Manipulation of lignin composition in plants using a tissue-specific promoter

DOEpatents

Chapple, Clinton C. S.

2003-08-26

The present invention relates to methods and materials in the field of molecular biology, the manipulation of the phenylpropanoid pathway and the regulation of proteins synthesis through plant genetic engineering. More particularly, the invention relates to the introduction of a foreign nucleotide sequence into a plant genome, wherein the introduction of the nucleotide sequence effects an increase in the syringyl content of the plant's lignin. In one specific aspect, the invention relates to methods for modifying the plant lignin composition in a plant cell by the introduction there into of a foreign nucleotide sequence comprising at issue specific plant promoter sequence and a sequence encoding an active ferulate-5-hydroxylase (F5H) enzyme. Plant transformants harboring an inventive promoter-F5H construct demonstrate increased levels of syringyl monomer residues in their lignin, rendering the polymer more readily delignified and, thereby, rendering the plant more readily pulped or digested.

Effects of transcriptional start site sequence and position on nucleotide-sensitive selection of alternative start sites at the pyrC promoter in Escherichia coli.

PubMed Central

Liu, J; Turnbough, C L

1994-01-01

In Escherichia coli, expression of the pyrC gene is regulated primarily by a translational control mechanism based on nucleotide-sensitive selection of transcriptional start sites at the pyrC promoter. When intracellular levels of CTP are high, pyrC transcripts are initiated predominantly with CTP at a site 7 bases downstream of the Pribnow box. These transcripts form a stable hairpin at their 5' ends that blocks ribosome binding. When the CTP level is low and the GTP level is high, conditions found in pyrimidine-limited cells, transcripts are initiated primarily with GTP at a site 9 bases downstream of the Pribnow box. These shorter transcripts are unable to form a hairpin at their 5' ends and are readily translated. In this study, we examined the effects of nucleotide sequence and position on the selection of transcriptional start sites at the pyrC promoter. We characterized promoter mutations that systematically alter the sequence at position 7 or 9 downstream of the Pribnow box or vary the spacing between the Pribnow box and wild-type transcriptional initiation region. The results reveal preferences for particular initiating nucleotides (ATP > or = GTP > UTP >> CTP) and for starting positions downstream of the Pribnow box (7 >> 6 and 8 > 9 > 10). The results indicate that optimal nucleotide-sensitive start site switching at the wild-type pyrC promoter is the result of competition between the preferred start site (position 7) that uses the poorest initiating nucleotide (CTP) and a weak start site (position 9) that uses a good initiating nucleotide (GTP). The sequence of the pyrC promoter also minimizes the synthesis of untranslatable transcripts and provides for maximum stability of the regulatory transcript hairpin. In addition, the results show that the effects of the mutations on pyrC expression and regulation are consistent with the current model for translational control. Possible effects of preferences for initiating nucleotides and start sites on the expression and regulation of other genes are discussed. Images PMID:7910603

Protein sequence annotation in the genome era: the annotation concept of SWISS-PROT+TREMBL.

PubMed

Apweiler, R; Gateau, A; Contrino, S; Martin, M J; Junker, V; O'Donovan, C; Lang, F; Mitaritonna, N; Kappus, S; Bairoch, A

1997-01-01

SWISS-PROT is a curated protein sequence database which strives to provide a high level of annotation, a minimal level of redundancy and high level of integration with other databases. Ongoing genome sequencing projects have dramatically increased the number of protein sequences to be incorporated into SWISS-PROT. Since we do not want to dilute the quality standards of SWISS-PROT by incorporating sequences without proper sequence analysis and annotation, we cannot speed up the incorporation of new incoming data indefinitely. However, as we also want to make the sequences available as fast as possible, we introduced TREMBL (TRanslation of EMBL nucleotide sequence database), a supplement to SWISS-PROT. TREMBL consists of computer-annotated entries in SWISS-PROT format derived from the translation of all coding sequences (CDS) in the EMBL nucleotide sequence database, except for CDS already included in SWISS-PROT. While TREMBL is already of immense value, its computer-generated annotation does not match the quality of SWISS-PROTs. The main difference is in the protein functional information attached to sequences. With this in mind, we are dedicating substantial effort to develop and apply computer methods to enhance the functional information attached to TREMBL entries.

Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp. NPVs.

PubMed

Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko

2009-10-01

A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.

Overproduction and nucleotide sequence of the respiratory D-lactate dehydrogenase of Escherichia coli.

PubMed Central

Rule, G S; Pratt, E A; Chin, C C; Wold, F; Ho, C

1985-01-01

Recombinant DNA plasmids containing the gene for the membrane-bound D-lactate dehydrogenase (D-LDH) of Escherichia coli linked to the promoter PL from lambda were constructed. After induction, the levels of D-LDH were elevated 300-fold over that of the wild type and amounted to 35% of the total cellular protein. The nucleotide sequence of the D-LDH gene was determined and shown to agree with the amino acid composition and the amino-terminal sequence of the purified enzyme. Removal of the amino-terminal formyl-Met from D-LDH was not inhibited in cells which contained these high levels of D-LDH. Images PMID:3882663

Nucleotide sequence of a resistance breaking mutant of southern bean mosaic virus.

PubMed

Lee, L; Anderson, E J

1998-01-01

SBMV-S is a resistance-breaking mutant of an Arkansas isolate of the bean strain of southern bean mosaic virus (SBMV-BARK) that is able to move systemically in Phaseolus vulgaris cvs. Pinto and Great Northern, whereas the wild-type SBMV-BARK causes local necrotic lesions and is restricted to the inoculated leaves of these hosts. Sequence analysis of the 4136 nucleotide genomes of SBMV-BARK and SBMV-S revealed seven nucleotide differences, but only four deduced amino acid changes. A single amino acid change occurred in the C-terminal region of the putative RNA-dependent RNA polymerase and three differences were identified in the N-terminal portion of the virus coat protein. SBMV-BARK and SBMV-S were compared with other sobemoviruses and were found to contain a high level of nucleotide sequence identity (91.3%) to SBMV-B. Unlike SBMV-B however, SBMV-BARK and SBMV-S contained four putative overlapping open reading frames, making them more similar in genome organization to the cowpea strain, SBMV-C. The possibility exists that mutations or even errors, that resulted in mis-identification of open reading frames, occurred in previously published information on nucleotide sequence and genomic organization for SBMV-B.

Zn-metalloprotease sequences in extremophiles

NASA Astrophysics Data System (ADS)

Holden, T.; Dehipawala, S.; Golebiewska, U.; Cheung, E.; Tremberger, G., Jr.; Williams, E.; Schneider, P.; Gadura, N.; Lieberman, D.; Cheung, T.

2010-09-01

The Zn-metalloprotease family contains conserved amino acid structures such that the nucleotide fluctuation at the DNA level would exhibit correlated randomness as described by fractal dimension. A nucleotide sequence fractal dimension can be calculated from a numerical series consisting of the atomic numbers of each nucleotide. The structure's vibration modes can also be studied using a Gaussian Network Model. The vibration measure and fractal dimension values form a two-dimensional plot with a standard vector metric that can be used for comparison of structures. The preference for amino acid usage in extremophiles may suppress nucleotide fluctuations that could be analyzed in terms of fractal dimension and Shannon entropy. A protein level cold adaptation study of the thermolysin Zn-metalloprotease family using molecular dynamics simulation was reported recently and our results show that the associated nucleotide fluctuation suppression is consistent with a regression pattern generated from the sequences's fractal dimension and entropy values (R-square { 0.98, N =5). It was observed that cold adaptation selected for high entropy and low fractal dimension values. Extension to the Archaemetzincin M54 family in extremophiles reveals a similar regression pattern (R-square = 0.98, N = 6). It was observed that the metalloprotease sequences of extremely halophilic organisms possess high fractal dimension and low entropy values as compared with non-halophiles. The zinc atom is usually bonded to the histidine residue, which shows limited levels of vibration in the Gaussian Network Model. The variability of the fractal dimension and entropy for a given protein structure suggests that extremophiles would have evolved after mesophiles, consistent with the bias usage of non-prebiotic amino acids by extremophiles. It may be argued that extremophiles have the capacity to offer extinction protection during drastic changes in astrobiological environments.

Characterizing novel endogenous retroviruses from genetic variation inferred from short sequence reads

PubMed Central

Mourier, Tobias; Mollerup, Sarah; Vinner, Lasse; Hansen, Thomas Arn; Kjartansdóttir, Kristín Rós; Guldberg Frøslev, Tobias; Snogdal Boutrup, Torsten; Nielsen, Lars Peter; Willerslev, Eske; Hansen, Anders J.

2015-01-01

From Illumina sequencing of DNA from brain and liver tissue from the lion, Panthera leo, and tumor samples from the pike-perch, Sander lucioperca, we obtained two assembled sequence contigs with similarity to known retroviruses. Phylogenetic analyses suggest that the pike-perch retrovirus belongs to the epsilonretroviruses, and the lion retrovirus to the gammaretroviruses. To determine if these novel retroviral sequences originate from an endogenous retrovirus or from a recently integrated exogenous retrovirus, we assessed the genetic diversity of the parental sequences from which the short Illumina reads are derived. First, we showed by simulations that we can robustly infer the level of genetic diversity from short sequence reads. Second, we find that the measures of nucleotide diversity inferred from our retroviral sequences significantly exceed the level observed from Human Immunodeficiency Virus infections, prompting us to conclude that the novel retroviruses are both of endogenous origin. Through further simulations, we rule out the possibility that the observed elevated levels of nucleotide diversity are the result of co-infection with two closely related exogenous retroviruses. PMID:26493184

An extended sequence specificity for UV-induced DNA damage.

PubMed

Chung, Long H; Murray, Vincent

2018-01-01

The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

Biological nanopore MspA for DNA sequencing

NASA Astrophysics Data System (ADS)

Manrao, Elizabeth A.

Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.

Identification of two allelic IgG1 C(H) coding regions (Cgamma1) of cat.

PubMed

Kanai, T H; Ueda, S; Nakamura, T

2000-01-31

Two types of cDNA encoding IgG1 heavy chain (gamma1) were isolated from a single domestic short-hair cat. Sequence analysis indicated a higher level of similarity of these Cgamma1 sequences to human Cgamma1 sequence (76.9 and 77.0%) than to mouse sequence (70.0 and 69.7%) at the nucleotide level. Predicted primary structures of both the feline Cgamma1 genes, designated as Cgamma1a and Cgamma1b, were similar to that of human Cgamma1 gene, for instance, as to the size of constant domains, the presence of six conserved cysteine residues involved in formation of the domain structure, and the location of a conserved N-linked glycosylation site. Sequence comparison between the two alleles showed that 7 out of 10 nucleotide differences were within the C(H)3 domain coding region, all leading to nonsynonymous changes in amino acid residues. Partial sequence analysis of genomic clones showed three nucleotide substitutions between the two Cgamma1 alleles in the intron between the CH2 and C(H)3 domain coding regions. In 12 domestic short-hair cats used in this study, the frequency of Cgamma1a allele (62.5%) was higher than that of the Cgamma1b allele (37.5%).

High levels of MHC class II allelic diversity in lake trout from Lake Superior

USGS Publications Warehouse

Dorschner, M.O.; Duris, T.; Bronte, C.R.; Burnham-Curtis, M. K.; Phillips, R.B.

2000-01-01

Sequence variation in a 216 bp portion of the major histocompatibility complex (MHC) II B1 domain was examined in 74 individual lake trout (Salvelinus namaycush) from different locations in Lake Superior. Forty-three alleles were obtained which encoded 71-72 amino acids of the mature protein. These sequences were compared with previous data obtained from five Pacific salmon species and Atlantic salmon using the same primers. Although all of the lake trout alleles clustered together in the neighbor-joining analysis of amino acid sequences, one amino acid allelic lineage was shared with Atlantic salmon (Salmo salar), a species in another genus which probably diverged from Salvelinus more than 10-20 million years ago. As shown previously in other salmonids, the level of nonsynonymous nucleotide substitution (d(N)) exceeded the level of synonymous substitution (d(S)). The level of nucleotide diversity at the MHC class II B1 locus was considerably higher in lake trout than in the Pacific salmon (genus Oncorhynchus). These results are consistent with the hypothesis that lake trout colonized Lake Superior from more than one refuge following the Wisconsin glaciation. Recent population bottlenecks may have reduced nucleotide diversity in Pacific salmon populations.

Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

PubMed

Nishizawa, M; Nishizawa, K

2000-10-01

The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions

PubMed Central

Nishizawa, Manami; Nishizawa, Kazuhisa

2000-01-01

The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the ‘between gene’ GC content heterogeneity, which is linked to ‘isochores’, is a principal factor associated with the bias in substitution patterns in human, ‘within gene’ heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed. PMID:11000273

Characterization of durum wheat high molecular weight glutenin subunits Bx20 and By20 sequences by a molecular and proteomic approach.

PubMed

Santagati, Vito Davide; Sestili, Francesco; Lafiandra, Domenico; D'Ovidio, Renato; Rogniaux, Helene; Masci, Stefania

2016-07-01

Wheat high molecular weight glutenin subunit variation is important because of its great influence on glutenin polymer structure, that is related to dough technological properties. Among the different subunits, the pair Bx20 and By20 is known to have a negative effect on quality, but the reasons are not clear: Bx20 has two cysteines, which theoretically make this subunit a chain extender of the glutenin polymer, just like the other Bx subunits, showing four cysteines, two of which should be involved in intra-molecular disulfide bonds. By20 has never been characterized so far at molecular level. Here we report the nucleotide sequences of Bx20 and By20 genes isolated from the durum wheat cultivar 'Lira 45' and the validation of the corresponding deduced amino acid sequences by using MALDI-TOF and LC-MS/MS. Four nucleotide differences were identified in the Bx20 gene with respect to the deduced sequence present in NCBI, causing two amino acid substitutions. For the By20 subunit, nucleotide and amino acid sequences revealed a great similarity to By15, both at gene and protein levels, showing five nucleotide changes generating two amino acid differences. No evidence of post-translational modifications has been found. Hypotheses are formulated in regard to relationships with technological quality. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Nucleotide sequencing and serological evidence that the recently recognized deer tick virus is a genotype of Powassan virus.

PubMed

Beasley, D W; Suderman, M T; Holbrook, M R; Barrett, A D

2001-11-05

Deer tick virus (DTV) is a recently recognized North American virus isolated from Ixodes dammini ticks. Nucleotide sequencing of fragments of structural and non-structural protein genes suggested that this virus was most closely related to the tick-borne flavivirus Powassan (POW), which causes potentially fatal encephalitis in humans. To determine whether DTV represents a new and distinct member of the Flavivirus genus of the family Flaviviridae, we sequenced the structural protein genes and 5' and 3' non-coding regions of this virus. In addition, we compared the reactivity of DTV and POW in hemagglutination inhibition tests with a panel of polyclonal and monoclonal antisera, and performed cross-neutralization experiments using anti-DTV antisera. Nucleotide sequencing revealed a high degree of homology between DTV and POW at both nucleotide (>80% homology) and amino acid (>90% homology) levels, and the two viruses were indistinguishable in serological assays and mouse neuroinvasiveness. On the basis of these results, we suggest that DTV should be classified as a genotype of POW virus.

[Sequencing and analysis of complete genome of rabies viruses isolated from Chinese Ferret-Badger and dog in Zhejiang province].

PubMed

Lei, Yong-Liang; Wang, Xiao-Guang; Tao, Xiao-Yan; Li, Hao; Meng, Sheng-Li; Chen, Xiu-Ying; Liu, Fu-Ming; Ye, Bi-Feng; Tang, Qing

2010-01-01

Based on sequencing the full-length genomes of four Chinese Ferret-Badger and dog, we analyze the properties of rabies viruses genetic variation in molecular level, get the information about rabies viruses prevalence and variation in Zhejiang, and enrich the genome database of rabies viruses street strains isolated from China. Rabies viruses in suckling mice were isolated, overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses from Chinese Ferret-Badger, dog, sika deer, vole, used vaccine strain were determined. The four full-length genomes were sequenced completely and had the same genetic structure with the length of 11, 923 nts or 11, 925 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions(IGRs), 423 nts-Pseudogene-like sequence (psi), 70 nts-Trailer. The four full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by BLAST and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the four full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so the nucleotide mutations happened in these four genomes were most synonymous mutations. Compared with the reference rabies viruses, the lengths of the five protein coding regions had no change, no recombination, only with a few point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the four genomes were similar to the reference vaccine or street strains. And the four strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessed the distinct district characteristics of China. Therefore, these four rabies viruses are likely to be street viruses already existing in the natural world.

The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

PubMed

Hammond, R W; Crosslin, J M

1995-04-01

The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

Nucleotide sequencing and identification of some wild mushrooms.

PubMed

Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari

2013-01-01

The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

The immediate upstream region of the 5′-UTR from the AUG start codon has a pronounced effect on the translational efficiency in Arabidopsis thaliana

PubMed Central

Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan

2014-01-01

The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084

Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

PubMed Central

Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

PubMed

Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

Code of Federal Regulations, 2011 CFR

2011-07-01

... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

T box transcription antitermination riboswitch: Influence of nucleotide sequence and orientation on tRNA binding by the antiterminator element

PubMed Central

Fauzi, Hamid; Agyeman, Akwasi; Hines, Jennifer V.

2008-01-01

Many bacteria utilize riboswitch transcription regulation to monitor and appropriately respond to cellular levels of important metabolites or effector molecules. The T box transcription antitermination riboswitch responds to cognate uncharged tRNA by specifically stabilizing an antiterminator element in the 5′-untranslated mRNA leader region and precluding formation of a thermodynamically more stable terminator element. Stabilization occurs when the tRNA acceptor end base pairs with the first four nucleotides in the seven nucleotide bulge of the highly conserved antiterminator element. The significance of the conservation of the antiterminator bulge nucleotides that do not base pair with the tRNA is unknown, but they are required for optimal function. In vitro selection was used to determine if the isolated antiterminator bulge context alone dictates the mode in which the tRNA acceptor end binds the bulge nucleotides. No sequence conservation beyond complementarity was observed and the location was not constrained to the first four bases of the bulge. The results indicate that formation of a structure that recognizes the tRNA acceptor end in isolation is not the determinant driving force for the high phylogenetic sequence conservation observed within the antiterminator bulge. Additional factors or T box leader features more likely influenced the phylogenetic sequence conservation. PMID:19152843

The maize stripe virus major noncapsid protein messenger RNA transcripts contain heterogeneous leader sequences at their 5' termini.

PubMed

Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W

1993-12-01

Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

Tidying Up International Nucleotide Sequence Databases: Ecological, Geographical and Sequence Quality Annotation of ITS Sequences of Mycorrhizal Fungi

PubMed Central

Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R. Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M.; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

2011-01-01

Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi. PMID:21949797

Genomic diversity of the human intestinal parasite Entamoeba histolytica

PubMed Central

2012-01-01

Background Entamoeba histolytica is a significant cause of disease worldwide. However, little is known about the genetic diversity of the parasite. We re-sequenced the genomes of ten laboratory cultured lines of the eukaryotic pathogen Entamoeba histolytica in order to develop a picture of genetic diversity across the genome. Results The extreme nucleotide composition bias and repetitiveness of the E. histolytica genome provide a challenge for short-read mapping, yet we were able to define putative single nucleotide polymorphisms in a large portion of the genome. The results suggest a rather low level of single nucleotide diversity, although genes and gene families with putative roles in virulence are among the more polymorphic genes. We did observe large differences in coverage depth among genes, indicating differences in gene copy number between genomes. We found evidence indicating that recombination has occurred in the history of the sequenced genomes, suggesting that E. histolytica may reproduce sexually. Conclusions E. histolytica displays a relatively low level of nucleotide diversity across its genome. However, large differences in gene family content and gene copy number are seen among the sequenced genomes. The pattern of polymorphism indicates that E. histolytica reproduces sexually, or has done so in the past, which has previously been suggested but not proven. PMID:22630046

Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70.

PubMed Central

Hunt, C; Morimoto, R I

1985-01-01

We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075

77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-29

... DEPARTMENT OF COMMERCE Patent and Trademark Office Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request... Patent applications that contain nucleotide and/or amino acid sequence disclosures must include a copy of...

Conservation of the structure and organization of lupin mitochondrial nad3 and rps12 genes.

PubMed

Rurek, M; Oczkowski, M; Augustyniak, H

1998-01-01

A high level of the nucleotide sequence conservation of mitochondrial nad3 and rps12 genes was found in four lupin species. The only differences concern three nucleotides in the Lupinus albus rps12 gene and three nucleotides insertion in the L. mutabilis spacer. Northern blot analysis as well as RT-PCR confirmed cotranscription of the L. luteus genes because the transcripts detected were long enough.

Simian immunodeficiency viruses from African green monkeys display unusual genetic diversity.

PubMed Central

Johnson, P R; Fomsgaard, A; Allan, J; Gravell, M; London, W T; Olmsted, R A; Hirsch, V M

1990-01-01

African green monkeys are asymptomatic carriers of simian immunodeficiency viruses (SIV), commonly called SIVagm. As many as 50% of African green monkeys in the wild may be SIV seropositive. This high seroprevalence rate and the potential for genetic variation of lentiviruses suggested to us that African green monkeys may harbor widely differing genotypes of SIVagm. To investigate this hypothesis, we determined the entire nucleotide sequence of an infectious proviral molecular clone of SIVagm (155-4) and partial sequences (long terminal repeat and Gag) of three other distinct SIVagm isolates (90, gri-1, and ver-1). Comparisons among the SIVagm isolates revealed extreme diversity at the nucleotide and amino acid levels. Long terminal repeat nucleotide sequences varied up to 35% and Gag protein sequences varied up to 30%. The variability among SIVagm isolates exceeded the variability among any other group of primate lentiviruses. Our data suggest that SIVagm has been in the African green monkey population for a long time and may be the oldest primate lentivirus group in existence. PMID:2304139

Sounds of silence: synonymous nucleotides as a key to biological regulation and complexity

PubMed Central

Shabalina, Svetlana A.; Spiridonov, Nikolay A.; Kashina, Anna

2013-01-01

Messenger RNA is a key component of an intricate regulatory network of its own. It accommodates numerous nucleotide signals that overlap protein coding sequences and are responsible for multiple levels of regulation and generation of biological complexity. A wealth of structural and regulatory information, which mRNA carries in addition to the encoded amino acid sequence, raises the question of how these signals and overlapping codes are delineated along non-synonymous and synonymous positions in protein coding regions, especially in eukaryotes. Silent or synonymous codon positions, which do not determine amino acid sequences of the encoded proteins, define mRNA secondary structure and stability and affect the rate of translation, folding and post-translational modifications of nascent polypeptides. The RNA level selection is acting on synonymous sites in both prokaryotes and eukaryotes and is more common than previously thought. Selection pressure on the coding gene regions follows three-nucleotide periodic pattern of nucleotide base-pairing in mRNA, which is imposed by the genetic code. Synonymous positions of the coding regions have a higher level of hybridization potential relative to non-synonymous positions, and are multifunctional in their regulatory and structural roles. Recent experimental evidence and analysis of mRNA structure and interspecies conservation suggest that there is an evolutionary tradeoff between selective pressure acting at the RNA and protein levels. Here we provide a comprehensive overview of the studies that define the role of silent positions in regulating RNA structure and processing that exert downstream effects on proteins and their functions. PMID:23293005

Random Amplification and Pyrosequencing for Identification of Novel Viral Genome Sequences

PubMed Central

Hang, Jun; Forshey, Brett M.; Kochel, Tadeusz J.; Li, Tao; Solórzano, Víctor Fiestas; Halsey, Eric S.; Kuschner, Robert A.

2012-01-01

ssRNA viruses have high levels of genomic divergence, which can lead to difficulty in genomic characterization of new viruses using traditional PCR amplification and sequencing methods. In this study, random reverse transcription, anchored random PCR amplification, and high-throughput pyrosequencing were used to identify orthobunyavirus sequences from total RNA extracted from viral cultures of acute febrile illness specimens. Draft genome sequence for the orthobunyavirus L segment was assembled and sequentially extended using de novo assembly contigs from pyrosequencing reads and orthobunyavirus sequences in GenBank as guidance. Accuracy and continuous coverage were achieved by mapping all reads to the L segment draft sequence. Subsequently, RT-PCR and Sanger sequencing were used to complete the genome sequence. The complete L segment was found to be 6936 bases in length, encoding a 2248-aa putative RNA polymerase. The identified L segment was distinct from previously published South American orthobunyaviruses, sharing 63% and 54% identity at the nucleotide and amino acid level, respectively, with the complete Oropouche virus L segment and 73% and 81% identity at the nucleotide and amino acid level, respectively, with a partial Caraparu virus L segment. The result demonstrated the effectiveness of a sequence-independent amplification and next-generation sequencing approach for obtaining complete viral genomes from total nucleic acid extracts and its use in pathogen discovery. PMID:22468136

Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX

2009-02-24

Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Brucella and methods for the detection of Brucella

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L

Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide Sequence Database Comparison for Routine Dermatophyte Identification by Internal Transcribed Spacer 2 Genetic Region DNA Barcoding.

PubMed

Normand, A C; Packeu, A; Cassagne, C; Hendrickx, M; Ranque, S; Piarroux, R

2018-05-01

Conventional dermatophyte identification is based on morphological features. However, recent studies have proposed to use the nucleotide sequences of the rRNA internal transcribed spacer (ITS) region as an identification barcode of all fungi, including dermatophytes. Several nucleotide databases are available to compare sequences and thus identify isolates; however, these databases often contain mislabeled sequences that impair sequence-based identification. We evaluated five of these databases on a clinical isolate panel. We selected 292 clinical dermatophyte strains that were prospectively subjected to an ITS2 nucleotide sequence analysis. Sequences were analyzed against the databases, and the results were compared to clusters obtained via DNA alignment of sequence segments. The DNA tree served as the identification standard throughout the study. According to the ITS2 sequence identification, the majority of strains (255/292) belonged to the genus Trichophyton , mainly T. rubrum complex ( n = 184), T. interdigitale ( n = 40), T. tonsurans ( n = 26), and T. benhamiae ( n = 5). Other genera included Microsporum (e.g., M. canis [ n = 21], M. audouinii [ n = 10], Nannizzia gypsea [ n = 3], and Epidermophyton [ n = 3]). Species-level identification of T. rubrum complex isolates was an issue. Overall, ITS DNA sequencing is a reliable tool to identify dermatophyte species given that a comprehensive and correctly labeled database is consulted. Since many inaccurate identification results exist in the DNA databases used for this study, reference databases must be verified frequently and amended in line with the current revisions of fungal taxonomy. Before describing a new species or adding a new DNA reference to the available databases, its position in the phylogenetic tree must be verified. Copyright © 2018 American Society for Microbiology.

Complete genome sequence analysis of novel human bocavirus reveals genetic recombination between human bocavirus 2 and human bocavirus 4.

PubMed

Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

2013-07-01

Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.

[Complete genome sequencing and analyses of rabies viruses isolated from wild animals (Chinese Ferret-Badger) in Zhejiang province].

PubMed

Lei, Yong-Liang; Wang, Xiao-Guang; Liu, Fu-Ming; Chen, Xiu-Ying; Ye, Bi-Feng; Mei, Jian-Hua; Lan, Jin-Quan; Tang, Qing

2009-08-01

Based on sequencing the full-length genomes of two Chinese Ferret-Badger, we analyzed the properties of rabies viruses genetic variation in molecular level to get information on prevalence and variation of rabies viruses in Zhejiang, and to enrich the genome database of rabies viruses street strains isolated from Chinese wildlife. Overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses of the N genes from Chinese Ferret-Badger, sika deer, vole, dog. Vaccine strains were then determined. The two full-length genomes were completely sequenced to find out that they had the same genetic structure with 11 923 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions (IGRs), 423 nts-Pseudogene-like sequence (Psi), 70 nts-Trailer. The two full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by blast and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the two full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so that the nucleotide mutations happened in these two genomes were most probably as synonymous mutations. Compared to the referenced rabies viruses, the lengths of the five protein coding regions did not show any changes or recombination, but only with a few-point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the two ferret badgers genomes were similar to the referenced vaccine or street strains. The two strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessing the distinct geographyphic characteristics of China. All the evidence suggested a cue that these two ferret badgers rabies viruses were likely to be street virus that already circulating in wildlife.

FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation.

PubMed

Bolleman, Jerven T; Mungall, Christopher J; Strozzi, Francesco; Baran, Joachim; Dumontier, Michel; Bonnal, Raoul J P; Buels, Robert; Hoehndorf, Robert; Fujisawa, Takatomo; Katayama, Toshiaki; Cock, Peter J A

2016-06-13

Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. We have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned "omics" areas. Using the same data format to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe - and potentially merge - sequence annotations from multiple sources. Data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.

FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation

DOE PAGES

Bolleman, Jerven T.; Mungall, Christopher J.; Strozzi, Francesco; ...

2016-06-13

Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. In this paper, we have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned “omics” areas. Using the same data formatmore » to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe – and potentially merge – sequence annotations from multiple sources. Finally, data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.« less

FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bolleman, Jerven T.; Mungall, Christopher J.; Strozzi, Francesco

Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. In this paper, we have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned “omics” areas. Using the same data formatmore » to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe – and potentially merge – sequence annotations from multiple sources. Finally, data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.« less

Phylogenetic analysis of Hungarian goose parvovirus isolates and vaccine strains.

PubMed

Tatár-Kis, Tímea; Mató, Tamás; Markos, Béla; Palya, Vilmos

2004-08-01

Polymerase chain reaction and sequencing were used to analyse goose parvovirus field isolates and vaccine strains. Two fragments of the genome were amplified. Fragment "A" represents a region of VP3 gene, while fragment "B" represents a region upstream of the VP3 gene, encompassing part of the VP1 gene. In the region of fragment "A" the deduced amino acid sequence of the strains was identical, therefore differentiation among strains could be done only at the nucleotide level, which resulted in the formation of three groups: Hungarian, West-European and Asian strains. In the region of fragment "B", separation of groups could be done by both nucleotide and deduced amino acid sequence level. The nucleotide sequences resulted in the same groups as for fragment "A" but with a different clustering pattern among the Hungarian strains. Within the "Hungarian" group most of the recent field isolates fell into one cluster, very closely related or identical to each other, indicating a very slow evolutionary change. The attenuated strains and field isolates from 1979/80 formed a separate cluster. When vaccine strains and field isolates were compared, two specific amino acid differences were found that can be considered as possible markers for vaccinal strains. Sequence analysis of fragment "B" seems to be a suitable method for differentiation of attenuated vaccine strains from virulent strains. Copyright 2004 Houghton Trust Ltd

Inhibition of Escherichia coli viability by external guide sequences complementary to two essential genes

PubMed Central

McKinney, Jeffrey; Guerrier-Takada, Cecilia; Wesolowski, Donna; Altman, Sidney

2001-01-01

Narrow spectrum antimicrobial activity has been designed to reduce the expression of two essential genes, one coding for the protein subunit of RNase P (C5 protein) and one for gyrase (gyrase A). In both cases, external guide sequences (EGS) have been designed to complex with either mRNA. Using the EGS technology, the level of microbial viability is reduced to less than 10% of the wild-type strain. The EGSs are additive when used together and depend on the number of nucleotides paired when attacking gyrase A mRNA. In the case of gyrase A, three nucleotides unpaired out of a 15-mer EGS still favor complete inhibition by the EGS but five unpaired nucleotides do not. PMID:11381134

Genetic variation in potential Giardia vaccine candidates cyst wall protein 2 and α1-giardin.

PubMed

Radunovic, Matej; Klotz, Christian; Saghaug, Christina Skår; Brattbakk, Hans-Richard; Aebischer, Toni; Langeland, Nina; Hanevik, Kurt

2017-08-01

Giardia is a prevalent intestinal parasitic infection. The trophozoite structural protein a1-giardin (a1-g) and the cyst protein cyst wall protein 2 (CWP2) have shown promise as Giardia vaccine antigen candidates in murine models. The present study assesses the genetic diversity of a1-g and CWP2 between and within assemblages A and B in human clinical isolates. a1-g and CWP2 sequences were acquired from 15 Norwegian isolates by PCR amplification and 20 sequences from German cultured isolates by whole genome sequencing. Sequences were aligned to reference genomes from assemblage A2 and B to identify genetic variance. Genetic diversity was found between assemblage A and B reference sequences for both a1-g (90.8% nucleotide identity) and CWP2 (82.5% nucleotide identity). However, for a1-g, this translated into only 3 amino acid (aa) substitutions, while for CWP2 there were 41 aa substitutions, and also one aa deletion. Genetic diversity within assemblage B was larger; nucleotide identity 92.0% for a1-g and 94.3% for CWP2, than within assemblage A (nucleotide identity 99.0% for a1-g and 99.7% for CWP2). For CWP2, the diversity on both nucleotide and protein level was higher in the C-terminal end. Predicted antigenic epitopes were not affected for a1-g, but partially for CWP2. Despite genetic diversity in a1-g, we found aa sequence, characteristics, and antigenicity to be well preserved. CWP2 showed more aa variance and potential antigenic differences. Several CWP2 antigens might be necessary in a future Giardia vaccine to provide cross protection against both Giardia assemblages infecting humans.

Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

PubMed

Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

2013-06-01

Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, David B.; Lao, Guifang

1998-01-01

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

High Degree of Interlaboratory Reproducibility of Human Immunodeficiency Virus Type 1 Protease and Reverse Transcriptase Sequencing of Plasma Samples from Heavily Treated Patients

PubMed Central

Shafer, Robert W.; Hertogs, Kurt; Zolopa, Andrew R.; Warford, Ann; Bloor, Stuart; Betts, Bradley J.; Merigan, Thomas C.; Harrigan, Richard; Larder, Brendon A.

2001-01-01

We assessed the reproducibility of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) and protease sequencing using cryopreserved plasma aliquots obtained from 46 heavily treated HIV-1-infected individuals in two laboratories using dideoxynucleotide sequencing. The rates of complete sequence concordance between the two laboratories were 99.1% for the protease sequence and 99.0% for the RT sequence. Approximately 90% of the discordances were partial, defined as one laboratory detecting a mixture and the second laboratory detecting only one of the mixture's components. Only 0.1% of the nucleotides were completely discordant between the two laboratories, and these were significantly more likely to occur in plasma samples with lower plasma HIV-1 RNA levels. Nucleotide mixtures were detected at approximately 1% of the nucleotide positions, and in every case in which one laboratory detected a mixture, the second laboratory either detected the same mixture or detected one of the mixture's components. The high rate of concordance in detecting mixtures and the fact that most discordances between the two laboratories were partial suggest that most discordances were caused by variation in sampling of the HIV-1 quasispecies by PCR rather than by technical errors in the sequencing process itself. PMID:11283081

Molecular characterization of a distinct monopartite begomovirus associated with betasatellites and alphasatellites infecting Pisum sativum in Nepal.

PubMed

Shahid, M S; Pudashini, B J; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

2017-04-01

Pea (Pisum sativum) plants exhibiting leaf distortion, yellowing, stunted growth and reduction in leaf size from Rampur, Nepal were shown to be infected by a begomovirus in association with betasatellites and alphasatellites. The begomovirus associated with the disease showed only low levels of nucleotide sequence identity (<91%) to previously characterized begomoviruses. This finding indicates that the pea samples were infected with an as yet undescribed begomovirus for which the name Pea leaf distortion virus (PLDV) is proposed. Two species of betasatellite were identified in association with PLDV. One group of sequences had high (>78%) nucleotide sequence identity to isolates of Ludwigia leaf distortion betasatellite (LuLDB), and the second group had less than 78% to all other betasatellite sequences. This showed PLDV to be associated with either LuLDB or a previously undescribed betasatellite for which the name Pea leaf distortion betasatellite is proposed. Two types of alphasatellites were identified in the PLDV-infected pea plants. The first type showed high levels of sequence identity to Ageratum yellow vein alphasatellite, and the second type showed high levels of identity to isolates of Sida yellow vein China alphasatellite. These are the first begomovirus, betasatellites and alphasatellites isolated from pea.

The nucleotide sequence of HLA-B{sup *}2704 reveals a new amino acid substitution in exon 4 which is also present in HLA-B{sup *}2706

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rudwaleit, M.; Bowness, P.; Wordsworth, P.

1996-12-31

The HLA-B27 subtype HLA-B{sup *}2704 is virtually absent in Caucasians but common in Orientals, where it is associated with ankylosing spondylitis. The amino acid sequence of HLA-B{sup *}2704 has been established by peptide mapping and was shown to differ by two amino acids from HLA-B{sup *}2705, HLA-B{sup *}2704 is characterized by a serine for aspartic acid substitution at position 77 and glutamic acid for valine at position 152. To date, however, no nucleotide sequence confirming these changes at the DNA level has been published. 13 refs., 2 figs.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2007-02-06

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2009-02-24

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Developing 100K Affymetrix Axiom SNP Array for Polyploid Sugarcane

USDA-ARS?s Scientific Manuscript database

Sugarcane genotyping or fingerprinting has long been a daunting task due to its high polyploidy level with large number of chromosomes. Single nucleotide polymorphisms (SNPs) are very abundant DNA sequence variations in the genomes. With the advance of next generation sequencing (NGS) technologies, ...

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, D.B.; Lao, G.

1998-01-06

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

Homology analysis and cross-immunogenicity of OmpA from pathogenic Yersinia enterocolitica, Yersinia pseudotuberculosis and Yersinia pestis.

PubMed

Chen, Yuhuang; Duan, Ran; Li, Xu; Li, Kewei; Liang, Junrong; Liu, Chang; Qiu, Haiyan; Xiao, Yuchun; Jing, Huaiqi; Wang, Xin

2015-12-01

The outer membrane protein A (OmpA) is one of the intra-species conserved proteins with immunogenicity widely found in the family of Enterobacteriaceae. Here we first confirmed OmpA is conserved in the three pathogenic Yersinia: Yersinia pestis, Yersinia pseudotuberculosis and pathogenic Yersinia enterocolitica, with high homology at the nucleotide level and at the amino acid sequence level. The identity of ompA sequences for 262 Y. pestis strains, 134 Y. pseudotuberculosis strains and 219 pathogenic Y. enterocolitica strains are 100%, 98.8% and 97.7% similar. The main pattern of OmpA of pathogenic Yersinia are 86.2% and 88.8% identical at the nucleotide and amino acid sequence levels, respectively. Immunological analysis showed the immunogenicity of each OmpA and cross-immunogenicity of OmpA for pathogenic Yersinia where OmpA may be a vaccine candidate for Y. pestis and other pathogenic Yersinia. Copyright © 2015 Elsevier Ltd. All rights reserved.

Complete genome sequence of maize yellow striate virus, a new cytorhabdovirus infecting maize and wheat crops in Argentina.

PubMed

Maurino, Fernanda; Dumón, Analía D; Llauger, Gabriela; Alemandri, Vanina; de Haro, Luis A; Mattio, M Fernanda; Del Vas, Mariana; Laguna, Irma Graciela; Giménez Pecci, María de la Paz

2018-01-01

A rhabdovirus infecting maize and wheat crops in Argentina was molecularly characterized. Through next-generation sequencing (NGS) of symptomatic leaf samples, the complete genome was obtained of two isolates of maize yellow striate virus (MYSV), a putative new rhabdovirus, differing by only 0.4% at the nucleotide level. The MYSV genome consists of 12,654 nucleotides for maize and wheat virus isolates, and shares 71% nucleotide sequence identity with the complete genome of barley yellow striate mosaic virus (BYSMV, NC028244). Ten open reading frames (ORFs) were predicted in the MYSV genome from the antigenomic strand and were compared with their BYSMV counterparts. The highest amino acid sequence identity of the MYSV and BYSMV proteins was 80% between the L proteins, and the lowest was 37% between the proteins 4. Phylogenetic analysis suggested that the MYSV isolates are new members of the genus Cytorhabdovirus, family Rhabdoviridae. Yellow striate, affecting maize and wheat crops in Argentina, is an emergent disease that presents a potential economic risk for these widely distributed crops.

[A new variant of the simian T-lymphotropic retrovirus type I (STLV-IF) in the Sukhumi colony of hamadryas baboons].

PubMed

Chikobaeva, M G; Schatzl, H; Rose, D; Bush, U; Iakovleva, L A; Deinhardt, F; Helm, K; Lapin, B A

1993-01-01

Polymerase chain reaction (PCR) was developed for the detection of simian T-lymphotropic virus type 1 (STLV-1) infection of P. hamadryas and direct sequencing using oligo-nucleotide primer pairs specific for the tax and env regions of the related human T-lymphotropic virus type 1 (HTLV-1). Excellent specificity was shown in the detection of STLV-1 provirus in infected baboons by PCR using HTLV-1-derived primers. The nucleotide sequences of env 467bp and tax 159bp of the proviral genome (env position 5700-6137, tax position 7373-7498 HTLV-1, according to Seiki et al., 1983) derived from STLV-1-infected P. hamadryas were analysed using PCR and direct sequencing techniques. Two STLV-1 isolates from different sources (Sukhumi main-SuTLV-1 and forest stocks-STLV-1F) were compared. Two variants of STLV-1 among P. hamadryas with different level of homology to HTLV-1 were wound (83.8% and 95.2%, respectively). A possible role of nucleotide changes in env and tax sequenced fragments and oncogenicity of STLV-1 variants is discussed.

Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

PubMed

de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

2015-01-01

The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Development and utilization of 100K SNP array in Saccharum Spp.

USDA-ARS?s Scientific Manuscript database

Sugarcane genotyping or fingerprinting has long been a daunting task due to its high polyploidy level with large number of chromosomes. Single nucleotide polymorphisms (SNPs) are very abundant DNA sequence variations in the genome. With the advance of next generation sequencing (NGS) technologies, m...

Genetic diversity among isolates of Autographa californica multiple nucleopolyhedrovirus

USDA-ARS?s Scientific Manuscript database

Our knowledge of genetic variation at the nucleotide sequence level of Autographa californica multiple nucleopolyhedrovirus (AcMNPV; Baculoviridae: Alphabaculovirus) derives from complete genome sequences of the C6 clonal isolate of AcMNPV and the R1 and CL3 clonal isolates of AcMNPV variants Rachip...

Senescence responsive transcriptional element

DOEpatents

Campisi, Judith; Testori, Alessandro

1999-01-01

Recombinant polynucleotides have expression control sequences that have a senescence responsive element and a minimal promoter, and which are operatively linked to a heterologous nucleotide sequence. The molecules are useful for achieving high levels of expression of genes in senescent cells. Methods of inhibiting expression of genes in senescent cells also are provided.

Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree.

PubMed

Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi

2017-04-01

Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

Composition for nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-08-26

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-06-06

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-05-30

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Labeled nucleotide phosphate (NP) probes

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2009-02-03

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

PubMed Central

Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

1982-01-01

The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

37 CFR 5.31-5.33 - [Reserved

Code of Federal Regulations, 2011 CFR

2011-07-01

... from abandonment 1.135 Amino Acid Sequences. (See Nucleotide and/or Amino Acid Sequences) Appeal to... Appeals and Interference 41.47 Of rejection of an application 1.104(a) Nucleotide and/or Amino Acid...) Symbols for nucleotide and/or amino acid sequence data 1.822 T Tables in patent applications 1.58 Terminal...

Long-term excretion of vaccine-derived poliovirus by a healthy child.

PubMed

Martín, Javier; Odoom, Kofi; Tuite, Gráinne; Dunn, Glynis; Hopewell, Nicola; Cooper, Gill; Fitzharris, Catherine; Butler, Karina; Hall, William W; Minor, Philip D

2004-12-01

A child was found to be excreting type 1 vaccine-derived poliovirus (VDPV) with a 1.1% sequence drift from Sabin type 1 vaccine strain in the VP1 coding region 6 months after he was immunized with oral live polio vaccine. Seventeen type 1 poliovirus isolates were recovered from stools taken from this child during the following 4 months. Contrary to expectation, the child was not deficient in humoral immunity and showed high levels of serum neutralization against poliovirus. Selected virus isolates were characterized in terms of their antigenic properties, virulence in transgenic mice, sensitivity for growth at high temperatures, and differences in nucleotide sequence from the Sabin type 1 strain. The VDPV isolates showed mutations at key nucleotide positions that correlated with the observed reversion to biological properties typical of wild polioviruses. A number of capsid mutations mapped at known antigenic sites leading to changes in the viral antigenic structure. Estimates of sequence evolution based on the accumulation of nucleotide changes in the VP1 coding region detected a "defective" molecular clock running at an apparent faster speed of 2.05% nucleotide changes per year versus 1% shown in previous studies. Remarkably, when compared to several type 1 VDPV strains of different origins, isolates from this child showed a much higher proportion of nonsynonymous versus synonymous nucleotide changes in the capsid coding region. This anomaly could explain the high VP1 sequence drift found and the ability of these virus strains to replicate in the gut for a longer period than expected.

[Phylogenetic relationship of street rabies virus strains and their antigenic reactivity with antibodies induced by vaccine strains. I. Analysis of phylogenetic relationship of street rabies virus strains isolated in Poland].

PubMed

Sadkowska-Todys, M

2000-01-01

The aims of these studies were: genetic characteristic of street rabies virus strains isolated from different animal species in Poland and determination of phylogenetic relationships to reference laboratory strains of the street rabies viruses belonging to genotype 1 and 5. The variability of rabies isolates and their phylogenetic relationship were studied by comparing the nucleotide sequence of the virus genome fragment. The Polish strains of genotype 1 belong to four phylogenetic groups (NE, CE, NEE, EE) corresponding to four variants: fox-racoon dog (F-RD); European fox 1 (F1); European fox 2 (F2) and European fox 3 (F3). On the Polish territories there are no rabies strains representing the variant dog-wolf and typical for arctic fox variant. The similarity of nucleotide and amino acid sequences of street rabies strains belonging to genotype 1 and laboratory strain CVS is very high. It is about 91% similarity at nucleotide level and 95% at amino acid level. Rabies strain CVS is similar to genotype 5 bat strains (EBL 1) only in about 69% and 74% at nucleotide and amino acid level, respectively. The genetic divergence of rabies strains circulating in Poland raised the need of permanent epidemiological and virological surveillance. The genotype and variant of isolated strains should be determined (using PCR and RLFP methods).

WEB-server for search of a periodicity in amino acid and nucleotide sequences

NASA Astrophysics Data System (ADS)

E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

2017-12-01

A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

PubMed

Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

1987-06-01

The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

PubMed

Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

1991-11-20

A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

Nucleotide cleaving agents and method

DOEpatents

Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.

2000-01-01

The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

Nucleic and Amino Acid Sequences Support Structure-Based Viral Classification.

PubMed

Sinclair, Robert M; Ravantti, Janne J; Bamford, Dennis H

2017-04-15

Viral capsids ensure viral genome integrity by protecting the enclosed nucleic acids. Interactions between the genome and capsid and between individual capsid proteins (i.e., capsid architecture) are intimate and are expected to be characterized by strong evolutionary conservation. For this reason, a capsid structure-based viral classification has been proposed as a way to bring order to the viral universe. The seeming lack of sufficient sequence similarity to reproduce this classification has made it difficult to reject structural convergence as the basis for the classification. We reinvestigate whether the structure-based classification for viral coat proteins making icosahedral virus capsids is in fact supported by previously undetected sequence similarity. Since codon choices can influence nascent protein folding cotranslationally, we searched for both amino acid and nucleotide sequence similarity. To demonstrate the sensitivity of the approach, we identify a candidate gene for the pandoravirus capsid protein. We show that the structure-based classification is strongly supported by amino acid and also nucleotide sequence similarities, suggesting that the similarities are due to common descent. The correspondence between structure-based and sequence-based analyses of the same proteins shown here allow them to be used in future analyses of the relationship between linear sequence information and macromolecular function, as well as between linear sequence and protein folds. IMPORTANCE Viral capsids protect nucleic acid genomes, which in turn encode capsid proteins. This tight coupling of protein shell and nucleic acids, together with strong functional constraints on capsid protein folding and architecture, leads to the hypothesis that capsid protein-coding nucleotide sequences may retain signatures of ancient viral evolution. We have been able to show that this is indeed the case, using the major capsid proteins of viruses forming icosahedral capsids. Importantly, we detected similarity at the nucleotide level between capsid protein-coding regions from viruses infecting cells belonging to all three domains of life, reproducing a previously established structure-based classification of icosahedral viral capsids. Copyright © 2017 Sinclair et al.

Nucleic and Amino Acid Sequences Support Structure-Based Viral Classification

PubMed Central

Sinclair, Robert M.; Ravantti, Janne J.

2017-01-01

ABSTRACT Viral capsids ensure viral genome integrity by protecting the enclosed nucleic acids. Interactions between the genome and capsid and between individual capsid proteins (i.e., capsid architecture) are intimate and are expected to be characterized by strong evolutionary conservation. For this reason, a capsid structure-based viral classification has been proposed as a way to bring order to the viral universe. The seeming lack of sufficient sequence similarity to reproduce this classification has made it difficult to reject structural convergence as the basis for the classification. We reinvestigate whether the structure-based classification for viral coat proteins making icosahedral virus capsids is in fact supported by previously undetected sequence similarity. Since codon choices can influence nascent protein folding cotranslationally, we searched for both amino acid and nucleotide sequence similarity. To demonstrate the sensitivity of the approach, we identify a candidate gene for the pandoravirus capsid protein. We show that the structure-based classification is strongly supported by amino acid and also nucleotide sequence similarities, suggesting that the similarities are due to common descent. The correspondence between structure-based and sequence-based analyses of the same proteins shown here allow them to be used in future analyses of the relationship between linear sequence information and macromolecular function, as well as between linear sequence and protein folds. IMPORTANCE Viral capsids protect nucleic acid genomes, which in turn encode capsid proteins. This tight coupling of protein shell and nucleic acids, together with strong functional constraints on capsid protein folding and architecture, leads to the hypothesis that capsid protein-coding nucleotide sequences may retain signatures of ancient viral evolution. We have been able to show that this is indeed the case, using the major capsid proteins of viruses forming icosahedral capsids. Importantly, we detected similarity at the nucleotide level between capsid protein-coding regions from viruses infecting cells belonging to all three domains of life, reproducing a previously established structure-based classification of icosahedral viral capsids. PMID:28122979

Genetic variation and biological activity of isolates of lymantria dispar multiple nucleopolyhedrovirus from north america, europe, and asia

USDA-ARS?s Scientific Manuscript database

Little is known about genetic variation of Lymantria dispar multiple nucleopolyhedrovirus (LdMNPV; Baculoviridae: Alphabaculovirus) at the nucleotide sequence level. To obtain a more comprehensive view of genetic diversity among isolates of LdMNPV, partial sequences of the lef-8 gene were generated...

Molecular analysis of the split cox1 gene from the Basidiomycota Agrocybe aegerita: relationship of its introns with homologous Ascomycota introns and divergence levels from common ancestral copies.

PubMed

Gonzalez, P; Barroso, G; Labarère, J

1998-10-05

The Basidiomycota Agrocybe aegerita (Aa) mitochondrial cox1 gene (6790 nucleotides), encoding a protein of 527aa (58377Da), is split by four large subgroup IB introns possessing site-specific endonucleases assumed to be involved in intron mobility. When compared to other fungal COX1 proteins, the Aa protein is closely related to the COX1 one of the Basidiomycota Schizophyllum commune (Sc). This clade reveals a relationship with the studied Ascomycota ones, with the exception of Schizosaccharomyces pombe (Sp) which ranges in an out-group position compared with both higher fungi divisions. When comparison is extended to other kingdoms, fungal COX1 sequences are found to be more related to algae and plant ones (more than 57.5% aa similarity) than to animal sequences (53.6% aa similarity), contrasting with the previously established close relationship between fungi and animals, based on comparisons of nuclear genes. The four Aa cox1 introns are homologous to Ascomycota or algae cox1 introns sharing the same location within the exonic sequences. The percentages of identity of the intronic nucleotide sequences suggest a possible acquisition by lateral transfers of ancestral copies or of their derived sequences. These identities extend over the whole intronic sequences, arguing in favor of a transfer of the complete intron rather than a transfer limited to the encoded ORF. The intron i4 shares 74% of identity, at the nucleotidic level, with the Podospora anserina (Pa) intron i14, and up to 90.5% of aa similarity between the encoded proteins, i.e. the highest values reported to date between introns of two phylogenetically distant species. This low divergence argues for a recent lateral transfer between the two species. On the contrary, the low sequence identities (below 36%) observed between Aa i1 and the homologous Sp i1 or Prototheca wickeramii (Pw) i1 suggest a long evolution time after the separation of these sequences. The introns i2 and i3 possessed intermediate percentages of identity with their homologous Ascomycota introns. This is the first report of the complete nucleotide sequence and molecular organization of a mitochondrial cox1 gene of any member of the Basidiomycota division.

Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

PubMed

Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

2004-01-01

Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Genetic variation of coat protein gene among the isolates of Rice tungro spherical virus from tungro-endemic states of the India.

PubMed

Mangrauthia, Satendra K; Malathi, P; Agarwal, Surekha; Ramkumar, G; Krishnaveni, D; Neeraja, C N; Madhav, M Sheshu; Ladhalakshmi, D; Balachandran, S M; Viraktamath, B C

2012-06-01

Rice tungro disease, one of the major constraints to rice production in South and Southeast Asia, is caused by a combination of two viruses: Rice tungro spherical virus (RTSV) and Rice tungro bacilliform virus (RTBV). The present study was undertaken to determine the genetic variation of RTSV population present in tungro endemic states of Indian subcontinent. Phylogenetic analysis based on coat protein sequences showed distinct divergence of Indian RTSV isolates into two groups; one consisted isolates from Hyderabad (Andhra Pradesh), Cuttack (Orissa), and Puducherry and another from West Bengal, Coimbatore (Tamil Nadu), and Kanyakumari (Tamil Nadu). The results obtained from phylogenetic study were further supported with the SNPs (single nucleotide polymorphism), INDELs (insertion and deletion) and evolutionary distance analysis. In addition, sequence difference count matrix revealed 2-68 nucleotides differences among all the Indian RTSV isolates taken in this study. However, at the protein level these differences were not significant as revealed by Ka/Ks ratio calculation. Sequence identity at nucleotide and amino acid level was 92-100% and 97-100%, respectively, among Indian isolates of RTSV. Understanding of the population structure of RTSV from tungro endemic regions of India would potentially provide insights into the molecular diversification of this virus.

Nucleic acid analysis using terminal-phosphate-labeled nucleotides

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-04-22

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Error correction and diversity analysis of population mixtures determined by NGS

PubMed Central

Burroughs, Nigel J.; Evans, David J.; Ryabov, Eugene V.

2014-01-01

The impetus for this work was the need to analyse nucleotide diversity in a viral mix taken from honeybees. The paper has two findings. First, a method for correction of next generation sequencing error in the distribution of nucleotides at a site is developed. Second, a package of methods for assessment of nucleotide diversity is assembled. The error correction method is statistically based and works at the level of the nucleotide distribution rather than the level of individual nucleotides. The method relies on an error model and a sample of known viral genotypes that is used for model calibration. A compendium of existing and new diversity analysis tools is also presented, allowing hypotheses about diversity and mean diversity to be tested and associated confidence intervals to be calculated. The methods are illustrated using honeybee viral samples. Software in both Excel and Matlab and a guide are available at http://www2.warwick.ac.uk/fac/sci/systemsbiology/research/software/, the Warwick University Systems Biology Centre software download site. PMID:25405074

Nucleotide sequence analysis of the L gene of Newcastle disease virus: homologies with Sendai and vesicular stomatitis viruses.

PubMed Central

Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T

1987-01-01

The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486

Genome-Wide Characterization of RNA Editing in Chicken Embryos Reveals Common Features among Vertebrates.

PubMed

Frésard, Laure; Leroux, Sophie; Roux, Pierre-François; Klopp, Christophe; Fabre, Stéphane; Esquerré, Diane; Dehais, Patrice; Djari, Anis; Gourichon, David; Lagarrigue, Sandrine; Pitel, Frédérique

2015-01-01

RNA editing results in a post-transcriptional nucleotide change in the RNA sequence that creates an alternative nucleotide not present in the DNA sequence. This leads to a diversification of transcription products with potential functional consequences. Two nucleotide substitutions are mainly described in animals, from adenosine to inosine (A-to-I) and from cytidine to uridine (C-to-U). This phenomenon is described in more details in mammals, notably since the availability of next generation sequencing technologies allowing whole genome screening of RNA-DNA differences. The number of studies recording RNA editing in other vertebrates like chicken is still limited. We chose to use high throughput sequencing technologies to search for RNA editing in chicken, and to extend the knowledge of its conservation among vertebrates. We performed sequencing of RNA and DNA from 8 embryos. Being aware of common pitfalls inherent to sequence analyses that lead to false positive discovery, we stringently filtered our datasets and found fewer than 40 reliable candidates. Conservation of particular sites of RNA editing was attested by the presence of 3 edited sites previously detected in mammals. We then characterized editing levels for selected candidates in several tissues and at different time points, from 4.5 days of embryonic development to adults, and observed a clear tissue-specificity and a gradual increase of editing level with time. By characterizing the RNA editing landscape in chicken, our results highlight the extent of evolutionary conservation of this phenomenon within vertebrates, attest to its tissue and stage specificity and provide support of the absence of non A-to-I events from the chicken transcriptome.

Genome-Wide Characterization of RNA Editing in Chicken Embryos Reveals Common Features among Vertebrates

PubMed Central

Frésard, Laure; Leroux, Sophie; Roux, Pierre-François; Klopp, Christophe; Fabre, Stéphane; Esquerré, Diane; Dehais, Patrice; Djari, Anis; Gourichon, David

2015-01-01

RNA editing results in a post-transcriptional nucleotide change in the RNA sequence that creates an alternative nucleotide not present in the DNA sequence. This leads to a diversification of transcription products with potential functional consequences. Two nucleotide substitutions are mainly described in animals, from adenosine to inosine (A-to-I) and from cytidine to uridine (C-to-U). This phenomenon is described in more details in mammals, notably since the availability of next generation sequencing technologies allowing whole genome screening of RNA-DNA differences. The number of studies recording RNA editing in other vertebrates like chicken is still limited. We chose to use high throughput sequencing technologies to search for RNA editing in chicken, and to extend the knowledge of its conservation among vertebrates. We performed sequencing of RNA and DNA from 8 embryos. Being aware of common pitfalls inherent to sequence analyses that lead to false positive discovery, we stringently filtered our datasets and found fewer than 40 reliable candidates. Conservation of particular sites of RNA editing was attested by the presence of 3 edited sites previously detected in mammals. We then characterized editing levels for selected candidates in several tissues and at different time points, from 4.5 days of embryonic development to adults, and observed a clear tissue-specificity and a gradual increase of editing level with time. By characterizing the RNA editing landscape in chicken, our results highlight the extent of evolutionary conservation of this phenomenon within vertebrates, attest to its tissue and stage specificity and provide support of the absence of non A-to-I events from the chicken transcriptome. PMID:26024316

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leong, JoAnn Ching

The nucleotide sequence of the IHNV glycoprotein gene has been determined from a cDNA clone containing the entire coding region. The glycoprotein cDNA clone contained a leader sequence of 48 bases, a coding region of 1524 nucleotides, and 39 bases at the 3 foot end. The entire cDNA clone contains 1609 nucleodites and encodes a protein of 508 amino acids. The deduced amino acid sequence gave a translated molecular weight of 56,795 daltons. A hydropathicity profile of the deduced amino acid sequence indicated that there were two major hydrophobic domains: one,at the N-terminus,delineating a signal peptide of 18 amino acidsmore » and the other, at the C-terminus,delineating the region of the transmembrane. Five possible sites of N-linked glyscoylation were identified. Although no nucleic acid homology existed between the IHNV glycoprotein gene and the glycoprotein genes of rabies and VSV, there was significant homology at the amino acid level between all three rhabdovirus glycoproteins.« less

Protein structure and the sequential structure of mRNA: alpha-helix and beta-sheet signals at the nucleotide level.

PubMed

Brunak, S; Engelbrecht, J

1996-06-01

A direct comparison of experimentally determined protein structures and their corresponding protein coding mRNA sequences has been performed. We examine whether real world data support the hypothesis that clusters of rare codons correlate with the location of structural units in the resulting protein. The degeneracy of the genetic code allows for a biased selection of codons which may control the translational rate of the ribosome, and may thus in vivo have a catalyzing effect on the folding of the polypeptide chain. A complete search for GenBank nucleotide sequences coding for structural entries in the Brookhaven Protein Data Bank produced 719 protein chains with matching mRNA sequence, amino acid sequence, and secondary structure assignment. By neural network analysis, we found strong signals in mRNA sequence regions surrounding helices and sheets. These signals do not originate from the clustering of rare codons, but from the similarity of codons coding for very abundant amino acid residues at the N- and C-termini of helices and sheets. No correlation between the positioning of rare codons and the location of structural units was found. The mRNA signals were also compared with conserved nucleotide features of 16S-like ribosomal RNA sequences and related to mechanisms for maintaining the correct reading frame by the ribosome.

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2014 CFR

2014-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2013 CFR

2013-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2012 CFR

2012-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

Precise detection of chromosomal translocation or inversion breakpoints by whole-genome sequencing.

PubMed

Suzuki, Toshifumi; Tsurusaki, Yoshinori; Nakashima, Mitsuko; Miyake, Noriko; Saitsu, Hirotomo; Takeda, Satoru; Matsumoto, Naomichi

2014-12-01

Structural variations (SVs), including translocations, inversions, deletions and duplications, are potentially associated with Mendelian diseases and contiguous gene syndromes. Determination of SV-related breakpoints at the nucleotide level is important to reveal the genetic causes for diseases. Whole-genome sequencing (WGS) by next-generation sequencers is expected to determine structural abnormalities more directly and efficiently than conventional methods. In this study, 14 SVs (9 balanced translocations, 1 inversion and 4 microdeletions) in 9 patients were analyzed by WGS with a shallow (5 × ) to moderate read coverage (20 × ). Among 28 breakpoints (as each SV has two breakpoints), 19 SV breakpoints had been determined previously at the nucleotide level by any other methods and 9 were uncharacterized. BreakDancer and Integrative Genomics Viewer determined 20 breakpoints (16 translocation, 2 inversion and 2 deletion breakpoints), but did not detect 8 breakpoints (2 translocation and 6 deletion breakpoints). These data indicate the efficacy of WGS for the precise determination of translocation and inversion breakpoints.

The nucleotide sequence of a segment of Trypanosoma brucei mitochondrial maxi-circle DNA that contains the gene for apocytochrome b and some unusual unassigned reading frames.

PubMed Central

Benne, R; De Vries, B F; Van den Burg, J; Klaver, B

1983-01-01

The nucleotide sequence of a 2.5-kb segment of the maxi-circle of Trypanosoma brucei mtDNA has been determined. The segment contains the gene for apocytochrome b, which displays about 25% homology at the amino acid level to the apocytochrome b gene from fungal and mammalian mtDNAs. Northern blot and S1 nuclease analyses have yielded accurate map positions of an RNA species in an area that coincides with the reading frame. The segment also contains two pairs of overlapping unassigned reading frames, which lack homology with any known mitochondrial gene or URF. The DNA sequence in these areas is AG-rich (70%), resulting in URFs with an unusually high level of glycine and charged amino acids (60%). They may not encode proteins, in spite of their size and the fact that abundant transcripts are mapped in these areas. Images PMID:6314266

The GS (genetic selection) Principle.

PubMed

Abel, David L

2009-01-01

The GS (Genetic Selection) Principle states that biological selection must occur at the nucleotide-sequencing molecular-genetic level of 3'5' phosphodiester bond formation. After-the-fact differential survival and reproduction of already-living phenotypic organisms (ordinary natural selection) does not explain polynucleotide prescription and coding. All life depends upon literal genetic algorithms. Even epigenetic and "genomic" factors such as regulation by DNA methylation, histone proteins and microRNAs are ultimately instructed by prior linear digital programming. Biological control requires selection of particular configurable switch-settings to achieve potential function. This occurs largely at the level of nucleotide selection, prior to the realization of any integrated biofunction. Each selection of a nucleotide corresponds to the setting of two formal binary logic gates. The setting of these switches only later determines folding and binding function through minimum-free-energy sinks. These sinks are determined by the primary structure of both the protein itself and the independently prescribed sequencing of chaperones. The GS Principle distinguishes selection of existing function (natural selection) from selection for potential function (formal selection at decision nodes, logic gates and configurable switch-settings).

Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

PubMed Central

Hall, L; Laird, J E; Craig, R K

1984-01-01

Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

PubMed Central

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

PubMed Central

Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

1982-01-01

The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

PubMed

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

Variation in the Nucleotide Sequence of Cottontail Rabbit Papillomavirus a and b Subtypes Affects Wart Regression and Malignant Transformation and Level of Viral Replication in Domestic Rabbits

PubMed Central

Salmon, Jérôme; Nonnenmacher, Mathieu; Cazé, Sandrine; Flamant, Patricia; Croissant, Odile; Orth, Gérard; Breitburd, Françoise

2000-01-01

We previously reported the partial characterization of two cottontail rabbit papillomavirus (CRPV) subtypes with strikingly divergent E6 and E7 oncoproteins. We report now the complete nucleotide sequences of these subtypes, referred to as CRPVa4 (7,868 nucleotides) and CRPVb (7,867 nucleotides). The CRPVa4 and CRPVb genomes differed at 238 (3%) nucleotide positions, whereas CRPVa4 and the prototype CRPV differed by only 5 nucleotides. The most variable region (7% nucleotide divergence) included the long regulatory region (LRR) and the E6 and E7 genes. A mutation in the stop codon resulted in an 8-amino-acid-longer CRPVb E4 protein, and a nucleotide deletion reduced the coding capacity of the E5 gene from 101 to 25 amino acids. In domestic rabbits homozygous for a specific haplotype of the DRA and DQA genes of the major histocompatibility complex, warts induced by CRPVb DNA or a chimeric genome containing the CRPVb LRR/E6/E7 region showed an early regression, whereas warts induced by CRPVa4 or a chimeric genome containing the CRPVa4 LRR/E6/E7 region persisted and evolved into carcinomas. In contrast, most CRPVa, CRPVb, and chimeric CRPV DNA-induced warts showed no early regression in rabbits homozygous for another DRA-DQA haplotype. Little, if any, viral replication is usually observed in domestic rabbit warts. When warts induced by CRPVa and CRPVb virions and DNA were compared, the number of cells positive for viral DNA or capsid antigens was found to be greater by 1 order of magnitude for specimens induced by CRPVb. Thus, both sequence variation in the LRR/E6/E7 region and the genetic constitution of the host influence the expression of the oncogenic potential of CRPV. Furthermore, intratype variation may overcome to some extent the host restriction of CRPV replication in domestic rabbits. PMID:11044121

Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

PubMed

Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

2014-11-01

As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

DOEpatents

Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

1999-01-19

The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

The use of sequence-based SSR mining for the development of a vast collection of microsatellites in Aquilegia Formosa

Treesearch

Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet

2014-01-01

Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...

Switchgrass ubiquitin promoter (PVUBI2) and uses thereof

DOEpatents

Stewart, C. Neal; Mann, David George James

2013-12-10

The subject application provides polynucleotides, compositions thereof and methods for regulating gene expression in a plant. Polynucleotides disclosed herein comprise novel sequences for a promoter isolated from Panicum virgatum (switchgrass) that initiates transcription of an operably linked nucleotide sequence. Thus, various embodiments of the invention comprise the nucleotide sequence of SEQ ID NO: 2 or fragments thereof comprising nucleotides 1 to 692 of SEQ ID NO: 2 that are capable of driving the expression of an operably linked nucleic acid sequence.

Relationship between mRNA secondary structure and sequence variability in Chloroplast genes: possible life history implications.

PubMed

Krishnan, Neeraja M; Seligmann, Hervé; Rao, Basuthkar J

2008-01-28

Synonymous sites are freer to vary because of redundancy in genetic code. Messenger RNA secondary structure restricts this freedom, as revealed by previous findings in mitochondrial genes that mutations at third codon position nucleotides in helices are more selected against than those in loops. This motivated us to explore the constraints imposed by mRNA secondary structure on evolutionary variability at all codon positions in general, in chloroplast systems. We found that the evolutionary variability and intrinsic secondary structure stability of these sequences share an inverse relationship. Simulations of most likely single nucleotide evolution in Psilotum nudum and Nephroselmis olivacea mRNAs, indicate that helix-forming propensities of mutated mRNAs are greater than those of the natural mRNAs for short sequences and vice-versa for long sequences. Moreover, helix-forming propensity estimated by the percentage of total mRNA in helices increases gradually with mRNA length, saturating beyond 1000 nucleotides. Protection levels of functionally important sites vary across plants and proteins: r-strategists minimize mutation costs in large genes; K-strategists do the opposite. Mrna length presumably predisposes shorter mRNAs to evolve under different constraints than longer mRNAs. The positive correlation between secondary structure protection and functional importance of sites suggests that some sites might be conserved due to packing-protection constraints at the nucleic acid level in addition to protein level constraints. Consequently, nucleic acid secondary structure a priori biases mutations. The converse (exposure of conserved sites) apparently occurs in a smaller number of cases, indicating a different evolutionary adaptive strategy in these plants. The differences between the protection levels of functionally important sites for r- and K-strategists reflect their respective molecular adaptive strategies. These converge with increasing domestication levels of K-strategists, perhaps because domestication increases reproductive output.

Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

USDA-ARS?s Scientific Manuscript database

Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

Extension of the COG and arCOG databases by amino acid and nucleotide sequences

PubMed Central

Meereis, Florian; Kaufmann, Michael

2008-01-01

Background The current versions of the COG and arCOG databases, both excellent frameworks for studies in comparative and functional genomics, do not contain the nucleotide sequences corresponding to their protein or protein domain entries. Results Using sequence information obtained from GenBank flat files covering the completely sequenced genomes of the COG and arCOG databases, we constructed NUCOCOG (nucleotide sequences containing COG databases) as an extended version including all nucleotide sequences and in addition the amino acid sequences originally utilized to construct the current COG and arCOG databases. We make available three comprehensive single XML files containing the complete databases including all sequence information. In addition, we provide a web interface as a utility suitable to browse the NUCOCOG database for sequence retrieval. The database is accessible at . Conclusion NUCOCOG offers the possibility to analyze any sequence related property in the context of the COG and arCOG framework simply by using script languages such as PERL applied to a large but single XML document. PMID:19014535

DNA Nucleotide Sequence Restricted by the RI Endonuclease

PubMed Central

Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

1972-01-01

The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

The G-quadruplex augments translation in the 5' untranslated region of transforming growth factor β2.

PubMed

Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik

2013-03-05

Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.

repDNA: a Python package to generate various modes of feature vectors for DNA sequences by incorporating user-defined physicochemical properties and sequence-order effects.

PubMed

Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen

2015-04-15

In order to develop powerful computational predictors for identifying the biological features or attributes of DNAs, one of the most challenging problems is to find a suitable approach to effectively represent the DNA sequences. To facilitate the studies of DNAs and nucleotides, we developed a Python package called representations of DNAs (repDNA) for generating the widely used features reflecting the physicochemical properties and sequence-order effects of DNAs and nucleotides. There are three feature groups composed of 15 features. The first group calculates three nucleic acid composition features describing the local sequence information by means of kmers; the second group calculates six autocorrelation features describing the level of correlation between two oligonucleotides along a DNA sequence in terms of their specific physicochemical properties; the third group calculates six pseudo nucleotide composition features, which can be used to represent a DNA sequence with a discrete model or vector yet still keep considerable sequence-order information via the physicochemical properties of its constituent oligonucleotides. In addition, these features can be easily calculated based on both the built-in and user-defined properties via using repDNA. The repDNA Python package is freely accessible to the public at http://bioinformatics.hitsz.edu.cn/repDNA/. bliu@insun.hit.edu.cn or kcchou@gordonlifescience.org Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Supplementation of Nucleosides During Selection can Reduce Sequence Variant Levels in CHO Cells Using GS/MSX Selection System.

PubMed

Tang, Danming; Lam, Cynthia; Louie, Salina; Hoi, Kam Hon; Shaw, David; Yim, Mandy; Snedecor, Brad; Misaghi, Shahram

2018-01-01

In the process of generating stable monoclonal antibody (mAb) producing cell lines, reagents such as methotrexate (MTX) or methionine sulfoximine (MSX) are often used. However, using such selection reagent(s) increases the possibility of having higher occurrence of sequence variants in the expressed antibody molecules due to the effects of MTX or MSX on de novo nucleotide synthesis. Since MSX inhibits glutamine synthase (GS) and results in both amino acid and nucleoside starvation, it is questioned whether supplementing nucleosides into the media could lower sequence variant levels without affecting titer. The results show that the supplementation of nucleosides to the media during MSX selection decreased genomic DNA mutagenesis rates in the selected cells, probably by reducing nucleotide mis-incorporation into the DNA. Furthermore, addition of nucleosides enhance clone recovery post selection and does not affect antibody expression. It is further observed that nucleoside supplements lowered DNA mutagenesis rates only at the initial stage of the clone selection and do not have any effect on DNA mutagenesis rates after stable cell lines are established. Therefore, the data suggests that addition of nucleosides during early stages of MSX selection can lower sequence variant levels without affecting titer or clone stability in antibody expression. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

PubMed Central

Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

1982-01-01

We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

Plant nitrogen regulatory P-PII genes

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2001-01-01

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the

[Complete nucleotide sequences and genome structure of two Chinese tobacco mosaic virus isolates deduced from full-length infectious cDNA clones].

PubMed

Yang, G; Liu, X G; Qiu, B S

2000-07-01

The complete nucleotides of two Chinese tobacco mosaic virus (TMV) isolates, TMV-Cv (vulgare strain) and TMV-N14 (an attenuated virus originated from a tomato strain), were determined from their respective full-length infectious cDNA clones and compared with published TMV sequences. The genome structure of TMV-Cv contained 6395 nucleotides, in which four functional open reading frames (ORF), coding for replicase (126 kD/183 kD), movement protein (MP, 30 kD) and coat protein (CP, 17.6 kD) respectively, could be recognized. TMV-N14 contained 6384 nucleotides in its genome. In contrast to TMV-Cv, five functional ORFs encoding the replicase 98.5 kD/126 kD/183 kD, MP(27 kD) and CP(17.6 kD), respectively, were detected in the TMV-N14 genome. TMV-Cv is 99% homologous to a Korean TMV isolate belonging to the vulgare strain at the nucleotide level. TMV-N14 is 99% homologous to a highly virulent Japanese isolate TMV-L (tomato strain) at the nucleotide level. In TMV-N14, one opal nulation (UGA) occurred in the replicase gene and one ochre nutation (UAA) in the MP gene. The former mutation created a potential, additional ORF within the replicase gene, the latter reduced the size of the MP to 27 kD. In addition, there were also 13 amino acid substitutions in the replicase gene of TMV-N14 when compared to that of TMV-L. Collectively, these changes may have significant implications in the attenuation of the virulence of TMV-N14.

Synthesis and evaluations of an acid-cleavable, fluorescently labeled nucleotide as a reversible terminator for DNA sequencing.

PubMed

Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng

2016-02-11

An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.

DNA sequence of the lymphotropic variant of minute virus of mice, MVM(i), and comparison with the DNA sequence of the fibrotropic prototype strain.

PubMed

Astell, C R; Gardiner, E M; Tattersall, P

1986-02-01

The sequence of molecular clones of the genome of MVM(i), a lymphotropic variant of minute virus of mice, was determined and compared with that of MVM(p), the fibrotropic prototype strain. At the nucleotide level there are 163 base changes: 129 transitions and 34 transversions. Most nucleotide changes are silent, with only 27 amino acids changes predicted, of which 22 are conservative. Notable differences between the MVM(i) and MVM(p) genomes which may account for the cell specificities of these viruses occur within the 3' nontranslated regions. The differences discussed include the absence of a 65-base-pair direct in MVM(i), the presence of only two polyadenylation sites in MVM(i) compared with four in MVM(p), and sequences that bear a resemblance to enhancer sequences. Also included in this paper is an important correction to the MVM(p) sequence (C.R. Astell, M. Thomson, M. Merchlinsky, and D. C. Ward, Nucleic Acids Res. 11:999-1018, 1983).

GenBank.

PubMed

Benson, Dennis A; Karsch-Mizrachi, Ilene; Lipman, David J; Ostell, James; Sayers, Eric W

2010-01-01

GenBank is a comprehensive database that contains publicly available nucleotide sequences for more than 300,000 organisms named at the genus level or lower, obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects, including whole genome shotgun (WGS) and environmental sampling projects. Most submissions are made using the web-based BankIt or standalone Sequin programs, and accession numbers are assigned by GenBank staff upon receipt. Daily data exchange with the European Molecular Biology Laboratory Nucleotide Sequence Database in Europe and the DNA Data Bank of Japan ensures worldwide coverage. GenBank is accessible through the NCBI Entrez retrieval system, which integrates data from the major DNA and protein sequence databases along with taxonomy, genome, mapping, protein structure and domain information, and the biomedical journal literature via PubMed. BLAST provides sequence similarity searches of GenBank and other sequence databases. Complete bi-monthly releases and daily updates of the GenBank database are available by FTP. To access GenBank and its related retrieval and analysis services, begin at the NCBI homepage: www.ncbi.nlm.nih.gov.

GenBank.

PubMed

Benson, Dennis A; Karsch-Mizrachi, Ilene; Lipman, David J; Ostell, James; Sayers, Eric W

2009-01-01

GenBank is a comprehensive database that contains publicly available nucleotide sequences for more than 300,000 organisms named at the genus level or lower, obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects. Most submissions are made using the web-based BankIt or standalone Sequin programs, and accession numbers are assigned by GenBank(R) staff upon receipt. Daily data exchange with the European Molecular Biology Laboratory Nucleotide Sequence Database in Europe and the DNA Data Bank of Japan ensures worldwide coverage. GenBank is accessible through the National Center for Biotechnology Information (NCBI) Entrez retrieval system, which integrates data from the major DNA and protein sequence databases along with taxonomy, genome, mapping, protein structure and domain information, and the biomedical journal literature via PubMed. BLAST provides sequence similarity searches of GenBank and other sequence databases. Complete bimonthly releases and daily updates of the GenBank database are available by FTP. To access GenBank and its related retrieval and analysis services, begin at the NCBI Homepage: www.ncbi.nlm.nih.gov.

Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

USDA-ARS?s Scientific Manuscript database

: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

Novel methodologies for spectral classification of exon and intron sequences

NASA Astrophysics Data System (ADS)

Kwan, Hon Keung; Kwan, Benjamin Y. M.; Kwan, Jennifer Y. Y.

2012-12-01

Digital processing of a nucleotide sequence requires it to be mapped to a numerical sequence in which the choice of nucleotide to numeric mapping affects how well its biological properties can be preserved and reflected from nucleotide domain to numerical domain. Digital spectral analysis of nucleotide sequences unfolds a period-3 power spectral value which is more prominent in an exon sequence as compared to that of an intron sequence. The success of a period-3 based exon and intron classification depends on the choice of a threshold value. The main purposes of this article are to introduce novel codes for 1-sequence numerical representations for spectral analysis and compare them to existing codes to determine appropriate representation, and to introduce novel thresholding methods for more accurate period-3 based exon and intron classification of an unknown sequence. The main findings of this study are summarized as follows: Among sixteen 1-sequence numerical representations, the K-Quaternary Code I offers an attractive performance. A windowed 1-sequence numerical representation (with window length of 9, 15, and 24 bases) offers a possible speed gain over non-windowed 4-sequence Voss representation which increases as sequence length increases. A winner threshold value (chosen from the best among two defined threshold values and one other threshold value) offers a top precision for classifying an unknown sequence of specified fixed lengths. An interpolated winner threshold value applicable to an unknown and arbitrary length sequence can be estimated from the winner threshold values of fixed length sequences with a comparable performance. In general, precision increases as sequence length increases. The study contributes an effective spectral analysis of nucleotide sequences to better reveal embedded properties, and has potential applications in improved genome annotation.

Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

USDA-ARS?s Scientific Manuscript database

The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

Molecular identification and phylogenetic analysis of important medicinal plant species in genus Paeonia based on rDNA-ITS, matK, and rbcL DNA barcode sequences.

PubMed

Kim, W J; Ji, Y; Choi, G; Kang, Y M; Yang, S; Moon, B C

2016-08-05

This study was performed to identify and analyze the phylogenetic relationship among four herbaceous species of the genus Paeonia, P. lactiflora, P. japonica, P. veitchii, and P. suffruticosa, using DNA barcodes. These four species, which are commonly used in traditional medicine as Paeoniae Radix and Moutan Radicis Cortex, are pharmaceutically defined in different ways in the national pharmacopoeias in Korea, Japan, and China. To authenticate the different species used in these medicines, we evaluated rDNA-internal transcribed spacers (ITS), matK and rbcL regions, which provide information capable of effectively distinguishing each species from one another. Seventeen samples were collected from different geographic regions in Korea and China, and DNA barcode regions were amplified using universal primers. Comparative analyses of these DNA barcode sequences revealed species-specific nucleotide sequences capable of discriminating the four Paeonia species. Among the entire sequences of three barcodes, marker nucleotides were identified at three positions in P. lactiflora, eleven in P. japonica, five in P. veitchii, and 25 in P. suffruticosa. Phylogenetic analyses also revealed four distinct clusters showing homogeneous clades with high resolution at the species level. The results demonstrate that the analysis of these three DNA barcode sequences is a reliable method for identifying the four Paeonia species and can be used to authenticate Paeoniae Radix and Moutan Radicis Cortex at the species level. Furthermore, based on the assessment of amplicon sizes, inter/intra-specific distances, marker nucleotides, and phylogenetic analysis, rDNA-ITS was the most suitable DNA barcode for identification of these species.

Statistical analysis of nucleotide sequences of the hemagglutinin gene of human influenza A viruses.

PubMed Central

Ina, Y; Gojobori, T

1994-01-01

To examine whether positive selection operates on the hemagglutinin 1 (HA1) gene of human influenza A viruses (H1 subtype), 21 nucleotide sequences of the HA1 gene were statistically analyzed. The nucleotide sequences were divided into antigenic and nonantigenic sites. The nucleotide diversities for antigenic and nonantigenic sites of the HA1 gene were computed at synonymous and nonsynonymous sites separately. For nonantigenic sites, the nucleotide diversities were larger at synonymous sites than at nonsynonymous sites. This is consistent with the neutral theory of molecular evolution. For antigenic sites, however, the nucleotide diversities at nonsynonymous sites were larger than those at synonymous sites. These results suggest that positive selection operates on antigenic sites of the HA1 gene of human influenza A viruses (H1 subtype). PMID:8078892

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

Ancient diversity and geographical sub-structuring in African buffalo Theileria parva populations revealed through metagenetic analysis of antigen-encoding loci.

PubMed

Hemmink, Johanneke D; Sitt, Tatjana; Pelle, Roger; de Klerk-Lorist, Lin-Mari; Shiels, Brian; Toye, Philip G; Morrison, W Ivan; Weir, William

2018-03-01

An infection and treatment protocol involving infection with a mixture of three parasite isolates and simultaneous treatment with oxytetracycline is currently used to vaccinate cattle against Theileria parva. While vaccination results in high levels of protection in some regions, little or no protection is observed in areas where animals are challenged predominantly by parasites of buffalo origin. A previous study involving sequencing of two antigen-encoding genes from a series of parasite isolates indicated that this is associated with greater antigenic diversity in buffalo-derived T. parva. The current study set out to extend these analyses by applying high-throughput sequencing to ex vivo samples from naturally infected buffalo to determine the extent of diversity in a set of antigen-encoding genes. Samples from two populations of buffalo, one in Kenya and the other in South Africa, were examined to investigate the effect of geographical distance on the nature of sequence diversity. The results revealed a number of significant findings. First, there was a variable degree of nucleotide sequence diversity in all gene segments examined, with the percentage of polymorphic nucleotides ranging from 10% to 69%. Second, large numbers of allelic variants of each gene were found in individual animals, indicating multiple infection events. Third, despite the observed diversity in nucleotide sequences, several of the gene products had highly conserved amino acid sequences, and thus represent potential candidates for vaccine development. Fourth, although compelling evidence for population differentiation between the Kenyan and South African T. parva parasites was identified, analysis of molecular variance for each gene revealed that the majority of the underlying nucleotide sequence polymorphism was common to both areas, indicating that much of this aspect of genetic variation in the parasite population arose prior to geographic separation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Selection rhizosphere-competent microbes for development of microbial products as biocontrol agents

NASA Astrophysics Data System (ADS)

Mashinistova, A. V.; Elchin, A. A.; Gorbunova, N. V.; Muratov, V. S.; Kydralieva, K. A.; Khudaibergenova, B. M.; Shabaev, V. P.; Jorobekova, Sh. J.

2009-04-01

Rhizosphere-borne microorganisms reintroduced to the soil-root interface can establish without inducing permanent disturbance in the microbial balance and effectively colonise the rhizosphere due to carbon sources of plant root exudates. A challenge for future development of microbial products for use in agriculture will be selection of rhizosphere-competent microbes that both protect the plant from pathogens and improve crop establishment and persistence. In this study screening, collection, identification and expression of stable and technological microbial strains living in soils and in the rhizosphere of abundant weed - couch-grass Elytrigia repens L. Nevski were conducted. A total of 98 bacteria isolated from the rhizosphere were assessed for biocontrol activity in vitro against phytopathogenic fungi including Fusarium culmorum, Fusarium heterosporum, Fusarium oxysporum, Drechslera teres, Bipolaris sorokiniana, Piricularia oryzae, Botrytis cinerea, Colletothrichum atramentarium and Cladosporium sp., Stagonospora nodorum. Biocontrol activity were performed by the following methods: radial and parallel streaks, "host - pathogen" on the cuts of wheat leaves. A culture collection comprising 64 potential biocontrol agents (BCA) against wheat and barley root diseases has been established. Of these, the most effective were 8 isolates inhibitory to at least 4 out of 5 phytopathogenic fungi tested. The remaining isolates inhibited at least 1 of 5 fungi tested. Growth stimulating activity of proposed rhizobacteria-based preparations was estimated using seedling and vegetative pot techniques. Seeds-inoculation and the tests in laboratory and field conditions were conducted for different agricultural crops - wheat and barley. Intact cells, liquid culture filtrates and crude extracts of the four beneficial bacterial strains isolated from the rhizosphere of weed were studied to stimulate plant growth. As a result, four bacterial strains selected from rhizosphere of weed - couch-grass Elytrigia repens L. Nevski were chosen as a core of collection of 98 pure cultures with high fungicidal and plant growth-stimulating potentials. Partial determination of nucleotide sequence of 16S ribosomes of tested bacteria indicated that Pseudomonas and Bacillus species were the most dominant bacteria exhibiting biocontrol activity. Typing of bacterial strains was performed on the basis of partial determination of nucleotide sequence 16S ribosome of the studying strain. For this purpose polymerase chain reaction (PCR), using specific primers was provided with chromosomal DNA of bacterial strain under study. After determination of nucleotide sequences of the obtained PCR-fragments, the data obtained was compared with the sequences available in the bank of data (GENEBANK: http://www.ncbi.nlm.nih.gov), with the aim to determine close related strain to the organism under study. When the level of homology exceeded the level of 98%, one could conclude that the strain under study was identical to the available in the bank of data. Amplification and sequencing of gene 16S pDNA was performed using universal for the majority of prokaryotes primers. Thermopolimerase Long PCR Enzyme Mix «Fermentas», dNTP -«Fermentas» was used for amplification. While performing PCR, reagent concentrations corresponded to the protocols described in a set Long PCR Enzyme Mix «Fermentas». DNA separation from the sample was performed with DNeasy Plant Mini Kit «QIAGEN». DNA separation from gel was performed with QIAquick Gel Extraction Kit«QIAGEN». Phylogenetic affinity was determined on the basis of the comparison of nucleotide sequence - 400 nucleotides that approximately corresponded to the positions from 500 to 907 nucleotides by nomenclature of E.coli. Primary analysis of the similarity of nucleotide sequences of genes 16S рDNA of the strains under study was performed on the basis of data Genbank. Sequences were aligned according to nucleotide sequences of those bacteria, which had the highest degree of homology with the strains under study, applying the program ClustalX 1.83. Building of rootless phylogenetic trees of the studying bacteria was carried out with the help of the program Njplot. Acknowledgement. This research was supported by the grant of ISTC KR-993.2.

Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.

PubMed

Faragher, S G; Meek, A D; Rice, C M; Dalgarno, L

1988-04-01

The nucleotide sequence of the genomic RNA of a mouse-avirulent strain of Ross River virus, RRV NB5092 (isolated in 1969), has been determined and the corresponding sequence for the prototype mouse-virulent strain, RRV T48 (isolated in 1959), has been completed. The RRV NB5092 genome is approximately 11,674 nucleotides in length, compared with 11,853 nucleotides for RRV T48. RRV NB5092 and RRV T48 have the same genome organization. For both viruses an untranslated region of 80 nucleotides at the 5' end of the genome is followed by a 7440-nucleotide open reading frame which is interrupted after 5586 nucleotides by a single opal termination codon. By homology with other alphaviruses, the 5586-nucleotide open reading frame encodes the nonstructural proteins nsP1, nsP2, and nsP3; a fourth nonstructural protein, nsP4, is produced by read-through of the opal codon. The RRV nonstructural proteins show strong homology with the corresponding proteins of Sindbis virus and Semliki Forest virus in terms of size, net charge, and hydropathy characteristics. However, homology is not uniform between or within the proteins; nsP1, nsP2, and nsP4 contain extended domains which are highly conserved between alphaviruses, while the C-terminal region of nsP3 shows little conservation in sequence or length between alphaviruses. An untranslated "junction" region of 44 nucleotides (for RRV NB5092) or 47 nucleotides (for RRV T48) separates the nonstructural and structural protein coding regions. The structural proteins (capsid-E3-E2-6K-E1) are translated from an open reading frame of 3762 nucleotides which is followed by a 3'-untranslated region of approximately 348 nucleotides (for RRV NB5092) or 524 nucleotides (for RRV T48). Excluding deletions and insertions, the genomes of RRV NB5092 and RRV T48 differ at 284 nucleotides, representing a sequence divergence of 2.38%. Sequence deletions or insertions were found only in the noncoding regions and include a 173-nucleotide deletion in the 3'-untranslated region of RRV NB5092, compared with RRV T48. In the coding regions, most of the nucleotide differences are silent; there are 36 amino acid differences in the nonstructural proteins and 12 in the structural proteins. The distribution of amino acid differences between the two RRV strains correlates with the location of domains which are poorly conserved in sequence between alphaviruses. The possible role of amino acid differences in envelope glycoproteins E1 and E2 in determining the different antigenic and biological properties of RRV NB5092 and RRV T48 is discussed.

Identification of a new genotype H wild-type mumps virus strain and its molecular relatedness to other virulent and attenuated strains.

PubMed

Amexis, Georgios; Rubin, Steven; Chatterjee, Nando; Carbone, Kathryn; Chumakov, Kostantin

2003-06-01

A single clinical isolate of mumps virus designated 88-1961 was obtained from a patient hospitalized with a clinical history of upper respiratory tract infection, parotitis, severe headache, fever and lymphadenopathy. We have sequenced the full-length genome of 88-1961 and compared it against all available full-length sequences of mumps virus. Based upon its nucleotide sequence of the SH gene 88-1961 was identified as a genotype H mumps strain. The overall extent of nucleotide and amino acid differences between each individual gene and protein of 88-1961 and the full-length mumps samples showed that the missense to silent ratios were unevenly distributed. Upon evaluation of the consensus sequence of 88-1961, four positions were found to be clearly heterogeneous at the nucleotide level (NP 315C/T, NP 318C/T, F 271A/C, and HN 855C/T). Sequence analysis revealed that the amino acid sequences for the NP, M, and the L protein were the most conserved, whereas the SH protein exhibited the highest variability among the compared mumps genotypes A, B, and G. No identifying molecular patterns in the non-coding (intergenic) or coding regions of 88-1961 were found when we compared it against relatively virulent (Urabe AM9 B, Glouc1/UK96, 87-1004 and 87-1005) and non-virulent mumps strains (Jeryl Lynn and all Urabe Am9 A substrains). Copyright 2003 Wiley-Liss, Inc.

Nucleotide sequence of the L1 ribosomal protein gene of Xenopus laevis: remarkable sequence homology among introns.

PubMed Central

Loreni, F; Ruberti, I; Bozzoni, I; Pierandrei-Amaldi, P; Amaldi, F

1985-01-01

Ribosomal protein L1 is encoded by two genes in Xenopus laevis. The comparison of two cDNA sequences shows that the two L1 gene copies (L1a and L1b) have diverged in many silent sites and very few substitution sites; moreover a small duplication occurred at the very end of the coding region of the L1b gene which thus codes for a product five amino acids longer than that coded by L1a. Quantitatively the divergence between the two L1 genes confirms that a whole genome duplication took place in Xenopus laevis approximately 30 million years ago. A genomic fragment containing one of the two L1 gene copies (L1a), with its nine introns and flanking regions, has been completely sequenced. The 5' end of this gene has been mapped within a 20-pyridimine stretch as already found for other vertebrate ribosomal protein genes. Four of the nine introns have a 60-nucleotide sequence with 80% homology; within this region some boxes, one of which is 16 nucleotides long, are 100% homologous among the four introns. This feature of L1a gene introns is interesting since we have previously shown that the activity of this gene is regulated at a post-transcriptional level and it involves the block of the normal splicing of some intron sequences. Images Fig. 3. Fig. 5. PMID:3841512

The nucleotides they are a-changin': function of RNA binding proteins in post-transcriptional messenger RNA editing and modification in Arabidopsis.

PubMed

Kramer, Marianne C; Anderson, Stephen J; Gregory, Brian D

2018-06-05

During and after transcription, the fate of an RNA molecule is almost entirely directed by the cohorts of interacting RNA-binding proteins (RBPs). RBPs regulate all stages of the life cycle of a messenger RNA (mRNA) molecule, including splicing, polyadenylation, transport out of the nucleus, RNA stability, and translation. In addition to these functions, RBPs can function to modify or edit the sequences encoded by the RNA. While the sequence for each transcript is determined in the genome, by the time an RNA reaches its final fate, the sequence may have been edited, where one nucleotide is converted to another, or modified, where a chemical group, or sometimes others moieties, are covalently linked to a nucleotide base. These changes to the RNA sequence have major consequences on the function of the RNA. Additionally, variation in the levels of the RBPs that perform the editing or modification can drastically affect the fitness of an organism. Here, we review RBPs that are known to edit or modify RNA ribonucleotides, focusing on the RNA editing ability of the pentatricopeptide repeat (PPR) proteins and the RBPs that modify adenosine to N 6 - methyladenosine. Copyright © 2018 Elsevier Ltd. All rights reserved.

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-11-11

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

Decision Tree Algorithm-Generated Single-Nucleotide Polymorphism Barcodes of rbcL Genes for 38 Brassicaceae Species Tagging.

PubMed

Yang, Cheng-Hong; Wu, Kuo-Chuan; Chuang, Li-Yeh; Chang, Hsueh-Wei

2018-01-01

DNA barcode sequences are accumulating in large data sets. A barcode is generally a sequence larger than 1000 base pairs and generates a computational burden. Although the DNA barcode was originally envisioned as straightforward species tags, the identification usage of barcode sequences is rarely emphasized currently. Single-nucleotide polymorphism (SNP) association studies provide us an idea that the SNPs may be the ideal target of feature selection to discriminate between different species. We hypothesize that SNP-based barcodes may be more effective than the full length of DNA barcode sequences for species discrimination. To address this issue, we tested a r ibulose diphosphate carboxylase ( rbcL ) S NP b arcoding (RSB) strategy using a decision tree algorithm. After alignment and trimming, 31 SNPs were discovered in the rbcL sequences from 38 Brassicaceae plant species. In the decision tree construction, these SNPs were computed to set up the decision rule to assign the sequences into 2 groups level by level. After algorithm processing, 37 nodes and 31 loci were required for discriminating 38 species. Finally, the sequence tags consisting of 31 rbcL SNP barcodes were identified for discriminating 38 Brassicaceae species based on the decision tree-selected SNP pattern using RSB method. Taken together, this study provides the rational that the SNP aspect of DNA barcode for rbcL gene is a useful and effective sequence for tagging 38 Brassicaceae species.

[Detection of West Nile virus in birds in the territories of Baraba and Kulunda lowlands (West Siberian migration way) during summer-autumn of 2002].

PubMed

Ternovoĭ, V A; Shchelkanov, M Iu; Shestopalov, A M; Aristova, V A; Protopopova, E V; Gromashevskiĭ, V L; Druziaka, A V; Slavskiĭ, A A; Zolotykh, S I; Loktev, V B; L'vov, D K

2004-01-01

West Nile Virus (WNV) was discovered in 3 species of birds collected in summer-autumn, 2002, in the South of Western Siberia. WNV was identified by ELISA and RT-PCR. Three of 5 dead rooks (Corvus frugilegus), which were found in the territory of the Kulunda plain, were WNV-infected. WNV RNA was detected in 2% of samples of internal organs of aquatics birds, i.e. teal (Anas crecca) and garganey (Anas querquedula), caught in the Chany Lake (Baraba plain). Nucleotide sequencing of the 300-472 aa fragment of WNV protein E gene showed the maximum level of homology with strain WNV/LEIV-Vlg99-27889, which was isolated from a patient in Volgograd (1999). A high homology level of nucleotide sequencing denotes the relationship between the WNV circulating in the Northern Caspian Region and in the South of Western Siberia.

Higher-level phylogeny of paraneopteran insects inferred from mitochondrial genome sequences

PubMed Central

Li, Hu; Shao, Renfu; Song, Nan; Song, Fan; Jiang, Pei; Li, Zhihong; Cai, Wanzhi

2015-01-01

Mitochondrial (mt) genome data have been proven to be informative for animal phylogenetic studies but may also suffer from systematic errors, due to the effects of accelerated substitution rate and compositional heterogeneity. We analyzed the mt genomes of 25 insect species from the four paraneopteran orders, aiming to better understand how accelerated substitution rate and compositional heterogeneity affect the inferences of the higher-level phylogeny of this diverse group of hemimetabolous insects. We found substantial heterogeneity in base composition and contrasting rates in nucleotide substitution among these paraneopteran insects, which complicate the inference of higher-level phylogeny. The phylogenies inferred with concatenated sequences of mt genes using maximum likelihood and Bayesian methods and homogeneous models failed to recover Psocodea and Hemiptera as monophyletic groups but grouped, instead, the taxa that had accelerated substitution rates together, including Sternorrhyncha (a suborder of Hemiptera), Thysanoptera, Phthiraptera and Liposcelididae (a family of Psocoptera). Bayesian inference with nucleotide sequences and heterogeneous models (CAT and CAT + GTR), however, recovered Psocodea, Thysanoptera and Hemiptera each as a monophyletic group. Within Psocodea, Liposcelididae is more closely related to Phthiraptera than to other species of Psocoptera. Furthermore, Thysanoptera was recovered as the sister group to Hemiptera. PMID:25704094

The EMBL nucleotide sequence database

PubMed Central

Stoesser, Guenter; Baker, Wendy; van den Broek, Alexandra; Camon, Evelyn; Garcia-Pastor, Maria; Kanz, Carola; Kulikova, Tamara; Lombard, Vincent; Lopez, Rodrigo; Parkinson, Helen; Redaschi, Nicole; Sterk, Peter; Stoehr, Peter; Tuli, Mary Ann

2001-01-01

The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/) is maintained at the European Bioinformatics Institute (EBI) in an international collaboration with the DNA Data Bank of Japan (DDBJ) and GenBank at the NCBI (USA). Data is exchanged amongst the collaborating databases on a daily basis. The major contributors to the EMBL database are individual authors and genome project groups. Webin is the preferred web-based submission system for individual submitters, whilst automatic procedures allow incorporation of sequence data from large-scale genome sequencing centres and from the European Patent Office (EPO). Database releases are produced quarterly. Network services allow free access to the most up-to-date data collection via ftp, email and World Wide Web interfaces. EBI’s Sequence Retrieval System (SRS), a network browser for databanks in molecular biology, integrates and links the main nucleotide and protein databases plus many specialized databases. For sequence similarity searching a variety of tools (e.g. Blitz, Fasta, BLAST) are available which allow external users to compare their own sequences against the latest data in the EMBL Nucleotide Sequence Database and SWISS-PROT. PMID:11125039

Interactive computer programs for the graphic analysis of nucleotide sequence data.

PubMed Central

Luckow, V A; Littlewood, R K; Rownd, R H

1984-01-01

A group of interactive computer programs have been developed which aid in the collection and graphical analysis of nucleotide and protein sequence data. The programs perform the following basic functions: a) enter, edit, list, and rearrange sequence data; b) permit automatic entry of nucleotide sequence data directly from an autoradiograph into the computer; c) search for restriction sites or other specified patterns and plot a linear or circular restriction map, or print their locations; d) plot base composition; e) analyze homology between sequences by plotting a two-dimensional graphic matrix; and f) aid in plotting predicted secondary structures of RNA molecules. PMID:6546437

Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

PubMed Central

Khan, A S

1984-01-01

The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

Identification of Genes Encoding Conjugated Bile Salt Hydrolase and Transport in Lactobacillus johnsonii 100-100

PubMed Central

Elkins, Christopher A.; Savage, Dwayne C.

1998-01-01

Cytosolic extracts of Lactobacillus johnsonii 100-100 (previously reported as Lactobacillus sp. strain 100-100) contain four heterotrimeric isozymes composed of two peptides, α and β, with conjugated bile salt hydrolase (BSH) activity. We now report cloning, from the genome of strain 100-100, a 2,977-bp DNA segment that expresses BSH activity in Escherichia coli. The sequencing of this segment showed that it contained one complete and two partial open reading frames (ORFs). The 3′ partial ORF (927 nucleotides) was predicted by BLAST and confirmed with 5′ and 3′ deletions to be a BSH gene. Thermal asymmetric interlaced PCR was used to extend and complete the 948-nucleotide sequence of the BSH gene 3′ of the cloned segment. The predicted amino acid sequence of the 5′ partial ORF (651 nucleotides) was about 80% similar to the C-terminal half of the largest, complete ORF (1,353 nucleotides), and these two putative proteins were similar to several amine, multidrug resistance, and sugar transport proteins of the major facilitator superfamily. E. coli DH5α cells transformed with a construct containing these ORFs, in concert with an extracellular factor produced by strain 100-100, demonstrated levels of uptake of [14C]taurocholic acid that were increased as much as threefold over control levels. [14C]Cholic acid was taken up in similar amounts by strain DH5α pSportI (control) and DH5α p2000 (transport clones). These findings support a hypothesis that the ORFs are conjugated bile salt transport genes which may be arranged in an operon with BSH genes. PMID:9721268

Human Chromosome 7: DNA Sequence and Biology

PubMed Central

Scherer, Stephen W.; Cheung, Joseph; MacDonald, Jeffrey R.; Osborne, Lucy R.; Nakabayashi, Kazuhiko; Herbrick, Jo-Anne; Carson, Andrew R.; Parker-Katiraee, Layla; Skaug, Jennifer; Khaja, Razi; Zhang, Junjun; Hudek, Alexander K.; Li, Martin; Haddad, May; Duggan, Gavin E.; Fernandez, Bridget A.; Kanematsu, Emiko; Gentles, Simone; Christopoulos, Constantine C.; Choufani, Sanaa; Kwasnicka, Dorota; Zheng, Xiangqun H.; Lai, Zhongwu; Nusskern, Deborah; Zhang, Qing; Gu, Zhiping; Lu, Fu; Zeesman, Susan; Nowaczyk, Malgorzata J.; Teshima, Ikuko; Chitayat, David; Shuman, Cheryl; Weksberg, Rosanna; Zackai, Elaine H.; Grebe, Theresa A.; Cox, Sarah R.; Kirkpatrick, Susan J.; Rahman, Nazneen; Friedman, Jan M.; Heng, Henry H. Q.; Pelicci, Pier Giuseppe; Lo-Coco, Francesco; Belloni, Elena; Shaffer, Lisa G.; Pober, Barbara; Morton, Cynthia C.; Gusella, James F.; Bruns, Gail A. P.; Korf, Bruce R.; Quade, Bradley J.; Ligon, Azra H.; Ferguson, Heather; Higgins, Anne W.; Leach, Natalia T.; Herrick, Steven R.; Lemyre, Emmanuelle; Farra, Chantal G.; Kim, Hyung-Goo; Summers, Anne M.; Gripp, Karen W.; Roberts, Wendy; Szatmari, Peter; Winsor, Elizabeth J. T.; Grzeschik, Karl-Heinz; Teebi, Ahmed; Minassian, Berge A.; Kere, Juha; Armengol, Lluis; Pujana, Miguel Angel; Estivill, Xavier; Wilson, Michael D.; Koop, Ben F.; Tosi, Sabrina; Moore, Gudrun E.; Boright, Andrew P.; Zlotorynski, Eitan; Kerem, Batsheva; Kroisel, Peter M.; Petek, Erwin; Oscier, David G.; Mould, Sarah J.; Döhner, Hartmut; Döhner, Konstanze; Rommens, Johanna M.; Vincent, John B.; Venter, J. Craig; Li, Peter W.; Mural, Richard J.; Adams, Mark D.; Tsui, Lap-Chee

2010-01-01

DNA sequence and annotation of the entire human chromosome 7, encompassing nearly 158 million nucleotides of DNA and 1917 gene structures, are presented. To generate a higher order description, additional structural features such as imprinted genes, fragile sites, and segmental duplications were integrated at the level of the DNA sequence with medical genetic data, including 440 chromosome rearrangement breakpoints associated with disease. This approach enabled the discovery of candidate genes for developmental diseases including autism. PMID:12690205

Molecular cloning, sequence characterization and recombinant expression of Nanog gene in goat fibroblast cells using lentiviral based expression system.

PubMed

Singhal, Dinesh K; Singhal, Raxita; Malik, Hruda N; Kumar, Surender; Kumar, Sudarshan; Mohanty, Ashok K; Kaushik, Jai K; Malakar, Dhruba

2014-01-01

Nanog is a homeodomain containing protein which plays important roles in regulation of signaling pathways for maintenance and induction of pluripotency in stem cells. Because of its unique expression in stem cells it is also regarded as pluripotency marker. In this study goat Nanog (gNanog) gene has been amplified, cloned and characterized at sequence level with successful over-expression in CHO-K1 cell line using a lentiviral based system. gNanog ORF is 903 bp long which codes for Nanog protein of size 300 amino acids (aas). Complete nucleotide sequence shows some evolutionary mutation in goat in comparision to other species. Protein sequence of goat is highly similar to other species. Overall, gNanog nucleotide sequence and predicted protein sequence showed high similarity and minimum divergence with cattle (96 % identity/4 % divergence) and buffalo (94/5 %) while low similarity and high divergence with pig (84/15 %), human (81/23 %) and mouse (69/40 %) indicating evolutionary closeness of gNanog to cattle and buffalo. gNanog lentiviral expression construct was prepared for over-expression of Nanog gene in adult goat fibroblast cells. Lentiviral expression construct of Nanog enabled continuous protein expression for induction and maintenance of pluripotency. Western blotting revealed the expression of Nanog gene at protein level which supported that the lentiviral expression system is highly promising for Nanog protein expression in differentiated goat cell.

Complete nucleotide sequence and genome organization of a novel allexivirus from alfalfa (Medicago sativa)

USDA-ARS?s Scientific Manuscript database

A new species of the family Alphaflexiviridae provisionally named Alfalfa virus S (AVS) was diagnosed in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by Illumina NGS technology ...

The primary structure of the thymidine kinase gene of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Handermann, M; Szépe, O; Darai, G

1991-06-01

The DNA nucleotide sequence of the thymidine kinase (TK) gene of fish lymphocystis disease virus (FLDV) which has been localized between the coordinates 0.678 to 0.688 of the viral genome was determined. The analysis of the DNA nucleotide sequence located between the recognition sites of HindIII (0.669 map unit; nucleotide position 1) and AccI (nucleotide position 2032) revealed the presence of an open reading frame of 954 bp on the lower strand of this region between nucleotide positions 1868 (ATG) and 915 (TAA). It encodes for a protein of 318 amino acid residues. The evolutionary relationships of the TK gene of FLDV to the other known TK genes was investigated using the method of progressive sequence alignment. These analyses revealed a high degree of diversity between the protein sequence of FLDV TK gene and the amino acid composition of other TKs tested. However, significant conservations were detected at several regions of amino acid residues of the FLDV TK protein when compared to the amino acid sequence of TKs of African swine fever virus, fowlpox virus, shope fibroma virus, and vaccinia virus and to the amino acid sequences of the cellular cytoplasmic TK of chicken, mouse, and man.

Sequence diversity within the reovirus S2 gene: reovirus genes reassort in nature, and their termini are predicted to form a panhandle motif.

PubMed Central

Chapell, J D; Goral, M I; Rodgers, S E; dePamphilis, C W; Dermody, T S

1994-01-01

To better understand genetic diversity within mammalian reoviruses, we determined S2 nucleotide and deduced sigma 2 amino acid sequences of nine reovirus strains and compared these sequences with those of prototype strains of the three reovirus serotypes. The S2 gene and sigma 2 protein are highly conserved among the four type 1, one type 2, and seven type 3 strains studied. Phylogenetic analyses based on S2 nucleotide sequences of the 12 reovirus strains indicate that diversity within the S2 gene is independent of viral serotype. Additionally, we found marked topological differences between phylogenetic trees generated from S1 and S2 gene nucleotide sequences of the seven type 3 strains. These results demonstrate that reovirus S1 and S2 genes have distinct evolutionary histories, thus providing phylogenetic evidence for lateral transfer of reovirus genes in nature. When variability among the 12 sigma 2-encoding S2 nucleotide sequences was analyzed at synonymous positions, we found that approximately 60 nucleotides at the 5' terminus and 30 nucleotides at the 3' terminus were markedly conserved in comparison with other sigma 2-encoding regions of S2. Predictions of RNA secondary structures indicate that the more conserved S2 sequences participate in the formation of an extended region of duplex RNA interrupted by a pair of stem-loops. Among the 12 deduced sigma 2 amino acid sequences examined, substitutions were observed at only 11% of amino acid positions. This finding suggests that constraints on the structure or function of sigma 2, perhaps in part because of its location in the virion core, have limited sequence diversity within this protein. PMID:8289378

DNA sequence analysis of simian virus 40 mutants with deletions mapping in the leader region of the late viral mRNA's: mutants with deletions similar in size and position exhibit varied phenotypes.

PubMed

Barkan, A; Mertz, J E

1981-02-01

The nucleotide sequences of 10 viable yet partially defective deletion mutants of simian virus 40 were determined. The deletions mapped within, and, in many cases, 5' to, the predominant leader sequence of the late viral mRNA's. They ranged from 74 to 187 nucleotide pairs in length. Six of the mutants had lost the sequence that corresponds to the "cap" site (5' terminus) of the most abundant class of 16S mRNA's. One of these mutants had a deletion that extended 103 nucleotide pairs into the region preceding this primary cap site and, therefore, was missing many secondary cap sites as well. A seventh mutant lacked the entire major 16S leader sequence except for the first six nucleotides at its 5' end and the last nine at its 3' end. Although these mutants differed in the size and position of their deletions, we were unable to discover any simple correlations between their growth characteristics and their DNA sequences. This finding indicates that the secondary structures of the RNA transcripts may play a more important role than the exact nucleotide sequence of the RNAs in determining how they function within the cell.

Complete sequence of two tick-borne flaviviruses isolated from Siberia and the UK: analysis and significance of the 5' and 3'-UTRs.

PubMed

Gritsun, T S; Venugopal, K; Zanotto, P M; Mikhailov, M V; Sall, A A; Holmes, E C; Polkinghorne, I; Frolova, T V; Pogodina, V V; Lashkevich, V A; Gould, E A

1997-05-01

The complete nucleotide sequence of two tick-transmitted flaviviruses, Vasilchenko (Vs) from Siberia and louping ill (LI) from the UK, have been determined. The genomes were respectively, 10928 and 10871 nucleotides (nt) in length. The coding strategy and functional protein sequence motifs of tick-borne flaviviruses are presented in both Vs and LI viruses. The phylogenies based on maximum likelihood, maximum parsimony and distance analysis of the polyproteins, identified Vs virus as a member of the tick-borne encephalitis virus subgroup within the tick-borne serocomplex, genus Flavivirus, family Flaviviridae. Comparative alignment of the 3'-untranslated regions revealed deletions of different lengths essentially at the same position downstream of the stop codon for all tick-borne viruses. Two direct 27 nucleotide repeats at the 3'-end were found only for Vs and LI virus. Immediately following the deletions a region of 332-334 nt with relatively conserved primary structure (67-94% identity) was observed at the 3'-non-coding end of the virus genome. Pairwise comparisons of the nucleotide sequence data revealed similar levels of variation between the coding region, and the 5' and 3'-termini of the genome, implying an equivalent strong selective control for translated and untranslated regions. Indeed the predicted folding of the 5' and 3'-untranslated regions revealed patterns of stem and loop structures conserved for all tick-borne flaviviruses suggesting a purifying selection for preservation of essential RNA secondary structures which could be involved in translational control and replication. The possible implications of these findings are discussed.

Characterization of sams genes of Amoeba proteus and the endosymbiotic X-bacteria.

PubMed

Jeon, Taeck J; Jeon, Kwang W

2003-01-01

As a result of harboring obligatory bacterial endosymbionts, the xD strain of Amoeba proteus no longer produces its own S-adenosylmethionine synthetase (SAMS). When symbiont-free D amoebae are infected with symbionts (X-bacteria), the amount of amoeba SAMS decreases to a negligible level within four weeks, but about 47% of the SAMS activity, which apparently comes from another source, is still detected. Complete nucleotide sequences of sams genes of D and xD amoebae are presented and show that there are no differences between the two. Long-established xD amoebae contain an intact sams gene and thus the loss of xD amoeba's SAMS is not due to the loss of the gene itself. The open reading frame of the amoeba's sams gene has 1,281 nucleotides, encoding SAMS of 426 amino acids with a mass of 48 kDa and pI of 6.5. The amino acid sequence of amoeba SAMS is longer than the SAMS of other organisms by having an extra internal stretch of 28 amino acids. The 5'-flanking region of amoeba sams contains consensus-binding sites for several transcription factors that are related to the regulation of sams genes in E. coli and yeast. The complete nucleotide sequence of the symbiont's sams gene is also presented. The open reading frame of X-bacteria sams is 1,146 nucleotides long, encoding SAMS of 381 amino acids with a mass of 41 kDa and pI of 6.0. The X-bacteria SAMS has 45% sequence identity with that of A. proteus.

Complete Nucleotide Sequence of Watermelon Chlorotic Stunt Virus Originating from Oman

PubMed Central

Khan, Akhtar J.; Akhtar, Sohail; Briddon, Rob W.; Ammara, Um; Al-Matrooshi, Abdulrahman M.; Mansoor, Shahid

2012-01-01

Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6–99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93–98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed. PMID:22852046

Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

PubMed

Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

2012-07-01

Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Ellanskaya, legal representative, Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser; Ellanskaya, deceased, Irina

2007-12-11

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Elleskaya, Irina; Ellanskaya, legal representative; Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-08-10

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Waukee, IA; Dahlbacka, Glen [Oakland, CA; Elleskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, IA; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2011-04-12

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Granger, IA; Dahlbacka, Glen [Oakland, CA; Ellanskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, TX; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2012-04-03

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

PubMed Central

Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

2011-01-01

DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

Recoding method that removes inhibitory sequences and improves HIV gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rabadan, Raul; Krasnitz, Michael; Robins, Harlan

The invention relates to inhibitory nucleotide signal sequences or "INS" sequences in the genomes of lentiviruses. In particular the invention relates to the AGG motif present in all viral genomes. The AGG motif may have an inhibitory effect on a virus, for example by reducing the levels of, or maintaining low steady-state levels of, viral RNAs in host cells, and inducing and/or maintaining in viral latency. In one aspect, the invention provides vaccines that contain, or are produced from, viral nucleic acids in which the AGG sequences have been mutated. In another aspect, the invention provides methods and compositions formore » affecting the function of the AGG motif, and methods for identifying other INS sequences in viral genomes.« less

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

PubMed

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed Central

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-01-01

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%). PMID:6891053

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2011 CFR

2011-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2013 CFR

2013-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2012 CFR

2012-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2010 CFR

2010-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2014 CFR

2014-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

Detection of Rickettsia helvetica and Candidatus R. tarasevichiae DNA in Ixodes persulcatus ticks collected in Northeastern European Russia (Komi Republic).

PubMed

Kartashov, Mikhail Yu; Glushkova, Ludmila I; Mikryukova, Tamara P; Korabelnikov, Igor V; Egorova, Yulia I; Tupota, Natalia L; Protopopova, Elena V; Konovalova, Svetlana N; Ternovoi, Vladimir A; Loktev, Valery B

2017-06-01

The number of tick-borne infections in the northern European regions of Russia has increased considerably in the last years. In the present study, 676 unfed adult Ixodes persulcatus ticks were collected in the Komi Republic from 2011 to 2013 to study tick-borne rickettsioses. Rickettsia spp. DNA was detected by PCR in 51 (7.6%) ticks. The nucleotide sequence analysis of gltA fragments (765bp) from 51 ticks indicated that 60.8% and 39.2% of the ticks were infected with Rickettsia helvetica and Candidatus R. tarasevichiae, respectively. The gltA fragments showed 100% identity with those of Candidatus R. tarasevichiae previously discovered in Siberia and China, whereas R. helvetica showed 99.9% sequence identity with European isolates. The ompB had 8 nucleotide substitutions, 6 of which resulted in amino acid substitutions. In the sca9 gene, 3 nucleotide substitutions were detected, and only one resulted in amino acid substitution. The smpA, ompW, and β-lactamase genes of R. helvetica also showed a high level of sequence identity. Copyright © 2017 Elsevier GmbH. All rights reserved.

GenBank.

PubMed

Benson, Dennis A; Karsch-Mizrachi, Ilene; Lipman, David J; Ostell, James; Sayers, Eric W

2011-01-01

GenBank® is a comprehensive database that contains publicly available nucleotide sequences for more than 380,000 organisms named at the genus level or lower, obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects, including whole genome shotgun (WGS) and environmental sampling projects. Most submissions are made using the web-based BankIt or standalone Sequin programs, and accession numbers are assigned by GenBank staff upon receipt. Daily data exchange with the European Nucleotide Archive (ENA) and the DNA Data Bank of Japan (DDBJ) ensures worldwide coverage. GenBank is accessible through the NCBI Entrez retrieval system that integrates data from the major DNA and protein sequence databases along with taxonomy, genome, mapping, protein structure and domain information, and the biomedical journal literature via PubMed. BLAST provides sequence similarity searches of GenBank and other sequence databases. Complete bimonthly releases and daily updates of the GenBank database are available by FTP. To access GenBank and its related retrieval and analysis services, begin at the NCBI Homepage: www.ncbi.nlm.nih.gov.

Crimean-Congo Hemorrhagic Fever

DTIC Science & Technology

2004-01-01

aminocaproic acid were also indicated. Much emphasis was also placed on preventing reinfection, including the necessity of remov- ing blood crusts from...The se- quence is approximately 60% identical both at the nucleotide and amino acid levels to the L segment of Dugbe virus, the only other Nairovirus...However, more recent data based on nucleic acid sequence analysis have revealed extensive genetic diversity. The first published CCHFV sequence

First report of Beet western yellows virus infecting Epiphyllum spp

USDA-ARS?s Scientific Manuscript database

Beet western yellow virus (BWYV) was identified from an orchid cactus (Epiphyllum spp.) hybrid without obvious symptoms by high-throughput sequencing. The nearly complete genomic sequence of 5,458 nucleotides of the virus was determined. The isolate has the highest nucleotide sequence identity (93%)...

A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout

USGS Publications Warehouse

Rasmussen, C.; Purcell, M.K.; Gregg, J.L.; LaPatra, S.E.; Winton, J.R.; Hershberger, P.K.

2010-01-01

The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of ~740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

Grizzly bear corticosteroid binding globulin: Cloning and serum protein expression.

PubMed

Chow, Brian A; Hamilton, Jason; Alsop, Derek; Cattet, Marc R L; Stenhouse, Gordon; Vijayan, Mathilakath M

2010-06-01

Serum corticosteroid levels are routinely measured as markers of stress in wild animals. However, corticosteroid levels rise rapidly in response to the acute stress of capture and restraint for sampling, limiting its use as an indicator of chronic stress. We hypothesized that serum corticosteroid binding globulin (CBG), the primary transport protein for corticosteroids in circulation, may be a better marker of the stress status prior to capture in grizzly bears (Ursus arctos). To test this, a full-length CBG cDNA was cloned and sequenced from grizzly bear testis and polyclonal antibodies were generated for detection of this protein in bear sera. The deduced nucleotide and protein sequences were 1218 bp and 405 amino acids, respectively. Multiple sequence alignments showed that grizzly bear CBG (gbCBG) was 90% and 83% identical to the dog CBG nucleotide and amino acid sequences, respectively. The affinity purified rabbit gbCBG antiserum detected grizzly bear but not human CBG. There were no sex differences in serum total cortisol concentration, while CBG expression was significantly higher in adult females compared to males. Serum cortisol levels were significantly higher in bears captured by leg-hold snare compared to those captured by remote drug delivery from helicopter. However, serum CBG expression between these two groups did not differ significantly. Overall, serum CBG levels may be a better marker of chronic stress, especially because this protein is not modulated by the stress of capture and restraint in grizzly bears. Copyright 2010 Elsevier Inc. All rights reserved.

[Study on the genetic difference of SEO type Hantaviruses].

PubMed

Zhang, X; Zhou, S; Wang, H; Hu, J; Guan, Z; Liu, H

2000-10-01

To understand the genetic type of Hantaviruses and the difference between them caused by rodents in Beijing and to furhter explore the source of the infectious factors. Hantavirus RNA, isolated from lungs of rodents captured in Beijing and positive with Hantavirus antigens with frozen sectioning and Immunofluorescent assay, were reverse-transcribed and amplified with PCR with Hantavirus-specific primers. Five of the PCR amplifications were discovered and sequenced with 300 bp sequence data of M segments (from 2003 - 2302nt according cDNA of seoul 8039 strain). Nucleotide sequence homology showed that they were sequences of SEO-type Hantavirus. Compared with SEO type Hantavirus, the nucleotide sequence homology of these samples was more than 94% while the homology of amonia acid sequence was more than 98%. When compared with HNT type Hantavirus, the homology of nucleotide sequence became less than 72% with the homology of amonia acid sequence less than 81%. Similar to other Hantavirus of SEO type, their nucleotide sequences and deduced amino acid sequences were highly preserved. Phylogenetic tree analysis showed that the five viruses could be divided into at least 4 branches. It was quite likely that there were at least two sub-type SEO viruses with 4 branches that were circulating in Beijing.

The delta-subunit of murine guanine nucleotide exchange factor eIF-2B. Characterization of cDNAs predicts isoforms differing at the amino-terminal end.

PubMed

Henderson, R A; Krissansen, G W; Yong, R Y; Leung, E; Watson, J D; Dholakia, J N

1994-12-02

Protein synthesis in mammalian cells is regulated at the level of the guanine nucleotide exchange factor, eIF-2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. We have isolated and sequenced cDNA clones encoding the delta-subunit of murine eIF-2B. The cDNA sequence encodes a polypeptide of 544 amino acids with molecular mass of 60 kDa. Antibodies against a synthetic polypeptide of 30 amino acids deduced from the cDNA sequence specifically react with the delta-subunit of mammalian eIF-2B. The cDNA-derived amino acid sequence shows significant homology with the yeast translational regulator Gcd2, supporting the hypothesis that Gcd2 may be the yeast homolog of the delta-subunit of mammalian eIF-2B. Primer extension studies and anchor polymerase chain reaction analysis were performed to determine the 5'-end of the transcript for the delta-subunit of eIF-2B. Results of these experiments demonstrate two different mRNAs for the delta-subunit of eIF-2B in murine cells. The isolation and characterization of two different full-length cDNAs also predicts the presence of two alternate forms of the delta-subunit of eIF-2B in murine cells. These differ at their amino-terminal end but have identical nucleotide sequences coding for amino acids 31-544.

Statistical Analysis of Readthrough Levels for Nonsense Mutations in Mammalian Cells Reveals a Major Determinant of Response to Gentamicin

PubMed Central

Floquet, Célia; Hatin, Isabelle; Rousset, Jean-Pierre; Bidou, Laure

2012-01-01

The efficiency of translation termination depends on the nature of the stop codon and the surrounding nucleotides. Some molecules, such as aminoglycoside antibiotics (gentamicin), decrease termination efficiency and are currently being evaluated for diseases caused by premature termination codons. However, the readthrough response to treatment is highly variable and little is known about the rules governing readthrough level and response to aminoglycosides. In this study, we carried out in-depth statistical analysis on a very large set of nonsense mutations to decipher the elements of nucleotide context responsible for modulating readthrough levels and gentamicin response. We quantified readthrough for 66 sequences containing a stop codon, in the presence and absence of gentamicin, in cultured mammalian cells. We demonstrated that the efficiency of readthrough after treatment is determined by the complex interplay between the stop codon and a larger sequence context. There was a strong positive correlation between basal and induced readthrough levels, and a weak negative correlation between basal readthrough level and gentamicin response (i.e. the factor of increase from basal to induced readthrough levels). The identity of the stop codon did not affect the response to gentamicin treatment. In agreement with a previous report, we confirm that the presence of a cytosine in +4 position promotes higher basal and gentamicin-induced readthrough than other nucleotides. We highlight for the first time that the presence of a uracil residue immediately upstream from the stop codon is a major determinant of the response to gentamicin. Moreover, this effect was mediated by the nucleotide itself, rather than by the amino-acid or tRNA corresponding to the −1 codon. Finally, we point out that a uracil at this position associated with a cytosine at +4 results in an optimal gentamicin-induced readthrough, which is the therapeutically relevant variable. PMID:22479203

Characterization of four species of Trichuris (Nematoda: Enoplida) by their second internal transcribed spacer ribosomal DNA sequence.

PubMed

Oliveros, R; Cutillas, C; De Rojas, M; Arias, P

2000-12-01

Adult worms of Trichuris ovis and T. globulosa were collected from Ovis aries (sheep) and Capra hircus (goats). T. suis was isolated from Sus scrofa domestica (swine) and T. leporis was isolated from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and a ribosomal internal transcribed spacer (ITS2) was amplified and sequenced using polymerase-chain-reaction (PCR) techniques. The ITS2 of T. ovis and T. globulosa was 407 nucleotides in length and had a GC content of about 62%. Furthermore, the ITS2 of T. suis and T. leporis was 534 and 418 nucleotides in length and had a GC content of about 64.8% and 62.4%, respectively. There was evidence of slight variation in the sequence within individuals of all species analyzed, indicating intraindividual variation in the sequence of different copies of the ribosomal DNA. Furthermore, low-level intraspecific variation was detected. Sequence analyses of ITS2 products of T. ovis and T. globulosa demonstrated no sequence difference between them. Nevertheless, differences were detected between the ITS2 sequences of T. suis, T. leporis, and T. ovis, indicating that Trichuris species can reliably be differentiated by their ITS2 sequences and PCR-linked restriction-fragment-length polymorphism (RFLP).

Sequence analysis of Jembrana disease virus strains reveals a genetically stable lentivirus.

PubMed

Desport, Moira; Stewart, Meredith E; Mikosza, Andrew S; Sheridan, Carol A; Peterson, Shane E; Chavand, Olivier; Hartaningsih, Nining; Wilcox, Graham E

2007-06-01

Jembrana disease virus (JDV) is a lentivirus associated with an acute disease syndrome with a 20% case fatality rate in Bos javanicus (Bali cattle) in Indonesia, occurring after a short incubation period and with no recurrence of the disease after recovery. Partial regions of gag and pol and the entire env were examined for sequence variation in DNA samples from cases of Jembrana disease obtained from Bali, Sumatra and South Kalimantan in Indonesian Borneo. A high level of nucleotide conservation (97-100%) was observed in gag sequences from samples taken in Bali and Sumatra, indicating that the source of JDV in Sumatra was most likely to have originated from Bali. The pol sequences and, unexpectedly, the env sequences from Bali samples were also well conserved with low nucleotide (96-99%) and amino acid substitutions (95-99%). However, the sample from South Kalimantan (JDV(KAL/01)) contained more divergent sequences, particularly in env (88% identity). Phylogenetic analysis revealed that the JDV(KAL/01)env sequences clustered with the sequence from the Pulukan sample (Bali) from 2001. JDV appears to be remarkably stable genetically and has undergone minor genetic changes over a period of nearly 20 years in Bali despite becoming endemic in the cattle population of the island.

Developmental rearrangement of cyanobacterial nif genes: nucleotide sequence, open reading frames, and cytochrome P-450 homology of the Anabaena sp. strain PCC 7120 nifD element.

PubMed Central

Lammers, P J; McLaughlin, S; Papin, S; Trujillo-Provencio, C; Ryncarz, A J

1990-01-01

An 11-kbp DNA element of unknown function interrupts the nifD gene in vegetative cells of Anabaena sp. strain PCC 7120. In developing heterocysts the nifD element excises from the chromosome via site-specific recombination between short repeat sequences that flank the element. The nucleotide sequence of the nifH-proximal half of the element was determined to elucidate the genetic potential of the element. Four open reading frames with the same relative orientation as the nifD element-encoded xisA gene were identified in the sequenced region. Each of the open reading frames was preceded by a reasonable ribosome-binding site and had biased codon utilization preferences consistent with low levels of expression. Open reading frame 3 was highly homologous with three cytochrome P-450 omega-hydroxylase proteins and showed regional homology to functionally significant domains common to the cytochrome P-450 superfamily. The sequence encoding open reading frame 2 was the most highly conserved portion of the sequenced region based on heterologous hybridization experiments with three genera of heterocystous cyanobacteria. Images PMID:2123860

Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.

PubMed

Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng

2017-07-01

The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.

Complete nucleotide sequences of the coat protein messenger RNAs of brome mosaic virus and cowpea chlorotic mottle virus.

PubMed Central

Dasgupta, R; Kaesberg, P

1982-01-01

The nucleotide sequences of the subgenomic coat protein messengers (RNA4's) of two related bromoviruses, brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV), have been determined by direct RNA and CDNA sequencing without cloning. BMV RNA4 is 876 b long including a 5' noncoding region of nine nucleotides and a 3' noncoding region of 300 nucleotides. CCMV RNA 4 is 824 b long, including a 5' noncoding region of 10 nucleotides and a 3' noncoding region of 244 nucleotides. The encoded coat proteins are similar in length (188 amino acids for BMV and 189 amino acids for CCMV) and display about 70% homology in their amino acid sequences. Length difference between the two RNAs is due mostly to a single deletion, in CCMV with respect to BMV, of about 57 b immediately following the coding region. Allowing for this deletion the RNAs are indicate that mutations leading to divergence were constrained in the coding region primarily by the requirement of maintaining a favorable coat protein structure and in the 3' noncoding region primarily by the requirement of maintaining a favorable RNA spatial configuration. PMID:6895941

Nucleotide sequence analysis of the 3' terminal region of a wasabi strain of crucifer tobamovirus genomic RNA: subgrouping of crucifer tobamoviruses.

PubMed

Shimamoto, I; Sonoda, S; Vazquez, P; Minaka, N; Nishiguchi, M

1998-01-01

The 3' terminal 2378 nucleotides of a wasabi strain of crucifer tobamovirus (CTMV-W) infectious to crucifer plants was determined. This includes the 3' non-coding region of 235 nucleotides, coat protein (CP) gene (468 nucleotides), movement protein (MP) gene (798 nucleotides) and C-terminal partial readthrough portion of 180 K protein gene (940 nucleotides). Comparison of the sequence with homologous regions of thirteen other tobamovirus genomes showed that it had much higher identity to those of four other crucifer tobamoviruses, 85.2% to cr-TMV and turnip vein-clearing virus (TVCV), 87.4% to oilseed rape mosaic virus (ORMV) and 87.1% to TMV-Cg, than to those of other tobamoviruses. Thus CTMV-W was most similar to ORMV and TMV-Cg in sequence, but only marginally so, whereas the location and size of its MP gene was the same as cr-TMV amd TVCV. These results, together with other analyses, show that CTMV-W is a new crucifer tobamovirus, that the five crucifer tobamoviruses can be classified into two subgroups based on MP gene organization, and that the rate of sequence change is not the same in all lineages.

A single alteration 20 nt 5′ to an editing target inhibits chloroplast RNA editing in vivo

PubMed Central

Reed, Martha L.; Peeters, Nemo M.; Hanson, Maureen R.

2001-01-01

Transcripts of typical dicot plant plastid genes undergo C→U RNA editing at approximately 30 locations, but there is no consensus sequence surrounding the C targets of editing. The cis-acting elements required for editing of the C located at tobacco rpoB editing site II were investigated by introducing translatable chimeric minigenes containing sequence –20 to +6 surrounding the C target of editing. When the –20 to +6 sequence specified by the homologous region present in the black pine chloroplast genome was incorporated, virtually no editing of the transcripts occurred in transgenic tobacco plastids. Nucleotides that differ between the black pine and tobacco sequence were tested for their role in C→U editing by designing chimeric genes containing one or more of these divergent nucleotides. Surprisingly, the divergent nucleotide that had the strongest negative effect on editing of the minigene transcript was located –20 nt 5′ to the C target of editing. Expression of transgene transcripts carrying the 27 nt sequence did not affect the editing extent of the endogenous rpoB transcripts, even though the chimeric transcripts were much more abundant than those of the endogenous gene. In plants carrying a 93 nt rpoB editing site sequence, transgene transcripts accumulated to a level three times greater than transgene transcripts in the plants carrying the 27 nt rpoB editing sites and resulted in editing of the endogenous transcripts from 100 to 50%. Both a lower affinity of the 27 nt site for a trans-acting factor and lower abundance of the transcript could explain why expression of minigene transcripts containing the 27 nt sequence did not affect endogenous editing. PMID:11266552

Changes in mumps virus neurovirulence phenotype associated with quasispecies heterogeneity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sauder, Christian J.; Vandenburgh, Kari M.; Iskow, Rebecca C.

2006-06-20

Mumps virus is a highly neurotropic virus with evidence of central nervous system invasion (CNS) in approximately half of all cases of infection. In countries where live attenuated mumps virus vaccines were introduced, the number of mumps cases declined dramatically; however, recently, the safety of some vaccine strains has been questioned. For example, one of the most widely used vaccines, the Urabe AM9 strain, was causally associated with meningitis, leading to the withdrawal of this product from the market in several countries. This highlights the need for a better understanding of the attenuation process and the identification of markers ofmore » attenuation. To this end, we further attenuated the Urabe AM9 strain by serial passage in cell culture and compared the complete nucleotide sequences of the parental and passaged viruses. Interestingly, despite a dramatic decrease in virus virulence (as assayed in rats), the only genomic changes were in the form of changes in the level of genetic heterogeneity at specific genome sites, i.e., either selection of one nucleotide variant at positions where the starting material exhibited nucleotide heterogeneity or the evolution of an additional nucleotide to create a heterogenic site. This finding suggests that changes in the level of genetic heterogeneity at specific genome sites can have profound neurovirulence phenotypic consequences and, therefore, caution should be exercised when evaluating genetic markers of virulence or attenuation based only on a consensus sequence.« less

Trading genes along the silk road: mtDNA sequences and the origin of central Asian populations.

PubMed Central

Comas, D; Calafell, F; Mateu, E; Pérez-Lezaun, A; Bosch, E; Martínez-Arias, R; Clarimon, J; Facchini, F; Fiori, G; Luiselli, D; Pettener, D; Bertranpetit, J

1998-01-01

Central Asia is a vast region at the crossroads of different habitats, cultures, and trade routes. Little is known about the genetics and the history of the population of this region. We present the analysis of mtDNA control-region sequences in samples of the Kazakh, the Uighurs, the lowland Kirghiz, and the highland Kirghiz, which we have used to address both the population history of the region and the possible selective pressures that high altitude has on mtDNA genes. Central Asian mtDNA sequences present features intermediate between European and eastern Asian sequences, in several parameters-such as the frequencies of certain nucleotides, the levels of nucleotide diversity, mean pairwise differences, and genetic distances. Several hypotheses could explain the intermediate position of central Asia between Europe and eastern Asia, but the most plausible would involve extensive levels of admixture between Europeans and eastern Asians in central Asia, possibly enhanced during the Silk Road trade and clearly after the eastern and western Eurasian human groups had diverged. Lowland and highland Kirghiz mtDNA sequences are very similar, and the analysis of molecular variance has revealed that the fraction of mitochondrial genetic variance due to altitude is not significantly different from zero. Thus, it seems unlikely that altitude has exerted a major selective pressure on mitochondrial genes in central Asian populations. PMID:9837835

Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

PubMed

Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

2011-10-17

The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection

PubMed Central

2011-01-01

Background The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. Results The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. Conclusions These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection. PMID:22004418

Genomic mid-range inhomogeneity correlates with an abundance of RNA secondary structures

PubMed Central

Bechtel, Jason M; Wittenschlaeger, Thomas; Dwyer, Trisha; Song, Jun; Arunachalam, Sasi; Ramakrishnan, Sadeesh K; Shepard, Samuel; Fedorov, Alexei

2008-01-01

Background Genomes possess different levels of non-randomness, in particular, an inhomogeneity in their nucleotide composition. Inhomogeneity is manifest from the short-range where neighboring nucleotides influence the choice of base at a site, to the long-range, commonly known as isochores, where a particular base composition can span millions of nucleotides. A separate genomic issue that has yet to be thoroughly elucidated is the role that RNA secondary structure (SS) plays in gene expression. Results We present novel data and approaches that show that a mid-range inhomogeneity (~30 to 1000 nt) not only exists in mammalian genomes but is also significantly associated with strong RNA SS. A whole-genome bioinformatics investigation of local SS in a set of 11,315 non-redundant human pre-mRNA sequences has been carried out. Four distinct components of these molecules (5'-UTRs, exons, introns and 3'-UTRs) were considered separately, since they differ in overall nucleotide composition, sequence motifs and periodicities. For each pre-mRNA component, the abundance of strong local SS (< -25 kcal/mol) was a factor of two to ten greater than a random expectation model. The randomization process preserves the short-range inhomogeneity of the corresponding natural sequences, thus, eliminating short-range signals as possible contributors to any observed phenomena. Conclusion We demonstrate that the excess of strong local SS in pre-mRNAs is linked to the little explored phenomenon of genomic mid-range inhomogeneity (MRI). MRI is an interdependence between nucleotide choice and base composition over a distance of 20–1000 nt. Additionally, we have created a public computational resource to support further study of genomic MRI. PMID:18549495

Predicted stem-loop structures and variation in nucleotide sequence of 3' noncoding regions among animal calicivirus genomes.

PubMed

Seal, B S; Neill, J D; Ridpath, J F

1994-07-01

Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.

Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

PubMed Central

Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

2016-01-01

Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

The Nucleotide Sequence and Spliced pol mRNA Levels of the Nonprimate Spumavirus Bovine Foamy Virus

PubMed Central

Holzschu, Donald L.; Delaney, Mari A.; Renshaw, Randall W.; Casey, James W.

1998-01-01

We have determined the complete nucleotide sequence of a replication-competent clone of bovine foamy virus (BFV) and have quantitated the amount of splice pol mRNA processed early in infection. The 544-amino-acid Gag protein precursor has little sequence similarity with its primate foamy virus homologs, but the putative nucleocapsid (NC) protein, like the primate NCs, contains the three glycine-arginine-rich regions that are postulated to bind genomic RNA during virion assembly. The BFV gag and pol open reading frames overlap, with pro and pol in the same translational frame. As with the human foamy virus (HFV) and feline foamy virus, we have detected a spliced pol mRNA by PCR. Quantitatively, this mRNA approximates the level of full-length genomic RNA early in infection. The integrase (IN) domain of reverse transcriptase does not contain the canonical HH-CC zinc finger motif present in all characterized retroviral INs, but it does contain a nearby histidine residue that could conceivably participate as a member of the zinc finger. The env gene encodes a protein that is over 40% identical in sequence to the HFV Env. By comparison, the Gag precursor of BFV is predicted to be only 28% identical to the HFV protein. PMID:9499074

Breaking the 1000-gene barrier for Mimivirus using ultra-deep genome and transcriptome sequencing.

PubMed

Legendre, Matthieu; Santini, Sébastien; Rico, Alain; Abergel, Chantal; Claverie, Jean-Michel

2011-03-04

Mimivirus, a giant dsDNA virus infecting Acanthamoeba, is the prototype of the mimiviridae family, the latest addition to the family of the nucleocytoplasmic large DNA viruses (NCLDVs). Its 1.2 Mb-genome was initially predicted to encode 917 genes. A subsequent RNA-Seq analysis precisely mapped many transcript boundaries and identified 75 new genes. We now report a much deeper analysis using the SOLiD™ technology combining RNA-Seq of the Mimivirus transcriptome during the infectious cycle (202.4 Million reads), and a complete genome re-sequencing (45.3 Million reads). This study corrected the genome sequence and identified several single nucleotide polymorphisms. Our results also provided clear evidence of previously overlooked transcription units, including an important RNA polymerase subunit distantly related to Euryarchea homologues. The total Mimivirus gene count is now 1018, 11% greater than the original annotation. This study highlights the huge progress brought about by ultra-deep sequencing for the comprehensive annotation of virus genomes, opening the door to a complete one-nucleotide resolution level description of their transcriptional activity, and to the realistic modeling of the viral genome expression at the ultimate molecular level. This work also illustrates the need to go beyond bioinformatics-only approaches for the annotation of short protein and non-coding genes in viral genomes.

Correlation approach to identify coding regions in DNA sequences

NASA Technical Reports Server (NTRS)

Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

1994-01-01

Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

Porcine insulin receptor substrate 4 (IRS4) gene: cloning, polymorphism and association study

USDA-ARS?s Scientific Manuscript database

Using PCR and IPCR techniques we obtained a 4498 bp nucleotide sequence FN424076 encompassing the complete coding sequence of the porcine IRS4 gene and its proximal promoter. The 1269-amino acid porcine protein deduced from the nucleotide sequence shares 92% identity with the human IRS4 and possesse...

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Detection of hyper-conserved regions in hepatitis B virus X gene potentially useful for gene therapy.

PubMed

González, Carolina; Tabernero, David; Cortese, Maria Francesca; Gregori, Josep; Casillas, Rosario; Riveiro-Barciela, Mar; Godoy, Cristina; Sopena, Sara; Rando, Ariadna; Yll, Marçal; Lopez-Martinez, Rosa; Quer, Josep; Esteban, Rafael; Buti, Maria; Rodríguez-Frías, Francisco

2018-05-21

To detect hyper-conserved regions in the hepatitis B virus (HBV) X gene ( HBX ) 5' region that could be candidates for gene therapy. The study included 27 chronic hepatitis B treatment-naive patients in various clinical stages (from chronic infection to cirrhosis and hepatocellular carcinoma, both HBeAg-negative and HBeAg-positive), and infected with HBV genotypes A-F and H. In a serum sample from each patient with viremia > 3.5 log IU/mL, the HBX 5' end region [nucleotide (nt) 1255-1611] was PCR-amplified and submitted to next-generation sequencing (NGS). We assessed genotype variants by phylogenetic analysis, and evaluated conservation of this region by calculating the information content of each nucleotide position in a multiple alignment of all unique sequences (haplotypes) obtained by NGS. Conservation at the HBx protein amino acid (aa) level was also analyzed. NGS yielded 1333069 sequences from the 27 samples, with a median of 4578 sequences/sample (2487-9279, IQR 2817). In 14/27 patients (51.8%), phylogenetic analysis of viral nucleotide haplotypes showed a complex mixture of genotypic variants. Analysis of the information content in the haplotype multiple alignments detected 2 hyper-conserved nucleotide regions, one in the HBX upstream non-coding region (nt 1255-1286) and the other in the 5' end coding region (nt 1519-1603). This last region coded for a conserved amino acid region (aa 63-76) that partially overlaps a Kunitz-like domain. Two hyper-conserved regions detected in the HBX 5' end may be of value for targeted gene therapy, regardless of the patients' clinical stage or HBV genotype.

Genomic analysis reveals Nairobi sheep disease virus to be highly diverse and present in both Africa, and in India in the form of the Ganjam virus variant.

PubMed

Yadav, Pragya D; Vincent, Martin J; Khristova, Marina; Kale, Charuta; Nichol, Stuart T; Mishra, Akhilesh C; Mourya, Devendra T

2011-07-01

Nairobi sheep disease (NSD) virus, the prototype tick-borne virus of the genus Nairovirus, family Bunyaviridae is associated with acute hemorrhagic gastroenteritis in sheep and goats in East and Central Africa. The closely related Ganjam virus found in India is associated with febrile illness in humans and disease in livestock. The complete S, M and L segment sequences of Ganjam and NSD virus and partial sequence analysis of Ganjam viral RNA genome S, M and L segments encoding regions (396 bp, 701 bp and 425 bp) of the viral nucleocapsid (N), glycoprotein precursor (GPC) and L polymerase (L) proteins, respectively, was carried out for multiple Ganjam virus isolates obtained from 1954 to 2002 and from various regions of India. M segments of NSD and Ganjam virus encode a large ORF for the glycoprotein precursor (GPC), (1627 and 1624 amino acids in length, respectively) and their L segments encode a very large L polymerase (3991 amino acids). The complete S, M and L segments of NSD and Ganjam viruses were more closely related to one another than to other characterized nairoviruses, and no evidence of reassortment was found. However, the NSD and Ganjam virus complete M segment differed by 22.90% and 14.70%, for nucleotide and amino acid respectively, and the complete L segment nucleotide and protein differing by 9.90% and 2.70%, respectively among themselves. Ganjam and NSD virus, complete S segment differed by 9.40-10.40% and 3.2-4.10 for nucleotide and proteins while among Ganjam viruses 0.0-6.20% and 0.0-1.4%, variation was found for nucleotide and amino acids. Ganjam virus isolates differed by up to 17% and 11% at the nucleotide level for the partial S and L gene fragments, respectively, with less variation observed at the deduced amino acid level (10.5 and 2%, S and L, respectively). However, the virus partial M gene fragment (which encodes the hypervariable mucin-like domain) of these viruses differed by as much as 56% at the nucleotide level. Phylogenetic analysis of partial sequence differences suggests considerable mixing and movement of Ganjam virus strains within India, with no clear relationship between genetic lineages and virus geographic origin or year of isolation. Surprisingly, NSD virus does not represent a distinct lineage, but appears as a variant with other Ganjam virus among NSD virus group. Copyright © 2011 Elsevier B.V. All rights reserved.

Regions of conservation and divergence in the 3' untranslated sequences of genomic RNA from Ross River virus isolates.

PubMed

Faragher, S G; Dalgarno, L

1986-07-20

The 3' untranslated (UT) sequences of the genomic RNAs of five geographic variants of the alphavirus Ross River virus (RRV) were determined and compared with the 3' UT sequence of RRV T48, the prototype strain. Part of the 3' UT region of Getah virus, a close serological relative of RRV, was also sequenced. The RRV 3' UT region varies markedly in length between variants. Large deletions or insertions, sequence rearrangements and single nucleotide substitutions are observed. A sequence tract of 49 to 58 nucleotides, which is repeated as four blocks in the RRV T48 3' UT region, occurs only once in the 3' UT region of one RRV strain (NB5092), indicating that the existence of repeat sequence blocks is not essential for RRV replication. However, the precise sequence of the 3' proximal copy of the repeat block and its position relative to the poly(A) tail were identical in all RRV isolates examined, suggesting that it has an important role in RRV replication. Nucleotide substitutions between RRV variants are distributed non-randomly along the length of the 3' UT region. The sequence of 120 to 130 nucleotides adjacent to the poly(A) tail is strongly conserved. Getah virus RNA contains three repeat sequence blocks in the 3' UT region. These are similar in sequence to those in RRV RNA but differ in their arrangement. Homology between the RRV and Getah 3' UT sequences is greatest in the 3' proximal repeat sequence block that shows three differences in 49 nucleotides. The 3' proximal repeat in Getah RNA occurs at the same position, relative to the poly(A) tail, as in all RRV variants. The RRV and Getah virus 3' UT sequences show extensive homology in the region between the 3' proximal repeat and the poly(A) tail but, apart from the repeat blocks themselves, they show no significant homology elsewhere.

Molecular Cloning and Ethylene Induction of mRNA Encoding a Phytoalexin Elicitor-Releasing Factor, beta-1,3-Endoglucanase, in Soybean.

PubMed

Takeuchi, Y; Yoshikawa, M; Takeba, G; Tanaka, K; Shibata, D; Horino, O

1990-06-01

Soybean (Glycine max) beta-1,3-endoglucanase (EC 3.2. 1.39) is involved in one of the earliest plant-pathogen interactions that may lead to active disease resistance by releasing elicitor-active carbohydrates from the cell walls of fungal pathogens. Ethylene induced beta-1,3-endoglucanase activity to 2- to 3-fold higher levels in cotyledons of soybean seedlings. A specific polyclonal antiserum raised against purified soybean beta-1,3-endoglucanase was used to immunoprecipitate in vitro translation products, demonstrating that ethylene induction increased translatable beta-1,3-endoglucanase mRNA. Several cDNA clones for the endoglucanase gene were obtained by antibody screening of a lambda-gt11 expression library prepared from soybean cotyledons. Hybrid-select translation experiments indicated that the cloned cDNA encoded a 36-kilodalton precursor protein product that was specifically immunoprecipitated with beta-1,3-endoglucanase antiserum. Escherichia coli cells expressing the cloned cDNA also synthesized an immunologically positive protein. Nucleotide sequence of three independent clones revealed a single uninterrupted open reading frame of 1041 nucleotides, corresponding to a polypeptide of 347 residue long. The primary amino acid sequence of beta-1,3-endoglucanase as deduced from the nucleotide sequence was confirmed by direct amino acid sequencing of trypsin digests of the glucanase. The soybean beta-1,3-endoglucanase exhibited 53% amino acid homology to a beta-1,3-glucanase cloned from cultured tobacco cells and 48% homology to a beta-(1,3-1,4)-glucanase from barley. Utilizing the largest cloned cDNA (pEG488) as a hybridization probe, it was found that the increase in translatable beta-1,3-endoglucanase mRNA seen upon ethylene treatment of soybean seedlings was due to 50- to 100-fold increase in steady state mRNA levels, indicating that ethylene regulates gene expression of this enzyme important in disease resistance at the level of gene transcription.

ESTs from Seeds to Assist the Selective Breeding of Jatropha curcas L. for Oil and Active Compounds

PubMed Central

Gomes, Kleber A; Almeida, Tiago C; Gesteira, Abelmon S; Lôbo, Ivon P; Guimarães, Ana Carolina R; de Miranda, Antonio B; Van Sluys, Marie-Anne; da Cruz, Rosenira S; Cascardo, Júlio CM; Carels, Nicolas

2010-01-01

We report here on the characterization of a cDNA library from seeds of Jatropha curcas L. at three stages of fruit maturation before yellowing. We sequenced a total of 2200 clones and obtained a set of 931 non-redundant sequences (unigenes) after trimming and quality control, ie, 140 contigs and 791 singlets with PHRED quality ≥10. We found low levels of sequence redundancy and extensive metabolic coverage by homology comparison to GO. After comparison of 5841 non-redundant ESTs from a total of 13193 reads from GenBank with KEGG, we identified tags with nucleotide variations among J. curcas accessions for genes of fatty acid, terpene, alkaloid, quinone and hormone pathways of biosynthesis. More specifically, the expression level of four genes (palmitoyl-acyl carrier protein thioesterase, 3-ketoacyl-CoA thiolase B, lysophosphatidic acid acyltransferase and geranyl pyrophosphate synthase) measured by real-time PCR proved to be significantly different between leaves and fruits. Since the nucleotide polymorphism of these tags is associated to higher level of gene expression in fruits compared to leaves, we propose this approach to speed up the search for quantitative traits in selective breeding of J. curcas. We also discuss its potential utility for the selective breeding of economically important traits in J. curcas. PMID:26217103

Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

PubMed Central

Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

1998-01-01

Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

Mutation of mapped TIA-1/TIAR binding sites in the 3' terminal stem-loop of West Nile virus minus-strand RNA in an infectious clone negatively affects genomic RNA amplification.

PubMed

Emara, Mohamed M; Liu, Hsuan; Davis, William G; Brinton, Margo A

2008-11-01

Previous data showed that the cellular proteins TIA-1 and TIAR bound specifically to the West Nile virus 3' minus-strand stem-loop [WNV3'(-)SL] RNA (37) and colocalized with flavivirus replication complexes in WNV- and dengue virus-infected cells (21). In the present study, the sites on the WNV3'(-)SL RNA required for efficient in vitro T-cell intracellular antigen-related (TIAR) and T-cell intracellular antigen-1 (TIA-1) protein binding were mapped to short AU sequences (UAAUU) located in two internal loops of the WNV3'(-)SL RNA structure. Infectious clone RNAs with all or most of the binding site nucleotides in one of the 3' (-)SL loops deleted or substituted did not produce detectable virus after transfection or subsequent passage. With one exception, deletion/mutation of a single terminal nucleotide in one of the binding sequences had little effect on the efficiency of protein binding or virus production, but mutation of a nucleotide in the middle of a binding sequence reduced both the in vitro protein binding efficiency and virus production. Plaque size, intracellular genomic RNA levels, and virus production progressively decreased with decreasing in vitro TIAR/TIA-1 binding activity, but the translation efficiency of the various mutant RNAs was similar to that of the parental RNA. Several of the mutant RNAs that inefficiently interacted with TIAR/TIA-1 in vitro rapidly reverted in vivo, indicating that they could replicate at a low level and suggesting that an interaction between TIAR/TIA-1 and the viral 3'(-)SL RNA is not required for initial low-level symmetric RNA replication but instead facilitates the subsequent asymmetric amplification of genome RNA from the minus-strand template.

Complete genomic sequence of Powassan virus: evaluation of genetic elements in tick-borne versus mosquito-borne flaviviruses.

PubMed

Mandl, C W; Holzmann, H; Kunz, C; Heinz, F X

1993-05-01

The complete nucleotide sequence of the positive-stranded RNA genome of the tick-borne flavivirus Powassan (10,839 nucleotides) was elucidated and the amino acid sequence of all viral proteins was derived. Based on this sequence as well as serological data, Powassan virus represents the most divergent member of the tick-borne serocomplex within the genus flaviviruses, family Flaviviridae. The primary nucleotide sequence and potential RNA secondary structures of the Powassan virus genome as well as the protein sequences and the reactivities of the virion with a panel of monoclonal antibodies were compared to other tick-borne and mosquito-borne flaviviruses. These analyses corroborated significant differences between tick-borne and mosquito-borne flaviviruses, but also emphasized structural elements that are conserved among both vector groups. The comparisons among tick-borne flaviviruses revealed conserved sequence elements that might represent important determinants of the tick-borne flavivirus phenotype.

Recent patents of nanopore DNA sequencing technology: progress and challenges.

PubMed

Zhou, Jianfeng; Xu, Bingqian

2010-11-01

DNA sequencing techniques witnessed fast development in the last decades, primarily driven by the Human Genome Project. Among the proposed new techniques, Nanopore was considered as a suitable candidate for the single DNA sequencing with ultrahigh speed and very low cost. Several fabrication and modification techniques have been developed to produce robust and well-defined nanopore devices. Many efforts have also been done to apply nanopore to analyze the properties of DNA molecules. By comparing with traditional sequencing techniques, nanopore has demonstrated its distinctive superiorities in main practical issues, such as sample preparation, sequencing speed, cost-effective and read-length. Although challenges still remain, recent researches in improving the capabilities of nanopore have shed a light to achieve its ultimate goal: Sequence individual DNA strand at single nucleotide level. This patent review briefly highlights recent developments and technological achievements for DNA analysis and sequencing at single molecule level, focusing on nanopore based methods.

Detection of a divergent variant of grapevine virus F by next-generation sequencing.

PubMed

Molenaar, Nicholas; Burger, Johan T; Maree, Hans J

2015-08-01

The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).

Automated sequence analysis and editing software for HIV drug resistance testing.

PubMed

Struck, Daniel; Wallis, Carole L; Denisov, Gennady; Lambert, Christine; Servais, Jean-Yves; Viana, Raquel V; Letsoalo, Esrom; Bronze, Michelle; Aitken, Sue C; Schuurman, Rob; Stevens, Wendy; Schmit, Jean Claude; Rinke de Wit, Tobias; Perez Bercoff, Danielle

2012-05-01

Access to antiretroviral treatment in resource-limited-settings is inevitably paralleled by the emergence of HIV drug resistance. Monitoring treatment efficacy and HIV drugs resistance testing are therefore of increasing importance in resource-limited settings. Yet low-cost technologies and procedures suited to the particular context and constraints of such settings are still lacking. The ART-A (Affordable Resistance Testing for Africa) consortium brought together public and private partners to address this issue. To develop an automated sequence analysis and editing software to support high throughput automated sequencing. The ART-A Software was designed to automatically process and edit ABI chromatograms or FASTA files from HIV-1 isolates. The ART-A Software performs the basecalling, assigns quality values, aligns query sequences against a set reference, infers a consensus sequence, identifies the HIV type and subtype, translates the nucleotide sequence to amino acids and reports insertions/deletions, premature stop codons, ambiguities and mixed calls. The results can be automatically exported to Excel to identify mutations. Automated analysis was compared to manual analysis using a panel of 1624 PR-RT sequences generated in 3 different laboratories. Discrepancies between manual and automated sequence analysis were 0.69% at the nucleotide level and 0.57% at the amino acid level (668,047 AA analyzed), and discordances at major resistance mutations were recorded in 62 cases (4.83% of differences, 0.04% of all AA) for PR and 171 (6.18% of differences, 0.03% of all AA) cases for RT. The ART-A Software is a time-sparing tool for pre-analyzing HIV and viral quasispecies sequences in high throughput laboratories and highlighting positions requiring attention. Copyright © 2012 Elsevier B.V. All rights reserved.

Comparing the normalization methods for the differential analysis of Illumina high-throughput RNA-Seq data.

PubMed

Li, Peipei; Piao, Yongjun; Shon, Ho Sun; Ryu, Keun Ho

2015-10-28

Recently, rapid improvements in technology and decrease in sequencing costs have made RNA-Seq a widely used technique to quantify gene expression levels. Various normalization approaches have been proposed, owing to the importance of normalization in the analysis of RNA-Seq data. A comparison of recently proposed normalization methods is required to generate suitable guidelines for the selection of the most appropriate approach for future experiments. In this paper, we compared eight non-abundance (RC, UQ, Med, TMM, DESeq, Q, RPKM, and ERPKM) and two abundance estimation normalization methods (RSEM and Sailfish). The experiments were based on real Illumina high-throughput RNA-Seq of 35- and 76-nucleotide sequences produced in the MAQC project and simulation reads. Reads were mapped with human genome obtained from UCSC Genome Browser Database. For precise evaluation, we investigated Spearman correlation between the normalization results from RNA-Seq and MAQC qRT-PCR values for 996 genes. Based on this work, we showed that out of the eight non-abundance estimation normalization methods, RC, UQ, Med, TMM, DESeq, and Q gave similar normalization results for all data sets. For RNA-Seq of a 35-nucleotide sequence, RPKM showed the highest correlation results, but for RNA-Seq of a 76-nucleotide sequence, least correlation was observed than the other methods. ERPKM did not improve results than RPKM. Between two abundance estimation normalization methods, for RNA-Seq of a 35-nucleotide sequence, higher correlation was obtained with Sailfish than that with RSEM, which was better than without using abundance estimation methods. However, for RNA-Seq of a 76-nucleotide sequence, the results achieved by RSEM were similar to without applying abundance estimation methods, and were much better than with Sailfish. Furthermore, we found that adding a poly-A tail increased alignment numbers, but did not improve normalization results. Spearman correlation analysis revealed that RC, UQ, Med, TMM, DESeq, and Q did not noticeably improve gene expression normalization, regardless of read length. Other normalization methods were more efficient when alignment accuracy was low; Sailfish with RPKM gave the best normalization results. When alignment accuracy was high, RC was sufficient for gene expression calculation. And we suggest ignoring poly-A tail during differential gene expression analysis.

rpoB-Based Identification of Nonpigmented and Late-Pigmenting Rapidly Growing Mycobacteria

PubMed Central

Adékambi, Toïdi; Colson, Philippe; Drancourt, Michel

2003-01-01

Nonpigmented and late-pigmenting rapidly growing mycobacteria (RGM) are increasingly isolated in clinical microbiology laboratories. Their accurate identification remains problematic because classification is labor intensive work and because new taxa are not often incorporated into classification databases. Also, 16S rRNA gene sequence analysis underestimates RGM diversity and does not distinguish between all taxa. We determined the complete nucleotide sequence of the rpoB gene, which encodes the bacterial β subunit of the RNA polymerase, for 20 RGM type strains. After using in-house software which analyzes and graphically represents variability stretches of 60 bp along the nucleotide sequence, our analysis focused on a 723-bp variable region exhibiting 83.9 to 97% interspecies similarity and 0 to 1.7% intraspecific divergence. Primer pair Myco-F-Myco-R was designed as a tool for both PCR amplification and sequencing of this region for molecular identification of RGM. This tool was used for identification of 63 RGM clinical isolates previously identified at the species level on the basis of phenotypic characteristics and by 16S rRNA gene sequence analysis. Of 63 clinical isolates, 59 (94%) exhibited <2% partial rpoB gene sequence divergence from 1 of 20 species under study and were regarded as correctly identified at the species level. Mycobacterium abscessus and Mycobacterium mucogenicum isolates were clearly distinguished from Mycobacterium chelonae; Mycobacterium mageritense isolates were clearly distinguished from “Mycobacterium houstonense.” Four isolates were not identified at the species level because they exhibited >3% partial rpoB gene sequence divergence from the corresponding type strain; they belonged to three taxa related to M. mucogenicum, Mycobacterium smegmatis, and Mycobacterium porcinum. For M. abscessus and M. mucogenicum, this partial sequence yielded a high genetic heterogeneity within the clinical isolates. We conclude that molecular identification by analysis of the 723-bp rpoB sequence is a rapid and accurate tool for identification of RGM. PMID:14662964

Characterization and mapping of cDNA encoding aspartate aminotransferase in rice, Oryza sativa L.

PubMed

Song, J; Yamamoto, K; Shomura, A; Yano, M; Minobe, Y; Sasaki, T

1996-10-31

Fifteen cDNA clones, putatively identified as encoding aspartate aminotransferase (AST, EC 2.6.1.1.), were isolated and partially sequenced. Together with six previously isolated clones putatively identified to encode ASTs (Sasaki, et al. 1994, Plant Journal 6, 615-624), their sequences were characterized and classified into 4 cDNA species. Two of the isolated clones, C60213 and C2079, were full-length cDNAs, and their complete nucleotide sequences were determined. C60213 was 1612 bp long and its deduced amino acid sequence showed 88% homology with that of Panicum miliaceum L. mitochondrial AST. The C60213-encoded protein had an N-terminal amino acid sequence that was characteristic of a mitochondrial transit peptide. On the other hand, C2079 was 1546 bp long and had 91% amino acid sequence homology with P. miliaceum L. cytosolic AST but lacked in the transit peptide sequence. The homologies of nucleotide sequences and deduced amino acid sequences of C2079 and C60213 were 54% and 52%, respectively. C2079 and C60213 were mapped on chromosomes 1 and 6, respectively, by restriction fragment length polymorphism linkage analysis. Northern blot analysis using C2079 as a probe revealed much higher transcript levels in callus and root than in green and etiolated shoots, suggesting tissue-specific variations of AST gene expression.

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lo, A.; Yang, H.L.

1990-02-13

This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

The nucleotide sequences of 5S rRNAs from a fern Dryopteris acuminata and a horsetail Equisetum arvense.

PubMed Central

Hori, H; Osawa, S; Takaiwa, F; Sugiura, M

1984-01-01

The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the Bryophyta species (88% identity on average) than to those of seed plants (84% identity on average). PMID:6538332

Energy efficiency trade-offs drive nucleotide usage in transcribed regions

PubMed Central

Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.

2016-01-01

Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217

Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

PubMed

Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

2011-01-01

In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

Information Entropy of Influenza A Segment 7

NASA Astrophysics Data System (ADS)

Thompson, William A.; Fan, Shaohua; Weltman, Joel K.

2008-12-01

Information entropy (H) is a measure of uncertainty at each position within in a sequence of nucleotides.H was used to characterize a set of influenza A segment 7 nucleotide sequences. Nucleotide locations of high entropy were identified near the 5’ start of all of the sequences and the sequences were assigned to subsets according to synonymous nucleotide variants at those positions: either uracil at position six (U6), cytosine at position six (C6), adenine (A12) at position 12, guanine at position 12 (G12), adenine at position 15 (A15) or cytosine (C15) at position 15. H values were found to be correlated/corresponding (Kendall tau) along the lengths of the nucleotide segments of the subset pairs at each position. However, the H values of each subset of sequences were statistically distinguishable from those of the other member of the pair (Kolmogorov-Smirnov test). The joint probability of uncorrelated distributions of U6 and C6 sequences to viral subtypes and to viral host species was 34 times greater than for the A12:G12 subset pair and 214 times greater than for the A15:C15 pair. This result indicates that the high entropy position six of segment 7 is either a reporter or a sentinel location. The fact that not one of the H5N1 sequences in the dataset was a member of the C6 subset, but all 125 H5N1 sequences are members of the U6 subset suggests a non-random sentinel function.

Choice of Reference Sequence and Assembler for Alignment of Listeria monocytogenes Short-Read Sequence Data Greatly Influences Rates of Error in SNP Analyses

PubMed Central

Pightling, Arthur W.; Petronella, Nicholas; Pagotto, Franco

2014-01-01

The wide availability of whole-genome sequencing (WGS) and an abundance of open-source software have made detection of single-nucleotide polymorphisms (SNPs) in bacterial genomes an increasingly accessible and effective tool for comparative analyses. Thus, ensuring that real nucleotide differences between genomes (i.e., true SNPs) are detected at high rates and that the influences of errors (such as false positive SNPs, ambiguously called sites, and gaps) are mitigated is of utmost importance. The choices researchers make regarding the generation and analysis of WGS data can greatly influence the accuracy of short-read sequence alignments and, therefore, the efficacy of such experiments. We studied the effects of some of these choices, including: i) depth of sequencing coverage, ii) choice of reference-guided short-read sequence assembler, iii) choice of reference genome, and iv) whether to perform read-quality filtering and trimming, on our ability to detect true SNPs and on the frequencies of errors. We performed benchmarking experiments, during which we assembled simulated and real Listeria monocytogenes strain 08-5578 short-read sequence datasets of varying quality with four commonly used assemblers (BWA, MOSAIK, Novoalign, and SMALT), using reference genomes of varying genetic distances, and with or without read pre-processing (i.e., quality filtering and trimming). We found that assemblies of at least 50-fold coverage provided the most accurate results. In addition, MOSAIK yielded the fewest errors when reads were aligned to a nearly identical reference genome, while using SMALT to align reads against a reference sequence that is ∼0.82% distant from 08-5578 at the nucleotide level resulted in the detection of the greatest numbers of true SNPs and the fewest errors. Finally, we show that whether read pre-processing improves SNP detection depends upon the choice of reference sequence and assembler. In total, this study demonstrates that researchers should test a variety of conditions to achieve optimal results. PMID:25144537

Organization of nif gene cluster in Frankia sp. EuIK1 strain, a symbiont of Elaeagnus umbellata.

PubMed

Oh, Chang Jae; Kim, Ho Bang; Kim, Jitae; Kim, Won Jin; Lee, Hyoungseok; An, Chung Sun

2012-01-01

The nucleotide sequence of a 20.5-kb genomic region harboring nif genes was determined and analyzed. The fragment was obtained from Frankia sp. EuIK1 strain, an indigenous symbiont of Elaeagnus umbellata. A total of 20 ORFs including 12 nif genes were identified and subjected to comparative analysis with the genome sequences of 3 Frankia strains representing diverse host plant specificities. The nucleotide and deduced amino acid sequences showed highest levels of identity with orthologous genes from an Elaeagnus-infecting strain. The gene organization patterns around the nif gene clusters were well conserved among all 4 Frankia strains. However, characteristic features appeared in the location of the nifV gene for each Frankia strain, depending on the type of host plant. Sequence analysis was performed to determine the transcription units and suggested that there could be an independent operon starting from the nifW gene in the EuIK strain. Considering the organization patterns and their total extensions on the genome, we propose that the nif gene clusters remained stable despite genetic variations occurring in the Frankia genomes.

Complete genome sequence of a novel Plum pox virus strain W isolate determined by 454 pyrosequencing.

PubMed

Sheveleva, Anna; Kudryavtseva, Anna; Speranskaya, Anna; Belenikin, Maxim; Melnikova, Natalia; Chirkov, Sergei

2013-10-01

The near-complete (99.7 %) genome sequence of a novel Russian Plum pox virus (PPV) isolate Pk, belonging to the strain Winona (W), has been determined by 454 pyrosequencing with the exception of the thirty-one 5'-terminal nucleotides. This region was amplified using 5'RACE kit and sequenced by the Sanger method. Genomic RNA released from immunocaptured PPV particles was employed for generation of cDNA library using TransPlex Whole transcriptome amplification kit (WTA2, Sigma-Aldrich). The entire Pk genome has identity level of 92.8-94.5 % when compared to the complete nucleotide sequences of other PPV-W isolates (W3174, LV-141pl, LV-145bt, and UKR 44189), confirming a high degree of variability within the PPV-W strain. The isolates Pk and LV-141pl are most closely related. The Pk has been found in a wild plum (Prunus domestica) in a new region of Russia indicating widespread dissemination of the PPV-W strain in the European part of the former USSR.

Molecular detection and characterization of Theileria species in the Philippines.

PubMed

Belotindos, Lawrence P; Lazaro, Jonathan V; Villanueva, Marvin A; Mingala, Claro N

2014-09-01

Theileriosis is a tick-borne disease of domestic and wild animals that cause devastating economic loss in livestock in tropical and subtropical regions. Theileriosis is not yet documented in the Philippines as compared to babesiosis and anaplasmosis which are considered major tick-borne diseases that infect livestock in the country and contribute major losses to the livestock industry. The study was aimed to detect Theileria sp. at genus level in blood samples of cattle using polymerase chain reaction (PCR) assay. Specifically, it determined the phylogenetic relationship of Theileria species affecting cattle in the Philippines to other Theileria sp. registered in the GenBank. A total of 292 blood samples of cattle that were collected from various provinces were used. Theileria sp. was detected in 43/292 from the cattle blood samples using PCR assay targeting the major piroplasm surface protein (MPSP) gene. DNA sequence showed high similarity (90-99%) among the reported Theileria sp. isolates in the GenBank and the Philippine isolates of Theileria. Phylogenetic tree construction using nucleotide sequence classified the Philippine isolates of Theileria as benign. However, nucleotide polymorphism was observed in the new isolate based on nucleotide sequence alignment. It revealed that the new isolate can be a new species of Theileria.

Single-Molecule Counting of Point Mutations by Transient DNA Binding

NASA Astrophysics Data System (ADS)

Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

2017-03-01

High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

Mitochondrial genome sequence of the Tibetan wild ass (Equus kiang).

PubMed

Luo, Yongjun; Chen, Yu; Liu, Fuyu; Jiang, Chunhua; Gao, Yuqi

2011-02-01

The Tibetan wild ass, or kiang (Equus kiang) is endemic to the cold and hypoxic (4000-7000 m above sea level) climates of the montane and alpine grasslands of the Tibetan Plateau. We report here the complete nucleotide sequence of the E. kiang mitochondrial genome. Our results show that E. kiang mitochondrial DNA is 16,634 bp long, and predicted to encode all the 37 genes that are typical for vertebrates.

Engineering disease resistance with pectate lyase-like genes

DOEpatents

Vogel, John; Somerville, Shauna

2005-03-08

A mutant gene coding for pectate lyase and homologs thereof is provided, which when incorporated in transgenic plants effect an increased level disease resistance in such plants. Also is provided the polypeptide sequence for the pectate lyase of the present invention. Methods of obtaining the mutant gene, producing transgenic plants which include the nucleotide sequence for the mutant gene and producing improved disease resistance in a crop of such transgenic plants are also provided.

Comparative sequence analyses of sixteen reptilian paramyxoviruses

USGS Publications Warehouse

Ahne, W.; Batts, W.N.; Kurath, G.; Winton, J.R.

1999-01-01

Viral genomic RNA of Fer-de-Lance virus (FDLV), a paramyxovirus highly pathogenic for reptiles, was reverse transcribed and cloned. Plasmids with significant sequence similarities to the hemagglutinin-neuraminidase (HN) and polymerase (L) genes of mammalian paramyxoviruses were identified by BLAST search. Partial sequences of the FDLV genes were used to design primers for amplification by nested polymerase chain reaction (PCR) and sequencing of 518-bp L gene and 352-bp HN gene fragments from a collection of 15 previously uncharacterized reptilian paramyxoviruses. Phylogenetic analyses of the partial L and HN sequences produced similar trees in which there were two distinct subgroups of isolates that were supported with maximum bootstrap values, and several intermediate isolates. Within each subgroup the nucleotide divergence values were less than 2.5%, while the divergence between the two subgroups was 20-22%. This indicated that the two subgroups represent distinct virus species containing multiple virus strains. The five intermediate isolates had nucleotide divergence values of 11-20% and may represent additional distinct species. In addition to establishing diversity among reptilian paramyxoviruses, the phylogenetic groupings showed some correlation with geographic location, and clearly demonstrated a low level of host species-specificity within these viruses. Copyright (C) 1999 Elsevier Science B.V.

Droplet-based pyrosequencing using digital microfluidics.

PubMed

Boles, Deborah J; Benton, Jonathan L; Siew, Germaine J; Levy, Miriam H; Thwar, Prasanna K; Sandahl, Melissa A; Rouse, Jeremy L; Perkins, Lisa C; Sudarsan, Arjun P; Jalili, Roxana; Pamula, Vamsee K; Srinivasan, Vijay; Fair, Richard B; Griffin, Peter B; Eckhardt, Allen E; Pollack, Michael G

2011-11-15

The feasibility of implementing pyrosequencing chemistry within droplets using electrowetting-based digital microfluidics is reported. An array of electrodes patterned on a printed-circuit board was used to control the formation, transportation, merging, mixing, and splitting of submicroliter-sized droplets contained within an oil-filled chamber. A three-enzyme pyrosequencing protocol was implemented in which individual droplets contained enzymes, deoxyribonucleotide triphosphates (dNTPs), and DNA templates. The DNA templates were anchored to magnetic beads which enabled them to be thoroughly washed between nucleotide additions. Reagents and protocols were optimized to maximize signal over background, linearity of response, cycle efficiency, and wash efficiency. As an initial demonstration of feasibility, a portion of a 229 bp Candida parapsilosis template was sequenced using both a de novo protocol and a resequencing protocol. The resequencing protocol generated over 60 bp of sequence with 100% sequence accuracy based on raw pyrogram levels. Excellent linearity was observed for all of the homopolymers (two, three, or four nucleotides) contained in the C. parapsilosis sequence. With improvements in microfluidic design it is expected that longer reads, higher throughput, and improved process integration (i.e., "sample-to-sequence" capability) could eventually be achieved using this low-cost platform.

Plants transformed with a tobacco mosaic virus nonstructural gene sequence are resistant to the virus.

PubMed Central

Golemboski, D B; Lomonossoff, G P; Zaitlin, M

1990-01-01

Nicotiana tabacum cv. Xanthi nn plants were transformed with nucleotides 3472-4916 of tobacco mosaic virus (TMV) strain U1. This sequence contains all but the three 3 terminal nucleotides of the TMV 54-kDa gene, which encodes a putative component of the replicase complex. These plants were resistant to infection when challenged with either TMV U1 virions or TMV U1 RNA at concentrations of up to 500 micrograms/ml or 300 micrograms/ml, respectively, the highest concentrations tested. Resistance was also exhibited when plants were inoculated at 100 micrograms/ml with the closely related TMV mutant YSI/1 but was not shown in plants challenged at the same concentrations with the more distantly related TMV strains U2 or L or cucumber mosaic virus. Although the copy number of the 54-kDa gene sequence varied in individual transformants from 1 to approximately 5, the level of resistance in plants was not dependent on the number of copies of the 54-kDa gene sequence integrated. The transformed plants accumulated a 54-kDa gene sequence-specific RNA transcript of the expected size, but no protein product was detected. Images PMID:2385595

PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES

PubMed Central

Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.

2008-01-01

Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195

The complete sequence of Cymbidium mosaic virus from Vanilla fragrans in Hainan, China.

PubMed

He, Zhen; Jiang, Dongmei; Liu, Aiqin; Sang, Liwei; Li, Wenfeng; Li, Shifang

2011-06-01

The complete nucleotide sequence of Cymbidium mosaic virus (CymMV) isolated from vanilla in Hainan province, China was determined for the first time. It comprised 6,224 nucleotides; sequence analysis suggested that the isolate we obtained was a member of the genus Potexvirus, and its sequence shared 86.67-96.61% identities with previously reported sequences. Phylogenetic analysis suggested that CymMV from vanilla fragrans was clustered into subgroup A and the isolates in this subgroup displayed little regional difference.

Hepatitis delta genotypes in chronic delta infection in the northeast of Spain (Catalonia).

PubMed

Cotrina, M; Buti, M; Jardi, R; Quer, J; Rodriguez, F; Pascual, C; Esteban, R; Guardia, J

1998-06-01

Based on genetic analysis of variants obtained around the world, three genotypes of the hepatitis delta virus have been defined. Hepatitis delta virus variants have been associated with different disease patterns and geographic distributions. To determine the prevalence of hepatitis delta virus genotypes in the northeast of Spain (Catalonia) and the correlation with transmission routes and clinical disease, we studied the nucleotide divergence of the consensus sequence of HDV RNA obtained from 33 patients with chronic delta hepatitis (24 were intravenous drug users and nine had no risk factors), and four patients with acute self-limited delta infection. Serum HDV RNA was amplified by the polymerase chain reaction technique and a fragment of 350 nucleotides (nt 910 to 1259) was directly sequenced. Genetic analysis of the nucleotide consensus sequence obtained showed a high degree of conservation among sequences (93% of mean). Comparison of these sequences with those derived from different geographic areas and pertaining to genotypes I, II and III, showed a mean sequence identity of 92% with genotype I, 73% with genotype II and 61% with genotype III. At the amino acid level (aa 115 to 214), the mean identity was 87% with genotype I, 63% with genotype II and 56% with genotype III. Conserved regions included the RNA editing domain, the carboxyl terminal 19 amino acids of the hepatitis delta antigen and the polyadenylation signal of the viral mRNA. Hepatitis delta virus isolates in the northeast of Spain are exclusively genotype I, independently of the transmission route and the type of infection. No hepatitis delta virus subgenotypes were found, suggesting that the origin of hepatitis delta virus infection in our geographical area is homogeneous.

Human papillomavirus type 18 variant lineages in United States populations characterized by sequence analysis of LCR-E6, E2, and L1 regions.

PubMed

Arias-Pulido, Hugo; Peyton, Cheri L; Torrez-Martínez, Norah; Anderson, D Nelson; Wheeler, Cosette M

2005-07-20

While HPV 16 variant lineages have been well characterized, the knowledge about HPV 18 variants is limited. In this study, HPV 18 nucleotide variations in the E2 hinge region were characterized by sequence analysis in 47 control and 51 tumor specimens. Fifty of these specimens were randomly selected for sequencing of an LCR-E6 segment and 20 samples representative of LCR-E6 and E2 sequence variants were examined across the L1 region. A total of 2770 nucleotides per HPV 18 variant genome were considered in this study. HPV 18 variant nucleotides were linked among all gene segments analyzed and grouped into three main branches: Asian-American (AA), European (E), and African (Af). These three branches were equally distributed among controls and cases and when stratified by Hispanic and non-Hispanic ethnicities. Among invasive cervical cancer cases, no significant differences in the three HPV variant branches were observed among ethnic groups or when stratified by histopathology (squamous vs. adenocarcinoma). The Af branch showed the greatest nucleotide variability when compared to the HPV 18 reference sequence and was more closely related to HPV 45 than either AA or E branches. Our data also characterize nucleotide and amino acid variations in the L1 capsid gene among HPV 18 variants, which may be relevant to vaccine strategies and subsequent studies of naturally occurring HPV 18 variants. Several novel HPV 18 nucleotide variations were identified in this study.

The repeating nucleotide sequence in the repetitive mitochondrial DNA from a "low-density" petite mutant of yeast.

PubMed Central

Van Kreijl, C F; Bos, J L

1977-01-01

The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740

Geographically Distinct and Domain-Specific Sequence Variations in the Alleles of Rice Blast Resistance Gene Pib

PubMed Central

Vasudevan, Kumar; Vera Cruz, Casiana M.; Gruissem, Wilhelm; Bhullar, Navreet K.

2016-01-01

Rice blast is caused by Magnaporthe oryzae, which is the most destructive fungal pathogen affecting rice growing regions worldwide. The rice blast resistance gene Pib confers broad-spectrum resistance against Southeast Asian M. oryzae races. We investigated the allelic diversity of Pib in rice germplasm originating from 12 major rice growing countries. Twenty-five new Pib alleles were identified that have unique single nucleotide polymorphisms (SNPs), insertions and/or deletions, in addition to the polymorphic nucleotides that are shared between the different alleles. These partially or completely shared polymorphic nucleotides indicate frequent sequence exchange events between the Pib alleles. In some of the new Pib alleles, nucleotide diversity is high in the LRR domain, whereas, in others it is distributed among the NB-ARC and LRR domains. Most of the polymorphic amino acids in LRR and NB-ARC2 domains are predicted as solvent-exposed. Several of the alleles and the unique SNPs are country specific, suggesting a diversifying selection of alleles in various geographical locations in response to the locally prevalent M. oryzae population. Together, the new Pib alleles are an important genetic resource for rice blast resistance breeding programs and provide new information on rice-M. oryzae interactions at the molecular level. PMID:27446145

Campylobacter jejuni chromosomal sequences that hybridize to Vibrio cholerae and Escherichia coli LT enterotoxin genes.

PubMed

Calva, E; Torres, J; Vázquez, M; Angeles, V; de la Vega, H; Ruíz-Palacios, G M

1989-02-20

Campylobacter jejuni is one of the main etiologic agents of gastrointestinal illness in developing and developed areas throughout the world. Isolation of enterotoxin-producing C. jejuni has been associated with clinical symptoms of a watery-secretory type of diarrhea. Although physiological and immunological relatedness has been demonstrated between the C. jejuni enterotoxin (CJT), the Vibrio cholerae enterotoxin (CT), and the heat-labile cholera-like Escherichia coli enterotoxin (LT), nucleotide sequence similarity between C. jejuni DNA and either the toxA, toxB, eltA or eltB genes remained to be shown. We found that binding to ganglioside GM1 prevented recognition of CJT by monoclonal antibodies directed to either CT or LT. This indicates antigenic similarity between the three enterotoxins in the ganglioside GM1-binding site. Therefore we searched for corresponding similarities at the DNA level and found, by oligodeoxynucleotide hybridization, C. jejuni chromosomal nucleotide sequences similar to the coding region for a postulated ganglioside GM1-binding site on toxB and eltB.

Mitochondrial genome of the bullet tuna Auxis rochei from Indo-West Pacific collection provides novel genetic information about two subspecies.

PubMed

Li, Mingming; Guo, Liang; Zhang, Heng; Yang, Sen; Chen, Xinghan; Lin, Haoran; Meng, Zining

2016-09-01

Previously morphological studies supported the division of the bullet tuna into the two subspecies, Auxis rochei rochei and A. rochei eudorax. As a cosmopolitan species, A. rochei rochei ranges in the Indo-West Pacific and Atlantic oceans, while A. rochei eudorax inhabits in eastern Pacific region. Here, we used the HiSeq next-generation sequencing technique to determine the mitochondrial genome (mitogenome) of A. rochei from Indo-West Pacific collection, and then compared our data with mitogenomic sequences of the Atlantic and eastern Pacific retrieved from NCBI database. Results showed the mitogenome of A. rochei from three geographic collections shared the same genes and gene order, similar to typical teleosts. Also, we examined a low level of nucleotide diversity among these mitogenomic sequences. Interestingly, nucleotide diversity of intra-subspecies (Atlantic versus Indo-West) was higher than that of inter-subspecies (Atlantic versus eastern Pacific, Indo-West versus eastern Pacific).

Mitochondrial DNA sequence variation and phylogeography of the scarlet kingsnake (Lampropeltis elapsoides).

PubMed

Friedman, Michael; Schaffer, Les

2011-02-01

BACKGROUND AND AIMS. With the goal of assessing population structure and geographic distribution of haplotype lineages among Lampropeltis elapsoides, we sequenced the ND4 mitochondrial DNA locus from 96 specimens of this snake across its area of distribution. MATERIALS AND METHODS. We relied heavily on formalin-fixed museum specimens to accomplish this analysis. RESULTS. The sequence alignment consisted of 491 bp of the selected gene, with 28% missing data. A simulation used to assess the effect of missing data on population genetic and phylogenetic resolution indicated increased character conflict, but with minimal loss of phylogenetic structure. CONCLUSION. This limited dataset suggests that L. elapsoides constitutes a largely unstructured population, with both widespread haplotypes and large number of private haplotypes, a moderate level of nucleotide diversity, and a low, but significant, degree of north-south population differentiation. Haplotype structure and frequency, nucleotide frequency, and values for Tajima's D and Fu's F(S) indicate a recent range or population expansion following a historic bottleneck.

Typing and comparative genome analysis of Brucella melitensis isolated from Lebanon.

PubMed

Abou Zaki, Natalia; Salloum, Tamara; Osman, Marwan; Rafei, Rayane; Hamze, Monzer; Tokajian, Sima

2017-10-16

Brucella melitensis is the main causative agent of the zoonotic disease brucellosis. This study aimed at typing and characterizing genetic variation in 33 Brucella isolates recovered from patients in Lebanon. Bruce-ladder multiplex PCR and PCR-RFLP of omp31, omp2a and omp2b were performed. Sixteen representative isolates were chosen for draft-genome sequencing and analyzed to determine variations in virulence, resistance, genomic islands, prophages and insertion sequences. Comparative whole-genome single nucleotide polymorphism analysis was also performed. The isolates were confirmed to be B. melitensis. Genome analysis revealed multiple virulence determinants and efflux pumps. Genome comparisons and single nucleotide polymorphisms divided the isolates based on geographical distribution but revealed high levels of similarity between the strains. Sequence divergence in B. melitensis was mainly due to lateral gene transfer of mobile elements. This is the first report of an in-depth genomic characterization of B. melitensis in Lebanon. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Role of promoter DNA sequence variations on the binding of EGR1 transcription factor.

PubMed

Mikles, David C; Schuchardt, Brett J; Bhat, Vikas; McDonald, Caleb B; Farooq, Amjad

2014-05-01

In response to a wide variety of stimuli such as growth factors and hormones, EGR1 transcription factor is rapidly induced and immediately exerts downstream effects central to the maintenance of cellular homeostasis. Herein, our biophysical analysis reveals that DNA sequence variations within the target gene promoters tightly modulate the energetics of binding of EGR1 and that nucleotide substitutions at certain positions are much more detrimental to EGR1-DNA interaction than others. Importantly, the reduction in binding affinity poorly correlates with the loss of enthalpy and gain of entropy-a trend indicative of a complex interplay between underlying thermodynamic factors due to the differential role of water solvent upon nucleotide substitution. We also provide a rationale for the physical basis of the effect of nucleotide substitutions on the EGR1-DNA interaction at atomic level. Taken together, our study bears important implications on understanding the molecular determinants of a key protein-DNA interaction at the cross-roads of human health and disease. Copyright © 2014 Elsevier Inc. All rights reserved.

Simian hepatitis A virus derived from a captive rhesus monkey in India is similar to the strain isolated from wild African green monkeys in Kenya.

PubMed

Arankalle, V A; Ramakrishnan, J

2009-03-01

A simian hepatitis A virus (HAV) was identified retrospectively in a faecal sample from a rhesus monkey in India, inoculated in 1995 with a faecal suspension from a suspected patient of non-A to E hepatitis. The monkey was in captivity for 2 years in one of the experimental primate facilities in western India before being moved to the National Institute of Virology, Pune for experimentation. Phylogenetic analysis based on a partial sequence of the 5' noncoding region placed this virus in genotype V, the only other member being the AGM-27 strain recovered in 1986 from African green monkeys in Kenya. The source of infection of the monkey remains unclear. The full genome was amplified in nine fragments and sequenced. The genome of the Indian simian HAV (IND-SHAV) is 7425 nucleotides long including the poly-A tail of 14 nucleotides at the 3' end. At the nucleotide and amino acid levels, IND-SHAV was 99.8 and 100% identical with AGM27, respectively.

37 CFR 1.824 - Form and format for nucleotide and/or amino acid sequence submissions in computer readable form.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Form and format for... And/or Amino Acid Sequences § 1.824 Form and format for nucleotide and/or amino acid sequence... Code for Information Interchange (ASCII) text. No other formats shall be allowed. (3) The computer...

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus.

PubMed Central

Gustafson, G; Armour, S L

1986-01-01

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus (BSMV) has been determined. The sequence is 3289 nucleotides in length and contains four open reading frames (ORFs) which code for proteins of Mr 22,147 (ORF1), Mr 58,098 (ORF2), Mr 17,378 (ORF3), and Mr 14,119 (ORF4). The predicted N-terminal amino acid sequence of the polypeptide encoded by the ORF nearest the 5'-end of the RNA (ORF1) is identical (after the initiator methionine) to the published N-terminal amino acid sequence of BSMV coat protein for 29 of the first 30 amino acids. ORF2 occupies the central portion of the coding region of RNA beta and ORF3 is located at the 3'-end. The ORF4 sequence overlaps the 3'-region of ORF2 and the 5'-region of ORF3 and differs in codon usage from the other three RNA beta ORFs. The coding region of RNA beta is followed by a poly(A) tract and a 238 nucleotide tRNA-like structure which are common to all three BSMV genomic RNAs. Images PMID:3754962

Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms.

PubMed

Zhang, Wei; Qi, Weihong; Albert, Thomas J; Motiwala, Alifiya S; Alland, David; Hyytia-Trees, Eija K; Ribot, Efrain M; Fields, Patricia I; Whittam, Thomas S; Swaminathan, Bala

2006-06-01

Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7x10(-9) per site per year), we estimate that the most recent common ancestor of the contemporary beta-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens.

Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms

PubMed Central

Zhang, Wei; Qi, Weihong; Albert, Thomas J.; Motiwala, Alifiya S.; Alland, David; Hyytia-Trees, Eija K.; Ribot, Efrain M.; Fields, Patricia I.; Whittam, Thomas S.; Swaminathan, Bala

2006-01-01

Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7 × 10−9 per site per year), we estimate that the most recent common ancestor of the contemporary β-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens. PMID:16606700

A population study of the minicircles in Trypanosoma cruzi: predicting guide RNAs in the absence of empirical RNA editing.

PubMed

Thomas, Sean; Martinez, L L Isadora Trejo; Westenberger, Scott J; Sturm, Nancy R

2007-05-24

The structurally complex network of minicircles and maxicircles comprising the mitochondrial DNA of kinetoplastids mirrors the complexity of the RNA editing process that is required for faithful expression of encrypted maxicircle genes. Although a few of the guide RNAs that direct this editing process have been discovered on maxicircles, guide RNAs are mostly found on the minicircles. The nuclear and maxicircle genomes have been sequenced and assembled for Trypanosoma cruzi, the causative agent of Chagas disease, however the complement of 1.4-kb minicircles, carrying four guide RNA genes per molecule in this parasite, has been less thoroughly characterised. Fifty-four CL Brener and 53 Esmeraldo strain minicircle sequence reads were extracted from T. cruzi whole genome shotgun sequencing data. With these sequences and all published T. cruzi minicircle sequences, 108 unique guide RNAs from all known T. cruzi minicircle sequences and two guide RNAs from the CL Brener maxicircle were predicted using a local alignment algorithm and mapped onto predicted or experimentally determined sequences of edited maxicircle open reading frames. For half of the sequences no statistically significant guide RNA could be assigned. Likely positions of these unidentified gRNAs in T. cruzi minicircle sequences are estimated using a simple Hidden Markov Model. With the local alignment predictions as a standard, the HMM had an ~85% chance of correctly identifying at least 20 nucleotides of guide RNA from a given minicircle sequence. Inter-minicircle recombination was documented. Variable regions contain species-specific areas of distinct nucleotide preference. Two maxicircle guide RNA genes were found. The identification of new minicircle sequences and the further characterization of all published minicircles are presented, including the first observation of recombination between minicircles. Extrapolation suggests a level of 4% recombinants in the population, supporting a relatively high recombination rate that may serve to minimize the persistence of gRNA pseudogenes. Characteristic nucleotide preferences observed within variable regions provide potential clues regarding the transcription and maturation of T. cruzi guide RNAs. Based on these preferences, a method of predicting T. cruzi guide RNAs using only primary minicircle sequence data was created.

Phylogeographic reconstruction of a bacterial species with high levels of lateral gene transfer

USGS Publications Warehouse

Pearson, T.; Giffard, P.; Beckstrom-Sternberg, S.; Auerbach, R.; Hornstra, H.; Tuanyok, A.; Price, E.P.; Glass, M.B.; Leadem, B.; Beckstrom-Sternberg, J. S.; Allan, G.J.; Foster, J.T.; Wagner, D.M.; Okinaka, R.T.; Sim, S.H.; Pearson, O.; Wu, Z.; Chang, J.; Kaul, R.; Hoffmaster, A.R.; Brettin, T.S.; Robison, R.A.; Mayo, M.; Gee, J.E.; Tan, P.; Currie, B.J.; Keim, P.

2009-01-01

Background: Phylogeographic reconstruction of some bacterial populations is hindered by low diversity coupled with high levels of lateral gene transfer. A comparison of recombination levels and diversity at seven housekeeping genes for eleven bacterial species, most of which are commonly cited as having high levels of lateral gene transfer shows that the relative contributions of homologous recombination versus mutation for Burkholderia pseudomallei is over two times higher than for Streptococcus pneumoniae and is thus the highest value yet reported in bacteria. Despite the potential for homologous recombination to increase diversity, B. pseudomallei exhibits a relative lack of diversity at these loci. In these situations, whole genome genotyping of orthologous shared single nucleotide polymorphism loci, discovered using next generation sequencing technologies, can provide very large data sets capable of estimating core phylogenetic relationships. We compared and searched 43 whole genome sequences of B. pseudomallei and its closest relatives for single nucleotide polymorphisms in orthologous shared regions to use in phylogenetic reconstruction. Results: Bayesian phylogenetic analyses of >14,000 single nucleotide polymorphisms yielded completely resolved trees for these 43 strains with high levels of statistical support. These results enable a better understanding of a separate analysis of population differentiation among >1,700 B. pseudomallei isolates as defined by sequence data from seven housekeeping genes. We analyzed this larger data set for population structure and allele sharing that can be attributed to lateral gene transfer. Our results suggest that despite an almost panmictic population, we can detect two distinct populations of B. pseudomallei that conform to biogeographic patterns found in many plant and animal species. That is, separation along Wallace's Line, a biogeographic boundary between Southeast Asia and Australia. Conclusion: We describe an Australian origin for B. pseudomallei, characterized by a single introduction event into Southeast Asia during a recent glacial period, and variable levels of lateral gene transfer within populations. These patterns provide insights into mechanisms of genetic diversification in B. pseudomallei and its closest relatives, and provide a framework for integrating the traditionally separate fields of population genetics and phylogenetics for other bacterial species with high levels of lateral gene transfer. ?? 2009 Pearson et al; licensee BioMed Central Ltd.

Molecular characterization of the vitamin D receptor (VDR) gene in Holstein cows.

PubMed

Ali, Mayar O; El-Adl, Mohamed A; Ibrahim, Hussam M M; Elseedy, Youssef Y; Rizk, Mohamed A; El-Khodery, Sabry A

2018-06-01

Vitamin D plays a vital role in calcium homeostasis, growth, and immunoregulation. Because little is known about the vitamin D receptor (VDR) gene in cattle, the aim of the present investigation was to present the molecular characterization of exons 5 and 6 of the VDR gene in Holstein cows. DNA extraction, genomic sequencing, phylogenetic analysis, synteny mapping and single nucleotide gene polymorphism analysis of the VDR gene were performed to assess blood samples collected from 50 clinically healthy Holstein cows. The results revealed the presence of a 450-base pair (bp) nucleotide sequence that resembled exons 5 and 6 with intron 5 enclosed between these exons. Sequence alignment and phylogenetic analysis revealed a close relationship between the sequenced VDR region and that found in Hereford cattle. A close association between this region and the corresponding region in small ruminants was also documented. Moreover, a single nucleotide polymorphism (SNP) that caused the replacement of a glutamate with an arginine in the deduced amino acid sequence was detected at position 7 of exon 5. In conclusion, Holstein and Hereford cattle differ with respect to exon 5 of the VDR gene. Phylogenetic analysis of the VDR gene based on nucleotide sequence produced different results from prior analyses based on amino acid sequence. Copyright © 2018 Elsevier Ltd. All rights reserved.

Complete genome sequence of a Chinese isolate of pepper vein yellows virus and evolutionary analysis based on the CP, MP and RdRp coding regions.

PubMed

Liu, Maoyan; Liu, Xiangning; Li, Xun; Zhang, Deyong; Dai, Liangyin; Tang, Qianjun

2016-03-01

The genome sequence of pepper vein yellows virus (PeVYV) (PeVYV-HN, accession number KP326573), isolated from pepper plants (Capsicum annuum L.) grown at the Hunan Vegetables Institute (Changsha, Hunan, China), was determined by deep sequencing of small RNAs. The PeVYV-HN genome consists of 6244 nucleotides, contains six open reading frames (ORFs), and is similar to that of an isolate (AB594828) from Japan. Its genomic organization is similar to that of members of the genus Polerovirus. Sequence analysis revealed that PeVYV-HN shared 92% sequence identity with the Japanese PeVYV genome at both the nucleotide and amino acid levels. Evolutionary analysis based on the coat protein (CP), movement protein (MP), and RNA-dependent RNA polymerase (RdRP) showed that PeVYV could be divided into two major lineages corresponding to their geographical origins. The Asian isolates have a higher population expansion frequency than the African isolates. Negative selection and genetic drift (founder effect) were found to be the potential drivers of the molecular evolution of PeVYV. Moreover, recombination was not the distinct cause of PeVYV evolution. This is the first report of a complete genomic sequence of PeVYV in China.

The CD8α gene in duck (Anatidae): cloning, characterization, and expression during viral infection.

PubMed

Xu, Qi; Chen, Yang; Zhao, Wen Ming; Huang, Zheng Yang; Duan, Xiu Jun; Tong, Yi Yu; Zhang, Yang; Li, Xiu; Chang, Guo Bin; Chen, Guo Hong

2015-02-01

Cluster of differentiation 8 alpha (CD8α) is critical for cell-mediated immune defense and T-cell development. Although CD8α sequences have been reported for several species, very little is known about CD8α in ducks. To elucidate the mechanisms involved in the innate and adaptive immune responses of ducks, we cloned CD8α coding sequences from domestic, Muscovy, Mallard, and Spotbill ducks using reverse transcription polymerase chain reaction (RT-PCR). Each sequence consisted of 714 nucleotides and encoded a signal peptide, an IgV-like domain, a stalk region, a transmembrane region, and a cytoplasmic tail. We identified 58 nucleotide differences and 37 amino acid differences among the four types of duck; of these, 53 nucleotide and 33 amino acid differences were between Muscovy ducks and the other duck species. The CD8α cDNA sequence from domestic duck consisted of a 61-nucleotide 5' untranslated region (UTR), a 714-nucleotide open reading frame, and an 849-nucleotide 3' UTR. Multiple sequence alignments showed that the amino acid sequence of CD8α is conserved in vertebrates. RT-PCR revealed that expression of CD8α mRNA of domestic ducks was highest in the thymus and very low in the kidney, cerebrum, cerebellum, and muscle. Immunohistochemical analyses detected CD8α on the splenic corpuscle and periarterial lymphatic sheath of the spleen. CD8α mRNA in domestic ducklings was initially up-regulated, and then down-regulated, in the thymus, spleen, and liver after treatment with duck hepatitis virus type I (DHV-1) or the immunostimulant polyriboinosinic polyribocytidylic acid (poly I:C).

The annotation-enriched non-redundant patent sequence databases.

PubMed

Li, Weizhong; Kondratowicz, Bartosz; McWilliam, Hamish; Nauche, Stephane; Lopez, Rodrigo

2013-01-01

The EMBL-European Bioinformatics Institute (EMBL-EBI) offers public access to patent sequence data, providing a valuable service to the intellectual property and scientific communities. The non-redundant (NR) patent sequence databases comprise two-level nucleotide and protein sequence clusters (NRNL1, NRNL2, NRPL1 and NRPL2) based on sequence identity (level-1) and patent family (level-2). Annotation from the source entries in these databases is merged and enhanced with additional information from the patent literature and biological context. Corrections in patent publication numbers, kind-codes and patent equivalents significantly improve the data quality. Data are available through various user interfaces including web browser, downloads via FTP, SRS, Dbfetch and EBI-Search. Sequence similarity/homology searches against the databases are available using BLAST, FASTA and PSI-Search. In this article, we describe the data collection and annotation and also outline major changes and improvements introduced since 2009. Apart from data growth, these changes include additional annotation for singleton clusters, the identifier versioning for tracking entry change and the entry mappings between the two-level databases. Database URL: http://www.ebi.ac.uk/patentdata/nr/

The Annotation-enriched non-redundant patent sequence databases

PubMed Central

Li, Weizhong; Kondratowicz, Bartosz; McWilliam, Hamish; Nauche, Stephane; Lopez, Rodrigo

2013-01-01

The EMBL-European Bioinformatics Institute (EMBL-EBI) offers public access to patent sequence data, providing a valuable service to the intellectual property and scientific communities. The non-redundant (NR) patent sequence databases comprise two-level nucleotide and protein sequence clusters (NRNL1, NRNL2, NRPL1 and NRPL2) based on sequence identity (level-1) and patent family (level-2). Annotation from the source entries in these databases is merged and enhanced with additional information from the patent literature and biological context. Corrections in patent publication numbers, kind-codes and patent equivalents significantly improve the data quality. Data are available through various user interfaces including web browser, downloads via FTP, SRS, Dbfetch and EBI-Search. Sequence similarity/homology searches against the databases are available using BLAST, FASTA and PSI-Search. In this article, we describe the data collection and annotation and also outline major changes and improvements introduced since 2009. Apart from data growth, these changes include additional annotation for singleton clusters, the identifier versioning for tracking entry change and the entry mappings between the two-level databases. Database URL: http://www.ebi.ac.uk/patentdata/nr/ PMID:23396323

Model-based quality assessment and base-calling for second-generation sequencing data.

PubMed

Bravo, Héctor Corrada; Irizarry, Rafael A

2010-09-01

Second-generation sequencing (sec-gen) technology can sequence millions of short fragments of DNA in parallel, making it capable of assembling complex genomes for a small fraction of the price and time of previous technologies. In fact, a recently formed international consortium, the 1000 Genomes Project, plans to fully sequence the genomes of approximately 1200 people. The prospect of comparative analysis at the sequence level of a large number of samples across multiple populations may be achieved within the next five years. These data present unprecedented challenges in statistical analysis. For instance, analysis operates on millions of short nucleotide sequences, or reads-strings of A,C,G, or T's, between 30 and 100 characters long-which are the result of complex processing of noisy continuous fluorescence intensity measurements known as base-calling. The complexity of the base-calling discretization process results in reads of widely varying quality within and across sequence samples. This variation in processing quality results in infrequent but systematic errors that we have found to mislead downstream analysis of the discretized sequence read data. For instance, a central goal of the 1000 Genomes Project is to quantify across-sample variation at the single nucleotide level. At this resolution, small error rates in sequencing prove significant, especially for rare variants. Sec-gen sequencing is a relatively new technology for which potential biases and sources of obscuring variation are not yet fully understood. Therefore, modeling and quantifying the uncertainty inherent in the generation of sequence reads is of utmost importance. In this article, we present a simple model to capture uncertainty arising in the base-calling procedure of the Illumina/Solexa GA platform. Model parameters have a straightforward interpretation in terms of the chemistry of base-calling allowing for informative and easily interpretable metrics that capture the variability in sequencing quality. Our model provides these informative estimates readily usable in quality assessment tools while significantly improving base-calling performance. © 2009, The International Biometric Society.

Molecular characterization of the virulent infectious hematopoietic necrosis virus (IHNV) strain 220-90

PubMed Central

2010-01-01

Background Infectious hematopoietic necrosis virus (IHNV) is the type species of the genus Novirhabdovirus, within the family Rhabdoviridae, infecting several species of wild and hatchery reared salmonids. Similar to other rhabdoviruses, IHNV has a linear single-stranded, negative-sense RNA genome of approximately 11,000 nucleotides. The IHNV genome encodes six genes; the nucleocapsid, phosphoprotein, matrix protein, glycoprotein, non-virion protein and polymerase protein genes, respectively. This study describes molecular characterization of the virulent IHNV strain 220-90, belonging to the M genogroup, and its phylogenetic relationships with available sequences of IHNV isolates worldwide. Results The complete genomic sequence of IHNV strain 220-90 was determined from the DNA of six overlapping clones obtained by RT-PCR amplification of genomic RNA. The complete genome sequence of 220-90 comprises 11,133 nucleotides (GenBank GQ413939) with the gene order of 3'-N-P-M-G-NV-L-5'. These genes are separated by conserved gene junctions, with di-nucleotide gene spacers. An additional uracil nucleotide was found at the end of the 5'-trailer region, which was not reported before in other IHNV strains. The first 15 of the 16 nucleotides at the 3'- and 5'-termini of the genome are complementary, and the first 4 nucleotides at 3'-ends of the IHNV are identical to other novirhadoviruses. Sequence homology and phylogenetic analysis of the glycoprotein genes show that 220-90 strain is 97% identical to most of the IHNV strains. Comparison of the virulent 220-90 genomic sequences with less virulent WRAC isolate shows more than 300 nucleotides changes in the genome, which doesn't allow one to speculate putative residues involved in the virulence of IHNV. Conclusion We have molecularly characterized one of the well studied IHNV isolates, 220-90 of genogroup M, which is virulent for rainbow trout, and compared phylogenetic relationship with North American and other strains. Determination of the complete nucleotide sequence is essential for future studies on pathogenesis of IHNV using a reverse genetics approach and developing efficient control strategies. PMID:20085652

Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.

PubMed Central

Ohno, T; Takamatsu, N; Meshi, T; Okada, Y

1983-01-01

The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412

Nucleotide sequences of Japanese isolates of citrus vein enation virus.

PubMed

Nakazono-Nagaoka, Eiko; Fujikawa, Takashi; Iwanami, Toru

2017-03-01

The genomic sequences of five Japanese isolates of citrus vein enation virus (CVEV) isolates that induce vein enation were determined and compared with that of the Spanish isolate VE-1. The nucleotide sequences of all Japanese isolates were 5,983 nt in length. The genomic RNA of Japanese isolates had five potential open reading frames (ORF 0, ORF 1, ORF 2, ORF 3, and ORF 5) in the positive-sense strand. The nucleotide sequence identity among the Japanese isolates and Spanish isolate VE-1 ranged from 98.0% to 99.8%. Comparison of the partial amino acid sequences of ten Japanese isolates and three Spanish isolates suggested that four amino acid residues, at positions of 83, 104, and 113 in ORF 2 and position 41 in ORF 5, might be unique to some Japanese isolates.

Detecting and Analyzing Genetic Recombination Using RDP4.

PubMed

Martin, Darren P; Murrell, Ben; Khoosal, Arjun; Muhire, Brejnev

2017-01-01

Recombination between nucleotide sequences is a major process influencing the evolution of most species on Earth. The evolutionary value of recombination has been widely debated and so too has its influence on evolutionary analysis methods that assume nucleotide sequences replicate without recombining. When nucleic acids recombine, the evolution of the daughter or recombinant molecule cannot be accurately described by a single phylogeny. This simple fact can seriously undermine the accuracy of any phylogenetics-based analytical approach which assumes that the evolutionary history of a set of recombining sequences can be adequately described by a single phylogenetic tree. There are presently a large number of available methods and associated computer programs for analyzing and characterizing recombination in various classes of nucleotide sequence datasets. Here we examine the use of some of these methods to derive and test recombination hypotheses using multiple sequence alignments.

DNAAlignEditor: DNA alignment editor tool

PubMed Central

Sanchez-Villeda, Hector; Schroeder, Steven; Flint-Garcia, Sherry; Guill, Katherine E; Yamasaki, Masanori; McMullen, Michael D

2008-01-01

Background With advances in DNA re-sequencing methods and Next-Generation parallel sequencing approaches, there has been a large increase in genomic efforts to define and analyze the sequence variability present among individuals within a species. For very polymorphic species such as maize, this has lead to a need for intuitive, user-friendly software that aids the biologist, often with naïve programming capability, in tracking, editing, displaying, and exporting multiple individual sequence alignments. To fill this need we have developed a novel DNA alignment editor. Results We have generated a nucleotide sequence alignment editor (DNAAlignEditor) that provides an intuitive, user-friendly interface for manual editing of multiple sequence alignments with functions for input, editing, and output of sequence alignments. The color-coding of nucleotide identity and the display of associated quality score aids in the manual alignment editing process. DNAAlignEditor works as a client/server tool having two main components: a relational database that collects the processed alignments and a user interface connected to database through universal data access connectivity drivers. DNAAlignEditor can be used either as a stand-alone application or as a network application with multiple users concurrently connected. Conclusion We anticipate that this software will be of general interest to biologists and population genetics in editing DNA sequence alignments and analyzing natural sequence variation regardless of species, and will be particularly useful for manual alignment editing of sequences in species with high levels of polymorphism. PMID:18366684

Rapid differentiation of citrus Hop stunt viroid variants by real-time RT-PCR and high resolution melting analysis.

PubMed

Loconsole, Giuliana; Onelge, Nuket; Yokomi, Raymond K; Kubaa, Raied Abou; Savino, Vito; Saponari, Maria

2013-01-01

The RNA genome of pathogenic and non-pathogenic variants of citrus Hop stunt viroid (HSVd) differ by five to six nucleotides located within the variable (V) domain referred to as the "cachexia expression motif". Sensitive hosts such as mandarin and its hybrids are seriously affected by cachexia disease. Current methods to differentiate HSVd variants rely on lengthy greenhouse biological indexing on Parson's Special mandarin and/or direct nucleotide sequence analysis of amplicons from RT-PCR of HSVd-infected plants. Two independent high throughput assays to segregate HSVd variants by real-time RT-PCR and High-Resolution Melting Temperature (HRM) analysis were developed: one based on EVAGreen dye; the other based on TaqMan probes. Primers for both assays targeted three differentiating nucleotides in the V domain which separated HSVd variants into three clusters by distinct melting temperatures with a confidence level higher than 98%. The accuracy of the HRM assays were validated by nucleotide sequencing of representative samples within each HRM cluster and by testing 45 HSVd-infected field trees from California, Italy, Spain, Syria and Turkey. To our knowledge, this is the first report of a rapid and sensitive approach to detect and differentiate HSVd variants associated with different biological behaviors. Although, HSVd is found in several crops including citrus, cachexia variants are restricted to some citrus-growing areas, particularly the Mediterranean Region. Rapid diagnosis for cachexia and non-cachexia variants is, thus, important for the management of HSVd in citrus and reduces the need for bioindexing and sequencing analysis. Copyright © 2013 Elsevier Ltd. All rights reserved.

Identifying Likely Transmission Pathways within a 10-Year Community Outbreak of Tuberculosis by High-Depth Whole Genome Sequencing

PubMed Central

Sadsad, Rosemarie; Martinez, Elena; Jelfs, Peter; Hill-Cawthorne, Grant A.; Gilbert, Gwendolyn L.; Marais, Ben J.; Sintchenko, Vitali

2016-01-01

Background Improved tuberculosis control and the need to contain the spread of drug-resistant strains provide a strong rationale for exploring tuberculosis transmission dynamics at the population level. Whole-genome sequencing provides optimal strain resolution, facilitating detailed mapping of potential transmission pathways. Methods We sequenced 22 isolates from a Mycobacterium tuberculosis cluster in New South Wales, Australia, identified during routine 24-locus mycobacterial interspersed repetitive unit typing. Following high-depth paired-end sequencing using the Illumina HiSeq 2000 platform, two independent pipelines were employed for analysis, both employing read mapping onto reference genomes as well as de novo assembly, to control biases in variant detection. In addition to single-nucleotide polymorphisms, the analyses also sought to identify insertions, deletions and structural variants. Results Isolates were highly similar, with a distance of 13 variants between the most distant members of the cluster. The most sensitive analysis classified the 22 isolates into 18 groups. Four of the isolates did not appear to share a recent common ancestor with the largest clade; another four isolates had an uncertain ancestral relationship with the largest clade. Conclusion Whole genome sequencing, with analysis of single-nucleotide polymorphisms, insertions, deletions, structural variants and subpopulations, enabled the highest possible level of discrimination between cluster members, clarifying likely transmission pathways and exposing the complexity of strain origin. The analysis provides a basis for targeted public health intervention and enhanced classification of future isolates linked to the cluster. PMID:26938641

Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

PubMed

Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

2009-08-13

Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

Normalization of Complete Genome Characteristics: Application to Evolution from Primitive Organisms to Homo sapiens.

PubMed

Sorimachi, Kenji; Okayasu, Teiji; Ohhira, Shuji

2015-04-01

Normalized nucleotide and amino acid contents of complete genome sequences can be visualized as radar charts. The shapes of these charts depict the characteristics of an organism's genome. The normalized values calculated from the genome sequence theoretically exclude experimental errors. Further, because normalization is independent of both target size and kind, this procedure is applicable not only to single genes but also to whole genomes, which consist of a huge number of different genes. In this review, we discuss the applications of the normalization of the nucleotide and predicted amino acid contents of complete genomes to the investigation of genome structure and to evolutionary research from primitive organisms to Homo sapiens. Some of the results could never have been obtained from the analysis of individual nucleotide or amino acid sequences but were revealed only after the normalization of nucleotide and amino acid contents was applied to genome research. The discovery that genome structure was homogeneous was obtained only after normalization methods were applied to the nucleotide or predicted amino acid contents of genome sequences. Normalization procedures are also applicable to evolutionary research. Thus, normalization of the contents of whole genomes is a useful procedure that can help to characterize organisms.

Detection of a new bat gammaherpesvirus in the Philippines.

PubMed

Watanabe, Shumpei; Ueda, Naoya; Iha, Koichiro; Masangkay, Joseph S; Fujii, Hikaru; Alviola, Phillip; Mizutani, Tetsuya; Maeda, Ken; Yamane, Daisuke; Walid, Azab; Kato, Kentaro; Kyuwa, Shigeru; Tohya, Yukinobu; Yoshikawa, Yasuhiro; Akashi, Hiroomi

2009-08-01

A new bat herpesvirus was detected in the spleen of an insectivorous bat (Hipposideros diadema, family Hipposideridae) collected on Panay Island, the Philippines. PCR analyses were performed using COnsensus-DEgenerate Hybrid Oligonucleotide Primers (CODEHOPs) targeting the herpesvirus DNA polymerase (DPOL) gene. Although we obtained PCR products with CODEHOPs, direct sequencing using the primers was not possible because of high degree of degeneracy. Direct sequencing technology developed in our rapid determination system of viral RNA sequences (RDV) was applied in this study, and a partial DPOL nucleotide sequence was determined. In addition, a partial gB gene nucleotide sequence was also determined using the same strategy. We connected the partial gB and DPOL sequences with long-distance PCR, and a 3741-bp nucleotide fragment, including the 3' part of the gB gene and the 5' part of the DPOL gene, was finally determined. Phylogenetic analysis showed that the sequence was novel and most similar to those of the subfamily Gammaherpesvirinae.

Plant nitrogen regulatory P-PII polypeptides

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2004-11-23

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the invention may be used to engineer organisms to overexpress wild-type or mutant P-PII regulatory protein. Engineered plants that overexpress or underexpress P-PII regulatory protein may have increased nitrogen assimilation capacity. Engineered organisms may be used to produce P-PII proteins which, in turn, can be used for a variety of purposes including in vitro screening of herbicides. P-PII nucleotide sequences have additional uses as probes for isolating additional genomic clones having the promoters of P-PII gene. P-PII promoters are light- and/or sucrose-inducible and may be advantageously used in genetic engineering of plants.

Greater numbers of nucleotide substitutions are introduced into the genomic RNA of bovine viral diarrhea virus during acute infections of pregnant cattle than of non-pregnant cattle.

PubMed

Neill, John D; Newcomer, Benjamin W; Marley, Shonda D; Ridpath, Julia F; Givens, M Daniel

2012-08-06

Bovine viral diarrhea virus (BVDV) strains circulating in livestock herds show significant sequence variation. Conventional wisdom states that most sequence variation arises during acute infections in response to immune or other environmental pressures. A recent study showed that more nucleotide changes were introduced into the BVDV genomic RNA during the establishment of a single fetal persistent infection than following a series of acute infections of naïve cattle. However, it was not known if nucleotide changes were introduce when the virus crossed the placenta and infected the fetus or during the acute infection of the dam. The sequence of the open reading frame (ORF) from viruses isolated from four acutely infected pregnant heifers following exposure to persistently infected (PI) calves was compared to the sequences of the virus from the progenitor PI calf and the virus from the resulting progeny PI calf to determine when genetic change was introduced. This was compared to genetic change found in viruses isolated from a pregnant PI cow and its PI calf, and in three viruses isolated from acutely infected, non-pregnant cattle exposed to PI calves. Most genetic changes previously identified between the progenitor and progeny PI viruses were in place in the acute phase viruses isolated from the dams six days post-exposure to the progenitor PI calf. Additionally, each progeny PI virus had two to three unique nucleotide substitutions that were introduced in crossing the placenta and infection of the fetus. The nucleotide sequence of two acute phase viruses isolated from steers exposed to PI calves revealed that six and seven nucleotide changes were introduced during the acute infection. The sequence of the BVDV-2 virus isolated from an acute infection of a PI calf (BVDV-1a) co-housed with a BVDV-2 PI calf had ten nucleotides that were different from the progenitor PI virus. Finally, twenty nucleotide changes were identified in the PI virus of a calf born to a PI dam. These results demonstrate that nucleotide changes are introduced into the BVDV infecting pregnant cattle at rates of 2.3 to 8 fold higher then during the acute infection of non-pregnant animals.

The Role of ABC Proteins in Drug-Resistant Breast Cancer Cells

DTIC Science & Technology

2007-04-01

and a biotin acceptor domain) under control of the alcohol oxidase promoter (Figure 2). Upon methanol induction, the yeast expressed high levels of...as native cDNA. Therefore, we backtranslated the protein into a nucleotide sequence codon-optimized for expression in Pichia pastoris yeast. Yeast

Isolation and characterization of NBS–LRR resistance gene analogues from mango

PubMed Central

Lei, Xintao; Yao, Quansheng; Xu, Xuerong; Liu, Yang

2014-01-01

The nucleotide-binding site (NBS)–leucine-rich repeat (LRR) gene family is a class of R genes in plants. NBS genes play a very important role in disease defence. To further study the variation and homology of mango NBS–LRR genes, 16 resistance gene analogues (RGAs) (GenBank accession number HM446507-22) were isolated from the polymerase chain reaction fragments and sequenced by using two degenerate primer sets. The total nucleotide diversity index Pi was 0.362, and 236 variation sites were found among 16 RGAs. The degree of homology between the RGAs varied from 44.4% to 98.5%. Sixteen RGAs could be translated into amino sequences. The high level of this homology in the protein sequences of the P-loop and kinase-2 of the NBS domain between the RGAs isolated in this study and previously characterized R genes indicated that these cloned sequences belonged to the NBS–LRR gene family. Moreover, these 16 RGAs could be classified into the non-TIR–NBS–LRR gene family because only tryptophan (W) could be claimed as the final residual of the kinase-2 domain of all RGAs isolated here. From our results, we concluded that our mango NBS–LRR genes possessed a high level of variation from the mango genome, which may allow mango to recognize many different pathogenic virulence factors. PMID:26740762

A low molecular weight artificial RNA of unique size with multiple probe target regions

NASA Technical Reports Server (NTRS)

Pitulle, C.; Dsouza, L.; Fox, G. E.

1997-01-01

Artificial RNAs (aRNAs) containing novel sequence segments embedded in a deletion mutant of Vibrio proteolyticus 5S rRNA have previously been shown to be expressed from a plasmid borne growth rate regulated promoter in E. coli. These aRNAs accumulate to high levels and their detection is a promising tool for studies in molecular microbial ecology and in environmental monitoring. Herein a new construct is described which illustrates the versatility of detection that is possible with aRNAs. This 3xPen aRNA construct carries a 72 nucleotide insert with three copies of a unique 17 base probe target sequence. This aRNA is 160 nucleotides in length and again accumulates to high levels in the E. coli cytoplasm without incorporating into ribosomes. The 3xPen aRNA illustrates two improvements in detection. First, by appropriate selection of insert size, we obtained an aRNA which provides a unique and hence, easily quantifiable peak, on a high resolution gel profile of low molecular weight RNAs. Second, the existence of multiple probe targets results in a nearly commensurate increase in signal when detection is by hybridization. These aRNAs are naturally amplified and carry sequence segments that are not found in known rRNA sequences. It thus may be possible to detect them directly. An experimental step involving RT-PCR or PCR amplification of the gene could therefore be avoided.

Ancestral sequence reconstruction in primate mitochondrial DNA: compositional bias and effect on functional inference.

PubMed

Krishnan, Neeraja M; Seligmann, Hervé; Stewart, Caro-Beth; De Koning, A P Jason; Pollock, David D

2004-10-01

Reconstruction of ancestral DNA and amino acid sequences is an important means of inferring information about past evolutionary events. Such reconstructions suggest changes in molecular function and evolutionary processes over the course of evolution and are used to infer adaptation and convergence. Maximum likelihood (ML) is generally thought to provide relatively accurate reconstructed sequences compared to parsimony, but both methods lead to the inference of multiple directional changes in nucleotide frequencies in primate mitochondrial DNA (mtDNA). To better understand this surprising result, as well as to better understand how parsimony and ML differ, we constructed a series of computationally simple "conditional pathway" methods that differed in the number of substitutions allowed per site along each branch, and we also evaluated the entire Bayesian posterior frequency distribution of reconstructed ancestral states. We analyzed primate mitochondrial cytochrome b (Cyt-b) and cytochrome oxidase subunit I (COI) genes and found that ML reconstructs ancestral frequencies that are often more different from tip sequences than are parsimony reconstructions. In contrast, frequency reconstructions based on the posterior ensemble more closely resemble extant nucleotide frequencies. Simulations indicate that these differences in ancestral sequence inference are probably due to deterministic bias caused by high uncertainty in the optimization-based ancestral reconstruction methods (parsimony, ML, Bayesian maximum a posteriori). In contrast, ancestral nucleotide frequencies based on an average of the Bayesian set of credible ancestral sequences are much less biased. The methods involving simpler conditional pathway calculations have slightly reduced likelihood values compared to full likelihood calculations, but they can provide fairly unbiased nucleotide reconstructions and may be useful in more complex phylogenetic analyses than considered here due to their speed and flexibility. To determine whether biased reconstructions using optimization methods might affect inferences of functional properties, ancestral primate mitochondrial tRNA sequences were inferred and helix-forming propensities for conserved pairs were evaluated in silico. For ambiguously reconstructed nucleotides at sites with high base composition variability, ancestral tRNA sequences from Bayesian analyses were more compatible with canonical base pairing than were those inferred by other methods. Thus, nucleotide bias in reconstructed sequences apparently can lead to serious bias and inaccuracies in functional predictions.

Intramolecular interactions in aminoacyl nucleotides: Implications regarding the origin of genetic coding and protein synthesis

NASA Technical Reports Server (NTRS)

Lacey, J. C., Jr.; Mullins, D. W., Jr.; Watkins, C. L.; Hall, L. M.

1986-01-01

Cellular organisms store information as sequences of nucleotides in double stranded DNA. This information is useless unless it can be converted into the active molecular species, protein. This is done in contemporary creatures first by transcription of one strand to give a complementary strand of mRNA. The sequence of nucleotides is then translated into a specific sequence of amino acids in a protein. Translation is made possible by a genetic coding system in which a sequence of three nucleotides codes for a specific amino acid. The origin and evolution of any chemical system can be understood through elucidation of the properties of the chemical entities which make up the system. There is an underlying logic to the coding system revealed by a correlation of the hydrophobicities of amino acids and their anticodonic nucleotides (i.e., the complement of the codon). Its importance lies in the fact that every amino acid going into protein synthesis must first be activated. This is universally accomplished with ATP. Past studies have concentrated on the chemistry of the adenylates, but more recently we have found, through the use of NMR, that we can observe intramolecular interactions even at low concentrations, between amino acid side chains and nucleotide base rings in these adenylates. The use of this type of compound thus affords a novel way of elucidating the manner in which amino acids and nucleotides interact with each other. In aqueous solution, when a hydrophobic amino acid is attached to the most hydrophobic nucleotide, AMP, a hydrophobic interaction takes place between the amino acid side chain and the adenine ring. The studies to be reported concern these hydrophobic interactions.

High speed nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2011-05-17

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid. Each type of labeled nucleotide comprises an acceptor fluorophore attached to a phosphate portion of the nucleotide such that the fluorophore is removed upon incorporation into a growing strand. Fluorescent signal is emitted via fluorescent resonance energy transfer between the donor fluorophore and the acceptor fluorophore as each nucleotide is incorporated into the growing strand. The sequence is deduced by identifying which base is being incorporated into the growing strand.

The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.

PubMed

Khoe, Clairine V; Chung, Long H; Murray, Vincent

2018-06-01

The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

Information capacity of nucleotide sequences and its applications.

PubMed

Sadovsky, M G

2006-05-01

The information capacity of nucleotide sequences is defined through the specific entropy of frequency dictionary of a sequence determined with respect to another one containing the most probable continuations of shorter strings. This measure distinguishes a sequence both from a random one, and from ordered entity. A comparison of sequences based on their information capacity is studied. An order within the genetic entities is found at the length scale ranged from 3 to 8. Some other applications of the developed methodology to genetics, bioinformatics, and molecular biology are discussed.

Nucleic acid constructs containing orthogonal site selective recombinases (OSSRs)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilmore, Joshua M.; Anderson, J. Christopher; Dueber, John E.

The present invention provides for a recombinant nucleic acid comprising a nucleotide sequence comprising a plurality of constructs, wherein each construct independently comprises a nucleotide sequence of interest flanked by a pair of recombinase recognition sequences. Each pair of recombinase recognition sequences is recognized by a distinct recombinase. Optionally, each construct can, independently, further comprise one or more genes encoding a recombinase capable of recognizing the pair of recombinase recognition sequences of the construct. The recombinase can be an orthogonal (non-cross reacting), site-selective recombinase (OSSR).

Complete genome sequence and phylogenetic analyses of an aquabirnavirus isolated from a diseased marbled eel culture in Taiwan.

PubMed

Wen, Chiu-Ming

2017-08-01

An aquabirnavirus was isolated from diseased marbled eels (Anguilla marmorata; MEIPNV1310) with gill haemorrhages and associated mortality. Its genome segment sequences were obtained through next-generation sequencing and compared with published aquabirnavirus sequences. The results indicated that the genome sequence of MEIPNV1310 contains segment A (3099 nucleotides) and segment B (2789 nucleotides). Phylogenetic analysis showed that MEIPNV1310 is closely related to the infectious pancreatic necrosis Ab strain within genogroup II. This genome sequence is beneficial for studying the geographic distribution and evolution of aquabirnaviruses.

Unlinking the methylome pattern from nucleotide sequence, revealed by large-scale in vivo genome engineering and methylome editing in medaka fish

PubMed Central

Nakamura, Ryohei; Uno, Ayako; Kumagai, Masahiko; Fukushima, Hiroto S.; Morishita, Shinichi; Takeda, Hiroyuki

2017-01-01

The heavily methylated vertebrate genomes are punctuated by stretches of poorly methylated DNA sequences that usually mark gene regulatory regions. It is known that the methylation state of these regions confers transcriptional control over their associated genes. Given its governance on the transcriptome, cellular functions and identity, genome-wide DNA methylation pattern is tightly regulated and evidently predefined. However, how is the methylation pattern determined in vivo remains enigmatic. Based on in silico and in vitro evidence, recent studies proposed that the regional hypomethylated state is primarily determined by local DNA sequence, e.g., high CpG density and presence of specific transcription factor binding sites. Nonetheless, the dependency of DNA methylation on nucleotide sequence has not been carefully validated in vertebrates in vivo. Herein, with the use of medaka (Oryzias latipes) as a model, the sequence dependency of DNA methylation was intensively tested in vivo. Our statistical modeling confirmed the strong statistical association between nucleotide sequence pattern and methylation state in the medaka genome. However, by manipulating the methylation state of a number of genomic sequences and reintegrating them into medaka embryos, we demonstrated that artificially conferred DNA methylation states were predominantly and robustly maintained in vivo, regardless of their sequences and endogenous states. This feature was also observed in the medaka transgene that had passed across generations. Thus, despite the observed statistical association, nucleotide sequence was unable to autonomously determine its own methylation state in medaka in vivo. Our results apparently argue against the notion of the governance on the DNA methylation by nucleotide sequence, but instead suggest the involvement of other epigenetic factors in defining and maintaining the DNA methylation landscape. Further investigation in other vertebrate models in vivo will be needed for the generalization of our observations made in medaka. PMID:29267279

Using expected sequence features to improve basecalling accuracy of amplicon pyrosequencing data.

PubMed

Rask, Thomas S; Petersen, Bent; Chen, Donald S; Day, Karen P; Pedersen, Anders Gorm

2016-04-22

Amplicon pyrosequencing targets a known genetic region and thus inherently produces reads highly anticipated to have certain features, such as conserved nucleotide sequence, and in the case of protein coding DNA, an open reading frame. Pyrosequencing errors, consisting mainly of nucleotide insertions and deletions, are on the other hand likely to disrupt open reading frames. Such an inverse relationship between errors and expectation based on prior knowledge can be used advantageously to guide the process known as basecalling, i.e. the inference of nucleotide sequence from raw sequencing data. The new basecalling method described here, named Multipass, implements a probabilistic framework for working with the raw flowgrams obtained by pyrosequencing. For each sequence variant Multipass calculates the likelihood and nucleotide sequence of several most likely sequences given the flowgram data. This probabilistic approach enables integration of basecalling into a larger model where other parameters can be incorporated, such as the likelihood for observing a full-length open reading frame at the targeted region. We apply the method to 454 amplicon pyrosequencing data obtained from a malaria virulence gene family, where Multipass generates 20 % more error-free sequences than current state of the art methods, and provides sequence characteristics that allow generation of a set of high confidence error-free sequences. This novel method can be used to increase accuracy of existing and future amplicon sequencing data, particularly where extensive prior knowledge is available about the obtained sequences, for example in analysis of the immunoglobulin VDJ region where Multipass can be combined with a model for the known recombining germline genes. Multipass is available for Roche 454 data at http://www.cbs.dtu.dk/services/MultiPass-1.0 , and the concept can potentially be implemented for other sequencing technologies as well.

The nucleotide sequence and genome organization of Plasmopara halstedii virus.

PubMed

Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar

2011-03-17

Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates. Insignificant viral sequence variation indicated that the virus did not account for differences in pathogenicity of the oomycete P. halstedii.

Investigating intra-host and intra-herd sequence diversity of foot-and-mouth disease virus.

PubMed

King, David J; Freimanis, Graham L; Orton, Richard J; Waters, Ryan A; Haydon, Daniel T; King, Donald P

2016-10-01

Due to the poor-fidelity of the enzymes involved in RNA genome replication, foot-and-mouth disease (FMD) virus samples comprise of unique polymorphic populations. In this study, deep sequencing was utilised to characterise the diversity of FMD virus (FMDV) populations in 6 infected cattle present on a single farm during the series of outbreaks in the UK in 2007. A novel RT-PCR method was developed to amplify a 7.6kb nucleotide fragment encompassing the polyprotein coding region of the FMDV genome. Illumina sequencing of each sample identified the fine polymorphic structures at each nucleotide position, from consensus level changes to variants present at a 0.24% frequency. These data were used to investigate population dynamics of FMDV at both herd and host levels, evaluate the impact of host on the viral swarm structure and to identify transmission links with viruses recovered from other farms in the same series of outbreaks. In 7 samples, from 6 different animals, a total of 5 consensus level variants were identified, in addition to 104 sub-consensus variants of which 22 were shared between 2 or more animals. Further analysis revealed differences in swarm structures from samples derived from the same animal suggesting the presence of distinct viral populations evolving independently at different lesion sites within the same infected animal. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

High levels of Y-chromosome nucleotide diversity in the genus Pan

PubMed Central

Stone, Anne C.; Griffiths, Robert C.; Zegura, Stephen L.; Hammer, Michael F.

2002-01-01

Although some mitochondrial, X chromosome, and autosomal sequence diversity data are available for our closest relatives, Pan troglodytes and Pan paniscus, data from the nonrecombining portion of the Y chromosome (NRY) are more limited. We examined ≈3 kb of NRY DNA from 101 chimpanzees, seven bonobos, and 42 humans to investigate: (i) relative levels of intraspecific diversity; (ii) the degree of paternal lineage sorting among species and subspecies of the genus Pan; and (iii) the date of the chimpanzee/bonobo divergence. We identified 10 informative sequence-tagged sites associated with 23 polymorphisms on the NRY from the genus Pan. Nucleotide diversity was significantly higher on the NRY of chimpanzees and bonobos than on the human NRY. Similar to mtDNA, but unlike X-linked and autosomal loci, lineages defined by mutations on the NRY were not shared among subspecies of P. troglodytes. Comparisons with mtDNA ND2 sequences from some of the same individuals revealed a larger female versus male effective population size for chimpanzees. The NRY-based divergence time between chimpanzees and bonobos was estimated at ≈1.8 million years ago. In contrast to human populations who appear to have had a low effective size and a recent origin with subsequent population growth, some taxa within the genus Pan may be characterized by large populations of relatively constant size, more ancient origins, and high levels of subdivision. PMID:11756656

Non-redundant patent sequence databases with value-added annotations at two levels

PubMed Central

Li, Weizhong; McWilliam, Hamish; de la Torre, Ana Richart; Grodowski, Adam; Benediktovich, Irina; Goujon, Mickael; Nauche, Stephane; Lopez, Rodrigo

2010-01-01

The European Bioinformatics Institute (EMBL-EBI) provides public access to patent data, including abstracts, chemical compounds and sequences. Sequences can appear multiple times due to the filing of the same invention with multiple patent offices, or the use of the same sequence by different inventors in different contexts. Information relating to the source invention may be incomplete, and biological information available in patent documents elsewhere may not be reflected in the annotation of the sequence. Search and analysis of these data have become increasingly challenging for both the scientific and intellectual-property communities. Here, we report a collection of non-redundant patent sequence databases, which cover the EMBL-Bank nucleotides patent class and the patent protein databases and contain value-added annotations from patent documents. The databases were created at two levels by the use of sequence MD5 checksums. Sequences within a level-1 cluster are 100% identical over their whole length. Level-2 clusters were defined by sub-grouping level-1 clusters based on patent family information. Value-added annotations, such as publication number corrections, earliest publication dates and feature collations, significantly enhance the quality of the data, allowing for better tracking and cross-referencing. The databases are available format: http://www.ebi.ac.uk/patentdata/nr/. PMID:19884134

Non-redundant patent sequence databases with value-added annotations at two levels.

PubMed

Li, Weizhong; McWilliam, Hamish; de la Torre, Ana Richart; Grodowski, Adam; Benediktovich, Irina; Goujon, Mickael; Nauche, Stephane; Lopez, Rodrigo

2010-01-01

The European Bioinformatics Institute (EMBL-EBI) provides public access to patent data, including abstracts, chemical compounds and sequences. Sequences can appear multiple times due to the filing of the same invention with multiple patent offices, or the use of the same sequence by different inventors in different contexts. Information relating to the source invention may be incomplete, and biological information available in patent documents elsewhere may not be reflected in the annotation of the sequence. Search and analysis of these data have become increasingly challenging for both the scientific and intellectual-property communities. Here, we report a collection of non-redundant patent sequence databases, which cover the EMBL-Bank nucleotides patent class and the patent protein databases and contain value-added annotations from patent documents. The databases were created at two levels by the use of sequence MD5 checksums. Sequences within a level-1 cluster are 100% identical over their whole length. Level-2 clusters were defined by sub-grouping level-1 clusters based on patent family information. Value-added annotations, such as publication number corrections, earliest publication dates and feature collations, significantly enhance the quality of the data, allowing for better tracking and cross-referencing. The databases are available format: http://www.ebi.ac.uk/patentdata/nr/.

Nucleotide Sequence and Genetic Structure of a Novel Carbaryl Hydrolase Gene (cehA) from Rhizobium sp. Strain AC100

PubMed Central

Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito

2002-01-01

Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471

The complete nucleotide sequence and genome organization of a novel betaflexivirus infecting Citrullus lanatus.

PubMed

Xin, Min; Zhang, Peipei; Liu, Wenwen; Ren, Yingdang; Cao, Mengji; Wang, Xifeng

2017-10-01

The complete nucleotide sequence of a novel positive single-stranded (+ss) RNA virus, tentatively named watermelon virus A (WVA), was determined using a combination of three methods: RNA sequencing, small RNA sequencing, and Sanger sequencing. The full genome of WVA is comprised of 8,372 nucleotides (nt), excluding the poly (A) tail, and contains four open reading frames (ORFs). The largest ORF, ORF1 encodes a putative replication-associated polyprotein (RP) with three conserved domains. ORF2 and ORF4 encode a movement protein (MP) and coat protein (CP), respectively. The putative product encoded by ORF3, of an estimated molecular mass of 25 kDa, has no significant similarity with other proteins. Identity and phylogenetic analysis indicate that WVA is a new virus, closely related to members of the family Betaflexiviridae. However, the final taxonomic allocation of WVA within the family is yet to be determined.

Dietary nitrogen alters codon bias and genome composition in parasitic microorganisms.

PubMed

Seward, Emily A; Kelly, Steven

2016-11-15

Genomes are composed of long strings of nucleotide monomers (A, C, G and T) that are either scavenged from the organism's environment or built from metabolic precursors. The biosynthesis of each nucleotide differs in atomic requirements with different nucleotides requiring different quantities of nitrogen atoms. However, the impact of the relative availability of dietary nitrogen on genome composition and codon bias is poorly understood. Here we show that differential nitrogen availability, due to differences in environment and dietary inputs, is a major determinant of genome nucleotide composition and synonymous codon use in both bacterial and eukaryotic microorganisms. Specifically, low nitrogen availability species use nucleotides that require fewer nitrogen atoms to encode the same genes compared to high nitrogen availability species. Furthermore, we provide a novel selection-mutation framework for the evaluation of the impact of metabolism on gene sequence evolution and show that it is possible to predict the metabolic inputs of related organisms from an analysis of the raw nucleotide sequence of their genes. Taken together, these results reveal a previously hidden relationship between cellular metabolism and genome evolution and provide new insight into how genome sequence evolution can be influenced by adaptation to different diets and environments.

Alfalfa virus S, a new species in the family Alphaflexiviridae

USDA-ARS?s Scientific Manuscript database

A new species of the family Alphaflexiviridae provisionally named alfalfa virus S (AVS) was discovered in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by high throughput sequenc...

Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

USDA-ARS?s Scientific Manuscript database

Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Optimized Next-Generation Sequencing Genotype-Haplotype Calling for Genome Variability Analysis

PubMed Central

Navarro, Javier; Nevado, Bruno; Hernández, Porfidio; Vera, Gonzalo; Ramos-Onsins, Sebastián E

2017-01-01

The accurate estimation of nucleotide variability using next-generation sequencing data is challenged by the high number of sequencing errors produced by new sequencing technologies, especially for nonmodel species, where reference sequences may not be available and the read depth may be low due to limited budgets. The most popular single-nucleotide polymorphism (SNP) callers are designed to obtain a high SNP recovery and low false discovery rate but are not designed to account appropriately the frequency of the variants. Instead, algorithms designed to account for the frequency of SNPs give precise results for estimating the levels and the patterns of variability. These algorithms are focused on the unbiased estimation of the variability and not on the high recovery of SNPs. Here, we implemented a fast and optimized parallel algorithm that includes the method developed by Roesti et al and Lynch, which estimates the genotype of each individual at each site, considering the possibility to call both bases from the genotype, a single one or none. This algorithm does not consider the reference and therefore is independent of biases related to the reference nucleotide specified. The pipeline starts from a BAM file converted to pileup or mpileup format and the software outputs a FASTA file. The new program not only reduces the running times but also, given the improved use of resources, it allows its usage with smaller computers and large parallel computers, expanding its benefits to a wider range of researchers. The output file can be analyzed using software for population genetics analysis, such as the R library PopGenome, the software VariScan, and the program mstatspop for analysis considering positions with missing data. PMID:28894353

Nucleotide sequence of the Varkud mitochondrial plasmid of Neurospora and synthesis of a hybrid transcript with a 5' leader derived from mitochondrial RNA.

PubMed

Akins, R A; Grant, D M; Stohl, L L; Bottorff, D A; Nargang, F E; Lambowitz, A M

1988-11-05

The Mauriceville and Varkud mitochondrial plasmids of Neurospora are closely related, closed circular DNAs (3.6 and 3.7 kb, respectively; 1 kb = 10(3) bases or base-pairs), whose characteristics suggest relationships to mitochondrial DNA introns and retrotransposons. Here, we characterized the structure of the Varkud plasmid, determined its complete nucleotide sequence and mapped its major transcripts. The Mauriceville and Varkud plasmids have more than 97% positional identity. Both plasmids contain a 710 amino acid open reading frame that encodes a reverse transcriptase-like protein. The amino acid sequence of this open reading frame is strongly conserved between the two plasmids (701/710 amino acids) as expected for a functionally important protein. Both plasmids have a 0.4 kb region that contains five PstI palindromes and a direct repeat of approximately 160 base-pairs. Comparison of sequences in this region suggests that the Varkud plasmid has diverged less from a common ancestor than has the Mauriceville plasmid. Two major transcripts of the Varkud plasmid were detected by Northern hybridization experiments: a full-length linear RNA of 3.7 kb and an additional prominent transcript of 4.9 kb, 1.2 kb longer than monomer plasmid. Remarkably, we find that the 4.9 kb transcript is a hybrid RNA consisting of the full-length 3.7 kb Varkud plasmid transcript plus a 5' leader of 1.2 kb that is derived from the 5' end of the mitochondrial small rRNA. This and other findings suggest that the Varkud plasmid, like certain RNA viruses, has a mechanism for joining heterologous RNAs to the 5' end of its major transcript, and that, under some circumstances, nucleotide sequences in mitochondria may be recombined at the RNA level.

Ariadne: a database search engine for identification and chemical analysis of RNA using tandem mass spectrometry data.

PubMed

Nakayama, Hiroshi; Akiyama, Misaki; Taoka, Masato; Yamauchi, Yoshio; Nobe, Yuko; Ishikawa, Hideaki; Takahashi, Nobuhiro; Isobe, Toshiaki

2009-04-01

We present here a method to correlate tandem mass spectra of sample RNA nucleolytic fragments with an RNA nucleotide sequence in a DNA/RNA sequence database, thereby allowing tandem mass spectrometry (MS/MS)-based identification of RNA in biological samples. Ariadne, a unique web-based database search engine, identifies RNA by two probability-based evaluation steps of MS/MS data. In the first step, the software evaluates the matches between the masses of product ions generated by MS/MS of an RNase digest of sample RNA and those calculated from a candidate nucleotide sequence in a DNA/RNA sequence database, which then predicts the nucleotide sequences of these RNase fragments. In the second step, the candidate sequences are mapped for all RNA entries in the database, and each entry is scored for a function of occurrences of the candidate sequences to identify a particular RNA. Ariadne can also predict post-transcriptional modifications of RNA, such as methylation of nucleotide bases and/or ribose, by estimating mass shifts from the theoretical mass values. The method was validated with MS/MS data of RNase T1 digests of in vitro transcripts. It was applied successfully to identify an unknown RNA component in a tRNA mixture and to analyze post-transcriptional modification in yeast tRNA(Phe-1).

PCV: An Alignment Free Method for Finding Homologous Nucleotide Sequences and its Application in Phylogenetic Study.

PubMed

Kumar, Rajnish; Mishra, Bharat Kumar; Lahiri, Tapobrata; Kumar, Gautam; Kumar, Nilesh; Gupta, Rahul; Pal, Manoj Kumar

2017-06-01

Online retrieval of the homologous nucleotide sequences through existing alignment techniques is a common practice against the given database of sequences. The salient point of these techniques is their dependence on local alignment techniques and scoring matrices the reliability of which is limited by computational complexity and accuracy. Toward this direction, this work offers a novel way for numerical representation of genes which can further help in dividing the data space into smaller partitions helping formation of a search tree. In this context, this paper introduces a 36-dimensional Periodicity Count Value (PCV) which is representative of a particular nucleotide sequence and created through adaptation from the concept of stochastic model of Kolekar et al. (American Institute of Physics 1298:307-312, 2010. doi: 10.1063/1.3516320 ). The PCV construct uses information on physicochemical properties of nucleotides and their positional distribution pattern within a gene. It is observed that PCV representation of gene reduces computational cost in the calculation of distances between a pair of genes while being consistent with the existing methods. The validity of PCV-based method was further tested through their use in molecular phylogeny constructs in comparison with that using existing sequence alignment methods.

Sequence of rat alpha- and gamma-casein mRNAs: evolutionary comparison of the calcium-dependent rat casein multigene family.

PubMed Central

Hobbs, A A; Rosen, J M

1982-01-01

The complete sequences of rat alpha- and gamma-casein mRNAs have been determined. The 1402-nucleotide alpha- and 864-nucleotide gamma-casein mRNAs both encode 15 amino acid signal peptides and mature proteins of 269 and 164 residues, respectively. Considerable homology between the 5' non-coding regions, and the regions encoding the signal peptides and the phosphorylation sites, in these mRNAs as compared to several other rodent casein mRNAs, was observed. Significant homology was also detected between rat alpha- and bovine alpha s1-casein. Comparison of the rodent and bovine sequences suggests that the caseins evolved at about the time of the appearance of the primitive mammals. This may have occurred by intragenic duplication of a nucleotide sequence encoding a primitive phosphorylation site, -(Ser)n-Glu-Glu-, and intergenic duplication resulting in the small casein multigene family. A unique feature of the rat alpha-casein sequence is an insertion in the coding region containing 10 repeated elements of 18 nucleotides each. This insertion appears to have occurred 7-12 million years ago, just prior to the divergence of rat and mouse. Images PMID:6298707

Cloning of ubiquitin-activating enzyme and ubiquitin-conjugating enzyme genes from Gracilaria lemaneiformis and their activity under heat shock.

PubMed

Li, Guang-Qi; Zang, Xiao-Nan; Zhang, Xue-Cheng; Lu, Ning; Ding, Yan; Gong, Le; Chen, Wen-Chao

2014-03-15

To study the response of Gracilaria lemaneiformis to heat stress, two key enzymes - ubiquitin-activating enzyme (E1) and ubiquitin-conjugating enzyme (E2) - of the Ubiquitin/26S proteasome pathway (UPP) were studied in three strains of G. lemaneiformis-wild type, heat-tolerant cultivar 981 and heat-tolerant cultivar 07-2. The full length DNA sequence of E1 contained only one exon. The open reading frame (ORF) sequence was 981 nucleotides encoding 326 amino acids, which contained conserved ATP binding sites (LYDRQIRLWGLE, ELAKNVLLAGV, LKEMN, VVCAI) and the ubiquitin-activating domains (VVCAI…LMTEAC, VFLDLGDEYSYQ, AIVGGMWGRE). The gene sequence of E2 contained four exons and three introns. The sum of the four exons gave an open reading frame sequence of 444 nucleotides encoding 147 amino acids, which contained a conserved ubiquitin-activating domain (GSICLDIL), ubiquitin-conjugating domains (RIYHPNIN, KVLLSICSLL, DDPLV) and ubiquitin-ligase (E3) recognition sites (KRI, YPF, WSP). Real-time-PCR analysis of transcription levels of E1 and E2 under heat shock conditions (28°C and 32°C) showed that in wild type, transcriptions of E1 and E2 were up-regulated at 28°C, while at 32°C, transcriptions of the two enzymes were below the normal level. In cultivar 981 and cultivar 07-2 of G. lemaneiformis, the transcription levels of the two enzymes were up-regulated at 32°C, and transcription level of cultivar 07-2 was even higher than that of cultivar 981. These results suggest that the UPP plays an important role in high temperature resistance of G. lemaneiformis and the bioactivity of UPP is directly related to the heat-resistant ability of G. lemaneiformis. Copyright © 2013 Elsevier B.V. All rights reserved.

EvoDB: a database of evolutionary rate profiles, associated protein domains and phylogenetic trees for PFAM-A

PubMed Central

Ndhlovu, Andrew; Durand, Pierre M.; Hazelhurst, Scott

2015-01-01

The evolutionary rate at codon sites across protein-coding nucleotide sequences represents a valuable tier of information for aligning sequences, inferring homology and constructing phylogenetic profiles. However, a comprehensive resource for cataloguing the evolutionary rate at codon sites and their corresponding nucleotide and protein domain sequence alignments has not been developed. To address this gap in knowledge, EvoDB (an Evolutionary rates DataBase) was compiled. Nucleotide sequences and their corresponding protein domain data including the associated seed alignments from the PFAM-A (protein family) database were used to estimate evolutionary rate (ω = dN/dS) profiles at codon sites for each entry. EvoDB contains 98.83% of the gapped nucleotide sequence alignments and 97.1% of the evolutionary rate profiles for the corresponding information in PFAM-A. As the identification of codon sites under positive selection and their position in a sequence profile is usually the most sought after information for molecular evolutionary biologists, evolutionary rate profiles were determined under the M2a model using the CODEML algorithm in the PAML (Phylogenetic Analysis by Maximum Likelihood) suite of software. Validation of nucleotide sequences against amino acid data was implemented to ensure high data quality. EvoDB is a catalogue of the evolutionary rate profiles and provides the corresponding phylogenetic trees, PFAM-A alignments and annotated accession identifier data. In addition, the database can be explored and queried using known evolutionary rate profiles to identify domains under similar evolutionary constraints and pressures. EvoDB is a resource for evolutionary, phylogenetic studies and presents a tier of information untapped by current databases. Database URL: http://www.bioinf.wits.ac.za/software/fire/evodb PMID:26140928

EvoDB: a database of evolutionary rate profiles, associated protein domains and phylogenetic trees for PFAM-A.

PubMed

Ndhlovu, Andrew; Durand, Pierre M; Hazelhurst, Scott

2015-01-01

The evolutionary rate at codon sites across protein-coding nucleotide sequences represents a valuable tier of information for aligning sequences, inferring homology and constructing phylogenetic profiles. However, a comprehensive resource for cataloguing the evolutionary rate at codon sites and their corresponding nucleotide and protein domain sequence alignments has not been developed. To address this gap in knowledge, EvoDB (an Evolutionary rates DataBase) was compiled. Nucleotide sequences and their corresponding protein domain data including the associated seed alignments from the PFAM-A (protein family) database were used to estimate evolutionary rate (ω = dN/dS) profiles at codon sites for each entry. EvoDB contains 98.83% of the gapped nucleotide sequence alignments and 97.1% of the evolutionary rate profiles for the corresponding information in PFAM-A. As the identification of codon sites under positive selection and their position in a sequence profile is usually the most sought after information for molecular evolutionary biologists, evolutionary rate profiles were determined under the M2a model using the CODEML algorithm in the PAML (Phylogenetic Analysis by Maximum Likelihood) suite of software. Validation of nucleotide sequences against amino acid data was implemented to ensure high data quality. EvoDB is a catalogue of the evolutionary rate profiles and provides the corresponding phylogenetic trees, PFAM-A alignments and annotated accession identifier data. In addition, the database can be explored and queried using known evolutionary rate profiles to identify domains under similar evolutionary constraints and pressures. EvoDB is a resource for evolutionary, phylogenetic studies and presents a tier of information untapped by current databases. © The Author(s) 2015. Published by Oxford University Press.

DNA Sequence-Dependent Ionic Currents in Ultra-Small Solid-State Nanopores†

PubMed Central

Comer, Jeffrey

2016-01-01

Measurements of ionic currents through nanopores partially blocked by DNA have emerged as a powerful method for characterization of the DNA nucleotide sequence. Although the effect of the nucleotide sequence on the nanopore blockade current has been experimentally demonstrated, prediction and interpretation of such measurements remain a formidable challenge. Using atomic resolution computational approaches, here we show how the sequence, molecular conformation, and pore geometry affect the blockade ionic current in model solid-state nanopores. We demonstrate that the blockade current from a DNA molecule is determined by the chemical identities and conformations of at least three consecutive nucleotides. We find the blockade currents produced by the nucleotide triplets to vary considerably with their nucleotide sequence despite having nearly identical molecular conformations. Encouragingly, we find blockade current differences as large as 25% for single-base substitutions in ultra small (1.6 nm × 1.1 nm cross section; 2 nm length) solid-state nanopores. Despite the complex dependence of the blockade current on the sequence and conformation of the DNA triplets, we find that, under many conditions, the number of thymine bases is positively correlated with the current, whereas the number of purine bases and the presence of both purine and pyrimidines in the triplet are negatively correlated with the current. Based on these observations, we construct a simple theoretical model that relates the ion current to the base content of a solid-state nanopore. Furthermore, we show that compact conformations of DNA in narrow pores provide the greatest signal-to-noise ratio for single base detection, whereas reduction of the nanopore length increases the ionic current noise. Thus, the sequence dependence of nanopore blockade current can be theoretically rationalized, although the predictions will likely need to be customized for each nanopore type. PMID:27103233

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

PubMed

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

Vacuolar H[sup +]-ATPase 69-kilodalton catalytic subunit cDNA from developing cotton (Gossypium hirsutum) ovules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilkins, T.A.

1993-06-01

This study investigates the molecular events of vacuole ontogeny in rapidly elongated cotton plant cells. Within the DNA coding region, the cotton and carrot cDNA clones exhibit 82.2% nucleotide sequence homology; at the amino acid level cotton and carrot catalytic subunits exhibited 95.7% identity and 2.1% amino acid similarity. When aligned with the analogous sequences from yeast, the cotton protein shared only 60.5% amino acid identity and 12.7% similarity. 10 refs., 1 tab.

Sequence-specific bias correction for RNA-seq data using recurrent neural networks.

PubMed

Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru

2017-01-25

The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.

Nucleotide diversity and linkage disequilibrium in wild avocado (Persea americana Mill.).

PubMed

Chen, Haofeng; Morrell, Peter L; de la Cruz, Marlene; Clegg, Michael T

2008-01-01

Resequencing studies provide the ultimate resolution of genetic diversity because they identify all mutations in a gene that are present within the sampled individuals. We report a resequencing study of Persea americana, a subtropical tree species native to Meso- and Central America and the progenitor of cultivated avocado. The sample includes 21 wild accessions from Mexico, Costa Rica, Ecuador, and the Dominican Republic. Estimated levels of nucleotide polymorphism and linkage disequilibrium (LD) are obtained from fully resolved haplotype data from 4 nuclear loci that span 5960 nucleotide sites. Results show that, although avocado is a subtropical tree crop and a predominantly outcrossing plant, the overall level of genetic variation is not exceptionally high (nucleotide diversity at silent sites, pi(sil) = 0.0102) compared with available estimates from temperate plant species. Intralocus LD decays rapidly to half the initial value within about 1 kb. Estimates of recombination rate (based on the sequence data) show that the rate is not exceptionally high when compared with annual plants such as wild barley or maize. Interlocus LD is significant owing to substantial population structure induced by mixing of the 3 botanical races of avocado.

[Genetic characterization of different populations of Rhopilema esculentum based on the mitochondrial COI sequence.

PubMed

Li, Yu Long; Dong, Jing; Wang, Bin; Li, Yi Ping; Yu, Xu Guang; Fu, Jie; Wang, Wen Bo

2016-07-01

To investigate the genetic characterization and population genetic structure of Rhopilema esculentum, we sequenced the mtDNA COI gene (624 bp) in 56 individuals collected from Liaodong Bay and the Ganghwado Island in the estuarine waters of the Han River. In addition, the homologous sequences of other 15 individuals which were sampled from the Bohai and Yellow seas and Sea of Japan were analyzed. A total of 28 polymorphic nucleotide sites were detected among the 71 individuals, which defined 32 haplotypes. Haplotype diversity levels were high (0.91±0.06-0.94±0.01) in R. esculentum populations, whereas those of nucleotide diversity were moderate to low [(0.60±0.34)%-(0.68±0.40)%]. Compared with several other giant jellyfish species, the variation level of R. esculentum was high. Phylogeographic analysis of the COI region revealed two lineages. The pairwise F ST comparison and hierarchical molecular variance analysis (AMOVA) showed that significant population structure existed throughout the range of R. esculentum. The results of this study indicated that the life-cycle characteristics, together with possible anthropogenic introduction such as stock enhancement and the prevailing ocean currents in this region, were proposed as the main factors that determined the genetic patterns of R. esculentum.

Novel Detection of Insecticide Resistance Related P450 Genes and Transcriptome Analysis of the Hemimetabolous Pest Erthesina fullo (Thunberg) (Hemiptera: Heteroptera).

PubMed

Liu, Yang; Wu, Haoyang; Xie, Qiang; Bu, Wenjun

2015-01-01

Erthesina fullo (Thunberg, 1783) is an economically important heteropteran species in China. Since only three nucleotide sequences of this species (COI, 16S rRNA, and 18S rRNA) appear in the GenBank database so far, no analysis of the molecular mechanisms underlying E. fullo's resistance to insecticide and environmental stress has been accomplished. We reported a de novo assembled and annotated transcriptome for adult E. fullo using the Illumina sequence system. A total of 53,359,458 clean reads of 4.8 billion nucleotides (nt) were assembled into 27,488 unigenes with an average length of 750 bp, of which 17,743 (64.55%) were annotated. In the present study, we identified 88 putative cytochrome P450 sequences and analyzed the evolution of cytochrome P450 superfamilies, genes of the CYP3 clan related to metabolizing xenobiotics and plant natural compounds, in E. fullo, increasing the candidate genes for the molecular mechanisms of insecticide resistance in P450. The sequenced transcriptome greatly expands the available genomic information and could allow a better understanding of the mechanisms of insecticide resistance at the systems biology level.

Droplet-Based Pyrosequencing Using Digital Microfluidics

PubMed Central

Boles, Deborah J.; Benton, Jonathan L.; Siew, Germaine J.; Levy, Miriam H.; Thwar, Prasanna K.; Sandahl, Melissa A.; Rouse, Jeremy L.; Perkins, Lisa C.; Sudarsan, Arjun P.; Jalili, Roxana; Pamula, Vamsee K.; Srinivasan, Vijay; Fair, Richard B.; Griffin, Peter B.; Eckhardt, Allen E.; Pollack, Michael G.

2013-01-01

The feasibility of implementing pyrosequencing chemistry within droplets using electrowetting-based digital microfluidics is reported. An array of electrodes patterned on a printed-circuit board was used to control the formation, transportation, merging, mixing, and splitting of submicroliter-sized droplets contained within an oil-filled chamber. A three-enzyme pyrosequencing protocol was implemented in which individual droplets contained enzymes, deoxyribonucleotide triphosphates (dNTPs), and DNA templates. The DNA templates were anchored to magnetic beads which enabled them to be thoroughly washed between nucleotide additions. Reagents and protocols were optimized to maximize signal over background, linearity of response, cycle efficiency, and wash efficiency. As an initial demonstration of feasibility, a portion of a 229 bp Candida parapsilosis template was sequenced using both a de novo protocol and a resequencing protocol. The resequencing protocol generated over 60 bp of sequence with 100% sequence accuracy based on raw pyrogram levels. Excellent linearity was observed for all of the homopolymers (two, three, or four nucleotides) contained in the C. parapsilosis sequence. With improvements in microfluidic design it is expected that longer reads, higher throughput, and improved process integration (i.e., “sample-to-sequence” capability) could eventually be achieved using this low-cost platform. PMID:21932784

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed

Levis, R; Schlesinger, S; Huang, H V

1990-04-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.

Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

PubMed Central

Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

2016-01-01

Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

Molecular detection of viral agents in free-ranging and captive neotropical felids in Brazil.

PubMed

Furtado, Mariana M; Taniwaki, Sueli A; de Barros, Iracema N; Brandão, Paulo E; Catão-Dias, José L; Cavalcanti, Sandra; Cullen, Laury; Filoni, Claudia; Jácomo, Anah T de Almeida; Jorge, Rodrigo S P; Silva, Nairléia Dos Santos; Silveira, Leandro; Ferreira Neto, José S

2017-09-01

We describe molecular testing for felid alphaherpesvirus 1 (FHV-1), carnivore protoparvovirus 1 (CPPV-1), feline calicivirus (FCV), alphacoronavirus 1 (feline coronavirus [FCoV]), feline leukemia virus (FeLV), feline immunodeficiency virus (FIV), and canine distemper virus (CDV) in whole blood samples of 109 free-ranging and 68 captive neotropical felids from Brazil. Samples from 2 jaguars ( Panthera onca) and 1 oncilla ( Leopardus tigrinus) were positive for FHV-1; 2 jaguars, 1 puma ( Puma concolor), and 1 jaguarundi ( Herpairulus yagouaroundi) tested positive for CPPV-1; and 1 puma was positive for FIV. Based on comparison of 103 nucleotides of the UL24-UL25 gene, the FHV-1 sequences were 99-100% similar to the FHV-1 strain of domestic cats. Nucleotide sequences of CPPV-1 were closely related to sequences detected in other wild carnivores, comparing 294 nucleotides of the VP1 gene. The FIV nucleotide sequence detected in the free-ranging puma, based on comparison of 444 nucleotides of the pol gene, grouped with other lentiviruses described in pumas, and had 82.4% identity with a free-ranging puma from Yellowstone Park and 79.5% with a captive puma from Brazil. Our data document the circulation of FHV-1, CPPV-1, and FIV in neotropical felids in Brazil.

A space-efficient algorithm for local similarities.

PubMed

Huang, X Q; Hardison, R C; Miller, W

1990-10-01

Existing dynamic-programming algorithms for identifying similar regions of two sequences require time and space proportional to the product of the sequence lengths. Often this space requirement is more limiting than the time requirement. We describe a dynamic-programming local-similarity algorithm that needs only space proportional to the sum of the sequence lengths. The method can also find repeats within a single long sequence. To illustrate the algorithm's potential, we discuss comparison of a 73,360 nucleotide sequence containing the human beta-like globin gene cluster and a corresponding 44,594 nucleotide sequence for rabbit, a problem well beyond the capabilities of other dynamic-programming software.

RoboOligo: software for mass spectrometry data to support manual and de novo sequencing of post-transcriptionally modified ribonucleic acids

PubMed Central

Sample, Paul J.; Gaston, Kirk W.; Alfonzo, Juan D.; Limbach, Patrick A.

2015-01-01

Ribosomal ribonucleic acid (RNA), transfer RNA and other biological or synthetic RNA polymers can contain nucleotides that have been modified by the addition of chemical groups. Traditional Sanger sequencing methods cannot establish the chemical nature and sequence of these modified-nucleotide containing oligomers. Mass spectrometry (MS) has become the conventional approach for determining the nucleotide composition, modification status and sequence of modified RNAs. Modified RNAs are analyzed by MS using collision-induced dissociation tandem mass spectrometry (CID MS/MS), which produces a complex dataset of oligomeric fragments that must be interpreted to identify and place modified nucleosides within the RNA sequence. Here we report the development of RoboOligo, an interactive software program for the robust analysis of data generated by CID MS/MS of RNA oligomers. There are three main functions of RoboOligo: (i) automated de novo sequencing via the local search paradigm. (ii) Manual sequencing with real-time spectrum labeling and cumulative intensity scoring. (iii) A hybrid approach, coined ‘variable sequencing’, which combines the user intuition of manual sequencing with the high-throughput sampling of automated de novo sequencing. PMID:25820423

Diagnosis and genetic analysis of Japanese encephalitis virus infected in horses.

PubMed

Lian, W C; Liau, M Y; Mao, C L

2002-10-01

Nervous disorders were found in two horses and verified as aseptic encephalitis by necropsy in the summer of 2000. To investigate agents that affected the horses, diagnostic procedures involving virus isolation, neutralization test and reverse transcription-polymerase chain reaction (RT-PCR) were performed. We intracranially inoculated litters of suckling mice with tissues suspected of containing aseptic encephalitis, including cerebrum, cerebellum, brain stem, thalamus, and cerebrospinal fluids; the mice were then observed for 14 days. Neutralizing antibodies against Japanese encephalitis (JE) viruses were present in the cerebrospinal fluid of the horses in titers of 10. Sequences of 500 nucleotides of the premembrane gene of JE virus, synthesized by RT-PCR, from both the cerebrum and cerebellum were determined. The phylogenetic analysis based on sequences of the premembrane gene revealed a relationship with the JE virus. The divergences at the nucleotide level of 1.2-5.7% and at the amino acid level of 0-4.3% were conserved with other JE strains. The results demonstrated that the pathogens causing equine encephalitis were JE viruses. The strains were closely related to Taiwanese isolates.

Molecular characterization of a novel rhabdovirus infecting blackcurrant identified by high-throughput sequencing.

PubMed

Wu, L-P; Yang, T; Liu, H-W; Postman, J; Li, R

2018-05-01

A large contig with sequence similarities to several nucleorhabdoviruses was identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genome sequence of this new nucleorhabdovirus is 14,432 nucleotides long. Its genomic organization is very similar to those of unsegmented plant rhabdoviruses, containing six open reading frames in the order 3'-N-P-P3-M-G-L-5. The virus, which is provisionally named "black currant-associated rhabdovirus", is 41-52% identical in its genome nucleotide sequence to other nucleorhabdoviruses and may represent a new species in the genus Nucleorhabdovirus.

Differential sequence diversity at merozoite surface protein-1 locus of Plasmodium knowlesi from humans and macaques in Thailand.

PubMed

Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai

2013-08-01

To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

First Complete Genome Sequence of an Isolate of Tomato Mottle Mosaic Virus Infecting Plants of Solanum lycopersicum in South America.

PubMed

Nagai, Alice; Duarte, Lígia M L; Chaves, Alexandre L R; Alexandre, Maria A V; Ramos-González, Pedro L; Chabi-Jesus, Camila; Harakava, Ricardo; Dos Santos, Déborah Y A C

2018-05-10

The complete nucleotide sequence of an isolate of tomato mottle mosaic virus (ToMMV) was determined. The virus, originally isolated from symptomatic tomato plants found in a county near the city of São Paulo, Brazil, has a genome with 99% nucleotide sequence identity with ToMMV from Mexico, China, Spain, and the United States. Copyright © 2018 Nagai et al.

Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

PubMed

Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

2010-05-07

Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

LISTA, LISTA-HOP and LISTA-HON: a comprehensive compilation of protein encoding sequences and its associated homology databases from the yeast Saccharomyces.

PubMed Central

Dölz, R; Mossé, M O; Slonimski, P P; Bairoch, A; Linder, P

1996-01-01

We continued our effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. As in previous editions the genetic names are consistently associated to each sequence with a known and confirmed ORF. If necessary, synonyms are given in the case of allelic duplicated sequences. Although the first publication of a sequence gives-according to our rules-the genetic name of a gene, in some instances more commonly used names are given to avoid nomenclature problems and the use of ancient designations which are no longer used. In these cases the old designation is given as synonym. Thus sequences can be found either by the name or by synonyms given in LISTA. Each entry contains the genetic name, the mnemonic from the EMBL data bank, the codon bias, reference of the publication of the sequence, Chromosomal location as far as known, SWISSPROT and EMBL accession numbers. New entries will also contain the name from the systematic sequencing efforts. Since the release of LISTA4.1 we update the database continuously. To obtain more information on the included sequences, each entry has been screened against non-redundant nucleotide and protein data bank collections resulting in LISTA-HON and LISTA-HOP. This release includes reports from full Smith and Watermann peptide-level searches against a non-redundant protein sequence database. The LISTA data base can be linked to the associated data sets or to nucleotide and protein banks by the Sequence Retrieval System (SRS). The database is available by FTP and on World Wide Web. PMID:8594599

A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

USDA-ARS?s Scientific Manuscript database

Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

Apyrase (Nucleoside Triphosphate-Diphosphohydrolase) and Extracellular Nucleotides Regulate Cotton Fiber Elongation in Cultured Ovules1[W][OA

PubMed Central

Clark, Greg; Torres, Jonathan; Finlayson, Scott; Guan, Xueying; Handley, Craig; Lee, Jinsuk; Kays, Julia E.; Chen, Z. Jeffery; Roux, Stanley J.

2010-01-01

Ectoapyrase enzymes remove the terminal phosphate from extracellular nucleoside tri- and diphosphates. In Arabidopsis (Arabidopsis thaliana), two ectoapyrases, AtAPY1 and AtAPY2, have been implicated as key modulators of growth. In fibers of cotton (Gossypium hirsutum), transcript levels for GhAPY1 and GhAPY2, two closely related ectoapyrases that have high sequence similarity to AtAPY1 and AtAPY2, are up-regulated when fibers enter their rapid growth phase. In an ovule culture system, fibers release ATP as they grow, and when their ectoapyrase activity is blocked by the addition of polyclonal anti-apyrase antibodies or by two different small molecule inhibitors, the medium ATP level rises and fiber growth is suppressed. High concentrations of the poorly hydrolyzable nucleotides ATPγS and ADPβS applied to the medium inhibit fiber growth, and low concentrations of them stimulate growth, but treatment with adenosine 5′-O-thiomonophosphate causes no change in the growth rate. Both the inhibition and stimulation of growth by applied nucleotides can be blocked by an antagonist that blocks purinoceptors in animal cells, and by adenosine. Treatment of cotton ovule cultures with ATPγS induces increased levels of ethylene, and two ethylene antagonists, aminovinylglycine and silver nitrate, block both the growth stimulatory and growth inhibitory effects of applied nucleotides. In addition, the ethylene precursor, 1-aminocyclopropane-1-carboxylic acid, lowers the concentration of nucleotide needed to promote fiber growth. These data indicate that ectoapyrases and extracellular nucleotides play a significant role in regulating cotton fiber growth and that ethylene is a likely downstream component of the signaling pathway. PMID:20018604

Gause's Principle and the Effect of Resource Partitioning on the Dynamical Coexistence of Replicating Templates

PubMed Central

Szilágyi, András; Zachar, István; Szathmáry, Eörs

2013-01-01

Models of competitive template replication, although basic for replicator dynamics and primordial evolution, have not yet taken different sequences explicitly into account, neither have they analyzed the effect of resource partitioning (feeding on different resources) on coexistence. Here we show by analytical and numerical calculations that Gause's principle of competitive exclusion holds for template replicators if resources (nucleotides) affect growth linearly and coexistence is at fixed point attractors. Cases of complementary or homologous pairing between building blocks with parallel or antiparallel strands show no deviation from the rule that the nucleotide compositions of stably coexisting species must be different and there cannot be more coexisting replicator species than nucleotide types. Besides this overlooked mechanism of template coexistence we show also that interesting sequence effects prevail as parts of sequences that are copied earlier affect coexistence more strongly due to the higher concentration of the corresponding replication intermediates. Template and copy always count as one species due their constraint of strict stoichiometric coupling. Stability of fixed-point coexistence tends to decrease with the length of sequences, although this effect is unlikely to be detrimental for sequences below 100 nucleotides. In sum, resource partitioning (niche differentiation) is the default form of competitive coexistence for replicating templates feeding on a cocktail of different nucleotides, as it may have been the case in the RNA world. Our analysis of different pairing and strand orientation schemes is relevant for artificial and potentially astrobiological genetics. PMID:23990769

Genome Survey Sequencing of Luffa Cylindrica L. and Microsatellite High Resolution Melting (SSR-HRM) Analysis for Genetic Relationship of Luffa Genotypes.

PubMed

An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin

2017-09-11

Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica , about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N 50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both "Zheda 23" and "Zheda 83". Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species.

Genetic structure and genealogy in the Sphagnum subsecundum complex (Sphagnaceae: Bryophyta).

PubMed

Shaw, A J; Pokorny, L; Shaw, B; Ricca, M; Boles, S; Szövényi, P

2008-10-01

Allopolyploidy is probably the most extensively studied mode of plant speciation and allopolyploid species appear to be common in the mosses (Bryophyta). The Sphagnum subsecundum complex includes species known to be gametophytically haploid or diploid, and it has been proposed that the diploids (i.e., with tetraploid sporophytes) are allopolyploids. Nucleotide sequence and microsatellite variation among haploids and diploids from Newfoundland and Scandinavia indicate that (1) the diploids exhibit fixed or nearly fixed heterozygosity at the majority of loci sampled, and are clearly allopolyploids, (2) diploids originated independently in North America and Europe, (3) the European diploids appear to have the haploid species, S. subsecundum, as the maternal parent based on shared chloroplast DNA haplotypes, (4) the North American diploids do not have the chloroplast DNA of any sampled haploid, (5) both North American and European diploids share nucleotide and microsatellite similarities with S. subsecundum, (6) the diploids harbor more nucleotide and microsatellite diversity than the haploids, and (7) diploids exhibit higher levels of linkage disequilibrium among microsatellite loci. An experiment demonstrates significant artifactual recombination between interspecific DNAs coamplified by PCR, which may be a complicating factor in the interpretation of sequence-based analyses of allopolyploids.

Rolling circle amplification-based analysis of Sri Lankan cassava mosaic virus isolates from Tamil Nadu, India, suggests a low level of genetic variability.

PubMed

Kushawaha, Akhilesh Kumar; Rabindran, Ramalingam; Dasgupta, Indranil

2018-03-01

Cassava mosaic disease is a widespread disease of cassava in south Asia and the African continent. In India, CMD is known to be caused by two single-stranded DNA viruses (geminiviruses), Indian cassava mosaic virus (ICMV) and Sri Lankan cassava mosdaic virus (SLCMV). Previously, the diversity of ICMV and SLCMV in India has been studied using PCR, a sequence-dependent method. To have a more in-depth study of the variability of the above viruses and to detect any novel geminiviruses associated with CMD, sequence-independent amplification using rolling circle amplification (RCA)-based methods were used. CMD affected cassava plants were sampled across eighty locations in nine districts of the southern Indian state of Tamil Nadu. Twelve complete sequence of coat protein genes of the resident geminiviruses, comprising 256 amino acid residues were generated from the above samples, which indicated changes at only six positions. RCA followed by RFLP of the 80 samples indicated that most samples (47) contained only SLCMV, followed by 8, which were infected jointly with ICMV and SLCMV. In 11 samples, the pattern did not match the expected patterns from either of the two viruses and hence, were variants. Sequence analysis of an average of 700 nucleotides from 31 RCA-generated fragments of the variants indicated identities of 97-99% with the sequence of a previously reported infectious clone of SLCMV. The evidence suggests low levels of genetic variability in the begomoviruses infecting cassava, mainly in the form of scattered single nucleotide changes.

Serotype and genetic diversity of human rhinovirus strains that circulated in Kenya in 2008.

PubMed

Milanoi, Sylvia; Ongus, Juliette R; Gachara, George; Coldren, Rodney; Bulimo, Wallace

2016-05-01

Human rhinoviruses (HRVs) are a well-established cause of the common cold and recent studies indicated that they may be associated with severe acute respiratory illnesses (SARIs) like pneumonia, asthma, and bronchiolitis. Despite global studies on the genetic diversity of the virus, the serotype diversity of these viruses across diverse geographic regions in Kenya has not been characterized. This study sought to characterize the serotype diversity of HRV strains that circulated in Kenya in 2008. A total of 517 archived nasopharyngeal samples collected in a previous respiratory virus surveillance program across Kenya in 2008 were selected. Participants enrolled were outpatients who presented with influenza-like (ILI) symptoms. Real-time RT-PCR was employed for preliminary HRV detection. HRV-positive samples were amplified using RT-PCR and thereafter the nucleotide sequences of the amplicons were determined followed by phylogenetic analysis. Twenty-five percent of the samples tested positive for HRV. Phylogenetic analysis revealed that the Kenyan HRVs clustered into three main species comprising HRV-A (54%), HRV-B (12%), and HRV-C (35%). Overall, 20 different serotypes were identified. Intrastrain sequence homology among the Kenyan strains ranged from 58% to 100% at the nucleotide level and 55% to 100% at the amino acid level. These results show that a wide range of HRV serotypes with different levels of nucleotide variation were present in Kenya. Furthermore, our data show that HRVs contributed substantially to influenza-like illness in Kenya in 2008. © 2016 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.

Characterization and mapping of the human rhodopsin kinase gene and screening of the gene for mutations in patients with retinitis pigmentosa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khani, S.C.; Lin, D.; Magovcevic, I.

1994-09-01

Rhodopsin kinase (RK) is a cytosolic enzyme in rod photoreceptors that initiates the deactivation of the phototransductions cascade by phosphorylating photoactivated rhodopsin. Although the cDNA sequence of bovine RK has been determined previously, no human cDNA or genomic sequence has thus far been available for genetic studies. In order to investigate the possible role of this candidate gene in retinitis pigmentosa (RP) and allied diseases, we have isolated and characterized human cDNA and genomic clones derived from the RK locus. The coding sequence of the human gene is 1692 nucleotides in length and is split into seven exons. The humanmore » and the bovine sequence show 84% identity at the nucleotide level and 92% identity at the amino acid level. Thus far, the intronic sequences flanking each exon except for one have been determined. We have also mapped the human RK gene to chromosome 13q34 using fluorescence in situ hybridization. To our knowledge, no RP gene has as yet been linked to this region. However, since the substrate for RK (rhodopsin) and other members of the phototransduction cascade have been implicated in the pathogenesis of RP, it is conceivable that defects in RK can also cause some forms of this disease. We are evaluating this possibility by screening DNA from 173 patients with autosomal recessive RP and 190 patients with autosomal dominant RP. So far, we have found 11 patients with variant bands. In one patient with autosomal dominant RP we discovered the missense change Ser536Leu. Cosegregation studies and further sequencing of the variant bands are currently underway.« less

Phylogenic analysis of human bocavirus detected in children with acute respiratory infection in Yaounde, Cameroon.

PubMed

Kenmoe, Sebastien; Vernet, Marie-Astrid; Njankouo-Ripa, Mohamadou; Penlap, Véronique Beng; Vabret, Astrid; Njouom, Richard

2017-07-17

Human Bocavirus (HBoV) was first identified in 2005 and has been shown to be a common cause of respiratory infections and gastroenteritis in children. In a recent study, we found that 10.7% of children with acute respiratory infections (ARI) were infected by HBoV. Genetic characterization of this virus remains unknown in Central Africa, particularly in Cameroon Leeding us to evaluate the molecular characteristics of HBoV strains in Cameroonian children with ARI. Phylogenetic analysis of partial HBoV VP1/2 sequences showed a low level of nucleotide variation and the circulation of HBoV genotype 1 (HBoV-1) only. Three clades were obtained, two clustering with each of the reference strains ST1 and ST2, and a third group consisting of only Cameroon strains. By comparing with the Swedish reference sequences, ST1 and ST2, Cameroon sequences showed nucleotide and amino acid similarities of respectively 97.36-100% and 98.35-100%. These results could help improve strategies for monitoring and control of respiratory infections in Cameroon.

Drosophila Melanogaster Mitochondrial DNA: Gene Organization and Evolutionary Considerations

PubMed Central

Garesse, R.

1988-01-01

The sequence of a 8351-nucleotide mitochondrial DNA (mtDNA) fragment has been obtained extending the knowledge of the Drosophila melanogaster mitochondrial genome to 90% of its coding region. The sequence encodes seven polypeptides, 12 tRNAs and the 3' end of the 16S rRNA and CO III genes. The gene organization is strictly conserved with respect to the Drosophila yakuba mitochondrial genome, and different from that found in mammals and Xenopus. The high A + T content of D. melanogaster mitochondrial DNA is reflected in a reiterative codon usage, with more than 90% of the codons ending in T or A, G + C rich codons being practically absent. The average level of homology between the D. melanogaster and D. yakuba sequences is very high (roughly 94%), although insertion and deletions have been detected in protein, tRNA and large ribosomal genes. The analysis of nucleotide changes reveals a similar frequency for transitions and transversions, and reflects a strong bias against G+C on both strands. The predominant type of transition is strand specific. PMID:3130291

Structural Analysis of Biodiversity

PubMed Central

Sirovich, Lawrence; Stoeckle, Mark Y.; Zhang, Yu

2010-01-01

Large, recently-available genomic databases cover a wide range of life forms, suggesting opportunity for insights into genetic structure of biodiversity. In this study we refine our recently-described technique using indicator vectors to analyze and visualize nucleotide sequences. The indicator vector approach generates correlation matrices, dubbed Klee diagrams, which represent a novel way of assembling and viewing large genomic datasets. To explore its potential utility, here we apply the improved algorithm to a collection of almost 17000 DNA barcode sequences covering 12 widely-separated animal taxa, demonstrating that indicator vectors for classification gave correct assignment in all 11000 test cases. Indicator vector analysis revealed discontinuities corresponding to species- and higher-level taxonomic divisions, suggesting an efficient approach to classification of organisms from poorly-studied groups. As compared to standard distance metrics, indicator vectors preserve diagnostic character probabilities, enable automated classification of test sequences, and generate high-information density single-page displays. These results support application of indicator vectors for comparative analysis of large nucleotide data sets and raise prospect of gaining insight into broad-scale patterns in the genetic structure of biodiversity. PMID:20195371

Resolving the tips of the tree of life: How much mitochondrialdata doe we need?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bonett, Ronald M.; Macey, J. Robert; Boore, Jeffrey L.

2005-04-29

Mitochondrial (mt) DNA sequences are used extensively to reconstruct evolutionary relationships among recently diverged animals,and have constituted the most widely used markers for species- and generic-level relationships for the last decade or more. However, most studies to date have employed relatively small portions of the mt-genome. In contrast, complete mt-genomes primarily have been used to investigate deep divergences, including several studies of the amount of mt sequence necessary to recover ancient relationships. We sequenced and analyzed 24 complete mt-genomes from a group of salamander species exhibiting divergences typical of those in many species-level studies. We present the first comprehensive investigationmore » of the amount of mt sequence data necessary to consistently recover the mt-genome tree at this level, using parsimony and Bayesian methods. Both methods of phylogenetic analysis revealed extremely similar results. A surprising number of well supported, yet conflicting, relationships were found in trees based on fragments less than {approx}2000 nucleotides (nt), typical of the vast majority of the thousands of mt-based studies published to date. Large amounts of data (11,500+ nt) were necessary to consistently recover the whole mt-genome tree. Some relationships consistently were recovered with fragments of all sizes, but many nodes required the majority of the mt-genome to stabilize, particularly those associated with short internal branches. Although moderate amounts of data (2000-3000 nt) were adequate to recover mt-based relationships for which most nodes were congruent with the whole mt-genome tree, many thousands of nucleotides were necessary to resolve rapid bursts of evolution. Recent advances in genomics are making collection of large amounts of sequence data highly feasible, and our results provide the basis for comparative studies of other closely related groups to optimize mt sequence sampling and phylogenetic resolution at the ''tips'' of the Tree of Life.« less

The styryl dye FM1-43 suppresses odorant responses in a subset of olfactory neurons by blocking cyclic nucleotide-gated (CNG) channels.

PubMed

Breunig, Esther; Kludt, Eugen; Czesnik, Dirk; Schild, Detlev

2011-08-12

Many olfactory receptor neurons use a cAMP-dependent transduction mechanism to transduce odorants into depolarizations. This signaling cascade is characterized by a sequence of two currents: a cation current through cyclic nucleotide-gated channels followed by a chloride current through calcium-activated chloride channels. To date, it is not possible to interfere with these generator channels under physiological conditions with potent and specific blockers. In this study we identified the styryl dye FM1-43 as a potent blocker of native olfactory cyclic nucleotide-gated channels. Furthermore, we characterized this substance to stain olfactory receptor neurons that are endowed with cAMP-dependent transduction. This allows optical differentiation and pharmacological interference with olfactory receptor neurons at the level of the signal transduction.

Masking as an effective quality control method for next-generation sequencing data analysis.

PubMed

Yun, Sajung; Yun, Sijung

2014-12-13

Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

Characterization of the repetitive DNA elements in the genome of fish lymphocystis disease viruses.

PubMed

Schnitzler, P; Darai, G

1989-09-01

The complete DNA nucleotide sequence of the repetitive DNA elements in the genome of fish lymphocystis disease virus (FLDV) isolated from two different species (flounder and dab) was determined. The size of these repetitive DNA elements was found to be 1413 bp which corresponds to the DNA sequences of the 5' terminus of the EcoRI DNA fragment B (0.034 to 0.052 m.u.) and to the EcoRI DNA fragment M (0.718 to 0.736 m.u.) of the FLDV genome causing lymphocystis disease in flounder and plaice. The degree of DNA nucleotide homology between both regions was found to be 99%. The repetitive DNA element in the genome of FLDV isolated from other fish species (dab) was identified and is located within the EcoRI DNA fragment B and J of the viral genome. The DNA nucleotide sequence of one duplicate of this repetition (EcoRI DNA fragment J) was determined (1410 bp) and compared to the DNA nucleotide sequences of the repetitive DNA elements of the genome of FLDV isolated from flounder. It was found that the repetitive DNA elements of the genome of FLDV derived from two different fish species are highly conserved and possess a degree of DNA sequence homology of 94%. The DNA sequences of each strand of the individual repetitive element possess one open reading frame.

ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

PubMed

Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

2012-09-08

The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

PubMed Central

2012-01-01

Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

Adenovirus EIIA early promoter: transcriptional control elements and induction by the viral pre-early EIA gene, which appears to be sequence independent.

PubMed Central

Murthy, S C; Bhat, G P; Thimmappaya, B

1985-01-01

A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577

Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

USDA-ARS?s Scientific Manuscript database

Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

An integrated genetic linkage map of watermelon and genetic diversity based on single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers

USDA-ARS?s Scientific Manuscript database

Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...

A new begomovirus associated with alpha- and betasatellite molecules isolated from Vernonia cinerea in China.

PubMed

Zulfiqar, Awais; Zhang, Jie; Cui, Xiaofeng; Qian, Yajuan; Zhou, Xueping; Xie, Yan

2012-01-01

A begomovirus disease complex associated with Vernonia cinerea showing yellow vein symptoms was studied. The full-length genomic DNA was comprised of 2739 nucleotides (nt) and contained the typical genome structure of begomoviruses. Comparison analysis showed that it shared the highest (78.9%) nucleotide sequence identity with recently characterized Vernonia yellow vein virus (VeYVV) from India. For associated satellites, betasatellite showed the highest nucleotide sequence identity (52.1%) with Vernonia yellow vein virus betasatellite (VeYVVB) and alphasatellite shared the highest sequence identity (70.7%) with Gossypium mustelinium symptomless alphasatellite (GMusSLA). It is a member of a distinct species with cognate alpha- and betasatellites for which the name Vernonia yellow vein Fujian virus (VeYVFjV) is proposed.

The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

PubMed

Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

2009-01-01

The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed Central

Levis, R; Schlesinger, S; Huang, H V

1990-01-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651

Molecular identification of Trichuris vulpis and Trichuris suis isolated from different hosts.

PubMed

Cutillas, Cristina; de Rojas, Manuel; Ariza, Concepción; Ubeda, José Manuel; Guevara, Diego

2007-01-01

Trichuris suis was isolated from the cecum of two different hosts (Sus scrofa domestica -- swine and Sus scrofa scrofa -- wild boar) and Trichuris vulpis from dogs in Sevilla, Spain. Genomic DNA was isolated and internal transcribed spacers (ITS)1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced using polymerase chain reaction techniques. The sequence of T. suis from both hosts was 1,396 bp in length while that of T. vulpis was 1,044 bp. ITS1 of both populations isolated of T. suis was 661 nucleotides in length, while the ITS2 was 534 nucleotides in length. Furthermore, the ITS1 of T. vulpis was 410 nucleotides in length, while the ITS2 was 433 nucleotides in length. One hundred fifty-four nucleotides were observed along the 5.8S gene of T. suis and T. vulpis. Intraindividual and intraspecific variations were detected in the rDNA of both species. The presence of microsatellites was observed in all the individuals assayed. Sequence analysis of the ITSs and the 5.8S gene has demonstrated no sequence differences between T. suis isolated from both hosts (S. scrofa domestica -- swine and S. scrofa scrofa -- wild boar). Nevertheless, clear differences were detected between the ITS1 and ITS2 of T. suis and T. vulpis. Furthermore, a comparative molecular analysis between both species and the previously published ITS1-5.8S-ITS2 sequence data of Trichuris ovis, Trichuris leporis, Trichuris muris, Trichuris arvicolae, and Trichuris skrjabini was carried out. A common homology zone was detected in the ITS1 sequence of all species of trichurids.

Detection of a novel herpesvirus from bats in the Philippines.

PubMed

Sano, Kaori; Okazaki, Sachiko; Taniguchi, Satoshi; Masangkay, Joseph S; Puentespina, Roberto; Eres, Eduardo; Cosico, Edison; Quibod, Niña; Kondo, Taisuke; Shimoda, Hiroshi; Hatta, Yuuki; Mitomo, Shumpei; Oba, Mami; Katayama, Yukie; Sassa, Yukiko; Furuya, Tetsuya; Nagai, Makoto; Une, Yumi; Maeda, Ken; Kyuwa, Shigeru; Yoshikawa, Yasuhiro; Akashi, Hiroomi; Omatsu, Tsutomu; Mizutani, Tetsuya

2015-08-01

Bats are natural hosts of many zoonotic viruses. Monitoring bat viruses is important to detect novel bat-borne infectious diseases. In this study, next generation sequencing techniques and conventional PCR were used to analyze intestine, lung, and blood clot samples collected from wild bats captured at three locations in Davao region, in the Philippines in 2012. Different viral genes belonging to the Retroviridae and Herpesviridae families were identified using next generation sequencing. The existence of herpesvirus in the samples was confirmed by PCR using herpesvirus consensus primers. The nucleotide sequences of the resulting PCR amplicons were 166-bp. Further phylogenetic analysis identified that the virus from which this nucleotide sequence was obtained belonged to the Gammaherpesvirinae subfamily. PCR using primers specific to the nucleotide sequence obtained revealed that the infection rate among the captured bats was 30 %. In this study, we present the partial genome of a novel gammaherpesvirus detected from wild bats. Our observations also indicate that this herpesvirus may be widely distributed in bat populations in Davao region.

Molecular epidemiology of Plum pox virus in Japan.

PubMed

Maejima, Kensaku; Himeno, Misako; Komatsu, Ken; Takinami, Yusuke; Hashimoto, Masayoshi; Takahashi, Shuichiro; Yamaji, Yasuyuki; Oshima, Kenro; Namba, Shigetou

2011-05-01

For a molecular epidemiological study based on complete genome sequences, 37 Plum pox virus (PPV) isolates were collected from the Kanto region in Japan. Pair-wise analyses revealed that all 37 Japanese isolates belong to the PPV-D strain, with low genetic diversity (less than 0.8%). In phylogenetic analysis of the PPV-D strain based on complete nucleotide sequences, the relationships of the PPV-D strain were reconstructed with high resolution: at the global level, the American, Canadian, and Japanese isolates formed their own distinct monophyletic clusters, suggesting that the routes of viral entry into these countries were independent; at the local level, the actual transmission histories of PPV were precisely reconstructed with high bootstrap support. This is the first description of the molecular epidemiology of PPV based on complete genome sequences.

De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

PubMed Central

Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

2012-01-01

Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

Adrenocorticotropin-dependent precocious puberty of testicular origin in a boy with X-linked adrenal hypoplasia congenita due to a novel mutation in the DAX1 gene.

PubMed

Domenice, S; Latronico, A C; Brito, V N; Arnhold, I J; Kok, F; Mendonca, B B

2001-09-01

Primary adrenal insufficiency is a rare condition in pediatric age, and its association with precocious sexual development is very uncommon. We report a 2-yr-old Brazilian boy with DAX1 gene mutation whose first clinical manifestation was isosexual gonadotropin-independent precocious puberty. He presented with pubic hair, enlarged penis and testes, and advanced bone age. T levels were elevated, whereas basal and GnRH-stimulated LH levels were compatible with a prepubertal pattern. Chronic GnRH agonist therapy did not reduce T levels, supporting the diagnosis of gonadotropin-independent precocious puberty. Testotoxicosis was ruled out after normal sequencing of exon 11 of the LH receptor gene. At age 3 yr he developed clinical and hormonal features of severe primary adrenal insufficiency. The entire coding region of the DAX1 gene was analyzed through direct sequencing. A nucleotide G insertion between nucleotides 430 and 431 in exon 1, resulting in a novel frameshift mutation and a premature stop codon at position 71 of DAX-1, was identified. Surprisingly, steroid replacement therapy induced a clear decrease in testicular size and T levels to the prepubertal range. These findings suggest that chronic excessive ACTH levels resulting from adrenal insufficiency may stimulate Leydig cells and lead to gonadotropin-independent precocious puberty in some boys with DAX1 gene mutations.

Iterative Correction of Reference Nucleotides (iCORN) using second generation sequencing technology.

PubMed

Otto, Thomas D; Sanders, Mandy; Berriman, Matthew; Newbold, Chris

2010-07-15

The accuracy of reference genomes is important for downstream analysis but a low error rate requires expensive manual interrogation of the sequence. Here, we describe a novel algorithm (Iterative Correction of Reference Nucleotides) that iteratively aligns deep coverage of short sequencing reads to correct errors in reference genome sequences and evaluate their accuracy. Using Plasmodium falciparum (81% A + T content) as an extreme example, we show that the algorithm is highly accurate and corrects over 2000 errors in the reference sequence. We give examples of its application to numerous other eukaryotic and prokaryotic genomes and suggest additional applications. The software is available at http://icorn.sourceforge.net

Re-sequencing of the APOAI promoter region and the genetic association of the -75G > A polymorphism with increased cholesterol and low density lipoprotein levels among a sample of the Kuwaiti population

PubMed Central

2013-01-01

Background APOAI, a member of the APOAI/CIII/IV/V gene cluster on chromosome 11q23-24, encodes a major protein component of HDL that has been associated with serum lipid levels. The aim of this study was to determine the genetic association of polymorphisms in the APOAI promoter region with plasma lipid levels in a cohort of healthy Kuwaiti volunteers. Methods A 435 bp region of the APOAI promoter was analyzed by re-sequencing in 549 Kuwaiti samples. DNA was extracted from blood taken from 549 healthy Kuwaiti volunteers who had fasted for the previous 12 h. Univariate and multivariate analysis was used to determine allele association with serum lipid levels. Results The target sequence included a partial segment of the promoter region, 5’UTR and exon 1 located between nucleotides −141 to +294 upstream of the APOAI gene on chromosome 11. No novel single nucleotide polymorphisms (SNPs) were observed. The sequences obtained were deposited with the NCBI GenBank with accession number [GenBank: JX438706]. The allelic frequencies for the three SNPs were as follows: APOAI rs670G = 0.807; rs5069C = 0.964; rs1799837G = 0.997 and found to be in HWE. A significant association (p < 0.05) was observed for the APOAI rs670 polymorphism with increased serum LDL-C. Multivariate analysis showed that APOAI rs670 was an independent predictive factor when controlling for age, sex and BMI for both LDL-C (OR: 1.66, p = 0.014) and TC (OR: 1.77, p = 0.006) levels. Conclusion This study is the first to report sequence analysis of the APOAI promoter in an Arab population. The unexpected positive association found between the APOAI rs670 polymorphism and increased levels of LDL-C and TC may be due to linkage disequilibrium with other polymorphisms in candidate and neighboring genes known to be associated with lipid metabolism and transport. PMID:24028463

Re-sequencing of the APOAI promoter region and the genetic association of the -75G > A polymorphism with increased cholesterol and low density lipoprotein levels among a sample of the Kuwaiti population.

PubMed

Al-Bustan, Suzanne A; Al-Serri, Ahmad E; Annice, Babitha G; Alnaqeeb, Majed A; Ebrahim, Ghada A

2013-09-12

APOAI, a member of the APOAI/CIII/IV/V gene cluster on chromosome 11q23-24, encodes a major protein component of HDL that has been associated with serum lipid levels. The aim of this study was to determine the genetic association of polymorphisms in the APOAI promoter region with plasma lipid levels in a cohort of healthy Kuwaiti volunteers. A 435 bp region of the APOAI promoter was analyzed by re-sequencing in 549 Kuwaiti samples. DNA was extracted from blood taken from 549 healthy Kuwaiti volunteers who had fasted for the previous 12 h. Univariate and multivariate analysis was used to determine allele association with serum lipid levels. The target sequence included a partial segment of the promoter region, 5'UTR and exon 1 located between nucleotides -141 to +294 upstream of the APOAI gene on chromosome 11. No novel single nucleotide polymorphisms (SNPs) were observed. The sequences obtained were deposited with the NCBI GenBank with accession number [GenBank: JX438706]. The allelic frequencies for the three SNPs were as follows: APOAI rs670G = 0.807; rs5069C = 0.964; rs1799837G = 0.997 and found to be in HWE. A significant association (p < 0.05) was observed for the APOAI rs670 polymorphism with increased serum LDL-C. Multivariate analysis showed that APOAI rs670 was an independent predictive factor when controlling for age, sex and BMI for both LDL-C (OR: 1.66, p = 0.014) and TC (OR: 1.77, p = 0.006) levels. This study is the first to report sequence analysis of the APOAI promoter in an Arab population. The unexpected positive association found between the APOAI rs670 polymorphism and increased levels of LDL-C and TC may be due to linkage disequilibrium with other polymorphisms in candidate and neighboring genes known to be associated with lipid metabolism and transport.

Isolated nucleic acids encoding antipathogenic polypeptides and uses thereof

DOEpatents

Altier, Daniel J.; Crane, Virginia C.; Ellanskaya, Irina; Ellanskaya, Natalia; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K.; Schepers, Eric J.; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-04-20

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from fungal fermentation broths. Nucleic acids that encode the antipathogenic polypeptides are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

Nucleotide sequence and proposed secondary structure of Columnea latent viroid: a natural mosaic of viroid sequences.

PubMed Central

Hammond, R; Smith, D R; Diener, T O

1989-01-01

The Columnea latent viroid (CLV) occurs latently in certain Columnea erythrophae plants grown commercially. In potato and tomato, CLV causes potato spindle tuber viroid (PSTV)-like symptoms. Its nucleotide sequence and proposed secondary structure reveal that CLV consists of a single-stranded circular RNA of 370 nucleotides which can assume a rod-like structure with extensive base-pairing characteristic of all known viroids. The electrophoretic mobility of circular CLV under nondenaturing conditions suggests a potential tertiary structure. CLV contains extensive sequence homologies to the PSTV group of viroids but contains a central conserved region identical to that of hop stunt viroid (HSV). CLV also shares some biological properties with each of the two types of viroids. Most probably, CLV is the result of intracellular RNA recombination between an HSV-type and one or more PSTV-type viroids replicating in the same plant. Images PMID:2602114

Two novel heat shock genes encoding proteins produced in response to heterologous protein expression in Escherichia coli.

PubMed Central

Allen, S P; Polazzi, J O; Gierse, J K; Easton, A M

1992-01-01

In Escherichia coli high-level production of some heterologous proteins (specifically, human prorenin, renin, and bovine insulin-like growth factor 2) resulted in the induction of two new E. coli heat shock proteins, both of which have molecular masses of 16 kDa and are tightly associated with inclusion bodies formed during heterologous protein production. We named these inclusion body-associated proteins IbpA and IbpB. The coding sequences for IbpA and IbpB were identified and isolated from the Kohara E. coli gene bank. The genes for these proteins (ibpA and ibpB) are located at 82.5 min on the chromosome. Nucleotide sequencing of the two genes revealed that they are transcribed in the same direction and are separated by 110 bp. Putative Shine-Dalgarno sequences are located upstream from the initiation codons of both genes. A putative heat shock promoter is located upstream from ibpA, and a putative transcription terminator is located downstream from ibpB. A temperature upshift experiment in which we used a wild-type E. coli strain and an isogenic rpoH mutant strain indicated that a sigma 32-containing RNA polymerase is involved in the regulation of expression of these genes. There is 57.5% identity between the genes at the nucleotide level and 52.2% identity at the amino acid level. A search of the protein data bases showed that both of these 16-kDa proteins exhibit low levels of homology to low-molecular-weight heat shock proteins from eukaryotic species. Images PMID:1356969

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts

PubMed Central

Naito, Yuki; Bono, Hidemasa

2012-01-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users. PMID:22641850

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.

PubMed

Naito, Yuki; Bono, Hidemasa

2012-07-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users.

Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

PubMed Central

Schnare, M N; Gray, M W

1982-01-01

In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

The C-terminal Helix of Pseudomonas aeruginosa Elongation Factor Ts Tunes EF-Tu Dynamics to Modulate Nucleotide Exchange.

PubMed

De Laurentiis, Evelina Ines; Mercier, Evan; Wieden, Hans-Joachim

2016-10-28

Little is known about the conservation of critical kinetic parameters and the mechanistic strategies of elongation factor (EF) Ts-catalyzed nucleotide exchange in EF-Tu in bacteria and particularly in clinically relevant pathogens. EF-Tu from the clinically relevant pathogen Pseudomonas aeruginosa shares over 84% sequence identity with the corresponding elongation factor from Escherichia coli Interestingly, the functionally closely linked EF-Ts only shares 55% sequence identity. To identify any differences in the nucleotide binding properties, as well as in the EF-Ts-mediated nucleotide exchange reaction, we performed a comparative rapid kinetics and mutagenesis analysis of the nucleotide exchange mechanism for both the E. coli and P. aeruginosa systems, identifying helix 13 of EF-Ts as a previously unnoticed regulatory element in the nucleotide exchange mechanism with species-specific elements. Our findings support the base side-first entry of the nucleotide into the binding pocket of the EF-Tu·EF-Ts binary complex, followed by displacement of helix 13 and rapid binding of the phosphate side of the nucleotide, ultimately leading to the release of EF-Ts. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Development of a 690K SNP array in catfish and its application for genetic mapping and validation of the reference genome sequence

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) are capable of providing the highest level of genome coverage for genomic and genetic analysis because of their abundance and relatively even distribution in the genome. Such a capacity, however, cannot be achieved without an efficient genotyping platform such ...

Mutations in Nicotinamide Nucleotide Transhydrogenase (NNT) cause familial glucocorticoid deficiency

PubMed Central

Meimaridou, Eirini; Kowalczyk, Julia; Guasti, Leonardo; Hughes, Claire R.; Wagner, Florian; Frommolt, Peter; Nürnberg, Peter; Mann, Nicholas P.; Banerjee, Ritwik; Saka, H. Nurcin; Chapple, J. Paul; King, Peter J.; Clark, Adrian J.L.; Metherell, Louise A.

2012-01-01

Using targeted exome sequencing we identified mutations in NNT, an antioxidant defence gene, in patients with familial glucocorticoid deficiency. In mice with Nnt loss, higher levels of adrenocortical cell apoptosis and impaired glucocorticoid production were observed. NNT knockdown in a human adrenocortical cell line resulted in impaired redox potential and increased ROS levels. Our results suggest that NNT may have a role in ROS detoxification in human adrenal glands. PMID:22634753

Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

PubMed Central

Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

1984-01-01

We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

PubMed Central

Le Gall, O; Candresse, T; Brault, V; Dunez, J

1989-01-01

The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein. PMID:2798128

A novel representation of the conformational structure of transfer RNAs. Correlation of the folding patterns of the polynucleotide chain with the base sequence and the nucleotide backbone torsions.

PubMed Central

Srinivasan, A R; Yathindra, N

1977-01-01

A novel description of the conformational characteristics of all the individual nucleotides and the phosphodiesters in tRNAs is presented in the form of a circular plot. This representation furnishes information of the base sequence with the folding patterns of the polynucleotide chain as one traverses along the circumference and with the individual nucleotide and phosphodiester linkage torsions along the radii. The circular plot obtained for yeast tRNAPhe strikingly distinguishes the helical and the loop regions. The variation of the different nucleotide torsions along the entire chain length and their effect on the secondary helical and tertiary loop regions become readily apparent. PMID:339206

A Bioluminometric Method of DNA Sequencing

NASA Technical Reports Server (NTRS)

Ronaghi, Mostafa; Pourmand, Nader; Stolc, Viktor; Arnold, Jim (Technical Monitor)

2001-01-01

Pyrosequencing is a bioluminometric single-tube DNA sequencing method that takes advantage of co-operativity between four enzymes to monitor DNA synthesis. In this sequencing-by-synthesis method, a cascade of enzymatic reactions yields detectable light, which is proportional to incorporated nucleotides. Pyrosequencing has the advantages of accuracy, flexibility and parallel processing. It can be easily automated. Furthermore, the technique dispenses with the need for labeled primers, labeled nucleotides and gel-electrophoresis. In this chapter, the use of this technique for different applications is discussed.

Genetic analysis of paramyxovirus isolates from pacific salmon reveals two independently co-circulating lineages

USGS Publications Warehouse

Batts, W.N.; Falk, K.; Winton, J.R.

2008-01-01

Viruses with the morphological and biochemical characteristics of the family Paramyxoviridae (paramyxoviruses) have been isolated from adult salmon returning to rivers along the Pacific coast of North America since 1982. These Pacific salmon paramyxoviruses (PSPV), which have mainly been isolated from Chinook salmon Oncorhynchus tshawytscha, grow slowly in established fish cell lines and have not been associated with disease. Genetic analysis of a 505-base-pair region of the polymerase gene from 47 PsPV isolates produced 17 nucleotide sequence types that could be grouped into two major sublineages, designated A and B. The two independently co-circulating sublineages differed by 12.1-13.9% at the nucleotide level but by only 1.2% at the amino acid level. Isolates of PSPV from adult Pacific salmon returning to rivers from Alaska to California over a 25-year period showed little evidence of geographic or temporal grouping. Phylogenetic analyses revealed that these paramyxoviruses of Pacific salmon were most closely related to the Atlantic salmon paramyxovirus (ASPV) from Norway, having a maximum nucleotide diversity of 26.1 % and an amino acid diversity of 19.0%. When compared with homologous sequences of other paramyxoviruses, PSPV and ASPV were sufficiently distinct to suggest that they are not clearly members of any of the established genera in the family Paramyxoviridae. in the course of this study, a polymerase chain reaction assay was developed that can be used for confirmatory identification of PSPV. ?? Copyright by the American Fisheries Society 2008.

Information Entropy Analysis of the H1N1 Genetic Code

NASA Astrophysics Data System (ADS)

Martwick, Andy

2010-03-01

During the current H1N1 pandemic, viral samples are being obtained from large numbers of infected people world-wide and are being sequenced on the NCBI Influenza Virus Resource Database. The information entropy of the sequences was computed from the probability of occurrence of each nucleotide base at every position of each set of sequences using Shannon's definition of information entropy, [ H=∑bpb,2( 1pb ) ] where H is the observed information entropy at each nucleotide position and pb is the probability of the base pair of the nucleotides A, C, G, U. Information entropy of the current H1N1 pandemic is compared to reference human and swine H1N1 entropy. As expected, the current H1N1 entropy is in a low entropy state and has a very large mutation potential. Using the entropy method in mature genes we can identify low entropy regions of nucleotides that generally correlate to critical protein function.

Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

PubMed

Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

2017-12-01

The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Genome Survey Sequencing of Luffa Cylindrica L. and Microsatellite High Resolution Melting (SSR-HRM) Analysis for Genetic Relationship of Luffa Genotypes

PubMed Central

An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin

2017-01-01

Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica, about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both “Zheda 23” and “Zheda 83”. Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species. PMID:28891982

Digital gene expression analysis of the zebra finch genome

PubMed Central

2010-01-01

Background In order to understand patterns of adaptation and molecular evolution it is important to quantify both variation in gene expression and nucleotide sequence divergence. Gene expression profiling in non-model organisms has recently been facilitated by the advent of massively parallel sequencing technology. Here we investigate tissue specific gene expression patterns in the zebra finch (Taeniopygia guttata) with special emphasis on the genes of the major histocompatibility complex (MHC). Results Almost 2 million 454-sequencing reads from cDNA of six different tissues were assembled and analysed. A total of 11,793 zebra finch transcripts were represented in this EST data, indicating a transcriptome coverage of about 65%. There was a positive correlation between the tissue specificity of gene expression and non-synonymous to synonymous nucleotide substitution ratio of genes, suggesting that genes with a specialised function are evolving at a higher rate (or with less constraint) than genes with a more general function. In line with this, there was also a negative correlation between overall expression levels and expression specificity of contigs. We found evidence for expression of 10 different genes related to the MHC. MHC genes showed relatively tissue specific expression levels and were in general primarily expressed in spleen. Several MHC genes, including MHC class I also showed expression in brain. Furthermore, for all genes with highest levels of expression in spleen there was an overrepresentation of several gene ontology terms related to immune function. Conclusions Our study highlights the usefulness of next-generation sequence data for quantifying gene expression in the genome as a whole as well as in specific candidate genes. Overall, the data show predicted patterns of gene expression profiles and molecular evolution in the zebra finch genome. Expression of MHC genes in particular, corresponds well with expression patterns in other vertebrates. PMID:20359325

Pstl repeat: a family of short interspersed nucleotide element (SINE)-like sequences in the genomes of cattle, goat, and buffalo.

PubMed

Sheikh, Faruk G; Mukhopadhyay, Sudit S; Gupta, Prabhakar

2002-02-01

The PstI family of elements are short, highly repetitive DNA sequences interspersed throughout the genome of the Bovidae. We have cloned and sequenced some members of the PstI family from cattle, goat, and buffalo. These elements are approximately 500 bp, have a copy number of 2 x 10(5) - 4 x 10(5), and comprise about 4% of the haploid genome. Studies of nucleotide sequence homology indicate that the buffalo and goat PstI repeats (type II) are similar types of short interspersed nucleotide element (SINE) sequences, but the cattle PstI repeat (type I) is considerably more divergent. Additionally, the goat PstI sequence showed significant sequence homology with bovine serine tRNA, and is therefore likely derived from serine tRNA. Interestingly, Southern hybridization suggests that both types of SINEs (I and II) are present in all the species of Bovidae. Dendrogram analysis indicates that cattle PstI SINE is similar to bovine Alu-like SINEs. Goat and buffalo SINEs formed a separate cluster, suggesting that these two types of SINEs evolved separately in the genome of the Bovidae.

DNA sequencing using polymerase substrate-binding kinetics

PubMed Central

Previte, Michael John Robert; Zhou, Chunhong; Kellinger, Matthew; Pantoja, Rigo; Chen, Cheng-Yao; Shi, Jin; Wang, BeiBei; Kia, Amirali; Etchin, Sergey; Vieceli, John; Nikoomanzar, Ali; Bomati, Erin; Gloeckner, Christian; Ronaghi, Mostafa; He, Molly Min

2015-01-01

Next-generation sequencing (NGS) has transformed genomic research by decreasing the cost of sequencing. However, whole-genome sequencing is still costly and complex for diagnostics purposes. In the clinical space, targeted sequencing has the advantage of allowing researchers to focus on specific genes of interest. Routine clinical use of targeted NGS mandates inexpensive instruments, fast turnaround time and an integrated and robust workflow. Here we demonstrate a version of the Sequencing by Synthesis (SBS) chemistry that potentially can become a preferred targeted sequencing method in the clinical space. This sequencing chemistry uses natural nucleotides and is based on real-time recording of the differential polymerase/DNA-binding kinetics in the presence of correct or mismatch nucleotides. This ensemble SBS chemistry has been implemented on an existing Illumina sequencing platform with integrated cluster amplification. We discuss the advantages of this sequencing chemistry for targeted sequencing as well as its limitations for other applications. PMID:25612848

VarDetect: a nucleotide sequence variation exploratory tool

PubMed Central

Ngamphiw, Chumpol; Kulawonganunchai, Supasak; Assawamakin, Anunchai; Jenwitheesuk, Ekachai; Tongsima, Sissades

2008-01-01

Background Single nucleotide polymorphisms (SNPs) are the most commonly studied units of genetic variation. The discovery of such variation may help to identify causative gene mutations in monogenic diseases and SNPs associated with predisposing genes in complex diseases. Accurate detection of SNPs requires software that can correctly interpret chromatogram signals to nucleotides. Results We present VarDetect, a stand-alone nucleotide variation exploratory tool that automatically detects nucleotide variation from fluorescence based chromatogram traces. Accurate SNP base-calling is achieved using pre-calculated peak content ratios, and is enhanced by rules which account for common sequence reading artifacts. The proposed software tool is benchmarked against four other well-known SNP discovery software tools (PolyPhred, novoSNP, Genalys and Mutation Surveyor) using fluorescence based chromatograms from 15 human genes. These chromatograms were obtained from sequencing 16 two-pooled DNA samples; a total of 32 individual DNA samples. In this comparison of automatic SNP detection tools, VarDetect achieved the highest detection efficiency. Availability VarDetect is compatible with most major operating systems such as Microsoft Windows, Linux, and Mac OSX. The current version of VarDetect is freely available at . PMID:19091032

pyr RNA binding to the Bacillus caldolyticus PyrR attenuation protein. Characterization and regulation by uridine and guanosine nucleotides

PubMed Central

Jørgensen, Casper Møller; Fields, Christopher J.; Chander, Preethi; Watt, Desmond; Burgner, John W.; Smith, Janet L.; Switzer, Robert L.

2011-01-01

Summary The PyrR protein regulates expression of pyrimidine biosynthetic (pyr) genes in many bacteria. PyrR binds to specific sites in the 5’ leader RNA of target operons and favors attenuation of transcription. Filter binding and gel mobility assays were used to characterize the binding of PyrR from Bacillus caldolyticus to RNA sequences (binding loops) from the three attenuation regions of the B. caldolyticus pyr operon. Binding of PyrR to the three binding loops and modulation of RNA binding by nucleotides was similar for all three RNAs. Apparent dissociation constants at 0° C ranged from 0.13 to 0.87 nM in the absence of effectors; dissociation constants were decreased by 3 to 12 fold by uridine nucleotides and increased by 40 to 200 fold by guanosine nucleotides. The binding data suggest that pyr operon expression is regulated by the ratio of intracellular uridine nucleotides to guanosine nucleotides; the effects of nucleoside addition to the growth medium on aspartate transcarbamylase (pyrB) levels in B. subtilis cells in vivo supported this conclusion. Analytical ultracentrifugation established that RNA binds to dimeric PyrR, even though the tetrameric form of unbound PyrR predominates in solution at the concentrations studied. PMID:18190533

Kaposi's Sarcoma-Associated Herpesvirus MicroRNA Single-Nucleotide Polymorphisms Identified in Clinical Samples Can Affect MicroRNA Processing, Level of Expression, and Silencing Activity

PubMed Central

Han, Soo-Jin; Marshall, Vickie; Barsov, Eugene; Quiñones, Octavio; Ray, Alex; Labo, Nazzarena; Trivett, Matthew; Ott, David; Renne, Rolf

2013-01-01

Kaposi's sarcoma-associated herpesvirus (KSHV) encodes 12 pre-microRNAs that can produce 25 KSHV mature microRNAs. We previously reported single-nucleotide polymorphisms (SNPs) in KSHV-encoded pre-microRNA and mature microRNA sequences from clinical samples (V. Marshall et al., J. Infect. Dis., 195:645–659, 2007). To determine whether microRNA SNPs affect pre-microRNA processing and, ultimately, mature microRNA expression levels, we performed a detailed comparative analysis of (i) mature microRNA expression levels, (ii) in vitro Drosha/Dicer processing, and (iii) RNA-induced silencing complex-dependent targeting of wild-type (wt) and variant microRNA genes. Expression of pairs of wt and variant pre-microRNAs from retroviral vectors and measurement of KSHV mature microRNA expression by real-time reverse transcription-PCR (RT-PCR) revealed differential expression levels that correlated with the presence of specific sequence polymorphisms. Measurement of KSHV mature microRNA expression in a panel of primary effusion lymphoma cell lines by real-time RT-PCR recapitulated some observed expression differences but suggested a more complex relationship between sequence differences and expression of mature microRNA. Furthermore, in vitro maturation assays demonstrated significant SNP-associated changes in Drosha/DGCR8 and/or Dicer processing. These data demonstrate that SNPs within KSHV-encoded pre-microRNAs are associated with differential microRNA expression levels. Given the multiple reports on the involvement of microRNAs in cancer, the biological significance of these phenotypic and genotypic variants merits further studies in patients with KSHV-associated malignancies. PMID:24006441

A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

ERIC Educational Resources Information Center

Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

2016-01-01

The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

PubMed

Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

2016-02-01

Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

Phenotypic and genotypic analysis of Borrelia burgdorferi isolates from various sources.

PubMed Central

Adam, T; Gassmann, G S; Rasiah, C; Göbel, U B

1991-01-01

A total of 17 B. burgdorferi isolates from various sources were characterized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell proteins, restriction enzyme analysis, Southern hybridization with probes complementary to unique regions of evolutionarily conserved genes (16S rRNA and fla), and direct sequencing of in vitro polymerase chain reaction-amplified fragments of the 16S rRNA gene. Three groups were distinguished on the basis of phenotypic and genotypic traits, the latter traced to the nucleotide sequence level. Images PMID:1649797

Length and sequence variability in mitochondrial control region of the milkfish, Chanos chanos.

PubMed

Ravago, Rachel G; Monje, Virginia D; Juinio-Meñez, Marie Antonette

2002-01-01

Extensive length variability was observed in the mitochondrial control region of the milkfish, Chanos chanos. The nucleotide sequence of the control region and flanking regions was determined. Length variability and heteroplasmy was due to the presence of varying numbers of a 41-bp tandemly repeated sequence and a 48-bp insertion/deletion (indel). The structure and organization of the milkfish control region is similar to that of other teleost fish and vertebrates. However, extensive variation in the copy number of tandem repeats (4-20 copies) and the presence of a relatively large (48-bp) indel, are apparently uncommon in teleost fish control region sequences reported to date. High sequence variability of control region peripheral domains indicates the potential utility of selected regions as markers for population-level studies.

Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

PubMed Central

Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

2010-01-01

Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

Substantial Regional Variation in Substitution Rates in the Human Genome: Importance of GC Content, Gene Density, and Telomere-Specific Effects

NASA Astrophysics Data System (ADS)

Arndt, Peter F.; Hwa, Terence; Petrov, Dmitri A.

2005-06-01

This study presents the first global, 1 Mbp level analysis of patterns of nucleotide substitutions along the human lineage. The study is based on the analysis of a large amount of repetitive elements deposited into the human genome since the mammalian radiation, yielding a number of results that would have been difficult to obtain using the more conventional comparative method of analysis. This analysis revealed substantial and consistent variability of rates of substitution, with the variability ranging up to 2-fold among different regions. The rates of substitutions of C or G nucleotides with A or T nucleotides vary much more sharply than the reverse rates suggesting that much of that variation is due to differences in mutation rates rather than in the probabilities of fixation of C/G vs. A/T nucleotides across the genome. For all types of substitution we observe substantially more hotspots than coldspots, with hotspots showing substantial clustering over tens of Mbp's. Our analysis revealed that GC-content of surrounding sequences is the best predictor of the rates of substitution. The pattern of substitution appears very different near telomeres compared to the rest of the genome and cannot be explained by the genome-wide correlations of the substitution rates with GC content or exon density. The telomere pattern of substitution is consistent with natural selection or biased gene conversion acting to increase the GC-content of the sequences that are within 10-15 Mbp away from the telomere.

Multilocus analysis of nucleotide variation and speciation in three closely related Populus (Salicaceae) species.

PubMed

Du, Shuhui; Wang, Zhaoshan; Ingvarsson, Pär K; Wang, Dongsheng; Wang, Junhui; Wu, Zhiqiang; Tembrock, Luke R; Zhang, Jianguo

2015-10-01

Historical tectonism and climate oscillations can isolate and contract the geographical distributions of many plant species, and they are even known to trigger species divergence and ultimately speciation. Here, we estimated the nucleotide variation and speciation in three closely related Populus species, Populus tremuloides, P. tremula and P. davidiana, distributed in North America and Eurasia. We analysed the sequence variation in six single-copy nuclear loci and three chloroplast (cpDNA) fragments in 497 individuals sampled from 33 populations of these three species across their geographic distributions. These three Populus species harboured relatively high levels of nucleotide diversity and showed high levels of nucleotide differentiation. Phylogenetic analysis revealed that P. tremuloides diverged earlier than the other two species. The cpDNA haplotype network result clearly illustrated the dispersal route from North America to eastern Asia and then into Europe. Molecular dating results confirmed that the divergence of these three species coincided with the sundering of the Bering land bridge in the late Miocene and a rapid uplift of the Qinghai-Tibetan Plateau around the Miocene/Pliocene boundary. Vicariance-driven successful allopatric speciation resulting from historical tectonism and climate oscillations most likely played roles in the formation of the disjunct distributions and divergence of these three Populus species. © 2015 John Wiley & Sons Ltd.

The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

PubMed

Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

2016-08-01

The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

In silico Derivation of HLA-Specific Alloreactivity Potential from Whole Exome Sequencing of Stem-Cell Transplant Donors and Recipients: Understanding the Quantitative Immunobiology of Allogeneic Transplantation

PubMed Central

Jameson-Lee, Max; Koparde, Vishal; Griffith, Phil; Scalora, Allison F.; Sampson, Juliana K.; Khalid, Haniya; Sheth, Nihar U.; Batalo, Michael; Serrano, Myrna G.; Roberts, Catherine H.; Hess, Michael L.; Buck, Gregory A.; Neale, Michael C.; Manjili, Masoud H.; Toor, Amir Ahmed

2014-01-01

Donor T-cell mediated graft versus host (GVH) effects may result from the aggregate alloreactivity to minor histocompatibility antigens (mHA) presented by the human leukocyte antigen (HLA) molecules in each donor–recipient pair undergoing stem-cell transplantation (SCT). Whole exome sequencing has previously demonstrated a large number of non-synonymous single nucleotide polymorphisms (SNP) present in HLA-matched recipients of SCT donors (GVH direction). The nucleotide sequence flanking each of these SNPs was obtained and the amino acid sequence determined. All the possible nonameric peptides incorporating the variant amino acid resulting from these SNPs were interrogated in silico for their likelihood to be presented by the HLA class I molecules using the Immune Epitope Database stabilized matrix method (SMM) and NetMHCpan algorithms. The SMM algorithm predicted that a median of 18,396 peptides weakly bound HLA class I molecules in individual SCT recipients, and 2,254 peptides displayed strong binding. A similar library of presented peptides was identified when the data were interrogated using the NetMHCpan algorithm. The bioinformatic algorithm presented here demonstrates that there may be a high level of mHA variation in HLA-matched individuals, constituting a HLA-specific alloreactivity potential. PMID:25414699

In silico Derivation of HLA-Specific Alloreactivity Potential from Whole Exome Sequencing of Stem-Cell Transplant Donors and Recipients: Understanding the Quantitative Immunobiology of Allogeneic Transplantation.

PubMed

Jameson-Lee, Max; Koparde, Vishal; Griffith, Phil; Scalora, Allison F; Sampson, Juliana K; Khalid, Haniya; Sheth, Nihar U; Batalo, Michael; Serrano, Myrna G; Roberts, Catherine H; Hess, Michael L; Buck, Gregory A; Neale, Michael C; Manjili, Masoud H; Toor, Amir Ahmed

2014-01-01

Donor T-cell mediated graft versus host (GVH) effects may result from the aggregate alloreactivity to minor histocompatibility antigens (mHA) presented by the human leukocyte antigen (HLA) molecules in each donor-recipient pair undergoing stem-cell transplantation (SCT). Whole exome sequencing has previously demonstrated a large number of non-synonymous single nucleotide polymorphisms (SNP) present in HLA-matched recipients of SCT donors (GVH direction). The nucleotide sequence flanking each of these SNPs was obtained and the amino acid sequence determined. All the possible nonameric peptides incorporating the variant amino acid resulting from these SNPs were interrogated in silico for their likelihood to be presented by the HLA class I molecules using the Immune Epitope Database stabilized matrix method (SMM) and NetMHCpan algorithms. The SMM algorithm predicted that a median of 18,396 peptides weakly bound HLA class I molecules in individual SCT recipients, and 2,254 peptides displayed strong binding. A similar library of presented peptides was identified when the data were interrogated using the NetMHCpan algorithm. The bioinformatic algorithm presented here demonstrates that there may be a high level of mHA variation in HLA-matched individuals, constituting a HLA-specific alloreactivity potential.

High-throughput nucleotide sequence analysis of diverse bacterial communities in leachates of decomposing pig carcasses

PubMed Central

Yang, Seung Hak; Lim, Joung Soo; Khan, Modabber Ahmed; Kim, Bong Soo; Choi, Dong Yoon; Lee, Eun Young; Ahn, Hee Kwon

2015-01-01

The leachate generated by the decomposition of animal carcass has been implicated as an environmental contaminant surrounding the burial site. High-throughput nucleotide sequencing was conducted to investigate the bacterial communities in leachates from the decomposition of pig carcasses. We acquired 51,230 reads from six different samples (1, 2, 3, 4, 6 and 14 week-old carcasses) and found that sequences representing the phylum Firmicutes predominated. The diversity of bacterial 16S rRNA gene sequences in the leachate was the highest at 6 weeks, in contrast to those at 2 and 14 weeks. The relative abundance of Firmicutes was reduced, while the proportion of Bacteroidetes and Proteobacteria increased from 3–6 weeks. The representation of phyla was restored after 14 weeks. However, the community structures between the samples taken at 1–2 and 14 weeks differed at the bacterial classification level. The trend in pH was similar to the changes seen in bacterial communities, indicating that the pH of the leachate could be related to the shift in the microbial community. The results indicate that the composition of bacterial communities in leachates of decomposing pig carcasses shifted continuously during the study period and might be influenced by the burial site. PMID:26500442

Recombination-dependent replication and gene conversion homogenize repeat sequences and diversify plastid genome structure.

PubMed

Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K

2017-04-01

There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.

Genetic Characteristics of Coronaviruses from Korean Bats in 2016.

PubMed

Lee, Saemi; Jo, Seong-Deok; Son, Kidong; An, Injung; Jeong, Jipseol; Wang, Seung-Jun; Kim, Yongkwan; Jheong, Weonhwa; Oem, Jae-Ku

2018-01-01

Bats have increasingly been recognized as the natural reservoir of severe acute respiratory syndrome (SARS), coronavirus, and other coronaviruses found in mammals. However, little research has been conducted on bat coronaviruses in South Korea. In this study, bat samples (332 oral swabs, 245 fecal samples, 38 urine samples, and 57 bat carcasses) were collected at 33 natural bat habitat sites in South Korea. RT-PCR and sequencing were performed for specific coronavirus genes to identify the bat coronaviruses in different bat samples. Coronaviruses were detected in 2.7% (18/672) of the samples: 13 oral swabs from one species of the family Rhinolophidae, and four fecal samples and one carcass (intestine) from three species of the family Vespertiliodae. To determine the genetic relationships of the 18 sequences obtained in this study and previously known coronaviruses, the nucleotide sequences of a 392-nt region of the RNA-dependent RNA polymerase (RdRp) gene were analyzed phylogenetically. Thirteen sequences belonging to SARS-like betacoronaviruses showed the highest nucleotide identity (97.1-99.7%) with Bat-CoV-JTMC15 reported in China. The other five sequences were most similar to MERS-like betacoronaviruses. Four nucleotide sequences displayed the highest identity (94.1-95.1%) with Bat-CoV-HKU5 from Hong Kong. The one sequence from a carcass showed the highest nucleotide identity (99%) with Bat-CoV-SC2013 from China. These results suggest that careful surveillance of coronaviruses from bats should be continued, because animal and human infections may result from the genetic variants present in bat coronavirus reservoirs.

Nucleotide sequence of the gag gene and gag-pol junction of feline leukemia virus.

PubMed Central

Laprevotte, I; Hampe, A; Sherr, C J; Galibert, F

1984-01-01

The nucleotide sequence of the gag gene of feline leukemia virus and its flanking sequences were determined and compared with the corresponding sequences of two strains of feline sarcoma virus and with that of the Moloney strain of murine leukemia virus. A high degree of nucleotide sequence homology between the feline leukemia virus and murine leukemia virus gag genes was observed, suggesting that retroviruses of domestic cats and laboratory mice have a common, proximal evolutionary progenitor. The predicted structure of the complete feline leukemia virus gag gene precursor suggests that the translation of nonglycosylated and glycosylated gag gene polypeptides is initiated at two different AUG codons. These initiator codons fall in the same reading frame and are separated by a 222-base-pair segment which encodes an amino terminal signal peptide. The nucleotide sequence predicts the order of amino acids in each of the individual gag-coded proteins (p15, p12, p30, p10), all of which derive from the gag gene precursor. Stable stem-and-loop secondary structures are proposed for two regions of viral RNA. The first falls within sequences at the 5' end of the viral genome, together with adjacent palindromic sequences which may play a role in dimer linkage of RNA subunits. The second includes coding sequences at the gag-pol junction and is proposed to be involved in translation of the pol gene product. Sequence analysis of the latter region shows that the gag and pol genes are translated in different reading frames. Classical consensus splice donor and acceptor sequences could not be localized to regions which would permit synthesis of the expected gag-pol precursor protein. Alternatively, we suggest that the pol gene product (RNA-dependent DNA polymerase) could be translated by a frameshift suppressing mechanism which could involve cleavage modification of stems and loops in a manner similar to that observed in tRNA processing. PMID:6328019

Evaluation of targeted exome sequencing for 28 protein-based blood group systems, including the homologous gene systems, for blood group genotyping.

PubMed

Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Millard, Glenda M; O'Brien, Helen; Roulis, Eileen V; Liew, Yew-Wah; Martin, Jacqueline R; McGrath, Kelli A; Powley, Tanya; Flower, Robert L; Hyland, Catherine A

2017-04-01

Blood group single nucleotide polymorphism genotyping probes for a limited range of polymorphisms. This study investigated whether massively parallel sequencing (also known as next-generation sequencing), with a targeted exome strategy, provides an extended blood group genotype and the extent to which massively parallel sequencing correctly genotypes in homologous gene systems, such as RH and MNS. Donor samples (n = 28) that were extensively phenotyped and genotyped using single nucleotide polymorphism typing, were analyzed using the TruSight One Sequencing Panel and MiSeq platform. Genes for 28 protein-based blood group systems, GATA1, and KLF1 were analyzed. Copy number variation analysis was used to characterize complex structural variants in the GYPC and RH systems. The average sequencing depth per target region was 66.2 ± 39.8. Each sample harbored on average 43 ± 9 variants, of which 10 ± 3 were used for genotyping. For the 28 samples, massively parallel sequencing variant sequences correctly matched expected sequences based on single nucleotide polymorphism genotyping data. Copy number variation analysis defined the Rh C/c alleles and complex RHD hybrids. Hybrid RHD*D-CE-D variants were correctly identified, but copy number variation analysis did not confidently distinguish between D and CE exon deletion versus rearrangement. The targeted exome sequencing strategy employed extended the range of blood group genotypes detected compared with single nucleotide polymorphism typing. This single-test format included detection of complex MNS hybrid cases and, with copy number variation analysis, defined RH hybrid genes along with the RHCE*C allele hitherto difficult to resolve by variant detection. The approach is economical compared with whole-genome sequencing and is suitable for a red blood cell reference laboratory setting. © 2017 AABB.

Identification and nucleotide sequence analysis of the repetitive DNA element in the genome of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Delius, H; Scholz, J; Touray, M; Orth, E; Darai, G

1987-12-01

The genome of the fish lymphocystis disease virus (FLDV) was screened for the existence of repetitive DNA sequences using a defined and complete gene library of the viral genome (98 kbp) by DNA-DNA hybridization, heteroduplex analysis, and restriction fine mapping. A repetitive DNA sequence was detected at the coordinates 0.034 to 0.057 and 0.718 to 0.736 map units (m.u.) of the FLDV genome. The first region (0.034 to 0.057 m.u.) corresponds to the 5' terminus of the EcoRI FLDV DNA fragment B (0.034 to 0.165 m.u.) and the second region (0.718 to 0.736 m.u.) is identical to the EcoRI DNA fragment M of the viral genome. The DNA nucleotide sequence of the EcoRI FLDV DNA fragment M was determined. This analysis revealed the presence of many short direct and inverted repetitions, e.g., a 18-mer direct repetition (TTTAAAATTTAATTAA) that started at nucleotide positions 812 and 942 and a 14-mer inverted repeat (TTAAATTTAAATTT) at nucleotide positions 820 and 959. Only short open reading frames were detected within this region. The DNA repetitions are discussed as sequences that play a possible regulatory role for virus replication. Furthermore, hybridization experiments revealed that the repetitive DNA sequences are conserved in the genome of different strains of fish lymphocystis disease virus isolated from two species of Pleuronectidae (flounder and dab).

Formation of cis-diamminedichloroplatinum(II) 1,2-intrastrand cross-links on DNA is flanking-sequence independent.

PubMed

Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J

2000-11-01

Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.

Sequence analysis of porcine kobuvirus VP1 region detected in pigs in Japan and Thailand.

PubMed

Okitsu, Shoko; Khamrin, Pattara; Thongprachum, Aksara; Hidaka, Satoshi; Kongkaew, Sompreeya; Kongkaew, Apisek; Maneekarn, Niwat; Mizuguchi, Masashi; Hayakawa, Satoshi; Ushijima, Hiroshi

2012-04-01

Porcine kobuvirus is a new candidate species of the genus Kobuvirus in the family Picornaviridae, and information is still limited. The identification of porcine kobuvirus has been performed by the sequence analyses of the 3D region of the viruses. Therefore, the purpose of this study was to characterize the molecular properties of VP1 nucleotide sequences of the porcine kobuviruses isolated from porcine stool samples in Japan during 2009 and Thailand between 2006 and 2008. In addition, previous identification of a unique porcine kobuvirus; Japanese H023/2009/JP, which is a bovine kobuvirus-like strain based on sequence analysis of the 3D region, was also included in this study. All of the strains were amplified by the VP1-specific primer pair: the amplicons were subjected to direct sequencing and compared with the VP1 nucleotide sequences of reference strains. The VP1 sequences of strains from the GenBank database revealed high nucleotide sequence identity at 84.3-100%. On the other hand, the nucleotide identities among the 15 porcine kobuvirus strains analyzed in this study ranged from 78.8 to 99.8%. The results revealed that diversity of the strains in this study were higher than those of the strains in previous studies. Furthermore, it was found that the VP1 region of the bovine kobuvirus-like strain, H023/2009/JP, clustered with nine porcine kobuvirus strains that were isolated in Thailand and Japan. Since this strain was previously found to be closely related to bovine kobuviruses in the 3D gene region, it may be a natural recombinant.

Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries.

PubMed

Wickersheim, Michelle L; Blumenstiel, Justin P

2013-11-01

A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.

The ura5 gene of the ascomycete Sordaria macrospora: molecular cloning, characterization and expression in Escherichia coli.

PubMed

Le Chevanton, L; Leblon, G

1989-04-15

We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.

Identification of Sequence Variation in the Apolipoprotein A2 Gene and Their Relationship with Serum High-Density Lipoprotein Cholesterol Levels.

PubMed

Bandarian, Fatemeh; Daneshpour, Maryam Sadat; Hedayati, Mehdi; Naseri, Mohsen; Azizi, Fereidoun

2016-01-01

Apolipoprotein A2 (APOA2) is the second major apolipoprotein of the high-density lipoprotein cholesterol (HDL-C). The study aim was to identify APOA2 gene variation in individuals within two extreme tails of HDL-C levels and its relationship with HDL-C level. This cross-sectional survey was conducted on participants from Tehran Glucose and Lipid Study (TLGS) at Research Institute for Endocrine Sciences, Tehran, Iran from April 2012 to February 2013. In total, 79 individuals with extreme low HDL-C levels (≤5th percentile for age and gender) and 63 individuals with extreme high HDL-C levels (≥95th percentile for age and gender) were selected. Variants were identified using DNA amplification and direct sequencing. Screen of all exons and the core promoter region of APOA2 gene identified nine single nucleotide substitutions and one microsatellite; five of which were known and four were new variants. Of these nine variants, two were common tag single nucleotide polymorphisms (SNPs) and seven were rare SNPs. Both exonic substitutions were missense mutations and caused an amino acid change. There was a significant association between the new missense mutation (variant Chr.1:16119226, Ala98Pro) and HDL-C level. None of two common tag SNPs of rs6413453 and rs5082 contributes to the HDL-C trait in Iranian population, but a new missense mutation in APOA2 in our population has a significant association with HDL-C.

A report on identification of sequence polymorphism in barcode region of six commercially important Cymbopogon species.

PubMed

Bishoyi, Ashok Kumar; Kavane, Aarti; Sharma, Anjali; Geetha, K A

2017-02-01

CYMBOPOGON: is an important member of grass family Poaceae, cultivated for essential oils which have greater medicinal and industrial value. Taxonomic identification of Cymbopogon species is determined mainly by morphological markers, odour of essential oils and concentration of bioactive compounds present in the oil matrices which are highly influenced by environment. Authenticated molecular marker based taxonomical identification is also lacking in the genus; hence effort was made to evaluate potential DNA barcode loci in six commercially important Cymbopogon species for their individual discrimination and authentication at the species level. Four widely used DNA barcoding regions viz., ITS 1 & ITS 2 spacers, matK, psbA-trnH and rbcL were taken for the study. Gene sequences of the same or related genera of the concerned loci were mined from NCBI domain and primers were designed and validated for barcode loci amplification. Out of the four loci studied, sequences from matK and ITS spacer loci revealed 0.46% and 5.64% nucleotide sequence diversity, respectively whereas the other two loci i.e., psbA-trnH and rbcL showed 100% sequence homology. The newly developed primers can be used for barcode loci amplification in the genus Cymbopogon. The identified Single Nucleotide Polymorphisms from the studied sequences may be used as barcodes for the six Cymbopogon species. The information generated can also be utilized for barcode development of the genus by including more number of Cymbopgon species in future.

VirVarSeq: a low-frequency virus variant detection pipeline for Illumina sequencing using adaptive base-calling accuracy filtering.

PubMed

Verbist, Bie M P; Thys, Kim; Reumers, Joke; Wetzels, Yves; Van der Borght, Koen; Talloen, Willem; Aerssens, Jeroen; Clement, Lieven; Thas, Olivier

2015-01-01

In virology, massively parallel sequencing (MPS) opens many opportunities for studying viral quasi-species, e.g. in HIV-1- and HCV-infected patients. This is essential for understanding pathways to resistance, which can substantially improve treatment. Although MPS platforms allow in-depth characterization of sequence variation, their measurements still involve substantial technical noise. For Illumina sequencing, single base substitutions are the main error source and impede powerful assessment of low-frequency mutations. Fortunately, base calls are complemented with quality scores (Qs) that are useful for differentiating errors from the real low-frequency mutations. A variant calling tool, Q-cpileup, is proposed, which exploits the Qs of nucleotides in a filtering strategy to increase specificity. The tool is imbedded in an open-source pipeline, VirVarSeq, which allows variant calling starting from fastq files. Using both plasmid mixtures and clinical samples, we show that Q-cpileup is able to reduce the number of false-positive findings. The filtering strategy is adaptive and provides an optimized threshold for individual samples in each sequencing run. Additionally, linkage information is kept between single-nucleotide polymorphisms as variants are called at the codon level. This enables virologists to have an immediate biological interpretation of the reported variants with respect to their antiviral drug responses. A comparison with existing SNP caller tools reveals that calling variants at the codon level with Q-cpileup results in an outstanding sensitivity while maintaining a good specificity for variants with frequencies down to 0.5%. The VirVarSeq is available, together with a user's guide and test data, at sourceforge: http://sourceforge.net/projects/virtools/?source=directory. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Quantum-Sequencing: Fast electronic single DNA molecule sequencing

NASA Astrophysics Data System (ADS)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

LISTA, a comprehensive compilation of nucleotide sequences encoding proteins from the yeast Saccharomyces.

PubMed Central

Linder, P; Dölz, R; Mossé, M O; Lazowska, J; Slonimski, P P

1993-01-01

The amount of nucleotide sequence data is increasing exponentially. We therefore made an effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. Each sequence has been attributed a single genetic name and in the case of allelic duplicated sequences, synonyms are given, if necessary. For the nomenclature we have introduced a standard principle for naming gene sequences based on priority rules. We have also applied a simple method to distinguish duplicated sequences of one and the same gene from non-allelic sequences of duplicated genes. By using these principles we have sorted out a lot of confusion in the literature and databanks. Along with the genetic name, the mnemonic from the EMBL databank, the codon bias, reference of the publication of the sequence and the EMBL accession numbers are included in each entry. PMID:8332521

Amino acid substitutions in the VanS sensor of the VanA-type vancomycin-resistant Enterococcus strains result in high-level vancomycin resistance and low-level teicoplanin resistance.

PubMed

Hashimoto, Y; Tanimoto, K; Ozawa, Y; Murata, T; Ike, Y

2000-04-15

The vancomycin-resistant enterococci GV1, GV2 and GV3, which were isolated from droppings from broiler farms in Japan have been characterized as VanA-type VRE, which express high-level vancomycin resistance (256 or 512 microg ml(-1), MIC) and low-level teicoplanin resistance (1 or 2 microg ml(-1), MIC). The vancomycin resistances were encoded on plasmids. The vancomycin resistance conjugative plasmid pMG2 was isolated from the GV2 strain. The VanA determinant of pMG2 showed the same genetic organization as that of the VanA genes encoded on the representative transposon Tn1546, which comprises vanRSHAXYZ. The nucleotide sequences of all the genes, except the gene related to the vanS gene on Tn1546, were completely identical to the genes encoded on Tn1546. Three amino acid substitutions in the N-terminal region of the deduced VanS were detected in the nucleotide sequence of vanS encoded on pMG2. There were also three amino acid substitutions in the vanS gene of the GV1 and GV3 strains in the same positions as in the vanS gene of pMG2. Vancomycin induced the increased teicoplanin resistance in these strains.

The human myelin oligodendrocyte glycoprotein (MOG) gene: Complete nucleotide sequence and structural characterization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paule Roth, M.; Malfroy, L.; Offer, C.

1995-07-20

Human myelin oligodendrocyte glycoprotein (MOG), a myelin component of the central nervous system, is a candidate target antigen for autoimmune-mediated demyelination. We have isolated and sequenced part of a cosmid clone that contains the entire human MOG gene. The primary nuclear transcript, extending from the putative start of transcription to the site of poly(A) addition, is 15,561 nucleotides in length. The human MOG gene contains 8 exons, separated by 7 introns; canonical intron/exon boundary sites are observed at each junction. The introns vary in size from 242 to 6484 bp and contain numerous repetitive DNA elements, including 14 Alu sequencesmore » within 3 introns. Another Alu element is located in the 3{prime}-untranslated region of the gene. Alu sequences were classified with respect to subfamily assignment. Seven hundred sixty-three nucleotides 5{prime} of the transcription start and 1214 nucleotides 3{prime} of the poly(A) addition sites were also sequenced. The 5{prime}-flanking region revealed the presence of several consensus sequences that could be relevant in the transcription of the MOG gene, in particular binding sites in common with other myelin gene promoters. Two polymorphic intragenic dinucleotide (CA){sub n} and tetranucleotide (TAAA){sub n} repeats were identified and may provide genetic marker tools for association and linkage studies. 50 refs., 3 figs., 3 tabs.« less

cDNA cloning of the human peroxisomal enoyl-CoA hydratase: 3-Hydroxyacyl-CoA dehydrogenase bifunctional enzyme and localization to chromosome 3q26. 3-3q28: A free left Alu arm is inserted in the 3[prime] noncoding region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoefler, G.; Forstner, M.; Hulla, W.

1994-01-01

Enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme is one of the four enzymes of the peroxisomal, [beta]-oxidation pathway. Here, the authors report the full-length human cDNA sequence and the localization of the corresponding gene on chromosome 3q26.3-3q28. The cDNA sequence spans 3779 nucleotides with an open reading frame of 2169 nucleotides. The tripeptide SKL at the carboxy terminus, known to serve as a peroxisomal targeting signal, is present. DNA sequence comparison of the coding region showed an 80% homology between human and rat bifunctional enzyme cDNA. The 3[prime] noncoding sequence contains 117 nucleotides homologous to an Alu repeat. Based on sequence comparison,more » they propose that these nucleotides are a free left Alu arm with 86% homology to the Alu-J family. RNA analysis shows one band with highest intensity in liver and kidney. This cDNA will allow in-depth studies of molecular defects in patients with defective peroxisomal bifunctional enzyme. Moreover, it will also provide a means for studying the regulation of peroxisomal [beta]-oxidation in humans. 33 refs., 5 figs.« less

Phylogenetic Analysis of Myobia musculi (Schranck, 1781) by Using the 18S Small Ribosomal Subunit Sequence

PubMed Central

Feldman, Sanford H; Ntenda, Abraham M

2011-01-01

We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574

Expression and Functional Characterization of two Pathogenesis-Related Protein 10 Genes from Zea mays

USDA-ARS?s Scientific Manuscript database

Pathogenesis-related protein 10 (PR10) is one of seventeen PR protein families and plays important roles in plant response to biotic and abiotic stresses. A novel PR10 gene (ZmPR10.1), which shares 89.8% and 85.7% identity to the previous ZmPR10 at the nucleotide and amino acid sequence level, respe...

Genetic analyses reveal unusually high diversity of infectious haematopoietic necrosis virus in rainbow trout aquaculture

USGS Publications Warehouse

Troyer, Ryan M.; LaPatra, Scott E.; Kurath, Gael

2000-01-01

Infectious haematopoietic necrosis virus (IHNV) is the most significant virus pathogen of salmon and trout in North America. Previous studies have shown relatively low genetic diversity of IHNV within large geographical regions. In this study, the genetic heterogeneity of 84 IHNV isolates sampled from rainbow trout (Oncorhynchus mykiss) over a 20 year period at four aquaculture facilities within a 12 mile stretch of the Snake River in Idaho, USA was investigated. The virus isolates were characterized using an RNase protection assay (RPA) and nucleotide sequence analyses. Among the 84 isolates analysed, 46 RPA haplotypes were found and analyses revealed a high level of genetic heterogeneity relative to that detected in other regions. Sequence analyses revealed up to 7·6% nucleotide divergence, which is the highest level of diversity reported for IHNV to date. Phylogenetic analyses identified four distinct monophyletic clades representing four virus lineages. These lineages were distributed across facilities, and individual facilities contained multiple lineages. These results suggest that co-circulating IHNV lineages of relatively high genetic diversity are present in the IHNV populations in this rainbow trout culture study site. Three of the four lineages exhibited temporal trends consistent with rapid evolution.

Genetic diversity and distribution of a distinct strain of Chili leaf curl virus and associated betasatellite infecting tomato and pepper in Oman.

PubMed

Khan, Akhtar J; Akhtar, Sohail; Al-Zaidi, Amal M; Singh, Achuit K; Briddon, Rob W

2013-10-01

Tomato and pepper are widely grown in Oman for local consumption. A countrywide survey was conducted during 2010-2011 to collect samples and assess the diversity of begomoviruses associated with leaf curl disease of tomato and pepper. A virus previously only identified on the Indian subcontinent, chili leaf curl virus (ChLCV), was found associated with tomato and pepper diseases in all vegetable grown areas of Oman. Some of the infected plant samples were also found to contain a betasatellite. A total of 19 potentially full-length begomovirus and eight betasatellite clones were sequenced. The begomovirus clones showed >96% nucleotide sequence identity, showing them to represent a single species. Comparisons to sequences available in the databases showed the highest levels of nucleotide sequence identity (88.0-91.1%) to isolates of the "Pakistan" strain of ChLCV (ChLCV-PK), indicating the virus from Oman to be a distinct strain, for which the name Oman strain (ChLCV-OM) is proposed. An analysis for recombination showed ChLCV-OM likely to have originated by recombination between ChLCV-PK (the major parent), pepper leaf curl Lahore virus and a third strain of ChLCV. The betasatellite sequences obtained were shown to have high levels of identity to isolates of tomato leaf curl betasatellite (ToLCB) previous shown to be present in Oman. For the disease in tomato Koch's postulates were satisfied by Agrobacterium-mediated inoculation of virus and betasatellites clones. This showed the symptoms induced by the virus in the presence of the betasatellite to be enhanced, although viral DNA levels were not affected. ChLCV-OM is the fourth begomovirus identified in tomato in Oman and the first in Capsicum. The significance of these findings is discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

Mapping RNA Structure In Vitro with SHAPE Chemistry and Next-Generation Sequencing (SHAPE-Seq).

PubMed

Watters, Kyle E; Lucks, Julius B

2016-01-01

Mapping RNA structure with selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistry has proven to be a versatile method for characterizing RNA structure in a variety of contexts. SHAPE reagents covalently modify RNAs in a structure-dependent manner to create adducts at the 2'-OH group of the ribose backbone at nucleotides that are structurally flexible. The positions of these adducts are detected using reverse transcriptase (RT) primer extension, which stops one nucleotide before the modification, to create a pool of cDNAs whose lengths reflect the location of SHAPE modification. Quantification of the cDNA pools is used to estimate the "reactivity" of each nucleotide in an RNA molecule to the SHAPE reagent. High reactivities indicate nucleotides that are structurally flexible, while low reactivities indicate nucleotides that are inflexible. These SHAPE reactivities can then be used to infer RNA structures by restraining RNA structure prediction algorithms. Here, we provide a state-of-the-art protocol describing how to perform in vitro RNA structure probing with SHAPE chemistry using next-generation sequencing to quantify cDNA pools and estimate reactivities (SHAPE-Seq). The use of next-generation sequencing allows for higher throughput, more consistent data analysis, and multiplexing capabilities. The technique described herein, SHAPE-Seq v2.0, uses a universal reverse transcription priming site that is ligated to the RNA after SHAPE modification. The introduced priming site allows for the structural analysis of an RNA independent of its sequence.

Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

PubMed

Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

2011-12-01

Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

Natural History of Human Respiratory Syncytial Virus Inferred from Phylogenetic Analysis of the Attachment (G) Glycoprotein with a 60-Nucleotide Duplication

PubMed Central

Trento, Alfonsina; Viegas, Mariana; Galiano, Mónica; Videla, Cristina; Carballal, Guadalupe; Mistchenko, Alicia S.; Melero, José A.

2006-01-01

A total of 47 clinical samples were identified during an active surveillance program of respiratory infections in Buenos Aires (BA) (1999 to 2004) that contained sequences of human respiratory syncytial virus (HRSV) with a 60-nucleotide duplication in the attachment (G) protein gene. This duplication was analogous to that previously described for other three viruses also isolated in Buenos Aires in 1999 (A. Trento et al., J. Gen. Virol. 84:3115-3120, 2003). Phylogenetic analysis indicated that BA sequences with that duplication shared a common ancestor (dated about 1998) with other HRSV G sequences reported worldwide after 1999. The duplicated nucleotide sequence was an exact copy of the preceding 60 nucleotides in early viruses, but both copies of the duplicated segment accumulated nucleotide substitutions in more recent viruses at a rate apparently higher than in other regions of the G protein gene. The evolution of the viruses with the duplicated G segment apparently followed the overall evolutionary pattern previously described for HRSV, and this genotype has replaced other prevailing antigenic group B genotypes in Buenos Aires and other places. Thus, the duplicated segment represents a natural tag that can be used to track the dissemination and evolution of HRSV in an unprecedented setting. We have taken advantage of this situation to reexamine the molecular epidemiology of HRSV and to explore the natural history of this important human pathogen. PMID:16378999

UrQt: an efficient software for the Unsupervised Quality trimming of NGS data.

PubMed

Modolo, Laurent; Lerat, Emmanuelle

2015-04-29

Quality control is a necessary step of any Next Generation Sequencing analysis. Although customary, this step still requires manual interventions to empirically choose tuning parameters according to various quality statistics. Moreover, current quality control procedures that provide a "good quality" data set, are not optimal and discard many informative nucleotides. To address these drawbacks, we present a new quality control method, implemented in UrQt software, for Unsupervised Quality trimming of Next Generation Sequencing reads. Our trimming procedure relies on a well-defined probabilistic framework to detect the best segmentation between two segments of unreliable nucleotides, framing a segment of informative nucleotides. Our software only requires one user-friendly parameter to define the minimal quality threshold (phred score) to consider a nucleotide to be informative, which is independent of both the experiment and the quality of the data. This procedure is implemented in C++ in an efficient and parallelized software with a low memory footprint. We tested the performances of UrQt compared to the best-known trimming programs, on seven RNA and DNA sequencing experiments and demonstrated its optimality in the resulting tradeoff between the number of trimmed nucleotides and the quality objective. By finding the best segmentation to delimit a segment of good quality nucleotides, UrQt greatly increases the number of reads and of nucleotides that can be retained for a given quality objective. UrQt source files, binary executables for different operating systems and documentation are freely available (under the GPLv3) at the following address: https://lbbe.univ-lyon1.fr/-UrQt-.html .

An analytical framework for whole-genome sequence association studies and its implications for autism spectrum disorder.

PubMed

Werling, Donna M; Brand, Harrison; An, Joon-Yong; Stone, Matthew R; Zhu, Lingxue; Glessner, Joseph T; Collins, Ryan L; Dong, Shan; Layer, Ryan M; Markenscoff-Papadimitriou, Eirene; Farrell, Andrew; Schwartz, Grace B; Wang, Harold Z; Currall, Benjamin B; Zhao, Xuefang; Dea, Jeanselle; Duhn, Clif; Erdman, Carolyn A; Gilson, Michael C; Yadav, Rachita; Handsaker, Robert E; Kashin, Seva; Klei, Lambertus; Mandell, Jeffrey D; Nowakowski, Tomasz J; Liu, Yuwen; Pochareddy, Sirisha; Smith, Louw; Walker, Michael F; Waterman, Matthew J; He, Xin; Kriegstein, Arnold R; Rubenstein, John L; Sestan, Nenad; McCarroll, Steven A; Neale, Benjamin M; Coon, Hilary; Willsey, A Jeremy; Buxbaum, Joseph D; Daly, Mark J; State, Matthew W; Quinlan, Aaron R; Marth, Gabor T; Roeder, Kathryn; Devlin, Bernie; Talkowski, Michael E; Sanders, Stephan J

2018-05-01

Genomic association studies of common or rare protein-coding variation have established robust statistical approaches to account for multiple testing. Here we present a comparable framework to evaluate rare and de novo noncoding single-nucleotide variants, insertion/deletions, and all classes of structural variation from whole-genome sequencing (WGS). Integrating genomic annotations at the level of nucleotides, genes, and regulatory regions, we define 51,801 annotation categories. Analyses of 519 autism spectrum disorder families did not identify association with any categories after correction for 4,123 effective tests. Without appropriate correction, biologically plausible associations are observed in both cases and controls. Despite excluding previously identified gene-disrupting mutations, coding regions still exhibited the strongest associations. Thus, in autism, the contribution of de novo noncoding variation is probably modest in comparison to that of de novo coding variants. Robust results from future WGS studies will require large cohorts and comprehensive analytical strategies that consider the substantial multiple-testing burden.

Molecular epidemiology of measles viruses in China, 1995–2003

PubMed Central

Zhang, Yan; Zhu, Zhen; Rota, Paul A; Jiang, Xiaohong; Hu, Jiayu; Wang, Jianguo; Tang, Wei; Zhang, Zhenying; Li, Congyong; Wang, Changyin; Wang, Tongzhan; Zheng, Lei; Tian, Hong; Ling, Hua; Zhao, Chunfang; Ma, Yan; Lin, Chunyan; He, Jilan; Tian, Jiang; Ma, Yan; Li, Ping; Guan, Ronghui; He, Weikuan; Zhou, Jianhui; Liu, Guiyan; Zhang, Hong; Yan, Xinge; Yang, Xuelei; Zhang, Jinlin; Lu, Yiyu; Zhou, Shunde; Ba, Zhuoma; Liu, Wei; Yang , Xiuhui; Ma, Yujie; Liang, Yong; Li, Yeqiang; Ji, Yixin; Featherstone, David; Bellini, William J; Xu, Songtao; Liang, Guodong; Xu, Wenbo

2007-01-01

This report describes the genetic characterization of 297 wild-type measles viruses that were isolated in 24 provinces of China between 1995 and 2003. Phylogenetic analysis of the N gene sequences showed that all of the isolates belonged to genotype H1 except 3 isolates, which were genotype A. The nucleotide sequence and predicted amino acid homologies of the 294-genotype H1 strains were 94.7%–100% and 93.3%–100%, respectively. The genotype H1 isolates were divided into 2 clusters, which differed by approximately 2.9% at the nucleotide level. Viruses from both clusters were distributed throughout China with no apparent geographic restriction and multiple co-circulating lineages were present in many provinces. Even though other measles genotypes have been detected in countries that border China, this report shows that genotype H1 is widely distributed throughout the country and that China has a single, endemic genotype. This important baseline data will help to monitor the progress of measles control in China. PMID:17280609

Molecular cloning and nucleotide sequence of a transforming gene detected by transfection of chicken B-cell lymphoma DNA

NASA Astrophysics Data System (ADS)

Goubin, Gerard; Goldman, Debra S.; Luce, Judith; Neiman, Paul E.; Cooper, Geoffrey M.

1983-03-01

A transforming gene detected by transfection of chicken B-cell lymphoma DNA has been isolated by molecular cloning. It is homologous to a conserved family of sequences present in normal chicken and human DNAs but is not related to transforming genes of acutely transforming retroviruses. The nucleotide sequence of the cloned transforming gene suggests that it encodes a protein that is partially homologous to the amino terminus of transferrin and related proteins although only about one tenth the size of transferrin.

Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

PubMed Central

Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

1974-01-01

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

Nucleotide Sequence of the blaRTG-2 (CARB-5) Gene and Phylogeny of a New Group of Carbenicillinases

PubMed Central

Choury, Daniele; Szajnert, Marie-France; Joly-Guillou, Marie-Laure; Azibi, Kemal; Delpech, Marc; Paul, Gérard

2000-01-01

We determined the nucleotide sequence of the bla gene for the Acinetobacter calcoaceticus β-lactamase previously described as CARB-5. Alignment of the deduced amino acid sequence with those of known β-lactamases revealed that CARB-5 possesses an RTG triad in box VII, as described for the Proteus mirabilis GN79 enzyme, instead of the RSG consensus characteristic of the other carbenicillinases. Phylogenetic studies showed that these RTG enzymes constitute a new, separate group, possibly ancestors of the carbenicillinase family. PMID:10722515

Molecular characterization of a wild poliovirus type 3 epidemic in The Netherlands (1992 and 1993).

PubMed Central

Mulders, M N; van Loon, A M; van der Avoort, H G; Reimerink, J H; Ras, A; Bestebroer, T M; Drebot, M A; Kew, O M; Koopmans, M P

1995-01-01

An outbreak of poliomyelitis due to wild poliovirus type 3 (PV3) occurred in an unvaccinated community in The Netherlands between September 1992 and February 1993. The outbreak involved 71 patients. The aim of this study was to characterize the virus at the molecular level and to analyze the molecular evolution of the epidemic virus. Molecular analysis was carried out by sequencing the VP1/2A junction region (150 nucleotides) of 50 PV3 strains isolated in association with this outbreak and the entire VP1 gene of 14 strains. In addition, the sequence of the VP1/2A junction region of strains from geographical regions endemic for PV3 (Egypt, India, and Central Asia) was analyzed and compared with the nucleotide sequence of the epidemic strain from The Netherlands. The earliest isolate was obtained from river water sampled 3 weeks before diagnosis of the first poliomyelitis patient and was found by VP1/2A sequence analysis to be genetically identical to the strain isolated from the first patient. Sequence divergence among the strains from the epidemic in The Netherlands was less than 2%. The closest genetic similarity (97.3%) was found with an Indian isolate (New Delhi, December 1991), indicating the likely source of the virus. A more than 99% sequence similarity was found in the VP1/2A region. Finally, the sequence information was used to design primers for the specific and highly sensitive molecular detection of PV3 strains during the epidemic. PMID:8586711

Mosaic organization of DNA nucleotides

NASA Technical Reports Server (NTRS)

Peng, C. K.; Buldyrev, S. V.; Havlin, S.; Simons, M.; Stanley, H. E.; Goldberger, A. L.

1994-01-01

Long-range power-law correlations have been reported recently for DNA sequences containing noncoding regions. We address the question of whether such correlations may be a trivial consequence of the known mosaic structure ("patchiness") of DNA. We analyze two classes of controls consisting of patchy nucleotide sequences generated by different algorithms--one without and one with long-range power-law correlations. Although both types of sequences are highly heterogenous, they are quantitatively distinguishable by an alternative fluctuation analysis method that differentiates local patchiness from long-range correlations. Application of this analysis to selected DNA sequences demonstrates that patchiness is not sufficient to account for long-range correlation properties.

Asystasia mosaic Madagascar virus: a novel bipartite begomovirus infecting the weed Asystasia gangetica in Madagascar.

PubMed

De Bruyn, Alexandre; Harimalala, Mireille; Hoareau, Murielle; Ranomenjanahary, Sahondramalala; Reynaud, Bernard; Lefeuvre, Pierre; Lett, Jean-Michel

2015-06-01

Here, we describe for the first time the complete genome sequence of a new bipartite begomovirus in Madagascar isolated from the weed Asystasia gangetica (Acanthaceae), for which we propose the tentative name asystasia mosaic Madagascar virus (AMMGV). DNA-A and -B nucleotide sequences of AMMGV were only distantly related to known begomovirus sequence and shared highest nucleotide sequence identity of 72.9 % (DNA-A) and 66.9 % (DNA-B) with a recently described bipartite begomovirus infecting Asystasia sp. in West Africa. Phylogenetic analysis demonstrated that this novel virus from Madagascar belongs to a new lineage of Old World bipartite begomoviruses.

Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

PubMed

Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2012-07-01

We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were <90%. This suggests that it is a new member of the genus Polerovirus, and the name pea mild chlorosis virus is proposed.

Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakoyama, Y.; Hong, K.J.; Byun, S.M.

To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: themore » mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.« less

Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale.

PubMed

Liu, Siyang; Huang, Shujia; Rao, Junhua; Ye, Weijian; Krogh, Anders; Wang, Jun

2015-01-01

Comprehensive recognition of genomic variation in one individual is important for understanding disease and developing personalized medication and treatment. Many tools based on DNA re-sequencing exist for identification of single nucleotide polymorphisms, small insertions and deletions (indels) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction of population-scale pan-genomes. Our study also highlights the usefulness of the de novo assembly strategy for definition of genome structure.

NullSeq: A Tool for Generating Random Coding Sequences with Desired Amino Acid and GC Contents.

PubMed

Liu, Sophia S; Hockenberry, Adam J; Lancichinetti, Andrea; Jewett, Michael C; Amaral, Luís A N

2016-11-01

The existence of over- and under-represented sequence motifs in genomes provides evidence of selective evolutionary pressures on biological mechanisms such as transcription, translation, ligand-substrate binding, and host immunity. In order to accurately identify motifs and other genome-scale patterns of interest, it is essential to be able to generate accurate null models that are appropriate for the sequences under study. While many tools have been developed to create random nucleotide sequences, protein coding sequences are subject to a unique set of constraints that complicates the process of generating appropriate null models. There are currently no tools available that allow users to create random coding sequences with specified amino acid composition and GC content for the purpose of hypothesis testing. Using the principle of maximum entropy, we developed a method that generates unbiased random sequences with pre-specified amino acid and GC content, which we have developed into a python package. Our method is the simplest way to obtain maximally unbiased random sequences that are subject to GC usage and primary amino acid sequence constraints. Furthermore, this approach can easily be expanded to create unbiased random sequences that incorporate more complicated constraints such as individual nucleotide usage or even di-nucleotide frequencies. The ability to generate correctly specified null models will allow researchers to accurately identify sequence motifs which will lead to a better understanding of biological processes as well as more effective engineering of biological systems.

Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum

PubMed Central

Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

2017-01-01

Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1–3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry. PMID:28056060

Whole-genome analyses of DS-1-like human G2P[4] and G8P[4] rotavirus strains from Eastern, Western and Southern Africa

PubMed Central

Nyaga, Martin M.; Stucker, Karla M.; Esona, Mathew D.; Jere, Khuzwayo C.; Mwinyi, Bakari; Shonhai, Annie; Tsolenyanu, Enyonam; Mulindwa, Augustine; Chibumbya, Julia N.; Adolfine, Hokororo; Halpin, Rebecca A.; Roy, Sunando; Stockwell, Timothy B.; Berejena, Chipo; Seheri, Mapaseka L.; Mwenda, Jason M.; Steele, A. Duncan; Wentworth, David E.

2018-01-01

Group A rotaviruses (RVAs) with distinct G and P genotype combinations have been reported globally. We report the genome composition and possible origin of seven G8P[4] and five G2P[4] human RVA strains based on the genetic evolution of all 11 genome segments at the nucleotide level. Twelve RVA ELISA positive stool samples collected in the representative countries of Eastern, Southern and West Africa during the 2007–2012 surveillance seasons were subjected to sequencing using the Ion Torrent PGM and Illumina MiSeq platforms. A reference-based assembly was performed using CLC Bio’s clc_ref_assemble_long program, and full-genome consensus sequences were obtained. With the exception of the neutralising antigen, VP7, all study strains exhibited the DS-1-like genome constellation (P[4]-I2-R2-C2-M2-A2-N2-T2-E2-H2) and clustered phylogenetically with reference strains having a DS-1-like genetic backbone. Comparison of the nucleotide and amino acid sequences with selected global cognate genome segments revealed nucleotide and amino acid sequence identities of 81.7–100 % and 90.6–100 %, respectively, with NSP4 gene segment showing the most diversity among the strains. Bayesian analyses of all gene sequences to estimate the time of divergence of the lineage indicated that divergence times ranged from 16 to 44 years, except for the NSP4 gene where the lineage seemed to arise in the more distant past at an estimated 203 years ago. However, the long-term effects of changes found within the NSP4 genome segment should be further explored, and thus we recommend continued whole-genome analyses from larger sample sets to determine the evolutionary mechanisms of the DS-1-like strains collected in Africa. PMID:24952422

Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum.

PubMed

Zhang, Xiuqing; Xu, Zhangyang; Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

2017-01-01

Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1-3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry.

HLA DNA Sequence Variation among Human Populations: Molecular Signatures of Demographic and Selective Events

PubMed Central

Buhler, Stéphane; Sanchez-Mazas, Alicia

2011-01-01

Molecular differences between HLA alleles vary up to 57 nucleotides within the peptide binding coding region of human Major Histocompatibility Complex (MHC) genes, but it is still unclear whether this variation results from a stochastic process or from selective constraints related to functional differences among HLA molecules. Although HLA alleles are generally treated as equidistant molecular units in population genetic studies, DNA sequence diversity among populations is also crucial to interpret the observed HLA polymorphism. In this study, we used a large dataset of 2,062 DNA sequences defined for the different HLA alleles to analyze nucleotide diversity of seven HLA genes in 23,500 individuals of about 200 populations spread worldwide. We first analyzed the HLA molecular structure and diversity of these populations in relation to geographic variation and we further investigated possible departures from selective neutrality through Tajima's tests and mismatch distributions. All results were compared to those obtained by classical approaches applied to HLA allele frequencies. Our study shows that the global patterns of HLA nucleotide diversity among populations are significantly correlated to geography, although in some specific cases the molecular information reveals unexpected genetic relationships. At all loci except HLA-DPB1, populations have accumulated a high proportion of very divergent alleles, suggesting an advantage of heterozygotes expressing molecularly distant HLA molecules (asymmetric overdominant selection model). However, both different intensities of selection and unequal levels of gene conversion may explain the heterogeneous mismatch distributions observed among the loci. Also, distinctive patterns of sequence divergence observed at the HLA-DPB1 locus suggest current neutrality but old selective pressures on this gene. We conclude that HLA DNA sequences advantageously complement HLA allele frequencies as a source of data used to explore the genetic history of human populations, and that their analysis allows a more thorough investigation of human MHC molecular evolution. PMID:21408106

Predicting protein-binding regions in RNA using nucleotide profiles and compositions.

PubMed

Choi, Daesik; Park, Byungkyu; Chae, Hanju; Lee, Wook; Han, Kyungsook

2017-03-14

Motivated by the increased amount of data on protein-RNA interactions and the availability of complete genome sequences of several organisms, many computational methods have been proposed to predict binding sites in protein-RNA interactions. However, most computational methods are limited to finding RNA-binding sites in proteins instead of protein-binding sites in RNAs. Predicting protein-binding sites in RNA is more challenging than predicting RNA-binding sites in proteins. Recent computational methods for finding protein-binding sites in RNAs have several drawbacks for practical use. We developed a new support vector machine (SVM) model for predicting protein-binding regions in mRNA sequences. The model uses sequence profiles constructed from log-odds scores of mono- and di-nucleotides and nucleotide compositions. The model was evaluated by standard 10-fold cross validation, leave-one-protein-out (LOPO) cross validation and independent testing. Since actual mRNA sequences have more non-binding regions than protein-binding regions, we tested the model on several datasets with different ratios of protein-binding regions to non-binding regions. The best performance of the model was obtained in a balanced dataset of positive and negative instances. 10-fold cross validation with a balanced dataset achieved a sensitivity of 91.6%, a specificity of 92.4%, an accuracy of 92.0%, a positive predictive value (PPV) of 91.7%, a negative predictive value (NPV) of 92.3% and a Matthews correlation coefficient (MCC) of 0.840. LOPO cross validation showed a lower performance than the 10-fold cross validation, but the performance remains high (87.6% accuracy and 0.752 MCC). In testing the model on independent datasets, it achieved an accuracy of 82.2% and an MCC of 0.656. Testing of our model and other state-of-the-art methods on a same dataset showed that our model is better than the others. Sequence profiles of log-odds scores of mono- and di-nucleotides were much more powerful features than nucleotide compositions in finding protein-binding regions in RNA sequences. But, a slight performance gain was obtained when using the sequence profiles along with nucleotide compositions. These are preliminary results of ongoing research, but demonstrate the potential of our approach as a powerful predictor of protein-binding regions in RNA. The program and supporting data are available at http://bclab.inha.ac.kr/RBPbinding .

Trichomonas vaginalis NTPDase and ecto-5'-nucleotidase hydrolyze guanine nucleotides and increase extracellular guanosine levels under serum restriction.

PubMed

Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana

2016-05-01

Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final accumulation of the nucleoside. The transcript levels of the five TvNTPDases gene sequences were analyzed by qRT-PCR and the highest gene expressions were found for TvNTPDase 2 and 4. The extracellular guanosine uptake was observed as (13C)GTP nucleotide into parasite DNA and it was lower than that observed for adenosine, labeled as (13C)ATP. These findings indicate the T. vaginalis preference for adenosine uptake and the accumulation of guanosine in the extracellular milieu, corroborating with HPLC data. Our data demonstrate, for the first time, the cascade of guanine nucleotides in T. vaginalis and open possibilities on the study of guanine-related purines other than the classical intracellular activity of G proteins for signal transduction. Copyright © 2016 Elsevier B.V. All rights reserved.

Patterns of nucleotide diversity and phenotypes of two domestication related genes (OsC1 and Wx) in indigenous rice varieties in Northeast India

PubMed Central

2014-01-01

Background During the domestication of crops, individual plants with traits desirable for human needs have been selected from their wild progenitors. Consequently, genetic and nucleotide diversity of genes associated with these selected traits in crop plants are expected to be lower than their wild progenitors. In the present study, we surveyed the pattern of nucleotide diversity of two selected trait specific genes, Wx and OsC1, which regulate amylose content and apiculus coloration respectively in cultivated rice varieties. The analyzed samples were collected from a wide geographic area in Northeast (NE) India, and included contrasting phenotypes considered to be associated with selected genes, namely glutinous and nonglutinous grains and colored and colorless apiculus. Results No statistically significant selection signatures were detected in both Wx and OsC1gene sequences. However, low level of selection that varied across the length of each gene was evident. The glutinous type varieties showed higher levels of nucleotide diversity at the Wx locus (πtot = 0.0053) than nonglutinous type varieties (πtot = 0.0043). The OsC1 gene revealed low levels of selection among the colorless apiculus varieties with lower nucleotide diversity (πtot = 0.0010) than in the colored apiculus varieties (πtot = 0.0023). Conclusions The results revealed that functional mutations at Wx and OsC1genes considered to be associated with specific phenotypes do not necessarily correspond to the phenotypes in indigenous rice varieties in NE India. This suggests that other than previously reported genomic regions may also be involved in determination of these phenotypes. PMID:24935343

Nucleic acids encoding antifungal polypeptides and uses thereof

DOEpatents

Altier, Daniel J.; Ellanskaya, I. A.; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-11-02

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include an amino acid sequence, and variants and fragments thereof, for an antipathogenic polypeptide that was isolated from a fungal fermentation broth. Nucleic acid molecules that encode the antipathogenic polypeptides of the invention, and antipathogenic domains thereof, are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

RNA Editing in Plant Mitochondria

NASA Astrophysics Data System (ADS)

Hiesel, Rudolf; Wissinger, Bernd; Schuster, Wolfgang; Brennicke, Axel

1989-12-01

Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.

3D RNA and functional interactions from evolutionary couplings

PubMed Central

Weinreb, Caleb; Riesselman, Adam; Ingraham, John B.; Gross, Torsten; Sander, Chris; Marks, Debora S.

2016-01-01

Summary Non-coding RNAs are ubiquitous, but the discovery of new RNA gene sequences far outpaces research on their structure and functional interactions. We mine the evolutionary sequence record to derive precise information about function and structure of RNAs and RNA-protein complexes. As in protein structure prediction, we use maximum entropy global probability models of sequence co-variation to infer evolutionarily constrained nucleotide-nucleotide interactions within RNA molecules, and nucleotide-amino acid interactions in RNA-protein complexes. The predicted contacts allow all-atom blinded 3D structure prediction at good accuracy for several known RNA structures and RNA-protein complexes. For unknown structures, we predict contacts in 160 non-coding RNA families. Beyond 3D structure prediction, evolutionary couplings help identify important functional interactions, e.g., at switch points in riboswitches and at a complex nucleation site in HIV. Aided by accelerating sequence accumulation, evolutionary coupling analysis can accelerate the discovery of functional interactions and 3D structures involving RNA. PMID:27087444

Telling apart Felidae and Ursidae from the distribution of nucleotides in mitochondrial DNA

NASA Astrophysics Data System (ADS)

Rovenchak, Andrij

2018-02-01

Rank-frequency distributions of nucleotide sequences in mitochondrial DNA are defined in a way analogous to the linguistic approach, with the highest-frequent nucleobase serving as a whitespace. For such sequences, entropy and mean length are calculated. These parameters are shown to discriminate the species of the Felidae (cats) and Ursidae (bears) families. From purely numerical values we are able to see in particular that giant pandas are bears while koalas are not. The observed linear relation between the parameters is explained using a simple probabilistic model. The approach based on the non-additive generalization of the Bose distribution is used to analyze the frequency spectra of the nucleotide sequences. In this case, the separation of families is not very sharp. Nevertheless, the distributions for Felidae have on average longer tails comparing to Ursidae.

MSuPDA: A Memory Efficient Algorithm for Sequence Alignment.

PubMed

Khan, Mohammad Ibrahim; Kamal, Md Sarwar; Chowdhury, Linkon

2016-03-01

Space complexity is a million dollar question in DNA sequence alignments. In this regard, memory saving under pushdown automata can help to reduce the occupied spaces in computer memory. Our proposed process is that anchor seed (AS) will be selected from given data set of nucleotide base pairs for local sequence alignment. Quick splitting techniques will separate the AS from all the DNA genome segments. Selected AS will be placed to pushdown automata's (PDA) input unit. Whole DNA genome segments will be placed into PDA's stack. AS from input unit will be matched with the DNA genome segments from stack of PDA. Match, mismatch and indel of nucleotides will be popped from the stack under the control unit of pushdown automata. During the POP operation on stack, it will free the memory cell occupied by the nucleotide base pair.

Diversity of 16S rRNA genes of new Ehrlichia strains isolated from horses with clinical signs of Potomac horse fever.

PubMed

Wen, B; Rikihisa, Y; Fuerst, P A; Chaichanasiriwithaya, W

1995-04-01

Ehrlichia risticii is the causative agent of Potomac horse fever. Variations among the major antigens of different local E. risticii strains have been detected previously. To further assess genetic variability in this species or species complex, the sequences of the 16S rRNA genes of several isolates obtained from sick horses diagnosed as having Potomac horse fever were determined. The sequences of six isolates obtained from Ohio and three isolates obtained from Kentucky were amplified by PCR. Three groups of sequences were identified. The sequences of five of the Ohio isolates were identical to the sequence of the type strain of E. risticii, the Illinois strain. The sequence of one Ohio isolate, isolate 081, was unique; this sequence differed in 10 nucleotides from the sequence of the type strain (level of similarity, 99.3%). The sequences of the three Kentucky isolates were identical to each other, but differed by five bases from the sequence of the type strain (level of similarity, 99.6%). The levels of sequence similarity of isolate 081, the Kentucky isolates, and the type strain to the next most closely related Ehrlichia sp., Ehrlichia sennetsu, were 99.3, 99.2, and 99.2%, respectively. On the basis of the distinct antigenic profiles and the levels of 16S rRNA sequence divergence, isolate 081 is as divergent from the type strain of E. risticii as E. sennetsu is. Therefore, we suggest that strain 081 and the Kentucky isolates may represent two new distinct Ehrlichia species.

Parallel gene analysis with allele-specific padlock probes and tag microarrays

PubMed Central

Banér, Johan; Isaksson, Anders; Waldenström, Erik; Jarvius, Jonas; Landegren, Ulf; Nilsson, Mats

2003-01-01

Parallel, highly specific analysis methods are required to take advantage of the extensive information about DNA sequence variation and of expressed sequences. We present a scalable laboratory technique suitable to analyze numerous target sequences in multiplexed assays. Sets of padlock probes were applied to analyze single nucleotide variation directly in total genomic DNA or cDNA for parallel genotyping or gene expression analysis. All reacted probes were then co-amplified and identified by hybridization to a standard tag oligonucleotide array. The technique was illustrated by analyzing normal and pathogenic variation within the Wilson disease-related ATP7B gene, both at the level of DNA and RNA, using allele-specific padlock probes. PMID:12930977

Translating natural genetic variation to gene expression in a computational model of the Drosophila gap gene regulatory network

PubMed Central

Kozlov, Konstantin N.; Kulakovskiy, Ivan V.; Zubair, Asif; Marjoram, Paul; Lawrie, David S.; Nuzhdin, Sergey V.; Samsonova, Maria G.

2017-01-01

Annotating the genotype-phenotype relationship, and developing a proper quantitative description of the relationship, requires understanding the impact of natural genomic variation on gene expression. We apply a sequence-level model of gap gene expression in the early development of Drosophila to analyze single nucleotide polymorphisms (SNPs) in a panel of natural sequenced D. melanogaster lines. Using a thermodynamic modeling framework, we provide both analytical and computational descriptions of how single-nucleotide variants affect gene expression. The analysis reveals that the sequence variants increase (decrease) gene expression if located within binding sites of repressors (activators). We show that the sign of SNP influence (activation or repression) may change in time and space and elucidate the origin of this change in specific examples. The thermodynamic modeling approach predicts non-local and non-linear effects arising from SNPs, and combinations of SNPs, in individual fly genotypes. Simulation of individual fly genotypes using our model reveals that this non-linearity reduces to almost additive inputs from multiple SNPs. Further, we see signatures of the action of purifying selection in the gap gene regulatory regions. To infer the specific targets of purifying selection, we analyze the patterns of polymorphism in the data at two phenotypic levels: the strengths of binding and expression. We find that combinations of SNPs show evidence of being under selective pressure, while individual SNPs do not. The model predicts that SNPs appear to accumulate in the genotypes of the natural population in a way biased towards small increases in activating action on the expression pattern. Taken together, these results provide a systems-level view of how genetic variation translates to the level of gene regulatory networks via combinatorial SNP effects. PMID:28898266

Browning in Annona cherimola fruit: role of polyphenol oxidase and characterization of a coding sequence of the enzyme.

PubMed

Prieto, Humberto; Utz, Daniella; Castro, Alvaro; Aguirre, Carlos; González-Agüero, Mauricio; Valdés, Héctor; Cifuentes, Nicolas; Defilippi, Bruno G; Zamora, Pablo; Zúñiga, Gustavo; Campos-Vargas, Reinaldo

2007-10-31

Cherimoya (Annona cherimola Mill.) fruit is an attractive candidate for food processing applications as fresh cut. However, along with its desirable delicate taste, cherimoya shows a marked susceptibility to browning. This condition is mainly attributed to polyphenol oxidase activity (PPO). A general lack of knowledge regarding PPO and its role in the oxidative loss of quality in processed cherimoya fruit requires a better understanding of the mechanisms involved. The work carried out included the cloning of a full-length cDNA, an analysis of its properties in the deduced amino sequence, and linkage of its mRNA levels with enzyme activity in mature and ripe fruits after wounding. The results showed one gene different at the nucleotide level when compared with previously reported genes, but a well-conserved protein, either in functional and in structural terms. Cherimoya PPO gene (Ac-ppo, GenBank DQ990911) showed to be present apparently in one copy of the genome, and its transcripts could be significantly detected in leaves and less abundantly in flowers and fruits. Analysis of wounded matured and ripened fruits revealed an inductive behavior for mRNA levels in the flesh of mature cherimoya after 16 h. Although the highest enzymatic activity was observed on rind, a consistent PPO activity was detected on flesh samples. A lack of correlation between PPO mRNA level and PPO activity was observed, especially in flesh tissue. This is probably due to the presence of monophenolic substrates inducing a lag period, enzyme inhibitors and/or diphenolic substrates causing suicide inactivation, and proenzyme or latent isoforms of PPO. To our knowledge this is the first report of a complete PPO sequence in cherimoya. Furthermore, the gene is highly divergent from known nucleotide sequences but shows a well conserved protein in terms of its function, deduced structure, and physiological role.

Molecular cloning and nucleotide sequence of the alpha and beta subunits of allophycocyanin from the cyanelle genome of Cyanophora paradoxa.

PubMed Central

Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E

1985-01-01

The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916

Begomoviruses infecting weeds in Cuba: increased host range and a novel virus infecting Sida rhombifolia.

PubMed

Fiallo-Olivé, Elvira; Navas-Castillo, Jesús; Moriones, Enrique; Martínez-Zubiaur, Yamila

2012-01-01

As a result of surveys conducted during the last few years to search for wild reservoirs of begomoviruses in Cuba, we detected a novel bipartite begomovirus, sida yellow mottle virus (SiYMoV), infecting Sida rhombifolia plants. The complete genome sequence was obtained, showing that DNA-A was 2622 nucleotides (nt) in length and that it was most closely related (87.6% nucleotide identity) to DNA-A of an isolate of sida golden mosaic virus (SiGMV) that infects snap beans (Phaseolus vulgaris) in Florida. The DNA-B sequence was 2600 nt in length and shared the highest nucleotide identity (75.1%) with corchorus yellow spot virus (CoYSV). Phylogenetic relationship analysis showed that both DNA components of SiYMoV were grouped in the Abutilon clade, along with begomoviruses from Florida and the Caribbean islands. We also present here the complete nucleotide sequence of a novel strain of sida yellow vein virus found infecting Malvastrum coromandelianum and an isolate of euphorbia mosaic virus that was found for the first time infecting Euphorbia heterophylla in Cuba.

[Determination of genetic bases of auxotrophy in Yersinia pestis ssp. caucasica strains].

PubMed

Odinokov, G N; Eroshenko, G A; Kukleva, L M; Shavina, N Iu; Krasnov, Ia M; Kutyrev, V V

2012-04-01

Based on the results of computer analysis of nucleotide sequences in strains Yersinia pestis and Y. pseudotuberculosis recorded in the files of NCBI GenBank database, differences between genes argA, aroG, aroF, thiH, and thiG of strain Pestoides F (subspecies caucasica) were found, compared to other strains of plaque agent and pseudotuberculosis microbe. Using PCR with calculated primers and the method of sequence analysis, the structure of variable regions of these genes was studied in 96 natural Y. pestis and Y. pseudotuberculosis strains. It was shown that all examined strains of subspecies caucasica, unlike strains of plague-causing agent of other subspecies and pseudotubercolosis microbe, had identical mutations in genes argA (integration of the insertion sequence IS100), aroG (insertion of ten nucleotides), aroF (inserion of IS100), thiH (insertion of nucleotide T), and thiG (deletion of 13 nucleotides). These mutations are the reason for the absence in strains belonging to this subspecies of the ability to synthesize arginine, phenylalanine, tyrosine, and vitamin B1 (thiamine), and cause their auxotrophy for these growth factors.

Comprehensive analysis of the T-cell receptor beta chain gene in rhesus monkey by high throughput sequencing

PubMed Central

Li, Zhoufang; Liu, Guangjie; Tong, Yin; Zhang, Meng; Xu, Ying; Qin, Li; Wang, Zhanhui; Chen, Xiaoping; He, Jiankui

2015-01-01

Profiling immune repertoires by high throughput sequencing enhances our understanding of immune system complexity and immune-related diseases in humans. Previously, cloning and Sanger sequencing identified limited numbers of T cell receptor (TCR) nucleotide sequences in rhesus monkeys, thus their full immune repertoire is unknown. We applied multiplex PCR and Illumina high throughput sequencing to study the TCRβ of rhesus monkeys. We identified 1.26 million TCRβ sequences corresponding to 643,570 unique TCRβ sequences and 270,557 unique complementarity-determining region 3 (CDR3) gene sequences. Precise measurements of CDR3 length distribution, CDR3 amino acid distribution, length distribution of N nucleotide of junctional region, and TCRV and TCRJ gene usage preferences were performed. A comprehensive profile of rhesus monkey immune repertoire might aid human infectious disease studies using rhesus monkeys. PMID:25961410

Genetic diversity of Plasmodium Vivax revealed by the merozoite surface protein-1 icb5-6 fragment.

PubMed

Ruan, Wei; Zhang, Ling-Ling; Feng, Yan; Zhang, Xuan; Chen, Hua-Liang; Lu, Qiao-Yi; Yao, Li-Nong; Hu, Wei

2017-06-05

Plasmodium vivax remains a potential cause of morbidity and mortality for people living in its endemic areas. Understanding the genetic diversity of P. vivax from different regions is valuable for studying population dynamics and tracing the origins of parasites. The PvMSP-1 gene is highly polymorphic and has been used as a marker in many P. vivax population studies. The aim of this study was to investigate the genetic diversity of the PvMSP-1 gene icb5-6 fragment and to provide more genetic polymorphism data for further studies on P. vivax population structure and tracking of the origin of clinical cases. Nested PCR and sequencing of the PvMSP-1 icb5-6 marker were performed to obtain the nucleotide sequences of 95 P. vivax isolates collected from Zhejiang province, China. To investigate the genetic diversity of PvMSP-1, the 95 nucleotide sequences of the PvMSP-1 icb5-6 fragment were genotyped and analyzed using DnaSP v5, MEGA software. The 95 P. vivax isolates collected from Zhejiang province were either indigenous cases or imported cases from different regions around the world. A total of 95 sequences ranging from 390 to 460 bp were obtained. The 95 sequences were genotyped into four allele-types (Sal I, Belem, R-III and R-IV) and 17 unique haplotypes. R-III and Sal I were the predominant allele-types. The haplotype diversity (Hd) and nucleotide diversity (Pi) were estimated to be 0.729 and 0.062, indicating that the PvMSP-1 icb5-6 fragment had the highest level of polymorphism due to frequent recombination processes and single nucleotide polymorphism. The values of dN/dS and Tajima's D both suggested neutral selection for the PvMSP-1icb5-6 fragment. In addition, a rare recombinant style of R-IV type was identified. This study presented high genetic diversity in the PvMSP-1 marker among P. vivax strains from around the world. The genetic data is valuable for expanding the polymorphism information on P. vivax, which could be helpful for further study on population dynamics and tracking the origin of P. vivax.

[The genetical evolution of the full length genes of 5 EV 71 strains from 5 Shenzhen patients with hand-food-mouth disease associated with EV71 infection].

PubMed

Liu, Wei-long; Yang, Gui-lin; Wei, Qing; Zhang, Ming-xia; Chen, Xin-chun; Liu, Ying-xia; Gao, Yang; Zhou, Bo-ping

2011-02-01

To investigate the characteristics of molecular epidemiology and molecular evolution of 5 EV 71 (enterovirus 71, EV71) strains from 5 Shenzhen patients with hand-food-mouth disease associated with EV 71 infection. 5 EV 71 strains were isolated, and sequenced to analyzed the full length gene sequences in order to compare nucleotide and amino acid homology with other EV71 strains from other regions and countries as well as previous strains across the world through bioinformatics software. 5 strains of EV 71 belonged to sub-genotype C4 by analysis of nucleotide sequences of VP1 and VP4 of EV 71. The differences of nucleotide and amino acid sequences were much small with nucleotide homology of 93% and amino acid homology of 98% among these 5 strains. A phylogenetic tree analysis indicated that 2008 Shenzhen epidemic strains were the most close to 2004 Shenzhen circulating strains, and also much close to 1998 Shenzhen epidemic strains and 2008 Fuyang Anhui strains. The dead strain was very close to 2008 Fuyang Anhui epidemic strains. It can be speculated that this epidemic strains of EV 71 probably originate from the same ancient strain in the history, may from 1998 Shenzhen strain.

TFBSshape: a motif database for DNA shape features of transcription factor binding sites.

PubMed

Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W; Gordân, Raluca; Rohs, Remo

2014-01-01

Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein-DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone.

TFBSshape: a motif database for DNA shape features of transcription factor binding sites

PubMed Central

Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W.; Gordân, Raluca; Rohs, Remo

2014-01-01

Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein–DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone. PMID:24214955

SNPGenie: estimating evolutionary parameters to detect natural selection using pooled next-generation sequencing data.

PubMed

Nelson, Chase W; Moncla, Louise H; Hughes, Austin L

2015-11-15

New applications of next-generation sequencing technologies use pools of DNA from multiple individuals to estimate population genetic parameters. However, no publicly available tools exist to analyse single-nucleotide polymorphism (SNP) calling results directly for evolutionary parameters important in detecting natural selection, including nucleotide diversity and gene diversity. We have developed SNPGenie to fill this gap. The user submits a FASTA reference sequence(s), a Gene Transfer Format (.GTF) file with CDS information and a SNP report(s) in an increasing selection of formats. The program estimates nucleotide diversity, distance from the reference and gene diversity. Sites are flagged for multiple overlapping reading frames, and are categorized by polymorphism type: nonsynonymous, synonymous, or ambiguous. The results allow single nucleotide, single codon, sliding window, whole gene and whole genome/population analyses that aid in the detection of positive and purifying natural selection in the source population. SNPGenie version 1.2 is a Perl program with no additional dependencies. It is free, open-source, and available for download at https://github.com/hugheslab/snpgenie. nelsoncw@email.sc.edu or austin@biol.sc.edu Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Sequence and RT-PCR expression analysis of two peroxidases from Arabidopsis thaliana belonging to a novel evolutionary branch of plant peroxidases.

PubMed

Kjaersgård, I V; Jespersen, H M; Rasmussen, S K; Welinder, K G

1997-03-01

cDNA clones encoding two new Arabidopsis thaliana peroxidases, ATP 1a and ATP 2a, have been identified by searching the Arabidopsis database of expressed sequence tags (dbEST). They represent a novel branch of hitherto uncharacterized plant peroxidases which is only 35% identical in amino acid sequence to the well characterized group of basic plant peroxidases represented by the horseradish (Armoracia rusticana) isoperoxidases HRP C, HRP E5 and the similar Arabidopsis isoperoxidases ATP Ca, ATP Cb, and ATP Ea. However ATP 1a is 87% identical in amino acid sequence to a peroxidase encoded by an mRNA isolated from cotton (Gossypium hirsutum). As cotton and Arabidopsis belong to rather diverse families (Malvaceae and Crucifereae, respectively), in contrast with Arabidopsis and horseradish (both Crucifereae), the high degree of sequence identity indicates that this novel type of peroxidase, albeit of unknown function, is likely to be widespread in plant species. The atp 1 and atp 2 types of cDNA sequences were the most redundant among the 28 different isoperoxidases identified among about 200 peroxidase encoding ESTs. Interestingly, 8 out of totally 38 EST sequences coding for ATP 1 showed three identical nucleotide substitutions. This variant form is designated ATP 1b. Similarly, six out of totally 16 EST sequences coding for ATP 2 showed a number of deletions and nucleotide changes. This variant form is designated ATP 2b. The selected EST clones are full-length and contain coding regions of 993 nucleotides for atp 1a, and 984 nucleotides for atp 2a. These regions show 61% DNA sequence identity. The predicted mature proteins ATP 1a, and ATP 2a are 57% identical in sequence and contain the structurally and functionally important residues, characteristic of the plant peroxidase superfamily. However, they do show two differences of importance to peroxidase catalysis: (1) the asparagine residue linked with the active site distal histidine via hydrogen bonding is absent; (2) an N-glycosylation site is located right at the entrance to the heme channel. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to identify mRNAs coding for ATP 1a/b and ATP 2a/b in germinating seeds, seedlings, roots, leaves, stems, flowers and cell suspension culture using elongation factor 1alpha (EF-1alpha) for the first time as a positive control. Both mRNAs were transcribed at levels comparable to EF-1alpha in all plant tissues investigated which were more than two days old, and in cell suspension culture. In addition, the mRNA coding for ATP 1a/b was found in two day old germinating seeds. The abundant transcription of ATP 1a/b and ATP 2a/b is in line with their many entries in dbEST, and indicates essential roles for these novel peroxidases.

Mechanisms of haplotype divergence at the RGA08 nucleotide-binding leucine-rich repeat gene locus in wild banana (Musa balbisiana).

PubMed

Baurens, Franc-Christophe; Bocs, Stéphanie; Rouard, Mathieu; Matsumoto, Takashi; Miller, Robert N G; Rodier-Goud, Marguerite; MBéguié-A-MBéguié, Didier; Yahiaoui, Nabila

2010-07-16

Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M. balbisiana haplotypes. A large RGA08 gene cluster identified in wild banana corresponds to a highly variable genomic region between haplotypes surrounded by conserved flanking regions. High level of sequence identity (70 to 99%) of the genic and intergenic regions suggests a recent and rapid evolution of this cluster in M. balbisiana.

A new family of satellite DNA sequences as a major component of centromeric heterochromatin in owls (Strigiformes).

PubMed

Yamada, Kazuhiko; Nishida-Umehara, Chizuko; Matsuda, Yoichi

2004-03-01

We isolated a new family of satellite DNA sequences from HaeIII- and EcoRI-digested genomic DNA of the Blakiston's fish owl ( Ketupa blakistoni). The repetitive sequences were organized in tandem arrays of the 174 bp element, and localized to the centromeric regions of all macrochromosomes, including the Z and W chromosomes, and microchromosomes. This hybridization pattern was consistent with the distribution of C-band-positive centromeric heterochromatin, and the satellite DNA sequences occupied 10% of the total genome as a major component of centromeric heterochromatin. The sequences were homogenized between macro- and microchromosomes in this species, and therefore intraspecific divergence of the nucleotide sequences was low. The 174 bp element cross-hybridized to the genomic DNA of six other Strigidae species, but not to that of the Tytonidae, suggesting that the satellite DNA sequences are conserved in the same family but fairly divergent between the different families in the Strigiformes. Secondly, the centromeric satellite DNAs were cloned from eight Strigidae species, and the nucleotide sequences of 41 monomer fragments were compared within and between species. Molecular phylogenetic relationships of the nucleotide sequences were highly correlated with both the taxonomy based on morphological traits and the phylogenetic tree constructed by DNA-DNA hybridization. These results suggest that the satellite DNA sequence has evolved by concerted evolution in the Strigidae and that it is a good taxonomic and phylogenetic marker to examine genetic diversity between Strigiformes species.

Novel Mutations in pncA Gene of Pyrazinamide Resistant Clinical Isolates of Mycobacterium tuberculosis.

PubMed

Kahbazi, Manijeh; Sarmadian, Hossein; Ahmadi, Azam; Didgar, Farshideh; Sadrnia, Maryam; Poolad, Toktam; Arjomandzadegan, Mohammad

2018-04-16

In clinical isolates of Mycobacterium tuberculosis (MTB), resistance to pyrazinamide occurs by mutations in any positions of the pncA gene (NC_000962.3) especially in nucleotides 359 and 374. In this study we examined the pncA gene sequence in clinical isolates of MTB. Genomic DNA of 33 clinical isolates of MTB was extracted by the Chelex100 method. The polymerase chain reactions (PCR) were performed using specific primers for amplification of 744 bp amplicon comprising the coding sequences (CDS) of the pncA gene. PCR products were sequenced by an automated sequencing Bioscience system. Additionally, semi Nested-allele specific (sNASP) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) methods were carried out for verification of probable mutations in nucleotides 359 and 374. Sequencing results showed that from 33 MTB clinical isolates, nine pyrazinamide-resistant isolates have mutations. Furthermore, no mutation was detected in 24 susceptible strains in the entire 561 bp of the pncA gene. Moreover, new mutations of G→A at position 3 of the pncA gene were identified in some of the resistant isolates. Results showed that the sNASP method could detect mutations in nucleotide 359 and 374 of the pncA gene, but the PCR-RFLP method by the SacII enzyme could not detect these mutations. In conclusion, the identification of new mutations in the pncA gene confirmed the probable occurrence of mutations in any nucleotides of the pncA gene sequence in resistant isolates of MTB.

37 CFR 41.37 - Appeal brief.

Code of Federal Regulations, 2011 CFR

2011-07-01

... limitation is described in the specification as filed. If there is a drawing or amino acid or nucleotide material sequence, and at least one limitation is illustrated in a drawing or amino acid or nucleotide...

37 CFR 41.37 - Appeal brief.

Code of Federal Regulations, 2010 CFR

2010-07-01

... limitation is described in the specification as filed. If there is a drawing or amino acid or nucleotide material sequence, and at least one limitation is illustrated in a drawing or amino acid or nucleotide...

Skipping of exon 27 in C3 gene compromises TED domain and results in complete human C3 deficiency.

PubMed

da Silva, Karina Ribeiro; Fraga, Tatiana Rodrigues; Lucatelli, Juliana Faggion; Grumach, Anete Sevciovic; Isaac, Lourdes

2016-05-01

Primary deficiency of complement C3 is rare and usually associated with increased susceptibility to bacterial infections. In this work, we investigated the molecular basis of complete C3 deficiency in a Brazilian 9-year old female patient with a family history of consanguinity. Hemolytic assays revealed complete lack of complement-mediated hemolytic activity in the patient's serum. While levels of the complement regulatory proteins Factor I, Factor H and Factor B were normal in the patient's and family members' sera, complement C3 levels were undetectable in the patient's serum and were reduced by at least 50% in the sera of the patient's parents and brother. Additionally, no C3 could be observed in the patient's plasma and cell culture supernatants by Western blot. We also observed that patient's skin fibroblasts stimulated with Escherichia coli LPS were unable to secrete C3, which might be accumulated within the cells before being intracellularly degraded. Sequencing analysis of the patient's C3 cDNA revealed a genetic mutation responsible for the complete skipping of exon 27, resulting in the loss of 99 nucleotides (3450-3549) located in the TED domain. Sequencing of the intronic region between the exons 26 and 27 of the C3 gene (nucleotides 6690313-6690961) showed a nucleotide exchange (T→C) at position 6690626 located in a splicing donor site, resulting in the complete skipping of exon 27 in the C3 mRNA. Copyright © 2016. Published by Elsevier GmbH.

Genetic characterization of L-Zagreb mumps vaccine strain.

PubMed

Ivancic, Jelena; Gulija, Tanja Kosutic; Forcic, Dubravko; Baricevic, Marijana; Jug, Renata; Mesko-Prejac, Majda; Mazuran, Renata

2005-04-01

Eleven mumps vaccine strains, all containing live attenuated virus, have been used throughout the world. Although L-Zagreb mumps vaccine has been licensed since 1972, only its partial nucleotide sequence was previously determined (accession numbers , and ). Therefore, we sequenced the entire genome of L-Zagreb vaccine strain (Institute of Immunology Inc., Zagreb, Croatia). In order to investigate the genetic stability of the vaccine, sequences of both L-Zagreb master seed and currently produced vaccine batch were determined and no difference between them was observed. A phylogenetic analysis based on SH gene sequence has shown that L-Zagreb strain does not belong to any of established mumps genotypes and that it is most similar to old, laboratory preserved European strains (1950s-1970s). L-Zagreb nucleotide and deduced protein sequences were compared with other mumps virus sequences obtained from the GenBank. Emphasis was put on functionally important protein regions and known antigenic epitopes. The extensive comparisons of nucleotide and deduced protein sequences between L-Zagreb vaccine strain and other previously determined mumps virus sequences have shown that while the functional regions of HN, V, and L proteins are well conserved among various mumps strains, there can be a substantial amino acid difference in antigenic epitopes of all proteins and in functional regions of F protein. No molecular pattern was identified that can be used as a distinction marker between virulent and attenuated strains.

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.

PubMed Central

D'Souza, T M; Boominathan, K; Reddy, C A

1996-01-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429

Dynamics of actin evolution in dinoflagellates.

PubMed

Kim, Sunju; Bachvaroff, Tsvetan R; Handy, Sara M; Delwiche, Charles F

2011-04-01

Dinoflagellates have unique nuclei and intriguing genome characteristics with very high DNA content making complete genome sequencing difficult. In dinoflagellates, many genes are found in multicopy gene families, but the processes involved in the establishment and maintenance of these gene families are poorly understood. Understanding the dynamics of gene family evolution in dinoflagellates requires comparisons at different evolutionary scales. Studies of closely related species provide fine-scale information relative to species divergence, whereas comparisons of more distantly related species provides broad context. We selected the actin gene family as a highly expressed conserved gene previously studied in dinoflagellates. Of the 142 sequences determined in this study, 103 were from the two closely related species, Dinophysis acuminata and D. caudata, including full length and partial cDNA sequences as well as partial genomic amplicons. For these two Dinophysis species, at least three types of sequences could be identified. Most copies (79%) were relatively similar and in nucleotide trees, the sequences formed two bushy clades corresponding to the two species. In comparisons within species, only eight to ten nucleotide differences were found between these copies. The two remaining types formed clades containing sequences from both species. One type included the most similar sequences in between-species comparisons with as few as 12 nucleotide differences between species. The second type included the most divergent sequences in comparisons between and within species with up to 93 nucleotide differences between sequences. In all the sequences, most variation occurred in synonymous sites or the 5' UnTranslated Region (UTR), although there was still limited amino acid variation between most sequences. Several potential pseudogenes were found (approximately 10% of all sequences depending on species) with incomplete open reading frames due to frameshifts or early stop codons. Overall, variation in the actin gene family fits best with the "birth and death" model of evolution based on recent duplications, pseudogenes, and incomplete lineage sorting. Divergence between species was similar to variation within species, so that actin may be too conserved to be useful for phylogenetic estimation of closely related species.

Duplicates, redundancies and inconsistencies in the primary nucleotide databases: a descriptive study.

PubMed

Chen, Qingyu; Zobel, Justin; Verspoor, Karin

2017-01-01

GenBank, the EMBL European Nucleotide Archive and the DNA DataBank of Japan, known collectively as the International Nucleotide Sequence Database Collaboration or INSDC, are the three most significant nucleotide sequence databases. Their records are derived from laboratory work undertaken by different individuals, by different teams, with a range of technologies and assumptions and over a period of decades. As a consequence, they contain a great many duplicates, redundancies and inconsistencies, but neither the prevalence nor the characteristics of various types of duplicates have been rigorously assessed. Existing duplicate detection methods in bioinformatics only address specific duplicate types, with inconsistent assumptions; and the impact of duplicates in bioinformatics databases has not been carefully assessed, making it difficult to judge the value of such methods. Our goal is to assess the scale, kinds and impact of duplicates in bioinformatics databases, through a retrospective analysis of merged groups in INSDC databases. Our outcomes are threefold: (1) We analyse a benchmark dataset consisting of duplicates manually identified in INSDC-a dataset of 67 888 merged groups with 111 823 duplicate pairs across 21 organisms from INSDC databases - in terms of the prevalence, types and impacts of duplicates. (2) We categorize duplicates at both sequence and annotation level, with supporting quantitative statistics, showing that different organisms have different prevalence of distinct kinds of duplicate. (3) We show that the presence of duplicates has practical impact via a simple case study on duplicates, in terms of GC content and melting temperature. We demonstrate that duplicates not only introduce redundancy, but can lead to inconsistent results for certain tasks. Our findings lead to a better understanding of the problem of duplication in biological databases.Database URL: the merged records are available at https://cloudstor.aarnet.edu.au/plus/index.php/s/Xef2fvsebBEAv9w. © The Author(s) 2017. Published by Oxford University Press.

Duplicates, redundancies and inconsistencies in the primary nucleotide databases: a descriptive study

PubMed Central

Chen, Qingyu; Zobel, Justin; Verspoor, Karin

2017-01-01

GenBank, the EMBL European Nucleotide Archive and the DNA DataBank of Japan, known collectively as the International Nucleotide Sequence Database Collaboration or INSDC, are the three most significant nucleotide sequence databases. Their records are derived from laboratory work undertaken by different individuals, by different teams, with a range of technologies and assumptions and over a period of decades. As a consequence, they contain a great many duplicates, redundancies and inconsistencies, but neither the prevalence nor the characteristics of various types of duplicates have been rigorously assessed. Existing duplicate detection methods in bioinformatics only address specific duplicate types, with inconsistent assumptions; and the impact of duplicates in bioinformatics databases has not been carefully assessed, making it difficult to judge the value of such methods. Our goal is to assess the scale, kinds and impact of duplicates in bioinformatics databases, through a retrospective analysis of merged groups in INSDC databases. Our outcomes are threefold: (1) We analyse a benchmark dataset consisting of duplicates manually identified in INSDC—a dataset of 67 888 merged groups with 111 823 duplicate pairs across 21 organisms from INSDC databases – in terms of the prevalence, types and impacts of duplicates. (2) We categorize duplicates at both sequence and annotation level, with supporting quantitative statistics, showing that different organisms have different prevalence of distinct kinds of duplicate. (3) We show that the presence of duplicates has practical impact via a simple case study on duplicates, in terms of GC content and melting temperature. We demonstrate that duplicates not only introduce redundancy, but can lead to inconsistent results for certain tasks. Our findings lead to a better understanding of the problem of duplication in biological databases. Database URL: the merged records are available at https://cloudstor.aarnet.edu.au/plus/index.php/s/Xef2fvsebBEAv9w PMID:28077566

Equalizer reduces SNP bias in Affymetrix microarrays.

PubMed

Quigley, David

2015-07-30

Gene expression microarrays measure the levels of messenger ribonucleic acid (mRNA) in a sample using probe sequences that hybridize with transcribed regions. These probe sequences are designed using a reference genome for the relevant species. However, most model organisms and all humans have genomes that deviate from their reference. These variations, which include single nucleotide polymorphisms, insertions of additional nucleotides, and nucleotide deletions, can affect the microarray's performance. Genetic experiments comparing individuals bearing different population-associated single nucleotide polymorphisms that intersect microarray probes are therefore subject to systemic bias, as the reduction in binding efficiency due to a technical artifact is confounded with genetic differences between parental strains. This problem has been recognized for some time, and earlier methods of compensation have attempted to identify probes affected by genome variants using statistical models. These methods may require replicate microarray measurement of gene expression in the relevant tissue in inbred parental samples, which are not always available in model organisms and are never available in humans. By using sequence information for the genomes of organisms under investigation, potentially problematic probes can now be identified a priori. However, there is no published software tool that makes it easy to eliminate these probes from an annotation. I present equalizer, a software package that uses genome variant data to modify annotation files for the commonly used Affymetrix IVT and Gene/Exon platforms. These files can be used by any microarray normalization method for subsequent analysis. I demonstrate how use of equalizer on experiments mapping germline influence on gene expression in a genetic cross between two divergent mouse species and in human samples significantly reduces probe hybridization-induced bias, reducing false positive and false negative findings. The equalizer package reduces probe hybridization bias from experiments performed on the Affymetrix microarray platform, allowing accurate assessment of germline influence on gene expression.

Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

PubMed

Wyszyńska-Koko, J; Kurył, J

2004-01-01

MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

A study of lactose metabolism in Lactococcus garvieae reveals a genetic marker for distinguishing between dairy and fish biotypes.

PubMed

Fortina, Maria Grazia; Ricci, Giovanni; Borgo, Francesca

2009-06-01

Dairy and fish isolates of Lactococcus garvieae were tested for their ability to utilize lactose and to grow in milk. Fish isolates were unable to assimilate lactose, but unexpectedly, they possessed the ability to grow in milk. Genetic studies, carried out constructing different vectorette libraries, provided evidence that in fish isolates, no genes involved in lactose utilization were present. For L. garvieae dairy isolates, a single system for the catabolism of lactose was found. It consists of a lactose transport and hydrolysis depending on a phosphoenolpyruvate-dependent phosphotransferase system combined with a phospho-beta-galactosidase. The genes involved were highly similar at the nucleotide sequence level to their counterparts in Lactococcus lactis; however, while in many L. lactis strains these genes are plasmid encoded, in L. garvieae they are chromosomally located. Thus, in the species L. garvieae, the phospho-beta-galactosidase gene, detectable in all strains of dairy origin but lacking in fish isolates, can be considered a reliable genetic marker for distinguishing biotypes in the two diverse ecological niches. Moreover, we obtained information regarding the complete nucleotide sequence of the gal operon in L. garvieae, consisting of a galactose permease and the Leloir pathway enzymes. This is one of the first reports concerning the determination of the nucleotide sequences of genes (other than the 16S rDNA gene) in L. garvieae and should be considered a step in a continuous effort to explore the genome of this species, with the aim of determining the real relationship between the presence of L. garvieae in dairy products and food safety.

An Outbreak of Respiratory Tularemia Caused by Diverse Clones of Francisella tularensis

PubMed Central

Johansson, Anders; Lärkeryd, Adrian; Widerström, Micael; Mörtberg, Sara; Myrtännäs, Kerstin; Öhrman, Caroline; Birdsell, Dawn; Keim, Paul; Wagner, David M.; Forsman, Mats; Larsson, Pär

2014-01-01

Background. The bacterium Francisella tularensis is recognized for its virulence, infectivity, genetic homogeneity, and potential as a bioterrorism agent. Outbreaks of respiratory tularemia, caused by inhalation of this bacterium, are poorly understood. Such outbreaks are exceedingly rare, and F. tularensis is seldom recovered from clinical specimens. Methods. A localized outbreak of tularemia in Sweden was investigated. Sixty-seven humans contracted laboratory-verified respiratory tularemia. F. tularensis subspecies holarctica was isolated from the blood or pleural fluid of 10 individuals from July to September 2010. Using whole-genome sequencing and analysis of single-nucleotide polymorphisms (SNPs), outbreak isolates were compared with 110 archived global isolates. Results. There were 757 SNPs among the genomes of the 10 outbreak isolates and the 25 most closely related archival isolates (all from Sweden/Finland). Whole genomes of outbreak isolates were >99.9% similar at the nucleotide level and clustered into 3 distinct genetic clades. Unexpectedly, high-sequence similarity grouped some outbreak and archival isolates that originated from patients from different geographic regions and up to 10 years apart. Outbreak and archival genomes frequently differed by only 1–3 of 1 585 229 examined nucleotides. Conclusions. The outbreak was caused by diverse clones of F. tularensis that occurred concomitantly, were widespread, and apparently persisted in the environment. Multiple independent acquisitions of F. tularensis from the environment over a short time period suggest that natural outbreaks of respiratory tularemia are triggered by environmental cues. The findings additionally caution against interpreting genome sequence identity for this pathogen as proof of a direct epidemiological link. PMID:25097081

DSAP: deep-sequencing small RNA analysis pipeline.

PubMed

Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

2010-07-01

DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

Single-Cell Sequencing for Drug Discovery and Drug Development.

PubMed

Wu, Hongjin; Wang, Charles; Wu, Shixiu

2017-01-01

Next-generation sequencing (NGS), particularly single-cell sequencing, has revolutionized the scale and scope of genomic and biomedical research. Recent technological advances in NGS and singlecell studies have made the deep whole-genome (DNA-seq), whole epigenome and whole-transcriptome sequencing (RNA-seq) at single-cell level feasible. NGS at the single-cell level expands our view of genome, epigenome and transcriptome and allows the genome, epigenome and transcriptome of any organism to be explored without a priori assumptions and with unprecedented throughput. And it does so with single-nucleotide resolution. NGS is also a very powerful tool for drug discovery and drug development. In this review, we describe the current state of single-cell sequencing techniques, which can provide a new, more powerful and precise approach for analyzing effects of drugs on treated cells and tissues. Our review discusses single-cell whole genome/exome sequencing (scWGS/scWES), single-cell transcriptome sequencing (scRNA-seq), single-cell bisulfite sequencing (scBS), and multiple omics of single-cell sequencing. We also highlight the advantages and challenges of each of these approaches. Finally, we describe, elaborate and speculate the potential applications of single-cell sequencing for drug discovery and drug development. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Molecular characterization and expression profiling of BMP 3 gene in broiler and layer chicken.

PubMed

Divya, Devara; Bhattacharya, Tarun Kumar; Gnana Prakash, Manthani; Chatterjee, R N; Shukla, Renu; Guru Vishnu, Pothana Boyina; Vinoth, Amirthalingam; Dushyanth, Kotha

2018-04-10

A study was carried out to characterize and explore the expression profile of BMP 3 gene in control broiler and control layer chicken. The total open reading frame of BMP 3 (1389 bp) was cloned and sequenced. The control broiler and control layer chicken showed variation at nucleotide and amino acid level with reference gene (Gallus gallus, NCBI Acc. No. NM_001034819). When compared to reference gene, the control broiler showed four nucleotide differences (c.192A>G, c.519C>T, 903G>A and 960C>G), while, control layer showed variation at c.33G>C, 192A>G, 858G>A, 904G>A, 960C>G and 1257C>T making six differences in total. However, between control broiler and control layer lines, nucleotide differences was observed at c.33G>C, 519T>C, 858G>A, 903A>G, 904G>A and 1257C>T. The change at amino acid level between reference and control broiler was p.D320N and with control layer chicken, it was p.D302N and p.D320N. On the other hand, a single amino acid difference (p.D302N) was observed between the control broiler and control layer chicken lines. The phylogenetic study displayed a close relationship between broiler and layer lines and reference gene and also with other avian species resulting in a cluster formation. These cluster in turn displayed a distant link with the mammalian species. The expression profile of BMP 3 gene exhibited a variation at different stages of embryonic development and also at post embryonic period among the lines with control layer showing higher expression than that of broiler chicken. The protein was also detected in bone marrow tissue of broiler and layer lines by western blotting. It is concluded that the BMP 3 gene sequence differed at nucleotide and amino acid level among the lines and the gene expressed differentially at different periods of embryonic development and also at post hatch period.

Complete nucleotide sequence of pig (Sus scrofa) mitochondrial genome and dating evolutionary divergence within Artiodactyla.

PubMed

Lin, C S; Sun, Y L; Liu, C Y; Yang, P C; Chang, L C; Cheng, I C; Mao, S J; Huang, M C

1999-08-05

The complete nucleotide sequence of the pig (Sus scrofa) mitochondrial genome, containing 16613bp, is presented in this report. The genome is not a specific length because of the presence of the variable numbers of tandem repeats, 5'-CGTGCGTACA in the displacement loop (D-loop). Genes responsible for 12S and 16S rRNAs, 22 tRNAs, and 13 protein-coding regions are found. The genome carries very few intergenic nucleotides with several instances of overlap between protein-coding or tRNA genes, except in the D-loop region. For evaluating the possible evolutionary relationships between Artiodactyla and Cetacea, the nucleotide substitutions and amino acid sequences of 13 protein-coding genes were aligned by pairwise comparisons of the pig, cow, and fin whale. By comparing these sequences, we suggest that there is a closer relationship between the pig and cow than that between either of these species and fin whale. In addition, the accumulation of transversions and gaps in pig 12S and 16S rRNA genes was compared with that in other eutherian species, including cow, fin whale, human, horse, and harbor seal. The results also reveal a close phylogenetic relationship between pig and cow, as compared to fin whale and others. Thus, according to the sequence differences of mitochondrial rRNA genes in eutherian species, the evolutionary separation of pig and cow occurred about 53-60 million years ago.

Structural analysis of the human U3 ribonucleoprotein particle reveal a conserved sequence available for base pairing with pre-rRNA.

PubMed Central

Parker, K A; Steitz, J A

1987-01-01

The human U3 ribonucleoprotein (RNP) has been analyzed to determine its protein constituents, sites of protein-RNA interaction, and RNA secondary structure. By using anti-U3 RNP antibodies and extracts prepared from HeLa cells labeled in vivo, the RNP was found to contain four nonphosphorylated proteins of 36, 30, 13, and 12.5 kilodaltons and two phosphorylated proteins of 74 and 59 kilodaltons. U3 nucleotides 72-90, 106-121, 154-166, and 190-217 must contain sites that interact with proteins since these regions are immunoprecipitated after treatment of the RNP with RNase A or T1. The secondary structure was probed with specific nucleases and by chemical modification with single-strand-specific reagents that block subsequent reverse transcription. Regions that are single stranded (and therefore potentially able to interact with a substrate RNA) include an evolutionarily conserved sequence at nucleotides 104-112 and nonconserved sequences at nucleotides 65-74, 80-84, and 88-93. Nucleotides 159-168 do not appear to be highly accessible, thus making it unlikely that this U3 sequence base pairs with sequences near the 5.8S rRNA-internal transcribed spacer II junction, as previously proposed. Alternative functions of the U3 RNP are discussed, including the possibility that U3 may participate in a processing event near the 3' end of 28S rRNA. Images PMID:2959855

Open reading frames in a 4556 nucleotide sequence within MDV-1 BamHI-D DNA fragment: evidence for splicing of mRNA from a new viral glycoprotein gene.

PubMed

Becker, Y; Asher, Y; Tabor, E; Davidson, I; Malkinson, M

1994-01-01

A DNA segment of the MDV-1 BamHI-D fragment was sequenced, and the open reading frames (ORFs) present in the 4556 nucleotide fragment were analyzed by computer programs. Computer analysis identified 19 putative ORFs in the sequence ranging from a coding capacity of 37 amino acids (aa) (ORF-1a) to 684aa (ORF-1). The special properties of four ORFs (1a, 1, 2, and 3) were investigated. Two adjacent ORFs, ORF-1a and ORF-1, were found by computer analysis to have the properties of two introns encoding a glycoprotein: ORF-1a encodes an aa sequence with the properties of a signal peptide, and ORF-1 encodes a polypeptide with a membrane anchor domain and putative N-glycosylation sites in the aa sequence. ORF-1a and ORF-1 were found to be transcribed in MDV-1-infected cells. Two RNA transcripts were detected: a precursor RNA and its spliced form. Both are transcribed from a promoter located 5' to ORF-1a, and splice donor and acceptor sites are used to splice the mRNA after cleavage of a 71-nucleotide sequence. This finding suggest that ORF-1a and ORF-1 are two introns of a new MDV-1 glycoprotein gene. The DNA sequence containing ORF-1 was transiently expressed in COS-1 cells, and the viral protein produced in these cells was found to react with anti-MDV serotype-1 Antigen B-specific monoclonal antibodies. These studies indicate that the protein encoded by ORF-1 has antigenic properties resembling Antigen B of MDV-1. A gene homologous to ORF-1 was detected in the genome of both MDV-2(SB1) and MDV-3(HVT), which serve as commercial vaccine strains. Two additional ORFs were noted in the 4556 nucleotide sequence: ORF-2, which encodes a 333 aa polypeptide initiating in the UL and terminating in the TRL prior to the putative origin of replication, and ORF-3, which encodes a 155 aa polypeptide that is partly homologous to the phosphoprotein pp38 encoded by the BamHI-H sequence. The 65 N-terminal aa of the two gene products are identical, both being derived from the nucleotide sequences in the TRL and IRL, respectively. Additional homologous aa sequences are the hydrophobic aa domain in the middle of both proteins. The functions of ORF-2, ORF-3, and additional ORFs are under study.

Shallow Population Genetic Structures of Thread-sail Filefish (Stephanolepis cirrhifer) Populations from Korean Coastal Waters.

PubMed

Yoon, M; Park, W; Nam, Y K; Kim, D S

2012-02-01

Genetic diversities, population genetic structures and demographic histories of the thread-sail filefish Stephanolepis cirrhifer were investigated by nucleotide sequencing of 336 base pairs of the mitochondrial DNA (mtDNA) control region in 111 individuals collected from six populations in Korean coastal waters. A total of 70 haplotypes were defined by 58 variable nucleotide sites. The neighbor-joining tree of the 70 haplotypes was shallow and did not provide evidence of geographical associations. Expansion of S. cirrhifer populations began approximate 51,000 to 102,000 years before present, correlating with the period of sea level rise since the late Pleistocene glacial maximum. High levels of haplotype diversities (0.974±0.029 to 1.000±0.076) and nucleotide diversities (0.014 to 0.019), and low levels of genetic differentiation among populations inferred from pairwise population F ST values (-0.007 to 0.107), support an expansion of the S. cirrhifer population. Hierarchical analysis of molecular variance (AMOVA) revealed weak but significant genetic structures among three groups (F CT = 0.028, p<0.05), and no genetic variation within groups (0.53%; F SC = 0.005, p = 0.23). These results may help establish appropriate fishery management strategies for stocks of S. cirrhifer and related species.

Shallow Population Genetic Structures of Thread-sail Filefish (Stephanolepis cirrhifer) Populations from Korean Coastal Waters

PubMed Central

Yoon, M.; Park, W.; Nam, Y. K.; Kim, D. S.

2012-01-01

Genetic diversities, population genetic structures and demographic histories of the thread-sail filefish Stephanolepis cirrhifer were investigated by nucleotide sequencing of 336 base pairs of the mitochondrial DNA (mtDNA) control region in 111 individuals collected from six populations in Korean coastal waters. A total of 70 haplotypes were defined by 58 variable nucleotide sites. The neighbor-joining tree of the 70 haplotypes was shallow and did not provide evidence of geographical associations. Expansion of S. cirrhifer populations began approximate 51,000 to 102,000 years before present, correlating with the period of sea level rise since the late Pleistocene glacial maximum. High levels of haplotype diversities (0.974±0.029 to 1.000±0.076) and nucleotide diversities (0.014 to 0.019), and low levels of genetic differentiation among populations inferred from pairwise population FST values (−0.007 to 0.107), support an expansion of the S. cirrhifer population. Hierarchical analysis of molecular variance (AMOVA) revealed weak but significant genetic structures among three groups (FCT = 0.028, p<0.05), and no genetic variation within groups (0.53%; FSC = 0.005, p = 0.23). These results may help establish appropriate fishery management strategies for stocks of S. cirrhifer and related species. PMID:25049547

Low level of sequence diversity at merozoite surface protein-1 locus of Plasmodium ovale curtisi and P. ovale wallikeri from Thai isolates.

PubMed

Putaporntip, Chaturong; Hughes, Austin L; Jongwutiwes, Somchai

2013-01-01

The merozoite surface protein-1 (MSP-1) is a candidate target for the development of blood stage vaccines against malaria. Polymorphism in MSP-1 can be useful as a genetic marker for strain differentiation in malarial parasites. Although sequence diversity in the MSP-1 locus has been extensively analyzed in field isolates of Plasmodium falciparum and P. vivax, the extent of variation in its homologues in P. ovale curtisi and P. ovale wallikeri, remains unknown. Analysis of the mitochondrial cytochrome b sequences of 10 P. ovale isolates from symptomatic malaria patients from diverse endemic areas of Thailand revealed co-existence of P. ovale curtisi (n = 5) and P. ovale wallikeri (n = 5). Direct sequencing of the PCR-amplified products encompassing the entire coding region of MSP-1 of P. ovale curtisi (PocMSP-1) and P. ovale wallikeri (PowMSP-1) has identified 3 imperfect repeated segments in the former and one in the latter. Most amino acid differences between these proteins were located in the interspecies variable domains of malarial MSP-1. Synonymous nucleotide diversity (πS) exceeded nonsynonymous nucleotide diversity (πN) for both PocMSP-1 and PowMSP-1, albeit at a non-significant level. However, when MSP-1 of both these species was considered together, πS was significantly greater than πN (p<0.0001), suggesting that purifying selection has shaped diversity at this locus prior to speciation. Phylogenetic analysis based on conserved domains has placed PocMSP-1 and PowMSP-1 in a distinct bifurcating branch that probably diverged from each other around 4.5 million years ago. The MSP-1 sequences support that P. ovale curtisi and P. ovale wallikeri are distinct species. Both species are sympatric in Thailand. The low level of sequence diversity in PocMSP-1 and PowMSP-1 among Thai isolates could stem from persistent low prevalence of these species, limiting the chance of outcrossing at this locus.

Low Level of Sequence Diversity at Merozoite Surface Protein-1 Locus of Plasmodium ovale curtisi and P. ovale wallikeri from Thai Isolates

PubMed Central

Putaporntip, Chaturong; Hughes, Austin L.; Jongwutiwes, Somchai

2013-01-01

Background The merozoite surface protein-1 (MSP-1) is a candidate target for the development of blood stage vaccines against malaria. Polymorphism in MSP-1 can be useful as a genetic marker for strain differentiation in malarial parasites. Although sequence diversity in the MSP-1 locus has been extensively analyzed in field isolates of Plasmodium falciparum and P. vivax, the extent of variation in its homologues in P. ovale curtisi and P. ovale wallikeri, remains unknown. Methodology/Principal Findings Analysis of the mitochondrial cytochrome b sequences of 10 P. ovale isolates from symptomatic malaria patients from diverse endemic areas of Thailand revealed co-existence of P. ovale curtisi (n = 5) and P. ovale wallikeri (n = 5). Direct sequencing of the PCR-amplified products encompassing the entire coding region of MSP-1 of P. ovale curtisi (PocMSP-1) and P. ovale wallikeri (PowMSP-1) has identified 3 imperfect repeated segments in the former and one in the latter. Most amino acid differences between these proteins were located in the interspecies variable domains of malarial MSP-1. Synonymous nucleotide diversity (πS) exceeded nonsynonymous nucleotide diversity (πN) for both PocMSP-1 and PowMSP-1, albeit at a non-significant level. However, when MSP-1 of both these species was considered together, πS was significantly greater than πN (p<0.0001), suggesting that purifying selection has shaped diversity at this locus prior to speciation. Phylogenetic analysis based on conserved domains has placed PocMSP-1 and PowMSP-1 in a distinct bifurcating branch that probably diverged from each other around 4.5 million years ago. Conclusion/Significance The MSP-1 sequences support that P. ovale curtisi and P. ovale wallikeri are distinct species. Both species are sympatric in Thailand. The low level of sequence diversity in PocMSP-1 and PowMSP-1 among Thai isolates could stem from persistent low prevalence of these species, limiting the chance of outcrossing at this locus. PMID:23536840

Large scale DNA microsequencing device

DOEpatents

Foote, Robert S.

1997-01-01

A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.

Large scale DNA microsequencing device

DOEpatents

Foote, Robert S.

1999-01-01

A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.

Complete sequence analysis reveals two distinct poleroviruses infecting cucurbits in China.

PubMed

Xiang, Hai-ying; Shang, Qiao-xia; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin

2008-01-01

The complete RNA genomes of a Chinese isolate of cucurbit aphid-borne yellows virus (CABYV-CHN) and a new polerovirus tentatively referred to as melon aphid-borne yellows virus (MABYV) were determined. The entire genome of CABYV-CHN shared 89.0% nucleotide sequence identity with the French CABYV isolate. In contrast, nucleotide sequence identities between MABYV and CABYV and other poleroviruses were in the range of 50.7-74.2%, with amino acid sequence identities ranging from 24.8 to 82.9% for individual gene products. We propose that CABYV-CHN is a strain of CABYV and that MABYV is a member of a tentative distinct species within the genus Polerovirus.

The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea.

PubMed

Zhao, Fumei; Lim, Seungmo; Yoo, Ran Hee; Igori, Davaajargal; Kim, Sang-Min; Kwak, Do Yeon; Kim, Sun Lim; Lee, Bong Choon; Moon, Jae Sun

2016-07-01

The complete nucleotide sequence of a new barley polerovirus, tentatively named barley virus G (BVG), which was isolated in Gimje, South Korea, has been determined using an RNA sequencing technique combined with polymerase chain reaction methods. The viral genomic RNA of BVG is 5,620 nucleotides long and contains six typical open reading frames commonly observed in other poleroviruses. Sequence comparisons revealed that BVG is most closely related to maize yellow dwarf virus-RMV, with the highest amino acid identities being less than 90 % for all of the corresponding proteins. These results suggested that BVG is a member of a new species in the genus Polerovirus.

Complete nucleotide sequence of spring beauty latent virus, a bromovirus infectious to Arabidopsis thaliana.

PubMed

Fujisaki, K; Hagihara, F; Kaido, M; Mise, K; Okuno, T

2003-01-01

Spring beauty latent virus (SBLV), a bromovirus, systemically and efficiently infected Arabidopsis thaliana, whereas the well-studied bromoviruses brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV) did not infect and poorly infected A. thaliana, respectively. We constructed biologically active cDNA clones of SBLV genomic RNAs and determined their complete nucleotide sequences. Interestingly, SBLV RNA3 contains both the box B motif in the intercistronic region, as does BMV, and the subgenomic promoter-like sequence in the 5' noncoding region, as does CCMV. Sequence comparisons of SBLV, BMV, CCMV, and broad bean mottle virus demonstrated that SBLV is closely related to BMV and CCMV.

Large scale DNA microsequencing device

DOEpatents

Foote, R.S.

1999-08-31

A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 11 figs.

Nucleotide sequence of a cluster of early and late genes in a conserved segment of the vaccinia virus genome.

PubMed Central

Plucienniczak, A; Schroeder, E; Zettlmeissl, G; Streeck, R E

1985-01-01

The nucleotide sequence of a 7.6 kb vaccinia DNA segment from a genomic region conserved among different orthopox virus has been determined. This segment contains a tight cluster of 12 partly overlapping open reading frames most of which can be correlated with previously identified early and late proteins and mRNAs. Regulatory signals used by vaccinia virus have been studied. Presumptive promoter regions are rich in A, T and carry the consensus sequences TATA and AATAA spaced at 20-24 base pairs. Tandem repeats of a CTATTC consensus sequence are proposed to be involved in the termination of early transcription. PMID:2987815

Genetic variability in environmental isolates of Legionella pneumophila from Comunidad Valenciana (Spain).

PubMed

Coscollá, Mireia; Gosalbes, María José; Catalán, Vicente; González-Candelas, Fernando

2006-06-01

Legionella pneumophila is associated to recurrent outbreaks in several Comunidad Valenciana (Spain) localities, especially in Alcoi, where social and climatic conditions seem to provide an excellent environment for bacterial growth. We have analysed the nucleotide sequences of three loci from 25 environmental isolates from Alcoi and nearby locations sampled over 3 years. The analysis of these isolates has revealed a substantial level of genetic variation, with consistent patterns of variability across loci, and comparable to that found in a large, European-wide sampling of clinical isolates. Among the tree loci studied, fliC showed the highest level of nucleotide diversity. The analysis of isolates sampled in different years revealed a clear differentiation, with samples from 2001 being significantly distinct from those obtained in 2002 and 2003. Furthermore, although linkage disequilibrium measures indicate a clonal nature for population structure in this sample, the presence of some recombination events cannot be ruled out.

Artemisinin Resistance-Associated Polymorphisms at the K13-Propeller Locus Are Absent in Plasmodium falciparum Isolates from Haiti

PubMed Central

Carter, Tamar E.; Boulter, Alexis; Existe, Alexandre; Romain, Jean R.; St. Victor, Jean Yves; Mulligan, Connie J.; Okech, Bernard A.

2015-01-01

Antimalarial drugs are a key tool in malaria elimination programs. With the emergence of artemisinin resistance in southeast Asia, an effort to identify molecular markers for surveillance of resistant malaria parasites is underway. Non-synonymous mutations in the kelch propeller domain (K13-propeller) in Plasmodium falciparum have been associated with artemisinin resistance in samples from southeast Asia, but additional studies are needed to characterize this locus in other P. falciparum populations with different levels of artemisinin use. Here, we sequenced the K13-propeller locus in 82 samples from Haiti, where limited government oversight of non-governmental organizations may have resulted in low-level use of artemisinin-based combination therapies. We detected a single-nucleotide polymorphism (SNP) at nucleotide 1,359 in a single isolate. Our results contribute to our understanding of the global genomic diversity of the K13-propeller locus in P. falciparum populations. PMID:25646258

A three-nucleotide helix I is sufficient for full activity of a hammerhead ribozyme: advantages of an asymmetric design.

PubMed Central

Tabler, M; Homann, M; Tzortzakaki, S; Sczakiel, G

1994-01-01

Trans-cleaving hammerhead ribozymes with long target-specific antisense sequences flanking the catalytic domain share some features with conventional antisense RNA and are therefore termed 'catalytic antisense RNAs'. Sequences 5' to the catalytic domain form helix I and sequences 3' to it form helix III when complexed with the target RNA. A catalytic antisense RNA of more than 400 nucleotides, and specific for the human immunodeficiency virus type 1 (HIV-1), was systematically truncated within the arm that constituted originally a helix I of 128 base pairs. The resulting ribozymes formed helices I of 13, 8, 5, 3, 2, 1 and 0 nucleotides, respectively, and a helix III of about 280 nucleotides. When their in vitro cleavage activity was compared with the original catalytic antisense RNA, it was found that a helix I of as little as three nucleotides was sufficient for full endonucleolytic activity. The catalytically active constructs inhibited HIV-1 replication about four-fold more effectively than the inactive ones when tested in human cells. A conventional hammerhead ribozyme having helices of just 8 nucleotides on either side failed to cleave the target RNA in vitro when tested under the conditions for catalytic antisense RNA. Cleavage activity could only be detected after heat-treatment of the ribozyme substrate mixture which indicates that hammerhead ribozymes with short arms do not associate as efficiently to the target RNA as catalytic antisense RNA. The requirement of just a three-nucleotide helix I allows simple PCR-based generation strategies for asymmetric hammerhead ribozymes. Advantages of an asymmetric design will be discussed. Images PMID:7937118

Analysing grouping of nucleotides in DNA sequences using lumped processes constructed from Markov chains.

PubMed

Guédon, Yann; d'Aubenton-Carafa, Yves; Thermes, Claude

2006-03-01

The most commonly used models for analysing local dependencies in DNA sequences are (high-order) Markov chains. Incorporating knowledge relative to the possible grouping of the nucleotides enables to define dedicated sub-classes of Markov chains. The problem of formulating lumpability hypotheses for a Markov chain is therefore addressed. In the classical approach to lumpability, this problem can be formulated as the determination of an appropriate state space (smaller than the original state space) such that the lumped chain defined on this state space retains the Markov property. We propose a different perspective on lumpability where the state space is fixed and the partitioning of this state space is represented by a one-to-many probabilistic function within a two-level stochastic process. Three nested classes of lumped processes can be defined in this way as sub-classes of first-order Markov chains. These lumped processes enable parsimonious reparameterizations of Markov chains that help to reveal relevant partitions of the state space. Characterizations of the lumped processes on the original transition probability matrix are derived. Different model selection methods relying either on hypothesis testing or on penalized log-likelihood criteria are presented as well as extensions to lumped processes constructed from high-order Markov chains. The relevance of the proposed approach to lumpability is illustrated by the analysis of DNA sequences. In particular, the use of lumped processes enables to highlight differences between intronic sequences and gene untranslated region sequences.

The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

NASA Astrophysics Data System (ADS)

Štambuk, Nikola

The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

The emergence and evolution of life in a "fatty acid world" based on quantum mechanics.

PubMed

Tamulis, Arvydas; Grigalavicius, Mantas

2011-02-01

Quantum mechanical based electron correlation interactions among molecules are the source of the weak hydrogen and Van der Waals bonds that are critical to the self-assembly of artificial fatty acid micelles. Life on Earth or elsewhere could have emerged in the form of self-reproducing photoactive fatty acid micelles, which gradually evolved into nucleotide-containing micelles due to the enhanced ability of nucleotide-coupled sensitizer molecules to absorb visible light. Comparison of the calculated absorption spectra of micelles with and without nucleotides confirmed this idea and supports the idea of the emergence and evolution of nucleotides in minimal cells of a so-called Fatty Acid World. Furthermore, the nucleotide-caused wavelength shift and broadening of the absorption pattern potentially gives these molecules an additional valuable role, other than a purely genetic one in the early stages of the development of life. From the information theory point of view, the nucleotide sequences in such micelles carry positional information providing better electron transport along the nucleotide-sensitizer chain and, in addition, providing complimentary copies of that information for the next generation. Nucleotide sequences, which in the first period of evolution of fatty acid molecules were useful just for better absorbance of the light in the longer wavelength region, later in the PNA or RNA World, took on the role of genetic information storage.

Isolation of a full-length CC-NBS-LRR resistance gene analog candidate from sugar pine showing low nucleotide diversity.

Treesearch

K.D. Jermstad; L.A. Sheppard; B.B. Kinloch; A. Delfino-Mix; E.S. Ersoz; K.V. Krutovsky; D.B Neale

2006-01-01

The nucleotide-binding-site and leucine-rich-repeat (NBS–LRR) class of R proteins is abundant and widely distributed in plants. By using degenerate primers designed on the NBS domain in lettuce, we amplified sequences in sugar pine that shared sequence identity with many of the NBS–LRR class resistance genes catalogued in GenBank. The polymerase chain reaction products...

Identification of largemouth bass virus in the introduced Northern Snakehead inhabiting the Chesapeake Bay watershed.

PubMed

Iwanowicz, L; Densmore, C; Hahn, C; McAllister, P; Odenkirk, J

2013-09-01

The Northern Snakehead Channa argus is an introduced species that now inhabits the Chesapeake Bay. During a preliminary survey for introduced pathogens possibly harbored by these fish in Virginia waters, a filterable agent was isolated from five specimens that produced cytopathic effects in BF-2 cells. Based on PCR amplification and partial sequencing of the major capsid protein (MCP), DNA polymerase (DNApol), and DNA methyltransferase (Mtase) genes, the isolates were identified as Largemouth Bass virus (LMBV). Nucleotide sequences of the MCP (492 bp) and DNApol (419 pb) genes were 100% identical to those of LMBV. The nucleotide sequence of the Mtase (206 bp) gene was 99.5% identical to that of LMBV, and the single nucleotide substitution did not lead to a predicted amino acid coding change. This is the first report of LMBV from the Northern Snakehead, and provides evidence that noncentrarchid fishes may be susceptible to this virus.

Modular and configurable optimal sequence alignment software: Cola.

PubMed

Zamani, Neda; Sundström, Görel; Höppner, Marc P; Grabherr, Manfred G

2014-01-01

The fundamental challenge in optimally aligning homologous sequences is to define a scoring scheme that best reflects the underlying biological processes. Maximising the overall number of matches in the alignment does not always reflect the patterns by which nucleotides mutate. Efficiently implemented algorithms that can be parameterised to accommodate more complex non-linear scoring schemes are thus desirable. We present Cola, alignment software that implements different optimal alignment algorithms, also allowing for scoring contiguous matches of nucleotides in a nonlinear manner. The latter places more emphasis on short, highly conserved motifs, and less on the surrounding nucleotides, which can be more diverged. To illustrate the differences, we report results from aligning 14,100 sequences from 3' untranslated regions of human genes to 25 of their mammalian counterparts, where we found that a nonlinear scoring scheme is more consistent than a linear scheme in detecting short, conserved motifs. Cola is freely available under LPGL from https://github.com/nedaz/cola.

Nucleotide-Specific Contrast for DNA Sequencing by Electron Spectroscopy.

PubMed

Mankos, Marian; Persson, Henrik H J; N'Diaye, Alpha T; Shadman, Khashayar; Schmid, Andreas K; Davis, Ronald W

2016-01-01

DNA sequencing by imaging in an electron microscope is an approach that holds promise to deliver long reads with low error rates and without the need for amplification. Earlier work using transmission electron microscopes, which use high electron energies on the order of 100 keV, has shown that low contrast and radiation damage necessitates the use of heavy atom labeling of individual nucleotides, which increases the read error rates. Other prior work using scattering electrons with much lower energy has shown to suppress beam damage on DNA. Here we explore possibilities to increase contrast by employing two methods, X-ray photoelectron and Auger electron spectroscopy. Using bulk DNA samples with monomers of each base, both methods are shown to provide contrast mechanisms that can distinguish individual nucleotides without labels. Both spectroscopic techniques can be readily implemented in a low energy electron microscope, which may enable label-free DNA sequencing by direct imaging.