jin-Shuang; Sun, Cheng-Zhen; Zhang, Shu-Ning; Hou, Xi-Lin; Bonnema, Guusje
2016-01-01
A significant fraction of the nuclear DNA of all eukaryotes is comprised of simple sequence repeats (SSRs). Although these sequences are widely used for studying genetic variation, linkage mapping and evolution, little attention had been paid to the chromosomal distribution and cytogenetic diversity of these sequences. In this paper, we report the distribution characterization of mono-, di-, and tri-nucleotide SSRs in Brassica rapa ssp. chinensis. Fluorescence in situ hybridization was used to characterize the cytogenetic diversity of SSRs among morphotypes of B. rapa ssp. chinensis. The proportion of different SSR motifs varied among morphotypes of B. rapa ssp. chinensis, with tri-nucleotide SSRs being more prevalent in the genome of B. rapa ssp. chinensis. We determined the chromosomal locations of mono-, di-, and tri-nucleotide repeat loci. The results showed that the chromosomal distribution of SSRs in the different morphotypes is non-random and motif-dependent, and allowed us to characterize the relative variability in terms of SSR numbers and similar chromosomal distributions in centromeric/peri-centromeric heterochromatin. The differences between SSR repeats with respect to abundance and distribution indicate that SSRs are a driving force in the genomic evolution of B. rapa species. Our results provide a comprehensive view of the SSR sequence distribution and evolution for comparison among morphotypes B. rapa ssp. chinensis.
Sakthivelkumar, S; Ramaraj, P; Veeramani, V; Janarthanan, S
2015-09-01
The basis of the present study was to distinguish the existence of any genetic variability among populations of Culex quinquefasciatus which would be a valuable tool in the management of mosquito control programmes. In the present study, population of Cx. quinquefasciatus collected at different locations in Tamil Nadu were analyzed for their genetic variation based on 28S rDNA D2 region nucleotide sequences. A high degree of genetic polymorphism was detected in the sequences of D2 region of 28S rDNA on the predicted secondary structures in spite of high nucleotide sequence similarity. The findings based on secondary structure using rDNA sequences suggested the existence of a complex genotypic diversity of Cx. quinquefasciatus population collected at different locations of Tamil Nadu, India. This complexity in genetic diversity in a single mosquito population collected at different locations is considered an important issue towards their influence and nature of vector potential of these mosquitoes.
Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis
McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX
2009-02-24
Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
Nucleotide sequences specific to Brucella and methods for the detection of Brucella
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L
Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
Genetic characterization of L-Zagreb mumps vaccine strain.
Ivancic, Jelena; Gulija, Tanja Kosutic; Forcic, Dubravko; Baricevic, Marijana; Jug, Renata; Mesko-Prejac, Majda; Mazuran, Renata
2005-04-01
Eleven mumps vaccine strains, all containing live attenuated virus, have been used throughout the world. Although L-Zagreb mumps vaccine has been licensed since 1972, only its partial nucleotide sequence was previously determined (accession numbers , and ). Therefore, we sequenced the entire genome of L-Zagreb vaccine strain (Institute of Immunology Inc., Zagreb, Croatia). In order to investigate the genetic stability of the vaccine, sequences of both L-Zagreb master seed and currently produced vaccine batch were determined and no difference between them was observed. A phylogenetic analysis based on SH gene sequence has shown that L-Zagreb strain does not belong to any of established mumps genotypes and that it is most similar to old, laboratory preserved European strains (1950s-1970s). L-Zagreb nucleotide and deduced protein sequences were compared with other mumps virus sequences obtained from the GenBank. Emphasis was put on functionally important protein regions and known antigenic epitopes. The extensive comparisons of nucleotide and deduced protein sequences between L-Zagreb vaccine strain and other previously determined mumps virus sequences have shown that while the functional regions of HN, V, and L proteins are well conserved among various mumps strains, there can be a substantial amino acid difference in antigenic epitopes of all proteins and in functional regions of F protein. No molecular pattern was identified that can be used as a distinction marker between virulent and attenuated strains.
Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.
Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio
2009-08-13
Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.
Nucleotide sequence of the gag gene and gag-pol junction of feline leukemia virus.
Laprevotte, I; Hampe, A; Sherr, C J; Galibert, F
1984-01-01
The nucleotide sequence of the gag gene of feline leukemia virus and its flanking sequences were determined and compared with the corresponding sequences of two strains of feline sarcoma virus and with that of the Moloney strain of murine leukemia virus. A high degree of nucleotide sequence homology between the feline leukemia virus and murine leukemia virus gag genes was observed, suggesting that retroviruses of domestic cats and laboratory mice have a common, proximal evolutionary progenitor. The predicted structure of the complete feline leukemia virus gag gene precursor suggests that the translation of nonglycosylated and glycosylated gag gene polypeptides is initiated at two different AUG codons. These initiator codons fall in the same reading frame and are separated by a 222-base-pair segment which encodes an amino terminal signal peptide. The nucleotide sequence predicts the order of amino acids in each of the individual gag-coded proteins (p15, p12, p30, p10), all of which derive from the gag gene precursor. Stable stem-and-loop secondary structures are proposed for two regions of viral RNA. The first falls within sequences at the 5' end of the viral genome, together with adjacent palindromic sequences which may play a role in dimer linkage of RNA subunits. The second includes coding sequences at the gag-pol junction and is proposed to be involved in translation of the pol gene product. Sequence analysis of the latter region shows that the gag and pol genes are translated in different reading frames. Classical consensus splice donor and acceptor sequences could not be localized to regions which would permit synthesis of the expected gag-pol precursor protein. Alternatively, we suggest that the pol gene product (RNA-dependent DNA polymerase) could be translated by a frameshift suppressing mechanism which could involve cleavage modification of stems and loops in a manner similar to that observed in tRNA processing. PMID:6328019
Chikobaeva, M G; Schatzl, H; Rose, D; Bush, U; Iakovleva, L A; Deinhardt, F; Helm, K; Lapin, B A
1993-01-01
Polymerase chain reaction (PCR) was developed for the detection of simian T-lymphotropic virus type 1 (STLV-1) infection of P. hamadryas and direct sequencing using oligo-nucleotide primer pairs specific for the tax and env regions of the related human T-lymphotropic virus type 1 (HTLV-1). Excellent specificity was shown in the detection of STLV-1 provirus in infected baboons by PCR using HTLV-1-derived primers. The nucleotide sequences of env 467bp and tax 159bp of the proviral genome (env position 5700-6137, tax position 7373-7498 HTLV-1, according to Seiki et al., 1983) derived from STLV-1-infected P. hamadryas were analysed using PCR and direct sequencing techniques. Two STLV-1 isolates from different sources (Sukhumi main-SuTLV-1 and forest stocks-STLV-1F) were compared. Two variants of STLV-1 among P. hamadryas with different level of homology to HTLV-1 were wound (83.8% and 95.2%, respectively). A possible role of nucleotide changes in env and tax sequenced fragments and oncogenicity of STLV-1 variants is discussed.
Genomic diversity of the human intestinal parasite Entamoeba histolytica
2012-01-01
Background Entamoeba histolytica is a significant cause of disease worldwide. However, little is known about the genetic diversity of the parasite. We re-sequenced the genomes of ten laboratory cultured lines of the eukaryotic pathogen Entamoeba histolytica in order to develop a picture of genetic diversity across the genome. Results The extreme nucleotide composition bias and repetitiveness of the E. histolytica genome provide a challenge for short-read mapping, yet we were able to define putative single nucleotide polymorphisms in a large portion of the genome. The results suggest a rather low level of single nucleotide diversity, although genes and gene families with putative roles in virulence are among the more polymorphic genes. We did observe large differences in coverage depth among genes, indicating differences in gene copy number between genomes. We found evidence indicating that recombination has occurred in the history of the sequenced genomes, suggesting that E. histolytica may reproduce sexually. Conclusions E. histolytica displays a relatively low level of nucleotide diversity across its genome. However, large differences in gene family content and gene copy number are seen among the sequenced genomes. The pattern of polymorphism indicates that E. histolytica reproduces sexually, or has done so in the past, which has previously been suggested but not proven. PMID:22630046
Mosaic organization of DNA nucleotides
NASA Technical Reports Server (NTRS)
Peng, C. K.; Buldyrev, S. V.; Havlin, S.; Simons, M.; Stanley, H. E.; Goldberger, A. L.
1994-01-01
Long-range power-law correlations have been reported recently for DNA sequences containing noncoding regions. We address the question of whether such correlations may be a trivial consequence of the known mosaic structure ("patchiness") of DNA. We analyze two classes of controls consisting of patchy nucleotide sequences generated by different algorithms--one without and one with long-range power-law correlations. Although both types of sequences are highly heterogenous, they are quantitatively distinguishable by an alternative fluctuation analysis method that differentiates local patchiness from long-range correlations. Application of this analysis to selected DNA sequences demonstrates that patchiness is not sufficient to account for long-range correlation properties.
Detection of a novel herpesvirus from bats in the Philippines.
Sano, Kaori; Okazaki, Sachiko; Taniguchi, Satoshi; Masangkay, Joseph S; Puentespina, Roberto; Eres, Eduardo; Cosico, Edison; Quibod, Niña; Kondo, Taisuke; Shimoda, Hiroshi; Hatta, Yuuki; Mitomo, Shumpei; Oba, Mami; Katayama, Yukie; Sassa, Yukiko; Furuya, Tetsuya; Nagai, Makoto; Une, Yumi; Maeda, Ken; Kyuwa, Shigeru; Yoshikawa, Yasuhiro; Akashi, Hiroomi; Omatsu, Tsutomu; Mizutani, Tetsuya
2015-08-01
Bats are natural hosts of many zoonotic viruses. Monitoring bat viruses is important to detect novel bat-borne infectious diseases. In this study, next generation sequencing techniques and conventional PCR were used to analyze intestine, lung, and blood clot samples collected from wild bats captured at three locations in Davao region, in the Philippines in 2012. Different viral genes belonging to the Retroviridae and Herpesviridae families were identified using next generation sequencing. The existence of herpesvirus in the samples was confirmed by PCR using herpesvirus consensus primers. The nucleotide sequences of the resulting PCR amplicons were 166-bp. Further phylogenetic analysis identified that the virus from which this nucleotide sequence was obtained belonged to the Gammaherpesvirinae subfamily. PCR using primers specific to the nucleotide sequence obtained revealed that the infection rate among the captured bats was 30 %. In this study, we present the partial genome of a novel gammaherpesvirus detected from wild bats. Our observations also indicate that this herpesvirus may be widely distributed in bat populations in Davao region.
Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T
2013-06-01
Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.
Bergmame, Laura; Huffman, Jane; Cole, Rebecca; Dayanandan, Selvadurai; Tkach, Vasyl; McLaughlin, J. Daniel
2011-01-01
Flukes belonging to Sphaeridiotrema are important parasites of waterfowl, and 2 morphologically similar species Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus, have been implicated in waterfowl mortality in North America. Cytochrome oxidase I (barcode region) and partial LSU-rDNA sequences from specimens of S. globulus and S. pseudoglobulus, obtained from naturally and experimentally infected hosts from New Jersey and Quebec, respectively, confirmed that these species were distinct. Barcode sequences of the 2 species differed at 92 of 590 nucleotide positions (15.6%) and the translated sequences differed by 13 amino acid residues. Partial LSU-rDNA sequences differed at 29 of 1,208 nucleotide positions (2.4%). Additional barcode sequences from specimens collected from waterfowl in Wisconsin and Minnesota and morphometric data obtained from specimens acquired along the north shore of Lake Superior revealed the presence of S. pseudoglobulus in these areas. Although morphometric data suggested the presence of S. globulus in the Lake Superior sample, it was not found among the specimens sequenced from Wisconsin or Minnesota.
Bergmame, L.; Huffman, J.; Cole, R.; Dayanandan, S.; Tkach, V.; McLaughlin, J.D.
2011-01-01
Flukes belonging to Sphaeridiotrema are important parasites of waterfowl, and 2 morphologically similar species Sphaeridiotrema globulus and Sphaeridiotrema pseudoglobulus, have been implicated in waterfowl mortality in North America. Cytochrome oxidase I (barcode region) and partial LSU-rDNA sequences from specimens of S. globulus and S. pseudoglobulus, obtained from naturally and experimentally infected hosts from New Jersey and Quebec, respectively, confirmed that these species were distinct. Barcode sequences of the 2 species differed at 92 of 590 nucleotide positions (15.6%) and the translated sequences differed by 13 amino acid residues. Partial LSU-rDNA sequences differed at 29 of 1,208 nucleotide positions (2.4%). Additional barcode sequences from specimens collected from waterfowl in Wisconsin and Minnesota and morphometric data obtained from specimens acquired along the north shore of Lake Superior revealed the presence of S. pseudoglobulus in these areas. Although morphometric data suggested the presence of S. globulus in the Lake Superior sample, it was not found among the specimens sequenced from Wisconsin or Minnesota. ?? 2011 American Society of Parasitologists.
Okimoto, R; Chamberlin, H M; Macfarlane, J L; Wolstenholme, D R
1991-01-01
Within a 7 kb segment of the mtDNA molecule of the root knot nematode, Meloidogyne javanica, that lacks standard mitochondrial genes, are three sets of strictly tandemly arranged, direct repeat sequences: approximately 36 copies of a 102 ntp sequence that contains a TaqI site; 11 copies of a 63 ntp sequence, and 5 copies of an 8 ntp sequence. The 7 kb repeat-containing segment is bounded by putative tRNAasp and tRNAf-met genes and the arrangement of sequences within this segment is: the tRNAasp gene; a unique 1,528 ntp segment that contains two highly stable hairpin-forming sequences; the 102 ntp repeat set; the 8 ntp repeat set; a unique 1,068 ntp segment; the 63 ntp repeat set; and the tRNAf-met gene. The nucleotide sequences of the 102 ntp copies and the 63 ntp copies have been conserved among the species examined. Data from Southern hybridization experiments indicate that 102 ntp and 63 ntp repeats occur in the mtDNAs of three, two and two races of M.incognita, M.hapla and M.arenaria, respectively. Nucleotide sequences of the M.incognita Race-3 102 ntp repeat were found to be either identical or highly similar to those of the M.javanica 102 ntp repeat. Differences in migration distance and number of 102 ntp repeat-containing bands seen in Southern hybridization autoradiographs of restriction-digested mtDNAs of M.javanica and the different host races of M.incognita, M.hapla and M.arenaria are sufficient to distinguish the different host races of each species. Images PMID:2027769
Fogt-Wyrwas, R; Mizgajska-Wiktor, H; Pacoń, J; Jarosz, W
2013-12-01
Some parasitic nematodes can inhabit different definitive hosts, which raises the question of the intraspecific variability of the nematode genotype affecting their preferences to choose particular species as hosts. Additionally, the issue of a possible intraspecific DNA microheterogeneity in specimens from different parts of the world seems to be interesting, especially from the evolutionary point of view. The problem was analysed in three related species - Toxocara canis, Toxocara cati and Toxascaris leonina - specimens originating from Central Europe (Poland). Using specific primers for species identification, internal transcribed spacer (ITS)-1 and ITS-2 regions were amplified and then sequenced. The sequences obtained were compared with sequences previously described for specimens originating from other geographical locations. No differences in nucleotide sequences were established in T. canis isolated from two different hosts (dogs and foxes). A comparison of ITS sequences of T. canis from Poland with sequences deposited in GenBank showed that the scope of intraspecific variability of the species did not exceed 0.4%, while in T. cati the differences did not exceed 2%. Significant differences were found in T. leonina, where ITS-1 differed by 3% and ITS-2 by as much as 7.4% in specimens collected from foxes in Poland and dogs in Australia. Such scope of differences in the nucleotide sequence seems to exceed the intraspecific variation of the species.
Lee, Jin Goo; Gu, Se Hun; Baek, Luck Ju; Shin, Ok Sarah; Park, Kwang Sook; Kim, Heung-Chul; Klein, Terry A.; Yanagihara, Richard; Song, Jin-Won
2014-01-01
The genome of Muju virus (MUJV), identified originally in the royal vole (Myodes regulus) in Korea, was fully sequenced to ascertain its genetic and phylogenetic relationship with Puumala virus (PUUV), harbored by the bank vole (My. glareolus), and a PUUV-like virus, named Hokkaido virus (HOKV), in the grey red-backed vole (My. rufocanus) in Japan. Whole genome sequence analysis of the 6544-nucleotide large (L), 3652-nucleotide medium (M) and 1831-nucleotide small (S) segments of MUJV, as well as the amino acid sequences of their gene products, indicated that MUJV strains from different capture sites might represent genetic variants of PUUV, the prototype arvicolid rodent-borne hantavirus in Europe. Distinct geographic-specific clustering of MUJV was found in different provinces in Korea, and phylogenetic analyses revealed that MUJV and HOKV share a common ancestry with PUUV. A better understanding of the taxonomic classification and pathogenic potential of MUJV must await its isolation in cell culture. PMID:24736214
Nucleotide sequences encoding a thermostable alkaline protease
Wilson, David B.; Lao, Guifang
1998-01-01
Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.
Three closely related herpesviruses are associated with fibropapillomatosis in marine turtles
Quackenbush, S.L.; Work, Thierry M.; Balazs, George H.; Casey, Rufina N.; Rovnak, J.; Chaves, A.; duToit, L.; Baines, J.D.; Parrish, C.R.; Bowser, Paul R.; Casey, James W.
1998-01-01
Green turtle fibropapillomatosis is a neoplastic disease of increasingly significant threat to the survivability of this species. Degenerate PCR primers that target highly conserved regions of genes encoding herpesvirus DNA polymerases were used to amplify a DNA sequence from fibropapillomas and fibromas from Hawaiian and Florida green turtles. All of the tumors tested (n= 23) were found to harbor viral DNA, whereas no viral DNA was detected in skin biopsies from tumor-negative turtles. The tissue distribution of the green turtle herpesvirus appears to be generally limited to tumors where viral DNA was found to accumulate at approximately two to five copies per cell and is occasionally detected, only by PCR, in some tissues normally associated with tumor development. In addition, herpesviral DNA was detected in fibropapillomas from two loggerhead and four olive ridley turtles. Nucleotide sequencing of a 483-bp fragment of the turtle herpesvirus DNA polymerase gene determined that the Florida green turtle and loggerhead turtle sequences are identical and differ from the Hawaiian green turtle sequence by five nucleotide changes, which results in two amino acid substitutions. The olive ridley sequence differs from the Florida and Hawaiian green turtle sequences by 15 and 16 nucleotide changes, respectively, resulting in four amino acid substitutions, three of which are unique to the olive ridley sequence. Our data suggest that these closely related turtle herpesviruses are intimately involved in the genesis of fibropapillomatosis.
McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA
2007-02-06
Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA
2009-02-24
Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
Long-term excretion of vaccine-derived poliovirus by a healthy child.
Martín, Javier; Odoom, Kofi; Tuite, Gráinne; Dunn, Glynis; Hopewell, Nicola; Cooper, Gill; Fitzharris, Catherine; Butler, Karina; Hall, William W; Minor, Philip D
2004-12-01
A child was found to be excreting type 1 vaccine-derived poliovirus (VDPV) with a 1.1% sequence drift from Sabin type 1 vaccine strain in the VP1 coding region 6 months after he was immunized with oral live polio vaccine. Seventeen type 1 poliovirus isolates were recovered from stools taken from this child during the following 4 months. Contrary to expectation, the child was not deficient in humoral immunity and showed high levels of serum neutralization against poliovirus. Selected virus isolates were characterized in terms of their antigenic properties, virulence in transgenic mice, sensitivity for growth at high temperatures, and differences in nucleotide sequence from the Sabin type 1 strain. The VDPV isolates showed mutations at key nucleotide positions that correlated with the observed reversion to biological properties typical of wild polioviruses. A number of capsid mutations mapped at known antigenic sites leading to changes in the viral antigenic structure. Estimates of sequence evolution based on the accumulation of nucleotide changes in the VP1 coding region detected a "defective" molecular clock running at an apparent faster speed of 2.05% nucleotide changes per year versus 1% shown in previous studies. Remarkably, when compared to several type 1 VDPV strains of different origins, isolates from this child showed a much higher proportion of nonsynonymous versus synonymous nucleotide changes in the capsid coding region. This anomaly could explain the high VP1 sequence drift found and the ability of these virus strains to replicate in the gut for a longer period than expected.
Chen, M J; Chu, C C; Shyr, M H; Lin, C L; Lin, P Y; Yang, K L
2010-02-01
HLA-B*5214, a novel rare allele of HLA-B*52 variant, was found in a Taiwanese volunteer bone marrow donor by sequence-based typing method. The sequence of B*5214 is identical to that of B*520101 in exon 2 but differs from B*520101 in exon 3 at nucleotide positions 419 A-->T and 435 A-->G. Alteration of these two nucleotides resulted an amino acid substitution at amino acid residue 116 Y-->F ( TAC-->TTC) and a silent exchange at residue 121 K-->K (AAA-->AAG).
DNA Barcodes of Asian Houbara Bustard (Chlamydotis undulata macqueenii)
Arif, Ibrahim A.; Khan, Haseeb A.; Williams, Joseph B.; Shobrak, Mohammad; Arif, Waad I.
2012-01-01
Populations of Houbara Bustards have dramatically declined in recent years. Captive breeding and reintroduction programs have had limited success in reviving population numbers and thus new technological solutions involving molecular methods are essential for the long term survival of this species. In this study, we sequenced the 694 bp segment of COI gene of the four specimens of Asian Houbara Bustard (Chlamydotis undulata macqueenii). We also compared these sequences with earlier published barcodes of 11 individuals comprising different families of the orders Gruiformes, Ciconiiformes, Podicipediformes and Crocodylia (out group). The pair-wise sequence comparison showed a total of 254 variable sites across all the 15 sequences from different taxa. Three of the four specimens of Houbara Bustard had an identical sequence of COI gene and one individual showed a single nucleotide difference (G > A transition at position 83). Within the bustard family (Otididae), comparison among the three species (Asian Houbara Bustard, Great Bustard (Otis tarda) and the Little Bustard (Tetrax tetrax)), representing three different genera, showed 116 variable sites. For another family (Rallidae), the intra-family variable sites among the individuals of four different genera were found to be 146. The COI genetic distances among the 15 individuals varied from 0.000 to 0.431. Phylogenetic analysis using 619 bp nucleotide segment of COI clearly discriminated all the species representing different genera, families and orders. All the four specimens of Houbara Bustard formed a single clade and are clearly separated from other two individuals of the same family (Otis tarda and Tetrax tetrax). The nucleotide sequence of partial segment of COI gene effectively discriminated the closely related species. This is the first study reporting the barcodes of Houbara Bustard and would be helpful in future molecular studies, particularly for the conservation of this threatened bird in Saudi Arabia. PMID:22408462
Nucleotide sequences encoding a thermostable alkaline protease
Wilson, D.B.; Lao, G.
1998-01-06
Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.
Arrays of nucleic acid probes on biological chips
Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.
1998-11-17
DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.
De Laurentiis, Evelina Ines; Mercier, Evan; Wieden, Hans-Joachim
2016-10-28
Little is known about the conservation of critical kinetic parameters and the mechanistic strategies of elongation factor (EF) Ts-catalyzed nucleotide exchange in EF-Tu in bacteria and particularly in clinically relevant pathogens. EF-Tu from the clinically relevant pathogen Pseudomonas aeruginosa shares over 84% sequence identity with the corresponding elongation factor from Escherichia coli Interestingly, the functionally closely linked EF-Ts only shares 55% sequence identity. To identify any differences in the nucleotide binding properties, as well as in the EF-Ts-mediated nucleotide exchange reaction, we performed a comparative rapid kinetics and mutagenesis analysis of the nucleotide exchange mechanism for both the E. coli and P. aeruginosa systems, identifying helix 13 of EF-Ts as a previously unnoticed regulatory element in the nucleotide exchange mechanism with species-specific elements. Our findings support the base side-first entry of the nucleotide into the binding pocket of the EF-Tu·EF-Ts binary complex, followed by displacement of helix 13 and rapid binding of the phosphate side of the nucleotide, ultimately leading to the release of EF-Ts. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
DNA Sequence-Dependent Ionic Currents in Ultra-Small Solid-State Nanopores†
Comer, Jeffrey
2016-01-01
Measurements of ionic currents through nanopores partially blocked by DNA have emerged as a powerful method for characterization of the DNA nucleotide sequence. Although the effect of the nucleotide sequence on the nanopore blockade current has been experimentally demonstrated, prediction and interpretation of such measurements remain a formidable challenge. Using atomic resolution computational approaches, here we show how the sequence, molecular conformation, and pore geometry affect the blockade ionic current in model solid-state nanopores. We demonstrate that the blockade current from a DNA molecule is determined by the chemical identities and conformations of at least three consecutive nucleotides. We find the blockade currents produced by the nucleotide triplets to vary considerably with their nucleotide sequence despite having nearly identical molecular conformations. Encouragingly, we find blockade current differences as large as 25% for single-base substitutions in ultra small (1.6 nm × 1.1 nm cross section; 2 nm length) solid-state nanopores. Despite the complex dependence of the blockade current on the sequence and conformation of the DNA triplets, we find that, under many conditions, the number of thymine bases is positively correlated with the current, whereas the number of purine bases and the presence of both purine and pyrimidines in the triplet are negatively correlated with the current. Based on these observations, we construct a simple theoretical model that relates the ion current to the base content of a solid-state nanopore. Furthermore, we show that compact conformations of DNA in narrow pores provide the greatest signal-to-noise ratio for single base detection, whereas reduction of the nanopore length increases the ionic current noise. Thus, the sequence dependence of nanopore blockade current can be theoretically rationalized, although the predictions will likely need to be customized for each nanopore type. PMID:27103233
Qin, Yanhong; Wang, Li; Zhang, Zhenchen; Qiao, Qi; Zhang, Desheng; Tian, Yuting; Wang, Shuang; Wang, Yongjiang; Yan, Zhaoling
2014-01-01
Background Sweet potato chlorotic stunt virus (family Closteroviridae, genus Crinivirus) features a large bipartite, single-stranded, positive-sense RNA genome. To date, only three complete genomic sequences of SPCSV can be accessed through GenBank. SPCSV was first detected from China in 2011, only partial genomic sequences have been determined in the country. No report on the complete genomic sequence and genome structure of Chinese SPCSV isolates or the genetic relation between isolates from China and other countries is available. Methodology/Principal Findings The complete genomic sequences of five isolates from different areas in China were characterized. This study is the first to report the complete genome sequences of SPCSV from whitefly vectors. Genome structure analysis showed that isolates of WA and EA strains from China have the same coding protein as isolates Can181-9 and m2-47, respectively. Twenty cp genes and four RNA1 partial segments were sequenced and analyzed, and the nucleotide identities of complete genomic, cp, and RNA1 partial sequences were determined. Results indicated high conservation among strains and significant differences between WA and EA strains. Genetic analysis demonstrated that, except for isolates from Guangdong Province, SPCSVs from other areas belong to the WA strain. Genome organization analysis showed that the isolates in this study lack the p22 gene. Conclusions/Significance We presented the complete genome sequences of SPCSV in China. Comparison of nucleotide identities and genome structures between these isolates and previously reported isolates showed slight differences. The nucleotide identities of different SPCSV isolates showed high conservation among strains and significant differences between strains. All nine isolates in this study lacked p22 gene. WA strains were more extensively distributed than EA strains in China. These data provide important insights into the molecular variation and genomic structure of SPCSV in China as well as genetic relationships among isolates from China and other countries. PMID:25170926
Masking as an effective quality control method for next-generation sequencing data analysis.
Yun, Sajung; Yun, Sijung
2014-12-13
Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).
Henderson, R A; Krissansen, G W; Yong, R Y; Leung, E; Watson, J D; Dholakia, J N
1994-12-02
Protein synthesis in mammalian cells is regulated at the level of the guanine nucleotide exchange factor, eIF-2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. We have isolated and sequenced cDNA clones encoding the delta-subunit of murine eIF-2B. The cDNA sequence encodes a polypeptide of 544 amino acids with molecular mass of 60 kDa. Antibodies against a synthetic polypeptide of 30 amino acids deduced from the cDNA sequence specifically react with the delta-subunit of mammalian eIF-2B. The cDNA-derived amino acid sequence shows significant homology with the yeast translational regulator Gcd2, supporting the hypothesis that Gcd2 may be the yeast homolog of the delta-subunit of mammalian eIF-2B. Primer extension studies and anchor polymerase chain reaction analysis were performed to determine the 5'-end of the transcript for the delta-subunit of eIF-2B. Results of these experiments demonstrate two different mRNAs for the delta-subunit of eIF-2B in murine cells. The isolation and characterization of two different full-length cDNAs also predicts the presence of two alternate forms of the delta-subunit of eIF-2B in murine cells. These differ at their amino-terminal end but have identical nucleotide sequences coding for amino acids 31-544.
Plucienniczak, A; Schroeder, E; Zettlmeissl, G; Streeck, R E
1985-01-01
The nucleotide sequence of a 7.6 kb vaccinia DNA segment from a genomic region conserved among different orthopox virus has been determined. This segment contains a tight cluster of 12 partly overlapping open reading frames most of which can be correlated with previously identified early and late proteins and mRNAs. Regulatory signals used by vaccinia virus have been studied. Presumptive promoter regions are rich in A, T and carry the consensus sequences TATA and AATAA spaced at 20-24 base pairs. Tandem repeats of a CTATTC consensus sequence are proposed to be involved in the termination of early transcription. PMID:2987815
Neill, John D; Newcomer, Benjamin W; Marley, Shonda D; Ridpath, Julia F; Givens, M Daniel
2012-08-06
Bovine viral diarrhea virus (BVDV) strains circulating in livestock herds show significant sequence variation. Conventional wisdom states that most sequence variation arises during acute infections in response to immune or other environmental pressures. A recent study showed that more nucleotide changes were introduced into the BVDV genomic RNA during the establishment of a single fetal persistent infection than following a series of acute infections of naïve cattle. However, it was not known if nucleotide changes were introduce when the virus crossed the placenta and infected the fetus or during the acute infection of the dam. The sequence of the open reading frame (ORF) from viruses isolated from four acutely infected pregnant heifers following exposure to persistently infected (PI) calves was compared to the sequences of the virus from the progenitor PI calf and the virus from the resulting progeny PI calf to determine when genetic change was introduced. This was compared to genetic change found in viruses isolated from a pregnant PI cow and its PI calf, and in three viruses isolated from acutely infected, non-pregnant cattle exposed to PI calves. Most genetic changes previously identified between the progenitor and progeny PI viruses were in place in the acute phase viruses isolated from the dams six days post-exposure to the progenitor PI calf. Additionally, each progeny PI virus had two to three unique nucleotide substitutions that were introduced in crossing the placenta and infection of the fetus. The nucleotide sequence of two acute phase viruses isolated from steers exposed to PI calves revealed that six and seven nucleotide changes were introduced during the acute infection. The sequence of the BVDV-2 virus isolated from an acute infection of a PI calf (BVDV-1a) co-housed with a BVDV-2 PI calf had ten nucleotides that were different from the progenitor PI virus. Finally, twenty nucleotide changes were identified in the PI virus of a calf born to a PI dam. These results demonstrate that nucleotide changes are introduced into the BVDV infecting pregnant cattle at rates of 2.3 to 8 fold higher then during the acute infection of non-pregnant animals.
Meiler, Arno; Klinger, Claudia; Kaufmann, Michael
2012-09-08
The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
2012-01-01
Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836
ADOMA: A Command Line Tool to Modify ClustalW Multiple Alignment Output.
Zaal, Dionne; Nota, Benjamin
2016-01-01
We present ADOMA, a command line tool that produces alternative outputs from ClustalW multiple alignments of nucleotide or protein sequences. ADOMA can simplify the output of alignments by showing only the different residues between sequences, which is often desirable when only small differences such as single nucleotide polymorphisms are present (e.g., between different alleles). Another feature of ADOMA is that it can enhance the ClustalW output by coloring the residues in the alignment. This tool is easily integrated into automated Linux pipelines for next-generation sequencing data analysis, and may be useful for researchers in a broad range of scientific disciplines including evolutionary biology and biomedical sciences. The source code is freely available at https://sourceforge. net/projects/adoma/. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sharma, Monika; Devi, Kangjam Rekha; Sehgal, Rakesh; Narain, Kanwar; Mahanta, Jagadish; Malla, Nancy
2014-01-01
Taenia solium taeniasis/cysticercosis is a major public health problem in developing countries. This study reports genotypic analysis of T. solium cysticerci collected from two different endemic areas of North (Chandigarh) and North East India (Dibrugarh) by the sequencing of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The variation in cox1 sequences of samples collected from these two different geographical regions located at a distance of 2585 km was minimal. Alignment of the nucleotide sequences with different species of Taenia showed the similarity with Asian genotype of T. solium. Among 50 isolates, 6 variant nucleotide positions (0.37% of total length) were detected. These results suggest that population in these geographical areas are homogenous. Copyright © 2013 Elsevier B.V. All rights reserved.
Shao, Renfu; Barker, Stephen C
2011-02-15
The mitochondrial (mt) genome of the human body louse, Pediculus humanus, consists of 18 minichromosomes. Each minichromosome is 3 to 4 kb long and has 1 to 3 genes. There is unequivocal evidence for recombination between different mt minichromosomes in P. humanus. It is not known, however, how these minichromosomes recombine. Here, we report the discovery of eight chimeric mt minichromosomes in P. humanus. We classify these chimeric mt minichromosomes into two groups: Group I and Group II. Group I chimeric minichromosomes contain parts of two different protein-coding genes that are from different minichromosomes. The two parts of protein-coding genes in each Group I chimeric minichromosome are joined at a microhomologous nucleotide sequence; microhomologous nucleotide sequences are hallmarks of non-homologous recombination. Group II chimeric minichromosomes contain all of the genes and the non-coding regions of two different minichromosomes. The conserved sequence blocks in the non-coding regions of Group II chimeric minichromosomes resemble the "recombination repeats" in the non-coding regions of the mt genomes of higher plants. These repeats are essential to homologous recombination in higher plants. Our analyses of the nucleotide sequences of chimeric mt minichromosomes indicate both homologous and non-homologous recombination between minichromosomes in the mitochondria of the human body louse. Copyright © 2010 Elsevier B.V. All rights reserved.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome
Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274
RNA Editing in Plant Mitochondria
NASA Astrophysics Data System (ADS)
Hiesel, Rudolf; Wissinger, Bernd; Schuster, Wolfgang; Brennicke, Axel
1989-12-01
Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.
Simian immunodeficiency viruses from African green monkeys display unusual genetic diversity.
Johnson, P R; Fomsgaard, A; Allan, J; Gravell, M; London, W T; Olmsted, R A; Hirsch, V M
1990-01-01
African green monkeys are asymptomatic carriers of simian immunodeficiency viruses (SIV), commonly called SIVagm. As many as 50% of African green monkeys in the wild may be SIV seropositive. This high seroprevalence rate and the potential for genetic variation of lentiviruses suggested to us that African green monkeys may harbor widely differing genotypes of SIVagm. To investigate this hypothesis, we determined the entire nucleotide sequence of an infectious proviral molecular clone of SIVagm (155-4) and partial sequences (long terminal repeat and Gag) of three other distinct SIVagm isolates (90, gri-1, and ver-1). Comparisons among the SIVagm isolates revealed extreme diversity at the nucleotide and amino acid levels. Long terminal repeat nucleotide sequences varied up to 35% and Gag protein sequences varied up to 30%. The variability among SIVagm isolates exceeded the variability among any other group of primate lentiviruses. Our data suggest that SIVagm has been in the African green monkey population for a long time and may be the oldest primate lentivirus group in existence. PMID:2304139
Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi
2017-04-01
Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.
Salmon, Jérôme; Nonnenmacher, Mathieu; Cazé, Sandrine; Flamant, Patricia; Croissant, Odile; Orth, Gérard; Breitburd, Françoise
2000-01-01
We previously reported the partial characterization of two cottontail rabbit papillomavirus (CRPV) subtypes with strikingly divergent E6 and E7 oncoproteins. We report now the complete nucleotide sequences of these subtypes, referred to as CRPVa4 (7,868 nucleotides) and CRPVb (7,867 nucleotides). The CRPVa4 and CRPVb genomes differed at 238 (3%) nucleotide positions, whereas CRPVa4 and the prototype CRPV differed by only 5 nucleotides. The most variable region (7% nucleotide divergence) included the long regulatory region (LRR) and the E6 and E7 genes. A mutation in the stop codon resulted in an 8-amino-acid-longer CRPVb E4 protein, and a nucleotide deletion reduced the coding capacity of the E5 gene from 101 to 25 amino acids. In domestic rabbits homozygous for a specific haplotype of the DRA and DQA genes of the major histocompatibility complex, warts induced by CRPVb DNA or a chimeric genome containing the CRPVb LRR/E6/E7 region showed an early regression, whereas warts induced by CRPVa4 or a chimeric genome containing the CRPVa4 LRR/E6/E7 region persisted and evolved into carcinomas. In contrast, most CRPVa, CRPVb, and chimeric CRPV DNA-induced warts showed no early regression in rabbits homozygous for another DRA-DQA haplotype. Little, if any, viral replication is usually observed in domestic rabbit warts. When warts induced by CRPVa and CRPVb virions and DNA were compared, the number of cells positive for viral DNA or capsid antigens was found to be greater by 1 order of magnitude for specimens induced by CRPVb. Thus, both sequence variation in the LRR/E6/E7 region and the genetic constitution of the host influence the expression of the oncogenic potential of CRPV. Furthermore, intratype variation may overcome to some extent the host restriction of CRPV replication in domestic rabbits. PMID:11044121
Bowen, D; Littlechild, J A; Fothergill, J E; Watson, H C; Hall, L
1988-01-01
Using oligonucleotide probes derived from amino acid sequencing information, the structural gene for phosphoglycerate kinase from the extreme thermophile, Thermus thermophilus, was cloned in Escherichia coli and its complete nucleotide sequence determined. The gene consists of an open reading frame corresponding to a protein of 390 amino acid residues (calculated Mr 41,791) with an extreme bias for G or C (93.1%) in the codon third base position. Comparison of the deduced amino acid sequence with that of the corresponding mesophilic yeast enzyme indicated a number of significant differences. These are discussed in terms of the unusual codon bias and their possible role in enhanced protein thermal stability. Images Fig. 1. PMID:3052437
Genetic variation in potential Giardia vaccine candidates cyst wall protein 2 and α1-giardin.
Radunovic, Matej; Klotz, Christian; Saghaug, Christina Skår; Brattbakk, Hans-Richard; Aebischer, Toni; Langeland, Nina; Hanevik, Kurt
2017-08-01
Giardia is a prevalent intestinal parasitic infection. The trophozoite structural protein a1-giardin (a1-g) and the cyst protein cyst wall protein 2 (CWP2) have shown promise as Giardia vaccine antigen candidates in murine models. The present study assesses the genetic diversity of a1-g and CWP2 between and within assemblages A and B in human clinical isolates. a1-g and CWP2 sequences were acquired from 15 Norwegian isolates by PCR amplification and 20 sequences from German cultured isolates by whole genome sequencing. Sequences were aligned to reference genomes from assemblage A2 and B to identify genetic variance. Genetic diversity was found between assemblage A and B reference sequences for both a1-g (90.8% nucleotide identity) and CWP2 (82.5% nucleotide identity). However, for a1-g, this translated into only 3 amino acid (aa) substitutions, while for CWP2 there were 41 aa substitutions, and also one aa deletion. Genetic diversity within assemblage B was larger; nucleotide identity 92.0% for a1-g and 94.3% for CWP2, than within assemblage A (nucleotide identity 99.0% for a1-g and 99.7% for CWP2). For CWP2, the diversity on both nucleotide and protein level was higher in the C-terminal end. Predicted antigenic epitopes were not affected for a1-g, but partially for CWP2. Despite genetic diversity in a1-g, we found aa sequence, characteristics, and antigenicity to be well preserved. CWP2 showed more aa variance and potential antigenic differences. Several CWP2 antigens might be necessary in a future Giardia vaccine to provide cross protection against both Giardia assemblages infecting humans.
Sequence specificity of the hammerhead ribozyme revisited; the NHH rule.
Kore, A R; Vaish, N K; Kutzke, U; Eckstein, F
1998-01-01
The sequence specificity of hammerhead ribozyme cleavage has been re-evaluated with respect to the NUH rule. Contrary to previous reports it was found that substrates with GAC triplets were also cleaved. This was established in three different sequence contexts. The rate of cleavage under single turnover conditions was between 3 and 7% that of cleavage 3' of GUC. Specificity of cleavage of substrates containing a central A in the cleavable triplet can be described as NAH, where N can be any nucleotide and H any nucleotide but G. As cleavage 3' of NCH triplets has recently been described, the NUH rule can be reformulated to NHH. PMID:9722629
The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.
Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R
1982-01-01
The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791
Conservation of the structure and organization of lupin mitochondrial nad3 and rps12 genes.
Rurek, M; Oczkowski, M; Augustyniak, H
1998-01-01
A high level of the nucleotide sequence conservation of mitochondrial nad3 and rps12 genes was found in four lupin species. The only differences concern three nucleotides in the Lupinus albus rps12 gene and three nucleotides insertion in the L. mutabilis spacer. Northern blot analysis as well as RT-PCR confirmed cotranscription of the L. luteus genes because the transcripts detected were long enough.
Liu, Siyang; Huang, Shujia; Rao, Junhua; Ye, Weijian; Krogh, Anders; Wang, Jun
2015-01-01
Comprehensive recognition of genomic variation in one individual is important for understanding disease and developing personalized medication and treatment. Many tools based on DNA re-sequencing exist for identification of single nucleotide polymorphisms, small insertions and deletions (indels) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction of population-scale pan-genomes. Our study also highlights the usefulness of the de novo assembly strategy for definition of genome structure.
Salem, Nida’ M.; Miller, W. Allen; Rowhani, Adib; Golino, Deborah A.; Moyne, Anne-Laure; Falk, Bryce W.
2015-01-01
We determined the complete nucleotide sequence of the Rose spring dwarf-associated virus (RSDaV) genomic RNA (GenBank accession no. EU024678) and compared its predicted RNA structural characteristics affecting gene expression. A cDNA library was derived from RSDaV double-stranded RNAs (dsRNAs) purified from infected tissue. Nucleotide sequence analysis of the cloned cDNAs, plus for clones generated by 5′- and 3′-RACE showed the RSDaV genomic RNA to be 5,808 nucleotides. The genomic RNA contains five major open reading frames (ORFs), and three small ORFs in the 3′-terminal 800 nucleotides, typical for viruses of genus Luteovirus in the family Luteoviridae. Northern blot hybridization analysis revealed the genomic RNA and two prominent subgenomic RNAs of approximately 3 kb and 1 kb. Putative 5′ ends of the sgRNAs were predicted by identification of conserved sequences and secondary structures which resembled the Barley yellow dwarf virus (BYDV) genomic RNA 5′ end and subgenomic RNA promoter sequences. Secondary structures of the BYDV-like ribosomal frameshift elements and cap-independent translation elements, including long-distance base pairing spanning four kb were identified. These contain similarities but also informative differences with the BYDV structures, including a strikingly different structure predicted for the 3′ cap-independent translation element. These analyses of the RSDaV genomic RNA show more complexity for the RNA structural elements for members of the Luteoviridae. PMID:18329064
Salem, Nida' M; Miller, W Allen; Rowhani, Adib; Golino, Deborah A; Moyne, Anne-Laure; Falk, Bryce W
2008-06-05
We determined the complete nucleotide sequence of the Rose spring dwarf-associated virus (RSDaV) genomic RNA (GenBank accession no. EU024678) and compared its predicted RNA structural characteristics affecting gene expression. A cDNA library was derived from RSDaV double-stranded RNAs (dsRNAs) purified from infected tissue. Nucleotide sequence analysis of the cloned cDNAs, plus for clones generated by 5'- and 3'-RACE showed the RSDaV genomic RNA to be 5808 nucleotides. The genomic RNA contains five major open reading frames (ORFs), and three small ORFs in the 3'-terminal 800 nucleotides, typical for viruses of genus Luteovirus in the family Luteoviridae. Northern blot hybridization analysis revealed the genomic RNA and two prominent subgenomic RNAs of approximately 3 kb and 1 kb. Putative 5' ends of the sgRNAs were predicted by identification of conserved sequences and secondary structures which resembled the Barley yellow dwarf virus (BYDV) genomic RNA 5' end and subgenomic RNA promoter sequences. Secondary structures of the BYDV-like ribosomal frameshift elements and cap-independent translation elements, including long-distance base pairing spanning four kb were identified. These contain similarities but also informative differences with the BYDV structures, including a strikingly different structure predicted for the 3' cap-independent translation element. These analyses of the RSDaV genomic RNA show more complexity for the RNA structural elements for members of the Luteoviridae.
Code of Federal Regulations, 2011 CFR
2011-07-01
... from abandonment 1.135 Amino Acid Sequences. (See Nucleotide and/or Amino Acid Sequences) Appeal to... Appeals and Interference 41.47 Of rejection of an application 1.104(a) Nucleotide and/or Amino Acid...) Symbols for nucleotide and/or amino acid sequence data 1.822 T Tables in patent applications 1.58 Terminal...
[Determination of genetic bases of auxotrophy in Yersinia pestis ssp. caucasica strains].
Odinokov, G N; Eroshenko, G A; Kukleva, L M; Shavina, N Iu; Krasnov, Ia M; Kutyrev, V V
2012-04-01
Based on the results of computer analysis of nucleotide sequences in strains Yersinia pestis and Y. pseudotuberculosis recorded in the files of NCBI GenBank database, differences between genes argA, aroG, aroF, thiH, and thiG of strain Pestoides F (subspecies caucasica) were found, compared to other strains of plaque agent and pseudotuberculosis microbe. Using PCR with calculated primers and the method of sequence analysis, the structure of variable regions of these genes was studied in 96 natural Y. pestis and Y. pseudotuberculosis strains. It was shown that all examined strains of subspecies caucasica, unlike strains of plague-causing agent of other subspecies and pseudotubercolosis microbe, had identical mutations in genes argA (integration of the insertion sequence IS100), aroG (insertion of ten nucleotides), aroF (inserion of IS100), thiH (insertion of nucleotide T), and thiG (deletion of 13 nucleotides). These mutations are the reason for the absence in strains belonging to this subspecies of the ability to synthesize arginine, phenylalanine, tyrosine, and vitamin B1 (thiamine), and cause their auxotrophy for these growth factors.
WEB-server for search of a periodicity in amino acid and nucleotide sequences
NASA Astrophysics Data System (ADS)
E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.
2017-12-01
A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.
Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.
Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O
1987-06-01
The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.
Hoelsch, K; Lenggeler, I; Pfannes, W; Knabe, H; Klein, H-G; Woelpl, A
2005-05-01
A new human leukocyte antigen (HLA)-B allele was found during routine typing of samples for a German unrelated bone marrow donor registry, the "Aktion Knochenmarkspende Bayern". After first interpretation of data of two independent low-resolution sequence-specific oligonucleotide typing tests, a B*51 variant was suggested. Further analysis via sequence-based typing identified the sequence as new B*52 allele. This new allele officially assigned as B*5206 differs from HLA-B*520102 by one nucleotide exchange in exon 2. The mutation is located at nucleotide position 274, at which a cytosine is substituted by a thymine leading to an amino acid change at protein position 67 from serine (TCC) to phenylalanine (TTC).
Schnitzler, P; Delius, H; Scholz, J; Touray, M; Orth, E; Darai, G
1987-12-01
The genome of the fish lymphocystis disease virus (FLDV) was screened for the existence of repetitive DNA sequences using a defined and complete gene library of the viral genome (98 kbp) by DNA-DNA hybridization, heteroduplex analysis, and restriction fine mapping. A repetitive DNA sequence was detected at the coordinates 0.034 to 0.057 and 0.718 to 0.736 map units (m.u.) of the FLDV genome. The first region (0.034 to 0.057 m.u.) corresponds to the 5' terminus of the EcoRI FLDV DNA fragment B (0.034 to 0.165 m.u.) and the second region (0.718 to 0.736 m.u.) is identical to the EcoRI DNA fragment M of the viral genome. The DNA nucleotide sequence of the EcoRI FLDV DNA fragment M was determined. This analysis revealed the presence of many short direct and inverted repetitions, e.g., a 18-mer direct repetition (TTTAAAATTTAATTAA) that started at nucleotide positions 812 and 942 and a 14-mer inverted repeat (TTAAATTTAAATTT) at nucleotide positions 820 and 959. Only short open reading frames were detected within this region. The DNA repetitions are discussed as sequences that play a possible regulatory role for virus replication. Furthermore, hybridization experiments revealed that the repetitive DNA sequences are conserved in the genome of different strains of fish lymphocystis disease virus isolated from two species of Pleuronectidae (flounder and dab).
Feldman, Sanford H; Ntenda, Abraham M
2011-01-01
We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574
Chen, Sherry Xi; Seelig, Georg
2016-04-20
Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.
Nucleotide cleaving agents and method
Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.
2000-01-01
The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.
Genetic Characteristics of Coronaviruses from Korean Bats in 2016.
Lee, Saemi; Jo, Seong-Deok; Son, Kidong; An, Injung; Jeong, Jipseol; Wang, Seung-Jun; Kim, Yongkwan; Jheong, Weonhwa; Oem, Jae-Ku
2018-01-01
Bats have increasingly been recognized as the natural reservoir of severe acute respiratory syndrome (SARS), coronavirus, and other coronaviruses found in mammals. However, little research has been conducted on bat coronaviruses in South Korea. In this study, bat samples (332 oral swabs, 245 fecal samples, 38 urine samples, and 57 bat carcasses) were collected at 33 natural bat habitat sites in South Korea. RT-PCR and sequencing were performed for specific coronavirus genes to identify the bat coronaviruses in different bat samples. Coronaviruses were detected in 2.7% (18/672) of the samples: 13 oral swabs from one species of the family Rhinolophidae, and four fecal samples and one carcass (intestine) from three species of the family Vespertiliodae. To determine the genetic relationships of the 18 sequences obtained in this study and previously known coronaviruses, the nucleotide sequences of a 392-nt region of the RNA-dependent RNA polymerase (RdRp) gene were analyzed phylogenetically. Thirteen sequences belonging to SARS-like betacoronaviruses showed the highest nucleotide identity (97.1-99.7%) with Bat-CoV-JTMC15 reported in China. The other five sequences were most similar to MERS-like betacoronaviruses. Four nucleotide sequences displayed the highest identity (94.1-95.1%) with Bat-CoV-HKU5 from Hong Kong. The one sequence from a carcass showed the highest nucleotide identity (99%) with Bat-CoV-SC2013 from China. These results suggest that careful surveillance of coronaviruses from bats should be continued, because animal and human infections may result from the genetic variants present in bat coronavirus reservoirs.
Païs de Barros, J P; Keith, G; El Adlouni, C; Glasser, A L; Mack, G; Dirheimer, G; Desgrès, J
1996-01-01
The nucleotide analysis of a cytoplasmic tRNA(Leu) isolated from bovine liver revealed the presence of an unknown modified nucleotide N. The corresponding N nucleoside was isolated by different enzymatic and chromatographic protocols from a partially purified preparation of this tRNA(Leu). Its chemical characterization was determined from its chromatographic properties, UV-absorption spectroscopy and mass spectrometric measurements, as well as from those of the borohydride reduced N nucleoside and its etheno-trimethylsilyl derivative. The structure of N was established as 2'-O-methyl-5-formylcytidine (f5CM), and its reduced derivative as 2'-O-methyl-5-hydroxy-methylcytidine (om5Cm). By sequencing the bovine liver tRNA(Leu), the structure of the anticodon was determined as f5CmAA. In addition, the nucleotide sequence showed two primary structures differing only by the nucleotide 47c which is either uridine or adenosine. The two slightly differing bovine liver tRNAs-Leu(f5CmAA) are the only tRNAs so far sequenced which contain f5Cm. The role of such a modified cytidine at the first position of the anticodon is discussed in terms of decoding properties for the UUG and UUA leucine codons. Recently, precise evidence was obtained for the presence of f5Cm at the same position in tRNAs(Leu)(NAA) isolated from rabbit and lamb liver. Therefore, the 2'-O-methyl-5-formyl modification of cytidine at position 34 could be a general feature of cytoplasmic tRNAs(Leu)(NAA) in mammals. PMID:8628682
Oliveros, R; Cutillas, C; De Rojas, M; Arias, P
2000-12-01
Adult worms of Trichuris ovis and T. globulosa were collected from Ovis aries (sheep) and Capra hircus (goats). T. suis was isolated from Sus scrofa domestica (swine) and T. leporis was isolated from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and a ribosomal internal transcribed spacer (ITS2) was amplified and sequenced using polymerase-chain-reaction (PCR) techniques. The ITS2 of T. ovis and T. globulosa was 407 nucleotides in length and had a GC content of about 62%. Furthermore, the ITS2 of T. suis and T. leporis was 534 and 418 nucleotides in length and had a GC content of about 64.8% and 62.4%, respectively. There was evidence of slight variation in the sequence within individuals of all species analyzed, indicating intraindividual variation in the sequence of different copies of the ribosomal DNA. Furthermore, low-level intraspecific variation was detected. Sequence analyses of ITS2 products of T. ovis and T. globulosa demonstrated no sequence difference between them. Nevertheless, differences were detected between the ITS2 sequences of T. suis, T. leporis, and T. ovis, indicating that Trichuris species can reliably be differentiated by their ITS2 sequences and PCR-linked restriction-fragment-length polymorphism (RFLP).
Liu, Wei-long; Yang, Gui-lin; Wei, Qing; Zhang, Ming-xia; Chen, Xin-chun; Liu, Ying-xia; Gao, Yang; Zhou, Bo-ping
2011-02-01
To investigate the characteristics of molecular epidemiology and molecular evolution of 5 EV 71 (enterovirus 71, EV71) strains from 5 Shenzhen patients with hand-food-mouth disease associated with EV 71 infection. 5 EV 71 strains were isolated, and sequenced to analyzed the full length gene sequences in order to compare nucleotide and amino acid homology with other EV71 strains from other regions and countries as well as previous strains across the world through bioinformatics software. 5 strains of EV 71 belonged to sub-genotype C4 by analysis of nucleotide sequences of VP1 and VP4 of EV 71. The differences of nucleotide and amino acid sequences were much small with nucleotide homology of 93% and amino acid homology of 98% among these 5 strains. A phylogenetic tree analysis indicated that 2008 Shenzhen epidemic strains were the most close to 2004 Shenzhen circulating strains, and also much close to 1998 Shenzhen epidemic strains and 2008 Fuyang Anhui strains. The dead strain was very close to 2008 Fuyang Anhui epidemic strains. It can be speculated that this epidemic strains of EV 71 probably originate from the same ancient strain in the history, may from 1998 Shenzhen strain.
TFBSshape: a motif database for DNA shape features of transcription factor binding sites.
Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W; Gordân, Raluca; Rohs, Remo
2014-01-01
Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein-DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone.
TFBSshape: a motif database for DNA shape features of transcription factor binding sites
Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W.; Gordân, Raluca; Rohs, Remo
2014-01-01
Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein–DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone. PMID:24214955
Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T
1987-01-01
The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486
Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids
NASA Astrophysics Data System (ADS)
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.
A novel model for DNA sequence similarity analysis based on graph theory.
Qi, Xingqin; Wu, Qin; Zhang, Yusen; Fuller, Eddie; Zhang, Cun-Quan
2011-01-01
Determination of sequence similarity is one of the major steps in computational phylogenetic studies. As we know, during evolutionary history, not only DNA mutations for individual nucleotide but also subsequent rearrangements occurred. It has been one of major tasks of computational biologists to develop novel mathematical descriptors for similarity analysis such that various mutation phenomena information would be involved simultaneously. In this paper, different from traditional methods (eg, nucleotide frequency, geometric representations) as bases for construction of mathematical descriptors, we construct novel mathematical descriptors based on graph theory. In particular, for each DNA sequence, we will set up a weighted directed graph. The adjacency matrix of the directed graph will be used to induce a representative vector for DNA sequence. This new approach measures similarity based on both ordering and frequency of nucleotides so that much more information is involved. As an application, the method is tested on a set of 0.9-kb mtDNA sequences of twelve different primate species. All output phylogenetic trees with various distance estimations have the same topology, and are generally consistent with the reported results from early studies, which proves the new method's efficiency; we also test the new method on a simulated data set, which shows our new method performs better than traditional global alignment method when subsequent rearrangements happen frequently during evolutionary history.
Phylogenetic analysis of Hungarian goose parvovirus isolates and vaccine strains.
Tatár-Kis, Tímea; Mató, Tamás; Markos, Béla; Palya, Vilmos
2004-08-01
Polymerase chain reaction and sequencing were used to analyse goose parvovirus field isolates and vaccine strains. Two fragments of the genome were amplified. Fragment "A" represents a region of VP3 gene, while fragment "B" represents a region upstream of the VP3 gene, encompassing part of the VP1 gene. In the region of fragment "A" the deduced amino acid sequence of the strains was identical, therefore differentiation among strains could be done only at the nucleotide level, which resulted in the formation of three groups: Hungarian, West-European and Asian strains. In the region of fragment "B", separation of groups could be done by both nucleotide and deduced amino acid sequence level. The nucleotide sequences resulted in the same groups as for fragment "A" but with a different clustering pattern among the Hungarian strains. Within the "Hungarian" group most of the recent field isolates fell into one cluster, very closely related or identical to each other, indicating a very slow evolutionary change. The attenuated strains and field isolates from 1979/80 formed a separate cluster. When vaccine strains and field isolates were compared, two specific amino acid differences were found that can be considered as possible markers for vaccinal strains. Sequence analysis of fragment "B" seems to be a suitable method for differentiation of attenuated vaccine strains from virulent strains. Copyright 2004 Houghton Trust Ltd
Structure of the coding region and mRNA variants of the apyrase gene from pea (Pisum sativum)
NASA Technical Reports Server (NTRS)
Shibata, K.; Abe, S.; Davies, E.
2001-01-01
Partial amino acid sequences of a 49 kDa apyrase (ATP diphosphohydrolase, EC 3.6.1.5) from the cytoskeletal fraction of etiolated pea stems were used to derive oligonucleotide DNA primers to generate a cDNA fragment of pea apyrase mRNA by RT-PCR and these primers were used to screen a pea stem cDNA library. Two almost identical cDNAs differing in just 6 nucleotides within the coding regions were found, and these cDNA sequences were used to clone genomic fragments by PCR. Two nearly identical gene fragments containing 8 exons and 7 introns were obtained. One of them (H-type) encoded the mRNA sequence described by Hsieh et al. (1996) (DDBJ/EMBL/GenBank Z32743), while the other (S-type) differed by the same 6 nucleotides as the mRNAs, suggesting that these genes may be alleles. The six nucleotide differences between these two alleles were found solely in the first exon, and these mutation sites had two types of consensus sequences. These mRNAs were found with varying lengths of 3' untranslated regions (3'-UTR). There are some similarities between the 3'-UTR of these mRNAs and those of actin and actin binding proteins in plants. The putative roles of the 3'-UTR and alternative polyadenylation sites are discussed in relation to their possible role in targeting the mRNAs to different subcellular compartments.
Astell, C R; Gardiner, E M; Tattersall, P
1986-02-01
The sequence of molecular clones of the genome of MVM(i), a lymphotropic variant of minute virus of mice, was determined and compared with that of MVM(p), the fibrotropic prototype strain. At the nucleotide level there are 163 base changes: 129 transitions and 34 transversions. Most nucleotide changes are silent, with only 27 amino acids changes predicted, of which 22 are conservative. Notable differences between the MVM(i) and MVM(p) genomes which may account for the cell specificities of these viruses occur within the 3' nontranslated regions. The differences discussed include the absence of a 65-base-pair direct in MVM(i), the presence of only two polyadenylation sites in MVM(i) compared with four in MVM(p), and sequences that bear a resemblance to enhancer sequences. Also included in this paper is an important correction to the MVM(p) sequence (C.R. Astell, M. Thomson, M. Merchlinsky, and D. C. Ward, Nucleic Acids Res. 11:999-1018, 1983).
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2014 CFR
2014-07-01
...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2013 CFR
2013-07-01
...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2012 CFR
2012-07-01
...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...
UrQt: an efficient software for the Unsupervised Quality trimming of NGS data.
Modolo, Laurent; Lerat, Emmanuelle
2015-04-29
Quality control is a necessary step of any Next Generation Sequencing analysis. Although customary, this step still requires manual interventions to empirically choose tuning parameters according to various quality statistics. Moreover, current quality control procedures that provide a "good quality" data set, are not optimal and discard many informative nucleotides. To address these drawbacks, we present a new quality control method, implemented in UrQt software, for Unsupervised Quality trimming of Next Generation Sequencing reads. Our trimming procedure relies on a well-defined probabilistic framework to detect the best segmentation between two segments of unreliable nucleotides, framing a segment of informative nucleotides. Our software only requires one user-friendly parameter to define the minimal quality threshold (phred score) to consider a nucleotide to be informative, which is independent of both the experiment and the quality of the data. This procedure is implemented in C++ in an efficient and parallelized software with a low memory footprint. We tested the performances of UrQt compared to the best-known trimming programs, on seven RNA and DNA sequencing experiments and demonstrated its optimality in the resulting tradeoff between the number of trimmed nucleotides and the quality objective. By finding the best segmentation to delimit a segment of good quality nucleotides, UrQt greatly increases the number of reads and of nucleotides that can be retained for a given quality objective. UrQt source files, binary executables for different operating systems and documentation are freely available (under the GPLv3) at the following address: https://lbbe.univ-lyon1.fr/-UrQt-.html .
Hall, L; Laird, J E; Craig, R K
1984-01-01
Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rudwaleit, M.; Bowness, P.; Wordsworth, P.
1996-12-31
The HLA-B27 subtype HLA-B{sup *}2704 is virtually absent in Caucasians but common in Orientals, where it is associated with ankylosing spondylitis. The amino acid sequence of HLA-B{sup *}2704 has been established by peptide mapping and was shown to differ by two amino acids from HLA-B{sup *}2705, HLA-B{sup *}2704 is characterized by a serine for aspartic acid substitution at position 77 and glutamic acid for valine at position 152. To date, however, no nucleotide sequence confirming these changes at the DNA level has been published. 13 refs., 2 figs.
Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián
2014-06-01
The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.
Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M
1982-01-01
The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460
Verma, Kapil; Sharma, Sapna; Sharma, Arun; Dalal, Jyoti; Bhardwaj, Tapeshwar
2018-06-01
Genetic variations among humans occur both within and among populations and range from single nucleotide changes to multiple-nucleotide variants. These multiple-nucleotide variants are useful for studying the relationships among individuals or various population groups. The study of human genetic variations can help scientists understand how different population groups are biologically related to one another. Sequence analysis of hypervariable regions of human mitochondrial DNA (mtDNA) has been successfully used for the genetic characterization of different population groups for forensic purposes. It is well established that different ethnic or population groups differ significantly in their mtDNA distributions. In the last decade, very little research has been conducted on mtDNA variations in the Indian population, although such data would be useful for elucidating the history of human population expansion across the world. Moreover, forensic studies on mtDNA variations in the Indian subcontinent are also scarce, particularly in the northern part of India. In this report, variations in the hypervariable regions of mtDNA were analyzed in the Yadav population of Haryana. Different molecular diversity indices were computed. Further, the obtained haplotypes were classified into different haplogroups and the phylogenetic relationship between different haplogroups was inferred.
Organellar phylogenomics of an emerging model system: Sphagnum (peatmoss).
Jonathan Shaw, A; Devos, Nicolas; Liu, Yang; Cox, Cymon J; Goffinet, Bernard; Flatberg, Kjell Ivar; Shaw, Blanka
2016-08-01
Sphagnum-dominated peatlands contain approx. 30 % of the terrestrial carbon pool in the form of partially decomposed plant material (peat), and, as a consequence, Sphagnum is currently a focus of studies on biogeochemistry and control of global climate. Sphagnum species differ in ecologically important traits that scale up to impact ecosystem function, and sequencing of the genome from selected Sphagnum species is currently underway. As an emerging model system, these resources for Sphagnum will facilitate linking nucleotide variation to plant functional traits, and through those traits to ecosystem processes. A solid phylogenetic framework for Sphagnum is crucial to comparative analyses of species-specific traits, but relationships among major clades within Sphagnum have been recalcitrant to resolution because the genus underwent a rapid radiation. Herein a well-supported hypothesis for phylogenetic relationships among major clades within Sphagnum based on organellar genome sequences (plastid, mitochondrial) is provided. We obtained nucleotide sequences (273 753 nucleotides in total) from the two organellar genomes from 38 species (including three outgroups). Phylogenetic analyses were conducted using a variety of methods applied to nucleotide and amino acid sequences. The Sphagnum phylogeny was rooted with sequences from the related Sphagnopsida genera, Eosphagnum and Flatbergium Phylogenetic analyses of the data converge on the following subgeneric relationships: (Rigida (((Subsecunda) (Cuspidata)) ((Sphagnum) (Acutifolia))). All relationships were strongly supported. Species in the two major clades (i.e. Subsecunda + Cuspidata and Sphagnum + Acutifolia), which include >90 % of all Sphagnum species, differ in ecological niches and these differences correlate with other functional traits that impact biogeochemical cycling. Mitochondrial intron presence/absence are variable among species and genera of the Sphagnopsida. Two new nomenclatural combinations are made, in the genera Eosphagnum and Flatbergium Newly resolved relationships now permit phylogenetic analyses of morphological, biochemical and ecological traits among Sphagnum species. The results clarify long-standing disagreements about subgeneric relationships and intrageneric classification. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Organellar phylogenomics of an emerging model system: Sphagnum (peatmoss)
Jonathan Shaw, A.; Devos, Nicolas; Liu, Yang; Cox, Cymon J.; Goffinet, Bernard; Flatberg, Kjell Ivar; Shaw, Blanka
2016-01-01
Background and Aims Sphagnum-dominated peatlands contain approx. 30 % of the terrestrial carbon pool in the form of partially decomposed plant material (peat), and, as a consequence, Sphagnum is currently a focus of studies on biogeochemistry and control of global climate. Sphagnum species differ in ecologically important traits that scale up to impact ecosystem function, and sequencing of the genome from selected Sphagnum species is currently underway. As an emerging model system, these resources for Sphagnum will facilitate linking nucleotide variation to plant functional traits, and through those traits to ecosystem processes. A solid phylogenetic framework for Sphagnum is crucial to comparative analyses of species-specific traits, but relationships among major clades within Sphagnum have been recalcitrant to resolution because the genus underwent a rapid radiation. Herein a well-supported hypothesis for phylogenetic relationships among major clades within Sphagnum based on organellar genome sequences (plastid, mitochondrial) is provided. Methods We obtained nucleotide sequences (273 753 nucleotides in total) from the two organellar genomes from 38 species (including three outgroups). Phylogenetic analyses were conducted using a variety of methods applied to nucleotide and amino acid sequences. The Sphagnum phylogeny was rooted with sequences from the related Sphagnopsida genera, Eosphagnum and Flatbergium. Key Results Phylogenetic analyses of the data converge on the following subgeneric relationships: (Rigida (((Subsecunda) (Cuspidata)) ((Sphagnum) (Acutifolia))). All relationships were strongly supported. Species in the two major clades (i.e. Subsecunda + Cuspidata and Sphagnum + Acutifolia), which include >90 % of all Sphagnum species, differ in ecological niches and these differences correlate with other functional traits that impact biogeochemical cycling. Mitochondrial intron presence/absence are variable among species and genera of the Sphagnopsida. Two new nomenclatural combinations are made, in the genera Eosphagnum and Flatbergium. Conclusions Newly resolved relationships now permit phylogenetic analyses of morphological, biochemical and ecological traits among Sphagnum species. The results clarify long-standing disagreements about subgeneric relationships and intrageneric classification. PMID:27268484
Maurino, Fernanda; Dumón, Analía D; Llauger, Gabriela; Alemandri, Vanina; de Haro, Luis A; Mattio, M Fernanda; Del Vas, Mariana; Laguna, Irma Graciela; Giménez Pecci, María de la Paz
2018-01-01
A rhabdovirus infecting maize and wheat crops in Argentina was molecularly characterized. Through next-generation sequencing (NGS) of symptomatic leaf samples, the complete genome was obtained of two isolates of maize yellow striate virus (MYSV), a putative new rhabdovirus, differing by only 0.4% at the nucleotide level. The MYSV genome consists of 12,654 nucleotides for maize and wheat virus isolates, and shares 71% nucleotide sequence identity with the complete genome of barley yellow striate mosaic virus (BYSMV, NC028244). Ten open reading frames (ORFs) were predicted in the MYSV genome from the antigenomic strand and were compared with their BYSMV counterparts. The highest amino acid sequence identity of the MYSV and BYSMV proteins was 80% between the L proteins, and the lowest was 37% between the proteins 4. Phylogenetic analysis suggested that the MYSV isolates are new members of the genus Cytorhabdovirus, family Rhabdoviridae. Yellow striate, affecting maize and wheat crops in Argentina, is an emergent disease that presents a potential economic risk for these widely distributed crops.
Yamada, Kazuhiko; Nishida-Umehara, Chizuko; Matsuda, Yoichi
2004-03-01
We isolated a new family of satellite DNA sequences from HaeIII- and EcoRI-digested genomic DNA of the Blakiston's fish owl ( Ketupa blakistoni). The repetitive sequences were organized in tandem arrays of the 174 bp element, and localized to the centromeric regions of all macrochromosomes, including the Z and W chromosomes, and microchromosomes. This hybridization pattern was consistent with the distribution of C-band-positive centromeric heterochromatin, and the satellite DNA sequences occupied 10% of the total genome as a major component of centromeric heterochromatin. The sequences were homogenized between macro- and microchromosomes in this species, and therefore intraspecific divergence of the nucleotide sequences was low. The 174 bp element cross-hybridized to the genomic DNA of six other Strigidae species, but not to that of the Tytonidae, suggesting that the satellite DNA sequences are conserved in the same family but fairly divergent between the different families in the Strigiformes. Secondly, the centromeric satellite DNAs were cloned from eight Strigidae species, and the nucleotide sequences of 41 monomer fragments were compared within and between species. Molecular phylogenetic relationships of the nucleotide sequences were highly correlated with both the taxonomy based on morphological traits and the phylogenetic tree constructed by DNA-DNA hybridization. These results suggest that the satellite DNA sequence has evolved by concerted evolution in the Strigidae and that it is a good taxonomic and phylogenetic marker to examine genetic diversity between Strigiformes species.
Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet
2014-01-01
Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...
Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R
2016-06-01
As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.
Identification of two allelic IgG1 C(H) coding regions (Cgamma1) of cat.
Kanai, T H; Ueda, S; Nakamura, T
2000-01-31
Two types of cDNA encoding IgG1 heavy chain (gamma1) were isolated from a single domestic short-hair cat. Sequence analysis indicated a higher level of similarity of these Cgamma1 sequences to human Cgamma1 sequence (76.9 and 77.0%) than to mouse sequence (70.0 and 69.7%) at the nucleotide level. Predicted primary structures of both the feline Cgamma1 genes, designated as Cgamma1a and Cgamma1b, were similar to that of human Cgamma1 gene, for instance, as to the size of constant domains, the presence of six conserved cysteine residues involved in formation of the domain structure, and the location of a conserved N-linked glycosylation site. Sequence comparison between the two alleles showed that 7 out of 10 nucleotide differences were within the C(H)3 domain coding region, all leading to nonsynonymous changes in amino acid residues. Partial sequence analysis of genomic clones showed three nucleotide substitutions between the two Cgamma1 alleles in the intron between the CH2 and C(H)3 domain coding regions. In 12 domestic short-hair cats used in this study, the frequency of Cgamma1a allele (62.5%) was higher than that of the Cgamma1b allele (37.5%).
Human somatostatin I: sequence of the cDNA.
Shen, L P; Pictet, R L; Rutter, W J
1982-01-01
RNA has been isolated from a human pancreatic somatostatinoma and used to prepare a cDNA library. After prescreening, clones containing somatostatin I sequences were identified by hybridization with an anglerfish somatostatin I-cloned cDNA probe. From the nucleotide sequence of two of these clones, we have deduced an essentially full-length mRNA sequence, including the preprosomatostatin coding region, 105 nucleotides from the 5' untranslated region and the complete 150-nucleotide 3' untranslated region. The coding region predicts a 116-amino acid precursor protein (Mr, 12.727) that contains somatostatin-14 and -28 at its COOH terminus. The predicted amino acid sequence of human somatostatin-28 is identical to that of somatostatin-28 isolated from the porcine and ovine species. A comparison of the amino acid sequences of human and anglerfish preprosomatostatin I indicated that the COOH-terminal region encoding somatostatin-14 and the adjacent 6 amino acids are highly conserved, whereas the remainder of the molecule, including the signal peptide region, is more divergent. However, many of the amino acid differences found in the pro region of the human and anglerfish proteins are conservative changes. This suggests that the propeptides have a similar secondary structure, which in turn may imply a biological function for this region of the molecule. Images PMID:6126875
Switchgrass ubiquitin promoter (PVUBI2) and uses thereof
Stewart, C. Neal; Mann, David George James
2013-12-10
The subject application provides polynucleotides, compositions thereof and methods for regulating gene expression in a plant. Polynucleotides disclosed herein comprise novel sequences for a promoter isolated from Panicum virgatum (switchgrass) that initiates transcription of an operably linked nucleotide sequence. Thus, various embodiments of the invention comprise the nucleotide sequence of SEQ ID NO: 2 or fragments thereof comprising nucleotides 1 to 692 of SEQ ID NO: 2 that are capable of driving the expression of an operably linked nucleic acid sequence.
USDA-ARS?s Scientific Manuscript database
Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...
Extension of the COG and arCOG databases by amino acid and nucleotide sequences
Meereis, Florian; Kaufmann, Michael
2008-01-01
Background The current versions of the COG and arCOG databases, both excellent frameworks for studies in comparative and functional genomics, do not contain the nucleotide sequences corresponding to their protein or protein domain entries. Results Using sequence information obtained from GenBank flat files covering the completely sequenced genomes of the COG and arCOG databases, we constructed NUCOCOG (nucleotide sequences containing COG databases) as an extended version including all nucleotide sequences and in addition the amino acid sequences originally utilized to construct the current COG and arCOG databases. We make available three comprehensive single XML files containing the complete databases including all sequence information. In addition, we provide a web interface as a utility suitable to browse the NUCOCOG database for sequence retrieval. The database is accessible at . Conclusion NUCOCOG offers the possibility to analyze any sequence related property in the context of the COG and arCOG framework simply by using script languages such as PERL applied to a large but single XML document. PMID:19014535
Lin, C S; Sun, Y L; Liu, C Y; Yang, P C; Chang, L C; Cheng, I C; Mao, S J; Huang, M C
1999-08-05
The complete nucleotide sequence of the pig (Sus scrofa) mitochondrial genome, containing 16613bp, is presented in this report. The genome is not a specific length because of the presence of the variable numbers of tandem repeats, 5'-CGTGCGTACA in the displacement loop (D-loop). Genes responsible for 12S and 16S rRNAs, 22 tRNAs, and 13 protein-coding regions are found. The genome carries very few intergenic nucleotides with several instances of overlap between protein-coding or tRNA genes, except in the D-loop region. For evaluating the possible evolutionary relationships between Artiodactyla and Cetacea, the nucleotide substitutions and amino acid sequences of 13 protein-coding genes were aligned by pairwise comparisons of the pig, cow, and fin whale. By comparing these sequences, we suggest that there is a closer relationship between the pig and cow than that between either of these species and fin whale. In addition, the accumulation of transversions and gaps in pig 12S and 16S rRNA genes was compared with that in other eutherian species, including cow, fin whale, human, horse, and harbor seal. The results also reveal a close phylogenetic relationship between pig and cow, as compared to fin whale and others. Thus, according to the sequence differences of mitochondrial rRNA genes in eutherian species, the evolutionary separation of pig and cow occurred about 53-60 million years ago.
DNA Nucleotide Sequence Restricted by the RI Endonuclease
Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.
1972-01-01
The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974
Mangrauthia, Satendra K; Malathi, P; Agarwal, Surekha; Ramkumar, G; Krishnaveni, D; Neeraja, C N; Madhav, M Sheshu; Ladhalakshmi, D; Balachandran, S M; Viraktamath, B C
2012-06-01
Rice tungro disease, one of the major constraints to rice production in South and Southeast Asia, is caused by a combination of two viruses: Rice tungro spherical virus (RTSV) and Rice tungro bacilliform virus (RTBV). The present study was undertaken to determine the genetic variation of RTSV population present in tungro endemic states of Indian subcontinent. Phylogenetic analysis based on coat protein sequences showed distinct divergence of Indian RTSV isolates into two groups; one consisted isolates from Hyderabad (Andhra Pradesh), Cuttack (Orissa), and Puducherry and another from West Bengal, Coimbatore (Tamil Nadu), and Kanyakumari (Tamil Nadu). The results obtained from phylogenetic study were further supported with the SNPs (single nucleotide polymorphism), INDELs (insertion and deletion) and evolutionary distance analysis. In addition, sequence difference count matrix revealed 2-68 nucleotides differences among all the Indian RTSV isolates taken in this study. However, at the protein level these differences were not significant as revealed by Ka/Ks ratio calculation. Sequence identity at nucleotide and amino acid level was 92-100% and 97-100%, respectively, among Indian isolates of RTSV. Understanding of the population structure of RTSV from tungro endemic regions of India would potentially provide insights into the molecular diversification of this virus.
Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca
2015-01-01
Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450
Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca
2015-01-01
Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.
Molecular variability analysis of five new complete cacao swollen shoot virus genomic sequences.
Muller, E; Sackey, S
2005-01-01
Cacao swollen shoot virus (CSSV), a member of the family Caulimovi-ridae, genus Badnavirus occurs in all the main cacao-growing areas of West Africa. We amplified, cloned and sequenced complete genomes of five new isolates, two originating from Togo and three originating from Ghana. The genome of these five newly sequenced isolates all contain the five putative open reading frames I, II, III, X and Y described for the first sequenced CSSV isolate, Agou1 originating from Togo. Their genomes have been aligned with the genome of Agou1. The nucleotide and amino acid sequence identities between isolates have been calculated and a phylogenetic analysis has been made including other pararetroviruses. Maximum nucleotide sequence variability between complete genomes of CSSV isolates was 29.4%. Geographical differentiation between isolates appears more important than differentiation between mild and severe isolates. ORF X differs greatly in size and sequence between the Togolese isolates Nyongbo2 and Agou1, and the four other isolates, its functional role is therefore clearly questionable.
Glenney, Gavin W; Barbash, Patricia A; Coll, John A
2016-03-01
A novel herpesvirus was found by molecular methods in samples of Lake Trout Salvelinus namaycush from Lake Erie, Pennsylvania, and Lake Ontario, Keuka Lake, and Lake Otsego, New York. Based on PCR amplification and partial sequencing of polymerase, terminase, and glycoprotein genes, a number of isolates were identified as a novel virus, which we have named Namaycush herpesvirus (NamHV) salmonid herpesvirus 5 (SalHV5). Phylogenetic analyses of three NamHV genes indicated strong clustering with other members of the genus Salmonivirus, placing these isolates into family Alloherpesviridae. The NamHV isolates were identical in the three partially sequenced genes; however, they varied from other salmonid herpesviruses in nucleotide sequence identity. In all three of the genes sequenced, NamHV shared the highest sequence identity with Atlantic Salmon papillomatosis virus (ASPV; SalHV4) isolated from Atlantic Salmon Salmo salar in northern Europe, including northwestern Russia. These results lead one to believe that NamHV and ASPV have a common ancestor that may have made a relatively recent host jump from Atlantic Salmon to Lake Trout or vice versa. Partial nucleotide sequence comparisons between NamHV and ASPV for the polymerase and glycoprotein genes differ by >5% and >10%, respectively. Additional nucleotide sequence comparisons between NamHV and epizootic epitheliotropic disease virus (EEDV/SalHV3) in the terminase, glycoprotein, and polymerase genes differ by >5%, >20%, and >10%, respectively. Thus, NamHV and EEDV may be occupying discrete ecological niches in Lake Trout. Even though NamHV shared the highest genetic identity with ASPV, each of these viruses has a separate host species, which also implies speciation. Additionally, NamHV has been detected over the last 4 years in four separate water bodies across two states, which suggests that NamHV is a distinct, naturally replicating lineage. This, in combination with a divergence in nucleotide sequence from EEDV, indicates that NamHV is a new species in the genus Salmonivirus. Received April 20, 2015; accepted October 11, 2015.
Nucleotide sequences of bovine alpha S1- and kappa-casein cDNAs.
Stewart, A F; Willis, I M; Mackinlay, A G
1984-01-01
The nucleotide sequences corresponding to bovine alpha S1- and kappa-casein mRNAs are presented. An unusual alpha S1-casein cDNA has been characterised whose 5' end commences upstream from its putative TATA box. The alpha S1-casein mRNA is compared to rat alpha-casein mRNA and two components of divergence are identified. Firstly, the two sequences have diverged at a high point mutation rate and the rate of amino acid replacement by this mechanism is at least as great as the rate of divergence of any other part of the mRNAs. Secondly, the protein coding sequence has been subjected to several insertion/deletion events, one of which may be an example of exon shuffling . The kappa-casein mRNA sequence verifies the proposition that it has arisen from a different ancestral gene to the other caseins. Images PMID:6328443
Lourenco-Jaramillo, Diana Lelidett; Sifuentes-Rincón, Ana María; Parra-Bracamonte, Gaspar Manuel; de la Rosa-Reyna, Xochitl Fabiola; Segura-Cabrera, Aldo; Arellano-Vera, Williams
2012-01-01
DNA from four cattle breeds was used to re-sequence all of the exons and 56% of the introns of the bovine tyrosine hydroxylase (TH) gene and 97% and 13% of the bovine dopamine β-hydroxylase (DBH) coding and non-coding sequences, respectively. Two novel single nucleotide polymorphisms (SNPs) and a microsatellite motif were found in the TH sequences. The DBH sequences contained 62 nucleotide changes, including eight non-synonymous SNPs (nsSNPs) that are of particular interest because they may alter protein function and therefore affect the phenotype. These DBH nsSNPs resulted in amino acid substitutions that were predicted to destabilize the protein structure. Six SNPs (one from TH and five from DBH non-synonymous SNPs) were genotyped in 140 animals; all of them were polymorphic and had a minor allele frequency of > 9%. There were significant differences in the intra- and inter-population haplotype distributions. The haplotype differences between Brahman cattle and the three B. t. taurus breeds (Charolais, Holstein and Lidia) were interesting from a behavioural point of view because of the differences in temperament between these breeds. PMID:22888292
Sequence of a cDNA encoding pancreatic preprosomatostatin-22.
Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E
1982-01-01
We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673
Plant nitrogen regulatory P-PII genes
Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun
2001-01-01
The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the
Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng
2016-02-11
An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.
USDA-ARS?s Scientific Manuscript database
: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...
Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N
1991-11-20
A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.
Novel methodologies for spectral classification of exon and intron sequences
NASA Astrophysics Data System (ADS)
Kwan, Hon Keung; Kwan, Benjamin Y. M.; Kwan, Jennifer Y. Y.
2012-12-01
Digital processing of a nucleotide sequence requires it to be mapped to a numerical sequence in which the choice of nucleotide to numeric mapping affects how well its biological properties can be preserved and reflected from nucleotide domain to numerical domain. Digital spectral analysis of nucleotide sequences unfolds a period-3 power spectral value which is more prominent in an exon sequence as compared to that of an intron sequence. The success of a period-3 based exon and intron classification depends on the choice of a threshold value. The main purposes of this article are to introduce novel codes for 1-sequence numerical representations for spectral analysis and compare them to existing codes to determine appropriate representation, and to introduce novel thresholding methods for more accurate period-3 based exon and intron classification of an unknown sequence. The main findings of this study are summarized as follows: Among sixteen 1-sequence numerical representations, the K-Quaternary Code I offers an attractive performance. A windowed 1-sequence numerical representation (with window length of 9, 15, and 24 bases) offers a possible speed gain over non-windowed 4-sequence Voss representation which increases as sequence length increases. A winner threshold value (chosen from the best among two defined threshold values and one other threshold value) offers a top precision for classifying an unknown sequence of specified fixed lengths. An interpolated winner threshold value applicable to an unknown and arbitrary length sequence can be estimated from the winner threshold values of fixed length sequences with a comparable performance. In general, precision increases as sequence length increases. The study contributes an effective spectral analysis of nucleotide sequences to better reveal embedded properties, and has potential applications in improved genome annotation.
USDA-ARS?s Scientific Manuscript database
The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...
Winterhagen, Patrick; Wünsche, Jens-Norbert
2016-05-01
Within a polyembryonic mango seedling tree population, the genetic background of individuals should be identical because vigorous plants for cultivation are expected to develop from nucellar embryos representing maternal clones. Due to the fact that the mango cultivar 'Hôi' is assigned to the polyembryonic ecotype, an intra-cultivar variability of ethylene receptor genes was unexpected. Ethylene receptors in plants are conserved, but the number of receptors or receptor isoforms is variable regarding different plant species. However, it is shown here that the ethylene receptor MiETR1 is present in various isoforms within the mango cultivar 'Hôi'. The investigation of single nucleotide polymorphisms revealed that different MiETR1 isoforms can not be discriminated simply by individual single nucleotide exchanges but by the specific arrangement of single nucleotide polymorphisms at certain positions in the exons of MiETR1. Furthermore, an MiETR1 isoform devoid of introns in the genomic sequence was identified. The investigation demonstrates some limitations of high resolution melting and ScreenClust analysis and points out the necessity of sequencing to identify individual isoforms and to determine the variability within the tree population.
Statistical analysis of nucleotide sequences of the hemagglutinin gene of human influenza A viruses.
Ina, Y; Gojobori, T
1994-01-01
To examine whether positive selection operates on the hemagglutinin 1 (HA1) gene of human influenza A viruses (H1 subtype), 21 nucleotide sequences of the HA1 gene were statistically analyzed. The nucleotide sequences were divided into antigenic and nonantigenic sites. The nucleotide diversities for antigenic and nonantigenic sites of the HA1 gene were computed at synonymous and nonsynonymous sites separately. For nonantigenic sites, the nucleotide diversities were larger at synonymous sites than at nonsynonymous sites. This is consistent with the neutral theory of molecular evolution. For antigenic sites, however, the nucleotide diversities at nonsynonymous sites were larger than those at synonymous sites. These results suggest that positive selection operates on antigenic sites of the HA1 gene of human influenza A viruses (H1 subtype). PMID:8078892
Code of Federal Regulations, 2010 CFR
2010-07-01
..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...
Code of Federal Regulations, 2012 CFR
2012-07-01
..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...
Code of Federal Regulations, 2013 CFR
2013-07-01
..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...
Code of Federal Regulations, 2011 CFR
2011-07-01
..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...
Code of Federal Regulations, 2014 CFR
2014-07-01
..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...
The genome-wide DNA sequence specificity of the anti-tumour drug bleomycin in human cells.
Murray, Vincent; Chen, Jon K; Tanaka, Mark M
2016-07-01
The cancer chemotherapeutic agent, bleomycin, cleaves DNA at specific sites. For the first time, the genome-wide DNA sequence specificity of bleomycin breakage was determined in human cells. Utilising Illumina next-generation DNA sequencing techniques, over 200 million bleomycin cleavage sites were examined to elucidate the bleomycin genome-wide DNA selectivity. The genome-wide bleomycin cleavage data were analysed by four different methods to determine the cellular DNA sequence specificity of bleomycin strand breakage. For the most highly cleaved DNA sequences, the preferred site of bleomycin breakage was at 5'-GT* dinucleotide sequences (where the asterisk indicates the bleomycin cleavage site), with lesser cleavage at 5'-GC* dinucleotides. This investigation also determined longer bleomycin cleavage sequences, with preferred cleavage at 5'-GT*A and 5'- TGT* trinucleotide sequences, and 5'-TGT*A tetranucleotides. For cellular DNA, the hexanucleotide DNA sequence 5'-RTGT*AY (where R is a purine and Y is a pyrimidine) was the most highly cleaved DNA sequence. It was striking that alternating purine-pyrimidine sequences were highly cleaved by bleomycin. The highest intensity cleavage sites in cellular and purified DNA were very similar although there were some minor differences. Statistical nucleotide frequency analysis indicated a G nucleotide was present at the -3 position (relative to the cleavage site) in cellular DNA but was absent in purified DNA.
The complete nucleotide sequence of the glnALG operon of Escherichia coli K12.
Miranda-Ríos, J; Sánchez-Pescador, R; Urdea, M; Covarrubias, A A
1987-01-01
The nucleotide sequence of the E. coli glnALG operon has been determined. The glnL (ntrB) and glnG (ntrC) genes present a high homology, at the nucleotide and aminoacid levels, with the corresponding genes of Klebsiella pneumoniae. The predicted aminoacid sequence for glutamine synthetase allowed us to locate some of the enzyme domains. The structure of this operon is discussed. PMID:2882477
Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K
1982-11-11
The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).
Genomic mid-range inhomogeneity correlates with an abundance of RNA secondary structures
Bechtel, Jason M; Wittenschlaeger, Thomas; Dwyer, Trisha; Song, Jun; Arunachalam, Sasi; Ramakrishnan, Sadeesh K; Shepard, Samuel; Fedorov, Alexei
2008-01-01
Background Genomes possess different levels of non-randomness, in particular, an inhomogeneity in their nucleotide composition. Inhomogeneity is manifest from the short-range where neighboring nucleotides influence the choice of base at a site, to the long-range, commonly known as isochores, where a particular base composition can span millions of nucleotides. A separate genomic issue that has yet to be thoroughly elucidated is the role that RNA secondary structure (SS) plays in gene expression. Results We present novel data and approaches that show that a mid-range inhomogeneity (~30 to 1000 nt) not only exists in mammalian genomes but is also significantly associated with strong RNA SS. A whole-genome bioinformatics investigation of local SS in a set of 11,315 non-redundant human pre-mRNA sequences has been carried out. Four distinct components of these molecules (5'-UTRs, exons, introns and 3'-UTRs) were considered separately, since they differ in overall nucleotide composition, sequence motifs and periodicities. For each pre-mRNA component, the abundance of strong local SS (< -25 kcal/mol) was a factor of two to ten greater than a random expectation model. The randomization process preserves the short-range inhomogeneity of the corresponding natural sequences, thus, eliminating short-range signals as possible contributors to any observed phenomena. Conclusion We demonstrate that the excess of strong local SS in pre-mRNAs is linked to the little explored phenomenon of genomic mid-range inhomogeneity (MRI). MRI is an interdependence between nucleotide choice and base composition over a distance of 20–1000 nt. Additionally, we have created a public computational resource to support further study of genomic MRI. PMID:18549495
Aoki, Koki; Ishiko, Hiroaki; Konno, Tsunetada; Shimada, Yasushi; Hayashi, Akio; Kaneko, Hisatoshi; Ohguchi, Takeshi; Tagawa, Yoshitsugu; Ohno, Shigeaki; Yamazaki, Shudo
2008-01-01
In a 2-month period in 2003, we encountered an outbreak of epidemic keratoconjunctivitis (EKC) in Japan. We detected 67 human adenoviruses (HAdVs) by PCR from eye swabs of patients with EKC at five eye clinics in different parts of Japan. Forty-one of the 67 HAdV DNAs from the swabs were identified as HAdV-37 by phylogenetic analysis using a partial hexon gene sequence. When the restriction patterns of these viral genomes were compared with that of the HAdV-37 prototype strain, one isolate showed a never-before-seen restriction pattern. Within 1 year, we encountered three more EKC cases caused by a genetically identical virus: two nosocomial infections at two different university hospitals and a sporadic infection at an eye clinic. We determined the nucleotide sequences of the full-length hexon and fiber genes of these isolates and compared them to those of the 51 prototype strains. Surprisingly, the sequence of the hexon (ɛ determinant) loop-1 and -2 regions showed the highest nucleotide identity with HAdV-22, a rare EKC isolate. However, the nucleotide sequence of the fiber gene was identical to that of the HAdV-8 prototype strain. 22 We propose that this virus is a new hexon-chimeric intermediate HAdV-22,37/H8, and may be an etiological agent of EKC. PMID:18701656
Predicting protein-binding regions in RNA using nucleotide profiles and compositions.
Choi, Daesik; Park, Byungkyu; Chae, Hanju; Lee, Wook; Han, Kyungsook
2017-03-14
Motivated by the increased amount of data on protein-RNA interactions and the availability of complete genome sequences of several organisms, many computational methods have been proposed to predict binding sites in protein-RNA interactions. However, most computational methods are limited to finding RNA-binding sites in proteins instead of protein-binding sites in RNAs. Predicting protein-binding sites in RNA is more challenging than predicting RNA-binding sites in proteins. Recent computational methods for finding protein-binding sites in RNAs have several drawbacks for practical use. We developed a new support vector machine (SVM) model for predicting protein-binding regions in mRNA sequences. The model uses sequence profiles constructed from log-odds scores of mono- and di-nucleotides and nucleotide compositions. The model was evaluated by standard 10-fold cross validation, leave-one-protein-out (LOPO) cross validation and independent testing. Since actual mRNA sequences have more non-binding regions than protein-binding regions, we tested the model on several datasets with different ratios of protein-binding regions to non-binding regions. The best performance of the model was obtained in a balanced dataset of positive and negative instances. 10-fold cross validation with a balanced dataset achieved a sensitivity of 91.6%, a specificity of 92.4%, an accuracy of 92.0%, a positive predictive value (PPV) of 91.7%, a negative predictive value (NPV) of 92.3% and a Matthews correlation coefficient (MCC) of 0.840. LOPO cross validation showed a lower performance than the 10-fold cross validation, but the performance remains high (87.6% accuracy and 0.752 MCC). In testing the model on independent datasets, it achieved an accuracy of 82.2% and an MCC of 0.656. Testing of our model and other state-of-the-art methods on a same dataset showed that our model is better than the others. Sequence profiles of log-odds scores of mono- and di-nucleotides were much more powerful features than nucleotide compositions in finding protein-binding regions in RNA sequences. But, a slight performance gain was obtained when using the sequence profiles along with nucleotide compositions. These are preliminary results of ongoing research, but demonstrate the potential of our approach as a powerful predictor of protein-binding regions in RNA. The program and supporting data are available at http://bclab.inha.ac.kr/RBPbinding .
Stephenson, F H; Ballard, B T; Boyer, H W; Rosenberg, J M; Greene, P J
1989-12-21
The RsrI endonuclease, a type-II restriction endonuclease (ENase) found in Rhodobacter sphaeroides, is an isoschizomer of the EcoRI ENase. A clone containing an 11-kb BamHI fragment was isolated from an R. sphaeroides genomic DNA library by hybridization with synthetic oligodeoxyribonucleotide probes based on the N-terminal amino acid (aa) sequence of RsrI. Extracts of E. coli containing a subclone of the 11-kb fragment display RsrI activity. Nucleotide sequence analysis reveals an 831-bp open reading frame encoding a polypeptide of 277 aa. A 50% identity exists within a 266-aa overlap between the deduced aa sequences of RsrI and EcoRI. Regions of 75-100% aa sequence identity correspond to key structural and functional regions of EcoRI. The type-II ENases have many common properties, and a common origin might have been expected. Nevertheless, this is the first demonstration of aa sequence similarity between ENases produced by different organisms.
The EMBL nucleotide sequence database
Stoesser, Guenter; Baker, Wendy; van den Broek, Alexandra; Camon, Evelyn; Garcia-Pastor, Maria; Kanz, Carola; Kulikova, Tamara; Lombard, Vincent; Lopez, Rodrigo; Parkinson, Helen; Redaschi, Nicole; Sterk, Peter; Stoehr, Peter; Tuli, Mary Ann
2001-01-01
The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/) is maintained at the European Bioinformatics Institute (EBI) in an international collaboration with the DNA Data Bank of Japan (DDBJ) and GenBank at the NCBI (USA). Data is exchanged amongst the collaborating databases on a daily basis. The major contributors to the EMBL database are individual authors and genome project groups. Webin is the preferred web-based submission system for individual submitters, whilst automatic procedures allow incorporation of sequence data from large-scale genome sequencing centres and from the European Patent Office (EPO). Database releases are produced quarterly. Network services allow free access to the most up-to-date data collection via ftp, email and World Wide Web interfaces. EBI’s Sequence Retrieval System (SRS), a network browser for databanks in molecular biology, integrates and links the main nucleotide and protein databases plus many specialized databases. For sequence similarity searching a variety of tools (e.g. Blitz, Fasta, BLAST) are available which allow external users to compare their own sequences against the latest data in the EMBL Nucleotide Sequence Database and SWISS-PROT. PMID:11125039
Mitochondrial control-region sequence variation in aboriginal Australians.
van Holst Pellekaan, S; Frommer, M; Sved, J; Boettcher, B
1998-01-01
The mitochondrial D-loop hypervariable segment 1 (mt HVS1) between nucleotides 15997 and 16377 has been examined in aboriginal Australian people from the Darling River region of New South Wales (riverine) and from Yuendumu in central Australia (desert). Forty-seven unique HVS1 types were identified, varying at 49 nucleotide positions. Pairwise analysis by calculation of BEPPI (between population proportion index) reveals statistically significant structure in the populations, although some identical HVS1 types are seen in the two contrasting regions. mt HVS1 types may reflect more-ancient distributions than do linguistic diversity and other culturally distinguishing attributes. Comparison with sequences from five published global studies reveals that these Australians demonstrate greatest divergence from some Africans, least from Papua New Guinea highlanders, and only slightly more from some Pacific groups (Indonesian, Asian, Samoan, and coastal Papua New Guinea), although the HVS1 types vary at different nucleotide sites. Construction of a median network, displaying three main groups, suggests that several hypervariable nucleotide sites within the HVS1 are likely to have undergone mutation independently, making phylogenetic comparison with global samples by conventional methods difficult. Specific nucleotide-site variants are major separators in median networks constructed from Australian HVS1 types alone and for one global selection. The distribution of these, requiring extended study, suggests that they may be signatures of different groups of prehistoric colonizers into Australia, for which the time of colonization remains elusive. PMID:9463317
Interactive computer programs for the graphic analysis of nucleotide sequence data.
Luckow, V A; Littlewood, R K; Rownd, R H
1984-01-01
A group of interactive computer programs have been developed which aid in the collection and graphical analysis of nucleotide and protein sequence data. The programs perform the following basic functions: a) enter, edit, list, and rearrange sequence data; b) permit automatic entry of nucleotide sequence data directly from an autoradiograph into the computer; c) search for restriction sites or other specified patterns and plot a linear or circular restriction map, or print their locations; d) plot base composition; e) analyze homology between sequences by plotting a two-dimensional graphic matrix; and f) aid in plotting predicted secondary structures of RNA molecules. PMID:6546437
Weak Negative and Positive Selection and the Drift Load at Splice Sites
Denisov, Stepan V.; Bazykin, Georgii A.; Sutormin, Roman; Favorov, Alexander V.; Mironov, Andrey A.; Gelfand, Mikhail S.; Kondrashov, Alexey S.
2014-01-01
Splice sites (SSs) are short sequences that are crucial for proper mRNA splicing in eukaryotic cells, and therefore can be expected to be shaped by strong selection. Nevertheless, in mammals and in other intron-rich organisms, many of the SSs often involve nonconsensus (Nc), rather than consensus (Cn), nucleotides, and beyond the two critical nucleotides, the SSs are not perfectly conserved between species. Here, we compare the SS sequences between primates, and between Drosophila fruit flies, to reveal the pattern of selection acting at SSs. Cn-to-Nc substitutions are less frequent, and Nc-to-Cn substitutions are more frequent, than neutrally expected, indicating, respectively, negative and positive selection. This selection is relatively weak (1 < |4Nes| < 4), and has a similar efficiency in primates and in Drosophila. Within some nucleotide positions, the positive selection in favor of Nc-to-Cn substitutions is weaker than the negative selection maintaining already established Cn nucleotides; this difference is due to site-specific negative selection favoring current Nc nucleotides. In general, however, the strength of negative selection protecting the Cn alleles is similar in magnitude to the strength of positive selection favoring replacement of Nc alleles, as expected under the simple nearly neutral turnover. In summary, although a fraction of the Nc nucleotides within SSs is maintained by selection, the abundance of deleterious nucleotides in this class suggests a substantial genome-wide drift load. PMID:24966225
USDA-ARS?s Scientific Manuscript database
A new species of the family Alphaflexiviridae provisionally named Alfalfa virus S (AVS) was diagnosed in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by Illumina NGS technology ...
The primary structure of the thymidine kinase gene of fish lymphocystis disease virus.
Schnitzler, P; Handermann, M; Szépe, O; Darai, G
1991-06-01
The DNA nucleotide sequence of the thymidine kinase (TK) gene of fish lymphocystis disease virus (FLDV) which has been localized between the coordinates 0.678 to 0.688 of the viral genome was determined. The analysis of the DNA nucleotide sequence located between the recognition sites of HindIII (0.669 map unit; nucleotide position 1) and AccI (nucleotide position 2032) revealed the presence of an open reading frame of 954 bp on the lower strand of this region between nucleotide positions 1868 (ATG) and 915 (TAA). It encodes for a protein of 318 amino acid residues. The evolutionary relationships of the TK gene of FLDV to the other known TK genes was investigated using the method of progressive sequence alignment. These analyses revealed a high degree of diversity between the protein sequence of FLDV TK gene and the amino acid composition of other TKs tested. However, significant conservations were detected at several regions of amino acid residues of the FLDV TK protein when compared to the amino acid sequence of TKs of African swine fever virus, fowlpox virus, shope fibroma virus, and vaccinia virus and to the amino acid sequences of the cellular cytoplasmic TK of chicken, mouse, and man.
Protein sequence annotation in the genome era: the annotation concept of SWISS-PROT+TREMBL.
Apweiler, R; Gateau, A; Contrino, S; Martin, M J; Junker, V; O'Donovan, C; Lang, F; Mitaritonna, N; Kappus, S; Bairoch, A
1997-01-01
SWISS-PROT is a curated protein sequence database which strives to provide a high level of annotation, a minimal level of redundancy and high level of integration with other databases. Ongoing genome sequencing projects have dramatically increased the number of protein sequences to be incorporated into SWISS-PROT. Since we do not want to dilute the quality standards of SWISS-PROT by incorporating sequences without proper sequence analysis and annotation, we cannot speed up the incorporation of new incoming data indefinitely. However, as we also want to make the sequences available as fast as possible, we introduced TREMBL (TRanslation of EMBL nucleotide sequence database), a supplement to SWISS-PROT. TREMBL consists of computer-annotated entries in SWISS-PROT format derived from the translation of all coding sequences (CDS) in the EMBL nucleotide sequence database, except for CDS already included in SWISS-PROT. While TREMBL is already of immense value, its computer-generated annotation does not match the quality of SWISS-PROTs. The main difference is in the protein functional information attached to sequences. With this in mind, we are dedicating substantial effort to develop and apply computer methods to enhance the functional information attached to TREMBL entries.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krishnakumar, Raga; Sinha, Anupama; Bird, Sara W.
Emerging sequencing technologies are allowing us to characterize environmental, clinical and laboratory samples with increasing speed and detail, including real-time analysis and interpretation of data. One example of this is being able to rapidly and accurately detect a wide range of pathogenic organisms, both in the clinic and the field. Genomes can have radically different GC content however, such that accurate sequence analysis can be challenging depending upon the technology used. Here, we have characterized the performance of the Oxford MinION nanopore sequencer for detection and evaluation of organisms with a range of genomic nucleotide bias. We have diagnosed themore » quality of base-calling across individual reads and discovered that the position within the read affects base-calling and quality scores. Finally, we have evaluated the performance of the current state-of-the-art neural network-based MinION basecaller, characterizing its behavior with respect to systemic errors as well as context- and sequence-specific errors. Overall, we present a detailed characterization the capabilities of the MinION in terms of generating high-accuracy sequence data from genomes with a wide range of nucleotide content. This study provides a framework for designing the appropriate experiments that are the likely to lead to accurate and rapid field-forward diagnostics.« less
Krishnakumar, Raga; Sinha, Anupama; Bird, Sara W.; ...
2018-02-16
Emerging sequencing technologies are allowing us to characterize environmental, clinical and laboratory samples with increasing speed and detail, including real-time analysis and interpretation of data. One example of this is being able to rapidly and accurately detect a wide range of pathogenic organisms, both in the clinic and the field. Genomes can have radically different GC content however, such that accurate sequence analysis can be challenging depending upon the technology used. Here, we have characterized the performance of the Oxford MinION nanopore sequencer for detection and evaluation of organisms with a range of genomic nucleotide bias. We have diagnosed themore » quality of base-calling across individual reads and discovered that the position within the read affects base-calling and quality scores. Finally, we have evaluated the performance of the current state-of-the-art neural network-based MinION basecaller, characterizing its behavior with respect to systemic errors as well as context- and sequence-specific errors. Overall, we present a detailed characterization the capabilities of the MinION in terms of generating high-accuracy sequence data from genomes with a wide range of nucleotide content. This study provides a framework for designing the appropriate experiments that are the likely to lead to accurate and rapid field-forward diagnostics.« less
Kim, W J; Ji, Y; Choi, G; Kang, Y M; Yang, S; Moon, B C
2016-08-05
This study was performed to identify and analyze the phylogenetic relationship among four herbaceous species of the genus Paeonia, P. lactiflora, P. japonica, P. veitchii, and P. suffruticosa, using DNA barcodes. These four species, which are commonly used in traditional medicine as Paeoniae Radix and Moutan Radicis Cortex, are pharmaceutically defined in different ways in the national pharmacopoeias in Korea, Japan, and China. To authenticate the different species used in these medicines, we evaluated rDNA-internal transcribed spacers (ITS), matK and rbcL regions, which provide information capable of effectively distinguishing each species from one another. Seventeen samples were collected from different geographic regions in Korea and China, and DNA barcode regions were amplified using universal primers. Comparative analyses of these DNA barcode sequences revealed species-specific nucleotide sequences capable of discriminating the four Paeonia species. Among the entire sequences of three barcodes, marker nucleotides were identified at three positions in P. lactiflora, eleven in P. japonica, five in P. veitchii, and 25 in P. suffruticosa. Phylogenetic analyses also revealed four distinct clusters showing homogeneous clades with high resolution at the species level. The results demonstrate that the analysis of these three DNA barcode sequences is a reliable method for identifying the four Paeonia species and can be used to authenticate Paeoniae Radix and Moutan Radicis Cortex at the species level. Furthermore, based on the assessment of amplicon sizes, inter/intra-specific distances, marker nucleotides, and phylogenetic analysis, rDNA-ITS was the most suitable DNA barcode for identification of these species.
Kutz, Russell; Okwumabua, Ogi
2008-10-01
The glutamate dehydrogenase (GDH) enzymes of 19 Streptococcus suis serotype 2 strains, consisting of 18 swine isolates and 1 human clinical isolate from a geographically varied collection, were analyzed by activity staining on a nondenaturing gel. All seven (100%) of the highly virulent strains tested produced an electrophoretic type (ET) distinct from those of moderately virulent and nonvirulent strains. By PCR and nucleotide sequence determination, the gdh genes of the 19 strains and of 2 highly virulent strains involved in recent Chinese outbreaks yielded a 1,820-bp fragment containing an open reading frame of 1,344 nucleotides, which encodes a protein of 448 amino acid residues with a calculated molecular mass of approximately 49 kDa. The nucleotide sequences contained base pair differences, but most were silent. Cluster analysis of the deduced amino acid sequences separated the isolates into three groups. Group I (ETI) consisted of the seven highly virulent isolates and the two Chinese outbreak strains, containing Ala(299)-to-Ser, Glu(305)-to-Lys, and Glu(330)-to-Lys amino acid substitutions compared with groups II and III (ETII). Groups II and III consisted of moderately virulent and nonvirulent strains, which are separated from each other by Tyr(72)-to-Asp and Thr(296)-to-Ala substitutions. Gene exchange studies resulted in the change of ETI to ETII and vice versa. A spectrophotometric activity assay for GDH did not show significant differences between the groups. These results suggest that the GDH ETs and sequence types may serve as useful markers in predicting the pathogenic behavior of strains of this serotype and that the molecular basis for the observed differences in the ETs was amino acid substitutions and not deletion, insertion, or processing uniqueness.
Altier, Daniel J.; Dahlbacka, Glen; Ellanskaya, legal representative, Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser; Ellanskaya, deceased, Irina
2007-12-11
Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.
Altier, Daniel J.; Dahlbacka, Glen; Elleskaya, Irina; Ellanskaya, legal representative; Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser
2010-08-10
Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.
Altier, Daniel J [Waukee, IA; Dahlbacka, Glen [Oakland, CA; Elleskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, IA; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA
2011-04-12
Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.
Altier, Daniel J [Granger, IA; Dahlbacka, Glen [Oakland, CA; Ellanskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, TX; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA
2012-04-03
Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.
Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou
2011-01-01
DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738
Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K
1982-01-01
The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%). PMID:6891053
McCutchen-Maloney, Sandra L.
2002-01-01
DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.
Zhao, Guozhong; Yao, Yunping; Hou, Lihua; Wang, Chunling; Cao, Xiaohong
2014-10-01
Aspergillus oryzae is used to produce traditional fermented foods and beverages. A. oryzae 3.042 produces a neutral protease and an alkaline protease but rarely an acid protease, which is unfavourable to soy-sauce fermentation. A. oryzae 100-8 was obtained by N(+) ion implantation mutagenesis of A. oryzae 3.042, and the protease secretions of these two strains are different. Sequencing the genome of A. oryzae 100-8 and comparing it to the genomes of A. oryzae 100-8 and 3.042 revealed some differences, such as single nucleotide polymorphisms, nucleotide deletion or insertion. Some of these differences may reflect the ability of A. oryzae to secrete proteases. Transcriptional sequencing and analysis of the two strains during the same growth processes provided further insights into the genes and pathways involved in protease secretion.
Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P; Panitz, Frank; Bendixen, Christian; Nielsen, Rasmus; Willerslev, Eske
2007-02-14
The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences). Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis. We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%). Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial analyses, population genetics, and phylogenetics.
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
Code of Federal Regulations, 2011 CFR
2011-07-01
... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
Code of Federal Regulations, 2013 CFR
2013-07-01
... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
Code of Federal Regulations, 2012 CFR
2012-07-01
... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
Code of Federal Regulations, 2010 CFR
2010-07-01
... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
Code of Federal Regulations, 2014 CFR
2014-07-01
... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...
[Genome-scale sequence data processing and epigenetic analysis of DNA methylation].
Wang, Ting-Zhang; Shan, Gao; Xu, Jian-Hong; Xue, Qing-Zhong
2013-06-01
A new approach recently developed for detecting cytosine DNA methylation (mC) and analyzing the genome-scale DNA methylation profiling, is called BS-Seq which is based on bisulfite conversion of genomic DNA combined with next-generation sequencing. The method can not only provide an insight into the difference of genome-scale DNA methylation among different organisms, but also reveal the conservation of DNA methylation in all contexts and nucleotide preference for different genomic regions, including genes, exons, and repetitive DNA sequences. It will be helpful to under-stand the epigenetic impacts of cytosine DNA methylation on the regulation of gene expression and maintaining silence of repetitive sequences, such as transposable elements. In this paper, we introduce the preprocessing steps of DNA methylation data, by which cytosine (C) and guanine (G) in the reference sequence are transferred to thymine (T) and adenine (A), and cytosine in reads is transferred to thymine, respectively. We also comprehensively review the main content of the DNA methylation analysis on the genomic scale: (1) the cytosine methylation under the context of different sequences; (2) the distribution of genomic methylcytosine; (3) DNA methylation context and the preference for the nucleotides; (4) DNA- protein interaction sites of DNA methylation; (5) degree of methylation of cytosine in the different structural elements of genes. DNA methylation analysis technique provides a powerful tool for the epigenome study in human and other species, and genes and environment interaction, and founds the theoretical basis for further development of disease diagnostics and therapeutics in human.
Hu, Beixia; Huang, Yanyan; He, Yefeng; Xu, Chuantian; Lu, Xishan; Zhang, Wei; Meng, Bin; Yan, Shigan; Zhang, Xiumei
2010-07-29
In order to determine the actual prevalence of avian influenza virus (AIV) and Newcastle disease virus (NDV) in ducks in Shandong province of China, extensive surveillance studies were carried out in the breeding ducks of an intensive farm from July 2007 to September 2008. Each month cloacal and tracheal swabs were taken from 30 randomly selected birds that appeared healthy. All of the swabs were negative for influenza A virus recovery, whereas 87.5% of tracheal swabs and 100% cloacal swabs collected in September 2007, were positive for Newcastle disease virus isolation. Several NDV isolates were recovered from tracheal and cloacal swabs of apparently healthy ducks. All of the isolates were apathogenic as determined by the MDT and ICPI. The HN gene and the variable region of F gene (nt 47-420) of four isolates selected at random were sequenced. A 374 bp region of F gene and the full length of HN gene were used for phylogenetic analysis. Four isolates were identified as the same isolate based on nucleotide sequences identities of 99.2-100%, displaying a closer phylogenetic relationship to lentogenic Class I viruses. There were 1.9-9.9% nucleotide differences between the isolates and other Class I virus in the variable region of F gene (nt 47-420), whereas there were 38.5-41.2% nucleotide difference between the isolates and Class II viruses. The amino acid sequences of the F protein cleavage sites in these isolates were 112-ERQERL-117. The full length of HN gene of these isolates was 1851 bp, coding 585 amino acids. The homology analysis of the nucleotide sequence of HN gene indicated that there were 2.0-4.2% nucleotide differences between the isolates and other Class I viruses, whereas there were 29.5-40.9% differences between the isolates and Class II viruses. The results shows that these isolates are not phylogenetically related to the vaccine strain (LaSota). This study adds to the understanding of the ecology of influenza viruses and Newcastle disease viruses in ducks and emphasizes the need for constant surveillance in times of an ongoing and expanding epidemic of AIV and NDV. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Feng, Hao; Conneely, Karen N.; Wu, Hao
2014-01-01
DNA methylation is an important epigenetic modification that has essential roles in cellular processes including gene regulation, development and disease and is widely dysregulated in most types of cancer. Recent advances in sequencing technology have enabled the measurement of DNA methylation at single nucleotide resolution through methods such as whole-genome bisulfite sequencing and reduced representation bisulfite sequencing. In DNA methylation studies, a key task is to identify differences under distinct biological contexts, for example, between tumor and normal tissue. A challenge in sequencing studies is that the number of biological replicates is often limited by the costs of sequencing. The small number of replicates leads to unstable variance estimation, which can reduce accuracy to detect differentially methylated loci (DML). Here we propose a novel statistical method to detect DML when comparing two treatment groups. The sequencing counts are described by a lognormal-beta-binomial hierarchical model, which provides a basis for information sharing across different CpG sites. A Wald test is developed for hypothesis testing at each CpG site. Simulation results show that the proposed method yields improved DML detection compared to existing methods, particularly when the number of replicates is low. The proposed method is implemented in the Bioconductor package DSS. PMID:24561809
Novel avian paramyxovirus (APMV-15) isolated from a migratory bird in South America.
Thomazelli, Luciano Matsumiya; de Araújo, Jansen; Fabrizio, Thomas; Walker, David; Reischak, Dilmara; Ometto, Tatiana; Barbosa, Carla Meneguin; Petry, Maria Virginia; Webby, Richard J; Durigon, Edison Luiz
2017-01-01
A novel avian paramyxovirus (APMV) isolated from a migratory bird cloacal swab obtained during active surveillance in April 2012 in the Lagoa do Peixe National Park, Rio Grande do Sul state, South of Brazil was biologically and genetically characterized. The nucleotide sequence of the full viral genome was completed using a next-generation sequencing approach. The genome was 14,952 nucleotides (nt) long, with six genes (3'-NP-P-M-F-HN-L-5') encoding 7 different proteins, typical of APMV. The fusion (F) protein gene of isolate RS-1177 contained 1,707 nucleotides in a single open reading frame encoding a protein of 569 amino acids. The F protein cleavage site contained two basic amino acids (VPKER↓L), typical of avirulent strains. Phylogenetic analysis of the whole genome indicated that the virus is related to APMV-10, -2 and -8, with 60.1% nucleotide sequence identity to the closest APMV-10 virus, 58.7% and 58.5% identity to the closest APMV-8 and APMV-2 genome, respectively, and less than 52% identity to representatives of the other APMVs groups. Such distances are comparable to the distances observed among other previously identified APMVs serotypes. These results suggest that unclassified/calidris_fuscicollis/Brazil/RS-1177/2012 is the prototype strain of a new APMV serotype, APMV-15.
Biological nanopore MspA for DNA sequencing
NASA Astrophysics Data System (ADS)
Manrao, Elizabeth A.
Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.
NASA Technical Reports Server (NTRS)
Ho, P. S.; Ellison, M. J.; Quigley, G. J.; Rich, A.
1986-01-01
The ease with which a particular DNA segment adopts the left-handed Z-conformation depends largely on the sequence and on the degree of negative supercoiling to which it is subjected. We describe a computer program (Z-hunt) that is designed to search long sequences of naturally occurring DNA and retrieve those nucleotide combinations of up to 24 bp in length which show a strong propensity for Z-DNA formation. Incorporated into Z-hunt is a statistical mechanical model based on empirically determined energetic parameters for the B to Z transition accumulated to date. The Z-forming potential of a sequence is assessed by ranking its behavior as a function of negative superhelicity relative to the behavior of similar sized randomly generated nucleotide sequences assembled from over 80,000 combinations. The program makes it possible to compare directly the Z-forming potential of sequences with different base compositions and different sequence lengths. Using Z-hunt, we have analyzed the DNA sequences of the bacteriophage phi X174, plasmid pBR322, the animal virus SV40 and the replicative form of the eukaryotic adenovirus-2. The results are compared with those previously obtained by others from experiments designed to locate Z-DNA forming regions in these sequences using probes which show specificity for the left-handed DNA conformation.
Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj
2010-01-01
Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.
First report of Beet western yellows virus infecting Epiphyllum spp
USDA-ARS?s Scientific Manuscript database
Beet western yellow virus (BWYV) was identified from an orchid cactus (Epiphyllum spp.) hybrid without obvious symptoms by high-throughput sequencing. The nearly complete genomic sequence of 5,458 nucleotides of the virus was determined. The isolate has the highest nucleotide sequence identity (93%)...
USDA-ARS?s Scientific Manuscript database
Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...
Genotypic relationships between Taenia saginata, Taenia asiatica and their hybrids.
Yamane, Kanako; Yanagida, Tetsuya; Li, Tiaoying; Chen, Xingwang; Dekumyoy, Paron; Waikagul, Jitra; Nkouawa, Agathe; Nakao, Minoru; Sako, Yasuhito; Ito, Akira; Sato, Hiroshi; Okamoto, Munehiro
2013-11-01
Partial sequences of the DNA polymerase delta (pold) gene from Taenia saginata-like adult worms were sequenced. Phylogenetic analysis revealed that pold gene sequences were clearly divided into two clades, differing from each other in five to seven nucleotides. There is little doubt that T. saginata and Taenia asiatica were once separated into two distinct taxa as has been concluded in previous studies. On the other hand, most of the adult worms, which were identified as T. asiatica using mitochondrial DNA, were homozygous for an allele that originated from the allele of T. saginata via single nucleotide substitution. These results indicate that most of the adult worms, which had been called T. asiatica, are not actually 'pure T. asiatica' but instead originated from the hybridization of 'pure T. saginata' and 'pure T. asiatica'.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Funkenstein, B.; Leary, S.L.; Stein, J.C.
1988-03-01
The Gus-s/sup ..cap alpha../ allele of the mouse ..beta..-glucuronidase gene exhibits a high degree of inducibility by androgens due to its linkage with the Gus-r/sup ..cap alpha../ regulatory locus. The authors isolated Gus-s/sup ..cap alpha../ on a 28-kilobase pair fragment of mouse chromosome 5 and found that it contains 12 exons and 11 intervening sequences spanning 14 kilobase pairs of this genomic segment. The mRNA cap site was identified by ribonuclease protection and primer extension analyses which revealed an unusually short 5' noncoding sequence of 12 nucleotides. Proximal regulatory sequences in the 5'-flanking DNA and the complete sequence of themore » Gus-s/sup ..cap alpha../ mRNA transcript were also determined. Comparison of the amino acid sequence determined from the Gus-s/sup ..cap alpha../ nucleotide sequence with that of human ..beta..-glucuronidase indicated that the two human mRNA species differ due to alternate splicing of an exon homologous to exon 6 of the mouse gene.« less
Chelomina, Galina N; Rozhkovan, Konstantin V; Voronova, Anastasia N; Burundukova, Olga L; Muzarok, Tamara I; Zhuravlev, Yuri N
2016-04-01
Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440-640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine.
Chelomina, Galina N.; Rozhkovan, Konstantin V.; Voronova, Anastasia N.; Burundukova, Olga L.; Muzarok, Tamara I.; Zhuravlev, Yuri N.
2015-01-01
Background Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. Methods The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. Results In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440–640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. Conclusion This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine. PMID:27158239
Hepatitis delta genotypes in chronic delta infection in the northeast of Spain (Catalonia).
Cotrina, M; Buti, M; Jardi, R; Quer, J; Rodriguez, F; Pascual, C; Esteban, R; Guardia, J
1998-06-01
Based on genetic analysis of variants obtained around the world, three genotypes of the hepatitis delta virus have been defined. Hepatitis delta virus variants have been associated with different disease patterns and geographic distributions. To determine the prevalence of hepatitis delta virus genotypes in the northeast of Spain (Catalonia) and the correlation with transmission routes and clinical disease, we studied the nucleotide divergence of the consensus sequence of HDV RNA obtained from 33 patients with chronic delta hepatitis (24 were intravenous drug users and nine had no risk factors), and four patients with acute self-limited delta infection. Serum HDV RNA was amplified by the polymerase chain reaction technique and a fragment of 350 nucleotides (nt 910 to 1259) was directly sequenced. Genetic analysis of the nucleotide consensus sequence obtained showed a high degree of conservation among sequences (93% of mean). Comparison of these sequences with those derived from different geographic areas and pertaining to genotypes I, II and III, showed a mean sequence identity of 92% with genotype I, 73% with genotype II and 61% with genotype III. At the amino acid level (aa 115 to 214), the mean identity was 87% with genotype I, 63% with genotype II and 56% with genotype III. Conserved regions included the RNA editing domain, the carboxyl terminal 19 amino acids of the hepatitis delta antigen and the polyadenylation signal of the viral mRNA. Hepatitis delta virus isolates in the northeast of Spain are exclusively genotype I, independently of the transmission route and the type of infection. No hepatitis delta virus subgenotypes were found, suggesting that the origin of hepatitis delta virus infection in our geographical area is homogeneous.
Frésard, Laure; Leroux, Sophie; Roux, Pierre-François; Klopp, Christophe; Fabre, Stéphane; Esquerré, Diane; Dehais, Patrice; Djari, Anis; Gourichon, David; Lagarrigue, Sandrine; Pitel, Frédérique
2015-01-01
RNA editing results in a post-transcriptional nucleotide change in the RNA sequence that creates an alternative nucleotide not present in the DNA sequence. This leads to a diversification of transcription products with potential functional consequences. Two nucleotide substitutions are mainly described in animals, from adenosine to inosine (A-to-I) and from cytidine to uridine (C-to-U). This phenomenon is described in more details in mammals, notably since the availability of next generation sequencing technologies allowing whole genome screening of RNA-DNA differences. The number of studies recording RNA editing in other vertebrates like chicken is still limited. We chose to use high throughput sequencing technologies to search for RNA editing in chicken, and to extend the knowledge of its conservation among vertebrates. We performed sequencing of RNA and DNA from 8 embryos. Being aware of common pitfalls inherent to sequence analyses that lead to false positive discovery, we stringently filtered our datasets and found fewer than 40 reliable candidates. Conservation of particular sites of RNA editing was attested by the presence of 3 edited sites previously detected in mammals. We then characterized editing levels for selected candidates in several tissues and at different time points, from 4.5 days of embryonic development to adults, and observed a clear tissue-specificity and a gradual increase of editing level with time. By characterizing the RNA editing landscape in chicken, our results highlight the extent of evolutionary conservation of this phenomenon within vertebrates, attest to its tissue and stage specificity and provide support of the absence of non A-to-I events from the chicken transcriptome.
Frésard, Laure; Leroux, Sophie; Roux, Pierre-François; Klopp, Christophe; Fabre, Stéphane; Esquerré, Diane; Dehais, Patrice; Djari, Anis; Gourichon, David
2015-01-01
RNA editing results in a post-transcriptional nucleotide change in the RNA sequence that creates an alternative nucleotide not present in the DNA sequence. This leads to a diversification of transcription products with potential functional consequences. Two nucleotide substitutions are mainly described in animals, from adenosine to inosine (A-to-I) and from cytidine to uridine (C-to-U). This phenomenon is described in more details in mammals, notably since the availability of next generation sequencing technologies allowing whole genome screening of RNA-DNA differences. The number of studies recording RNA editing in other vertebrates like chicken is still limited. We chose to use high throughput sequencing technologies to search for RNA editing in chicken, and to extend the knowledge of its conservation among vertebrates. We performed sequencing of RNA and DNA from 8 embryos. Being aware of common pitfalls inherent to sequence analyses that lead to false positive discovery, we stringently filtered our datasets and found fewer than 40 reliable candidates. Conservation of particular sites of RNA editing was attested by the presence of 3 edited sites previously detected in mammals. We then characterized editing levels for selected candidates in several tissues and at different time points, from 4.5 days of embryonic development to adults, and observed a clear tissue-specificity and a gradual increase of editing level with time. By characterizing the RNA editing landscape in chicken, our results highlight the extent of evolutionary conservation of this phenomenon within vertebrates, attest to its tissue and stage specificity and provide support of the absence of non A-to-I events from the chicken transcriptome. PMID:26024316
Zheng, Hongying; Chen, Jiong; Chen, Jianping; Adams, Michael J; Hou, Mingsheng
2002-06-01
Potyvirus isolates from asparagus bean ( Vigna sesquipedalis) plants in Zhejiang province, China, caused either rugose and vein banding mosaic symptoms (isolate R) or severe yellowing (isolate Y) in this host, but were otherwise similar in host range. Both isolates were completely sequenced and shown to be isolates of Bean common mosaic virus (BCMV). The complete sequences were 9992 (R) or 10062 (Y) nucleotides long and shared 91.7% identical nucleotides (93.2% identical amino acids) in their genomes and were more distantly related to the BCMV-Peanut stripe virus sequence (PStV). The isolates were much less similar to one another in the 5'-UTR and the N-terminal region of the P1 protein. In the P1, isolate Y was closer to PStV (76.1% identical amino acids) than to isolate R (64.8%). Phylogenetic analyses of the coat protein region showed that the new isolates grouped with other isolates from Vigna spp., forming the blackeye cowpea mosaic strain subgroup of BCMV with 94-98% nucleotides (96-99% amino acids) identical to one another and about 90% identity to other BCMV isolates. Other significant subgroupings amongst published BCMV isolates were detected.
Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés
2011-10-17
The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.
2011-01-01
Background The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. Results The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. Conclusions These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection. PMID:22004418
Lara-Ramírez, Edgar E.; Salazar, Ma Isabel; López-López, María de Jesús; Salas-Benito, Juan Santiago; Sánchez-Varela, Alejandro
2014-01-01
The increasing number of dengue virus (DENV) genome sequences available allows identifying the contributing factors to DENV evolution. In the present study, the codon usage in serotypes 1–4 (DENV1–4) has been explored for 3047 sequenced genomes using different statistics methods. The correlation analysis of total GC content (GC) with GC content at the three nucleotide positions of codons (GC1, GC2, and GC3) as well as the effective number of codons (ENC, ENCp) versus GC3 plots revealed mutational bias and purifying selection pressures as the major forces influencing the codon usage, but with distinct pressure on specific nucleotide position in the codon. The correspondence analysis (CA) and clustering analysis on relative synonymous codon usage (RSCU) within each serotype showed similar clustering patterns to the phylogenetic analysis of nucleotide sequences for DENV1–4. These clustering patterns are strongly related to the virus geographic origin. The phylogenetic dependence analysis also suggests that stabilizing selection acts on the codon usage bias. Our analysis of a large scale reveals new feature on DENV genomic evolution. PMID:25136631
2011-01-01
The genomic DNA sequence of a novel enteric uncultured microphage, ΦCA82 from a turkey gastrointestinal system was determined utilizing metagenomics techniques. The entire circular, single-stranded nucleotide sequence of the genome was 5,514 nucleotides. The ΦCA82 genome is quite different from other microviruses as indicated by comparisons of nucleotide similarity, predicted protein similarity, and functional classifications. Only three genes showed significant similarity to microviral proteins as determined by local alignments using BLAST analysis. ORF1 encoded a predicted phage F capsid protein that was phylogenetically most similar to the Microviridae ΦMH2K member's major coat protein. The ΦCA82 genome also encoded a predicted minor capsid protein (ORF2) and putative replication initiation protein (ORF3) most similar to the microviral bacteriophage SpV4. The distant evolutionary relationship of ΦCA82 suggests that the divergence of this novel turkey microvirus from other microviruses may reflect unique evolutionary pressures encountered within the turkey gastrointestinal system. PMID:21714899
USDA-ARS?s Scientific Manuscript database
Complete genomic sequences of nine isolates of sweet potato symptomless virus 1 (SPSMV-1), a virus of genus Mastrevirus in the family Geminiviridae, was determined to be 2,559-2,602 nucleotides from sweet potato accessions from different countries. These isolates shared genomic sequence identities o...
Pilloff, Marcela Gabriela; Bilen, Marcos Fabián; Belaich, Mariano Nicolás; Lozano, Mario Enrique; Ghiringhelli, Pablo Daniel
2003-01-01
The gp64 locus of Anticarsia gemmatalis multicapsid nucleopolyhedrovirus isolate Santa Fe (AgMNPV-SF) was characterised molecularly in our laboratory. To this end, we have located and cloned a AgMNPV-SF genomic DNA fragment containing the gp64 gene and sequenced the complete gp64 locus. Nucleotide sequence analysis indicated that the AgMNPV gp64 gene consists of a 1500 nucleotide open reading frame (ORF), encoding a protein of 499 amino acids. Of the seven gp64 homologues identified to date, the AgMNPV gp64 ORF shared most sequence similarity with the gp64 gene of Orgyia pseudotsugata MNPV. The GP64 from AgMNPV is the smallest baculoviral envelope glycoprotein found to date, differing in 10 or more residues from the other group I nucleopolyhedroviruses. The biological activity of AgMNPV GP64 protein was assessed by cell fusion assays in UFL-AG-286 cells using the obtained recombinant plasmids. In the upstream and downstream regions, relative to the gp64 ORF, we found different conserved transcriptional and post-transcriptional regulatory elements, respectively.
Shayan, P; Jafari, S; Fattahi, R; Ebrahimzade, E; Amininia, N; Changizi, E
2016-05-01
Ovine theileriosis is an important hemoprotozoal disease of sheep and goats in tropical and subtropical regions which caused high economic loses in the livestock industry. Theileria annulata surface protein (TaSp) was used previously as a tool for serological analysis in livestock. Since the amino acid sequences of TaSp is, at least, in part very conserved in T. annulata, Theileria lestoquardi and Theileria china I and II, it is very important to determine the amino acid sequence of this protein in Theileria ovis as well, to avoid false interpretation of serological data based on this protein in small animal. In the present study, the nucleotide sequence and amino acid sequence of T. ovis surface protein (ToSp) were determined. The comparison of the nucleotide sequence of ToSp showed 96, 96, 99, and 86 % homology to the corresponding nucleotide sequence of TaSp genes by T. annulata, T. China I, T. China II and T. lestoquardi, previously registered in GenBank under accession nos. AJ316260.1, AY274329.1, DQ120058.1, and EF092924.1 respectively. The amino acid sequence analysis showed 95, 81, 98 and 70 % homology to the corresponding amino acid sequence of T. annulata, T chinaI, T china II and T. lestoquardi, registered in GenBank under accession nos. CAC87478.1, AAP36993.1, AAZ30365.1 and AAP36999.11, respectively. Interestingly, in contrast to the C terminus, a significant difference in amino acid sequence in the N teminus of the ToSp protein could be determined compared to the other known corresponding TaSp sequences, which make this region attractive for designing of a suitable tool for serological diagnosis.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.
Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions
NASA Astrophysics Data System (ADS)
Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.
Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng
2017-07-01
The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.
Shimamoto, I; Sonoda, S; Vazquez, P; Minaka, N; Nishiguchi, M
1998-01-01
The 3' terminal 2378 nucleotides of a wasabi strain of crucifer tobamovirus (CTMV-W) infectious to crucifer plants was determined. This includes the 3' non-coding region of 235 nucleotides, coat protein (CP) gene (468 nucleotides), movement protein (MP) gene (798 nucleotides) and C-terminal partial readthrough portion of 180 K protein gene (940 nucleotides). Comparison of the sequence with homologous regions of thirteen other tobamovirus genomes showed that it had much higher identity to those of four other crucifer tobamoviruses, 85.2% to cr-TMV and turnip vein-clearing virus (TVCV), 87.4% to oilseed rape mosaic virus (ORMV) and 87.1% to TMV-Cg, than to those of other tobamoviruses. Thus CTMV-W was most similar to ORMV and TMV-Cg in sequence, but only marginally so, whereas the location and size of its MP gene was the same as cr-TMV amd TVCV. These results, together with other analyses, show that CTMV-W is a new crucifer tobamovirus, that the five crucifer tobamoviruses can be classified into two subgroups based on MP gene organization, and that the rate of sequence change is not the same in all lineages.
Candida ruelliae sp. nov., a novel yeast species isolated from flowers of Ruellia sp. (Acanthaceae).
Saluja, Puja; Prasad, Gandham S
2008-06-01
Two novel yeast strains designated as 16Q1 and 16Q3 were isolated from flowers of the Ruellia species of the Acanthaceae family. The D1/D2 domain and ITS sequences of these two strains were identical. Sequence analysis of the D1/D2 domain of large-subunit rRNA gene indicated their relationship to species of the Candida haemulonii cluster. However, they differ from C. haemulonii by 14% nucleotide sequence divergence, from Candida pseudohaemulonii by 16.1% and from C. haemulonii type II by 16.5%. These strains also differ in 18 physiological tests from the type strain of C. haemulonii, and 12 and 16 tests, respectively, from C. pseudohaemulonii and C. haemulonii type II. They also differ from C. haemulonii and other related species by more than 13% sequence divergence in the internal transcribed spacer region. In the SSU rRNA gene sequences, strain 16Q1 differs by 1.7% nucleotide divergence from C. haemulonii. Sporulation was not observed in pure or mixed cultures on several media examined. All these data support the assignment of these strains to a novel species; we have named them as Candida ruelliae sp. nov., and designate strain 16Q1(T)=MTCC 7739(T)=CBS10815(T) as type strain of the novel species.
2010-01-01
Bombyx mori and Bombyx mandarina are morphologically and physiologically similar. In this study, we compared the nucleotide variations in the complete mitochondrial (mt) genomes between the domesticated silkmoth, B. mori, and its wild ancestors, Chinese B. mandarina (ChBm) and Japanese B. mandarina (JaBm). The sequence divergence and transition mutation ratio between B. mori and ChBm are significantly smaller than those observed between B. mori and JaBm. The preference of transition by DNA strands between B. mori and ChBm is consistent with that between B. mori and JaBm, however, the regional variation in nucleotide substitution rate shows a different feature. These results suggest that the ChBm mt genome is not undergoing the same evolutionary process as JaBm, providing evidence for selection on mtDNA. Moreover, investigation of the nucleotide sequence divergence in the A+T-rich region of Bombyx mt genomes also provides evidence for the assumption that the A+T-rich region might not be the fastest evolving region of the mtDNA of insects. PMID:21637625
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pallan, Pradeep S.; Marshall, William S.; Harp, Joel
To understand the role of structural elements of RNA pseudoknots in controlling the extent of -1-type ribosomal frameshifting, we determined the crystal structure of a high-efficiency frameshifting mutant of the pseudoknot from potato leaf roll virus (PLRV). Correlations of the structure with available in vitro frameshifting data for PLRV pseudoknot mutants implicate sequence and length of a stem-loop linker as modulators of frameshifting efficiency. Although the sequences and overall structures of the RNA pseudoknots from PLRV and beet western yellow virus (BWYV) are similar, nucleotide deletions in the linker and adjacent minor groove loop abolish frameshifting only with the latter.more » Conversely, mutant PLRV pseudoknots with up to four nucleotides deleted in this region exhibit nearly wild-type frameshifting efficiencies. The crystal structure helps rationalize the different tolerances for deletions in the PLRV and BWYV RNAs, and we have used it to build a three-dimensional model of the PRLV pseudoknot with a four-nucleotide deletion. The resulting structure defines a minimal RNA pseudoknot motif composed of 22 nucleotides capable of stimulating -1-type ribosomal frameshifts.« less
Yadav, Pragya D; Vincent, Martin J; Khristova, Marina; Kale, Charuta; Nichol, Stuart T; Mishra, Akhilesh C; Mourya, Devendra T
2011-07-01
Nairobi sheep disease (NSD) virus, the prototype tick-borne virus of the genus Nairovirus, family Bunyaviridae is associated with acute hemorrhagic gastroenteritis in sheep and goats in East and Central Africa. The closely related Ganjam virus found in India is associated with febrile illness in humans and disease in livestock. The complete S, M and L segment sequences of Ganjam and NSD virus and partial sequence analysis of Ganjam viral RNA genome S, M and L segments encoding regions (396 bp, 701 bp and 425 bp) of the viral nucleocapsid (N), glycoprotein precursor (GPC) and L polymerase (L) proteins, respectively, was carried out for multiple Ganjam virus isolates obtained from 1954 to 2002 and from various regions of India. M segments of NSD and Ganjam virus encode a large ORF for the glycoprotein precursor (GPC), (1627 and 1624 amino acids in length, respectively) and their L segments encode a very large L polymerase (3991 amino acids). The complete S, M and L segments of NSD and Ganjam viruses were more closely related to one another than to other characterized nairoviruses, and no evidence of reassortment was found. However, the NSD and Ganjam virus complete M segment differed by 22.90% and 14.70%, for nucleotide and amino acid respectively, and the complete L segment nucleotide and protein differing by 9.90% and 2.70%, respectively among themselves. Ganjam and NSD virus, complete S segment differed by 9.40-10.40% and 3.2-4.10 for nucleotide and proteins while among Ganjam viruses 0.0-6.20% and 0.0-1.4%, variation was found for nucleotide and amino acids. Ganjam virus isolates differed by up to 17% and 11% at the nucleotide level for the partial S and L gene fragments, respectively, with less variation observed at the deduced amino acid level (10.5 and 2%, S and L, respectively). However, the virus partial M gene fragment (which encodes the hypervariable mucin-like domain) of these viruses differed by as much as 56% at the nucleotide level. Phylogenetic analysis of partial sequence differences suggests considerable mixing and movement of Ganjam virus strains within India, with no clear relationship between genetic lineages and virus geographic origin or year of isolation. Surprisingly, NSD virus does not represent a distinct lineage, but appears as a variant with other Ganjam virus among NSD virus group. Copyright © 2011 Elsevier B.V. All rights reserved.
2014-01-01
Background Plasmodium vivax is a protozoan parasite with an extensive worldwide distribution, being highly prevalent in Asia as well as in Mesoamerica and South America. In southern Mexico, P. vivax transmission has been endemic and recent studies suggest that these parasites have unique biological and genetic features. The msp1 gene has shown high rate of nucleotide substitutions, deletions, insertions, and its mosaic structure reveals frequent events of recombination, maybe between highly divergent parasite isolates. Methods The nucleotide sequence variation in the polymorphic icb5-6 fragment of the msp1 gene of Mexican and worldwide isolates was analysed. To understand how genotype diversity arises, disperses and persists in Mexico, the genetic structure and genealogical relationships of local isolates were examined. To identify new sequence hybrids and their evolutionary relationships with other P. vivax isolates circulating worldwide two haplotype networks were constructed questioning that two portions of the icb5-6 have different evolutionary history. Results Twelve new msp1 icb5-6 haplotypes of P. vivax from Mexico were identified. These nucleotide sequences show mosaic structure comprising three partially conserved and two variable subfragments and resulted into five different sequence types. The variable subfragment sV1 has undergone recombination events and resulted in hybrid sequences and the haplotype network allocated the Mexican haplotypes to three lineages, corresponding to the Sal I and Belem types, and other more divergent group. In contrast, the network from icb5-6 fragment but not sV1 revealed that the Mexican haplotypes belong to two separate lineages, none of which are closely related to Sal I or Belem sequences. Conclusions These results suggest that the new hybrid haplotypes from southern Mexico were the result of at least three different recombination events. These rearrangements likely resulted from the recombination between haplotypes of highly divergent lineages that are frequently distributed in South America and Asia and diversified rapidly. PMID:24472213
Evidence for a Complex Class of Nonadenylated mRNA in Drosophila
Zimmerman, J. Lynn; Fouts, David L.; Manning, Jerry E.
1980-01-01
The amount, by mass, of poly(A+) mRNA present in the polyribosomes of third-instar larvae of Drosophila melanogaster, and the relative contribution of the poly(A+) mRNA to the sequence complexity of total polysomal RNA, has been determined. Selective removal of poly(A+) mRNA from total polysomal RNA by use of either oligo-dT-cellulose, or poly(U)-sepharose affinity chromatography, revealed that only 0.15% of the mass of the polysomal RNA was present as poly(A+) mRNA. The present study shows that this RNA hybridized at saturation with 3.3% of the single-copy DNA in the Drosophila genome. After correction for asymmetric transcription and reactability of the DNA, 7.4% of the single-copy DNA in the Drosophila genome is represented in larval poly(A+) mRNA. This corresponds to 6.73 x 106 nucleotides of mRNA coding sequences, or approximately 5,384 diverse RNA sequences of average size 1,250 nucleotides. However, total polysomal RNA hybridizes at saturation to 10.9% of the single-copy DNA sequences. After correcting this value for asymmetric transcription and tracer DNA reactability, 24% of the single-copy DNA in Drosophila is represented in total polysomal RNA. This corresponds to 2.18 x 107 nucleotides of RNA coding sequences or 17,440 diverse RNA molecules of size 1,250 nucleotides. This value is 3.2 times greater than that observed for poly(A+) mRNA, and indicates that ≃69% of the polysomal RNA sequence complexity is contributed by nonadenylated RNA. Furthermore, if the number of different structural genes represented in total polysomal RNA is ≃1.7 x 104, then the number of genes expressed in third-instar larvae exceeds the number of chromomeres in Drosophila by about a factor of three. This numerology indicates that the number of chromomeres observed in polytene chromosomes does not reflect the number of structural gene sequences in the Drosophila genome. PMID:6777246
Zscheck, K K; Murray, B E
1991-01-01
The nucleotide sequence of the constitutively produced beta-lactamase (Bla) gene from Enterococcus faecalis HH22 was shown to be identical to the published sequences of three of four staphylococcal type A beta-lactamase genes; more differences were seen with the genes for staphylococcal type C and D enzymes. One hundred forty nucleotides upstream of the beta-lactamase start codon were determined for an inducible staphylococcal beta-lactamase and were identical to those of the constitutively expressed enterococcal gene, indicating that the changes resulting in constitutive expression are not due to changes in the promoter or operator region. Moreover, complementation studies indicated that production of the enterococcal enzyme could be repressed. The genes for the enterococcal Bla and an inducible staphylococcal Bla were each cloned into a shuttle vector and transformed into enterococcal and staphylococcal recipients. The major difference between the backgrounds of the two hosts was that more enzyme was produced by the staphylococcal host, regardless of the source of the gene. The location of the enzyme was found to be host dependent, since each cloned gene generated extracellular (free) enzyme in the staphylococcus and cell-bound enzyme in the enterococcus. On the basis of the identities of the enterococcal Bla and several staphylococcal Bla sequences, these data suggest the recent spread of beta-lactamase to enterococci and also suggest the loss of a functional repressor. PMID:1952840
Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus
2013-01-01
Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered – 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had “no hits found”, 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. Conclusions High-quality EST-SNPs from different citrus genotypes were detected, and compared to estimate the heterozygosity of each genome. All the SNP oligo sequences were aligned with the Clementine citrus genome to determine their distribution and uniqueness and for in silico validation, in addition to SNaPshot and sequencing validation of selected SNPs. PMID:24175923
Optimization of sequence alignment for simple sequence repeat regions.
Jighly, Abdulqader; Hamwieh, Aladdin; Ogbonnaya, Francis C
2011-07-20
Microsatellites, or simple sequence repeats (SSRs), are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs) mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs).SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type.When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic phylogenic relationship.
Loconsole, Giuliana; Onelge, Nuket; Yokomi, Raymond K; Kubaa, Raied Abou; Savino, Vito; Saponari, Maria
2013-01-01
The RNA genome of pathogenic and non-pathogenic variants of citrus Hop stunt viroid (HSVd) differ by five to six nucleotides located within the variable (V) domain referred to as the "cachexia expression motif". Sensitive hosts such as mandarin and its hybrids are seriously affected by cachexia disease. Current methods to differentiate HSVd variants rely on lengthy greenhouse biological indexing on Parson's Special mandarin and/or direct nucleotide sequence analysis of amplicons from RT-PCR of HSVd-infected plants. Two independent high throughput assays to segregate HSVd variants by real-time RT-PCR and High-Resolution Melting Temperature (HRM) analysis were developed: one based on EVAGreen dye; the other based on TaqMan probes. Primers for both assays targeted three differentiating nucleotides in the V domain which separated HSVd variants into three clusters by distinct melting temperatures with a confidence level higher than 98%. The accuracy of the HRM assays were validated by nucleotide sequencing of representative samples within each HRM cluster and by testing 45 HSVd-infected field trees from California, Italy, Spain, Syria and Turkey. To our knowledge, this is the first report of a rapid and sensitive approach to detect and differentiate HSVd variants associated with different biological behaviors. Although, HSVd is found in several crops including citrus, cachexia variants are restricted to some citrus-growing areas, particularly the Mediterranean Region. Rapid diagnosis for cachexia and non-cachexia variants is, thus, important for the management of HSVd in citrus and reduces the need for bioindexing and sequencing analysis. Copyright © 2013 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Mackiewicz, P.; Gierlik, A.; Kowalczuk, M.; Szczepanik, D.; Dudek, M. R.; Cebrat, S.
1999-12-01
We have analysed protein coding and intergenic sequences in the Borrelia burgdorferi (the Lyme disease bacterium) genome using different kinds of DNA walks. Genes occupying the leading strand of DNA have significantly different nucleotide composition from genes occupying the lagging strand. Nucleotide compositional bias of the two DNA strands reflects the aminoacid composition of proteins. 96% of genes coding for ribosomal proteins lie on the leading DNA strand, which suggests that the positions of these as well as other genes are non-random. In the B. burgdorferi genome, the asymmetry in intergenic DNA sequences is lower than the asymmetry in the third positions in codons. All these characters of the B. burgdorferi genome suggest that both replication-associated mutational pressure and recombination mechanisms have established the specific structure of the genome and now any recombination leading to inversion of a gene in respect to the direction of replication is forbidden. This property of the genome allows us to assume that it is in a steady state, which enables us to fix some parameters for simulations of DNA evolution.
Seal, B S; Neill, J D; Ridpath, J F
1994-07-01
Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.
Li, Yunlang; Schlick, Tamar
2013-01-01
Incorporating the cognate instead of non-cognate substrates is crucial for DNA polymerase function. Here we analyze molecular dynamics simulations of DNA polymerase μ (pol μ) bound to different non-cognate incoming nucleotides including A:dCTP, A:dGTP, A(syn):dGTP, A:dATP, A(syn):dATP, T:dCTP, and T:dGTP to study the structure-function relationships involved with aberrant base pairs in the conformational pathway; while a pol μ complex with the A:dTTP base pair is available, no solved non-cognate structures are available. We observe distinct differences of the non-cognate systems compared to the cognate system. Specifically, the motions of active-site residue His329 and Asp330 distort the active site, and Trp436, Gln440, Glu443 and Arg444 tend to tighten the nucleotide-binding pocket when non-cognate nucleotides are bound; the latter effect may further lead to an altered electrostatic potential within the active site. That most of these “gate-keeper” residues are located farther apart from the upstream primer in pol μ, compared to other X family members, also suggests an interesting relation to pol μ's ability to incorporate nucleotides when the upstream primer is not paired. By examining the correlated motions within pol μ complexes, we also observe different patterns of correlations between non-cognate systems and the cognate system, especially decreased interactions between the incoming nucleotides and the nucleotide-binding pocket. Altered correlated motions in non-cognate systems agree with our recently proposed hybrid conformational selection/induced-fit models. Taken together, our studies propose the following order for difficulty of non-cognate system insertions by pol μ: T:dGTP
Polanski, A; Kimmel, M; Chakraborty, R
1998-05-12
Distribution of pairwise differences of nucleotides from data on a sample of DNA sequences from a given segment of the genome has been used in the past to draw inferences about the past history of population size changes. However, all earlier methods assume a given model of population size changes (such as sudden expansion), parameters of which (e.g., time and amplitude of expansion) are fitted to the observed distributions of nucleotide differences among pairwise comparisons of all DNA sequences in the sample. Our theory indicates that for any time-dependent population size, N(tau) (in which time tau is counted backward from present), a time-dependent coalescence process yields the distribution, p(tau), of the time of coalescence between two DNA sequences randomly drawn from the population. Prediction of p(tau) and N(tau) requires the use of a reverse Laplace transform known to be unstable. Nevertheless, simulated data obtained from three models of monotone population change (stepwise, exponential, and logistic) indicate that the pattern of a past population size change leaves its signature on the pattern of DNA polymorphism. Application of the theory to the published mtDNA sequences indicates that the current mtDNA sequence variation is not inconsistent with a logistic growth of the human population.
Takahashi, Mayumi; Wu, Xiwei; Ho, Michelle; Chomchan, Pritsana; Rossi, John J; Burnett, John C; Zhou, Jiehua
2016-09-22
The systemic evolution of ligands by exponential enrichment (SELEX) technique is a powerful and effective aptamer-selection procedure. However, modifications to the process can dramatically improve selection efficiency and aptamer performance. For example, droplet digital PCR (ddPCR) has been recently incorporated into SELEX selection protocols to putatively reduce the propagation of byproducts and avoid selection bias that result from differences in PCR efficiency of sequences within the random library. However, a detailed, parallel comparison of the efficacy of conventional solution PCR versus the ddPCR modification in the RNA aptamer-selection process is needed to understand effects on overall SELEX performance. In the present study, we took advantage of powerful high throughput sequencing technology and bioinformatics analysis coupled with SELEX (HT-SELEX) to thoroughly investigate the effects of initial library and PCR methods in the RNA aptamer identification. Our analysis revealed that distinct "biased sequences" and nucleotide composition existed in the initial, unselected libraries purchased from two different manufacturers and that the fate of the "biased sequences" was target-dependent during selection. Our comparison of solution PCR- and ddPCR-driven HT-SELEX demonstrated that PCR method affected not only the nucleotide composition of the enriched sequences, but also the overall SELEX efficiency and aptamer efficacy.
Mapping copy number variation by population-scale genome sequencing.
Mills, Ryan E; Walter, Klaudia; Stewart, Chip; Handsaker, Robert E; Chen, Ken; Alkan, Can; Abyzov, Alexej; Yoon, Seungtai Chris; Ye, Kai; Cheetham, R Keira; Chinwalla, Asif; Conrad, Donald F; Fu, Yutao; Grubert, Fabian; Hajirasouliha, Iman; Hormozdiari, Fereydoun; Iakoucheva, Lilia M; Iqbal, Zamin; Kang, Shuli; Kidd, Jeffrey M; Konkel, Miriam K; Korn, Joshua; Khurana, Ekta; Kural, Deniz; Lam, Hugo Y K; Leng, Jing; Li, Ruiqiang; Li, Yingrui; Lin, Chang-Yun; Luo, Ruibang; Mu, Xinmeng Jasmine; Nemesh, James; Peckham, Heather E; Rausch, Tobias; Scally, Aylwyn; Shi, Xinghua; Stromberg, Michael P; Stütz, Adrian M; Urban, Alexander Eckehart; Walker, Jerilyn A; Wu, Jiantao; Zhang, Yujun; Zhang, Zhengdong D; Batzer, Mark A; Ding, Li; Marth, Gabor T; McVean, Gil; Sebat, Jonathan; Snyder, Michael; Wang, Jun; Ye, Kenny; Eichler, Evan E; Gerstein, Mark B; Hurles, Matthew E; Lee, Charles; McCarroll, Steven A; Korbel, Jan O
2011-02-03
Genomic structural variants (SVs) are abundant in humans, differing from other forms of variation in extent, origin and functional impact. Despite progress in SV characterization, the nucleotide resolution architecture of most SVs remains unknown. We constructed a map of unbalanced SVs (that is, copy number variants) based on whole genome DNA sequencing data from 185 human genomes, integrating evidence from complementary SV discovery approaches with extensive experimental validations. Our map encompassed 22,025 deletions and 6,000 additional SVs, including insertions and tandem duplications. Most SVs (53%) were mapped to nucleotide resolution, which facilitated analysing their origin and functional impact. We examined numerous whole and partial gene deletions with a genotyping approach and observed a depletion of gene disruptions amongst high frequency deletions. Furthermore, we observed differences in the size spectra of SVs originating from distinct formation mechanisms, and constructed a map of SV hotspots formed by common mechanisms. Our analytical framework and SV map serves as a resource for sequencing-based association studies.
Comparison and correlation of Simple Sequence Repeats distribution in genomes of Brucella species
Kiran, Jangampalli Adi Pradeep; Chakravarthi, Veeraraghavulu Praveen; Kumar, Yellapu Nanda; Rekha, Somesula Swapna; Kruti, Srinivasan Shanthi; Bhaskar, Matcha
2011-01-01
Computational genomics is one of the important tools to understand the distribution of closely related genomes including simple sequence repeats (SSRs) in an organism, which gives valuable information regarding genetic variations. The central objective of the present study was to screen the SSRs distributed in coding and non-coding regions among different human Brucella species which are involved in a range of pathological disorders. Computational analysis of the SSRs in the Brucella indicates few deviations from expected random models. Statistical analysis also reveals that tri-nucleotide SSRs are overrepresented and tetranucleotide SSRs underrepresented in Brucella genomes. From the data, it can be suggested that over expressed tri-nucleotide SSRs in genomic and coding regions might be responsible in the generation of functional variation of proteins expressed which in turn may lead to different pathogenicity, virulence determinants, stress response genes, transcription regulators and host adaptation proteins of Brucella genomes. Abbreviations SSRs - Simple Sequence Repeats, ORFs - Open Reading Frames. PMID:21738309
Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi
2016-01-01
Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870
Buhler, Stéphane; Sanchez-Mazas, Alicia
2011-01-01
Molecular differences between HLA alleles vary up to 57 nucleotides within the peptide binding coding region of human Major Histocompatibility Complex (MHC) genes, but it is still unclear whether this variation results from a stochastic process or from selective constraints related to functional differences among HLA molecules. Although HLA alleles are generally treated as equidistant molecular units in population genetic studies, DNA sequence diversity among populations is also crucial to interpret the observed HLA polymorphism. In this study, we used a large dataset of 2,062 DNA sequences defined for the different HLA alleles to analyze nucleotide diversity of seven HLA genes in 23,500 individuals of about 200 populations spread worldwide. We first analyzed the HLA molecular structure and diversity of these populations in relation to geographic variation and we further investigated possible departures from selective neutrality through Tajima's tests and mismatch distributions. All results were compared to those obtained by classical approaches applied to HLA allele frequencies. Our study shows that the global patterns of HLA nucleotide diversity among populations are significantly correlated to geography, although in some specific cases the molecular information reveals unexpected genetic relationships. At all loci except HLA-DPB1, populations have accumulated a high proportion of very divergent alleles, suggesting an advantage of heterozygotes expressing molecularly distant HLA molecules (asymmetric overdominant selection model). However, both different intensities of selection and unequal levels of gene conversion may explain the heterogeneous mismatch distributions observed among the loci. Also, distinctive patterns of sequence divergence observed at the HLA-DPB1 locus suggest current neutrality but old selective pressures on this gene. We conclude that HLA DNA sequences advantageously complement HLA allele frequencies as a source of data used to explore the genetic history of human populations, and that their analysis allows a more thorough investigation of human MHC molecular evolution. PMID:21408106
Porcine insulin receptor substrate 4 (IRS4) gene: cloning, polymorphism and association study
USDA-ARS?s Scientific Manuscript database
Using PCR and IPCR techniques we obtained a 4498 bp nucleotide sequence FN424076 encompassing the complete coding sequence of the porcine IRS4 gene and its proximal promoter. The 1269-amino acid porcine protein deduced from the nucleotide sequence shares 92% identity with the human IRS4 and possesse...
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Cutillas, C; Oliveros, R; de Rojas, M; Guevara, D C
2004-06-01
Adults of Trichuris skrjahini have been isolated from the cecum of caprine hosts (Capra hircus), Trichuris ovis and Trichuris globulosa from Ovis aries (sheep) and C. hircus (goats), and Trichuris leporis from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and the ITS1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced by polymerase chain reaction (PCR) techniques. The ITS1 of T. skrjabini, T. ovis, T. globulosa, and T. leporis was 495, 757, 757, and 536 nucleotides in length, respectively, and had G + C contents of 59.6, 58.7, 58.7, and 60.8%, respectively. Intraindividual variation was detected in the ITSI sequences of the 4 species. Furthermore, the 5.8S sequences of T. skrjabini, T. ovis, T. globulosa, and T. leporis were compared. A total of 157, 152, 153, and 157 nucleotides in length was observed in the 5.8S sequences of these 4 species, respectively. There were no sequence differences of ITS1 and 5.8S products between T. ovis and T. globulosa. Nevertheless, clear differences were detected between the ITS1 sequences of T. skrjabini, T. ovis, T. leporis, Trichuris muris, and T. arvicolae. The ITS2 fragment from the rDNA of T. skrjabini was sequenced. A comparative study of the ITS2 sequence of T. skrjabini with the previously published ITS2 sequence data of T. ovis, T. leporis, T. muris, and T. arvicolae suggested that the combined use of sequence data from both spacers would be useful in the molecular characterization of trichurid parasites.
Amexis, Georgios; Rubin, Steven; Chatterjee, Nando; Carbone, Kathryn; Chumakov, Kostantin
2003-06-01
A single clinical isolate of mumps virus designated 88-1961 was obtained from a patient hospitalized with a clinical history of upper respiratory tract infection, parotitis, severe headache, fever and lymphadenopathy. We have sequenced the full-length genome of 88-1961 and compared it against all available full-length sequences of mumps virus. Based upon its nucleotide sequence of the SH gene 88-1961 was identified as a genotype H mumps strain. The overall extent of nucleotide and amino acid differences between each individual gene and protein of 88-1961 and the full-length mumps samples showed that the missense to silent ratios were unevenly distributed. Upon evaluation of the consensus sequence of 88-1961, four positions were found to be clearly heterogeneous at the nucleotide level (NP 315C/T, NP 318C/T, F 271A/C, and HN 855C/T). Sequence analysis revealed that the amino acid sequences for the NP, M, and the L protein were the most conserved, whereas the SH protein exhibited the highest variability among the compared mumps genotypes A, B, and G. No identifying molecular patterns in the non-coding (intergenic) or coding regions of 88-1961 were found when we compared it against relatively virulent (Urabe AM9 B, Glouc1/UK96, 87-1004 and 87-1005) and non-virulent mumps strains (Jeryl Lynn and all Urabe Am9 A substrains). Copyright 2003 Wiley-Liss, Inc.
Hwang, Dae-Sik; Ki, Jang-Seu; Jeong, Dong-Hyuk; Kim, Bo-Hyun; Lee, Bae-Keun; Han, Sang-Hoon; Lee, Jae-Seong
2008-08-01
In the present paper, we describe the mitochondrial genome sequence of the Asiatic black bear (Ursus thibetanus ussuricus) with particular emphasis on the control region (CR), and compared with mitochondrial genomes on molecular relationships among the bears. The mitochondrial genome sequence of U. thibetanus ussuricus was 16,700 bp in size with mostly conserved structures (e.g. 13 protein-coding, two rRNA genes, 22 tRNA genes). The CR consisted of several typical conserved domains such as F, E, D, and C boxes, and a conserved sequence block. Nucleotide sequences and the repeated motifs in the CR were different among the bear species, and their copy numbers were also variable according to populations, even within F1 generations of U. thibetanus ussuricus. Comparative analyses showed that the CR D1 region was highly informative for the discrimination of the bear family. These findings suggest that nucleotide sequences of both repeated motifs and CR D1 in the bear family are good markers for species discriminations.
Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.
1998-01-01
Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304
He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang
2015-01-01
Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
[Molecular epidemiological analysis of rubella virus isolates from 2001 to 2011 in Shanghai, China].
Li, Chong-Shan; Yang, Yu-Ying; Wang, Jian-Guo; Zhu, Zhen; Tang, Wei; Li, Zhi; Sun, Xiao-Dong; Xu, Wen-Bo
2012-03-01
Throat swabs collected from patients whose serum was measles IgM negative and rubella IgM positive during 2001-2011 were used to conduct cell culture for rubella virus. After identification of cell culture with RT-PCR, nucleotide of gene E1 of rubella virus was amplified and sequenced, followed by molecular epidemiological analysis. A total of 31 rubella viruses were isolated from 60 throat swabs. Compared 27 isolates with the WHO reference strains of all genotypes, phylogenetic tree was constructed based on the amplified 739 nucleotide fragment. These isolates belonged to two different genotypes respectively. Isolates 11009, 11052 and 11106 in 2011 belonged to genotype 2B, and others belonged to genotype 1E. Most of mutations were nonsense mutation, and sequence of amino acid was highly conserved. Amino acid sequence of most isolates of genotype 1E was identical, which suggested rubella viruses from same transmission chain might be transmitted continually since 2001. Rubella virus genotype 2B was found to be popular for the first time in Shanghai in 2011. The nucleotide sequences of these genotype 2B isolates showed 99% identity compared with that of isolates recently from Vietnam, Japan and Argentina. The resources of these strains were not confirmed due to the absence of rubella virus surveillance before.
Beltrán-Valero de Bernabé, D; Jimenez, F J; Aquaron, R; Rodríguez de Córdoba, S
1999-01-01
We recently showed that alkaptonuria (AKU) is caused by loss-of-function mutations in the homogentisate 1,2 dioxygenase gene (HGO). Herein we describe haplotype and mutational analyses of HGO in seven new AKU pedigrees. These analyses identified two novel single-nucleotide polymorphisms (INV4+31A-->G and INV11+18A-->G) and six novel AKU mutations (INV1-1G-->A, W60G, Y62C, A122D, P230T, and D291E), which further illustrates the remarkable allelic heterogeneity found in AKU. Reexamination of all 29 mutations and polymorphisms thus far described in HGO shows that these nucleotide changes are not randomly distributed; the CCC sequence motif and its inverted complement, GGG, are preferentially mutated. These analyses also demonstrated that the nucleotide substitutions in HGO do not involve CpG dinucleotides, which illustrates important differences between HGO and other genes for the occurrence of mutation at specific short-sequence motifs. Because the CCC sequence motifs comprise a significant proportion (34.5%) of all mutated bases that have been observed in HGO, we conclude that the CCC triplet is a mutational hot spot in HGO. PMID:10205262
Koike-Takeshita, A; Koyama, T; Obata, S; Ogura, K
1995-08-04
The genes encoding two dissociable components essential for Bacillus stearothermophilus heptaprenyl diphosphate synthase (all-trans-hexparenyl-diphosphate:isopentenyl-diphosphate hexaprenyl-trans-transferase, EC 2.5.1.30) were cloned, and their nucleotide sequences were determined. Sequence analyses revealed the presence of three open reading frames within 2,350 base pairs, designated as ORF-1, ORF-2, and ORF-3 in order of nucleotide sequence, which encode proteins of 220, 234, and 323 amino acids, respectively. Deletion experiments have shown that expression of the enzymatic activity requires the presence of ORF-1 and ORF-3, but ORF-2 is not essential. As a result, this enzyme was proved genetically to consist of two different protein compounds with molecular masses of 25 kDa (Component I) and 36 kDa (Component II), encoded by two of the three tandem genes. The protein encoded by ORF-1 has no similarity to any protein so far registered. However, the protein encoded by ORF-3 shows a 32% similarity to the farnesyl diphosphate synthase of the same bacterium and has seven highly conserved regions that have been shown typical in prenyltransferases (Koyama, T., Obata, S., Osabe, M., Takeshita, A., Yokoyama, K., Uchida, M., Nishino, T., and Ogura, K. (1993) J. Biochem. (Tokyo) 113, 355-363).
Detection of a divergent variant of grapevine virus F by next-generation sequencing.
Molenaar, Nicholas; Burger, Johan T; Maree, Hans J
2015-08-01
The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).
The complete nucleotide sequence of the domestic dog (Canis familiaris) mitochondrial genome.
Kim, K S; Lee, S E; Jeong, H W; Ha, J H
1998-10-01
The complete nucleotide sequence of the mitochondrial genome of the domestic dog, Canis familiaris, was determined. The length of the sequence was 16,728 bp; however, the length was not absolute due to the variation (heteroplasmy) caused by differing numbers of the repetitive motif, 5'-GTACACGT(A/G)C-3', in the control region. The genome organization, gene contents, and codon usage conformed to those of other mammalian mitochondrial genomes. Although its features were unknown, the "CTAGA" duplication event which followed the translational stop codon of the COII gene was not observed in other mammalian mitochondrial genomes. In order to determine the possible differences between mtDNAs in carnivores, two rRNA and 13 protein-coding genes from the cat, dog, and seal were compared. The combined molecular differences, in two rRNA genes as well as in the inferred amino acid sequences of the mitochondrial 13 protein-coding genes, suggested that there is a closer relationship between the dog and the seal than there is between either of these species and the cat. Based on the molecular differences of the mtDNA, the evolutionary divergence between the cat, the dog, and the seal was dated to approximately 50 +/- 4 million years ago. The degree of difference between carnivore mtDNAs varied according to the individual protein-coding gene applied, showing that the evolutionary relationships of distantly related species should be presented in an extended study based on ample sequence data like complete mtDNA molecules. Copyright 1998 Academic Press.
Uncovering drug-responsive regulatory elements
Luizon, Marcelo R; Ahituv, Nadav
2015-01-01
Nucleotide changes in gene regulatory elements can have a major effect on interindividual differences in drug response. For example, by reviewing all published pharmacogenomic genome-wide association studies, we show here that 96.4% of the associated single nucleotide polymorphisms reside in noncoding regions. We discuss how sequencing technologies are improving our ability to identify drug response-associated regulatory elements genome-wide and to annotate nucleotide variants within them. We highlight specific examples of how nucleotide changes in these elements can affect drug response and illustrate the techniques used to find them and functionally characterize them. Finally, we also discuss challenges in the field of drug-responsive regulatory elements that need to be considered in order to translate these findings into the clinic. PMID:26555224
USDA-ARS?s Scientific Manuscript database
Copy number variants (CNV) are large scale duplications or deletions of genomic sequence that are caused by a diverse set of molecular phenomena that are distinct from single nucleotide polymorphism (SNP) formation. Due to their different mechanisms of formation, CNVs are often difficult to track us...
2012-01-01
The increasing size and complexity of exome/genome sequencing data requires new tools for clinical geneticists to discover disease-causing variants. Bottlenecks in identifying the causative variation include poor cross-sample querying, constantly changing functional annotation and not considering existing knowledge concerning the phenotype. We describe a methodology that facilitates exploration of patient sequencing data towards identification of causal variants under different genetic hypotheses. Annotate-it facilitates handling, analysis and interpretation of high-throughput single nucleotide variant data. We demonstrate our strategy using three case studies. Annotate-it is freely available and test data are accessible to all users at http://www.annotate-it.org. PMID:23013645
Fluorescent signatures for variable DNA sequences
Rice, John E.; Reis, Arthur H.; Rice, Lisa M.; Carver-Brown, Rachel K.; Wangh, Lawrence J.
2012-01-01
Life abounds with genetic variations writ in sequences that are often only a few hundred nucleotides long. Rapid detection of these variations for identification of genetic diseases, pathogens and organisms has become the mainstay of molecular science and medicine. This report describes a new, highly informative closed-tube polymerase chain reaction (PCR) strategy for analysis of both known and unknown sequence variations. It combines efficient quantitative amplification of single-stranded DNA targets through LATE-PCR with sets of Lights-On/Lights-Off probes that hybridize to their target sequences over a broad temperature range. Contiguous pairs of Lights-On/Lights-Off probes of the same fluorescent color are used to scan hundreds of nucleotides for the presence of mutations. Sets of probes in different colors can be combined in the same tube to analyze even longer single-stranded targets. Each set of hybridized Lights-On/Lights-Off probes generates a composite fluorescent contour, which is mathematically converted to a sequence-specific fluorescent signature. The versatility and broad utility of this new technology is illustrated in this report by characterization of variant sequences in three different DNA targets: the rpoB gene of Mycobacterium tuberculosis, a sequence in the mitochondrial cytochrome C oxidase subunit 1 gene of nematodes and the V3 hypervariable region of the bacterial 16 s ribosomal RNA gene. We anticipate widespread use of these technologies for diagnostics, species identification and basic research. PMID:22879378
Chen, Qingyu; Zobel, Justin; Verspoor, Karin
2017-01-01
GenBank, the EMBL European Nucleotide Archive and the DNA DataBank of Japan, known collectively as the International Nucleotide Sequence Database Collaboration or INSDC, are the three most significant nucleotide sequence databases. Their records are derived from laboratory work undertaken by different individuals, by different teams, with a range of technologies and assumptions and over a period of decades. As a consequence, they contain a great many duplicates, redundancies and inconsistencies, but neither the prevalence nor the characteristics of various types of duplicates have been rigorously assessed. Existing duplicate detection methods in bioinformatics only address specific duplicate types, with inconsistent assumptions; and the impact of duplicates in bioinformatics databases has not been carefully assessed, making it difficult to judge the value of such methods. Our goal is to assess the scale, kinds and impact of duplicates in bioinformatics databases, through a retrospective analysis of merged groups in INSDC databases. Our outcomes are threefold: (1) We analyse a benchmark dataset consisting of duplicates manually identified in INSDC-a dataset of 67 888 merged groups with 111 823 duplicate pairs across 21 organisms from INSDC databases - in terms of the prevalence, types and impacts of duplicates. (2) We categorize duplicates at both sequence and annotation level, with supporting quantitative statistics, showing that different organisms have different prevalence of distinct kinds of duplicate. (3) We show that the presence of duplicates has practical impact via a simple case study on duplicates, in terms of GC content and melting temperature. We demonstrate that duplicates not only introduce redundancy, but can lead to inconsistent results for certain tasks. Our findings lead to a better understanding of the problem of duplication in biological databases.Database URL: the merged records are available at https://cloudstor.aarnet.edu.au/plus/index.php/s/Xef2fvsebBEAv9w. © The Author(s) 2017. Published by Oxford University Press.
Chen, Qingyu; Zobel, Justin; Verspoor, Karin
2017-01-01
GenBank, the EMBL European Nucleotide Archive and the DNA DataBank of Japan, known collectively as the International Nucleotide Sequence Database Collaboration or INSDC, are the three most significant nucleotide sequence databases. Their records are derived from laboratory work undertaken by different individuals, by different teams, with a range of technologies and assumptions and over a period of decades. As a consequence, they contain a great many duplicates, redundancies and inconsistencies, but neither the prevalence nor the characteristics of various types of duplicates have been rigorously assessed. Existing duplicate detection methods in bioinformatics only address specific duplicate types, with inconsistent assumptions; and the impact of duplicates in bioinformatics databases has not been carefully assessed, making it difficult to judge the value of such methods. Our goal is to assess the scale, kinds and impact of duplicates in bioinformatics databases, through a retrospective analysis of merged groups in INSDC databases. Our outcomes are threefold: (1) We analyse a benchmark dataset consisting of duplicates manually identified in INSDC—a dataset of 67 888 merged groups with 111 823 duplicate pairs across 21 organisms from INSDC databases – in terms of the prevalence, types and impacts of duplicates. (2) We categorize duplicates at both sequence and annotation level, with supporting quantitative statistics, showing that different organisms have different prevalence of distinct kinds of duplicate. (3) We show that the presence of duplicates has practical impact via a simple case study on duplicates, in terms of GC content and melting temperature. We demonstrate that duplicates not only introduce redundancy, but can lead to inconsistent results for certain tasks. Our findings lead to a better understanding of the problem of duplication in biological databases. Database URL: the merged records are available at https://cloudstor.aarnet.edu.au/plus/index.php/s/Xef2fvsebBEAv9w PMID:28077566
Nucleotide sequence composition and method for detection of neisseria gonorrhoeae
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lo, A.; Yang, H.L.
1990-02-13
This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.
Desai, Prerak T.; den Bakker, Henk C.; Mikoleit, Matthew; Tolar, Beth; Trees, Eija; Hendriksen, Rene S.; Frye, Jonathan G.; Porwollik, Steffen; Weimer, Bart C.; Wiedmann, Martin; Weinstock, George M.; Fields, Patricia I.; McClelland, Michael
2014-01-01
Salmonella enterica serotype Enteritidis is one of the most commonly reported causes of human salmonellosis. Its low genetic diversity, measured by fingerprinting methods, has made subtyping a challenge. We used whole-genome sequencing to characterize 125 S. enterica Enteritidis and 3 S. enterica serotype Nitra strains. Single-nucleotide polymorphisms were filtered to identify 4,887 reliable loci that distinguished all isolates from each other. Our whole-genome single-nucleotide polymorphism typing approach was robust for S. enterica Enteritidis subtyping with combined data for different strains from 2 different sequencing platforms. Five major genetic lineages were recognized, which revealed possible patterns of geographic and epidemiologic distribution. Analyses on the population dynamics and evolutionary history estimated that major lineages emerged during the 17th–18th centuries and diversified during the 1920s and 1950s. PMID:25147968
Sampson, Juliana K.; Sheth, Nihar U.; Koparde, Vishal N.; Scalora, Allison F.; Serrano, Myrna G.; Lee, Vladimir; Roberts, Catherine H.; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H.; Buck, Gregory A.; Neale, Michael C.; Toor, Amir A.
2016-01-01
Summary Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. PMID:24749631
Hori, H; Osawa, S; Takaiwa, F; Sugiura, M
1984-01-01
The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the Bryophyta species (88% identity on average) than to those of seed plants (84% identity on average). PMID:6538332
Energy efficiency trade-offs drive nucleotide usage in transcribed regions
Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.
2016-01-01
Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217
Gritsun, T S; Venugopal, K; Zanotto, P M; Mikhailov, M V; Sall, A A; Holmes, E C; Polkinghorne, I; Frolova, T V; Pogodina, V V; Lashkevich, V A; Gould, E A
1997-05-01
The complete nucleotide sequence of two tick-transmitted flaviviruses, Vasilchenko (Vs) from Siberia and louping ill (LI) from the UK, have been determined. The genomes were respectively, 10928 and 10871 nucleotides (nt) in length. The coding strategy and functional protein sequence motifs of tick-borne flaviviruses are presented in both Vs and LI viruses. The phylogenies based on maximum likelihood, maximum parsimony and distance analysis of the polyproteins, identified Vs virus as a member of the tick-borne encephalitis virus subgroup within the tick-borne serocomplex, genus Flavivirus, family Flaviviridae. Comparative alignment of the 3'-untranslated regions revealed deletions of different lengths essentially at the same position downstream of the stop codon for all tick-borne viruses. Two direct 27 nucleotide repeats at the 3'-end were found only for Vs and LI virus. Immediately following the deletions a region of 332-334 nt with relatively conserved primary structure (67-94% identity) was observed at the 3'-non-coding end of the virus genome. Pairwise comparisons of the nucleotide sequence data revealed similar levels of variation between the coding region, and the 5' and 3'-termini of the genome, implying an equivalent strong selective control for translated and untranslated regions. Indeed the predicted folding of the 5' and 3'-untranslated regions revealed patterns of stem and loop structures conserved for all tick-borne flaviviruses suggesting a purifying selection for preservation of essential RNA secondary structures which could be involved in translational control and replication. The possible implications of these findings are discussed.
Characterization of sams genes of Amoeba proteus and the endosymbiotic X-bacteria.
Jeon, Taeck J; Jeon, Kwang W
2003-01-01
As a result of harboring obligatory bacterial endosymbionts, the xD strain of Amoeba proteus no longer produces its own S-adenosylmethionine synthetase (SAMS). When symbiont-free D amoebae are infected with symbionts (X-bacteria), the amount of amoeba SAMS decreases to a negligible level within four weeks, but about 47% of the SAMS activity, which apparently comes from another source, is still detected. Complete nucleotide sequences of sams genes of D and xD amoebae are presented and show that there are no differences between the two. Long-established xD amoebae contain an intact sams gene and thus the loss of xD amoeba's SAMS is not due to the loss of the gene itself. The open reading frame of the amoeba's sams gene has 1,281 nucleotides, encoding SAMS of 426 amino acids with a mass of 48 kDa and pI of 6.5. The amino acid sequence of amoeba SAMS is longer than the SAMS of other organisms by having an extra internal stretch of 28 amino acids. The 5'-flanking region of amoeba sams contains consensus-binding sites for several transcription factors that are related to the regulation of sams genes in E. coli and yeast. The complete nucleotide sequence of the symbiont's sams gene is also presented. The open reading frame of X-bacteria sams is 1,146 nucleotides long, encoding SAMS of 381 amino acids with a mass of 41 kDa and pI of 6.0. The X-bacteria SAMS has 45% sequence identity with that of A. proteus.
Detection of possible restriction sites for type II restriction enzymes in DNA sequences.
Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L
2011-01-01
In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.
Information Entropy of Influenza A Segment 7
NASA Astrophysics Data System (ADS)
Thompson, William A.; Fan, Shaohua; Weltman, Joel K.
2008-12-01
Information entropy (H) is a measure of uncertainty at each position within in a sequence of nucleotides.H was used to characterize a set of influenza A segment 7 nucleotide sequences. Nucleotide locations of high entropy were identified near the 5’ start of all of the sequences and the sequences were assigned to subsets according to synonymous nucleotide variants at those positions: either uracil at position six (U6), cytosine at position six (C6), adenine (A12) at position 12, guanine at position 12 (G12), adenine at position 15 (A15) or cytosine (C15) at position 15. H values were found to be correlated/corresponding (Kendall tau) along the lengths of the nucleotide segments of the subset pairs at each position. However, the H values of each subset of sequences were statistically distinguishable from those of the other member of the pair (Kolmogorov-Smirnov test). The joint probability of uncorrelated distributions of U6 and C6 sequences to viral subtypes and to viral host species was 34 times greater than for the A12:G12 subset pair and 214 times greater than for the A15:C15 pair. This result indicates that the high entropy position six of segment 7 is either a reporter or a sentinel location. The fact that not one of the H5N1 sequences in the dataset was a member of the C6 subset, but all 125 H5N1 sequences are members of the U6 subset suggests a non-random sentinel function.
Molecular Variability Among Isolates of Prunus Necrotic Ringspot Virus from Different Prunus spp.
Aparicio, F; Myrta, A; Di Terlizzi, B; Pallás, V
1999-11-01
ABSTRACT Viral sequences amplified by polymerase chain reaction from 25 isolates of Prunus necrotic ringspot virus (PNRSV), varying in the symptomatology they cause in six different Prunus spp., were analyzed for restriction fragment polymorphisms. Most of the isolates could be discriminated by using a combination of three different restriction enzymes. The nucleotide sequences of the RNA 4 of 15 of these isolates were determined. Sequence comparisons and phylogenetic analyses of the RNA 4 and coat proteins (CPs) revealed that all of the isolates clustered into three different groups, represented by three previously sequenced PNRSV isolates: PV32, PE5, and PV96. The PE5-type group was characterized by a 5' untranslated region that was clearly different from that of the other two groups. The PV32-type group was characterized by an extra hexanucleotide consisting of a duplication of the six immediately preceding nucleotides. Although most of the variability was observed in the first third of the CP, the amino acid residues in this region, which were previously thought to be functionally important in the replication cycle of the virus, were strictly conserved. No clear correlation with the type of symptom or host specificity could be observed. The validity of this grouping was confirmed when other isolates recently characterized by other authors were included in these analyses.
Ekblom, Robert; Farrell, Lindsay L; Lank, David B; Burke, Terry
2012-01-01
By next generation transcriptome sequencing, it is possible to obtain data on both nucleotide sequence variation and gene expression. We have used this approach (RNA-Seq) to investigate the genetic basis for differences in plumage coloration and mating strategies in a non-model bird species, the ruff (Philomachus pugnax). Ruff males show enormous variation in the coloration of ornamental feathers, used for individual recognition. This polymorphism is linked to reproductive strategies, with dark males (Independents) defending territories on leks against other Independents, whereas white morphs (Satellites) co-occupy Independent's courts without agonistic interactions. Previous work found a strong genetic component for mating strategy, but the genes involved were not identified. We present feather transcriptome data of more than 6,000 de-novo sequenced ruff genes (although with limited coverage for many of them). None of the identified genes showed significant expression divergence between males, but many genetic markers showed nucleotide differentiation between different color morphs and mating strategies. These include several feather keratin genes, splicing factors, and the Xg blood-group gene. Many of the genes with significant genetic structure between mating strategies have not yet been annotated and their functions remain to be elucidated. We also conducted in-depth investigations of 28 pre-identified coloration candidate genes. Two of these (EDNRB and TYR) were specifically expressed in black- and rust-colored males, respectively. We have demonstrated the utility of next generation transcriptome sequencing for identifying and genotyping large number of genetic markers in a non-model species without previous genomic resources, and highlight the potential of this approach for addressing the genetic basis of ecologically important variation. PMID:23145334
NASA Astrophysics Data System (ADS)
Arndt, Peter F.; Hwa, Terence; Petrov, Dmitri A.
2005-06-01
This study presents the first global, 1 Mbp level analysis of patterns of nucleotide substitutions along the human lineage. The study is based on the analysis of a large amount of repetitive elements deposited into the human genome since the mammalian radiation, yielding a number of results that would have been difficult to obtain using the more conventional comparative method of analysis. This analysis revealed substantial and consistent variability of rates of substitution, with the variability ranging up to 2-fold among different regions. The rates of substitutions of C or G nucleotides with A or T nucleotides vary much more sharply than the reverse rates suggesting that much of that variation is due to differences in mutation rates rather than in the probabilities of fixation of C/G vs. A/T nucleotides across the genome. For all types of substitution we observe substantially more hotspots than coldspots, with hotspots showing substantial clustering over tens of Mbp's. Our analysis revealed that GC-content of surrounding sequences is the best predictor of the rates of substitution. The pattern of substitution appears very different near telomeres compared to the rest of the genome and cannot be explained by the genome-wide correlations of the substitution rates with GC content or exon density. The telomere pattern of substitution is consistent with natural selection or biased gene conversion acting to increase the GC-content of the sequences that are within 10-15 Mbp away from the telomere.
PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES
Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.
2008-01-01
Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195
Trading genes along the silk road: mtDNA sequences and the origin of central Asian populations.
Comas, D; Calafell, F; Mateu, E; Pérez-Lezaun, A; Bosch, E; Martínez-Arias, R; Clarimon, J; Facchini, F; Fiori, G; Luiselli, D; Pettener, D; Bertranpetit, J
1998-01-01
Central Asia is a vast region at the crossroads of different habitats, cultures, and trade routes. Little is known about the genetics and the history of the population of this region. We present the analysis of mtDNA control-region sequences in samples of the Kazakh, the Uighurs, the lowland Kirghiz, and the highland Kirghiz, which we have used to address both the population history of the region and the possible selective pressures that high altitude has on mtDNA genes. Central Asian mtDNA sequences present features intermediate between European and eastern Asian sequences, in several parameters-such as the frequencies of certain nucleotides, the levels of nucleotide diversity, mean pairwise differences, and genetic distances. Several hypotheses could explain the intermediate position of central Asia between Europe and eastern Asia, but the most plausible would involve extensive levels of admixture between Europeans and eastern Asians in central Asia, possibly enhanced during the Silk Road trade and clearly after the eastern and western Eurasian human groups had diverged. Lowland and highland Kirghiz mtDNA sequences are very similar, and the analysis of molecular variance has revealed that the fraction of mitochondrial genetic variance due to altitude is not significantly different from zero. Thus, it seems unlikely that altitude has exerted a major selective pressure on mitochondrial genes in central Asian populations. PMID:9837835
Enzmann, P J; Kurath, G; Fichtner, D; Bergmann, S M
2005-09-23
Infectious hematopoietic necrosis virus (IHNV) was first detected in Europe in 1987 in France and Italy, and later, in 1992, in Germany. The source of the virus and the route of introduction are unknown. The present study investigates the molecular epidemiology of IHNV outbreaks in Germany since its first introduction. The complete nucleotide sequences of the glycoprotein (G) and non-virion (NV) genes from 9 IHNV isolates from Germany have been determined, and this has allowed the identification of characteristic differences between these isolates. Phylogenetic analysis of partial G gene sequences (mid-G, 303 nucleotides) from North American IHNV isolates (Kurath et al. 2003) has revealed 3 major genogroups, designated U, M and L. Using this gene region with 2 different North American IHNV data sets, it was possible to group the European IHNV strains within the M genogroup, but not in any previously defined subgroup. Analysis of the full length G gene sequences indicated that an independent evolution of IHN viruses had occurred in Europe. IHN viruses in Europe seem to be of a monophyletic origin, again most closely related to North American isolates in the M genogroup. Analysis of the NV gene sequences also showed the European isolates to be monophyletic, but resolution of the 3 genogroups was poor with this gene region. As a result of comparative sequence analyses, several different genotypes have been identified circulating in Europe.
PseKNC: a flexible web server for generating pseudo K-tuple nucleotide composition.
Chen, Wei; Lei, Tian-Yu; Jin, Dian-Chuan; Lin, Hao; Chou, Kuo-Chen
2014-07-01
The pseudo oligonucleotide composition, or pseudo K-tuple nucleotide composition (PseKNC), can be used to represent a DNA or RNA sequence with a discrete model or vector yet still keep considerable sequence order information, particularly the global or long-range sequence order information, via the physicochemical properties of its constituent oligonucleotides. Therefore, the PseKNC approach may hold very high potential for enhancing the power in dealing with many problems in computational genomics and genome sequence analysis. However, dealing with different DNA or RNA problems may need different kinds of PseKNC. Here, we present a flexible and user-friendly web server for PseKNC (at http://lin.uestc.edu.cn/pseknc/default.aspx) by which users can easily generate many different modes of PseKNC according to their need by selecting various parameters and physicochemical properties. Furthermore, for the convenience of the vast majority of experimental scientists, a step-by-step guide is provided on how to use the current web server to generate their desired PseKNC without the need to follow the complicated mathematical equations, which are presented in this article just for the integrity of PseKNC formulation and its development. It is anticipated that the PseKNC web server will become a very useful tool in computational genomics and genome sequence analysis. Copyright © 2014 Elsevier Inc. All rights reserved.
Van Kreijl, C F; Bos, J L
1977-01-01
The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740
Setoh, Yin Xiang; Amarilla, Alberto A; Peng, Nias Y; Slonchak, Andrii; Periasamy, Parthiban; Figueiredo, Luiz T M; Aquino, Victor H; Khromykh, Alexander A
2018-01-01
Rocio virus (ROCV) is an arbovirus belonging to the genus Flavivirus, family Flaviviridae. We present an updated sequence of ROCV strain SPH 34675 (GenBank: AY632542.4), the only available full genome sequence prior to this study. Using next-generation sequencing of the entire genome, we reveal substantial sequence variation from the prototype sequence, with 30 nucleotide differences amounting to 14 amino acid changes, as well as significant changes to predicted 3'UTR RNA structures. Our results present an updated and corrected sequence of a potential emerging human-virulent flavivirus uniquely indigenous to Brazil (GenBank: MF461639).
Poimenidou, Sofia V; Dalmasso, Marion; Papadimitriou, Konstantinos; Fox, Edward M; Skandamis, Panagiotis N; Jordan, Kieran
2018-01-01
The prfA -virulence gene cluster ( p VGC) is the main pathogenicity island in Listeria monocytogenes , comprising the prfA, plcA, hly, mpl, actA , and plcB genes. In this study, the p VGC of 36 L. monocytogenes isolates with respect to different serotypes (1/2a or 4b), geographical origin (Australia, Greece or Ireland) and isolation source (food-associated or clinical) was characterized. The most conserved genes were prfA and hly , with the lowest nucleotide diversity (π) among all genes ( P < 0.05), and the lowest number of alleles, substitutions and non-synonymous substitutions for prfA . Conversely, the most diverse gene was actA , which presented the highest number of alleles ( n = 20) and showed the highest nucleotide diversity. Grouping by serotype had a significantly lower π value ( P < 0.0001) compared to isolation source or geographical origin, suggesting a distinct and well-defined unit compared to other groupings. Among all tested genes, only hly and mpl were those with lower nucleotide diversity in 1/2a serotype than 4b serotype, reflecting a high within-1/2a serotype divergence compared to 4b serotype. Geographical divergence was noted with respect to the hly gene, where serotype 4b Irish strains were distinct from Greek and Australian strains. Australian strains showed less diversity in plcB and mpl relative to Irish or Greek strains. Notable differences regarding sequence mutations were identified between food-associated and clinical isolates in prfA, actA , and plcB sequences. Overall, these results indicate that virulence genes follow different evolutionary pathways, which are affected by a strain's origin and serotype and may influence virulence and/or epidemiological dominance of certain subgroups.
de Kloet, E; de Kloet, S R
2004-12-01
A study was made of the phylogenetic relationships between fifteen complete nucleotide sequences as well as 43 nucleotide sequences of the putative coat protein gene of different strains belonging to the virus species Beak and feather disease virus obtained from 39 individuals of 16 psittacine species. The species included among others, cockatoos ( Cacatuini), African grey parrots ( Psittacus erithacus) and peach-faced lovebirds ( Agapornis roseicollis), which were infected at different geographical locations, within and outside Australia, the native origin of the virus. The derived amino acid sequences of the putative coat protein were highly diverse, with differences between some strains amounting to 50 of the 250 amino acids. Phylogenetic analysis demonstrated that the putative coat gene sequences form six clusters which show a varying degree of psittacine species specificity. Most, but not all strains infecting African grey parrots formed a single cluster as did the strains infecting the cockatoos. Strains infecting the lovebirds clustered with those infecting such Australasian species as Eclectus roratus, Psittacula kramerii and Psephotus haematogaster. Although individual birds included in this study were, where studied, often infected by closely related strains, infection by highly diverged trains was also detected. The possible relationship between BFD viral strains and clinical disease signs is discussed.
Automated sequence analysis and editing software for HIV drug resistance testing.
Struck, Daniel; Wallis, Carole L; Denisov, Gennady; Lambert, Christine; Servais, Jean-Yves; Viana, Raquel V; Letsoalo, Esrom; Bronze, Michelle; Aitken, Sue C; Schuurman, Rob; Stevens, Wendy; Schmit, Jean Claude; Rinke de Wit, Tobias; Perez Bercoff, Danielle
2012-05-01
Access to antiretroviral treatment in resource-limited-settings is inevitably paralleled by the emergence of HIV drug resistance. Monitoring treatment efficacy and HIV drugs resistance testing are therefore of increasing importance in resource-limited settings. Yet low-cost technologies and procedures suited to the particular context and constraints of such settings are still lacking. The ART-A (Affordable Resistance Testing for Africa) consortium brought together public and private partners to address this issue. To develop an automated sequence analysis and editing software to support high throughput automated sequencing. The ART-A Software was designed to automatically process and edit ABI chromatograms or FASTA files from HIV-1 isolates. The ART-A Software performs the basecalling, assigns quality values, aligns query sequences against a set reference, infers a consensus sequence, identifies the HIV type and subtype, translates the nucleotide sequence to amino acids and reports insertions/deletions, premature stop codons, ambiguities and mixed calls. The results can be automatically exported to Excel to identify mutations. Automated analysis was compared to manual analysis using a panel of 1624 PR-RT sequences generated in 3 different laboratories. Discrepancies between manual and automated sequence analysis were 0.69% at the nucleotide level and 0.57% at the amino acid level (668,047 AA analyzed), and discordances at major resistance mutations were recorded in 62 cases (4.83% of differences, 0.04% of all AA) for PR and 171 (6.18% of differences, 0.03% of all AA) cases for RT. The ART-A Software is a time-sparing tool for pre-analyzing HIV and viral quasispecies sequences in high throughput laboratories and highlighting positions requiring attention. Copyright © 2012 Elsevier B.V. All rights reserved.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Form and format for... And/or Amino Acid Sequences § 1.824 Form and format for nucleotide and/or amino acid sequence... Code for Information Interchange (ASCII) text. No other formats shall be allowed. (3) The computer...
The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.
Hori, H; Osawa, S; Iwabuchi, M
1980-01-01
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421
High levels of MHC class II allelic diversity in lake trout from Lake Superior
Dorschner, M.O.; Duris, T.; Bronte, C.R.; Burnham-Curtis, M. K.; Phillips, R.B.
2000-01-01
Sequence variation in a 216 bp portion of the major histocompatibility complex (MHC) II B1 domain was examined in 74 individual lake trout (Salvelinus namaycush) from different locations in Lake Superior. Forty-three alleles were obtained which encoded 71-72 amino acids of the mature protein. These sequences were compared with previous data obtained from five Pacific salmon species and Atlantic salmon using the same primers. Although all of the lake trout alleles clustered together in the neighbor-joining analysis of amino acid sequences, one amino acid allelic lineage was shared with Atlantic salmon (Salmo salar), a species in another genus which probably diverged from Salvelinus more than 10-20 million years ago. As shown previously in other salmonids, the level of nonsynonymous nucleotide substitution (d(N)) exceeded the level of synonymous substitution (d(S)). The level of nucleotide diversity at the MHC class II B1 locus was considerably higher in lake trout than in the Pacific salmon (genus Oncorhynchus). These results are consistent with the hypothesis that lake trout colonized Lake Superior from more than one refuge following the Wisconsin glaciation. Recent population bottlenecks may have reduced nucleotide diversity in Pacific salmon populations.
Detection of nucleotide-specific CRISPR/Cas9 modified alleles using multiplex ligation detection
KC, R.; Srivastava, A.; Wilkowski, J. M.; Richter, C. E.; Shavit, J. A.; Burke, D. T.; Bielas, S. L.
2016-01-01
CRISPR/Cas9 genome-editing has emerged as a powerful tool to create mutant alleles in model organisms. However, the precision with which these mutations are created has introduced a new set of complications for genotyping and colony management. Traditional gene-targeting approaches in many experimental organisms incorporated exogenous DNA and/or allele specific sequence that allow for genotyping strategies based on binary readout of PCR product amplification and size selection. In contrast, alleles created by non-homologous end-joining (NHEJ) repair of double-stranded DNA breaks generated by Cas9 are much less amenable to such strategies. Here we describe a novel genotyping strategy that is cost effective, sequence specific and allows for accurate and efficient multiplexing of small insertion-deletions and single-nucleotide variants characteristic of CRISPR/Cas9 edited alleles. We show that ligation detection reaction (LDR) can be used to generate products that are sequence specific and uniquely detected by product size and/or fluorescent tags. The method works independently of the model organism and will be useful for colony management as mutant alleles differing by a few nucleotides become more prevalent in experimental animal colonies. PMID:27557703
De Wachter, R; Neefs, J M; Goris, A; Van de Peer, Y
1992-01-01
The nucleotide sequence of the gene coding for small ribosomal subunit RNA in the basidiomycete Ustilago maydis was determined. It revealed the presence of a group I intron with a length of 411 nucleotides. This is the third occurrence of such an intron discovered in a small subunit rRNA gene encoded by a eukaryotic nuclear genome. The other two occurrences are in Pneumocystis carinii, a fungus of uncertain taxonomic status, and Ankistrodesmus stipitatus, a green alga. The nucleotides of the conserved core structure of 101 group I intron sequences present in different genes and genome types were aligned and their evolutionary relatedness was examined. This revealed a cluster including all group I introns hitherto found in eukaryotic nuclear genes coding for small and large subunit rRNAs. A secondary structure model was designed for the area of the Ustilago maydis small ribosomal subunit RNA precursor where the intron is situated. It shows that the internal guide sequence pairing with the intron boundaries fits between two helices of the small subunit rRNA, and that minimal rearrangement of base pairs suffices to achieve the definitive secondary structure of the 18S rRNA upon splicing. PMID:1561081
Dynamic basis for dG•dT misincorporation via tautomerization and ionization
NASA Astrophysics Data System (ADS)
Kimsey, Isaac J.; Szymanski, Eric S.; Zahurancik, Walter J.; Shakya, Anisha; Xue, Yi; Chu, Chia-Chieh; Sathyamoorthy, Bharathwaj; Suo, Zucai; Al-Hashimi, Hashim M.
2018-02-01
Tautomeric and anionic Watson-Crick-like mismatches have important roles in replication and translation errors through mechanisms that are not fully understood. Here, using NMR relaxation dispersion, we resolve a sequence-dependent kinetic network connecting G•T/U wobbles with three distinct Watson-Crick mismatches: two rapidly exchanging tautomeric species (Genol•T/UG•Tenol/Uenol population less than 0.4%) and one anionic species (G•T-/U- population around 0.001% at neutral pH). The sequence-dependent tautomerization or ionization step was inserted into a minimal kinetic mechanism for correct incorporation during replication after the initial binding of the nucleotide, leading to accurate predictions of the probability of dG•dT misincorporation across different polymerases and pH conditions and for a chemically modified nucleotide, and providing mechanisms for sequence-dependent misincorporation. Our results indicate that the energetic penalty for tautomerization and/or ionization accounts for an approximately 10-2 to 10-3-fold discrimination against misincorporation, which proceeds primarily via tautomeric dGenol•dT and dG•dTenol, with contributions from anionic dG•dT- dominant at pH 8.4 and above or for some mutagenic nucleotides.
Draft Genome Sequence of the Rifamycin Producer Amycolatopsis rifamycinica DSM 46095
Saxena, Anjali; Kumari, Rashmi; Mukherjee, Udita; Singh, Priya
2014-01-01
Amycolatopsis rifamycinica DSM 46095 is an actinobacterium that produces rifamycin SV, an antibiotic used against Mycobacterium tuberculosis. Here, we present the draft genome of DSM 46095, which harbors a novel rifamycin polyketide biosynthetic gene cluster (rif PKS) that differed by 10% in nucleotide sequence from the already reported rif PKS cluster of Amycolatopsis mediterranei S699. PMID:24994803
Surussawadee, Janjira; Jindamorakot, Sasitorn; Nakase, Takashi; Lee, Ching-Fu; Limtong, Savitree
2015-07-01
Five strains representing one novel anamorphic yeast species were isolated from plant leaves collected in Thailand (strains DMKU-SP186(T), ST-111 and ST-201) and Taiwan (strains FN20L02 and SM13L16). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics and sequence analysis of the D1/D2 region of the large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS) region, they were assigned to a single novel species of the genus Hannaella. The sequences of the D1/D2 regions of the LSU rRNA genes of four of the strains (DMKU-SP186(T), ST-111, FN20L02 and SM13L16) were identical, while differing from strain ST-201 by 2 substitutions and 2 gaps. The nucleotide sequence of the ITS regions of the five strains differed from each other by between 0 and 3 nucleotide substitutions. The novel species was most closely related to Hannaella luteola, but showed 1.0-1.3% nucleotide substitutions (between 6 substitutions out of 568-606 nt and 8 substitutions, and 2 gaps out of 597 nt) in the D1/D2 region of the LSU rRNA gene and 1.4-2.0% nucleotide substitutions (6-9 substitutions out of 435 nt) in the ITS region. Ballistospores were produced by three of the strains on cornmeal agar at 15 and 20 °C after 4 weeks, while H. luteola did not produce ballistospores. The name Hannaella phyllophila sp. nov. is proposed. The type strain is DMKU-SP186(T) ( = BCC 69500(T) = NBRC 110428(T) = CBS 13921(T)).
Haddad-Boubaker, Sondes; Rezq, Moftah; Smeo, Mohamed-Najeb; Ben Yahia, Ahlem; Abudher, Abdulhafid; Slim, Amin; Ben Ghorbel, Mohamed; Ahmed, Hinda; Rota, Paul; Triki, Hinda
2010-11-01
Genetic characterization was conducted on 18 wild-type measles viruses, detected in Tunisia and Libya from 2002 to 2009. Sequence analysis of the 456 nucleotides in the carboxy terminus of the nucleoprotein (N) gene and the entire hemagglutinin (H) gene indicated that all isolates were in genotype B3. All of the viruses from 2002 to 2007 and some of the isolates from 2009 belonged to subtype B3.1. In contrast, 7 of the viruses isolated during 2008 and 2009 were quite divergent from all B3 isolates. The nucleotide sequences of the N gene of these 7 isolates differed from the sequences of the Ibadan and New York reference strain by an average of 3.1 and 4.4%, respectively. The H gene sequences differed by 1.1 and 2.6% with the same reference strains. This is the first report describing the genetic characteristics of measles viruses from clade B isolated in North Africa; the results suggest that these viruses represent a new subtype of genotype B3. Copyright © 2010 Elsevier B.V. All rights reserved.
Huang, C.; Chien, M.S.; Landolt, M.L.; Batts, W.; Winton, J.
1996-01-01
Twelve neutralizing monoclonal antibodies (MAbs) against the fish rhabdovirus, infectious haematopoietic necrosis virus (IHNV), were used to select 20 MAb escape mutants. The nucleotide sequence of the entire glycoprotein (G) gene was determined for six mutants representing differing cross-neutralization patterns and each had a single nucleotide change leading to a single amino acid substitution within one of three regions of the protein. These data were used to design nested PCR primers to amplify portions of the G gene of the 14 remaining mutants. When the PCR products from these mutants were sequenced, they also had single nucleotide substitutions coding for amino acid substitutions at the same, or nearby, locations. Of the 20 mutants for which all or part of the glycoprotein gene was sequenced, two MAbs selected mutants with substitutions at amino acids 230-231 (antigenic site I) and the remaining MAbs selected mutants with substitutions at amino acids 272-276 (antigenic site II). Two MAbs that selected mutants mapping to amino acids 272-276, selected other mutants that mapped to amino acids 78-81, raising the possibility that this portion of the N terminus of the protein was part of a discontinuous epitope defining antigenic site II. CLUSTAL alignment of the glycoproteins of rabies virus, vesicular stomatitis virus and IHNV revealed similarities in the location of the neutralizing epitopes and a high degree of conservation among cysteine residues, indicating that the glycoproteins of three different genera of animal rhabdoviruses may share a similar three-dimensional structure in spite of extensive sequence divergence.
Control of total GFP expression by alterations to the 3′ region nucleotide sequence
2013-01-01
Background Previously, we distinguished the Escherichia coli type II cytoplasmic membrane translocation pathways of Tat, Yid, and Sec for unfolded and folded soluble target proteins. The translocation of folded protein to the periplasm for soluble expression via the Tat pathway was controlled by an N-terminal hydrophilic leader sequence. In this study, we investigated the effect of the hydrophilic C-terminal end and its nucleotide sequence on total and soluble protein expression. Results The native hydrophilic C-terminal end of GFP was obtained by deleting the C-terminal peptide LeuGlu-6×His, derived from pET22b(+). The corresponding clones induced total and soluble GFP expression that was either slightly increased or dramatically reduced, apparently through reconstruction of the nucleotide sequence around the stop codon in the 3′ region. In the expression-induced clones, the hydrophilic C-terminus showed increased Tat pathway specificity for soluble expression. However, in the expression-reduced clone, after analyzing the role of the 5′ poly(A) coding sequence with a substituted synonymous codon, we proved that the longer 5′ poly(A) coding sequence interacted with the reconstructed 3′ region nucleotide sequence to create a new mRNA tertiary structure between the 5′ and 3′ regions, which resulted in reduced total GFP expression. Further, to recover the reduced expression by changing the 3′ nucleotide sequence, after replacing selected C-terminal 5′ codons and the stop codon in the ORF with synonymous codons, total GFP expression in most of the clones was recovered to the undeleted control level. The insertion of trinucleotides after the stop codon in the 3′-UTR recovered or reduced total GFP expression. RT-PCR revealed that the level of total protein expression was controlled by changes in translational or transcriptional regulation, which were induced or reduced by the substitution or insertion of 3′ region nucleotides. Conclusions We found that the hydrophilic C-terminal end of GFP increased Tat pathway specificity and that the 3′ nucleotide sequence played an important role in total protein expression through translational and transcriptional regulation. These findings may be useful for efficiently producing recombinant proteins as well as for potentially controlling the expression level of specific genes in the body for therapeutic purposes. PMID:23834827
CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design
Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven
2003-01-01
We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413
Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.
Dron, M; Rahire, M; Rochaix, J D
1982-01-01
The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784
Amino acid sequence of the Amur tiger prion protein.
Wu, Changde; Pang, Wanyong; Zhao, Deming
2006-10-01
Prion diseases are fatal neurodegenerative disorders in human and animal associated with conformational conversion of a cellular prion protein (PrP(C)) into the pathologic isoform (PrP(Sc)). Various data indicate that the polymorphisms within the open reading frame (ORF) of PrP are associated with the susceptibility and control the species barrier in prion diseases. In the present study, partial Prnp from 25 Amur tigers (tPrnp) were cloned and screened for polymorphisms. Four single nucleotide polymorphisms (T423C, A501G, C511A, A610G) were found; the C511A and A610G nucleotide substitutions resulted in the amino acid changes Lysine171Glutamine and Alanine204Threoine, respectively. The tPrnp amino acid sequence is similar to house cat (Felis catus ) and sheep, but differs significantly from other two cat Prnp sequences that were previously deposited in GenBank.
Sampson, Juliana K; Sheth, Nihar U; Koparde, Vishal N; Scalora, Allison F; Serrano, Myrna G; Lee, Vladimir; Roberts, Catherine H; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H; Buck, Gregory A; Neale, Michael C; Toor, Amir A
2014-08-01
Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. © 2014 John Wiley & Sons Ltd.
Paulsrud, Per; Lindblad, Peter
1998-01-01
We examined the genetic diversity of Nostoc symbionts in some lichens by using the tRNALeu (UAA) intron as a genetic marker. The nucleotide sequence was analyzed in the context of the secondary structure of the transcribed intron. Cyanobacterial tRNALeu (UAA) introns were specifically amplified from freshly collected lichen samples without previous DNA extraction. The lichen species used in the present study were Nephroma arcticum, Peltigera aphthosa, P. membranacea, and P. canina. Introns with different sizes around 300 bp were consistently obtained. Multiple clones from single PCRs were screened by using their single-stranded conformational polymorphism pattern, and the nucleotide sequence was determined. No evidence for sample heterogenity was found. This implies that the symbiont in situ is not a diverse community of cyanobionts but, rather, one Nostoc strain. Furthermore, each lichen thallus contained only one intron type, indicating that each thallus is colonized only once or that there is a high degree of specificity. The same cyanobacterial intron sequence was also found in samples of one lichen species from different localities. In a phylogenetic analysis, the cyanobacterial lichen sequences grouped together with the sequences from two free-living Nostoc strains. The size differences in the intron were due to insertions and deletions in highly variable regions. The sequence data were used in discussions concerning specificity and biology of the lichen symbiosis. It is concluded that the tRNALeu (UAA) intron can be of great value when examining cyanobacterial diversity. PMID:9435083
Molecular characterization of Giardia psittaci by multilocus sequence analysis.
Abe, Niichiro; Makino, Ikuko; Kojima, Atsushi
2012-12-01
Multilocus sequence analyses targeting small subunit ribosomal DNA (SSU rDNA), elongation factor 1 alpha (ef1α), glutamate dehydrogenase (gdh), and beta giardin (β-giardin) were performed on Giardia psittaci isolates from three Budgerigars (Melopsittacus undulates) and four Barred parakeets (Bolborhynchus lineola) kept in individual households or imported from overseas. Nucleotide differences and phylogenetic analyses at four loci indicate the distinction of G. psittaci from the other known Giardia species: Giardia muris, Giardia microti, Giardia ardeae, and Giardia duodenalis assemblages. Furthermore, G. psittaci was related more closely to G. duodenalis than to the other known Giardia species, except for G. microti. Conflicting signals regarded as "double peaks" were found at the same nucleotide positions of the ef1α in all isolates. However, the sequences of the other three loci, including gdh and β-giardin, which are known to be highly variable, from all isolates were also mutually identical at every locus. They showed no double peaks. These results suggest that double peaks found in the ef1α sequences are caused not by mixed infection with genetically different G. psittaci isolates but by allelic sequence heterogeneity (ASH), which is observed in diplomonad lineages including G. duodenalis. No sequence difference was found in any G. psittaci isolates at the gdh and β-giardin, suggesting that G. psittaci is indeed not more diverse genetically than other Giardia species. This report is the first to provide evidence related to the genetic characteristics of G. psittaci obtained using multilocus sequence analysis. Copyright © 2012 Elsevier B.V. All rights reserved.
2010-01-01
Background Infectious hematopoietic necrosis virus (IHNV) is the type species of the genus Novirhabdovirus, within the family Rhabdoviridae, infecting several species of wild and hatchery reared salmonids. Similar to other rhabdoviruses, IHNV has a linear single-stranded, negative-sense RNA genome of approximately 11,000 nucleotides. The IHNV genome encodes six genes; the nucleocapsid, phosphoprotein, matrix protein, glycoprotein, non-virion protein and polymerase protein genes, respectively. This study describes molecular characterization of the virulent IHNV strain 220-90, belonging to the M genogroup, and its phylogenetic relationships with available sequences of IHNV isolates worldwide. Results The complete genomic sequence of IHNV strain 220-90 was determined from the DNA of six overlapping clones obtained by RT-PCR amplification of genomic RNA. The complete genome sequence of 220-90 comprises 11,133 nucleotides (GenBank GQ413939) with the gene order of 3'-N-P-M-G-NV-L-5'. These genes are separated by conserved gene junctions, with di-nucleotide gene spacers. An additional uracil nucleotide was found at the end of the 5'-trailer region, which was not reported before in other IHNV strains. The first 15 of the 16 nucleotides at the 3'- and 5'-termini of the genome are complementary, and the first 4 nucleotides at 3'-ends of the IHNV are identical to other novirhadoviruses. Sequence homology and phylogenetic analysis of the glycoprotein genes show that 220-90 strain is 97% identical to most of the IHNV strains. Comparison of the virulent 220-90 genomic sequences with less virulent WRAC isolate shows more than 300 nucleotides changes in the genome, which doesn't allow one to speculate putative residues involved in the virulence of IHNV. Conclusion We have molecularly characterized one of the well studied IHNV isolates, 220-90 of genogroup M, which is virulent for rainbow trout, and compared phylogenetic relationship with North American and other strains. Determination of the complete nucleotide sequence is essential for future studies on pathogenesis of IHNV using a reverse genetics approach and developing efficient control strategies. PMID:20085652
Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.
Ohno, T; Takamatsu, N; Meshi, T; Okada, Y
1983-01-01
The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412
Nucleotide sequences of Japanese isolates of citrus vein enation virus.
Nakazono-Nagaoka, Eiko; Fujikawa, Takashi; Iwanami, Toru
2017-03-01
The genomic sequences of five Japanese isolates of citrus vein enation virus (CVEV) isolates that induce vein enation were determined and compared with that of the Spanish isolate VE-1. The nucleotide sequences of all Japanese isolates were 5,983 nt in length. The genomic RNA of Japanese isolates had five potential open reading frames (ORF 0, ORF 1, ORF 2, ORF 3, and ORF 5) in the positive-sense strand. The nucleotide sequence identity among the Japanese isolates and Spanish isolate VE-1 ranged from 98.0% to 99.8%. Comparison of the partial amino acid sequences of ten Japanese isolates and three Spanish isolates suggested that four amino acid residues, at positions of 83, 104, and 113 in ORF 2 and position 41 in ORF 5, might be unique to some Japanese isolates.
Detecting and Analyzing Genetic Recombination Using RDP4.
Martin, Darren P; Murrell, Ben; Khoosal, Arjun; Muhire, Brejnev
2017-01-01
Recombination between nucleotide sequences is a major process influencing the evolution of most species on Earth. The evolutionary value of recombination has been widely debated and so too has its influence on evolutionary analysis methods that assume nucleotide sequences replicate without recombining. When nucleic acids recombine, the evolution of the daughter or recombinant molecule cannot be accurately described by a single phylogeny. This simple fact can seriously undermine the accuracy of any phylogenetics-based analytical approach which assumes that the evolutionary history of a set of recombining sequences can be adequately described by a single phylogenetic tree. There are presently a large number of available methods and associated computer programs for analyzing and characterizing recombination in various classes of nucleotide sequence datasets. Here we examine the use of some of these methods to derive and test recombination hypotheses using multiple sequence alignments.
Updating Our View of Organelle Genome Nucleotide Landscape
Smith, David Roy
2012-01-01
Organelle genomes show remarkable variation in architecture and coding content, yet their nucleotide composition is relatively unvarying across the eukaryotic domain, with most having a high adenine and thymine (AT) content. Recent studies, however, have uncovered guanine and cytosine (GC)-rich mitochondrial and plastid genomes. These sequences come from a small but eclectic list of species, including certain green plants and animals. Here, I review GC-rich organelle DNAs and the insights they have provided into the evolution of nucleotide landscape. I emphasize that GC-biased mitochondrial and plastid DNAs are more widespread than once thought, sometimes occurring together in the same species, and suggest that the forces biasing their nucleotide content can differ both among and within lineages, and may be associated with specific genome architectural features and life history traits. PMID:22973299
Characterization of c-Ki-ras and N-ras oncogenes in aflatoxin B sub 1 -induced rat liver tumors
DOE Office of Scientific and Technical Information (OSTI.GOV)
McMahon, G.; Davis, E.F.; Huber, L.J.
c-Ki-ras and N-ras oncogenes have been characterized in aflatoxin B{sub 1}-induced hepatocellular carcinomas. Detection of different protooncogene and oncogene sequences and estimation of their frequency distribution were accomplished by polymerase chain reaction, cloning, and plaque screening methods. Two c-Ki-ras oncogene sequences were identified in DNA from liver tumors that contained nucleotide changes absent in DNA from livers of untreated control rats. Sequence changes involving G{center dot}C to T{center dot}A or G{center dot}C to A{center dot}T nucleotide substitutions in codon 12 were scored in three of eight tumor-bearing animals. Distributions of c-Ki-ras sequences in tumors and normal liver DNA indicated thatmore » the observed nucleotide changes were consistent with those expected to result from direct mutagenesis of the germ-line protooncogene by aflatoxin B{sub 1}. N-ras oncogene sequences were identified in DNA from two of eight tumors. Three N-ras gene regions were identified, one of which was shown to be associated with an oncogene containing a putative activating amino acid residing at codon 13. All three N-ras sequences, including the region detected in N-ras oncogenes, were present at similar frequencies in DNA samples from control livers as well as liver tumors. The presence of a potential germ-line oncogene may be related to the sensitivity of the Fischer rat strain to liver carcinogenesis by aflatoxin B{sub 1} and other chemical carcinogens.« less
2013-01-01
predicted amino acid sequences of the three encoded BmAChEs were no more closely related to one another than AChEs from different organisms and their...solely on nucleotide and amino acid sequence similarity; however, the cholinesterase gene family contains a number of related enzymes and structural...acetylcholinesterase of P. papatasi was cloned, sequenced , and expressed in the baculo- virus system to generate a recombinant enzyme for biochemical
AgdbNet – antigen sequence database software for bacterial typing
Jolley, Keith A; Maiden, Martin CJ
2006-01-01
Background Bacterial typing schemes based on the sequences of genes encoding surface antigens require databases that provide a uniform, curated, and widely accepted nomenclature of the variants identified. Due to the differences in typing schemes, imposed by the diversity of genes targeted, creating these databases has typically required the writing of one-off code to link the database to a web interface. Here we describe agdbNet, widely applicable web database software that facilitates simultaneous BLAST querying of multiple loci using either nucleotide or peptide sequences. Results Databases are described by XML files that are parsed by a Perl CGI script. Each database can have any number of loci, which may be defined by nucleotide and/or peptide sequences. The software is currently in use on at least five public databases for the typing of Neisseria meningitidis, Campylobacter jejuni and Streptococcus equi and can be set up to query internal isolate tables or suitably-configured external isolate databases, such as those used for multilocus sequence typing. The style of the resulting website can be fully configured by modifying stylesheets and through the use of customised header and footer files that surround the output of the script. Conclusion The software provides a rapid means of setting up customised Internet antigen sequence databases. The flexible configuration options enable typing schemes with differing requirements to be accommodated. PMID:16790057
Detection of a new bat gammaherpesvirus in the Philippines.
Watanabe, Shumpei; Ueda, Naoya; Iha, Koichiro; Masangkay, Joseph S; Fujii, Hikaru; Alviola, Phillip; Mizutani, Tetsuya; Maeda, Ken; Yamane, Daisuke; Walid, Azab; Kato, Kentaro; Kyuwa, Shigeru; Tohya, Yukinobu; Yoshikawa, Yasuhiro; Akashi, Hiroomi
2009-08-01
A new bat herpesvirus was detected in the spleen of an insectivorous bat (Hipposideros diadema, family Hipposideridae) collected on Panay Island, the Philippines. PCR analyses were performed using COnsensus-DEgenerate Hybrid Oligonucleotide Primers (CODEHOPs) targeting the herpesvirus DNA polymerase (DPOL) gene. Although we obtained PCR products with CODEHOPs, direct sequencing using the primers was not possible because of high degree of degeneracy. Direct sequencing technology developed in our rapid determination system of viral RNA sequences (RDV) was applied in this study, and a partial DPOL nucleotide sequence was determined. In addition, a partial gB gene nucleotide sequence was also determined using the same strategy. We connected the partial gB and DPOL sequences with long-distance PCR, and a 3741-bp nucleotide fragment, including the 3' part of the gB gene and the 5' part of the DPOL gene, was finally determined. Phylogenetic analysis showed that the sequence was novel and most similar to those of the subfamily Gammaherpesvirinae.
Plant nitrogen regulatory P-PII polypeptides
Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun
2004-11-23
The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the invention may be used to engineer organisms to overexpress wild-type or mutant P-PII regulatory protein. Engineered plants that overexpress or underexpress P-PII regulatory protein may have increased nitrogen assimilation capacity. Engineered organisms may be used to produce P-PII proteins which, in turn, can be used for a variety of purposes including in vitro screening of herbicides. P-PII nucleotide sequences have additional uses as probes for isolating additional genomic clones having the promoters of P-PII gene. P-PII promoters are light- and/or sucrose-inducible and may be advantageously used in genetic engineering of plants.
Denoising DNA deep sequencing data—high-throughput sequencing errors and their correction
Laehnemann, David; Borkhardt, Arndt
2016-01-01
Characterizing the errors generated by common high-throughput sequencing platforms and telling true genetic variation from technical artefacts are two interdependent steps, essential to many analyses such as single nucleotide variant calling, haplotype inference, sequence assembly and evolutionary studies. Both random and systematic errors can show a specific occurrence profile for each of the six prominent sequencing platforms surveyed here: 454 pyrosequencing, Complete Genomics DNA nanoball sequencing, Illumina sequencing by synthesis, Ion Torrent semiconductor sequencing, Pacific Biosciences single-molecule real-time sequencing and Oxford Nanopore sequencing. There is a large variety of programs available for error removal in sequencing read data, which differ in the error models and statistical techniques they use, the features of the data they analyse, the parameters they determine from them and the data structures and algorithms they use. We highlight the assumptions they make and for which data types these hold, providing guidance which tools to consider for benchmarking with regard to the data properties. While no benchmarking results are included here, such specific benchmarks would greatly inform tool choices and future software development. The development of stand-alone error correctors, as well as single nucleotide variant and haplotype callers, could also benefit from using more of the knowledge about error profiles and from (re)combining ideas from the existing approaches presented here. PMID:26026159
A single alteration 20 nt 5′ to an editing target inhibits chloroplast RNA editing in vivo
Reed, Martha L.; Peeters, Nemo M.; Hanson, Maureen R.
2001-01-01
Transcripts of typical dicot plant plastid genes undergo C→U RNA editing at approximately 30 locations, but there is no consensus sequence surrounding the C targets of editing. The cis-acting elements required for editing of the C located at tobacco rpoB editing site II were investigated by introducing translatable chimeric minigenes containing sequence –20 to +6 surrounding the C target of editing. When the –20 to +6 sequence specified by the homologous region present in the black pine chloroplast genome was incorporated, virtually no editing of the transcripts occurred in transgenic tobacco plastids. Nucleotides that differ between the black pine and tobacco sequence were tested for their role in C→U editing by designing chimeric genes containing one or more of these divergent nucleotides. Surprisingly, the divergent nucleotide that had the strongest negative effect on editing of the minigene transcript was located –20 nt 5′ to the C target of editing. Expression of transgene transcripts carrying the 27 nt sequence did not affect the editing extent of the endogenous rpoB transcripts, even though the chimeric transcripts were much more abundant than those of the endogenous gene. In plants carrying a 93 nt rpoB editing site sequence, transgene transcripts accumulated to a level three times greater than transgene transcripts in the plants carrying the 27 nt rpoB editing sites and resulted in editing of the endogenous transcripts from 100 to 50%. Both a lower affinity of the 27 nt site for a trans-acting factor and lower abundance of the transcript could explain why expression of minigene transcripts containing the 27 nt sequence did not affect endogenous editing. PMID:11266552
NASA Technical Reports Server (NTRS)
Lacey, J. C., Jr.; Mullins, D. W., Jr.; Watkins, C. L.; Hall, L. M.
1986-01-01
Cellular organisms store information as sequences of nucleotides in double stranded DNA. This information is useless unless it can be converted into the active molecular species, protein. This is done in contemporary creatures first by transcription of one strand to give a complementary strand of mRNA. The sequence of nucleotides is then translated into a specific sequence of amino acids in a protein. Translation is made possible by a genetic coding system in which a sequence of three nucleotides codes for a specific amino acid. The origin and evolution of any chemical system can be understood through elucidation of the properties of the chemical entities which make up the system. There is an underlying logic to the coding system revealed by a correlation of the hydrophobicities of amino acids and their anticodonic nucleotides (i.e., the complement of the codon). Its importance lies in the fact that every amino acid going into protein synthesis must first be activated. This is universally accomplished with ATP. Past studies have concentrated on the chemistry of the adenylates, but more recently we have found, through the use of NMR, that we can observe intramolecular interactions even at low concentrations, between amino acid side chains and nucleotide base rings in these adenylates. The use of this type of compound thus affords a novel way of elucidating the manner in which amino acids and nucleotides interact with each other. In aqueous solution, when a hydrophobic amino acid is attached to the most hydrophobic nucleotide, AMP, a hydrophobic interaction takes place between the amino acid side chain and the adenine ring. The studies to be reported concern these hydrophobic interactions.
Mahto, Santosh K.
2013-01-01
The bacterial decoding region of 16S ribosomal RNA has multiple modified nucleotides. In order to study the role of N4,2′-O-dimethylcytidine (m4Cm), the corresponding phosphoramidite was synthesized utilizing 5′-silyl-2′-ACE chemistry. Using solid-phase synthesis, m4Cm, 5-methylcytidine (m5C), 3-methyluridine (m3U), and 2′-O-methylcytidine (Cm) were site-specifically incorporated into small RNAs representing the decoding regions of different bacterial species. Biophysical studies were then used to provide insight into the stabilizing roles of the modified nucleotides. These studies reveal that methylation of cytidine and uridine has different effects. The same modifications at different positions or sequence contexts within similar RNA constructs also have contrasting roles, such as stabilizing or destabilizing the RNA helix. PMID:23566761
Three new HLA-C alleles (HLA-C*14:02:13, HLA-C*15:72 and HLA-C*15:74) in Saudi bone marrow donors.
Fakhoury, H A; Jawdat, D; Alaskar, A S; Al Jumah, M; Cereb, N; Hajeer, A H
2015-10-01
Three new HLA-C alleles were identified by sequence-based typing method (SBT) in donors for the Saudi Bone Marrow Donor Registry (SBMDR). HLA-C*14:02:13 differs from HLA-C*14:02:01 by a silent G to A substitution at nucleotide position 400 in exon 2, where lysine at position 66 remains unchanged. HLA-C*15:72 differs from HLA-C*15:22 by a nonsynonymous C to A substitution at nucleotide position 796 in exon 3, resulting in an amino acid change from phenylalanine to leucine at position 116. HLA-C*15:74 differs from HLA-C*15:08 by a nonsynonymous C to T substitution at nucleotide position 914 in exon 3, resulting in an amino acid change from arginine to tryptophan at position 156. © 2015 John Wiley & Sons Ltd.
High speed nucleic acid sequencing
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2011-05-17
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid. Each type of labeled nucleotide comprises an acceptor fluorophore attached to a phosphate portion of the nucleotide such that the fluorophore is removed upon incorporation into a growing strand. Fluorescent signal is emitted via fluorescent resonance energy transfer between the donor fluorophore and the acceptor fluorophore as each nucleotide is incorporated into the growing strand. The sequence is deduced by identifying which base is being incorporated into the growing strand.
The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.
Khoe, Clairine V; Chung, Long H; Murray, Vincent
2018-06-01
The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.
Information capacity of nucleotide sequences and its applications.
Sadovsky, M G
2006-05-01
The information capacity of nucleotide sequences is defined through the specific entropy of frequency dictionary of a sequence determined with respect to another one containing the most probable continuations of shorter strings. This measure distinguishes a sequence both from a random one, and from ordered entity. A comparison of sequences based on their information capacity is studied. An order within the genetic entities is found at the length scale ranged from 3 to 8. Some other applications of the developed methodology to genetics, bioinformatics, and molecular biology are discussed.
Nucleic acid constructs containing orthogonal site selective recombinases (OSSRs)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gilmore, Joshua M.; Anderson, J. Christopher; Dueber, John E.
The present invention provides for a recombinant nucleic acid comprising a nucleotide sequence comprising a plurality of constructs, wherein each construct independently comprises a nucleotide sequence of interest flanked by a pair of recombinase recognition sequences. Each pair of recombinase recognition sequences is recognized by a distinct recombinase. Optionally, each construct can, independently, further comprise one or more genes encoding a recombinase capable of recognizing the pair of recombinase recognition sequences of the construct. The recombinase can be an orthogonal (non-cross reacting), site-selective recombinase (OSSR).
Wen, Chiu-Ming
2017-08-01
An aquabirnavirus was isolated from diseased marbled eels (Anguilla marmorata; MEIPNV1310) with gill haemorrhages and associated mortality. Its genome segment sequences were obtained through next-generation sequencing and compared with published aquabirnavirus sequences. The results indicated that the genome sequence of MEIPNV1310 contains segment A (3099 nucleotides) and segment B (2789 nucleotides). Phylogenetic analysis showed that MEIPNV1310 is closely related to the infectious pancreatic necrosis Ab strain within genogroup II. This genome sequence is beneficial for studying the geographic distribution and evolution of aquabirnaviruses.
L1-mediated retrotransposition of murine B1 and B2 SINEs recapitulated in cultured cells.
Dewannieux, Marie; Heidmann, Thierry
2005-06-03
SINEs are short interspersed nucleotide elements with transpositional activity, present at a high copy number (up to a million) in mammalian genomes. They are 80-400 bp long, non-coding sequences which derive either from the 7SL RNA (e.g. human Alus, murine B1s) or tRNA (e.g. murine B2s) polymerase III-driven genes. We have previously demonstrated that Alus very efficiently divert the enzymatic machinery of the autonomous L1 LINE (long interspersed nucleotide element) retrotransposons to transpose at a high rate. Here we show, using an ex vivo assay for transposition, that both B1 and B2 SINEs can be mobilized by murine LINEs, with the hallmarks of a bona fide retrotransposition process, including target site duplications of varying lengths and integrations into A-rich sequences. Despite different phylogenetic origins, transposition of the tRNA-derived B2 sequences is as efficient as that of the human Alus, whereas that of B1s is 20-100-fold lower despite a similar high copy number of these elements in the mouse genome. We provide evidence, via an appropriate nucleotide substitution within the B1 sequence in a domain essential for its intracellular targeting, that the current B1 SINEs are not optimal for transposition, a feature most probably selected for the host sake in the course of evolution.
Nakamura, Ryohei; Uno, Ayako; Kumagai, Masahiko; Fukushima, Hiroto S.; Morishita, Shinichi; Takeda, Hiroyuki
2017-01-01
The heavily methylated vertebrate genomes are punctuated by stretches of poorly methylated DNA sequences that usually mark gene regulatory regions. It is known that the methylation state of these regions confers transcriptional control over their associated genes. Given its governance on the transcriptome, cellular functions and identity, genome-wide DNA methylation pattern is tightly regulated and evidently predefined. However, how is the methylation pattern determined in vivo remains enigmatic. Based on in silico and in vitro evidence, recent studies proposed that the regional hypomethylated state is primarily determined by local DNA sequence, e.g., high CpG density and presence of specific transcription factor binding sites. Nonetheless, the dependency of DNA methylation on nucleotide sequence has not been carefully validated in vertebrates in vivo. Herein, with the use of medaka (Oryzias latipes) as a model, the sequence dependency of DNA methylation was intensively tested in vivo. Our statistical modeling confirmed the strong statistical association between nucleotide sequence pattern and methylation state in the medaka genome. However, by manipulating the methylation state of a number of genomic sequences and reintegrating them into medaka embryos, we demonstrated that artificially conferred DNA methylation states were predominantly and robustly maintained in vivo, regardless of their sequences and endogenous states. This feature was also observed in the medaka transgene that had passed across generations. Thus, despite the observed statistical association, nucleotide sequence was unable to autonomously determine its own methylation state in medaka in vivo. Our results apparently argue against the notion of the governance on the DNA methylation by nucleotide sequence, but instead suggest the involvement of other epigenetic factors in defining and maintaining the DNA methylation landscape. Further investigation in other vertebrate models in vivo will be needed for the generalization of our observations made in medaka. PMID:29267279
Using expected sequence features to improve basecalling accuracy of amplicon pyrosequencing data.
Rask, Thomas S; Petersen, Bent; Chen, Donald S; Day, Karen P; Pedersen, Anders Gorm
2016-04-22
Amplicon pyrosequencing targets a known genetic region and thus inherently produces reads highly anticipated to have certain features, such as conserved nucleotide sequence, and in the case of protein coding DNA, an open reading frame. Pyrosequencing errors, consisting mainly of nucleotide insertions and deletions, are on the other hand likely to disrupt open reading frames. Such an inverse relationship between errors and expectation based on prior knowledge can be used advantageously to guide the process known as basecalling, i.e. the inference of nucleotide sequence from raw sequencing data. The new basecalling method described here, named Multipass, implements a probabilistic framework for working with the raw flowgrams obtained by pyrosequencing. For each sequence variant Multipass calculates the likelihood and nucleotide sequence of several most likely sequences given the flowgram data. This probabilistic approach enables integration of basecalling into a larger model where other parameters can be incorporated, such as the likelihood for observing a full-length open reading frame at the targeted region. We apply the method to 454 amplicon pyrosequencing data obtained from a malaria virulence gene family, where Multipass generates 20 % more error-free sequences than current state of the art methods, and provides sequence characteristics that allow generation of a set of high confidence error-free sequences. This novel method can be used to increase accuracy of existing and future amplicon sequencing data, particularly where extensive prior knowledge is available about the obtained sequences, for example in analysis of the immunoglobulin VDJ region where Multipass can be combined with a model for the known recombining germline genes. Multipass is available for Roche 454 data at http://www.cbs.dtu.dk/services/MultiPass-1.0 , and the concept can potentially be implemented for other sequencing technologies as well.
Domier, L L; Latorre, I J; Steinlage, T A; McCoppin, N; Hartman, G L
2003-10-01
The variability of North American and Asian strains and isolates of Soybean mosaic virus was investigated. First, polymerase chain reaction (PCR) products representing the coat protein (CP)-coding regions of 38 SMVs were analyzed for restriction fragment length polymorphisms (RFLP). Second, the nucleotide and predicted amino acid sequence variability of the P1-coding region of 18 SMVs and the helper component/protease (HC/Pro) and CP-coding regions of 25 SMVs were assessed. The CP nucleotide and predicted amino acid sequences were the most similar and predicted phylogenetic relationships similar to those obtained from RFLP analysis. Neither RFLP nor sequence analyses of the CP-coding regions grouped the SMVs by geographical origin. The P1 and HC/Pro sequences were more variable and separated the North American and Asian SMV isolates into two groups similar to previously reported differences in pathogenic diversity of the two sets of SMV isolates. The P1 region was the most informative of the three regions analyzed. To assess the biological relevance of the sequence differences in the HC/Pro and CP coding regions, the transmissibility of 14 SMV isolates by Aphis glycines was tested. All field isolates of SMV were transmitted efficiently by A. glycines, but the laboratory isolates analyzed were transmitted poorly. The amino acid sequences from most, but not all, of the poorly transmitted isolates contained mutations in the aphid transmission-associated DAG and/or KLSC amino acid sequence motifs of CP and HC/Pro, respectively.
Kletsov, Aleksey A; Glukhovskoy, Evgeny G; Chumakov, Aleksey S; Ortiz, Joseph V
2016-01-01
The conduction properties of DNA molecule, particularly its transverse conductance (electron transfer through nucleotide bridges), represent a point of interest for DNA chemistry community, especially for DNA sequencing. However, there is no fully developed first-principles theory for molecular conductance and current that allows one to analyze the transverse flow of electrical charge through a nucleotide base. We theoretically investigate the transverse electron transport through all four DNA nucleotide bases by implementing an unbiased ab initio theoretical approach, namely, the electron propagator theory. The electrical conductance and current through DNA nucleobases (guanine [G], cytosine [C], adenine [A] and thymine [T]) inserted into a model 1-nm Ag-Ag nanogap are calculated. The magnitudes of the calculated conductance and current are ordered in the following hierarchies: gA>gG>gC>gT and IG>IA>IT>IC correspondingly. The new distinguishing parameter for the nucleobase identification is proposed, namely, the onset bias magnitude. Nucleobases exhibit the following hierarchy with respect to this parameter: Vonset(A)
Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito
2002-01-01
Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471
An improved model for whole genome phylogenetic analysis by Fourier transform.
Yin, Changchuan; Yau, Stephen S-T
2015-10-07
DNA sequence similarity comparison is one of the major steps in computational phylogenetic studies. The sequence comparison of closely related DNA sequences and genomes is usually performed by multiple sequence alignments (MSA). While the MSA method is accurate for some types of sequences, it may produce incorrect results when DNA sequences undergone rearrangements as in many bacterial and viral genomes. It is also limited by its computational complexity for comparing large volumes of data. Previously, we proposed an alignment-free method that exploits the full information contents of DNA sequences by Discrete Fourier Transform (DFT), but still with some limitations. Here, we present a significantly improved method for the similarity comparison of DNA sequences by DFT. In this method, we map DNA sequences into 2-dimensional (2D) numerical sequences and then apply DFT to transform the 2D numerical sequences into frequency domain. In the 2D mapping, the nucleotide composition of a DNA sequence is a determinant factor and the 2D mapping reduces the nucleotide composition bias in distance measure, and thus improving the similarity measure of DNA sequences. To compare the DFT power spectra of DNA sequences with different lengths, we propose an improved even scaling algorithm to extend shorter DFT power spectra to the longest length of the underlying sequences. After the DFT power spectra are evenly scaled, the spectra are in the same dimensionality of the Fourier frequency space, then the Euclidean distances of full Fourier power spectra of the DNA sequences are used as the dissimilarity metrics. The improved DFT method, with increased computational performance by 2D numerical representation, can be applicable to any DNA sequences of different length ranges. We assess the accuracy of the improved DFT similarity measure in hierarchical clustering of different DNA sequences including simulated and real datasets. The method yields accurate and reliable phylogenetic trees and demonstrates that the improved DFT dissimilarity measure is an efficient and effective similarity measure of DNA sequences. Due to its high efficiency and accuracy, the proposed DFT similarity measure is successfully applied on phylogenetic analysis for individual genes and large whole bacterial genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.
Xin, Min; Zhang, Peipei; Liu, Wenwen; Ren, Yingdang; Cao, Mengji; Wang, Xifeng
2017-10-01
The complete nucleotide sequence of a novel positive single-stranded (+ss) RNA virus, tentatively named watermelon virus A (WVA), was determined using a combination of three methods: RNA sequencing, small RNA sequencing, and Sanger sequencing. The full genome of WVA is comprised of 8,372 nucleotides (nt), excluding the poly (A) tail, and contains four open reading frames (ORFs). The largest ORF, ORF1 encodes a putative replication-associated polyprotein (RP) with three conserved domains. ORF2 and ORF4 encode a movement protein (MP) and coat protein (CP), respectively. The putative product encoded by ORF3, of an estimated molecular mass of 25 kDa, has no significant similarity with other proteins. Identity and phylogenetic analysis indicate that WVA is a new virus, closely related to members of the family Betaflexiviridae. However, the final taxonomic allocation of WVA within the family is yet to be determined.
Manipulation of lignin composition in plants using a tissue-specific promoter
Chapple, Clinton C. S.
2003-08-26
The present invention relates to methods and materials in the field of molecular biology, the manipulation of the phenylpropanoid pathway and the regulation of proteins synthesis through plant genetic engineering. More particularly, the invention relates to the introduction of a foreign nucleotide sequence into a plant genome, wherein the introduction of the nucleotide sequence effects an increase in the syringyl content of the plant's lignin. In one specific aspect, the invention relates to methods for modifying the plant lignin composition in a plant cell by the introduction there into of a foreign nucleotide sequence comprising at issue specific plant promoter sequence and a sequence encoding an active ferulate-5-hydroxylase (F5H) enzyme. Plant transformants harboring an inventive promoter-F5H construct demonstrate increased levels of syringyl monomer residues in their lignin, rendering the polymer more readily delignified and, thereby, rendering the plant more readily pulped or digested.
Evidence of codon usage in the nearest neighbor spacing distribution of bases in bacterial genomes
NASA Astrophysics Data System (ADS)
Higareda, M. F.; Geiger, O.; Mendoza, L.; Méndez-Sánchez, R. A.
2012-02-01
Statistical analysis of whole genomic sequences usually assumes a homogeneous nucleotide density throughout the genome, an assumption that has been proved incorrect for several organisms since the nucleotide density is only locally homogeneous. To avoid giving a single numerical value to this variable property, we propose the use of spectral statistics, which characterizes the density of nucleotides as a function of its position in the genome. We show that the cumulative density of bases in bacterial genomes can be separated into an average (or secular) plus a fluctuating part. Bacterial genomes can be divided into two groups according to the qualitative description of their secular part: linear and piecewise linear. These two groups of genomes show different properties when their nucleotide spacing distribution is studied. In order to analyze genomes having a variable nucleotide density, statistically, the use of unfolding is necessary, i.e., to get a separation between the secular part and the fluctuations. The unfolding allows an adequate comparison with the statistical properties of other genomes. With this methodology, four genomes were analyzed Burkholderia, Bacillus, Clostridium and Corynebacterium. Interestingly, the nearest neighbor spacing distributions or detrended distance distributions are very similar for species within the same genus but they are very different for species from different genera. This difference can be attributed to the difference in the codon usage.
Alfalfa virus S, a new species in the family Alphaflexiviridae
USDA-ARS?s Scientific Manuscript database
A new species of the family Alphaflexiviridae provisionally named alfalfa virus S (AVS) was discovered in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by high throughput sequenc...
USDA-ARS?s Scientific Manuscript database
Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...
Molecular Characterization of an Avian Astrovirus
Koci, Matthew D.; Seal, Bruce S.; Schultz-Cherry, Stacey
2000-01-01
Astroviruses are known to cause enteric disease in several animal species, including turkeys. However, only human astroviruses have been well characterized at the nucleotide level. Herein we report the nucleotide sequence, genomic organization, and predicted amino acid sequence of a turkey astrovirus isolated from poults with an emerging enteric disease. PMID:10846102
USDA-ARS?s Scientific Manuscript database
Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...
Nucleotide sequencing and identification of some wild mushrooms.
Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari
2013-01-01
The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.
Sequence variation and phylogenetic analysis of envelope glycoprotein of hepatitis G virus.
Lim, M Y; Fry, K; Yun, A; Chong, S; Linnen, J; Fung, K; Kim, J P
1997-11-01
A transfusion-transmissible agent provisionally designated hepatitis G virus (HGV) was recently identified. In this study, we examined the variability of the HGV genome by analysing sequences in the putative envelope region from 72 isolates obtained from diverse geographical sources. The 1561 nucleotide sequence of the E1/E2/NS2a region of HGV was determined from 12 isolates, and compared with three published sequences. The most variability was observed in 400 nucleotides at the N terminus of E2. We next analysed this 400 nucleotide envelope variable region (EV) from an additional 60 HGV isolates. This sequence varied considerably among the 75 isolates, with overall identity ranging from 79.3% to 99.5% at the nucleotide level, and from 83.5% to 100% at the amino acid level. However, hypervariable regions were not identified. Phylogenetic analyses indicated that the 75 HGV isolates belong to a single genotype. A single-tier distribution of evolutionary distances was observed among the 15 E1/E2/NS2a sequences and the 75 EV sequences. In contrast, 11 isolates of HCV were analysed and showed a three-tiered distribution, representing genotypes, subtypes, and isolates. The 75 isolates of HGV fell into four clusters on the phylogenetic tree. Tight geographical clustering was observed among the HGV isolates from Japan and Korea.
Nakayama, Hiroshi; Akiyama, Misaki; Taoka, Masato; Yamauchi, Yoshio; Nobe, Yuko; Ishikawa, Hideaki; Takahashi, Nobuhiro; Isobe, Toshiaki
2009-04-01
We present here a method to correlate tandem mass spectra of sample RNA nucleolytic fragments with an RNA nucleotide sequence in a DNA/RNA sequence database, thereby allowing tandem mass spectrometry (MS/MS)-based identification of RNA in biological samples. Ariadne, a unique web-based database search engine, identifies RNA by two probability-based evaluation steps of MS/MS data. In the first step, the software evaluates the matches between the masses of product ions generated by MS/MS of an RNase digest of sample RNA and those calculated from a candidate nucleotide sequence in a DNA/RNA sequence database, which then predicts the nucleotide sequences of these RNase fragments. In the second step, the candidate sequences are mapped for all RNA entries in the database, and each entry is scored for a function of occurrences of the candidate sequences to identify a particular RNA. Ariadne can also predict post-transcriptional modifications of RNA, such as methylation of nucleotide bases and/or ribose, by estimating mass shifts from the theoretical mass values. The method was validated with MS/MS data of RNase T1 digests of in vitro transcripts. It was applied successfully to identify an unknown RNA component in a tRNA mixture and to analyze post-transcriptional modification in yeast tRNA(Phe-1).
Kumar, Rajnish; Mishra, Bharat Kumar; Lahiri, Tapobrata; Kumar, Gautam; Kumar, Nilesh; Gupta, Rahul; Pal, Manoj Kumar
2017-06-01
Online retrieval of the homologous nucleotide sequences through existing alignment techniques is a common practice against the given database of sequences. The salient point of these techniques is their dependence on local alignment techniques and scoring matrices the reliability of which is limited by computational complexity and accuracy. Toward this direction, this work offers a novel way for numerical representation of genes which can further help in dividing the data space into smaller partitions helping formation of a search tree. In this context, this paper introduces a 36-dimensional Periodicity Count Value (PCV) which is representative of a particular nucleotide sequence and created through adaptation from the concept of stochastic model of Kolekar et al. (American Institute of Physics 1298:307-312, 2010. doi: 10.1063/1.3516320 ). The PCV construct uses information on physicochemical properties of nucleotides and their positional distribution pattern within a gene. It is observed that PCV representation of gene reduces computational cost in the calculation of distances between a pair of genes while being consistent with the existing methods. The validity of PCV-based method was further tested through their use in molecular phylogeny constructs in comparison with that using existing sequence alignment methods.
Hobbs, A A; Rosen, J M
1982-01-01
The complete sequences of rat alpha- and gamma-casein mRNAs have been determined. The 1402-nucleotide alpha- and 864-nucleotide gamma-casein mRNAs both encode 15 amino acid signal peptides and mature proteins of 269 and 164 residues, respectively. Considerable homology between the 5' non-coding regions, and the regions encoding the signal peptides and the phosphorylation sites, in these mRNAs as compared to several other rodent casein mRNAs, was observed. Significant homology was also detected between rat alpha- and bovine alpha s1-casein. Comparison of the rodent and bovine sequences suggests that the caseins evolved at about the time of the appearance of the primitive mammals. This may have occurred by intragenic duplication of a nucleotide sequence encoding a primitive phosphorylation site, -(Ser)n-Glu-Glu-, and intergenic duplication resulting in the small casein multigene family. A unique feature of the rat alpha-casein sequence is an insertion in the coding region containing 10 repeated elements of 18 nucleotides each. This insertion appears to have occurred 7-12 million years ago, just prior to the divergence of rat and mouse. Images PMID:6298707
Guédon, Yann; d'Aubenton-Carafa, Yves; Thermes, Claude
2006-03-01
The most commonly used models for analysing local dependencies in DNA sequences are (high-order) Markov chains. Incorporating knowledge relative to the possible grouping of the nucleotides enables to define dedicated sub-classes of Markov chains. The problem of formulating lumpability hypotheses for a Markov chain is therefore addressed. In the classical approach to lumpability, this problem can be formulated as the determination of an appropriate state space (smaller than the original state space) such that the lumped chain defined on this state space retains the Markov property. We propose a different perspective on lumpability where the state space is fixed and the partitioning of this state space is represented by a one-to-many probabilistic function within a two-level stochastic process. Three nested classes of lumped processes can be defined in this way as sub-classes of first-order Markov chains. These lumped processes enable parsimonious reparameterizations of Markov chains that help to reveal relevant partitions of the state space. Characterizations of the lumped processes on the original transition probability matrix are derived. Different model selection methods relying either on hypothesis testing or on penalized log-likelihood criteria are presented as well as extensions to lumped processes constructed from high-order Markov chains. The relevance of the proposed approach to lumpability is illustrated by the analysis of DNA sequences. In particular, the use of lumped processes enables to highlight differences between intronic sequences and gene untranslated region sequences.
Enzmann, P.-J.; Kurath, G.; Fichtner, D.; Bergmann, S.M.
2005-01-01
Infectious hematopoietic necrosis virus (IHNV) was first detected in Europe in 1987 in France and Italy, and later, in 1992, in Germany. The source of the virus and the route of introduction are unknown. The present study investigates the molecular epidemiology of IHNV outbreaks in Germany since its first introduction. The complete nucleotide sequences of the glycoprotein (G) and non-virion (NV) genes from 9 IHNV isolates from Germany have been determined, and this has allowed the identification of characteristic differences between these isolates. Phylogenetic analysis of partial G gene sequences (mid-G, 303 nucleotides) from North American IHNV isolates (Kurath et al. 2003) has revealed 3 major genogroups, designated U, M and L. Using this gene region with 2 different North American IHNV data sets, it was possible to group the European IHNV strains within the M genogroup, but not in any previously defined subgroup. Analysis of the full length G gene sequences indicated that an independent evolution of IHN viruses had occurred in Europe. IHN viruses in Europe seem to be of a monophyletic origin, again most closely related to North American isolates in the M genogroup. Analysis of the NV gene sequences also showed the European isolates to be monophyletic, but resolution of the 3 genogroups was poor with this gene region. As a result of comparative sequence analyses, several different genotypes have been identified circulating in Europe. ?? Inter-Research 2005.
Ndhlovu, Andrew; Durand, Pierre M.; Hazelhurst, Scott
2015-01-01
The evolutionary rate at codon sites across protein-coding nucleotide sequences represents a valuable tier of information for aligning sequences, inferring homology and constructing phylogenetic profiles. However, a comprehensive resource for cataloguing the evolutionary rate at codon sites and their corresponding nucleotide and protein domain sequence alignments has not been developed. To address this gap in knowledge, EvoDB (an Evolutionary rates DataBase) was compiled. Nucleotide sequences and their corresponding protein domain data including the associated seed alignments from the PFAM-A (protein family) database were used to estimate evolutionary rate (ω = dN/dS) profiles at codon sites for each entry. EvoDB contains 98.83% of the gapped nucleotide sequence alignments and 97.1% of the evolutionary rate profiles for the corresponding information in PFAM-A. As the identification of codon sites under positive selection and their position in a sequence profile is usually the most sought after information for molecular evolutionary biologists, evolutionary rate profiles were determined under the M2a model using the CODEML algorithm in the PAML (Phylogenetic Analysis by Maximum Likelihood) suite of software. Validation of nucleotide sequences against amino acid data was implemented to ensure high data quality. EvoDB is a catalogue of the evolutionary rate profiles and provides the corresponding phylogenetic trees, PFAM-A alignments and annotated accession identifier data. In addition, the database can be explored and queried using known evolutionary rate profiles to identify domains under similar evolutionary constraints and pressures. EvoDB is a resource for evolutionary, phylogenetic studies and presents a tier of information untapped by current databases. Database URL: http://www.bioinf.wits.ac.za/software/fire/evodb PMID:26140928
Ndhlovu, Andrew; Durand, Pierre M; Hazelhurst, Scott
2015-01-01
The evolutionary rate at codon sites across protein-coding nucleotide sequences represents a valuable tier of information for aligning sequences, inferring homology and constructing phylogenetic profiles. However, a comprehensive resource for cataloguing the evolutionary rate at codon sites and their corresponding nucleotide and protein domain sequence alignments has not been developed. To address this gap in knowledge, EvoDB (an Evolutionary rates DataBase) was compiled. Nucleotide sequences and their corresponding protein domain data including the associated seed alignments from the PFAM-A (protein family) database were used to estimate evolutionary rate (ω = dN/dS) profiles at codon sites for each entry. EvoDB contains 98.83% of the gapped nucleotide sequence alignments and 97.1% of the evolutionary rate profiles for the corresponding information in PFAM-A. As the identification of codon sites under positive selection and their position in a sequence profile is usually the most sought after information for molecular evolutionary biologists, evolutionary rate profiles were determined under the M2a model using the CODEML algorithm in the PAML (Phylogenetic Analysis by Maximum Likelihood) suite of software. Validation of nucleotide sequences against amino acid data was implemented to ensure high data quality. EvoDB is a catalogue of the evolutionary rate profiles and provides the corresponding phylogenetic trees, PFAM-A alignments and annotated accession identifier data. In addition, the database can be explored and queried using known evolutionary rate profiles to identify domains under similar evolutionary constraints and pressures. EvoDB is a resource for evolutionary, phylogenetic studies and presents a tier of information untapped by current databases. © The Author(s) 2015. Published by Oxford University Press.
Pightling, Arthur W.; Petronella, Nicholas; Pagotto, Franco
2014-01-01
The wide availability of whole-genome sequencing (WGS) and an abundance of open-source software have made detection of single-nucleotide polymorphisms (SNPs) in bacterial genomes an increasingly accessible and effective tool for comparative analyses. Thus, ensuring that real nucleotide differences between genomes (i.e., true SNPs) are detected at high rates and that the influences of errors (such as false positive SNPs, ambiguously called sites, and gaps) are mitigated is of utmost importance. The choices researchers make regarding the generation and analysis of WGS data can greatly influence the accuracy of short-read sequence alignments and, therefore, the efficacy of such experiments. We studied the effects of some of these choices, including: i) depth of sequencing coverage, ii) choice of reference-guided short-read sequence assembler, iii) choice of reference genome, and iv) whether to perform read-quality filtering and trimming, on our ability to detect true SNPs and on the frequencies of errors. We performed benchmarking experiments, during which we assembled simulated and real Listeria monocytogenes strain 08-5578 short-read sequence datasets of varying quality with four commonly used assemblers (BWA, MOSAIK, Novoalign, and SMALT), using reference genomes of varying genetic distances, and with or without read pre-processing (i.e., quality filtering and trimming). We found that assemblies of at least 50-fold coverage provided the most accurate results. In addition, MOSAIK yielded the fewest errors when reads were aligned to a nearly identical reference genome, while using SMALT to align reads against a reference sequence that is ∼0.82% distant from 08-5578 at the nucleotide level resulted in the detection of the greatest numbers of true SNPs and the fewest errors. Finally, we show that whether read pre-processing improves SNP detection depends upon the choice of reference sequence and assembler. In total, this study demonstrates that researchers should test a variety of conditions to achieve optimal results. PMID:25144537
Complete genomic sequence of a Tobacco rattle virus isolate from Michigan-grown potatoes.
Crosslin, James M; Hamm, Philip B; Kirk, William W; Hammond, Rosemarie W
2010-04-01
Tobacco rattle virus (TRV) causes stem mottle on potato leaves and necrotic arcs and rings in potato tubers, known as corky ringspot disease. Recently, TRV was reported in Michigan potato tubers cv. FL1879 exhibiting corky ringspot disease. Sequence analysis of the RNA-1-encoded 16-kDa gene of the Michigan isolate, designated MI-1, revealed homology to TRV isolates from Florida and Washington. Here, we report the complete genomic sequence of RNA-1 (6,791 nt) and RNA-2 (3,685 nt) of TRV MI-1. RNA-1 is predicted to contain four open reading frames, and the genome structure and phylogenetic analyses of the RNA-1 nucleotide sequence revealed significant homologies to the known sequences of other TRV-1 isolates. The relationships based on the full-length nucleotide sequence were different from than those based on the 16-kDa gene encoded on genomic RNA-1 and reflect sequence variation within a 20-25-aa residue region of the 16-kDa protein. MI-1 RNA-2 is predicted to contain three ORFs, encoding the coat protein (CP), a 37.6-kDa protein (ORF 2b), and a 33.6-kDa protein (ORF 2c). In addition, it contains a region of similarity to the 3' terminus of RNA-1, including a truncated portion of the 16-kDa cistron. Phylogenetic analysis of RNA-2, based on a comparison of nucleotide sequences with other members of the genus Tobravirus, indicates that TRV MI-1 and other North American isolates cluster as a distinct group. TRV M1-1 is only the second North American isolate for which there is a complete sequence of the genome, and it is distinct from the North American isolate TRV ORY. The relationship of the TRV MI-1 isolate to other tobravirus isolates is discussed.
Stability of Tandem Repeats in the Drosophila Melanogaster HSR-Omega Nuclear RNA
Hogan, N. C.; Slot, F.; Traverse, K. L.; Garbe, J. C.; Bendena, W. G.; Pardue, M. L.
1995-01-01
The Drosophila melanogaster Hsr-omega locus produces a nuclear RNA containing >5 kb of tandem repeat sequences. These repeats are unique to Hsr-omega and show concerted evolution similar to that seen with classical satellite DNAs. In D. melanogaster the monomer is ~280 bp. Sequences of 191/2 monomers differ by 8 +/- 5% (mean +/- SD), when all pairwise comparisons are considered. Differences are single nucleotide substitutions and 1-3 nucleotide deletions/insertions. Changes appear to be randomly distributed over the repeat unit. Outer repeats do not show the decrease in monomer homogeneity that might be expected if homogeneity is maintained by recombination. However, just outside the last complete repeat at each end, there are a few fragments of sequence similar to the monomer. The sequences in these flanking regions are not those predicted for sequences decaying in the absence of recombination. Instead, the fragmentation of the sequence homology suggests that flanking regions have undergone more severe disruptions, possibly during an insertion or amplification event. Hsr-omega alleles differing in the number of repeats are detected and appear to be stable over a few thousand generations; however, both increases and decreases in repeat numbers have been observed. The new alleles appear to be as stable as their predecessors. No alleles of less than ~5 kb nor more than ~16 kb of repeats were seen in any stocks examined. The evidence that there is a limit on the minimum number of repeats is consistent with the suggestion that these repeats are important in the function of the unusual Hsr-omega nuclear RNA. PMID:7540581
McMeel, O M; Hoey, E M; Ferguson, A
2001-01-01
The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.
Franciosa, Giovanna; Pourshaban, Manoocheher; De Luca, Alessandro; Buccino, Anna; Dallapiccola, Bruno; Aureli, Paolo
2004-01-01
Denaturing high-performance liquid chromatography (DHPLC) is a recently developed technique for rapid screening of nucleotide polymorphisms in PCR products. We used this technique for the identification of type A, B, E, and F botulinum neurotoxin genes. PCR products amplified from a conserved region of the type A, B, E, and F botulinum toxin genes from Clostridium botulinum, neurotoxigenic C. butyricum type E, and C. baratii type F strains were subjected to both DHPLC analysis and sequencing. Unique DHPLC peak profiles were obtained with each different type of botulinum toxin gene fragment, consistent with nucleotide differences observed in the related sequences. We then evaluated the ability of this technique to identify botulinal neurotoxigenic organisms at the genus and species level. A specific short region of the 16S rRNA gene which contains genus-specific and in some cases species-specific heterogeneity was amplified from botulinum neurotoxigenic clostridia and from different food-borne pathogens and subjected to DHPLC analysis. Different peak profiles were obtained for each genus and species, demonstrating that the technique could be a reliable alternative to sequencing for the rapid identification of food-borne pathogens, specifically of botulinal neurotoxigenic clostridia most frequently implicated in human botulism. PMID:15240298
[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].
Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I
1985-11-01
The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.
Sequence-specific bias correction for RNA-seq data using recurrent neural networks.
Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru
2017-01-25
The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.
Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.
Levis, R; Schlesinger, S; Huang, H V
1990-04-01
Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.
Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya
2011-01-01
To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533
Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.
2016-01-01
Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524
Molecular detection of viral agents in free-ranging and captive neotropical felids in Brazil.
Furtado, Mariana M; Taniwaki, Sueli A; de Barros, Iracema N; Brandão, Paulo E; Catão-Dias, José L; Cavalcanti, Sandra; Cullen, Laury; Filoni, Claudia; Jácomo, Anah T de Almeida; Jorge, Rodrigo S P; Silva, Nairléia Dos Santos; Silveira, Leandro; Ferreira Neto, José S
2017-09-01
We describe molecular testing for felid alphaherpesvirus 1 (FHV-1), carnivore protoparvovirus 1 (CPPV-1), feline calicivirus (FCV), alphacoronavirus 1 (feline coronavirus [FCoV]), feline leukemia virus (FeLV), feline immunodeficiency virus (FIV), and canine distemper virus (CDV) in whole blood samples of 109 free-ranging and 68 captive neotropical felids from Brazil. Samples from 2 jaguars ( Panthera onca) and 1 oncilla ( Leopardus tigrinus) were positive for FHV-1; 2 jaguars, 1 puma ( Puma concolor), and 1 jaguarundi ( Herpairulus yagouaroundi) tested positive for CPPV-1; and 1 puma was positive for FIV. Based on comparison of 103 nucleotides of the UL24-UL25 gene, the FHV-1 sequences were 99-100% similar to the FHV-1 strain of domestic cats. Nucleotide sequences of CPPV-1 were closely related to sequences detected in other wild carnivores, comparing 294 nucleotides of the VP1 gene. The FIV nucleotide sequence detected in the free-ranging puma, based on comparison of 444 nucleotides of the pol gene, grouped with other lentiviruses described in pumas, and had 82.4% identity with a free-ranging puma from Yellowstone Park and 79.5% with a captive puma from Brazil. Our data document the circulation of FHV-1, CPPV-1, and FIV in neotropical felids in Brazil.
Fauzi, Hamid; Agyeman, Akwasi; Hines, Jennifer V.
2008-01-01
Many bacteria utilize riboswitch transcription regulation to monitor and appropriately respond to cellular levels of important metabolites or effector molecules. The T box transcription antitermination riboswitch responds to cognate uncharged tRNA by specifically stabilizing an antiterminator element in the 5′-untranslated mRNA leader region and precluding formation of a thermodynamically more stable terminator element. Stabilization occurs when the tRNA acceptor end base pairs with the first four nucleotides in the seven nucleotide bulge of the highly conserved antiterminator element. The significance of the conservation of the antiterminator bulge nucleotides that do not base pair with the tRNA is unknown, but they are required for optimal function. In vitro selection was used to determine if the isolated antiterminator bulge context alone dictates the mode in which the tRNA acceptor end binds the bulge nucleotides. No sequence conservation beyond complementarity was observed and the location was not constrained to the first four bases of the bulge. The results indicate that formation of a structure that recognizes the tRNA acceptor end in isolation is not the determinant driving force for the high phylogenetic sequence conservation observed within the antiterminator bulge. Additional factors or T box leader features more likely influenced the phylogenetic sequence conservation. PMID:19152843
A space-efficient algorithm for local similarities.
Huang, X Q; Hardison, R C; Miller, W
1990-10-01
Existing dynamic-programming algorithms for identifying similar regions of two sequences require time and space proportional to the product of the sequence lengths. Often this space requirement is more limiting than the time requirement. We describe a dynamic-programming local-similarity algorithm that needs only space proportional to the sum of the sequence lengths. The method can also find repeats within a single long sequence. To illustrate the algorithm's potential, we discuss comparison of a 73,360 nucleotide sequence containing the human beta-like globin gene cluster and a corresponding 44,594 nucleotide sequence for rabbit, a problem well beyond the capabilities of other dynamic-programming software.
Sample, Paul J.; Gaston, Kirk W.; Alfonzo, Juan D.; Limbach, Patrick A.
2015-01-01
Ribosomal ribonucleic acid (RNA), transfer RNA and other biological or synthetic RNA polymers can contain nucleotides that have been modified by the addition of chemical groups. Traditional Sanger sequencing methods cannot establish the chemical nature and sequence of these modified-nucleotide containing oligomers. Mass spectrometry (MS) has become the conventional approach for determining the nucleotide composition, modification status and sequence of modified RNAs. Modified RNAs are analyzed by MS using collision-induced dissociation tandem mass spectrometry (CID MS/MS), which produces a complex dataset of oligomeric fragments that must be interpreted to identify and place modified nucleosides within the RNA sequence. Here we report the development of RoboOligo, an interactive software program for the robust analysis of data generated by CID MS/MS of RNA oligomers. There are three main functions of RoboOligo: (i) automated de novo sequencing via the local search paradigm. (ii) Manual sequencing with real-time spectrum labeling and cumulative intensity scoring. (iii) A hybrid approach, coined ‘variable sequencing’, which combines the user intuition of manual sequencing with the high-throughput sampling of automated de novo sequencing. PMID:25820423
FASH: A web application for nucleotides sequence search.
Veksler-Lublinksy, Isana; Barash, Danny; Avisar, Chai; Troim, Einav; Chew, Paul; Kedem, Klara
2008-05-27
: FASH (Fourier Alignment Sequence Heuristics) is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome), FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. FASH can be accessed athttps://fash.bgu.ac.il:8443/fash/default.jsp (secured website).
Wu, L-P; Yang, T; Liu, H-W; Postman, J; Li, R
2018-05-01
A large contig with sequence similarities to several nucleorhabdoviruses was identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genome sequence of this new nucleorhabdovirus is 14,432 nucleotides long. Its genomic organization is very similar to those of unsegmented plant rhabdoviruses, containing six open reading frames in the order 3'-N-P-P3-M-G-L-5. The virus, which is provisionally named "black currant-associated rhabdovirus", is 41-52% identical in its genome nucleotide sequence to other nucleorhabdoviruses and may represent a new species in the genus Nucleorhabdovirus.
Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai
2013-08-01
To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.
Rojas, Miguel; Gonçalves, Jorge Luiz S; Dias, Helver G; Manchego, Alberto; Pezo, Danilo; Santos, Norma
2016-11-30
The SA44 isolate of Rotavirus A (RVA) was identified from a neonatal Peruvian alpaca presenting with diarrhea, and the full-length genome sequence of the isolate (designated RVA/Alpaca-tc/PER/SA44/2014/G3P[40]) was determined. Phylogenetic analyses showed that the isolate possessed the genotype constellation G3-P[40]-I8-R3-C3-M3-A9-N3-T3-E3-H6, which differs considerably from those of RVA strains isolated from other species of the order Artiodactyla. Overall, the genetic constellation of the SA44 strain was quite similar to those of RVA strains isolated from a bat in Asia (MSLH14 and MYAS33). Nonetheless, phylogenetic analyses of each genome segment identified a distinct combination of genes. Several sequences were closely related to corresponding gene sequences in RVA strains from other species, including human (VP1, VP2, NSP1, and NSP2), simian (VP3 and NSP5), bat (VP6 and NSP4), and equine (NSP3). The VP7 gene sequence was closely related to RVA strains from a Peruvian alpaca (K'ayra/3368-10; 99.0% nucleotide and 99.7% amino acid identity) and from humans (RCH272; 95% nucleotide and 99.0% amino acid identity). The nucleotide sequence of the VP4 gene was distantly related to other VP4 sequences and was designated as the reference strain for the new P[40] genotype. This unique genetic makeup suggests that the SA44 strain emerged from multiple reassortment events between bat-, equine-, and human-like RVA strains. Copyright © 2016 Elsevier B.V. All rights reserved.
Nagai, Alice; Duarte, Lígia M L; Chaves, Alexandre L R; Alexandre, Maria A V; Ramos-González, Pedro L; Chabi-Jesus, Camila; Harakava, Ricardo; Dos Santos, Déborah Y A C
2018-05-10
The complete nucleotide sequence of an isolate of tomato mottle mosaic virus (ToMMV) was determined. The virus, originally isolated from symptomatic tomato plants found in a county near the city of São Paulo, Brazil, has a genome with 99% nucleotide sequence identity with ToMMV from Mexico, China, Spain, and the United States. Copyright © 2018 Nagai et al.
USDA-ARS?s Scientific Manuscript database
Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...
Beasley, D W; Suderman, M T; Holbrook, M R; Barrett, A D
2001-11-05
Deer tick virus (DTV) is a recently recognized North American virus isolated from Ixodes dammini ticks. Nucleotide sequencing of fragments of structural and non-structural protein genes suggested that this virus was most closely related to the tick-borne flavivirus Powassan (POW), which causes potentially fatal encephalitis in humans. To determine whether DTV represents a new and distinct member of the Flavivirus genus of the family Flaviviridae, we sequenced the structural protein genes and 5' and 3' non-coding regions of this virus. In addition, we compared the reactivity of DTV and POW in hemagglutination inhibition tests with a panel of polyclonal and monoclonal antisera, and performed cross-neutralization experiments using anti-DTV antisera. Nucleotide sequencing revealed a high degree of homology between DTV and POW at both nucleotide (>80% homology) and amino acid (>90% homology) levels, and the two viruses were indistinguishable in serological assays and mouse neuroinvasiveness. On the basis of these results, we suggest that DTV should be classified as a genotype of POW virus.
Wang, C S; Chao, S Y; Ku, C C; Wen, C M; Shih, H H
2009-06-01
Viruses belonging to the genus Megalocytivirus in the family Iridoviridae are one of the major agents causing mass mortalities in marine and freshwater fish in Asian countries. Outbreaks of iridovirus disease have been reported among various fish species in Taiwan. However, the genotypes of these iridoviruses have not yet been determined. In this study, seven megalocytivirus isolates from four fish species: king grouper, Epinephelus lanceolatus (Bloch), barramundi perch, Lates calcarifer (Bloch), silver sea bream, Rhabdosargus sarba (Forsskal), and common ponyfish, Leiognathus equulus (Forsskal), cultured in three different regions of Taiwan were collected. The full open reading frame encoding the viral major capsid protein gene was amplified using PCR. The PCR products of approximately 1581 bp were cloned and the nucleotide sequences were phylogenetically analysed. Results showed that all seven PCR products contained a unique open reading frame with 1362 nucleotides and encoded a structural protein with 453 amino acids. Even though the nucleotide sequences were not identical, these seven megalocytiviruses were classified into one cluster and showed very high homology with red sea bream iridovirus (RSIV) with more than 97% identity. Thus, the seven iridovirus strains isolated from cultured marine fish in Taiwan were closer to the RSIV genotype than the infectious spleen and kidney necrosis virus genotype.
Circulation of Endemic Type 2 Vaccine-Derived Poliovirus in Egypt from 1983 to 1993
Yang, Chen-Fu; Naguib, Tary; Yang, Su-Ju; Nasr, Eman; Jorba, Jaume; Ahmed, Nahed; Campagnoli, Ray; van der Avoort, Harrie; Shimizu, Hiroyuki; Yoneyama, Tetsuo; Miyamura, Tatsuo; Pallansch, Mark; Kew, Olen
2003-01-01
From 1988 to 1993, 30 cases of poliomyelitis associated with poliovirus type 2 were found in seven governorates of Egypt. Because many of the cases were geographically and temporally clustered and because the case isolates differed antigenically from the vaccine strain, it was initially assumed that the cases signaled the continued circulation of wild type 2 poliovirus. However, comparison of sequences encoding the major capsid protein, VP1 (903 nucleotides), revealed that the isolates were related (93 to 97% nucleotide sequence identity) to the Sabin type 2 oral poliovirus vaccine (OPV) strain and unrelated (<82% nucleotide sequence identity) to the wild type 2 polioviruses previously indigenous to Egypt (last known isolate: 1979) or to any contemporary wild type 2 polioviruses found elsewhere. The rate and pattern of VP1 divergence among the circulating vaccine-derived poliovirus (cVDPV) isolates suggested that all lineages were derived from a single OPV infection that occurred around 1983 and that progeny from the initiating infection circulated for approximately a decade within Egypt along several independent chains of transmission. Complete genomic sequences of an early (1988) and a late (1993) cVDPV isolate revealed that their 5′ untranslated region (5′ UTR) and noncapsid- 3′ UTR sequences were derived from other species C enteroviruses. Circulation of type 2 cVDPVs occurred at a time of low OPV coverage in the affected communities and ceased when OPV coverage rates increased. The potential for cVDPVs to circulate in populations with low immunity to poliovirus has important implications for current and future strategies to eradicate polio worldwide. PMID:12857906
Circulation of endemic type 2 vaccine-derived poliovirus in Egypt from 1983 to 1993.
Yang, Chen-Fu; Naguib, Tary; Yang, Su-Ju; Nasr, Eman; Jorba, Jaume; Ahmed, Nahed; Campagnoli, Ray; van der Avoort, Harrie; Shimizu, Hiroyuki; Yoneyama, Tetsuo; Miyamura, Tatsuo; Pallansch, Mark; Kew, Olen
2003-08-01
From 1988 to 1993, 30 cases of poliomyelitis associated with poliovirus type 2 were found in seven governorates of Egypt. Because many of the cases were geographically and temporally clustered and because the case isolates differed antigenically from the vaccine strain, it was initially assumed that the cases signaled the continued circulation of wild type 2 poliovirus. However, comparison of sequences encoding the major capsid protein, VP1 (903 nucleotides), revealed that the isolates were related (93 to 97% nucleotide sequence identity) to the Sabin type 2 oral poliovirus vaccine (OPV) strain and unrelated (<82% nucleotide sequence identity) to the wild type 2 polioviruses previously indigenous to Egypt (last known isolate: 1979) or to any contemporary wild type 2 polioviruses found elsewhere. The rate and pattern of VP1 divergence among the circulating vaccine-derived poliovirus (cVDPV) isolates suggested that all lineages were derived from a single OPV infection that occurred around 1983 and that progeny from the initiating infection circulated for approximately a decade within Egypt along several independent chains of transmission. Complete genomic sequences of an early (1988) and a late (1993) cVDPV isolate revealed that their 5' untranslated region (5' UTR) and noncapsid- 3' UTR sequences were derived from other species C enteroviruses. Circulation of type 2 cVDPVs occurred at a time of low OPV coverage in the affected communities and ceased when OPV coverage rates increased. The potential for cVDPVs to circulate in populations with low immunity to poliovirus has important implications for current and future strategies to eradicate polio worldwide.
Church, George M.; Kieffer-Higgins, Stephen
1992-01-01
This invention features vectors and a method for sequencing DNA. The method includes the steps of: a) ligating the DNA into a vector comprising a tag sequence, the tag sequence includes at least 15 bases, wherein the tag sequence will not hybridize to the DNA under stringent hybridization conditions and is unique in the vector, to form a hybrid vector, b) treating the hybrid vector in a plurality of vessels to produce fragments comprising the tag sequence, wherein the fragments differ in length and terminate at a fixed known base or bases, wherein the fixed known base or bases differs in each vessel, c) separating the fragments from each vessel according to their size, d) hybridizing the fragments with an oligonucleotide able to hybridize specifically with the tag sequence, and e) detecting the pattern of hybridization of the tag sequence, wherein the pattern reflects the nucleotide sequence of the DNA.
Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R. Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M.; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas
2011-01-01
Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi. PMID:21949797
Transposon Tn10 contains two structural genes with opposite polarity between tetA and IS10R.
Schollmeier, K; Hillen, W
1984-01-01
The nucleotide sequence of the central part of Tn10 has been determined from the rightmost HindIII site to IS10R. This sequence contains two open reading frames with opposite polarity. The in vivo transcription start points in this sequence have been determined by S1 mapping. These results define one minor and two major promoters. The transcription starts of the two major promoters are only 18 base pairs apart, and the transcripts show different polarity and overlap by 18 base pairs. The nucleotide sequence reveals two regions with palindromic symmetry which may serve as operators. Their possible involvement in the regulation of transcription of both genes is discussed. Taken together these results allow for a maximal coding capacity of 138 amino acids directed toward IS10R and 197 amino acids directed toward tetA. The possible function of these gene products is discussed. The accompanying article (Braus et al., J. Bacteriol. 160:504-509, 1984) presents evidence that these genes are expressed. Images PMID:6094471
Kodama, Yuichi; Mashima, Jun; Kaminuma, Eli; Gojobori, Takashi; Ogasawara, Osamu; Takagi, Toshihisa; Okubo, Kousaku; Nakamura, Yasukazu
2012-01-01
The DNA Data Bank of Japan (DDBJ; http://www.ddbj.nig.ac.jp) maintains and provides archival, retrieval and analytical resources for biological information. The central DDBJ resource consists of public, open-access nucleotide sequence databases including raw sequence reads, assembly information and functional annotation. Database content is exchanged with EBI and NCBI within the framework of the International Nucleotide Sequence Database Collaboration (INSDC). In 2011, DDBJ launched two new resources: the 'DDBJ Omics Archive' (DOR; http://trace.ddbj.nig.ac.jp/dor) and BioProject (http://trace.ddbj.nig.ac.jp/bioproject). DOR is an archival database of functional genomics data generated by microarray and highly parallel new generation sequencers. Data are exchanged between the ArrayExpress at EBI and DOR in the common MAGE-TAB format. BioProject provides an organizational framework to access metadata about research projects and the data from the projects that are deposited into different databases. In this article, we describe major changes and improvements introduced to the DDBJ services, and the launch of two new resources: DOR and BioProject.
An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin
2017-09-11
Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica , about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N 50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both "Zheda 23" and "Zheda 83". Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species.
Takahashi, Mayumi; Wu, Xiwei; Ho, Michelle; Chomchan, Pritsana; Rossi, John J.; Burnett, John C.; Zhou, Jiehua
2016-01-01
The systemic evolution of ligands by exponential enrichment (SELEX) technique is a powerful and effective aptamer-selection procedure. However, modifications to the process can dramatically improve selection efficiency and aptamer performance. For example, droplet digital PCR (ddPCR) has been recently incorporated into SELEX selection protocols to putatively reduce the propagation of byproducts and avoid selection bias that result from differences in PCR efficiency of sequences within the random library. However, a detailed, parallel comparison of the efficacy of conventional solution PCR versus the ddPCR modification in the RNA aptamer-selection process is needed to understand effects on overall SELEX performance. In the present study, we took advantage of powerful high throughput sequencing technology and bioinformatics analysis coupled with SELEX (HT-SELEX) to thoroughly investigate the effects of initial library and PCR methods in the RNA aptamer identification. Our analysis revealed that distinct “biased sequences” and nucleotide composition existed in the initial, unselected libraries purchased from two different manufacturers and that the fate of the “biased sequences” was target-dependent during selection. Our comparison of solution PCR- and ddPCR-driven HT-SELEX demonstrated that PCR method affected not only the nucleotide composition of the enriched sequences, but also the overall SELEX efficiency and aptamer efficacy. PMID:27652575
Yang, Seung Hak; Lim, Joung Soo; Khan, Modabber Ahmed; Kim, Bong Soo; Choi, Dong Yoon; Lee, Eun Young; Ahn, Hee Kwon
2015-01-01
The leachate generated by the decomposition of animal carcass has been implicated as an environmental contaminant surrounding the burial site. High-throughput nucleotide sequencing was conducted to investigate the bacterial communities in leachates from the decomposition of pig carcasses. We acquired 51,230 reads from six different samples (1, 2, 3, 4, 6 and 14 week-old carcasses) and found that sequences representing the phylum Firmicutes predominated. The diversity of bacterial 16S rRNA gene sequences in the leachate was the highest at 6 weeks, in contrast to those at 2 and 14 weeks. The relative abundance of Firmicutes was reduced, while the proportion of Bacteroidetes and Proteobacteria increased from 3–6 weeks. The representation of phyla was restored after 14 weeks. However, the community structures between the samples taken at 1–2 and 14 weeks differed at the bacterial classification level. The trend in pH was similar to the changes seen in bacterial communities, indicating that the pH of the leachate could be related to the shift in the microbial community. The results indicate that the composition of bacterial communities in leachates of decomposing pig carcasses shifted continuously during the study period and might be influenced by the burial site. PMID:26500442
Simonen, Marja-Leena; Roivainen, Merja; Iber, Jane; Burns, Cara; Hovi, Tapani
2010-01-01
In 1984, a wild type 3 poliovirus (PV3/FIN84) spread all over Finland causing nine cases of paralytic poliomyelitis and one case of aseptic meningitis. The outbreak was ended in 1985 with an intensive vaccination campaign. By limited sequence comparison with previously isolated PV3 strains, closest relatives of PV3/FIN84 were found among strains circulating in the Mediterranean region. Now we wanted to reanalyse the relationships using approaches currently exploited in poliovirus surveillance. Cell lysates of 22 strains isolated during the outbreak and stored frozen were subjected to RT-PCR amplification in three genomic regions without prior subculture. Sequences of the entire VP1 coding region, 150 nucleotides in the VP1-2A junction, most of the 5' non-coding region, partial sequences of the 3D RNA polymerase coding region and partial 3' non-coding region were compared within the outbreak and with sequences available in data banks. In addition, complete nucleotide sequences were obtained for 2 strains isolated from two different cases of disease during the outbreak. The results confirmed the previously described wide intraepidemic variation of the strains, including amino acid substitutions in antigenic sites, as well as the likely Mediterranean region origin of the strains. Simplot and bootscanning analyses of the complete genomes indicated complicated evolutionary history of the non-capsid coding regions of the genome suggesting several recombinations with different HEV-C viruses in the past.
Selection rhizosphere-competent microbes for development of microbial products as biocontrol agents
NASA Astrophysics Data System (ADS)
Mashinistova, A. V.; Elchin, A. A.; Gorbunova, N. V.; Muratov, V. S.; Kydralieva, K. A.; Khudaibergenova, B. M.; Shabaev, V. P.; Jorobekova, Sh. J.
2009-04-01
Rhizosphere-borne microorganisms reintroduced to the soil-root interface can establish without inducing permanent disturbance in the microbial balance and effectively colonise the rhizosphere due to carbon sources of plant root exudates. A challenge for future development of microbial products for use in agriculture will be selection of rhizosphere-competent microbes that both protect the plant from pathogens and improve crop establishment and persistence. In this study screening, collection, identification and expression of stable and technological microbial strains living in soils and in the rhizosphere of abundant weed - couch-grass Elytrigia repens L. Nevski were conducted. A total of 98 bacteria isolated from the rhizosphere were assessed for biocontrol activity in vitro against phytopathogenic fungi including Fusarium culmorum, Fusarium heterosporum, Fusarium oxysporum, Drechslera teres, Bipolaris sorokiniana, Piricularia oryzae, Botrytis cinerea, Colletothrichum atramentarium and Cladosporium sp., Stagonospora nodorum. Biocontrol activity were performed by the following methods: radial and parallel streaks, "host - pathogen" on the cuts of wheat leaves. A culture collection comprising 64 potential biocontrol agents (BCA) against wheat and barley root diseases has been established. Of these, the most effective were 8 isolates inhibitory to at least 4 out of 5 phytopathogenic fungi tested. The remaining isolates inhibited at least 1 of 5 fungi tested. Growth stimulating activity of proposed rhizobacteria-based preparations was estimated using seedling and vegetative pot techniques. Seeds-inoculation and the tests in laboratory and field conditions were conducted for different agricultural crops - wheat and barley. Intact cells, liquid culture filtrates and crude extracts of the four beneficial bacterial strains isolated from the rhizosphere of weed were studied to stimulate plant growth. As a result, four bacterial strains selected from rhizosphere of weed - couch-grass Elytrigia repens L. Nevski were chosen as a core of collection of 98 pure cultures with high fungicidal and plant growth-stimulating potentials. Partial determination of nucleotide sequence of 16S ribosomes of tested bacteria indicated that Pseudomonas and Bacillus species were the most dominant bacteria exhibiting biocontrol activity. Typing of bacterial strains was performed on the basis of partial determination of nucleotide sequence 16S ribosome of the studying strain. For this purpose polymerase chain reaction (PCR), using specific primers was provided with chromosomal DNA of bacterial strain under study. After determination of nucleotide sequences of the obtained PCR-fragments, the data obtained was compared with the sequences available in the bank of data (GENEBANK: http://www.ncbi.nlm.nih.gov), with the aim to determine close related strain to the organism under study. When the level of homology exceeded the level of 98%, one could conclude that the strain under study was identical to the available in the bank of data. Amplification and sequencing of gene 16S pDNA was performed using universal for the majority of prokaryotes primers. Thermopolimerase Long PCR Enzyme Mix «Fermentas», dNTP -«Fermentas» was used for amplification. While performing PCR, reagent concentrations corresponded to the protocols described in a set Long PCR Enzyme Mix «Fermentas». DNA separation from the sample was performed with DNeasy Plant Mini Kit «QIAGEN». DNA separation from gel was performed with QIAquick Gel Extraction Kit«QIAGEN». Phylogenetic affinity was determined on the basis of the comparison of nucleotide sequence - 400 nucleotides that approximately corresponded to the positions from 500 to 907 nucleotides by nomenclature of E.coli. Primary analysis of the similarity of nucleotide sequences of genes 16S рDNA of the strains under study was performed on the basis of data Genbank. Sequences were aligned according to nucleotide sequences of those bacteria, which had the highest degree of homology with the strains under study, applying the program ClustalX 1.83. Building of rootless phylogenetic trees of the studying bacteria was carried out with the help of the program Njplot. Acknowledgement. This research was supported by the grant of ISTC KR-993.2.
NASA Astrophysics Data System (ADS)
Holden, Todd; Marchese, P.; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Lieberman, D.; Cheung, T.
2008-08-01
We have characterized function related DNA sequences of various organisms using informatics techniques, including fractal dimension calculation, nucleotide and multi-nucleotide statistics, and sequence fluctuation analysis. Our analysis shows trends which differentiate extremophile from non-extremophile organisms, which could be reproduced in extraterrestrial life. Among the systems studied are radiation repair genes, genes involved in thermal shocks, and genes involved in drug resistance. We also evaluate sequence level changes that have occurred during short term evolution (several thousand generations) under extreme conditions.
An adaptive, object oriented strategy for base calling in DNA sequence analysis.
Giddings, M C; Brumley, R L; Haker, M; Smith, L M
1993-01-01
An algorithm has been developed for the determination of nucleotide sequence from data produced in fluorescence-based automated DNA sequencing instruments employing the four-color strategy. This algorithm takes advantage of object oriented programming techniques for modularity and extensibility. The algorithm is adaptive in that data sets from a wide variety of instruments and sequencing conditions can be used with good results. Confidence values are provided on the base calls as an estimate of accuracy. The algorithm iteratively employs confidence determinations from several different modules, each of which examines a different feature of the data for accurate peak identification. Modules within this system can be added or removed for increased performance or for application to a different task. In comparisons with commercial software, the algorithm performed well. Images PMID:8233787
Torshin, Ivan Y.
2004-01-01
Ribozymes are functionally diverse RNA molecules with intrinsic catalytic activity. Multiple structural and biochemical studies are required to establish which nucleotide bases are involved in the catalysis. The relative energetic properties of the nucleotide bases have been analyzed in a set of the known ribozyme structures. It was found that many of the known catalytic nucleotides can be identified using only the structure without any additional biochemical data. The results of the calculations compare well with the available biochemical data on RNA stability. Extensive in silico mutagenesis suggests that most of the nucleotides in ribozymes stabilize the RNA. The calculations show that relative contribution of the catalytic bases to RNA stability observably differs from contributions of the noncatalytic bases. Distinction between the concepts of “relative stability” and “mutational stability” is suggested. As results of prediction for several models of ribozymes appear to be in agreement with the published data on the potential active site regions, the method can potentially be used for prediction of functional nucleotides from nucleic sequence. PMID:15105962
Vasudevan, Kumar; Vera Cruz, Casiana M.; Gruissem, Wilhelm; Bhullar, Navreet K.
2016-01-01
Rice blast is caused by Magnaporthe oryzae, which is the most destructive fungal pathogen affecting rice growing regions worldwide. The rice blast resistance gene Pib confers broad-spectrum resistance against Southeast Asian M. oryzae races. We investigated the allelic diversity of Pib in rice germplasm originating from 12 major rice growing countries. Twenty-five new Pib alleles were identified that have unique single nucleotide polymorphisms (SNPs), insertions and/or deletions, in addition to the polymorphic nucleotides that are shared between the different alleles. These partially or completely shared polymorphic nucleotides indicate frequent sequence exchange events between the Pib alleles. In some of the new Pib alleles, nucleotide diversity is high in the LRR domain, whereas, in others it is distributed among the NB-ARC and LRR domains. Most of the polymorphic amino acids in LRR and NB-ARC2 domains are predicted as solvent-exposed. Several of the alleles and the unique SNPs are country specific, suggesting a diversifying selection of alleles in various geographical locations in response to the locally prevalent M. oryzae population. Together, the new Pib alleles are an important genetic resource for rice blast resistance breeding programs and provide new information on rice-M. oryzae interactions at the molecular level. PMID:27446145
Full Genome Sequence of Egg Drop Syndrome Virus Strain FJ12025 Isolated from Muscovy Duckling.
Fu, Guanghua; Chen, Hongmei; Huang, Yu; Cheng, Longfei; Fu, Qiuling; Shi, Shaohua; Wan, Chunhe; Chen, Cuiteng; Lin, Jiansheng
2013-08-22
Egg drop syndrome virus (EDSV) strain FJ12025 was isolated from a 9-day-old Muscovy duckling. The results of the sequence showed that the genome of strain FJ12025 is 33,213 bp in length, with a G+C content of 43.03%. When comparing the genome sequence of strain FJ12025 to that of laying duck original strain AV-127, we found 50 single-nucleotide polymorphisms (SNPs) between the two viral genome sequences. A genomic sequence comparison of FJ12025 and AV-127 will help to understand the phenotypic differences between the two viruses.
Sun, Zichen; Stack, Colin; Šlapeta, Jan
2012-05-25
In order to investigate the genetic variation between Tritrichomonas foetus from bovine and feline origins, cysteine protease 8 (CP8) coding sequence was selected as the polymorphic DNA marker. Direct sequencing of CP8 coding sequence of T. foetus from four feline isolates and two bovine isolates with polymerase chain reaction successfully revealed conserved nucleotide polymorphisms between feline and bovine isolates. These results provide useful information for CP8-based molecular differentiation of T. foetus genotypes. Copyright © 2011 Elsevier B.V. All rights reserved.
Normand, A C; Packeu, A; Cassagne, C; Hendrickx, M; Ranque, S; Piarroux, R
2018-05-01
Conventional dermatophyte identification is based on morphological features. However, recent studies have proposed to use the nucleotide sequences of the rRNA internal transcribed spacer (ITS) region as an identification barcode of all fungi, including dermatophytes. Several nucleotide databases are available to compare sequences and thus identify isolates; however, these databases often contain mislabeled sequences that impair sequence-based identification. We evaluated five of these databases on a clinical isolate panel. We selected 292 clinical dermatophyte strains that were prospectively subjected to an ITS2 nucleotide sequence analysis. Sequences were analyzed against the databases, and the results were compared to clusters obtained via DNA alignment of sequence segments. The DNA tree served as the identification standard throughout the study. According to the ITS2 sequence identification, the majority of strains (255/292) belonged to the genus Trichophyton , mainly T. rubrum complex ( n = 184), T. interdigitale ( n = 40), T. tonsurans ( n = 26), and T. benhamiae ( n = 5). Other genera included Microsporum (e.g., M. canis [ n = 21], M. audouinii [ n = 10], Nannizzia gypsea [ n = 3], and Epidermophyton [ n = 3]). Species-level identification of T. rubrum complex isolates was an issue. Overall, ITS DNA sequencing is a reliable tool to identify dermatophyte species given that a comprehensive and correctly labeled database is consulted. Since many inaccurate identification results exist in the DNA databases used for this study, reference databases must be verified frequently and amended in line with the current revisions of fungal taxonomy. Before describing a new species or adding a new DNA reference to the available databases, its position in the phylogenetic tree must be verified. Copyright © 2018 American Society for Microbiology.
Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat
2013-07-01
Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.
A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice.
Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, Hongbin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan
2007-04-17
The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia.
A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice
Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, HongBin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan
2007-01-01
Background The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. Results A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. Conclusion A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia. PMID:17439653
From milk to diet: feed recognition for milk authenticity.
Ponzoni, E; Gianì, S; Mastromauro, F; Breviario, D
2009-11-01
The presence of plastidial DNA fragments of plant origin in animal milk samples has been confirmed. An experimental plan was arranged with 4 groups of goats, each provided with a different monophytic diet: 3 fresh forages (oats, ryegrass, and X-triticosecale) and one 2-wk-old silage (X-triticosecale). Feed-derived rubisco (ribulose bisphosphate carboxylase, rbcL) DNA fragments were detected in 100% of the analyzed goat milk samples, and the nucleotide sequence of the PCR-amplified fragments was found to be 100% identical to the corresponding fragments amplified from the plant species consumed in the diet. Two additional chloroplast-based molecular markers were used to set up an assay for distinctiveness, conveniently based on a simple PCR. In one case, differences in single nucleotides occurring within the gene encoding for plant maturase K (matK) were exploited. In the other, plant species recognition was based on the difference in the length of the intron present within the transfer RNA leucine (trnL) gene. The presence of plastidial plant DNA, ascertained by the PCR-based amplification of the rbcL fragment, was also assessed in raw cow milk samples collected directly from stock farms or taken from milk sold on the commercial market. In this case, the nucleotide sequence of the amplified DNA fragments reflected the multiple forages present in the diet fed to the animals.
On fuzzy semantic similarity measure for DNA coding.
Ahmad, Muneer; Jung, Low Tang; Bhuiyan, Md Al-Amin
2016-02-01
A coding measure scheme numerically translates the DNA sequence to a time domain signal for protein coding regions identification. A number of coding measure schemes based on numerology, geometry, fixed mapping, statistical characteristics and chemical attributes of nucleotides have been proposed in recent decades. Such coding measure schemes lack the biologically meaningful aspects of nucleotide data and hence do not significantly discriminate coding regions from non-coding regions. This paper presents a novel fuzzy semantic similarity measure (FSSM) coding scheme centering on FSSM codons׳ clustering and genetic code context of nucleotides. Certain natural characteristics of nucleotides i.e. appearance as a unique combination of triplets, preserving special structure and occurrence, and ability to own and share density distributions in codons have been exploited in FSSM. The nucleotides׳ fuzzy behaviors, semantic similarities and defuzzification based on the center of gravity of nucleotides revealed a strong correlation between nucleotides in codons. The proposed FSSM coding scheme attains a significant enhancement in coding regions identification i.e. 36-133% as compared to other existing coding measure schemes tested over more than 250 benchmarked and randomly taken DNA datasets of different organisms. Copyright © 2015 Elsevier Ltd. All rights reserved.
Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe
2017-01-01
Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1–3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry. PMID:28056060
Zhang, Xiuqing; Xu, Zhangyang; Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe
2017-01-01
Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1-3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry.
Lin, Yi-Hua; Gao, San-Ji; Damaj, Mona B; Fu, Hua-Ying; Chen, Ru-Kai; Mirkov, T Erik
2014-06-01
Sugarcane yellow leaf virus (SCYLV; genus Polerovirus, family Luteoviridae) is a recombinant virus associated with yellow leaf disease, a serious threat to sugarcane in China and worldwide. Among the nine known SCYLV genotypes existing worldwide, COL, HAW, REU, IND, CHN1, CHN2, BRA, CUB and PER, the last five have been reported in China. In this study, the complete genome sequences (5,880 nt) of GZ-GZ18 and HN-CP502 isolates from the Chinese provinces of Guizhou and Hainan, respectively, were cloned, sequenced and characterized. Phylogenetic analysis showed that, among 29 SCYLV isolates described worldwide, the two Chinese isolates clustered together into an independent clade based on the near-complete genome nucleotide (ORF0-ORF5) or amino acid sequences of individual genes, except for the MP protein (ORF4). We propose that the two isolates represent a novel genotype, CHN3, diverging from other genotypes by 1.7-13.6 % nucleotide differences in ORF0-ORF5, and 2.7-28.1 %, 1.8-20.4 %, 0.5-5.1 % and 2.7-15.9 % amino acid differences in P0 (ORF0), RdRp (RNA-dependent RNA polymerase) (ORF1+2), CP (coat protein) (ORF3) and RT (readthrough protein) (ORF3+5), respectively. CHN3 was closely related to the BRA, HAW and PER genotypes, differing by 1.7-3.8 % in the near-complete genome nucleotide sequence. Recombination analysis further identified CHN3 as a new recombinant strain, arising from the major parent CHN-HN1 and the minor parent CHN-GD-WY19. Recombination breakpoints were distributed mostly within the RdRp region in CHN3 and the four significant recombinant genotypes, IND, REU, CUB and BRA. Recombination is considered to contribute significantly to the evolution and emergence of such new SCYLV variants.
Krishnan, Neeraja M; Seligmann, Hervé; Rao, Basuthkar J
2008-01-28
Synonymous sites are freer to vary because of redundancy in genetic code. Messenger RNA secondary structure restricts this freedom, as revealed by previous findings in mitochondrial genes that mutations at third codon position nucleotides in helices are more selected against than those in loops. This motivated us to explore the constraints imposed by mRNA secondary structure on evolutionary variability at all codon positions in general, in chloroplast systems. We found that the evolutionary variability and intrinsic secondary structure stability of these sequences share an inverse relationship. Simulations of most likely single nucleotide evolution in Psilotum nudum and Nephroselmis olivacea mRNAs, indicate that helix-forming propensities of mutated mRNAs are greater than those of the natural mRNAs for short sequences and vice-versa for long sequences. Moreover, helix-forming propensity estimated by the percentage of total mRNA in helices increases gradually with mRNA length, saturating beyond 1000 nucleotides. Protection levels of functionally important sites vary across plants and proteins: r-strategists minimize mutation costs in large genes; K-strategists do the opposite. Mrna length presumably predisposes shorter mRNAs to evolve under different constraints than longer mRNAs. The positive correlation between secondary structure protection and functional importance of sites suggests that some sites might be conserved due to packing-protection constraints at the nucleic acid level in addition to protein level constraints. Consequently, nucleic acid secondary structure a priori biases mutations. The converse (exposure of conserved sites) apparently occurs in a smaller number of cases, indicating a different evolutionary adaptive strategy in these plants. The differences between the protection levels of functionally important sites for r- and K-strategists reflect their respective molecular adaptive strategies. These converge with increasing domestication levels of K-strategists, perhaps because domestication increases reproductive output.
Wu, Shuang; Nakamoto, Shingo; Kanda, Tatsuo; Jiang, Xia; Nakamura, Masato; Miyamura, Tatsuo; Shirasawa, Hiroshi; Sugiura, Nobuyuki; Takahashi-Nakaguchi, Azusa; Gonoi, Tohru; Yokosuka, Osamu
2014-01-01
Hepatitis A virus (HAV) is a causative agent of acute viral hepatitis for which an effective vaccine has been developed. Here we describe ultra-deep pyrosequences (UDPSs) of HAV 5'-untranslated region (5'UTR) among cases of the same outbreak, which arose from a single source, associated with a revolving sushi bar. We determined the reference sequence from HAV-derived clone from an attendant by the Sanger method. Sixteen UDPSs from this outbreak and one from another sporadic case were compared with this reference. Nucleotide errors yielded a UDPS error rate of < 1%. This study confirmed that nucleotide substitutions of this region are transition mutations in outbreak cases, that insertion was observed only in non-severe cases, and that these nucleotide substitutions were different from those of the sporadic case. Analysis of UDPSs detected low-prevalence HAV variations in 5'UTR, but no specific mutations associated with severity in these outbreak cases. To our surprise, HAV strains in this outbreak conserved HAV IRES sequence even if we performed analysis of UDPSs. UDPS analysis of HAV 5'UTR gave us no association between the disease severity of hepatitis A and HAV 5'UTR substitutions. It might be more interesting to perform ultra-deep sequencing of full length HAV genome in order to reveal possible unknown genomic determinants associated with disease severity. Further studies will be needed. PMID:24396287
Genetic variation and dynamics of infections of equid herpesvirus 5 in individual horses.
Back, Helena; Ullman, Karin; Leijon, Mikael; Söderlund, Robert; Penell, Johanna; Ståhl, Karl; Pringle, John; Valarcher, Jean-François
2016-01-01
Equid herpesvirus 5 (EHV-5) is related to the human Epstein-Barr virus (human herpesvirus 4) and has frequently been observed in equine populations worldwide. EHV-5 was previously assumed to be low to non-pathogenic; however, studies have also related the virus to the severe lung disease equine multinodular pulmonary fibrosis (EMPF). Genetic information of EHV-5 is scanty: the whole genome was recently described and only limited nucleotide sequences are available. In this study, samples were taken twice 1 year apart from eight healthy horses at the same professional training yard and samples from a ninth horse that was diagnosed with EMPF with samples taken pre- and post-mortem to analyse partial glycoprotein B (gB) gene of EHV-5 by using next-generation sequencing. The analysis resulted in 27 partial gB gene sequences, 11 unique sequence types and five amino acid sequences. These sequences could be classified within four genotypes (I-IV) of the EHV-5 gB gene based on the degree of similarity of the nucleotide and amino acid sequences, and in this work horses were shown to be identified with up to three different genotypes simultaneously. The observations showed a range of interactions between EHV-5 and the host over time, where the same virus persists in some horses, whereas others have a more dynamic infection pattern including strains from different genotypes. This study provides insight into the genetic variation and dynamics of EHV-5, and highlights that further work is needed to understand the EHV-5 interaction with its host.
Expansion of inverted repeat does not decrease substitution rates in Pelargonium plastid genomes.
Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K
2017-04-01
For species with minor inverted repeat (IR) boundary changes in the plastid genome (plastome), nucleotide substitution rates were previously shown to be lower in the IR than the single copy regions (SC). However, the impact of large-scale IR expansion/contraction on plastid nucleotide substitution rates among closely related species remains unclear. We included plastomes from 22 Pelargonium species, including eight newly sequenced genomes, and used both pairwise and model-based comparisons to investigate the impact of the IR on sequence evolution in plastids. Ten types of plastome organization with different inversions or IR boundary changes were identified in Pelargonium. Inclusion in the IR was not sufficient to explain the variation of nucleotide substitution rates. Instead, the rate heterogeneity in Pelargonium plastomes was a mixture of locus-specific, lineage-specific and IR-dependent effects. Our study of Pelargonium plastomes that vary in IR length and gene content demonstrates that the evolutionary consequences of retaining these repeats are more complicated than previously suggested. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
López-Urrutia, Eduardo; Valdés, Jesús; Bonilla-Moreno, Raúl; Martínez-Salazar, Martha; Martínez-Garcia, Martha; Berumen, Jaime; Villegas-Sepúlveda, Nicolás
2012-06-01
The HPV-16 E6/E7 genes, which contain intron 1, are processed by alternative splicing and its transcripts are detected with a heterogeneous profile in tumours cells. Frequently, the HPV-16 positive carcinoma cells bear viral variants that contain single nucleotide polymorphisms into its DNA sequence. We were interested in analysing the contribution of this polymorphism to the heterogeneity in the pattern of the E6/E7 spliced transcripts. Using the E6/E7 sequences from three closely related HPV-16 variants, we have shown that a few nucleotide changes are sufficient to produce heterogeneity in the splicing profile. Furthermore, using mutants that contained a single SNP, we also showed that one nucleotide change was sufficient to reproduce the heterogeneous splicing profile. Additionally, a difference of two or three SNPs among these viral sequences was sufficient to recruit differentially several splicing factors to the polymorphic E6/E7 transcripts. Moreover, only one SNP was sufficient to alter the binding site of at least one splicing factor, changing the ability of splicing factors to bind the transcript. Finally, the factors that were differentially bound to the short form of intron 1 of one of these E6/E7 variants were identified as TIA1 and/or TIAR and U1-70k, while U2AF65, U5-52k and PTB were preferentially bound to the transcript of the other variants. Copyright © 2012 Elsevier B.V. All rights reserved.
Molecular systematics of higher primates: genealogical relations and classification.
Miyamoto, M M; Koop, B F; Slightom, J L; Goodman, M; Tennant, M R
1988-01-01
We obtained 5' and 3' flanking sequences (5.4 kilobase pairs) from the psi eta-globin gene region of the rhesus macaque (Macaca mulatta) and combined them with available nucleotide data. The completed sequence, representing 10.8 kilobase pairs of contiguous noncoding DNA, was compared to the same orthologous regions available for human (Homo sapiens, as represented by five different alleles), common chimpanzee (Pan troglodytes), gorilla (Gorilla gorilla), and orangutan (Pongo pygmaeus). The nucleotide sequence for Macaca mulatta provided the outgroup perspective needed to evaluate better the relationships of humans and great apes. Pairwise comparisons and parsimony analysis of these orthologues clearly demonstrated (i) that humans and great apes share a high degree of genetic similarity and (ii) that humans, chimpanzees, and gorillas form a natural monophyletic group. These conclusions strongly favor a genealogical classification for higher primates consisting of a single family (Hominidae) with two subfamilies (Homininae for Homo, Pan, and Gorilla and Ponginae for Pongo). PMID:3174657
Dodovski, A; Cvetkovikj, I; Krstevski, K; Naletoski, I; Savić, Vladimir
2017-06-01
We have characterized in this study 10 PPMV-1 isolated from domestic pigeons and one PPMV-1 isolated from a feral pigeon in the period 2007-2012, using both classical methods (HI test and ICPI test) and molecular methods (RT-qPCR, RT-PCR, and nucleotide sequencing). Using phylogenetic analysis of partial fusion gene sequences, these viruses clustered with recent European PPMV-1 isolates (EU/re) within the genotype VIb/1. All isolates possessed virulent cleavage site motifs with variable morbidity and mortality in pigeons. The intracerebral pathogenecity indices of the five isolates ranged from 0.59 to 1.53. The repetitive isolation of PPMV-1 viruses for several consecutive years led toward establishing enzootic presence of the disease in pigeons. A high nucleotide sequence homology between the Macedonian isolates and EU/re isolates was shown. Co-circulation of different isolates in the same holdings was detected. This is the first study to extensively describe the molecular epidemiology of PPMV-1 isolated in Macedonia.
Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe
2015-05-30
Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.
USDA-ARS?s Scientific Manuscript database
Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...
USDA-ARS?s Scientific Manuscript database
Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...
Zulfiqar, Awais; Zhang, Jie; Cui, Xiaofeng; Qian, Yajuan; Zhou, Xueping; Xie, Yan
2012-01-01
A begomovirus disease complex associated with Vernonia cinerea showing yellow vein symptoms was studied. The full-length genomic DNA was comprised of 2739 nucleotides (nt) and contained the typical genome structure of begomoviruses. Comparison analysis showed that it shared the highest (78.9%) nucleotide sequence identity with recently characterized Vernonia yellow vein virus (VeYVV) from India. For associated satellites, betasatellite showed the highest nucleotide sequence identity (52.1%) with Vernonia yellow vein virus betasatellite (VeYVVB) and alphasatellite shared the highest sequence identity (70.7%) with Gossypium mustelinium symptomless alphasatellite (GMusSLA). It is a member of a distinct species with cognate alpha- and betasatellites for which the name Vernonia yellow vein Fujian virus (VeYVFjV) is proposed.
Kweon, Chang-Hee; Nguyen, Lien Thi Kim; Yoo, Mi-Sun; Kang, Seung-Won
2015-09-15
Porcine circovirus type 2 (PCV2) is the causative agent of post-weaning multisystemic wasting syndrome (PMWS) in swine. Here, a phylogenetic tree was constructed using PCV2 nucleotide sequences derived from the bone marrow of Korean boar and previously reported PCV2 sequences isolated from various countries. PCV2 from Korean boar bone marrow (KC188796) was classified into the group containing PCV2a-Canada and other PCV2 strain from Korea. While the ORF1 region of the PCV2 genome was highly conserved, ORF2 (the capsid protein coding region) was relatively variable. The nucleotide sequences for bone marrow-derived PCV2 were 93.4-99.0% homologous to the other reference sequences. The deduced amino acid sequences for the ORF1 and ORF2 coding regions were 97.4-99.3% and 84.5-97.4% homologous with the other reference strains, respectively, indicating that KC188796 did not differ markedly from the other PCV2 strains. Phylogenetic analysis demonstrated that bone marrow-derived PCV2 was highly similar to PCV2a from Canada and may be related to persistent PCV2 infections in swine. Copyright © 2015 Elsevier B.V. All rights reserved.
Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.
Levis, R; Schlesinger, S; Huang, H V
1990-01-01
Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651
Genetic diversity of Plasmodium Vivax revealed by the merozoite surface protein-1 icb5-6 fragment.
Ruan, Wei; Zhang, Ling-Ling; Feng, Yan; Zhang, Xuan; Chen, Hua-Liang; Lu, Qiao-Yi; Yao, Li-Nong; Hu, Wei
2017-06-05
Plasmodium vivax remains a potential cause of morbidity and mortality for people living in its endemic areas. Understanding the genetic diversity of P. vivax from different regions is valuable for studying population dynamics and tracing the origins of parasites. The PvMSP-1 gene is highly polymorphic and has been used as a marker in many P. vivax population studies. The aim of this study was to investigate the genetic diversity of the PvMSP-1 gene icb5-6 fragment and to provide more genetic polymorphism data for further studies on P. vivax population structure and tracking of the origin of clinical cases. Nested PCR and sequencing of the PvMSP-1 icb5-6 marker were performed to obtain the nucleotide sequences of 95 P. vivax isolates collected from Zhejiang province, China. To investigate the genetic diversity of PvMSP-1, the 95 nucleotide sequences of the PvMSP-1 icb5-6 fragment were genotyped and analyzed using DnaSP v5, MEGA software. The 95 P. vivax isolates collected from Zhejiang province were either indigenous cases or imported cases from different regions around the world. A total of 95 sequences ranging from 390 to 460 bp were obtained. The 95 sequences were genotyped into four allele-types (Sal I, Belem, R-III and R-IV) and 17 unique haplotypes. R-III and Sal I were the predominant allele-types. The haplotype diversity (Hd) and nucleotide diversity (Pi) were estimated to be 0.729 and 0.062, indicating that the PvMSP-1 icb5-6 fragment had the highest level of polymorphism due to frequent recombination processes and single nucleotide polymorphism. The values of dN/dS and Tajima's D both suggested neutral selection for the PvMSP-1icb5-6 fragment. In addition, a rare recombinant style of R-IV type was identified. This study presented high genetic diversity in the PvMSP-1 marker among P. vivax strains from around the world. The genetic data is valuable for expanding the polymorphism information on P. vivax, which could be helpful for further study on population dynamics and tracking the origin of P. vivax.
Kjaersgård, I V; Jespersen, H M; Rasmussen, S K; Welinder, K G
1997-03-01
cDNA clones encoding two new Arabidopsis thaliana peroxidases, ATP 1a and ATP 2a, have been identified by searching the Arabidopsis database of expressed sequence tags (dbEST). They represent a novel branch of hitherto uncharacterized plant peroxidases which is only 35% identical in amino acid sequence to the well characterized group of basic plant peroxidases represented by the horseradish (Armoracia rusticana) isoperoxidases HRP C, HRP E5 and the similar Arabidopsis isoperoxidases ATP Ca, ATP Cb, and ATP Ea. However ATP 1a is 87% identical in amino acid sequence to a peroxidase encoded by an mRNA isolated from cotton (Gossypium hirsutum). As cotton and Arabidopsis belong to rather diverse families (Malvaceae and Crucifereae, respectively), in contrast with Arabidopsis and horseradish (both Crucifereae), the high degree of sequence identity indicates that this novel type of peroxidase, albeit of unknown function, is likely to be widespread in plant species. The atp 1 and atp 2 types of cDNA sequences were the most redundant among the 28 different isoperoxidases identified among about 200 peroxidase encoding ESTs. Interestingly, 8 out of totally 38 EST sequences coding for ATP 1 showed three identical nucleotide substitutions. This variant form is designated ATP 1b. Similarly, six out of totally 16 EST sequences coding for ATP 2 showed a number of deletions and nucleotide changes. This variant form is designated ATP 2b. The selected EST clones are full-length and contain coding regions of 993 nucleotides for atp 1a, and 984 nucleotides for atp 2a. These regions show 61% DNA sequence identity. The predicted mature proteins ATP 1a, and ATP 2a are 57% identical in sequence and contain the structurally and functionally important residues, characteristic of the plant peroxidase superfamily. However, they do show two differences of importance to peroxidase catalysis: (1) the asparagine residue linked with the active site distal histidine via hydrogen bonding is absent; (2) an N-glycosylation site is located right at the entrance to the heme channel. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to identify mRNAs coding for ATP 1a/b and ATP 2a/b in germinating seeds, seedlings, roots, leaves, stems, flowers and cell suspension culture using elongation factor 1alpha (EF-1alpha) for the first time as a positive control. Both mRNAs were transcribed at levels comparable to EF-1alpha in all plant tissues investigated which were more than two days old, and in cell suspension culture. In addition, the mRNA coding for ATP 1a/b was found in two day old germinating seeds. The abundant transcription of ATP 1a/b and ATP 2a/b is in line with their many entries in dbEST, and indicates essential roles for these novel peroxidases.
Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou
2014-11-01
In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.
Gibbs, Mark J; Armstrong, John S; Gibbs, Adrian J
2005-01-01
Background Most current DNA diagnostic tests for identifying organisms use specific oligonucleotide probes that are complementary in sequence to, and hence only hybridise with the DNA of one target species. By contrast, in traditional taxonomy, specimens are usually identified by 'dichotomous keys' that use combinations of characters shared by different members of the target set. Using one specific character for each target is the least efficient strategy for identification. Using combinations of shared bisectionally-distributed characters is much more efficient, and this strategy is most efficient when they separate the targets in a progressively binary way. Results We have developed a practical method for finding minimal sets of sub-sequences that identify individual sequences, and could be targeted by combinations of probes, so that the efficient strategy of traditional taxonomic identification could be used in DNA diagnosis. The sizes of minimal sub-sequence sets depended mostly on sequence diversity and sub-sequence length and interactions between these parameters. We found that 201 distinct cytochrome oxidase subunit-1 (CO1) genes from moths (Lepidoptera) were distinguished using only 15 sub-sequences 20 nucleotides long, whereas only 8–10 sub-sequences 6–10 nucleotides long were required to distinguish the CO1 genes of 92 species from the 9 largest orders of insects. Conclusion The presence/absence of sub-sequences in a set of gene sequences can be used like the questions in a traditional dichotomous taxonomic key; hybridisation probes complementary to such sub-sequences should provide a very efficient means for identifying individual species, subtypes or genotypes. Sequence diversity and sub-sequence length are the major factors that determine the numbers of distinguishing sub-sequences in any set of sequences. PMID:15817134
Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison
2012-01-01
Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198
Iterative Correction of Reference Nucleotides (iCORN) using second generation sequencing technology.
Otto, Thomas D; Sanders, Mandy; Berriman, Matthew; Newbold, Chris
2010-07-15
The accuracy of reference genomes is important for downstream analysis but a low error rate requires expensive manual interrogation of the sequence. Here, we describe a novel algorithm (Iterative Correction of Reference Nucleotides) that iteratively aligns deep coverage of short sequencing reads to correct errors in reference genome sequences and evaluate their accuracy. Using Plasmodium falciparum (81% A + T content) as an extreme example, we show that the algorithm is highly accurate and corrects over 2000 errors in the reference sequence. We give examples of its application to numerous other eukaryotic and prokaryotic genomes and suggest additional applications. The software is available at http://icorn.sourceforge.net
Isolated nucleic acids encoding antipathogenic polypeptides and uses thereof
Altier, Daniel J.; Crane, Virginia C.; Ellanskaya, Irina; Ellanskaya, Natalia; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K.; Schepers, Eric J.; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser
2010-04-20
Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from fungal fermentation broths. Nucleic acids that encode the antipathogenic polypeptides are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.
Hammond, R; Smith, D R; Diener, T O
1989-01-01
The Columnea latent viroid (CLV) occurs latently in certain Columnea erythrophae plants grown commercially. In potato and tomato, CLV causes potato spindle tuber viroid (PSTV)-like symptoms. Its nucleotide sequence and proposed secondary structure reveal that CLV consists of a single-stranded circular RNA of 370 nucleotides which can assume a rod-like structure with extensive base-pairing characteristic of all known viroids. The electrophoretic mobility of circular CLV under nondenaturing conditions suggests a potential tertiary structure. CLV contains extensive sequence homologies to the PSTV group of viroids but contains a central conserved region identical to that of hop stunt viroid (HSV). CLV also shares some biological properties with each of the two types of viroids. Most probably, CLV is the result of intracellular RNA recombination between an HSV-type and one or more PSTV-type viroids replicating in the same plant. Images PMID:2602114
Proteogenomic Investigation of Strain Variation in Clinical Mycobacterium tuberculosis Isolates.
Heunis, Tiaan; Dippenaar, Anzaan; Warren, Robin M; van Helden, Paul D; van der Merwe, Ruben G; Gey van Pittius, Nicolaas C; Pain, Arnab; Sampson, Samantha L; Tabb, David L
2017-10-06
Mycobacterium tuberculosis consists of a large number of different strains that display unique virulence characteristics. Whole-genome sequencing has revealed substantial genetic diversity among clinical M. tuberculosis isolates, and elucidating the phenotypic variation encoded by this genetic diversity will be of the utmost importance to fully understand M. tuberculosis biology and pathogenicity. In this study, we integrated whole-genome sequencing and mass spectrometry (GeLC-MS/MS) to reveal strain-specific characteristics in the proteomes of two clinical M. tuberculosis Latin American-Mediterranean isolates. Using this approach, we identified 59 peptides containing single amino acid variants, which covered ∼9% of all coding nonsynonymous single nucleotide variants detected by whole-genome sequencing. Furthermore, we identified 29 distinct peptides that mapped to a hypothetical protein not present in the M. tuberculosis H37Rv reference proteome. Here, we provide evidence for the expression of this protein in the clinical M. tuberculosis SAWC3651 isolate. The strain-specific databases enabled confirmation of genomic differences (i.e., large genomic regions of difference and nonsynonymous single nucleotide variants) in these two clinical M. tuberculosis isolates and allowed strain differentiation at the proteome level. Our results contribute to the growing field of clinical microbial proteogenomics and can improve our understanding of phenotypic variation in clinical M. tuberculosis isolates.
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts
Naito, Yuki; Bono, Hidemasa
2012-01-01
GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users. PMID:22641850
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Naito, Yuki; Bono, Hidemasa
2012-07-01
GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users.
Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.
Schnare, M N; Gray, M W
1982-01-01
In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176
Ammayappan, Arun; Vakharia, Vikram N
2009-01-01
Background Viral hemorrhagic septicemia virus (VHSV) is a highly contagious viral disease of fresh and saltwater fish worldwide. VHSV caused several large scale fish kills in the Great Lakes area and has been found in 28 different host species. The emergence of VHS in the Great Lakes began with the isolation of VHSV from a diseased muskellunge (Esox masquinongy) caught from Lake St. Clair in 2003. VHSV is a member of the genus Novirhabdovirus, within the family Rhabdoviridae. It has a linear single-stranded, negative-sense RNA genome of approximately 11 kbp, with six genes. VHSV replicates in the cytoplasm and produces six monocistronic mRNAs. The gene order of VHSV is 3'-N-P-M-G-NV-L-5'. This study describes molecular characterization of the Great Lakes VHSV strain (MI03GL), and its phylogenetic relationships with selected European and North American isolates. Results The complete genomic sequences of VHSV-MI03GL strain was determined from cloned cDNA of six overlapping fragments, obtained by RT-PCR amplification of genomic RNA. The complete genome sequence of MI03GL comprises 11,184 nucleotides (GenBank GQ385941) with the gene order of 3'-N-P-M-G-NV-L-5'. These genes are separated by conserved gene junctions, with di-nucleotide gene spacers. The first 4 nucleotides at the termini of the VHSV genome are complementary and identical to other novirhadoviruses genomic termini. Sequence homology and phylogenetic analysis show that the Great Lakes virus is closely related to the Japanese strains JF00Ehi1 (96%) and KRRV9822 (95%). Among other novirhabdoviruses, VHSV shares highest sequence homology (62%) with snakehead rhabdovirus. Conclusion Phylogenetic tree obtained by comparing 48 glycoprotein gene sequences of different VHSV strains demonstrate that the Great Lakes VHSV is closely related to the North American and Japanese genotype IVa, but forms a distinct genotype IVb, which is clearly different from the three European genotypes. Molecular characterization of the Great Lakes isolate will be helpful in studying the pathogenesis of VHSV using a reverse genetics approach and developing efficient control strategies. PMID:19852863
Parniewski, P; Galazka, G; Wilk, A; Klysik, J
1989-01-01
Synthetic sequence GATCC(AG)7ATCG(AT)4CG(AG)7 was cloned into plasmid and its structural behavior under the influence of supercoiling was analysed by chemical modification at variety of experimental conditions. It was found that this sequence adopts at least two different non-B conformations depending on -delta and pH values. Moreover, 12 nucleotide long non-pur.pyr spacer region separating two identical (AG)7 blocks does not provide a significant energy barrier protecting against unusual structures formation. Images PMID:2644622
Novel Human Adenovirus Causing Nosocomial Epidemic Keratoconjunctivitis▿
Ishiko, Hiroaki; Shimada, Yasushi; Konno, Tsunetada; Hayashi, Akio; Ohguchi, Takeshi; Tagawa, Yoshitsugu; Aoki, Koki; Ohno, Shigeaki; Yamazaki, Shudo
2008-01-01
In 2000, we encountered cases of nosocomial infections with epidemic keratoconjunctivitis (EKC) at a university hospital in Kobe, in the western part of Japan. Two human adenovirus (HAdV) strains, Kobe-H and Kobe-S, were isolated from patients with nosocomial EKC infection. They were untypeable by existing neutralizing antisera; however, the isolate was neutralized with homologous antisera. We then encountered several cases of EKC due to nosocomial infections in eye clinics in different parts of Japan. A total of 80 HAdVs were isolated from patients with EKC at eight different hospitals. The partial hexon gene sequences of the isolates were determined and compared to those of the prototype strains of 51 serotypes. All isolates had identical partial hexon nucleotide sequences. Phylogenetic analysis classified these isolates into species of HAdV-D. The isolates showed 93.9 to 96.7% nucleotide identity with HAdV-D prototype strains, while all 32 HAdV-D prototype strains ranged from 93.2 to 99.2% identity. The sequences of the loop 2 and fiber knob regions from the representative strain, Kobe-H, were dissimilar in all prototype strains of 51 serotypes. We believe that this virus is a novel serotype of HAdV that causes EKC. PMID:18385435
DOE Office of Scientific and Technical Information (OSTI.GOV)
Siegel, A.
Previous work had demonstrated the presence of a unique low-molecular-weight RNA component (LMC) in extracts of tobacco mosaic virus (TMV) infected tissue. Enough of this component has been isolated during the past year to ascertain that it has a molecular weight of 250,000 daltons and that it acts as an in vitro messenger for the synthesis of TMV capsid protein. Thus, we conclude that at least one monocistronic messenger RNA for a virion coded product is generated during TMV infection. Strains of TMV were classified according to nucleotide sequence homology of their RNAs. The strains fall into groups by themore » test employed. No differences were observed between strains within a group, whereas no homology was detected between groups. Using this information, it was possible, in part, to relate differences in capsid protein amino acid sequences to the degree of nomology of their nucleotide coding sequences. A study was initiated into the Pot Y virus group infection mechanism. In contrast to TMV infection, it was determined that for both tobacco etch and potato virus Y that: viral RNA synthesis is inhibited by actinomycin B and synthesis by virus-related proteins is inhibited by chloramphenicol.« less
Survey of bat populations from Mexico and Paraguay for rabies.
Sheeler-Gordon, L L; Smith, J S
2001-07-01
A mammalian survey was conducted in Mexico (October 1994-January 1996) and in Paraguay (August 1996-March 1997); a complete specimen was collected for each bat in the survey, including primary voucher specimen, ectoparasites, karyotype, and various frozen tissues. The surveys combined provided 937 brain samples (65 bat species) for rabies diagnosis. One male Lasiurus ega, collected in Paraguay, tested positive for the rabies virus (overall prevalence rate of 0.1%). Nucleotide sequence from a 300 bp region of the rabies nucleoprotein gene was compared with sequence obtained from representative rabies virus samples in the repository at the Centers for Disease Control and Prevention (Atlanta, Georgia, USA). Rabies virus extracted from the brain material of L. ega differed by only one nucleotide from a 300 bp consensus sequence (>99% homology) derived from samples for the variant of rabies virus transmitted by Lasiurus cinereus. Lasiurus ego differed by approximately 15% for the variant transmitted by Desmodus rotundus. Phylogenetic analysis found no evidence to suggest L. ego is a reservoir for rabies antigenic variant 6. The most likely explanation for rabies in L. ega was infection following contact with a rabid L. cinereus.
Joffret, Marie-Line; Jégouic, Sophie; Bessaud, Maël; Balanant, Jean; Tran, Coralie; Caro, Valerie; Holmblat, Barbara; Razafindratsimandresy, Richter; Reynes, Jean-Marc; Rakoto-Andrianarivelo, Mala; Delpeyroux, Francis
2012-05-01
Five cases of poliomyelitis due to type 2 or 3 recombinant vaccine-derived polioviruses (VDPVs) were reported in the Toliara province of Madagascar in 2005. We sequenced the genome of the VDPVs isolated from the patients and from 12 healthy children and characterized phenotypic aspects, including pathogenicity, in mice transgenic for the poliovirus receptor. We identified 6 highly complex mosaic recombinant lineages composed of sequences derived from different vaccine polioviruses and other species C human enteroviruses (HEV-Cs). Most had some recombinant genome features in common and contained nucleotide sequences closely related to certain cocirculating coxsackie A virus isolates. However, they differed in terms of their recombinant characteristics or nucleotide substitutions and phenotypic features. All VDPVs were neurovirulent in mice. This study confirms the genetic relationship between type 2 and 3 VDPVs, indicating that both types can be involved in a single outbreak of disease. Our results highlight the various ways in which a vaccine-derived poliovirus may become pathogenic in complex viral ecosystems, through frequent recombination events and mutations. Intertypic recombination between cocirculating HEV-Cs (including polioviruses) appears to be a common mechanism of genetic plasticity underlying transverse genetic variability.
Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P
1984-01-01
We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950
Zhang, Xi; Zhang, Jing; Wu, Dongzhi; Liu, Zhijing; Cai, Shuxian; Chen, Mei; Zhao, Yanping; Li, Chunyan; Yang, Huanghao; Chen, Jinghua
2014-12-07
Locked nucleic acid (LNA) is applied in toehold-mediated strand displacement reaction (TMSDR) to develop a junction-probe electrochemiluminescence (ECL) biosensor for single-nucleotide polymorphism (SNP) detection in the BRCA1 gene related to breast cancer. More than 65-fold signal difference can be observed with perfectly matched target sequence to single-base mismatched sequence under the same conditions, indicating good selectivity of the ECL biosensor.
Wang, Boyi; Tan, Hua-Wei; Fang, Wanping; Meinhardt, Lyndel W; Mischke, Sue; Matsumoto, Tracie; Zhang, Dapeng
2015-01-01
Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in 50 longan germplasm accessions, including cultivated varieties and wild germplasm; and designated 25 SNP markers that unambiguously identified all tested longan varieties with high statistical rigor (P<0.0001). Multiple trees from the same clone were verified and off-type trees were identified. Diversity analysis revealed genetic relationships among analyzed accessions. Cultivated varieties differed significantly from wild populations (Fst=0.300; P<0.001), demonstrating untapped genetic diversity for germplasm conservation and utilization. Within cultivated varieties, apparent differences between varieties from China and those from Thailand and Hawaii indicated geographic patterns of genetic differentiation. These SNP markers provide a powerful tool to manage longan genetic resources and breeding, with accurate and efficient genotype identification. PMID:26504559
Molecular characterization of the canine mitochondrial DNA control region for forensic applications.
Eichmann, Cordula; Parson, Walther
2007-09-01
The canine mitochondrial DNA (mtDNA) control region of 133 dogs living in the area around Innsbruck, Austria was sequenced. A total of 40 polymorphic sites were observed in the first hypervariable segment and 15 in the second, which resulted in the differentiation of 40 distinct haplotypes. We observed five nucleotide positions that were highly polymorphic within different haplogroups, and they represent good candidates for mtDNA screening. We found five point heteroplasmic positions; all located in HVS-I and a polythymine region in HVS-II, the latter often being associated with length heteroplasmy. In contrast to human mtDNA, the canine control region contains a hypervariable 10 nucleotide repeat region, which is located between the two hypervariable regions. In our population sample, we observed eight different repeat types, which we characterized by direct sequencing and fragment length analysis. The discrimination power of the canine mtDNA control region was 0.93, not taking the polymorphic repeat region into consideration.
Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I
1999-07-01
Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.
Drosophila Nora virus capsid proteins differ from those of other picorna-like viruses.
Ekström, Jens-Ola; Habayeb, Mazen S; Srivastava, Vaibhav; Kieselbach, Thomas; Wingsle, Gunnar; Hultmark, Dan
2011-09-01
The recently discovered Nora virus from Drosophila melanogaster is a single-stranded RNA virus. Its published genomic sequence encodes a typical picorna-like cassette of replicative enzymes, but no capsid proteins similar to those in other picorna-like viruses. We have now done additional sequencing at the termini of the viral genome, extending it by 455 nucleotides at the 5' end, but no more coding sequence was found. The completeness of the final 12,333-nucleotide sequence was verified by the production of infectious virus from the cloned genome. To identify the capsid proteins, we purified Nora virus particles and analyzed their proteins by mass spectrometry. Our results show that the capsid is built from three major proteins, VP4A, B and C, encoded in the fourth open reading frame of the viral genome. The viral particles also contain traces of a protein from the third open reading frame, VP3. VP4A and B are not closely related to other picorna-like virus capsid proteins in sequence, but may form similar jelly roll folds. VP4C differs from the others and is predicted to have an essentially α-helical conformation. In a related virus, identified from EST database sequences from Nasonia parasitoid wasps, VP4C is encoded in a separate open reading frame, separated from VP4A and B by a frame-shift. This opens a possibility that VP4C is produced in non-equimolar quantities. Altogether, our results suggest that the Nora virus capsid has a different protein organization compared to the order Picornavirales. Copyright © 2011 Elsevier B.V. All rights reserved.
Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.
Le Gall, O; Candresse, T; Brault, V; Dunez, J
1989-01-01
The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein. PMID:2798128
Ryynänen, Heikki J; Primmer, Craig R
2006-01-01
Background Single nucleotide polymorphisms (SNPs) represent the most abundant type of DNA variation in the vertebrate genome, and their applications as genetic markers in numerous studies of molecular ecology and conservation of natural populations are emerging. Recent large-scale sequencing projects in several fish species have provided a vast amount of data in public databases, which can be utilized in novel SNP discovery in salmonids. However, the suggested duplicated nature of the salmonid genome may hamper SNP characterization if the primers designed in conserved gene regions amplify multiple loci. Results Here we introduce a new intron-primed exon-crossing (IPEC) method in an attempt to overcome this duplication problem, and also evaluate different priming methods for SNP discovery in Atlantic salmon (Salmo salar) and other salmonids. A total of 69 loci with differing priming strategies were screened in S. salar, and 27 of these produced ~13 kb of high-quality sequence data consisting of 19 SNPs or indels (one per 680 bp). The SNP frequency and the overall nucleotide diversity (3.99 × 10-4) in S. salar was lower than reported in a majority of other organisms, which may suggest a relative young population history for Atlantic salmon. A subset of primers used in cross-species analyses revealed considerable variation in the SNP frequencies and nucleotide diversities in other salmonids. Conclusion Sequencing success was significantly higher with the new IPEC primers; thus the total number of loci to screen in order to identify one potential polymorphic site was six times less with this new strategy. Given that duplication may hamper SNP discovery in some species, the IPEC method reported here is an alternative way of identifying novel polymorphisms in such cases. PMID:16872523
Equalizer reduces SNP bias in Affymetrix microarrays.
Quigley, David
2015-07-30
Gene expression microarrays measure the levels of messenger ribonucleic acid (mRNA) in a sample using probe sequences that hybridize with transcribed regions. These probe sequences are designed using a reference genome for the relevant species. However, most model organisms and all humans have genomes that deviate from their reference. These variations, which include single nucleotide polymorphisms, insertions of additional nucleotides, and nucleotide deletions, can affect the microarray's performance. Genetic experiments comparing individuals bearing different population-associated single nucleotide polymorphisms that intersect microarray probes are therefore subject to systemic bias, as the reduction in binding efficiency due to a technical artifact is confounded with genetic differences between parental strains. This problem has been recognized for some time, and earlier methods of compensation have attempted to identify probes affected by genome variants using statistical models. These methods may require replicate microarray measurement of gene expression in the relevant tissue in inbred parental samples, which are not always available in model organisms and are never available in humans. By using sequence information for the genomes of organisms under investigation, potentially problematic probes can now be identified a priori. However, there is no published software tool that makes it easy to eliminate these probes from an annotation. I present equalizer, a software package that uses genome variant data to modify annotation files for the commonly used Affymetrix IVT and Gene/Exon platforms. These files can be used by any microarray normalization method for subsequent analysis. I demonstrate how use of equalizer on experiments mapping germline influence on gene expression in a genetic cross between two divergent mouse species and in human samples significantly reduces probe hybridization-induced bias, reducing false positive and false negative findings. The equalizer package reduces probe hybridization bias from experiments performed on the Affymetrix microarray platform, allowing accurate assessment of germline influence on gene expression.
Information Entropy Analysis of the H1N1 Genetic Code
NASA Astrophysics Data System (ADS)
Martwick, Andy
2010-03-01
During the current H1N1 pandemic, viral samples are being obtained from large numbers of infected people world-wide and are being sequenced on the NCBI Influenza Virus Resource Database. The information entropy of the sequences was computed from the probability of occurrence of each nucleotide base at every position of each set of sequences using Shannon's definition of information entropy, [ H=∑bpb,2( 1pb ) ] where H is the observed information entropy at each nucleotide position and pb is the probability of the base pair of the nucleotides A, C, G, U. Information entropy of the current H1N1 pandemic is compared to reference human and swine H1N1 entropy. As expected, the current H1N1 entropy is in a low entropy state and has a very large mutation potential. Using the entropy method in mature genes we can identify low entropy regions of nucleotides that generally correlate to critical protein function.
Phosphate-Modified Nucleotides for Monitoring Enzyme Activity.
Ermert, Susanne; Marx, Andreas; Hacker, Stephan M
2017-04-01
Nucleotides modified at the terminal phosphate position have been proven to be interesting entities to study the activity of a variety of different protein classes. In this chapter, we present various types of modifications that were attached as reporter molecules to the phosphate chain of nucleotides and briefly describe the chemical reactions that are frequently used to synthesize them. Furthermore, we discuss a variety of applications of these molecules. Kinase activity, for instance, was studied by transfer of a phosphate modified with a reporter group to the target proteins. This allows not only studying the activity of kinases, but also identifying their target proteins. Moreover, kinases can also be directly labeled with a reporter at a conserved lysine using acyl-phosphate probes. Another important application for phosphate-modified nucleotides is the study of RNA and DNA polymerases. In this context, single-molecule sequencing is made possible using detection in zero-mode waveguides, nanopores or by a Förster resonance energy transfer (FRET)-based mechanism between the polymerase and a fluorophore-labeled nucleotide. Additionally, fluorogenic nucleotides that utilize an intramolecular interaction between a fluorophore and the nucleobase or an intramolecular FRET effect have been successfully developed to study a variety of different enzymes. Finally, also some novel techniques applying electron paramagnetic resonance (EPR)-based detection of nucleotide cleavage or the detection of the cleavage of fluorophosphates are discussed. Taken together, nucleotides modified at the terminal phosphate position have been applied to study the activity of a large diversity of proteins and are valuable tools to enhance the knowledge of biological systems.
Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito
2017-12-01
The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin
2017-01-01
Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica, about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both “Zheda 23” and “Zheda 83”. Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species. PMID:28891982
Ji, Feng; Zhao, Jing-Zhuang; Liu, Miao; Lu, Tong-Yan; Liu, Hong-Bai; Yin, Jiasheng; Xu, Li-Ming
2017-04-01
Infectious pancreatic necrosis (IPN) is a significant disease of farmed salmonids resulting in direct economic losses due to high mortality in China. However, no gene sequence of any Chinese infectious pancreatic necrosis virus (IPNV) isolates was available. In the study, moribund rainbow trout fry samples were collected during an outbreak of IPN in Yunnan province of southwest China in 2013. An IPNV was isolated and tentatively named ChRtm213. We determined the full genome sequence of the IPNV ChRtm213 and compared it with previously identified IPNV sequences worldwide. The sequences of different structural and non-structural protein genes were compared to those of other aquatic birnaviruses sequenced to date. The results indicated that the complete genome sequence of ChRtm213 strain contains a segment A (3099 nucleotides) coding a polyprotein VP2-VP4-VP3, and a segment B (2789 nucleotides) coding a RNA-dependent RNA polymerase VP1. The phylogenetic analyses showed that ChRtm213 strain fell within genogroup 1, serotype A9 (Jasper), having similarities of 96.3% (segment A) and 97.3% (segment B) with the IPNV strain AM98 from Japan. The results suggest that the Chinese IPNV isolate has relative closer relationship with Japanese IPNV strains. The sequence of ChRtm213 was the first gene sequence of IPNV isolates in China. This study provided a robust reference for diagnosis and/or control of IPNV prevalent in China.
Sheikh, Faruk G; Mukhopadhyay, Sudit S; Gupta, Prabhakar
2002-02-01
The PstI family of elements are short, highly repetitive DNA sequences interspersed throughout the genome of the Bovidae. We have cloned and sequenced some members of the PstI family from cattle, goat, and buffalo. These elements are approximately 500 bp, have a copy number of 2 x 10(5) - 4 x 10(5), and comprise about 4% of the haploid genome. Studies of nucleotide sequence homology indicate that the buffalo and goat PstI repeats (type II) are similar types of short interspersed nucleotide element (SINE) sequences, but the cattle PstI repeat (type I) is considerably more divergent. Additionally, the goat PstI sequence showed significant sequence homology with bovine serine tRNA, and is therefore likely derived from serine tRNA. Interestingly, Southern hybridization suggests that both types of SINEs (I and II) are present in all the species of Bovidae. Dendrogram analysis indicates that cattle PstI SINE is similar to bovine Alu-like SINEs. Goat and buffalo SINEs formed a separate cluster, suggesting that these two types of SINEs evolved separately in the genome of the Bovidae.
Metz, Edward C.; Robles-Sikisaka, Refugio; Vacquier, Victor D.
1998-01-01
Strong positive Darwinian selection acts on two sperm fertilization proteins, lysin and 18-kDa protein, from abalone (Haliotis). To understand the phylogenetic context for this dramatic molecular evolution, we obtained sequences of mitochondrial cytochrome c oxidase subunit I (mtCOI), and genomic sequences of lysin, 18-kDa, and a G protein subunit. Based on mtDNA differentiation, four north Pacific abalone species diverged within the past 2 million years (Myr), and remaining north Pacific species diverged over a period of 4–20 Myr. Between-species nonsynonymous differences in lysin and 18-kDa exons exceed nucleotide differences in introns by 3.5- to 24-fold. Remarkably, in some comparisons nonsynonymous substitutions in lysin and 18-kDa genes exceed synonymous substitutions in mtCOI. Lysin and 18-kDa intron/exon segments were sequenced from multiple red abalone individuals collected over a 1,200-km range. Only two nucleotide changes and two sites of slippage variation were detected in a total of >29,000 nucleotides surveyed. However, polymorphism in mtCOI and a G protein intron was found in this species. This finding suggests that positive selection swept one lysin allele and one 18-kDa allele to fixation. Similarities between mtCOI and lysin gene trees indicate that rapid adaptive evolution of lysin has occurred consistently through the history of the group. Comparisons with mtCOI molecular clock calibrations suggest that nonsynonymous substitutions accumulate 2–50 times faster in lysin and 18-kDa genes than in rapidly evolving mammalian genes. PMID:9724763
Precise detection of de novo single nucleotide variants in human genomes.
Gómez-Romero, Laura; Palacios-Flores, Kim; Reyes, José; García, Delfino; Boege, Margareta; Dávila, Guillermo; Flores, Margarita; Schatz, Michael C; Palacios, Rafael
2018-05-22
The precise determination of de novo genetic variants has enormous implications across different fields of biology and medicine, particularly personalized medicine. Currently, de novo variations are identified by mapping sample reads from a parent-offspring trio to a reference genome, allowing for a certain degree of differences. While widely used, this approach often introduces false-positive (FP) results due to misaligned reads and mischaracterized sequencing errors. In a previous study, we developed an alternative approach to accurately identify single nucleotide variants (SNVs) using only perfect matches. However, this approach could be applied only to haploid regions of the genome and was computationally intensive. In this study, we present a unique approach, coverage-based single nucleotide variant identification (COBASI), which allows the exploration of the entire genome using second-generation short sequence reads without extensive computing requirements. COBASI identifies SNVs using changes in coverage of exactly matching unique substrings, and is particularly suited for pinpointing de novo SNVs. Unlike other approaches that require population frequencies across hundreds of samples to filter out any methodological biases, COBASI can be applied to detect de novo SNVs within isolated families. We demonstrate this capability through extensive simulation studies and by studying a parent-offspring trio we sequenced using short reads. Experimental validation of all 58 candidate de novo SNVs and a selection of non-de novo SNVs found in the trio confirmed zero FP calls. COBASI is available as open source at https://github.com/Laura-Gomez/COBASI for any researcher to use. Copyright © 2018 the Author(s). Published by PNAS.
An Outbreak of Respiratory Tularemia Caused by Diverse Clones of Francisella tularensis
Johansson, Anders; Lärkeryd, Adrian; Widerström, Micael; Mörtberg, Sara; Myrtännäs, Kerstin; Öhrman, Caroline; Birdsell, Dawn; Keim, Paul; Wagner, David M.; Forsman, Mats; Larsson, Pär
2014-01-01
Background. The bacterium Francisella tularensis is recognized for its virulence, infectivity, genetic homogeneity, and potential as a bioterrorism agent. Outbreaks of respiratory tularemia, caused by inhalation of this bacterium, are poorly understood. Such outbreaks are exceedingly rare, and F. tularensis is seldom recovered from clinical specimens. Methods. A localized outbreak of tularemia in Sweden was investigated. Sixty-seven humans contracted laboratory-verified respiratory tularemia. F. tularensis subspecies holarctica was isolated from the blood or pleural fluid of 10 individuals from July to September 2010. Using whole-genome sequencing and analysis of single-nucleotide polymorphisms (SNPs), outbreak isolates were compared with 110 archived global isolates. Results. There were 757 SNPs among the genomes of the 10 outbreak isolates and the 25 most closely related archival isolates (all from Sweden/Finland). Whole genomes of outbreak isolates were >99.9% similar at the nucleotide level and clustered into 3 distinct genetic clades. Unexpectedly, high-sequence similarity grouped some outbreak and archival isolates that originated from patients from different geographic regions and up to 10 years apart. Outbreak and archival genomes frequently differed by only 1–3 of 1 585 229 examined nucleotides. Conclusions. The outbreak was caused by diverse clones of F. tularensis that occurred concomitantly, were widespread, and apparently persisted in the environment. Multiple independent acquisitions of F. tularensis from the environment over a short time period suggest that natural outbreaks of respiratory tularemia are triggered by environmental cues. The findings additionally caution against interpreting genome sequence identity for this pathogen as proof of a direct epidemiological link. PMID:25097081
DNA sequencing using polymerase substrate-binding kinetics
Previte, Michael John Robert; Zhou, Chunhong; Kellinger, Matthew; Pantoja, Rigo; Chen, Cheng-Yao; Shi, Jin; Wang, BeiBei; Kia, Amirali; Etchin, Sergey; Vieceli, John; Nikoomanzar, Ali; Bomati, Erin; Gloeckner, Christian; Ronaghi, Mostafa; He, Molly Min
2015-01-01
Next-generation sequencing (NGS) has transformed genomic research by decreasing the cost of sequencing. However, whole-genome sequencing is still costly and complex for diagnostics purposes. In the clinical space, targeted sequencing has the advantage of allowing researchers to focus on specific genes of interest. Routine clinical use of targeted NGS mandates inexpensive instruments, fast turnaround time and an integrated and robust workflow. Here we demonstrate a version of the Sequencing by Synthesis (SBS) chemistry that potentially can become a preferred targeted sequencing method in the clinical space. This sequencing chemistry uses natural nucleotides and is based on real-time recording of the differential polymerase/DNA-binding kinetics in the presence of correct or mismatch nucleotides. This ensemble SBS chemistry has been implemented on an existing Illumina sequencing platform with integrated cluster amplification. We discuss the advantages of this sequencing chemistry for targeted sequencing as well as its limitations for other applications. PMID:25612848
Silicon nanowire sensor for DNA detection and sequencing: an ab initio simulation
NASA Astrophysics Data System (ADS)
Lu, Wenchang; Li, Yan; Hodak, Miroslav; Xiao, Zhongcan; Bernholc, Jerry
Electrical sensors able to detect DNA replication and determine its sequence would enable fast and relatively cheap diagnosis of gene-related vulnerabilities and cancers. At present, it is already possible to electrically monitor DNA replication events using a Klenow fragment of polymerase I attached to a carbon nanotube. Since devices based on Si nanowires would be much easier to produce in quantity, we examine theoretically the sensitivity of a Si nanowire/Klenow fragment for electrical detection of nucleotide addition. A highly parallel real-space multigrid code is used for DFT-based non-equilibrium Green's function calculations involving up to 16,000 atoms, employing highly-accurate variationally-optimized localized orbitals. We find that the open and closed Klenow fragment configurations, prior and during nucleotide addition, respectively, screen the Si nanowire differently and result in a detectable current difference. The sensitivity is the largest in the subthreshold regime while the absolute current difference is maximized in the turn-on state. The sensitivity decreases with an increase of the nanowire size, as expected, but the current difference between different enzymatic states is nearly independent on the nanowire size up to 800 Å2 cross section.
VarDetect: a nucleotide sequence variation exploratory tool
Ngamphiw, Chumpol; Kulawonganunchai, Supasak; Assawamakin, Anunchai; Jenwitheesuk, Ekachai; Tongsima, Sissades
2008-01-01
Background Single nucleotide polymorphisms (SNPs) are the most commonly studied units of genetic variation. The discovery of such variation may help to identify causative gene mutations in monogenic diseases and SNPs associated with predisposing genes in complex diseases. Accurate detection of SNPs requires software that can correctly interpret chromatogram signals to nucleotides. Results We present VarDetect, a stand-alone nucleotide variation exploratory tool that automatically detects nucleotide variation from fluorescence based chromatogram traces. Accurate SNP base-calling is achieved using pre-calculated peak content ratios, and is enhanced by rules which account for common sequence reading artifacts. The proposed software tool is benchmarked against four other well-known SNP discovery software tools (PolyPhred, novoSNP, Genalys and Mutation Surveyor) using fluorescence based chromatograms from 15 human genes. These chromatograms were obtained from sequencing 16 two-pooled DNA samples; a total of 32 individual DNA samples. In this comparison of automatic SNP detection tools, VarDetect achieved the highest detection efficiency. Availability VarDetect is compatible with most major operating systems such as Microsoft Windows, Linux, and Mac OSX. The current version of VarDetect is freely available at . PMID:19091032
Duplication polymorphisms in exon 4 of κ-casein gene in yak breeds/populations.
Pingcuo, S; Gao, J; Jiang, Z R; Jin, S Y; Fu, C Y; Liu, X; Huang, L; Zheng, Y C
2015-08-28
The objective of this study was to compare 12 bp-duplication polymorphisms in exon 4 of the κ-casein gene among 3 breeds/populations of yak (Bos grunniens). Genomic DNA was extracted from yak blood or muscle samples (N = 211) and a partial sequence of exon 4 of κ-casein gene was amplified by polymerase chain reaction. A polyacrylamide gel electrophoresis assay of the products (169 bp) revealed 2 variants. These variants differed in a 12-bp duplication of the nucleotide sequence corresponding to amino acids 147-150 (Glu-Ala-Ser-Pro) or 148-151 (Ala-Ser-Pro-Glu). The genotype frequency and gene frequency of the 2 κ-casein variants differed among the 3 yak breeds/populations. The long form of the κ-casein gene was the predominant allele, and the Jiulong yak showed the highest frequency of the short form variant of the κ-casein gene. In addition, 2 nucleotide differences resulting in amino acid substitutions were also identified in yaks. These results are significant for designing a breeding strategy to improve the genetic makeup of yak herds.
Predicting protein-binding RNA nucleotides with consideration of binding partners.
Tuvshinjargal, Narankhuu; Lee, Wook; Park, Byungkyu; Han, Kyungsook
2015-06-01
In recent years several computational methods have been developed to predict RNA-binding sites in protein. Most of these methods do not consider interacting partners of a protein, so they predict the same RNA-binding sites for a given protein sequence even if the protein binds to different RNAs. Unlike the problem of predicting RNA-binding sites in protein, the problem of predicting protein-binding sites in RNA has received little attention mainly because it is much more difficult and shows a lower accuracy on average. In our previous study, we developed a method that predicts protein-binding nucleotides from an RNA sequence. In an effort to improve the prediction accuracy and usefulness of the previous method, we developed a new method that uses both RNA and protein sequence data. In this study, we identified effective features of RNA and protein molecules and developed a new support vector machine (SVM) model to predict protein-binding nucleotides from RNA and protein sequence data. The new model that used both protein and RNA sequence data achieved a sensitivity of 86.5%, a specificity of 86.2%, a positive predictive value (PPV) of 72.6%, a negative predictive value (NPV) of 93.8% and Matthews correlation coefficient (MCC) of 0.69 in a 10-fold cross validation; it achieved a sensitivity of 58.8%, a specificity of 87.4%, a PPV of 65.1%, a NPV of 84.2% and MCC of 0.48 in independent testing. For comparative purpose, we built another prediction model that used RNA sequence data alone and ran it on the same dataset. In a 10 fold-cross validation it achieved a sensitivity of 85.7%, a specificity of 80.5%, a PPV of 67.7%, a NPV of 92.2% and MCC of 0.63; in independent testing it achieved a sensitivity of 67.7%, a specificity of 78.8%, a PPV of 57.6%, a NPV of 85.2% and MCC of 0.45. In both cross-validations and independent testing, the new model that used both RNA and protein sequences showed a better performance than the model that used RNA sequence data alone in most performance measures. To the best of our knowledge, this is the first sequence-based prediction of protein-binding nucleotides in RNA which considers the binding partner of RNA. The new model will provide valuable information for designing biochemical experiments to find putative protein-binding sites in RNA with unknown structure. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms
ERIC Educational Resources Information Center
Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.
2016-01-01
The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…
Vigne, Emmanuelle; Bergdoll, Marc; Guyader, Sébastien; Fuchs, Marc
2004-08-01
The nematode-borne Grapevine fanleaf virus, from the genus Nepovirus in the family Comoviridae, causes severe degeneration of grapevines in most vineyards worldwide. We characterized 347 isolates from transgenic and conventional grapevines from two vineyard sites in the Champagne region of France for their molecular variant composition. The population structure and genetic diversity were examined in the coat protein gene by IC-RT-PCR-RFLP analysis with EcoRI and StyI, and nucleotide sequencing, respectively. RFLP data suggested that 55 % (191 of 347) of the isolates had a population structure consisting of one predominant variant. Sequencing data of 51 isolates representing the different restrictotypes confirmed the existence of mixed infection with a frequency of 33 % (17 of 51) and showed two major predominant haplotypes representing 71 % (60 of 85) of the sequence variants. Comparative nucleotide diversity among population subsets implied a lack of genetic differentiation according to host (transgenic vs conventional) or field site for most restrictotypes (17 of 18 and 13 of 18) and for haplotypes in most phylogenetic groups (seven of eight and six of eight), respectively. Interestingly, five of the 85 haplotypes sequenced had an intermediate divergence (0.036-0.066) between the lower (0.005-0.028) and upper range (0.083-0.138) of nucleotide variability, suggesting the occurrence of homologous RNA recombination. Sequence alignments clearly indicated a mosaic structure for four of these five variants, for which recombination sites were identified and parental lineages proposed. This is the first in-depth characterization of the population structure and genetic diversity in a nepovirus.
Al-Qahtani, Ahmed Ali; Mubin, Muhammad; Dela Cruz, Damian M; Althawadi, Sahar Isa; Ul Rehman, Muhammad Shah Nawaz; Bohol, Marie Fe F; Al-Ahdal, Mohammed N
2017-01-30
In early 2009, a novel influenza A (H1N1) virus appeared in Mexico and rapidly disseminated worldwide. Little is known about the phylogeny and evolutionary dynamics of the H1N1 strain found in Saudi Arabia. Nucleotide sequencing and bioinformatics analyses were used to study molecular variation between the virus isolates. In this report, 72 hemagglutinin (HA) and 45 neuraminidase (NA) H1N1 virus gene sequences, isolated in 2009 from various regions of Saudi Arabia, were analyzed. Genetic characterization indicated that viruses from two different clades, 6 and 7, were circulating in the region, with clade 7, the most widely circulating H1N1 clade globally in 2009, being predominant. Sequence analysis of the HA and NA genes revealed a high degree of sequence identity with the corresponding genes from viruses circulating in the South East Asia region and with the A/California/7/2009 strain. New mutations in the HA gene of pandemic H1N1 (pH1N1) viruses, that could alter viral fitness, were identified. Relaxed-clock and Bayesian Skyline Plot analyses, based on the isolates used in this study and closely related globally representative strains, indicated marginally higher substitution rates than the type strain (5.14×10-3 and 4.18×10-3 substitutions/nucleotide/year in the HA and NA genes, respectively). The Saudi isolates were antigenically homogeneous and closely related to the prototype vaccine strain A/California/7/2009. The antigenic site of the HA gene had acquired novel mutations in some isolates, making continued monitoring of these viruses vital for the identification of potentially highly virulent and drug resistant variants.
Atopkin, D M; Nikitenko, A Yu; Ngo, H D; Ha, N V; Tang, N V
2015-01-01
Intraspecific genetic differentiation of the trematode Skrjabinolecithum spasskii and its phylogenetic relationships with other species of the family Haploporidae were studied by comparing the nucleotide sequences of a part of the 28S rRNA gene and the ITS1-5.8S-ITS2 rDNA region. Trematodes were isolated from so-iuy mullet Liza haematocheila fishes collected in rivers of Primorye and flathead grey mullet Mugil cephalus fishes collected in water bodies of Vietnam (27 fishes in total). A phylogenetic analysis showed that S. spasskii is close to species of the genus Capitimitta of the subfamily Waretrematinae. By intraspecific variation of rDNA sequences, trematodes were divided into three groups with tree different genotypes, which had fixed nucleotide substitutions. Genotype I was found in trematodes from fishes collected in Primorye. Genotype II was detected in trematodes from M. cephalus fishes collected in the Tonkin Bay, Cat Ba Island, Vietnam. Genotype III was found in five trematodes from L. haematocheila collected in the Kievka River, Primorye. The genetic distances between genotypes I and III from Primorye were 0.4 and 0.65% by 28S and ITS rDNA sequences, respectively. The lowest genetic distances were observed between genotypes II (Vietnam) and III (Primorye), 0.1 and 0.33% by 28S and ITS rDNA sequences, respectively. Possible causes of genetic differentiation of S. spasskii from different geographic locations and different definitive host species are discussed.
Král'ová-Hromadová, Iva; Tietz, David F; Shinn, Andrew P; Spakulová, Marta
2003-10-01
The internal transcribed spacers (ITS-1 and ITS-2) of the ribosomal RNA gene of Pomphorhynchus laevis (Zoega in Müller, 1776) (Acanthocephala) isolated from various fish species across Central and Southern Europe were compared with those of P. lucyi Williams and Rogers, 1984 collected from the largemouth bass Micropterus salmonoides Boulenger from the USA. The nucleotide sequences of ITS regions of P. laevis from minnows Phoxinus phoxinus (L.) and chub Leuciscus cephalus (L.) from two distant localities in the Slovak Republic were found to be 100% identical. The ITS-1 and ITS-2 of P. laevis from chub from the Czech Republic and Italy were also mutually identical, but significantly different from Slovak worms (88.7% identity for ITS-1, 91.3% identity for ITS-2). A fifth sample collected from Barbus tyberinus Bonaparte from Italy was very similar to the sympatric Italian isolate from chub, possessing four nucleotide substitutions in ITS-1 (98.4% identity). The ITS rDNA sequences of P. lucyi differed significantly from those of P. laevis; the values of identity were 51.8-56.1% for ITS-1 and 63.1-65.3% for ITS-2, and were significantly higher than the range of P. laevis within-species variability. The results based on the ITS sequences confirmed the occurrence of strains in P. laevis from Continental Europe which are well defined by molecules but reveal only slight differences in their morphology.
Amor, Nabil; Halajian, Ali; Farjallah, Sarra; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine
2011-07-01
Fasciolosis caused by Fasciola spp. (Platyhelminthes: Trematoda: Digenea) is considered as the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. In the endemic regions of the North of Iran, Fasciola hepatica and Fasciola gigantica have been previously characterized on the basis of morphometric differences, but the use of molecular markers is necessary to distinguish exactly between species and intermediate forms. Samples from buffaloes and goats from different localities of northern Iran were identified morphologically and then genetically characterized by sequences of the first (ITS-1) and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA). Comparison of the ITS of the northern Iranian samples with sequences of Fasciola spp. from GenBank showed that the examined specimens had sequences identical to those of the most frequent haplotypes of F. hepatica (n=25, 48.1%) and F. gigantica (n=20, 38.45%), which differed from each other in different variable nucleotide positions of ITS region sequences, and their intermediate forms (n=7, 13.45%), which had nucleotides overlapped between the two Fasciola species in all the positions. The ITS sequences from populations of Fasciola isolates in buffaloes and goats had experienced introgression/hybridization as previously reported in isolates from other ruminants and humans. Based on ITS-1 and ITS-2 sequences, flukes are scattered in pure F. hepatica, F. gigantica and intermediate Fasciola clades, revealing that multiple genotypes of Fasciola are able to infect goats and buffaloes in North of Iran. Furthermore, the phylogenetic trees based upon the ITS-1 and ITS-2 sequences showed a close relationship of the Iranian samples with isolates of F. hepatica and F. gigantica from different localities of Africa and Asia. In the present study, the intergenic transcribed spacers ITS-1 and ITS-2 showed to be reliable approaches for the genetic differentiation of Fasciola spp., providing bases for further studies on F. hepatica, F. gigantica and their intermediate forms in the endemic areas in Asia. Copyright © 2011 Elsevier Inc. All rights reserved.
Bricheux, G; Brugerolle, G
1997-08-01
The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.
Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K
2017-04-01
There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.
Complete genome sequence of duck Tembusu virus, isolated from Muscovy ducks in southern China.
Zhu, Wanjun; Chen, Jidang; Wei, Chunya; Wang, Heng; Huang, Zhen; Zhang, Minze; Tang, Fengfeng; Xie, Jiexiong; Liang, Huanbin; Zhang, Guihong; Su, Shuo
2012-12-01
We report here the complete genomic sequence of the duck Tembusu virus (DTMUV) WJ-1 strain, isolated from Muscovy ducks. This is the first complete genome sequence of DTMUV reported in southern China. Compared with the other strains (TA, GH-2, YY5, and ZJ-407) that were previously found in eastern China, WJ-1 bears a few differences in the nucleotide and amino acid sequences. We found that there are 47 mutations of amino acids encoded by the whole open reading frame (ORF) among these five strains. The whole-genome sequence of DTMUV will help in understanding the epidemiology and molecular characteristics of duck Tembusu virus in southern China.
Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Millard, Glenda M; O'Brien, Helen; Roulis, Eileen V; Liew, Yew-Wah; Martin, Jacqueline R; McGrath, Kelli A; Powley, Tanya; Flower, Robert L; Hyland, Catherine A
2017-04-01
Blood group single nucleotide polymorphism genotyping probes for a limited range of polymorphisms. This study investigated whether massively parallel sequencing (also known as next-generation sequencing), with a targeted exome strategy, provides an extended blood group genotype and the extent to which massively parallel sequencing correctly genotypes in homologous gene systems, such as RH and MNS. Donor samples (n = 28) that were extensively phenotyped and genotyped using single nucleotide polymorphism typing, were analyzed using the TruSight One Sequencing Panel and MiSeq platform. Genes for 28 protein-based blood group systems, GATA1, and KLF1 were analyzed. Copy number variation analysis was used to characterize complex structural variants in the GYPC and RH systems. The average sequencing depth per target region was 66.2 ± 39.8. Each sample harbored on average 43 ± 9 variants, of which 10 ± 3 were used for genotyping. For the 28 samples, massively parallel sequencing variant sequences correctly matched expected sequences based on single nucleotide polymorphism genotyping data. Copy number variation analysis defined the Rh C/c alleles and complex RHD hybrids. Hybrid RHD*D-CE-D variants were correctly identified, but copy number variation analysis did not confidently distinguish between D and CE exon deletion versus rearrangement. The targeted exome sequencing strategy employed extended the range of blood group genotypes detected compared with single nucleotide polymorphism typing. This single-test format included detection of complex MNS hybrid cases and, with copy number variation analysis, defined RH hybrid genes along with the RHCE*C allele hitherto difficult to resolve by variant detection. The approach is economical compared with whole-genome sequencing and is suitable for a red blood cell reference laboratory setting. © 2017 AABB.
SAM: String-based sequence search algorithm for mitochondrial DNA database queries
Röck, Alexander; Irwin, Jodi; Dür, Arne; Parsons, Thomas; Parson, Walther
2011-01-01
The analysis of the haploid mitochondrial (mt) genome has numerous applications in forensic and population genetics, as well as in disease studies. Although mtDNA haplotypes are usually determined by sequencing, they are rarely reported as a nucleotide string. Traditionally they are presented in a difference-coded position-based format relative to the corrected version of the first sequenced mtDNA. This convention requires recommendations for standardized sequence alignment that is known to vary between scientific disciplines, even between laboratories. As a consequence, database searches that are vital for the interpretation of mtDNA data can suffer from biased results when query and database haplotypes are annotated differently. In the forensic context that would usually lead to underestimation of the absolute and relative frequencies. To address this issue we introduce SAM, a string-based search algorithm that converts query and database sequences to position-free nucleotide strings and thus eliminates the possibility that identical sequences will be missed in a database query. The mere application of a BLAST algorithm would not be a sufficient remedy as it uses a heuristic approach and does not address properties specific to mtDNA, such as phylogenetically stable but also rapidly evolving insertion and deletion events. The software presented here provides additional flexibility to incorporate phylogenetic data, site-specific mutation rates, and other biologically relevant information that would refine the interpretation of mitochondrial DNA data. The manuscript is accompanied by freeware and example data sets that can be used to evaluate the new software (http://stringvalidation.org). PMID:21056022
Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J
2000-11-01
Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.
Sequence analysis of porcine kobuvirus VP1 region detected in pigs in Japan and Thailand.
Okitsu, Shoko; Khamrin, Pattara; Thongprachum, Aksara; Hidaka, Satoshi; Kongkaew, Sompreeya; Kongkaew, Apisek; Maneekarn, Niwat; Mizuguchi, Masashi; Hayakawa, Satoshi; Ushijima, Hiroshi
2012-04-01
Porcine kobuvirus is a new candidate species of the genus Kobuvirus in the family Picornaviridae, and information is still limited. The identification of porcine kobuvirus has been performed by the sequence analyses of the 3D region of the viruses. Therefore, the purpose of this study was to characterize the molecular properties of VP1 nucleotide sequences of the porcine kobuviruses isolated from porcine stool samples in Japan during 2009 and Thailand between 2006 and 2008. In addition, previous identification of a unique porcine kobuvirus; Japanese H023/2009/JP, which is a bovine kobuvirus-like strain based on sequence analysis of the 3D region, was also included in this study. All of the strains were amplified by the VP1-specific primer pair: the amplicons were subjected to direct sequencing and compared with the VP1 nucleotide sequences of reference strains. The VP1 sequences of strains from the GenBank database revealed high nucleotide sequence identity at 84.3-100%. On the other hand, the nucleotide identities among the 15 porcine kobuvirus strains analyzed in this study ranged from 78.8 to 99.8%. The results revealed that diversity of the strains in this study were higher than those of the strains in previous studies. Furthermore, it was found that the VP1 region of the bovine kobuvirus-like strain, H023/2009/JP, clustered with nine porcine kobuvirus strains that were isolated in Thailand and Japan. Since this strain was previously found to be closely related to bovine kobuviruses in the 3D gene region, it may be a natural recombinant.
Seroprevalence of porcine circovirus type 2 in swine populations in Canada and Costa Rica
Liu, Qiang; Wang, Li; Willson, Philip; O'Connor, Brendan; Keenliside, Julia; Chirino-Trejo, Manuel; Meléndez, Ronald; Babiuk, Lorne
2002-01-01
Porcine circovirus (PCV) was recently divided into 2 antigenically distinct types that differ (65% amino acid identity) in the protein encoded by open reading frame 2 (ORF2). Porcine circovirus 1 is apparently non-pathogenic and, in contrast, PCV2 is associated with porcine multisystemic wasting syndrome (PMWS). Our objective was to determine the extent of exposure of normal pigs in Canada and Costa Rica to PCV2. Recombinant DNA techniques were used to produce an antigen from ORF2 of PCV2 that was suitable for the detection of antibody in swine sera. The presence of PCV2 nucleotide sequences was detected using polymerase chain reaction (PCR) techniques. Using these tests, specific antibody and nucleotide sequences were demonstrated in sera from a cohort of pigs during a PMWS outbreak. Antibody was detected in normal, healthy hogs slaughtered in Canada (82.4% of 386) and in Costa Rica (14.6% of 322). This is the first report indicating the presence of PCV2 in Latin America. More than 50% of these sera also contained PCV2 nucleotide sequence. Although these hogs were healthy when slaughtered, they were infected with PCV2 and may have previously been ill. The widespread occurrence of PCV2 in swine suggests that this virus is adapted to replication in porcine tissue. PMID:12418777
Phylogenetic analysis of the envelope protein (domain lll) of dengue 4 viruses
Mota, Javier; Ramos-Castañeda, José; Rico-Hesse, Rebeca; Ramos, Celso
2011-01-01
Objective To evaluate the genetic variability of domain III of envelope (E) protein and to estimate phylogenetic relationships of dengue 4 (Den-4) viruses isolated in Mexico and from other endemic areas of the world. Material and Methods A phylogenetic study of domain III of envelope (E) protein of Den-4 viruses was conducted in 1998 using virus strains from Mexico and other parts of the world, isolated in different years. Specific primers were used to amplify by RT-PCR the domain III and to obtain nucleotide sequence. Based on nucleotide and deduced aminoacid sequence, genetic variability was estimated and a phylogenetic tree was generated. To make an easy genetic analysis of domain III region, a Restriction Fragment Length Polymorphism (RFLP) assay was performed, using six restriction enzymes. Results Study results demonstrate that nucleotide and aminoacid sequence analysis of domain III are similar to those reported from the complete E protein gene. Based on the RFLP analysis of domain III using the restriction enzymes Nla III, Dde I and Cfo I, Den-4 viruses included in this study were clustered into genotypes 1 and 2 previously reported. Conclusions Study results suggest that domain III may be used as a genetic marker for phylogenetic and molecular epidemiology studies of dengue viruses. The English version of this paper is available too at: http://www.insp.mx/salud/index.html PMID:12132320
Wang, Li; Yokoyama, Koji; Miyaji, Makoto; Nishimura, Kazuko
2001-01-01
We analyzed a 402-bp sequence of the mitochondrial cytochrome b gene of 34 strains of Exophiala jeanselmei and 16 strains representing 12 related species. The strains of E. jeanselmei were classified into 20 DNA types and 17 amino acid types. The differences between these strains were found in 1 to 60 nucleotides and 1 to 17 amino acids. On the basis of the identities and similarities of nucleotide and amino acid sequences, some strains were reidentified: i.e., two strains of E. jeanselmei var. hetermorpha and one strain of E. castellanii as E. dermatitidis (including the type strain), three strains of E. jeanselmei as E. jeanselmei var. lecanii-corni (including the type strain), three strains of E. jeanselmei as E. bergeri (including the type strain), seven strains of E. jeanselmei as E. pisciphila (including the type strain), seven strains of E. jeanselmei as E. jeanselmei var. jeanselmei (including the type strain), one strain of E. jeanselmei as Fonsecaea pedrosoi (including the type strain), and one strain of E. jeanselmei as E. spinifera (including the type strain). Some E. jeanselmei strains showed distinct nucleotide and amino acid sequences. The amino-acid-based UPGMA (unweighted pair group method with the arithmetic mean) tree exhibited nearly the same topology as those of the DNA-based trees obtained by neighbor joining, maximum parsimony, and maximum likelihood methods. PMID:11724862
Wickersheim, Michelle L; Blumenstiel, Justin P
2013-11-01
A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.
Le Chevanton, L; Leblon, G
1989-04-15
We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.
de Vin, Filip; Rådström, Peter; Herman, Lieve; De Vuyst, Luc
2005-01-01
Lactose-limited fermentations of 49 dairy Streptococcus thermophilus strains revealed four distinct fermentation profiles with respect to galactose consumption after lactose depletion. All the strains excreted galactose into the medium during growth on lactose, except for strain IMDOST40, which also displayed extremely high galactokinase (GalK) activity. Among this strain collection eight galactose-positive phenotypes sensu stricto were found and their fermentation characteristics and Leloir enzyme activities were measured. As the gal promoter seems to play an important role in the galactose phenotype, the galR-galK intergenic region was sequenced for all strains yielding eight different nucleotide sequences (NS1 to NS8). The gal promoter played an important role in the Gal-positive phenotype but did not determine it exclusively. Although GalT and GalE activities were detected for all Gal-positive strains, GalK activity could only be detected for two out of eight Gal-positive strains. This finding suggests that the other six S. thermophilus strains metabolize galactose via an alternative route. For each type of fermentation profile obtained, a representative strain was chosen and four complete Leloir gene clusters were sequenced. It turned out that Gal-positive strains contained more amino acid differences within their gal genes than Gal-negative strains. Finally, the biodiversity regarding lactose-galactose utilization among the different S. thermophilus strains used in this study was shown by RAPD-PCR. Five Gal-positive strains that contain nucleotide sequence NS2 in their galR-galK intergenic region were closely related. PMID:16000774
Quantum-Sequencing: Fast electronic single DNA molecule sequencing
NASA Astrophysics Data System (ADS)
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.
Linder, P; Dölz, R; Mossé, M O; Lazowska, J; Slonimski, P P
1993-01-01
The amount of nucleotide sequence data is increasing exponentially. We therefore made an effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. Each sequence has been attributed a single genetic name and in the case of allelic duplicated sequences, synonyms are given, if necessary. For the nomenclature we have introduced a standard principle for naming gene sequences based on priority rules. We have also applied a simple method to distinguish duplicated sequences of one and the same gene from non-allelic sequences of duplicated genes. By using these principles we have sorted out a lot of confusion in the literature and databanks. Along with the genetic name, the mnemonic from the EMBL databank, the codon bias, reference of the publication of the sequence and the EMBL accession numbers are included in each entry. PMID:8332521
Tolson, D A; Nicholson, N H
1998-01-01
The determination of DNA sequences by partial exonuclease digestion followed by Matrix-Assisted Laser Desorption Time of Flight Mass Spectrometry (MALDI-TOF) is a well established method. When the same procedure is applied to RNA, difficulties arise due to the small (1 Da) mass difference between the nucleotides U and C, which makes unambiguous assignment difficult using a MALDI-TOF instrument. Here we report our experiences with sequence specific endonucleases and chemical methods followed by MALDI-TOF to resolve these sequence ambiguities. We have found chemical methods superior to endonucleases both in terms of correct specificity and extent of sequence coverage. This methodology can be used in combination with exonuclease digestion to rapidly assign RNA sequences. PMID:9421498
2004-01-01
The nucleotide pyrophosphatases/phosphodiesterases NPP1 and NPP2/autotaxin are structurally related eukaryotic ecto-enzymes, but display a very different substrate specificity. NPP1 releases nucleoside 5′-monophosphates from various nucleotides, whereas NPP2 mainly functions as a lysophospholipase D. We have used a domain-swapping approach to map substrate-specifying determinants of NPP1 and NPP2. The catalytic domain of NPP1 fused to the N- and C-terminal domains of NPP2 was hyperactive as a nucleotide phosphodiesterase, but did not show any lysophospholipase D activity. In contrast, chimaeras of the catalytic domain of NPP2 and the N- and/or C-terminal domains of NPP1 were completely inactive. These data indicate that the catalytic domain as well as both extremities of NPP2 contain lysophospholipid-specifying sequences. Within the catalytic domain of NPP1 and NPP2, we have mapped residues close to the catalytic site that determine the activities towards nucleotides and lysophospholipids. We also show that the conserved Gly/Phe-Xaa-Gly-Xaa-Xaa-Gly (G/FXGXXG) motif near the catalytic site is required for metal binding, but is not involved in substrate-specification. Our data suggest that the distinct activities of NPP1 and NPP2 stem from multiple differences throughout the polypeptide chain. PMID:15096095
Cimino, Matthew T
2010-03-01
Twenty-four herbal dietary supplement powder and extract reference standards provided by the National Institute of Standards and Technology (NIST) were investigated using three different commercially available DNA extraction kits to evaluate DNA availability for downstream nucleotide-based applications. The material included samples of Camellia, Citrus, Ephedra, Ginkgo, Hypericum, Serenoa, And Vaccinium. Protocols from Qiagen, MoBio, and Phytopure were used to isolate and purify DNA from the NIST standards. The resulting DNA concentration was quantified using SYBR Green fluorometry. Each of the 24 samples yielded DNA, though the concentration of DNA from each approach was notably different. The Phytopure method consistently yielded more DNA. The average yield ratio was 22 : 3 : 1 (ng/microL; Phytopure : Qiagen : MoBio). Amplification of the internal transcribed spacer II region using PCR was ultimately successful in 22 of the 24 samples. Direct sequencing chromatograms of the amplified material suggested that most of the samples were comprised of mixtures. However, the sequencing chromatograms of 12 of the 24 samples were sufficient to confirm the identity of the target material. The successful extraction, amplification, and sequencing of DNA from these herbal dietary supplement extracts and powders supports a continued effort to explore nucleotide sequence-based tools for the authentication and identification of plants in dietary supplements. (c) Georg Thieme Verlag KG Stuttgart . New York.
Greiner, Stephan; Wang, Xi; Herrmann, Reinhold G; Rauwolf, Uwe; Mayer, Klaus; Haberer, Georg; Meurer, Jörg
2008-09-01
A unique combination of genetic features and a rich stock of information make the flowering plant genus Oenothera an appealing model to explore the molecular basis of speciation processes including nucleus-organelle coevolution. From representative species, we have recently reported complete nucleotide sequences of the 5 basic and genetically distinguishable plastid chromosomes of subsection Oenothera (I-V). In nature, Oenothera plastid genomes are associated with 6 distinct, either homozygous or heterozygous, diploid nuclear genotypes of the 3 basic genomes A, B, or C. Artificially produced plastome-genome combinations that do not occur naturally often display interspecific plastome-genome incompatibility (PGI). In this study, we compare formal genetic data available from all 30 plastome-genome combinations with sequence differences between the plastomes to uncover potential determinants for interspecific PGI. Consistent with an active role in speciation, a remarkable number of genes have high Ka/Ks ratios. Different from the Solanacean cybrid model Atropa/tobacco, RNA editing seems not to be relevant for PGIs in Oenothera. However, predominantly sequence polymorphisms in intergenic segments are proposed as possible sources for PGI. A single locus, the bidirectional promoter region between psbB and clpP, is suggested to contribute to compartmental PGI in the interspecific AB hybrid containing plastome I (AB-I), consistent with its perturbed photosystem II activity.
Bahramnejad, Bahman
2014-01-01
P. atlantica subsp. Kurdica, with the local name of Baneh, is a wild medicinal plant which grows in Kurdistan, Iran. The identification of resistance gene analogs holds great promise for the development of resistant cultivars. A PCR approach with degenerate primers designed according to conserved NBS-LRR (nucleotide binding site-leucine rich repeat) regions of known disease-resistance (R) genes was used to amplify and clone homologous sequences from P. atlantica subsp. Kurdica. A DNA fragment of the expected 500-bp size was amplified. The nucleotide sequence of this amplicon was obtained through sequencing and the predicted amino acid sequence compared to the amino acid sequences of known R-genes revealed significant sequence similarity. Alignment of the deduced amino acid sequence of P. atlantica subsp. Kurdica resistance gene analog (RGA) showed strong identity, ranging from 68% to 77%, to the non-toll interleukin receptor (non-TIR) R-gene subfamily from other plants. A P-loop motif (GMMGGEGKTT), a conserved and hydrophobic motif GLPLAL, a kinase-2a motif (LLVLDDV), when replaced by IAVFDDI in PAKRGA1 and a kinase-3a (FGPGSRIII) were presented in all RGA. A phylogenetic tree, based on the deduced amino-acid sequences of PAKRGA1 and RGAs from different species indicated that they were separated in two clusters, PAKRGA1 being on cluster II. The isolated NBS analogs can be eventually used as guidelines to isolate numerous R-genes in Pistachio. PMID:27843981
Yang, Cheng-Hong; Wu, Kuo-Chuan; Chuang, Li-Yeh; Chang, Hsueh-Wei
2018-01-01
DNA barcode sequences are accumulating in large data sets. A barcode is generally a sequence larger than 1000 base pairs and generates a computational burden. Although the DNA barcode was originally envisioned as straightforward species tags, the identification usage of barcode sequences is rarely emphasized currently. Single-nucleotide polymorphism (SNP) association studies provide us an idea that the SNPs may be the ideal target of feature selection to discriminate between different species. We hypothesize that SNP-based barcodes may be more effective than the full length of DNA barcode sequences for species discrimination. To address this issue, we tested a r ibulose diphosphate carboxylase ( rbcL ) S NP b arcoding (RSB) strategy using a decision tree algorithm. After alignment and trimming, 31 SNPs were discovered in the rbcL sequences from 38 Brassicaceae plant species. In the decision tree construction, these SNPs were computed to set up the decision rule to assign the sequences into 2 groups level by level. After algorithm processing, 37 nodes and 31 loci were required for discriminating 38 species. Finally, the sequence tags consisting of 31 rbcL SNP barcodes were identified for discriminating 38 Brassicaceae species based on the decision tree-selected SNP pattern using RSB method. Taken together, this study provides the rational that the SNP aspect of DNA barcode for rbcL gene is a useful and effective sequence for tagging 38 Brassicaceae species.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paule Roth, M.; Malfroy, L.; Offer, C.
1995-07-20
Human myelin oligodendrocyte glycoprotein (MOG), a myelin component of the central nervous system, is a candidate target antigen for autoimmune-mediated demyelination. We have isolated and sequenced part of a cosmid clone that contains the entire human MOG gene. The primary nuclear transcript, extending from the putative start of transcription to the site of poly(A) addition, is 15,561 nucleotides in length. The human MOG gene contains 8 exons, separated by 7 introns; canonical intron/exon boundary sites are observed at each junction. The introns vary in size from 242 to 6484 bp and contain numerous repetitive DNA elements, including 14 Alu sequencesmore » within 3 introns. Another Alu element is located in the 3{prime}-untranslated region of the gene. Alu sequences were classified with respect to subfamily assignment. Seven hundred sixty-three nucleotides 5{prime} of the transcription start and 1214 nucleotides 3{prime} of the poly(A) addition sites were also sequenced. The 5{prime}-flanking region revealed the presence of several consensus sequences that could be relevant in the transcription of the MOG gene, in particular binding sites in common with other myelin gene promoters. Two polymorphic intragenic dinucleotide (CA){sub n} and tetranucleotide (TAAA){sub n} repeats were identified and may provide genetic marker tools for association and linkage studies. 50 refs., 3 figs., 3 tabs.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hoefler, G.; Forstner, M.; Hulla, W.
1994-01-01
Enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme is one of the four enzymes of the peroxisomal, [beta]-oxidation pathway. Here, the authors report the full-length human cDNA sequence and the localization of the corresponding gene on chromosome 3q26.3-3q28. The cDNA sequence spans 3779 nucleotides with an open reading frame of 2169 nucleotides. The tripeptide SKL at the carboxy terminus, known to serve as a peroxisomal targeting signal, is present. DNA sequence comparison of the coding region showed an 80% homology between human and rat bifunctional enzyme cDNA. The 3[prime] noncoding sequence contains 117 nucleotides homologous to an Alu repeat. Based on sequence comparison,more » they propose that these nucleotides are a free left Alu arm with 86% homology to the Alu-J family. RNA analysis shows one band with highest intensity in liver and kidney. This cDNA will allow in-depth studies of molecular defects in patients with defective peroxisomal bifunctional enzyme. Moreover, it will also provide a means for studying the regulation of peroxisomal [beta]-oxidation in humans. 33 refs., 5 figs.« less
Sadkowska-Todys, M
2000-01-01
The aims of these studies were: genetic characteristic of street rabies virus strains isolated from different animal species in Poland and determination of phylogenetic relationships to reference laboratory strains of the street rabies viruses belonging to genotype 1 and 5. The variability of rabies isolates and their phylogenetic relationship were studied by comparing the nucleotide sequence of the virus genome fragment. The Polish strains of genotype 1 belong to four phylogenetic groups (NE, CE, NEE, EE) corresponding to four variants: fox-racoon dog (F-RD); European fox 1 (F1); European fox 2 (F2) and European fox 3 (F3). On the Polish territories there are no rabies strains representing the variant dog-wolf and typical for arctic fox variant. The similarity of nucleotide and amino acid sequences of street rabies strains belonging to genotype 1 and laboratory strain CVS is very high. It is about 91% similarity at nucleotide level and 95% at amino acid level. Rabies strain CVS is similar to genotype 5 bat strains (EBL 1) only in about 69% and 74% at nucleotide and amino acid level, respectively. The genetic divergence of rabies strains circulating in Poland raised the need of permanent epidemiological and virological surveillance. The genotype and variant of isolated strains should be determined (using PCR and RLFP methods).
Single nucleotide polymorphism analysis using different colored dye dimer probes
NASA Astrophysics Data System (ADS)
Marmé, Nicole; Friedrich, Achim; Denapaite, Dalia; Hakenbeck, Regine; Knemeyer, Jens-Peter
2006-09-01
Fluorescence quenching by dye dimer formation has been utilized to develop hairpin-structured DNA probes for the detection of a single nucleotide polymorphism (SNP) in the penicillin target gene pbp2x, which is implicated in the penicillin resistance of Streptococcus pneumoniae. We designed two specific DNA probes for the identification of the pbp2x genes from a penicillin susceptible strain R6 and a resistant strain Streptococcus mitis 661 using green-fluorescent tetramethylrhodamine (TMR) and red-fluorescent DY-636, respectively. Hybridization of each of the probes to its respective target DNA sequence opened the DNA hairpin probes, consequently breaking the nonfluorescent dye dimers into fluorescent species. This hybridization of the target with the hairpin probe achieved single nucleotide specific detection at nanomolar concentrations via increased fluorescence.
Hesamizadeh, Khashayar; Alavian, Seyed Moayed; Najafi Tireh Shabankareh, Azar; Sharafi, Heidar
2016-12-01
Hepatitis C virus (HCV) is characterized by a high degree of genetic heterogeneity and classified into 7 genotypes and different subtypes. It heterogeneously distributed through various risk groups and geographical regions. A well-established phylogenetic relationship can simplify the tracing of HCV hierarchical strata into geographical regions. The current study aimed to find genetic phylogeny of subtypes 1a and 1b of HCV isolates based on NS5B nucleotide sequences in Iran and other members of Eastern Mediterranean regional office of world health organization, as well as other Middle Eastern countries, with a systematic review of available published and unpublished studies. The phylogenetic analyses were performed based on the nucleotide sequences of NS5B gene of HCV genotype 1 (HCV-1), which were registered in the GenBank database. The literature review was performed in two steps: 1) searching studies evaluating the NS5B sequences of HCV-1, on PubMed, Scopus, and Web of Science, and 2) Searching sequences of unpublished studies registered in the GenBank database. In this study, 442 sequences from HCV-1a and 232 from HCV-1b underwent phylogenetic analysis. Phylogenetic analysis of all sequences revealed different clusters in the phylogenetic trees. The results showed that the proportion of HCV-1a and -1b isolates from Iranian patients probably originated from domestic sources. Moreover, the HCV-1b isolates from Iranian patients may have similarities with the European ones. In this study, phylogenetic reconstruction of HCV-1 sequences clearly indicated for molecular tracing and ancestral relationships of the HCV genotypes in Iran, and showed the likelihood of domestic origin for HCV-1a and various origin for HCV-1b.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kerr, J.M.; Fisher, L.W.; Termine, J.D.
The authors have isolated and partially sequenced the human bone sialoprotein gene (IBSP). IBSP has been sublocalized by in situ hybridization to chromosome 4q38-q31 and is composed of six small exons (51 to 159 bp) and 1 large exon ([approximately]2.6 kb). The intron/exon junctions defined by sequence analysis are of class O, retaining an intact coding triplet. Sequence analysis of the 5[prime] upstream region revealed a TATAA (nucleotides -30 to-25 from the transcriptional start point) and a CCAAT (nucleotides -56 to-52) box, both in the reverse orientation. Intron 1 contains interesting structural elements composed of polypyrimidine repeats followed by amore » poly(AC)[sub n] tract. Both types of structural elements have been detected in promoter regions of other genes and have been implicated in transcriptional regulation. Several differences between the previously published cDNA sequence and the authors' sequence have been identified, most of which are contained within the untranslated exon 1. Three base revisions in the coding region include a G to T (Gly to Val, amino acid 195), T to C (Val to Ala, amino acid 268), and T to A (Glu to Asp, amino acid 270). In conclusion, the genomic organization and potential regulatory elements of human IBSP have been elucidated. 42 refs., 4 figs., 1 tab.« less
E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China
Wen, Qiang; Wang, Tao; Mu, Xuemei; Chenzhang, Yuwei; Cao, Man
2017-01-01
Cancer of the cervix is associated with infection by certain types of human papillomavirus (HPV). The gene variants differ in immune responses and oncogenic potential. The E6 and E7 proteins encoded by high-risk HPV play a key role in cellular transformation. HPV-33 and HPV-58 types are highly prevalent among Chinese women. To study the gene intratypic variations, polymorphisms and positive selections of HPV-33 and HPV-58 E6/E7 in southwest China, HPV-33 (E6, E7: n = 216) and HPV-58 (E6, E7: n = 405) E6 and E7 genes were sequenced and compared to others submitted to GenBank. Phylogenetic trees were constructed by Maximum-likelihood and the Kimura 2-parameters methods by MEGA 6 (Molecular Evolutionary Genetics Analysis version 6.0). The diversity of secondary structure was analyzed by PSIPred software. The selection pressures acting on the E6/E7 genes were estimated by PAML 4.8 (Phylogenetic Analyses by Maximun Likelihood version4.8) software. The positive sites of HPV-33 and HPV-58 E6/E7 were contrasted by ClustalX 2.1. Among 216 HPV-33 E6 sequences, 8 single nucleotide mutations were observed with 6/8 non-synonymous and 2/8 synonymous mutations. The 216 HPV-33 E7 sequences showed 3 single nucleotide mutations that were non-synonymous. The 405 HPV-58 E6 sequences revealed 8 single nucleotide mutations with 4/8 non-synonymous and 4/8 synonymous mutations. Among 405 HPV-58 E7 sequences, 13 single nucleotide mutations were observed with 10/13 non-synonymous mutations and 3/13 synonymous mutations. The selective pressure analysis showed that all HPV-33 and 4/6 HPV-58 E6/E7 major non-synonymous mutations were sites of positive selection. All variations were observed in sites belonging to major histocompatibility complex and/or B-cell predicted epitopes. K93N and R145 (I/N) were observed in both HPV-33 and HPV-58 E6. PMID:28141822
Ding, Zhong; Peng, Deliang; Huang, Wenkun; He, Wenting; Gao, Bida
2008-02-01
A cDNA, named Dd-ace-2, encoding an acetylcholinesterase (AChE, EC3.1.1.7), was isolated from sweet-potato-stem nematode, Ditylenchus destructor. The nucleotide and amino acid sequences among different nematode species were compared and analyzed with DNAMAN5.0, MEGA3.0 softwares. The results showed that the complete nucleotide sequence of Dd-ace-2 gene of Ditylenchus destructor contains 2425 base pairs from which deduced 734 amino acids (GenBank accession No. EF583058). The homology rates of amino acid sequences of Dd-ace-2 gene between Ditylenchus destructor and Meloidogyne incognita, Caenorhabditis elegans, Dictyocaulus viviparous were 48.0%, 42.7%, 42.1% respectively. The mature acetylcholinesterase sequences of Ditylenchus destructor may encode by the first 701 residues of deduced 734 amino acids.The conserved motifs involved in the catalytic triad, the choline binding site and 10 aromatic residues lining the catalytic gorge were present in the Dd-ace-2 deduced protein. Phylogenetic analysis based on AChEs of other nematodes and species showed that the deduced AChE formed the same cluster with ACE-2s.
Simple sequence repeats in Escherichia coli: abundance, distribution, composition, and polymorphism.
Gur-Arie, R; Cohen, C J; Eitan, Y; Shelef, L; Hallerman, E M; Kashi, Y
2000-01-01
Computer-based genome-wide screening of the DNA sequence of Escherichia coli strain K12 revealed tens of thousands of tandem simple sequence repeat (SSR) tracts, with motifs ranging from 1 to 6 nucleotides. SSRs were well distributed throughout the genome. Mononucleotide SSRs were over-represented in noncoding regions and under-represented in open reading frames (ORFs). Nucleotide composition of mono- and dinucleotide SSRs, both in ORFs and in noncoding regions, differed from that of the genomic region in which they occurred, with 93% of all mononucleotide SSRs proving to be of A or T. Computer-based analysis of the fine position of every SSR locus in the noncoding portion of the genome relative to downstream ORFs showed SSRs located in areas that could affect gene regulation. DNA sequences at 14 arbitrarily chosen SSR tracts were compared among E. coli strains. Polymorphisms of SSR copy number were observed at four of seven mononucleotide SSR tracts screened, with all polymorphisms occurring in noncoding regions. SSR polymorphism could prove important as a genome-wide source of variation, both for practical applications (including rapid detection, strain identification, and detection of loci affecting key phenotypes) and for evolutionary adaptation of microbes.
Non-Canonical G-quadruplexes cause the hCEB1 minisatellite instability in Saccharomyces cerevisiae
Piazza, Aurèle; Cui, Xiaojie; Adrian, Michael; Samazan, Frédéric; Heddi, Brahim; Phan, Anh-Tuan; Nicolas, Alain G
2017-01-01
G-quadruplexes (G4) are polymorphic four-stranded structures formed by certain G-rich nucleic acids in vitro, but the sequence and structural features dictating their formation and function in vivo remains uncertain. Here we report a structure-function analysis of the complex hCEB1 G4-forming sequence. We isolated four G4 conformations in vitro, all of which bear unusual structural features: Form 1 bears a V-shaped loop and a snapback guanine; Form 2 contains a terminal G-triad; Form 3 bears a zero-nucleotide loop; and Form 4 is a zero-nucleotide loop monomer or an interlocked dimer. In vivo, Form 1 and Form 2 differently account for 2/3rd of the genomic instability of hCEB1 in two G4-stabilizing conditions. Form 3 and an unidentified form contribute to the remaining instability, while Form 4 has no detectable effect. This work underscores the structural polymorphisms originated from a single highly G-rich sequence and demonstrates the existence of non-canonical G4s in cells, thus broadening the definition of G4-forming sequences. DOI: http://dx.doi.org/10.7554/eLife.26884.001 PMID:28661396
Martin, Lauren; Damaso, Natalie; Mills, DeEtta
2016-10-01
Molecular methods for the detection of mammalian coat color phenotypes have expanded greatly within the past decade. Many phenotypes are associated with a single nucleotide polymorphism mutation in the genetic sequence. Traditionally, these mutations are detected through sequencing, hybridization assays or mini-sequencing. However, these techniques can be expensive and tedious. Previously, CE-SSCP using the F-108 polymer was able to distinguish SNPs for the melanocortin-1 receptor (mc1r) coat color gene in horses (Equus caballus) that differed by one nucleotide substitution. The objective of this study was to expand the detection of coat color SNPs in horses. The genes for the solute carrier family member 2 (slc45a2/matp), type III receptor protein-tyrosine kinase (kit) and mc1r genes using CE-SSCP and F-108 polymer were compared to mini-sequencing with the SNaPshot TM kit. The F-108 polymer reproducibly resolved homozygous and heterozygous individuals for the mc1r and kit markers, but was unable to resolve heterozygous individuals for slc45a2 at 38ºC. The need for temperatures <15ºC, the SNP position being close to the 5'-end, and conformational structures/free energy with similar values resulted in the inability to resolve the secondary structures. Despite this limitation, the CE-SSCP method could be used to provide a rapid phenotypic description for equine forensic investigations. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
2004-01-01
alleles have different predicted lengths, e.g. in pCC31, cpp46 starts with ATGATG whereas in pTet this gene starts with only one ATG; in ssb1 , cmgB7 and...homologues in plasmid pVT745 from Actinobacillus actinomycetemcomitans, and a single-stranded DNA-binding protein ssb1 that may coat the single-stranded
Bioinformatics: A History of Evolution "In Silico"
ERIC Educational Resources Information Center
Ondrej, Vladan; Dvorak, Petr
2012-01-01
Bioinformatics, biological databases, and the worldwide use of computers have accelerated biological research in many fields, such as evolutionary biology. Here, we describe a primer of nucleotide sequence management and the construction of a phylogenetic tree with two examples; the two selected are from completely different groups of organisms:…
Mapping RNA Structure In Vitro with SHAPE Chemistry and Next-Generation Sequencing (SHAPE-Seq).
Watters, Kyle E; Lucks, Julius B
2016-01-01
Mapping RNA structure with selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistry has proven to be a versatile method for characterizing RNA structure in a variety of contexts. SHAPE reagents covalently modify RNAs in a structure-dependent manner to create adducts at the 2'-OH group of the ribose backbone at nucleotides that are structurally flexible. The positions of these adducts are detected using reverse transcriptase (RT) primer extension, which stops one nucleotide before the modification, to create a pool of cDNAs whose lengths reflect the location of SHAPE modification. Quantification of the cDNA pools is used to estimate the "reactivity" of each nucleotide in an RNA molecule to the SHAPE reagent. High reactivities indicate nucleotides that are structurally flexible, while low reactivities indicate nucleotides that are inflexible. These SHAPE reactivities can then be used to infer RNA structures by restraining RNA structure prediction algorithms. Here, we provide a state-of-the-art protocol describing how to perform in vitro RNA structure probing with SHAPE chemistry using next-generation sequencing to quantify cDNA pools and estimate reactivities (SHAPE-Seq). The use of next-generation sequencing allows for higher throughput, more consistent data analysis, and multiplexing capabilities. The technique described herein, SHAPE-Seq v2.0, uses a universal reverse transcription priming site that is ligated to the RNA after SHAPE modification. The introduced priming site allows for the structural analysis of an RNA independent of its sequence.
Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J
2011-12-01
Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.