Sample records for nucleotide sequence polymorphism

  1. Single nucleotide polymorphisms associated with rat expressed sequences.


    Guryev, Victor; Berezikov, Eugene; Malik, Rainer; Plasterk, Ronald H A; Cuppen, Edwin


    Single nucleotide polymorphisms (SNPs) are the most common source of genetic variation in populations and are thus most likely to account for the majority of phenotypic and behavioral differences between individuals or strains. Although the rat is extensively studied for the latter, data on naturally occurring polymorphisms are mostly lacking. We have used publicly available sequences consisting of whole-genome shotgun (WGS), expressed sequence tag (EST), and mRNA data as a source for the in silico identification of SNPs in gene-coding regions and have identified a large collection of 33,305 high-quality candidate SNPs. Experimental verification of 471 candidate SNPs using a limited set of rat isolates revealed a confirmation rate of approximately 50%. Although the majority of SNPs were identified between Sprague-Dawley (EST data) and Brown Norway (WGS data) strains, we found that 66% of the verified variations are common among different rat strains. All SNPs were extensively annotated, including chromosomal and genetic map information, and nonsynonymous SNPs were analyzed by SIFT and PolyPhen prediction programs for their potential deleterious effect on protein function. Interestingly, we retrieved three SNPs from the database that result in the introduction of a premature stop codon and that could be confirmed experimentally. Two of these "in silico-identified knockouts" reside in interesting QTL regions. Data are publicly available via a Web interface (, allowing simple and advanced search queries.

  2. Single nucleotide polymorphism mining and nucleotide sequence analysis of Mx1 gene in exonic regions of Japanese quail

    PubMed Central

    Niraj, Diwesh Kumar; Kumar, Pushpendra; Mishra, Chinmoy; Narayan, Raj; Bhattacharya, Tarun Kumar; Shrivastava, Kush; Bhushan, Bharat; Tiwari, Ashok Kumar; Saxena, Vishesh; Sahoo, Nihar Ranjan; Sharma, Deepak


    Aim: An attempt has been made to study the Myxovirus resistant (Mx1) gene polymorphism in Japanese quail. Materials and Methods: In the present, investigation four fragments viz. Fragment I of 185 bp (Exon 3 region), Fragment II of 148 bp (Exon 5 region), Fragment III of 161 bp (Exon 7 region), and Fragment IV of 176 bp (Exon 13 region) of Mx1 gene were amplified and screened for polymorphism by polymerase chain reaction-single-strand conformation polymorphism technique in 170 Japanese quail birds. Results: Out of the four fragments, one fragment (Fragment II) was found to be polymorphic. Remaining three fragments (Fragment I, III, and IV) were found to be monomorphic which was confirmed by custom sequencing. Overall nucleotide sequence analysis of Mx1 gene of Japanese quail showed 100% homology with common quail and more than 80% homology with reported sequence of chicken breeds. Conclusion: The Mx1 gene is mostly conserved in Japanese quail. There is an urgent need of comprehensive analysis of other regions of Mx1 gene along with its possible association with the traits of economic importance in Japanese quail. PMID:27047057

  3. Genome-wide analysis of single-nucleotide polymorphisms in human expressed sequences.


    Irizarry, K; Kustanovich, V; Li, C; Brown, N; Nelson, S; Wong, W; Lee, C J


    Single-nucleotide polymorphisms (SNPs) have been explored as a high-resolution marker set for accelerating the mapping of disease genes. Here we report 48,196 candidate SNPs detected by statistical analysis of human expressed sequence tags (ESTs), associated primarily with coding regions of genes. We used Bayesian inference to weigh evidence for true polymorphism versus sequencing error, misalignment or ambiguity, misclustering or chimaeric EST sequences, assessing data such as raw chromatogram height, sharpness, overlap and spacing, sequencing error rates, context-sensitivity and cDNA library origin. Three separate validations-comparison with 54 genes screened for SNPs independently, verification of HLA-A polymorphisms and restriction fragment length polymorphism (RFLP) testing-verified 70%, 89% and 71% of our predicted SNPs, respectively. Our method detects tenfold more true HLA-A SNPs than previous analyses of the EST data. We found SNPs in a large fraction of known disease genes, including some disease-causing mutations (for example, the HbS sickle-cell mutation). Our comprehensive analysis of human coding region polymorphism provides a public resource for mapping of disease genes (available at

  4. Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

  5. Large-scale detection and application of expressed sequence tag single nucleotide polymorphisms in Nicotiana.


    Wang, Y; Zhou, D; Wang, S; Yang, L


    Single nucleotide polymorphisms (SNPs) are widespread in the Nicotiana genome. Using an alignment and variation detection method, we developed 20,607,973 SNPs, based on the expressed sequence tag sequences of 10 Nicotiana species. The replacement rate was much higher than the transversion rate in the SNPs, and SNPs widely exist in the Nicotiana. In vitro verification indicated that all of the SNPs were high quality and accurate. Evolutionary relationships between 15 varieties were investigated by polymerase chain reaction with a special primer; the specific 302 locus of these sequence results clearly indicated the origin of Zhongyan 100. A database of Nicotiana SNPs (NSNP) was developed to store and search for SNPs in Nicotiana. NSNP is a tool for researchers to develop SNP markers of sequence data. PMID:26214460

  6. Large-scale detection and application of expressed sequence tag single nucleotide polymorphisms in Nicotiana.


    Wang, Y; Zhou, D; Wang, S; Yang, L


    Single nucleotide polymorphisms (SNPs) are widespread in the Nicotiana genome. Using an alignment and variation detection method, we developed 20,607,973 SNPs, based on the expressed sequence tag sequences of 10 Nicotiana species. The replacement rate was much higher than the transversion rate in the SNPs, and SNPs widely exist in the Nicotiana. In vitro verification indicated that all of the SNPs were high quality and accurate. Evolutionary relationships between 15 varieties were investigated by polymerase chain reaction with a special primer; the specific 302 locus of these sequence results clearly indicated the origin of Zhongyan 100. A database of Nicotiana SNPs (NSNP) was developed to store and search for SNPs in Nicotiana. NSNP is a tool for researchers to develop SNP markers of sequence data.

  7. Single nucleotide polymorphisms from Theobroma cacao expressed sequence tags associated with witches' broom disease in cacao.


    Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F


    In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.

  8. Single nucleotide polymorphisms in the IS900 sequence of Mycobacterium avium subsp. paratuberculosis are strain type specific.


    Castellanos, Elena; Aranaz, Alicia; de Juan, Lucia; Alvarez, Julio; Rodríguez, Sabrina; Romero, Beatriz; Bezos, Javier; Stevenson, Karen; Mateos, Ana; Domínguez, Lucas


    Insertion sequence IS900 is used as a target for the identification of Mycobacterium avium subsp. paratuberculosis. Previous reports have revealed single nucleotide polymorphisms within IS900. This study, which analyzed the IS900 sequences of a panel of isolates representing M. avium subsp. paratuberculosis strain types I, II, and III, revealed conserved type-specific polymorphisms that could be utilized as a tool for diagnostic and epidemiological purposes.

  9. [Polymorphism of DNA nucleotide sequence as a source of enhancement of the discrimination potential of the STR-markers].


    Zemskova, E Yu; Timoshenko, T V; Leonov, S N; Ivanov, P L


    The objective of the present pilot investigation was to reveal and to study polymorphism of nucleotide sequence in the alleles of STR loci of human autosomal DNA with special reference to the role of this phenomenon as a source of the differences between homonymous allelic variants. The secondary objection was to evaluate the possibility of using the data thus obtained for the enhancement of the informative value of the forensic medical genotyping of STR loci by means of identification of single nucleotide polymorphisms (SNP) for the purpose of extending their allelic spectrum. The methodological basis of the study was constituted by the comprehensive amplified fragment length polymorphism (AFLP) analysis and amplified fragment sequence polymorphisms (AFSP) analysis of DNA with the use of the PLEX-ID^TM analytical mass-spectrometry platform (Abbot Molecular, USA). The study has demonstrated that polymorphism of DNA nucleotide sequence can be regarded as the possible source of enhancement of the discriminating potential of STR markers. It means that the analysis of polymorphism of DNA nucleotide sequence for genotyping AFLP-type markers of chromosomal DNA can considerably increase the effectiveness of their application as individualizing markers for the purpose of molecular genetic expertises.

  10. [Polymorphism of DNA nucleotide sequence as a source of enhancement of the discrimination potential of the STR-markers].


    Zemskova, E Yu; Timoshenko, T V; Leonov, S N; Ivanov, P L


    The objective of the present pilot investigation was to reveal and to study polymorphism of nucleotide sequence in the alleles of STR loci of human autosomal DNA with special reference to the role of this phenomenon as a source of the differences between homonymous allelic variants. The secondary objection was to evaluate the possibility of using the data thus obtained for the enhancement of the informative value of the forensic medical genotyping of STR loci by means of identification of single nucleotide polymorphisms (SNP) for the purpose of extending their allelic spectrum. The methodological basis of the study was constituted by the comprehensive amplified fragment length polymorphism (AFLP) analysis and amplified fragment sequence polymorphisms (AFSP) analysis of DNA with the use of the PLEX-ID^TM analytical mass-spectrometry platform (Abbot Molecular, USA). The study has demonstrated that polymorphism of DNA nucleotide sequence can be regarded as the possible source of enhancement of the discriminating potential of STR markers. It means that the analysis of polymorphism of DNA nucleotide sequence for genotyping AFLP-type markers of chromosomal DNA can considerably increase the effectiveness of their application as individualizing markers for the purpose of molecular genetic expertises. PMID:27500481

  11. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches


    McCutchen-Maloney, Sandra L.


    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  12. Developing single nucleotide polymorphism (SNP) markers from transcriptome sequences for identification of longan (Dimocarpus longan) germplasm

    PubMed Central

    Wang, Boyi; Tan, Hua-Wei; Fang, Wanping; Meinhardt, Lyndel W; Mischke, Sue; Matsumoto, Tracie; Zhang, Dapeng


    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in 50 longan germplasm accessions, including cultivated varieties and wild germplasm; and designated 25 SNP markers that unambiguously identified all tested longan varieties with high statistical rigor (P<0.0001). Multiple trees from the same clone were verified and off-type trees were identified. Diversity analysis revealed genetic relationships among analyzed accessions. Cultivated varieties differed significantly from wild populations (Fst=0.300; P<0.001), demonstrating untapped genetic diversity for germplasm conservation and utilization. Within cultivated varieties, apparent differences between varieties from China and those from Thailand and Hawaii indicated geographic patterns of genetic differentiation. These SNP markers provide a powerful tool to manage longan genetic resources and breeding, with accurate and efficient genotype identification. PMID:26504559

  13. Whole genome sequencing of a single Bos taurus animal for single nucleotide polymorphism discovery

    PubMed Central

    Eck, Sebastian H; Benet-Pagès, Anna; Flisikowski, Krzysztof; Meitinger, Thomas; Fries, Ruedi; Strom, Tim M


    Background The majority of the 2 million bovine single nucleotide polymorphisms (SNPs) currently available in dbSNP have been identified in a single breed, Hereford cattle, during the bovine genome project. In an attempt to evaluate the variance of a second breed, we have produced a whole genome sequence at low coverage of a single Fleckvieh bull. Results We generated 24 gigabases of sequence, mainly using 36-bp paired-end reads, resulting in an average 7.4-fold sequence depth. This coverage was sufficient to identify 2.44 million SNPs, 82% of which were previously unknown, and 115,000 small indels. A comparison with the genotypes of the same animal, generated on a 50 k oligonucleotide chip, revealed a detection rate of 74% and 30% for homozygous and heterozygous SNPs, respectively. The false positive rate, as determined by comparison with genotypes determined for 196 randomly selected SNPs, was approximately 1.1%. We further determined the allele frequencies of the 196 SNPs in 48 Fleckvieh and 48 Braunvieh bulls. 95% of the SNPs were polymorphic with an average minor allele frequency of 24.5% and with 83% of the SNPs having a minor allele frequency larger than 5%. Conclusions This work provides the first single cattle genome by next-generation sequencing. The chosen approach - low to medium coverage re-sequencing - added more than 2 million novel SNPs to the currently publicly available SNP resource, providing a valuable resource for the construction of high density oligonucleotide arrays in the context of genome-wide association studies. PMID:19660108

  14. Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus

    PubMed Central


    Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered – 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had “no hits found”, 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. Conclusions High-quality EST-SNPs from different

  15. A high-density simple sequence repeat and single nucleotide polymorphism genetic map of the tetraploid cotton genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton genome complexity was investigated with a saturated molecular genetic map that combined several sets of microsatellites or simple sequence repeats (SSR) and the first major public set of single nucleotide polymorphism (SNP) markers in cotton genomes (Gossypium spp.), and that was constructed ...

  16. Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.


    Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon


    There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

  17. A single nucleotide polymorphism and sequence analysis of CSN1S1 gene promoter region in Chinese Bos grunniens (yak).


    Bai, W L; Yin, R H; Dou, Q L; Yang, J C; Zhao, S J; Ma, Z J; Yin, R L; Luo, G B; Zhao, Z H


    The aim of this study was to investigate the polymorphism of the CSN1S1 gene promoter region in 4 Chinese yak breeds, and compare the yak CSN1S1 gene promoter region sequences with other ruminants. A Polymerase Chain Reaction-Single Strand Conformation Polymorphism protocol was developed for rapid genotyping of the yak CSN1S1 gene. One hundred fifty-eight animals from 4 Chinese yak breeds were genotyped at the CSN1S1 locus using the protocol developed. A single nucleotide polymorphism of the CSN1S1 gene promoter region has been identified in all yak breeds investigated. The polymorphism consists of a single nucleotide substitution G-->A at position 386 of the CSN1S1 gene promoter region, resulting in two alleles named, respectively, G(386) and A(386), based on the nucleotide at position 386. The allele G(386) was found to be more common in the animals investigated. The corresponding nucleotide sequences in GenBank of yak (having the same nucleotides as allele G(386) in this study), bovine, water buffalo, sheep, and goat had similarity of 99.68%, 99.35%, 97.42%, 95.14%, and 94.19%, respectively, with the yak allele A(386.).

  18. Genomic DNA enrichment using sequence capture microarrays: a novel approach to discover sequence nucleotide polymorphisms (SNP) in Brassica napus L.


    Clarke, Wayne E; Parkin, Isobel A; Gajardo, Humberto A; Gerhardt, Daniel J; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G; Snowdon, Rod J; Federico, Maria L; Iniguez-Luy, Federico L


    Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci -QTL- analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species.

  19. Associations of single nucleotide polymorphisms in the Pygo2 coding sequence with idiopathic oligospermia and azoospermia.


    Ge, S-Q; Grifin, J; Liu, L-H; Aston, K I; Simon, L; Jenkins, T G; Emery, B R; Carrell, D T


    Male infertility is often associated with a decreased sperm count. The Pygo2 gene is expressed in the elongating spermatid during chromatin remodeling; thus impairment in PYGO2 function might lead to spermatogenic arrest, sperm count reduction, and subsequent infertility. The aim of this study was to identify mutations in Pygo2 that might lead to idiopathic oligospermia and azoospermia. DNA was isolated from venous blood from 77 men with normal fertility and 195 men with idiopathic oligospermia or azoospermia. Polymerase chain reaction-sequencing analysis was performed for the three Pygo2 coding regions. Non-synonymous single nucleotide polymorphisms (SNPs) were detected and analyzed using SIFT, Polyphen-2, and Mutation Taster softwares to identify possible changes in protein structure that could affect phenotype. Pygo2 sequencing was successful for 178 patients (30 with mild or moderate oligospermia, 57 with severe oligospermia, and 91 with azoospermia). Three previously reported non-synonymous SNPs were identified in patients with azoospermia or severe oligospermic but not in those with mild or moderate oligozoopermia or normozoospermia. SNPs rs61758740 (M141I) and rs141722381 (N240I) cause the replacement of one hydrophobic or hydrophilic amino acid, respectively, with another, and SNP rs61758741 (K261E) causes the replacement of a basic amino acid with an acidic one. The software predictions demonstrated that SNP rsl41722381 would likely result in disrupted tertiary protein structure and thus could be involved in disease pathogenesis. Overall, this study demonstrated that SNPs in the coding region of Pygo2 might be one of the causative factors in idiopathic oligospermia and azoospermia, resulting in male infertility.

  20. Phylogenetic discovery bias in Bacillus anthracis using single-nucleotide polymorphisms from whole-genome sequencing

    PubMed Central

    Pearson, Talima; Busch, Joseph D.; Ravel, Jacques; Read, Timothy D.; Rhoton, Shane D.; U'Ren, Jana M.; Simonson, Tatum S.; Kachur, Sergey M.; Leadem, Rebecca R.; Cardon, Michelle L.; Van Ert, Matthew N.; Huynh, Lynn Y.; Fraser, Claire M.; Keim, Paul


    Phylogenetic reconstruction using molecular data is often subject to homoplasy, leading to inaccurate conclusions about phylogenetic relationships among operational taxonomic units. Compared with other molecular markers, single-nucleotide polymorphisms (SNPs) exhibit extremely low mutation rates, making them rare in recently emerged pathogens, but they are less prone to homoplasy and thus extremely valuable for phylogenetic analyses. Despite their phylogenetic potential, ascertainment bias occurs when SNP characters are discovered through biased taxonomic sampling; by using whole-genome comparisons of five diverse strains of Bacillus anthracis to facilitate SNP discovery, we show that only polymorphisms lying along the evolutionary pathway between reference strains will be observed. We illustrate this in theoretical and simulated data sets in which complex phylogenetic topologies are reduced to linear evolutionary models. Using a set of 990 SNP markers, we also show how divergent branches in our topologies collapse to single points but provide accurate information on internodal distances and points of origin for ancestral clades. These data allowed us to determine the ancestral root of B. anthracis, showing that it lies closer to a newly described “C” branch than to either of two previously described “A” or “B” branches. In addition, subclade rooting of the C branch revealed unequal evolutionary rates that seem to be correlated with ecological parameters and strain attributes. Our use of nonhomoplastic whole-genome SNP characters allows branch points and clade membership to be estimated with great precision, providing greater insight into epidemiological, ecological, and forensic questions. PMID:15347815

  1. A Simple Sequence Repeat- and Single-Nucleotide Polymorphism-Based Genetic Linkage Map of the Brown Planthopper, Nilaparvata lugens

    PubMed Central

    Jairin, Jirapong; Kobayashi, Tetsuya; Yamagata, Yoshiyuki; Sanada-Morimura, Sachiyo; Mori, Kazuki; Tashiro, Kosuke; Kuhara, Satoru; Kuwazaki, Seigo; Urio, Masahiro; Suetsugu, Yoshitaka; Yamamoto, Kimiko; Matsumura, Masaya; Yasui, Hideshi


    In this study, we developed the first genetic linkage map for the major rice insect pest, the brown planthopper (BPH, Nilaparvata lugens). The linkage map was constructed by integrating linkage data from two backcross populations derived from three inbred BPH strains. The consensus map consists of 474 simple sequence repeats, 43 single-nucleotide polymorphisms, and 1 sequence-tagged site, for a total of 518 markers at 472 unique positions in 17 linkage groups. The linkage groups cover 1093.9 cM, with an average distance of 2.3 cM between loci. The average number of marker loci per linkage group was 27.8. The sex-linkage group was identified by exploiting X-linked and Y-specific markers. Our linkage map and the newly developed markers used to create it constitute an essential resource and a useful framework for future genetic analyses in BPH. PMID:23204257

  2. Species-wide genome sequence and nucleotide polymorphisms from the model allopolyploid plant Brassica napus

    PubMed Central

    Schmutzer, Thomas; Samans, Birgit; Dyrszka, Emmanuelle; Ulpinnis, Chris; Weise, Stephan; Stengel, Doreen; Colmsee, Christian; Lespinasse, Denis; Micic, Zeljko; Abel, Stefan; Duchscherer, Peter; Breuer, Frank; Abbadi, Amine; Leckband, Gunhild; Snowdon, Rod; Scholz, Uwe


    Brassica napus (oilseed rape, canola) is one of the world’s most important sources of vegetable oil for human nutrition and biofuel, and also a model species for studies investigating the evolutionary consequences of polyploidisation. Strong bottlenecks during its recent origin from interspecific hybridisation, and subsequently through intensive artificial selection, have severely depleted the genetic diversity available for breeding. On the other hand, high-throughput genome profiling technologies today provide unprecedented scope to identify, characterise and utilise genetic diversity in primary and secondary crop gene pools. Such methods also enable implementation of genomic selection strategies to accelerate breeding progress. The key prerequisite is availability of high-quality sequence data and identification of high-quality, genome-wide sequence polymorphisms representing relevant gene pools. We present comprehensive genome resequencing data from a panel of 52 highly diverse natural and synthetic B. napus accessions, along with a stringently selected panel of 4.3 million high-confidence, genome-wide SNPs. The data is of great interest for genomics-assisted breeding and for evolutionary studies on the origins and consequences in allopolyploidisation in plants. PMID:26647166

  3. Species-wide genome sequence and nucleotide polymorphisms from the model allopolyploid plant Brassica napus.


    Schmutzer, Thomas; Samans, Birgit; Dyrszka, Emmanuelle; Ulpinnis, Chris; Weise, Stephan; Stengel, Doreen; Colmsee, Christian; Lespinasse, Denis; Micic, Zeljko; Abel, Stefan; Duchscherer, Peter; Breuer, Frank; Abbadi, Amine; Leckband, Gunhild; Snowdon, Rod; Scholz, Uwe


    Brassica napus (oilseed rape, canola) is one of the world's most important sources of vegetable oil for human nutrition and biofuel, and also a model species for studies investigating the evolutionary consequences of polyploidisation. Strong bottlenecks during its recent origin from interspecific hybridisation, and subsequently through intensive artificial selection, have severely depleted the genetic diversity available for breeding. On the other hand, high-throughput genome profiling technologies today provide unprecedented scope to identify, characterise and utilise genetic diversity in primary and secondary crop gene pools. Such methods also enable implementation of genomic selection strategies to accelerate breeding progress. The key prerequisite is availability of high-quality sequence data and identification of high-quality, genome-wide sequence polymorphisms representing relevant gene pools. We present comprehensive genome resequencing data from a panel of 52 highly diverse natural and synthetic B. napus accessions, along with a stringently selected panel of 4.3 million high-confidence, genome-wide SNPs. The data is of great interest for genomics-assisted breeding and for evolutionary studies on the origins and consequences in allopolyploidisation in plants. PMID:26647166

  4. Confirming single nucleotide polymorphisms from expressed sequence tag datasets derived from three cattle cDNA libraries.


    Lee, Seung-Hwan; Park, Eung-Woo; Cho, Yong-Min; Lee, Ji-Woong; Kim, Hyoung-Yong; Lee, Jun-Heon; Oh, Sung-Jong; Cheong, Il-Cheong; Yoon, Du-Hak


    Using the Phred/Phrap/Polyphred/Consed pipeline established in the National Livestock Research Institute of Korea, we predicted candidate coding single nucleotide polymorphisms (cSNPs) from 7,600 expressed sequence tags (ESTs) derived from three cDNA libraries (liver, M. longissimus dorsi, and intermuscular fat) of Hanwoo (Korean native cattle) steers. From the 7,600 ESTs, 829 contigs comprising more than two EST reads were assembled using the Phrap assembler. Based on the contig analysis, 201 candidate cSNPs were identified in 129 contigs, in which transitions (69%) outnumbered transversions (31%). To verify whether the predicted cSNPs are real, 17 SNPs involved in lipid and energy metabolism were selected from the ESTs. Twelve of these were confirmed to be real while five were identified as artifacts, possibly due to expressed sequence tag sequence error. Further analysis of the 12 verified cSNPs was performed using the program BLASTX. Five were identified as nonsynonymous cSNPs, five were synonymous cSNPs, and two SNPs were located in 3'-UTRs. Our data indicated that a relatively high SNP prediction rate (71%) from a large EST database could produce abundant cSNPs rapidly, which can be used as valuable genetic markers in cattle.

  5. Development of Single Nucleotide Polymorphism markers in Theobroma cacao and comparison to Simple Sequence Repeat markers for genotyping of Cameroon clones.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Single Nucleotide Polymorphism (SNP) markers are increasingly being used in crop breeding programs, slowly replacing Simple Sequence Repeats (SSR) and other markers. SNPs provide many benefits over SSRs, including ease of analysis and unambiguous results across various platforms. We have identifie...

  6. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.


    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca


    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  7. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.


    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca


    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

  8. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

    PubMed Central

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca


    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

  9. Finding the right coverage: the impact of coverage and sequence quality on single nucleotide polymorphism genotyping error rates.


    Fountain, Emily D; Pauli, Jonathan N; Reid, Brendan N; Palsbøll, Per J; Peery, M Zachariah


    Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown. Here, we estimated genotyping error rates in SNPs genotyped with double digest RAD sequencing from Mendelian incompatibilities in known mother-offspring dyads of Hoffman's two-toed sloth (Choloepus hoffmanni) across a range of coverage and sequence quality criteria, for both reference-aligned and de novo-assembled data sets. Genotyping error rates were more sensitive to coverage than sequence quality and low coverage yielded high error rates, particularly in de novo-assembled data sets. For example, coverage ≥5 yielded median genotyping error rates of ≥0.03 and ≥0.11 in reference-aligned and de novo-assembled data sets, respectively. Genotyping error rates declined to ≤0.01 in reference-aligned data sets with a coverage ≥30, but remained ≥0.04 in the de novo-assembled data sets. We observed approximately 10- and 13-fold declines in the number of loci sampled in the reference-aligned and de novo-assembled data sets when coverage was increased from ≥5 to ≥30 at quality score ≥30, respectively. Finally, we assessed the effects of genotyping coverage on a common population genetic application, parentage assignments, and showed that the proportion of incorrectly assigned maternities was relatively high at low coverage. Overall, our results suggest that the trade-off between sample size and genotyping error rates be considered prior to building sequencing libraries, reporting genotyping error rates become standard practice, and that effects of genotyping errors on inference be evaluated in restriction-enzyme-based SNP studies.

  10. Comparison of single nucleotide polymorphisms and simple sequence repeats in genotype identification and diversity assessment of cacao germplasm

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Accurate identification of individual genotypes in an efficient manner is especially important for cacao (Theobroma cacao L.) germplasm conservation and breeding. The development of single nucleotide polymorphism (SNP) markers in cacao offers the opportunity to use a high throughput genotyping syste...

  11. The Single Nucleotide Polymorphism Consortium

    NASA Technical Reports Server (NTRS)

    Morgan, Michael


    I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.

  12. A high-density simple sequence repeat and single nucleotide polymorphism genetic map of the tetraploid cotton genome.


    Yu, John Z; Kohel, Russell J; Fang, David D; Cho, Jaemin; Van Deynze, Allen; Ulloa, Mauricio; Hoffman, Steven M; Pepper, Alan E; Stelly, David M; Jenkins, Johnie N; Saha, Sukumar; Kumpatla, Siva P; Shah, Manali R; Hugie, William V; Percy, Richard G


    Genetic linkage maps play fundamental roles in understanding genome structure, explaining genome formation events during evolution, and discovering the genetic bases of important traits. A high-density cotton (Gossypium spp.) genetic map was developed using representative sets of simple sequence repeat (SSR) and the first public set of single nucleotide polymorphism (SNP) markers to genotype 186 recombinant inbred lines (RILs) derived from an interspecific cross between Gossypium hirsutum L. (TM-1) and G. barbadense L. (3-79). The genetic map comprised 2072 loci (1825 SSRs and 247 SNPs) and covered 3380 centiMorgan (cM) of the cotton genome (AD) with an average marker interval of 1.63 cM. The allotetraploid cotton genome produced equivalent recombination frequencies in its two subgenomes (At and Dt). Of the 2072 loci, 1138 (54.9%) were mapped to 13 At-subgenome chromosomes, covering 1726.8 cM (51.1%), and 934 (45.1%) mapped to 13 Dt-subgenome chromosomes, covering 1653.1 cM (48.9%). The genetically smallest homeologous chromosome pair was Chr. 04 (A04) and 22 (D04), and the largest was Chr. 05 (A05) and 19 (D05). Duplicate loci between and within homeologous chromosomes were identified that facilitate investigations of chromosome translocations. The map augments evidence of reciprocal rearrangement between ancestral forms of Chr. 02 and 03 versus segmental homeologs 14 and 17 as centromeric regions show homeologous between Chr. 02 (A02) and 17 (D02), as well as between Chr. 03 (A03) and 14 (D03). This research represents an important foundation for studies on polyploid cottons, including germplasm characterization, gene discovery, and genome sequence assembly. PMID:22384381

  13. Genome-wide association study for endocrine fertility traits using single nucleotide polymorphism arrays and sequence variants in dairy cattle.


    Tenghe, A M M; Bouwman, A C; Berglund, B; Strandberg, E; de Koning, D J; Veerkamp, R F


    Endocrine fertility traits, which are defined from progesterone concentration levels in milk, are interesting indicators of dairy cow fertility because they more directly reflect the cows own reproductive physiology than classical fertility traits, which are more biased by farm management decisions. The aim of this study was to detect quantitative trait loci (QTL) for 7 endocrine fertility traits in dairy cows by performing a genome-wide association study with 85k single nucleotide polymorphisms (SNP), and then fine-map targeted QTL regions, using imputed sequence variants. Two classical fertility traits were also analyzed for QTL with 85k SNP. The association between a SNP and a phenotype was assessed by single-locus regression for each SNP, using a linear mixed model that included a random polygenic effect. A total of 2,447 Holstein Friesian cows with 5,339 lactations with both phenotypes and genotypes were used for association analysis. Heritability estimates ranged from 0.09 to 0.15 for endocrine fertility traits and 0.03 to 0.10 for classical fertility traits. The genome-wide association study identified 17 QTL regions for endocrine fertility traits on Bos taurus autosomes (BTA) 2, 3, 8, 12, 15, 17, 23, and 25. The highest number (5) of QTL regions from the genome-wide association study was identified for the endocrine trait "proportion of samples with luteal activity." Overlapping QTL regions were found between endocrine traits on BTA 2, 3, and 17. For the classical trait calving to first service, 3 QTL regions were identified on BTA 3, 15, and 23, and an overlapping region was identified on BTA 23 with endocrine traits. Fine-mapping target regions for the endocrine traits on BTA 2 and 3 using imputed sequence variants confirmed the QTL from the genome-wide association study, and identified several associated variants that can contribute to an index of markers for genetic improvement of fertility. Several potential candidate genes underlying endocrine

  14. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing.


    Mendonça, Marcos César Lima de; Ferreira, Ana Maria de Amorim; Santos, Marta Gonçalves Matos dos; Oviedo, Elva Cristina; Bello, Maria Sônia Dal; Siqueira, Marilda Mendonça; Maceira, Juan Manuel Piñeiro; von Hubinger, Maria Genoveva; Couceiro, José Nelson dos Santos Silva


    Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  15. Insertion sequence element single nucleotide polymorphism typing provides insights into the population structure and evolution of Mycobacterium ulcerans across Africa.


    Vandelannoote, Koen; Jordaens, Kurt; Bomans, Pieter; Leirs, Herwig; Durnez, Lies; Affolabi, Dissou; Sopoh, Ghislain; Aguiar, Julia; Phanzu, Delphin Mavinga; Kibadi, Kapay; Eyangoh, Sara; Manou, Louis Bayonne; Phillips, Richard Odame; Adjei, Ohene; Ablordey, Anthony; Rigouts, Leen; Portaels, Françoise; Eddyani, Miriam; de Jong, Bouke C


    Buruli ulcer is an indolent, slowly progressing necrotizing disease of the skin caused by infection with Mycobacterium ulcerans. In the present study, we applied a redesigned technique to a vast panel of M. ulcerans disease isolates and clinical samples originating from multiple African disease foci in order to (i) gain fundamental insights into the population structure and evolutionary history of the pathogen and (ii) disentangle the phylogeographic relationships within the genetically conserved cluster of African M. ulcerans. Our analyses identified 23 different African insertion sequence element single nucleotide polymorphism (ISE-SNP) types that dominate in different areas where Buruli ulcer is endemic. These ISE-SNP types appear to be the initial stages of clonal diversification from a common, possibly ancestral ISE-SNP type. ISE-SNP types were found unevenly distributed over the greater West African hydrological drainage basins. Our findings suggest that geographical barriers bordering the basins to some extent prevented bacterial gene flow between basins and that this resulted in independent focal transmission clusters associated with the hydrological drainage areas. Different phylogenetic methods yielded two well-supported sister clades within the African ISE-SNP types. The ISE-SNP types from the "pan-African clade" were found to be widespread throughout Africa, while the ISE-SNP types of the "Gabonese/Cameroonian clade" were much rarer and found in a more restricted area, which suggested that the latter clade evolved more recently. Additionally, the Gabonese/Cameroonian clade was found to form a strongly supported monophyletic group with Papua New Guinean ISE-SNP type 8, which is unrelated to other Southeast Asian ISE-SNP types.

  16. Insertion Sequence Element Single Nucleotide Polymorphism Typing Provides Insights into the Population Structure and Evolution of Mycobacterium ulcerans across Africa

    PubMed Central

    Jordaens, Kurt; Bomans, Pieter; Leirs, Herwig; Durnez, Lies; Affolabi, Dissou; Sopoh, Ghislain; Aguiar, Julia; Phanzu, Delphin Mavinga; Kibadi, Kapay; Eyangoh, Sara; Manou, Louis Bayonne; Phillips, Richard Odame; Adjei, Ohene; Ablordey, Anthony; Rigouts, Leen; Portaels, Françoise; Eddyani, Miriam; de Jong, Bouke C.


    Buruli ulcer is an indolent, slowly progressing necrotizing disease of the skin caused by infection with Mycobacterium ulcerans. In the present study, we applied a redesigned technique to a vast panel of M. ulcerans disease isolates and clinical samples originating from multiple African disease foci in order to (i) gain fundamental insights into the population structure and evolutionary history of the pathogen and (ii) disentangle the phylogeographic relationships within the genetically conserved cluster of African M. ulcerans. Our analyses identified 23 different African insertion sequence element single nucleotide polymorphism (ISE-SNP) types that dominate in different areas where Buruli ulcer is endemic. These ISE-SNP types appear to be the initial stages of clonal diversification from a common, possibly ancestral ISE-SNP type. ISE-SNP types were found unevenly distributed over the greater West African hydrological drainage basins. Our findings suggest that geographical barriers bordering the basins to some extent prevented bacterial gene flow between basins and that this resulted in independent focal transmission clusters associated with the hydrological drainage areas. Different phylogenetic methods yielded two well-supported sister clades within the African ISE-SNP types. The ISE-SNP types from the “pan-African clade” were found to be widespread throughout Africa, while the ISE-SNP types of the “Gabonese/Cameroonian clade” were much rarer and found in a more restricted area, which suggested that the latter clade evolved more recently. Additionally, the Gabonese/Cameroonian clade was found to form a strongly supported monophyletic group with Papua New Guinean ISE-SNP type 8, which is unrelated to other Southeast Asian ISE-SNP types. PMID:24296504

  17. Insertion sequence element single nucleotide polymorphism typing provides insights into the population structure and evolution of Mycobacterium ulcerans across Africa.


    Vandelannoote, Koen; Jordaens, Kurt; Bomans, Pieter; Leirs, Herwig; Durnez, Lies; Affolabi, Dissou; Sopoh, Ghislain; Aguiar, Julia; Phanzu, Delphin Mavinga; Kibadi, Kapay; Eyangoh, Sara; Manou, Louis Bayonne; Phillips, Richard Odame; Adjei, Ohene; Ablordey, Anthony; Rigouts, Leen; Portaels, Françoise; Eddyani, Miriam; de Jong, Bouke C


    Buruli ulcer is an indolent, slowly progressing necrotizing disease of the skin caused by infection with Mycobacterium ulcerans. In the present study, we applied a redesigned technique to a vast panel of M. ulcerans disease isolates and clinical samples originating from multiple African disease foci in order to (i) gain fundamental insights into the population structure and evolutionary history of the pathogen and (ii) disentangle the phylogeographic relationships within the genetically conserved cluster of African M. ulcerans. Our analyses identified 23 different African insertion sequence element single nucleotide polymorphism (ISE-SNP) types that dominate in different areas where Buruli ulcer is endemic. These ISE-SNP types appear to be the initial stages of clonal diversification from a common, possibly ancestral ISE-SNP type. ISE-SNP types were found unevenly distributed over the greater West African hydrological drainage basins. Our findings suggest that geographical barriers bordering the basins to some extent prevented bacterial gene flow between basins and that this resulted in independent focal transmission clusters associated with the hydrological drainage areas. Different phylogenetic methods yielded two well-supported sister clades within the African ISE-SNP types. The ISE-SNP types from the "pan-African clade" were found to be widespread throughout Africa, while the ISE-SNP types of the "Gabonese/Cameroonian clade" were much rarer and found in a more restricted area, which suggested that the latter clade evolved more recently. Additionally, the Gabonese/Cameroonian clade was found to form a strongly supported monophyletic group with Papua New Guinean ISE-SNP type 8, which is unrelated to other Southeast Asian ISE-SNP types. PMID:24296504

  18. Single nucleotide polymorphism discovery in cutthroat trout subspecies using genome reduction, barcoding, and 454 pyro-sequencing

    PubMed Central


    Background Salmonids are popular sport fishes, and as such have been subjected to widespread stocking throughout western North America. Historically, stocking was done with little regard for genetic variation among populations and has resulted in genetic mixing among species and subspecies in many areas, thus putting the genetic integrity of native salmonid populations at risk and creating a need to assess the genetic constitution of native salmonid populations. Cutthroat trout is a salmonid species with pronounced geographic structure (there are 10 extant subspecies) and a recent history of hybridization with introduced rainbow trout in many populations. Genetic admixture has also occurred among cutthroat trout subspecies in areas where introductions have brought two or more subspecies into contact. Consequently, management agencies have increased their efforts to evaluate the genetic composition of cutthroat trout populations to identify populations that remain uncompromised and manage them accordingly, but additional genetic markers are needed to do so effectively. Here we used genome reduction, MID-barcoding, and 454-pyrosequencing to discover single nucleotide polymorphisms that differentiate cutthroat trout subspecies and can be used as a rapid, cost-effective method to characterize the genetic composition of cutthroat trout populations. Results Thirty cutthroat and six rainbow trout individuals were subjected to genome reduction and next-generation sequencing. A total of 1,499,670 reads averaging 379 base pairs in length were generated by 454-pyrosequencing, resulting in 569,060,077 total base pairs sequenced. A total of 43,558 putative SNPs were identified, and of those, 125 SNP primers were developed that successfully amplified 96 cutthroat trout and rainbow trout individuals. These SNP loci were able to differentiate most cutthroat trout subspecies using distance methods and Structure analyses. Conclusions Genomic and bioinformatic protocols were

  19. Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.


    Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi


    The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

  20. Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis

    PubMed Central

    Hong, Yanbin; Pandey, Manish K.; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K.; Liang, Xuanqiang; Huang, Shangzhi


    The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut. PMID:26697032

  1. Deep sequencing revealed genome-wide single-nucleotide polymorphism and plasmid content of Erwinia amylovora strains isolated in Middle Atlas, Morocco.


    Hannou, Najat; Mondy, Samuel; Planamente, Sara; Moumni, Mohieddine; Llop, Pablo; López, María; Manceau, Charles; Barny, Marie-Anne; Faure, Denis


    Erwinia amylovora causes economic losses that affect pear and apple production in Morocco. Here, we report comparative genomics of four Moroccan E. amylovora strains with the European strain CFBP1430 and North-American strain ATCC49946. Analysis of single nucleotide polymorphisms (SNPs) revealed genetic homogeneity of Moroccan's strains and their proximity to the European strain CFBP1430. Moreover, the collected sequences allowed the assembly of a 65 kpb plasmid, which is highly similar to the plasmid pEI70 harbored by several European E. amylovora isolates. This plasmid was found in 33% of the 40 E. amylovora strains collected from several host plants in 2009 and 2010 in Morocco.

  2. [Analysis of nucleotide sequences polymorphism of chloroplast trnL-trnF spacer of tRNA genes in giant duckweed Spirodela polyrrhiza (L.) Schleiden].


    Ryzhova, N N; Martirosian, L V; Kolganova, T V; Goriunova, S V; Kochieva, E Z


    Chloroplast DNA trnL-trnF spacer sequences of tRNA genes of 14 specimens of the fam. Lemnaceae have been characterized. Nucleotide polymorphism analysis of the spacer trnL-trnF of geographically isolated and morphologically differing accessions of S. polyrrhiza that is the most widespread species of Spirodela genus showed the low level of intraspecific variability. Five trnL-trnF haplotypes of S. polyrrhiza are identified. Both mono-, and polynucleotide repeats, and also extensive indels, specific to representatives Spirodela polyrrhiza, Landoltia punctata and Lemna sp. are revealed. Competency of Landoltia genus allocation as separate entity was confirmed. PMID:17209426

  3. Hydroxylamine-amplified gold nanoparticles for the naked eye and chemiluminescent detection of sequence-specific DNA with notable potential for single-nucleotide polymorphism discrimination.


    Fan, Aiping; Lau, Choiwan; Lu, Jianzhong


    Herein, we report a hydroxylamine-amplified gold nanoparticle-based assay with naked eye and chemiluminescent (CL) detection of sequence-specific DNA. For the naked eye detection assay, the signal can be observed by naked eye directly, which provides a general way for other biological assays. In contrast, the CL detection method can improve the detection limit by two orders of magnitude as compared to the naked eye detection, and a limit as low as 10 amol of target DNA can be sensitively detected. Most importantly, stringent control of either temperature or salt concentration is not needed during washing steps, and this new methodology exhibits an excellent capability for differentiating a perfectly matched target oligonucleotide from eight kinds of one-nucleotide mismatched oligonucleotides, and this detection specificity indicates that the present protocol could be applied to single-nucleotide polymorphism (SNP) analysis in many fields.

  4. Development and Validation of Single Nucleotide Polymorphism (SNP) Markers from an Expressed Sequence Tag (EST) Database in Olive Flounder (Paralichthys olivaceus).


    Kim, Jung Eun; Lee, Young Mee; Lee, Jeong-Ho; Noh, Jae Koo; Kim, Hyun Chul; Park, Choul-Ji; Park, Jong-Won; Kim, Kyung-Kil


    To successful molecular breeding, identification and functional characterization of breeding related genes and development of molecular breeding techniques using DNA markers are essential. Although the development of a useful marker is difficult in the aspect of time, cost and effort, many markers are being developed to be used in molecular breeding and developed markers have been used in many fields. Single nucleotide polymorphisms (SNPs) markers were widely used for genomic research and breeding, but has hardly been validated for screening functional genes in olive flounder. We identified single nucleotide polymorphisms (SNPs) from expressed sequence tag (EST) database in olive flounder; out of a total 4,327 ESTs, 693 contigs and 514 SNPs were detected in total EST, and these substitutions include 297 transitions and 217 transversions. As a result, 144 SNP markers were developed on the basis of 514 SNP to selection of useful gene region, and then applied to each of eight wild and culture olive flounder (total 16 samples). In our experimental result, only 32 markers had detected polymorphism in sample, also identified 21 transitions and 11 transversions, whereas indel was not detected in polymorphic SNPs. Heterozygosity of wild and cultured olive flounder using the 32 SNP markers is 0.34 and 0.29, respectively. In conclusion, we identified SNP and polymorphism in olive flounder using newly designed marker, it supports that developed markers are suitable for SNP detection and diversity analysis in olive flounder. The outcome of this study can be basic data for researches for immunity gene and characteristic with SNP.

  5. Insertions, Deletions, and Single-Nucleotide Polymorphisms at Rare Restriction Enzyme Sites Enhance Discriminatory Power of Polymorphic Amplified Typing Sequences, a Novel Strain Typing System for Escherichia coli O157:H7

    PubMed Central

    Kudva, Indira T.; Griffin, Robert W.; Murray, Megan; John, Manohar; Perna, Nicole T.; Barrett, Timothy J.; Calderwood, Stephen B.


    Polymorphic amplified typing sequences (PATS) for Escherichia coli O157:H7 (O157) was previously based on indels containing XbaI restriction enzyme sites occurring in O-island sequences of the O157 genome. This strain-typing system, referred to as XbaI-based PATS, typed every O157 isolate tested in a reproducible, rapid, straightforward, and easy-to-interpret manner and had technical advantages over pulsed-field gel electrophoresis (PFGE). However, the system was less discriminatory than PFGE and was unable to differentiate fully between unrelated isolates. To overcome this drawback, we enhanced PATS by using another infrequently cutting restriction enzyme, AvrII (also known as BlnI), to identify additional polymorphic regions that could increase the discriminatory ability of PATS typing. Referred to as AvrII-based PATS, the system identified seven new polymorphic regions in the O157 genome. Unlike XbaI, polymorphisms involving AvrII sites were caused by both indels and single-nucleotide polymorphisms occurring in O-island and backbone sequences of the O157 genome. AvrII-based PATS by itself provided poor discrimination of the O157 isolates tested. However, when primer pairs amplifying the seven polymorphic AvrII sites were combined with those amplifying the eight polymorphic XbaI sites (combined PATS), the discriminatory power of PATS was enhanced. Combined PATS matched related O157 isolates better than PFGE while differentiating between unrelated isolates. PATS typed every O157 isolate tested and directly targeted polymorphic sequences responsible for differences in the restriction digest patterns of O157 genomic DNA, utilizing PCR rather than relying on gel electrophoresis. This enabled PATS to resolve the ambiguity in PFGE typing, including that arising from the “more distantly related” and “untypeable” profiles. PMID:15184409

  6. Analysis of single nucleotide polymorphisms based on RNA sequencing data of diverse bio-geographical accessions in barley

    PubMed Central

    Takahagi, Kotaro; Uehara-Yamaguchi, Yukiko; Yoshida, Takuhiro; Sakurai, Tetsuya; Shinozaki, Kazuo; Mochida, Keiichi; Saisho, Daisuke


    Barley is one of the founder crops of Old world agriculture and has become the fourth most important cereal worldwide. Information on genome-scale DNA polymorphisms allows elucidating the evolutionary history behind domestication, as well as discovering and isolating useful genes for molecular breeding. Deep transcriptome sequencing enables the exploration of sequence variations in transcribed sequences; such analysis is particularly useful for species with large and complex genomes, such as barley. In this study, we performed RNA sequencing of 20 barley accessions, comprising representatives of several biogeographic regions and a wild ancestor. We identified 38,729 to 79,949 SNPs in the 19 domesticated accessions and 55,403 SNPs in the wild barley and revealed their genome-wide distribution using a reference genome. Genome-scale comparisons among accessions showed a clear differentiation between oriental and occidental barley populations. The results based on population structure analyses provide genome-scale properties of sub-populations grouped to oriental, occidental and marginal groups in barley. Our findings suggest that the oriental population of domesticated barley has genomic variations distinct from those in occidental groups, which might have contributed to barley’s domestication. PMID:27616653

  7. Analysis of single nucleotide polymorphisms based on RNA sequencing data of diverse bio-geographical accessions in barley.


    Takahagi, Kotaro; Uehara-Yamaguchi, Yukiko; Yoshida, Takuhiro; Sakurai, Tetsuya; Shinozaki, Kazuo; Mochida, Keiichi; Saisho, Daisuke


    Barley is one of the founder crops of Old world agriculture and has become the fourth most important cereal worldwide. Information on genome-scale DNA polymorphisms allows elucidating the evolutionary history behind domestication, as well as discovering and isolating useful genes for molecular breeding. Deep transcriptome sequencing enables the exploration of sequence variations in transcribed sequences; such analysis is particularly useful for species with large and complex genomes, such as barley. In this study, we performed RNA sequencing of 20 barley accessions, comprising representatives of several biogeographic regions and a wild ancestor. We identified 38,729 to 79,949 SNPs in the 19 domesticated accessions and 55,403 SNPs in the wild barley and revealed their genome-wide distribution using a reference genome. Genome-scale comparisons among accessions showed a clear differentiation between oriental and occidental barley populations. The results based on population structure analyses provide genome-scale properties of sub-populations grouped to oriental, occidental and marginal groups in barley. Our findings suggest that the oriental population of domesticated barley has genomic variations distinct from those in occidental groups, which might have contributed to barley's domestication. PMID:27616653

  8. Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing.


    Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan


    Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower.

  9. Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

    PubMed Central

    Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan


    Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

  10. InPhaDel: integrative shotgun and proximity-ligation sequencing to phase deletions with single nucleotide polymorphisms

    PubMed Central

    Patel, Anand; Edge, Peter; Selvaraj, Siddarth; Bansal, Vikas; Bafna, Vineet


    Phasing of single nucleotide (SNV), and structural variations into chromosome-wide haplotypes in humans has been challenging, and required either trio sequencing or restricting phasing to population-based haplotypes. Selvaraj et al. demonstrated single individual SNV phasing is possible with proximity ligated (HiC) sequencing. Here, we demonstrate HiC can phase structural variants into phased scaffolds of SNVs. Since HiC data is noisy, and SV calling is challenging, we applied a range of supervised classification techniques, including Support Vector Machines and Random Forest, to phase deletions. Our approach was demonstrated on deletion calls and phasings on the NA12878 human genome. We used three NA12878 chromosomes and simulated chromosomes to train model parameters. The remaining NA12878 chromosomes withheld from training were used to evaluate phasing accuracy. Random Forest had the highest accuracy and correctly phased 86% of the deletions with allele-specific read evidence. Allele-specific read evidence was found for 76% of the deletions. HiC provides significant read evidence for accurately phasing 33% of the deletions. Also, eight of eight top ranked deletions phased by only HiC were validated using long range polymerase chain reaction and Sanger. Thus, deletions from a single individual can be accurately phased using a combination of shotgun and proximity ligation sequencing. InPhaDel software is available at: PMID:27105843

  11. A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

    ERIC Educational Resources Information Center

    Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.


    The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

  12. A hybrid next generation transcript sequencing-based approach to identify allelic and homeolog-specific single nucleotide polymorphisms in allotetraploid white clover

    PubMed Central


    Background White clover (Trifolium repens L.) is an allotetraploid species possessing two highly collinear ancestral sub-genomes. The apparent existence of highly similar homeolog copies for the majority of genes in white clover is problematic for the development of genome-based resources in the species. This is especially true for the development of genetic markers based on single nucleotide polymorphisms (SNPs), since it is difficult to distinguish between homeolog-specific and allelic variants. Robust methods for categorising single nucleotide variants as allelic or homeolog-specific in large transcript datasets are required. We illustrate one potential approach in this study. Results We used 454-pyrosequencing sequencing to generate ~760,000 transcript sequences from an 8th generation white clover inbred line. These were assembled and partially annotated to yield a reference transcript set comprising 71,545 sequences. We subsequently performed Illumina sequencing on three further white clover samples, generating 14 million transcript reads from a mixed sample comprising 24 divergent white clover genotypes, and 50 million reads on two further eighth generation white clover inbred lines. Mapping these reads to the reference transcript set allowed us to develop a significant SNP resource for white clover, and to partition the SNPs from the inbred lines into categories reflecting allelic or homeolog-specific variation. The potential for using haplotype reconstruction and progenitor genome comparison to assign haplotypes to specific ancestral sub-genomes of white clover is demonstrated for sequences corresponding to genes encoding dehydration responsive element binding protein and acyl-coA oxidase. Conclusions In total, 208,854 independent SNPs in 31,715 reference sequences were discovered, approximately three quarters of which were categorised as representing allelic or homeolog-specific variation using two inbred lines. This represents a significant resource for

  13. Single Nucleotide Polymorphisms and Osteoarthritis

    PubMed Central

    Wang, Ting; Liang, Yuting; Li, Hong; Li, Haibo; He, Quanze; Xue, Ying; Shen, Cong; Zhang, Chunhua; Xiang, Jingjing; Ding, Jie; Qiao, Longwei; Zheng, Qiping


    Abstract Osteoarthritis (OA) is a complex disorder characterized by degenerative articular cartilage and is largely attributed to genetic risk factors. Single nucleotide polymorphisms (SNPs) are common DNA variants that have shown promising and efficiency, compared with positional cloning, to map candidate genes of complex diseases, including OA. In this study, we aim to provide an overview of multiple SNPs from a number of genes that have recently been linked to OA susceptibility. We also performed a comprehensive meta-analysis to evaluate the association of SNP rs7639618 of double von Willebrand factor A domains (DVWA) gene with OA susceptibility. A systematic search of studies on the association of SNPs with susceptibility to OA was conducted in PubMed and Google scholar. Studies subjected to meta-analysis include human and case-control studies that met the Hardy–Weinberg equilibrium model and provide sufficient data to calculate an odds ratio (OR). A total of 9500 OA cases and 9365 controls in 7 case-control studies relating to SNP rs7639618 were included in this study and the ORs with 95% confidence intervals (CIs) were calculated. Over 50 SNPs from different genes have been shown to be associated with either hip (23), or knee (20), or both (13) OA. The ORs of these SNPs for OA and the subtypes are not consistent. As to SNP rs7639618 of DVWA, increased knee OA risk was observed in all genetic models analyzed. Specifically, people from Asian with G-allele showed significantly increased risk of knee OA (A versus G: OR = 1.28, 95% CI 1.13–1.46; AA versus GG: OR = 1.60, 95% CI 1.25–2.05; GA versus GG: OR = 1.31, 95% CI 1.18–1.44; AA versus GA+GG: OR = 1.34, 95% CI 1.12–1.61; AA+GA versus GG: OR = 1.40, 95% CI 1.19–1.64), but not in Caucasians or with hip OA. Our results suggest that multiple SNPs play different roles in the pathogenesis of OA and its subtypes; SNP rs7639618 of DVWA gene is associated with a significantly increased

  14. Nucleotide Sequence-Based Multitarget Identification

    PubMed Central

    Vinayagamoorthy, T.; Mulatz, Kirk; Hodkinson, Roger


    MULTIGEN technology (T. Vinayagamoorthy, U.S. patent 6,197,510, March 2001) is a modification of conventional sequencing technology that generates a single electropherogram consisting of short nucleotide sequences from a mixture of known DNA targets. The target sequences may be present on the same or different nucleic acid molecules. For example, when two DNA targets are sequenced, the first and second sequencing primers are annealed to their respective target sequences, and then a polymerase causes chain extension by the addition of new deoxyribose nucleotides. Since the electrophoretic separation depends on the relative molecular weights of the truncated molecules, the molecular weight of the second sequencing primer was specifically designed to be higher than the combined molecular weight of the first sequencing primer plus the molecular weight of the largest truncated molecule generated from the first target sequence. Thus, the series of truncated molecules produced by the second sequencing primer will have higher molecular weights than those produced by the first sequencing primer. Hence, the truncated molecules produced by these two sequencing primers can be effectively separated in a single lane by standard gel electrophoresis in a single electropherogram without any overlapping of the nucleotide sequences. By using sequencing primers with progressively higher molecular weights, multiple short DNA sequences from a variety of targets can be determined simultaneously. We describe here the basic concept of MULTIGEN technology and three applications: detection of sexually transmitted pathogens (Neisseria gonorrhoeae, Chlamydia trachomatis, and Ureaplasma urealyticum), detection of contaminants in meat samples (coliforms, fecal coliforms, and Escherichia coli O157:H7), and detection of single-nucleotide polymorphisms in the human N-acetyltransferase (NAT1) gene (S. Fronhoffs et al., Carcinogenesis 22:1405-1412, 2001). PMID:12843076

  15. Nucleotide polymorphism and copy number variant detection using exome capture and next-generation sequencing in the polyploid grass Panicum virgatum

    PubMed Central

    Evans, Joseph; Kim, Jeongwoon; Childs, Kevin L; Vaillancourt, Brieanne; Crisovan, Emily; Nandety, Aruna; Gerhardt, Daniel J; Richmond, Todd A; Jeddeloh, Jeffrey A; Kaeppler, Shawn M; Casler, Michael D; Buell, C Robin


    Switchgrass (Panicum virgatum) is a polyploid, outcrossing grass species native to North America and has recently been recognized as a potential biofuel feedstock crop. Significant phenotypic variation including ploidy is present across the two primary ecotypes of switchgrass, referred to as upland and lowland switchgrass. The tetraploid switchgrass genome is approximately 1400 Mbp, split between two subgenomes, with significant repetitive sequence content limiting the efficiency of re-sequencing approaches for determining genome diversity. To characterize genetic diversity in upland and lowland switchgrass as a first step in linking genotype to phenotype, we designed an exome capture probe set based on transcript assemblies that represent approximately 50 Mb of annotated switchgrass exome sequences. We then evaluated and optimized the probe set using solid phase comparative genome hybridization and liquid phase exome capture followed by next-generation sequencing. Using the optimized probe set, we assessed variation in the exomes of eight switchgrass genotypes representing tetraploid lowland and octoploid upland cultivars to benchmark our exome capture probe set design. We identified ample variation in the switchgrass genome including 1 395 501 single nucleotide polymorphisms (SNPs), 8173 putative copy number variants and 3336 presence/absence variants. While the majority of the SNPs (84%) detected was bi-allelic, a substantial number was tri-allelic with limited occurrence of tetra-allelic polymorphisms consistent with the heterozygous and polyploid nature of the switchgrass genome. Collectively, these data demonstrate the efficacy of exome capture for discovery of genome variation in a polyploid species with a large, repetitive and heterozygous genome. PMID:24947485

  16. Characterization of pancreatic ductal adenocarcinoma using whole transcriptome sequencing and copy number analysis by single-nucleotide polymorphism array.


    Di Marco, Mariacristina; Astolfi, Annalisa; Grassi, Elisa; Vecchiarelli, Silvia; Macchini, Marina; Indio, Valentina; Casadei, Riccardo; Ricci, Claudio; D'Ambra, Marielda; Taffurelli, Giovanni; Serra, Carla; Ercolani, Giorgio; Santini, Donatella; D'Errico, Antonia; Pinna, Antonio Daniele; Minni, Francesco; Durante, Sandra; Martella, Laura Raffaella; Biasco, Guido


    The aim of the current study was to implement whole transcriptome massively parallel sequencing (RNASeq) and copy number analysis to investigate the molecular biology of pancreatic ductal adenocarcinoma (PDAC). Samples from 16 patients with PDAC were collected by ultrasound‑guided biopsy or from surgical specimens for DNA and RNA extraction. All samples were analyzed by RNASeq performed at 75x2 base pairs on a HiScanSQ Illumina platform. Single‑nucleotide variants (SNVs) were detected with SNVMix and filtered on dbSNP, 1000 Genomes and Cosmic. Non‑synonymous SNVs were analyzed with SNPs&GO and PROVEAN. A total of 13 samples were analyzed by high resolution copy number analysis on an Affymetrix SNP array 6.0. RNAseq resulted in an average of 264 coding non‑synonymous novel SNVs (ranging from 146‑374) and 16 novel insertions or deletions (In/Dels) (ranging from 6‑24) for each sample, of which a mean of 11.2% were disease‑associated and somatic events, while 34.7% were frameshift somatic In/Dels. From this analysis, alterations in the known oncogenes associated with PDAC were observed, including Kirsten rat sarcoma viral oncogene homolog (KRAS) mutations (93.7%) and inactivation of cyclin‑dependent kinase inhibitor 2A (CDKN2A) (50%), mothers against decapentaplegic homolog 4 (SMAD4) (50%), and tumor protein 53 (TP53) (56%). One case that was negative for KRAS exhibited a G13D neuroblastoma RAS viral oncogene homolog mutation. In addition, gene fusions were detected in 10 samples for a total of 23 different intra‑ or inter‑chromosomal rearrangements, however, a recurrent fusion transcript remains to be identified. SNP arrays identified macroscopic and cryptic cytogenetic alterations in 85% of patients. Gains were observed in the chromosome arms 6p, 12p, 18q and 19q which contain KRAS, GATA binding protein 6, protein kinase B and cyclin D3. Deletions were identified on chromosome arms 1p, 9p, 6p, 18q, 10q, 15q, 17p, 21q and 19q which involve TP53

  17. Characterization of pancreatic ductal adenocarcinoma using whole transcriptome sequencing and copy number analysis by single-nucleotide polymorphism array.


    Di Marco, Mariacristina; Astolfi, Annalisa; Grassi, Elisa; Vecchiarelli, Silvia; Macchini, Marina; Indio, Valentina; Casadei, Riccardo; Ricci, Claudio; D'Ambra, Marielda; Taffurelli, Giovanni; Serra, Carla; Ercolani, Giorgio; Santini, Donatella; D'Errico, Antonia; Pinna, Antonio Daniele; Minni, Francesco; Durante, Sandra; Martella, Laura Raffaella; Biasco, Guido


    The aim of the current study was to implement whole transcriptome massively parallel sequencing (RNASeq) and copy number analysis to investigate the molecular biology of pancreatic ductal adenocarcinoma (PDAC). Samples from 16 patients with PDAC were collected by ultrasound‑guided biopsy or from surgical specimens for DNA and RNA extraction. All samples were analyzed by RNASeq performed at 75x2 base pairs on a HiScanSQ Illumina platform. Single‑nucleotide variants (SNVs) were detected with SNVMix and filtered on dbSNP, 1000 Genomes and Cosmic. Non‑synonymous SNVs were analyzed with SNPs&GO and PROVEAN. A total of 13 samples were analyzed by high resolution copy number analysis on an Affymetrix SNP array 6.0. RNAseq resulted in an average of 264 coding non‑synonymous novel SNVs (ranging from 146‑374) and 16 novel insertions or deletions (In/Dels) (ranging from 6‑24) for each sample, of which a mean of 11.2% were disease‑associated and somatic events, while 34.7% were frameshift somatic In/Dels. From this analysis, alterations in the known oncogenes associated with PDAC were observed, including Kirsten rat sarcoma viral oncogene homolog (KRAS) mutations (93.7%) and inactivation of cyclin‑dependent kinase inhibitor 2A (CDKN2A) (50%), mothers against decapentaplegic homolog 4 (SMAD4) (50%), and tumor protein 53 (TP53) (56%). One case that was negative for KRAS exhibited a G13D neuroblastoma RAS viral oncogene homolog mutation. In addition, gene fusions were detected in 10 samples for a total of 23 different intra‑ or inter‑chromosomal rearrangements, however, a recurrent fusion transcript remains to be identified. SNP arrays identified macroscopic and cryptic cytogenetic alterations in 85% of patients. Gains were observed in the chromosome arms 6p, 12p, 18q and 19q which contain KRAS, GATA binding protein 6, protein kinase B and cyclin D3. Deletions were identified on chromosome arms 1p, 9p, 6p, 18q, 10q, 15q, 17p, 21q and 19q which involve TP53

  18. The genetic landscape of paediatric de novo acute myeloid leukaemia as defined by single nucleotide polymorphism array and exon sequencing of 100 candidate genes.


    Olsson, Linda; Zettermark, Sofia; Biloglav, Andrea; Castor, Anders; Behrendtz, Mikael; Forestier, Erik; Paulsson, Kajsa; Johansson, Bertil


    Cytogenetic analyses of a consecutive series of 67 paediatric (median age 8 years; range 0-17) de novo acute myeloid leukaemia (AML) patients revealed aberrations in 55 (82%) cases. The most common subgroups were KMT2A rearrangement (29%), normal karyotype (15%), RUNX1-RUNX1T1 (10%), deletions of 5q, 7q and/or 17p (9%), myeloid leukaemia associated with Down syndrome (7%), PML-RARA (7%) and CBFB-MYH11 (5%). Single nucleotide polymorphism array (SNP-A) analysis and exon sequencing of 100 genes, performed in 52 and 40 cases, respectively (39 overlapping), revealed ≥1 aberration in 89%; when adding cytogenetic data, this frequency increased to 98%. Uniparental isodisomies (UPIDs) were detected in 13% and copy number aberrations (CNAs) in 63% (median 2/case); three UPIDs and 22 CNAs were recurrent. Twenty-two genes were targeted by focal CNAs, including AEBP2 and PHF6 deletions and genes involved in AML-associated gene fusions. Deep sequencing identified mutations in 65% of cases (median 1/case). In total, 60 mutations were found in 30 genes, primarily those encoding signalling proteins (47%), transcription factors (25%), or epigenetic modifiers (13%). Twelve genes (BCOR, CEBPA, FLT3, GATA1, KIT, KRAS, NOTCH1, NPM1, NRAS, PTPN11, SMC3 and TP53) were recurrently mutated. We conclude that SNP-A and deep sequencing analyses complement the cytogenetic diagnosis of paediatric AML.

  19. The genetic landscape of paediatric de novo acute myeloid leukaemia as defined by single nucleotide polymorphism array and exon sequencing of 100 candidate genes.


    Olsson, Linda; Zettermark, Sofia; Biloglav, Andrea; Castor, Anders; Behrendtz, Mikael; Forestier, Erik; Paulsson, Kajsa; Johansson, Bertil


    Cytogenetic analyses of a consecutive series of 67 paediatric (median age 8 years; range 0-17) de novo acute myeloid leukaemia (AML) patients revealed aberrations in 55 (82%) cases. The most common subgroups were KMT2A rearrangement (29%), normal karyotype (15%), RUNX1-RUNX1T1 (10%), deletions of 5q, 7q and/or 17p (9%), myeloid leukaemia associated with Down syndrome (7%), PML-RARA (7%) and CBFB-MYH11 (5%). Single nucleotide polymorphism array (SNP-A) analysis and exon sequencing of 100 genes, performed in 52 and 40 cases, respectively (39 overlapping), revealed ≥1 aberration in 89%; when adding cytogenetic data, this frequency increased to 98%. Uniparental isodisomies (UPIDs) were detected in 13% and copy number aberrations (CNAs) in 63% (median 2/case); three UPIDs and 22 CNAs were recurrent. Twenty-two genes were targeted by focal CNAs, including AEBP2 and PHF6 deletions and genes involved in AML-associated gene fusions. Deep sequencing identified mutations in 65% of cases (median 1/case). In total, 60 mutations were found in 30 genes, primarily those encoding signalling proteins (47%), transcription factors (25%), or epigenetic modifiers (13%). Twelve genes (BCOR, CEBPA, FLT3, GATA1, KIT, KRAS, NOTCH1, NPM1, NRAS, PTPN11, SMC3 and TP53) were recurrently mutated. We conclude that SNP-A and deep sequencing analyses complement the cytogenetic diagnosis of paediatric AML. PMID:27022003

  20. Characterization of Foodborne Outbreaks of Salmonella enterica Serovar Enteritidis with Whole-Genome Sequencing Single Nucleotide Polymorphism-Based Analysis for Surveillance and Outbreak Detection

    PubMed Central

    Lappi, Victoria; Wolfgang, William J.; Lapierre, Pascal; Palumbo, Michael J.; Medus, Carlota; Boxrud, David


    Salmonella enterica serovar Enteritidis is a significant cause of gastrointestinal illness in the United States; however, current molecular subtyping methods lack resolution for this highly clonal serovar. Advances in next-generation sequencing technologies have made it possible to examine whole-genome sequencing (WGS) as a potential molecular subtyping tool for outbreak detection and source trace back. Here, we conducted a retrospective analysis of S. Enteritidis isolates from seven epidemiologically confirmed foodborne outbreaks and sporadic isolates (not epidemiologically linked) to determine the utility of WGS to identify outbreaks. A collection of 55 epidemiologically characterized clinical and environmental S. Enteritidis isolates were sequenced. Single nucleotide polymorphism (SNP)-based cluster analysis of the S. Enteritidis genomes revealed well supported clades, with less than four-SNP pairwise diversity, that were concordant with epidemiologically defined outbreaks. Sporadic isolates were an average of 42.5 SNPs distant from the outbreak clusters. Isolates collected from the same patient over several weeks differed by only two SNPs. Our findings show that WGS provided greater resolution between outbreak, sporadic, and suspect isolates than the current gold standard subtyping method, pulsed-field gel electrophoresis (PFGE). Furthermore, results could be obtained in a time frame suitable for surveillance activities, supporting the use of WGS as an outbreak detection and characterization method for S. Enteritidis. PMID:26269623

  1. Characterization of Foodborne Outbreaks of Salmonella enterica Serovar Enteritidis with Whole-Genome Sequencing Single Nucleotide Polymorphism-Based Analysis for Surveillance and Outbreak Detection.


    Taylor, Angela J; Lappi, Victoria; Wolfgang, William J; Lapierre, Pascal; Palumbo, Michael J; Medus, Carlota; Boxrud, David


    Salmonella enterica serovar Enteritidis is a significant cause of gastrointestinal illness in the United States; however, current molecular subtyping methods lack resolution for this highly clonal serovar. Advances in next-generation sequencing technologies have made it possible to examine whole-genome sequencing (WGS) as a potential molecular subtyping tool for outbreak detection and source trace back. Here, we conducted a retrospective analysis of S. Enteritidis isolates from seven epidemiologically confirmed foodborne outbreaks and sporadic isolates (not epidemiologically linked) to determine the utility of WGS to identify outbreaks. A collection of 55 epidemiologically characterized clinical and environmental S. Enteritidis isolates were sequenced. Single nucleotide polymorphism (SNP)-based cluster analysis of the S. Enteritidis genomes revealed well supported clades, with less than four-SNP pairwise diversity, that were concordant with epidemiologically defined outbreaks. Sporadic isolates were an average of 42.5 SNPs distant from the outbreak clusters. Isolates collected from the same patient over several weeks differed by only two SNPs. Our findings show that WGS provided greater resolution between outbreak, sporadic, and suspect isolates than the current gold standard subtyping method, pulsed-field gel electrophoresis (PFGE). Furthermore, results could be obtained in a time frame suitable for surveillance activities, supporting the use of WGS as an outbreak detection and characterization method for S. Enteritidis. PMID:26269623

  2. Genome-wide association study using high-density single nucleotide polymorphism arrays and whole-genome sequences for clinical mastitis traits in dairy cattle.


    Sahana, G; Guldbrandtsen, B; Thomsen, B; Holm, L-E; Panitz, F; Brøndum, R F; Bendixen, C; Lund, M S


    Mastitis is a mammary disease that frequently affects dairy cattle. Despite considerable research on the development of effective prevention and treatment strategies, mastitis continues to be a significant issue in bovine veterinary medicine. To identify major genes that affect mastitis in dairy cattle, 6 chromosomal regions on Bos taurus autosome (BTA) 6, 13, 16, 19, and 20 were selected from a genome scan for 9 mastitis phenotypes using imputed high-density single nucleotide polymorphism arrays. Association analyses using sequence-level variants for the 6 targeted regions were carried out to map causal variants using whole-genome sequence data from 3 breeds. The quantitative trait loci (QTL) discovery population comprised 4,992 progeny-tested Holstein bulls, and QTL were confirmed in 4,442 Nordic Red and 1,126 Jersey cattle. The targeted regions were imputed to the sequence level. The highest association signal for clinical mastitis was observed on BTA 6 at 88.97 Mb in Holstein cattle and was confirmed in Nordic Red cattle. The peak association region on BTA 6 contained 2 genes: vitamin D-binding protein precursor (GC) and neuropeptide FF receptor 2 (NPFFR2), which, based on known biological functions, are good candidates for affecting mastitis. However, strong linkage disequilibrium in this region prevented conclusive determination of the causal gene. A different QTL on BTA 6 located at 88.32 Mb in Holstein cattle affected mastitis. In addition, QTL on BTA 13 and 19 were confirmed to segregate in Nordic Red cattle and QTL on BTA 16 and 20 were confirmed in Jersey cattle. Although several candidate genes were identified in these targeted regions, it was not possible to identify a gene or polymorphism as the causal factor for any of these regions.

  3. The EMBL nucleotide sequence database.

    PubMed Central

    Stoesser, G; Moseley, M A; Sleep, J; McGowran, M; Garcia-Pastor, M; Sterk, P


    The EMBL Nucleotide Sequence Database ( html ) constitutes Europe's primary nucleotide sequence resource. DNA and RNA sequences are directly submitted from researchers and genome sequencing groups and collected from the scientific literature and patent applications (Fig. 1). In collaboration with DDBJ and GenBank the database is produced, maintained and distributed at the European Bioinformatics Institute. Database releases are produced quarterly and are distributed on CD-ROM. EBI's network services allow access to the most up-to-date data collection via Internet and World Wide Web interface, providing database searching and sequence similarity facilities plus access to a large number of additional databases. PMID:9399791

  4. Authentication of anglerfish species (Lophius spp) by means of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and forensically informative nucleotide sequencing (FINS) methodologies.


    Espiñeira, Montserrat; González-Lavín, Nerea; Vieites, Juan M; Santaclara, Francisco J


    Lophius represents the most important genus of the family Lophiidae from a commercial point of view. The main marketing formats of the species included in this genus are tails and cheeks, making impossible the species identification on the basis of their morphological characters. In the present study, two methods based on the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and phylogenetic analysis of DNA sequences [forensically informative nucleotide sequencing (FINS)] were developed to differentiate the seven species contained in the genus Lophius. In both cases, the molecular marker studied was the cytochrome oxidase subunit I gene (COI). The RFLP analysis of the PCR products digested with the endonuclease Mbo I generated species-specific restriction profiles, and the phylogenetic analysis showing a neighbor-joining tree with independent nodes was strongly supported for all of the studied species. These methods were applied to 40 commercial samples, allowing us to detect the samples incorrectly labeled. The fraudulent labeling ratio was higher in processed products (68.75%) than whole fish (31.25%). The species subjected to mislabeling were L. budegassa (68.75%), L. vomerinus (18.75%), and L. piscatorius (12.5%). Therefore, both methodologies can be independently used to authenticate the species belonging to the genus Lophius, being useful to check the fulfillment of labeling regulations of seafood products and to verify the correct traceability of commercial trade and the control of fisheries. PMID:18975961

  5. Authentication of anglerfish species (Lophius spp) by means of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and forensically informative nucleotide sequencing (FINS) methodologies.


    Espiñeira, Montserrat; González-Lavín, Nerea; Vieites, Juan M; Santaclara, Francisco J


    Lophius represents the most important genus of the family Lophiidae from a commercial point of view. The main marketing formats of the species included in this genus are tails and cheeks, making impossible the species identification on the basis of their morphological characters. In the present study, two methods based on the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and phylogenetic analysis of DNA sequences [forensically informative nucleotide sequencing (FINS)] were developed to differentiate the seven species contained in the genus Lophius. In both cases, the molecular marker studied was the cytochrome oxidase subunit I gene (COI). The RFLP analysis of the PCR products digested with the endonuclease Mbo I generated species-specific restriction profiles, and the phylogenetic analysis showing a neighbor-joining tree with independent nodes was strongly supported for all of the studied species. These methods were applied to 40 commercial samples, allowing us to detect the samples incorrectly labeled. The fraudulent labeling ratio was higher in processed products (68.75%) than whole fish (31.25%). The species subjected to mislabeling were L. budegassa (68.75%), L. vomerinus (18.75%), and L. piscatorius (12.5%). Therefore, both methodologies can be independently used to authenticate the species belonging to the genus Lophius, being useful to check the fulfillment of labeling regulations of seafood products and to verify the correct traceability of commercial trade and the control of fisheries.

  6. Tracking a Tuberculosis Outbreak Over 21 Years: Strain-Specific Single-Nucleotide Polymorphism Typing Combined With Targeted Whole-Genome Sequencing

    PubMed Central

    Stucki, David; Ballif, Marie; Bodmer, Thomas; Coscolla, Mireia; Maurer, Anne-Marie; Droz, Sara; Butz, Christa; Borrell, Sonia; Längle, Christel; Feldmann, Julia; Furrer, Hansjakob; Mordasini, Carlo; Helbling, Peter; Rieder, Hans L.; Egger, Matthias; Gagneux, Sébastien; Fenner, Lukas


    Background. Whole-genome sequencing (WGS) is increasingly used in molecular-epidemiological investigations of bacterial pathogens, despite cost- and time-intensive analyses. We combined strain-specific single-nucleotide polymorphism (SNP) typing and targeted WGS to investigate a tuberculosis cluster spanning 21 years in Bern, Switzerland. Methods. On the basis of genome sequences of 3 historical outbreak Mycobacterium tuberculosis isolates, we developed a strain-specific SNP-typing assay to identify further cases. We screened 1642 patient isolates and performed WGS on all identified cluster isolates. We extracted SNPs to construct genomic networks. Clinical and social data were retrospectively collected. Results. We identified 68 patients associated with the outbreak strain. Most received a tuberculosis diagnosis in 1991–1995, but cases were observed until 2011. Two thirds were homeless and/or substance abusers. Targeted WGS revealed 133 variable SNP positions among outbreak isolates. Genomic network analyses suggested a single origin of the outbreak, with subsequent division into 3 subclusters. Isolates from patients with confirmed epidemiological links differed by 0–11 SNPs. Conclusions. Strain-specific SNP genotyping allowed rapid and inexpensive identification of M. tuberculosis outbreak isolates in a population-based strain collection. Subsequent targeted WGS provided detailed insights into transmission dynamics. This combined approach could be applied to track bacterial pathogens in real time and at high resolution. PMID:25362193

  7. Single nucleotide polymorphisms generated by genotyping by sequencing to characterize genome-wide diversity, linkage disequilibrium, and selective sweeps in cultivated watermelon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Large datasets containing single nucleotide polymorphisms (SNPs) are used to analyze genome-wide diversity in a robust collection of cultivars from representative accessions, across the world. The extent of linkage disequilibrium (LD) within a population determines the number of markers required fo...

  8. Automated Identification of Nucleotide Sequences

    NASA Technical Reports Server (NTRS)

    Osman, Shariff; Venkateswaran, Kasthuri; Fox, George; Zhu, Dian-Hui


    STITCH is a computer program that processes raw nucleotide-sequence data to automatically remove unwanted vector information, perform reverse-complement comparison, stitch shorter sequences together to make longer ones to which the shorter ones presumably belong, and search against the user s choice of private and Internet-accessible public 16S rRNA databases. ["16S rRNA" denotes a ribosomal ribonucleic acid (rRNA) sequence that is common to all organisms.] In STITCH, a template 16S rRNA sequence is used to position forward and reverse reads. STITCH then automatically searches known 16S rRNA sequences in the user s chosen database(s) to find the sequence most similar to (the sequence that lies at the smallest edit distance from) each spliced sequence. The result of processing by STITCH is the identification of the most similar well-described bacterium. Whereas previously commercially available software for analyzing genetic sequences operates on one sequence at a time, STITCH can manipulate multiple sequences simultaneously to perform the aforementioned operations. A typical analysis of several dozen sequences (length of the order of 103 base pairs) by use of STITCH is completed in a few minutes, whereas such an analysis performed by use of prior software takes hours or days.

  9. A High-Throughput Data Mining of Single Nucleotide Polymorphisms in Coffea Species Expressed Sequence Tags Suggests Differential Homeologous Gene Expression in the Allotetraploid Coffea arabica1[W

    PubMed Central

    Vidal, Ramon Oliveira; Mondego, Jorge Maurício Costa; Pot, David; Ambrósio, Alinne Batista; Andrade, Alan Carvalho; Pereira, Luiz Filipe Protasio; Colombo, Carlos Augusto; Vieira, Luiz Gonzaga Esteves; Carazzolle, Marcelo Falsarella; Pereira, Gonçalo Amarante Guimarães


    Polyploidization constitutes a common mode of evolution in flowering plants. This event provides the raw material for the divergence of function in homeologous genes, leading to phenotypic novelty that can contribute to the success of polyploids in nature or their selection for use in agriculture. Mounting evidence underlined the existence of homeologous expression biases in polyploid genomes; however, strategies to analyze such transcriptome regulation remained scarce. Important factors regarding homeologous expression biases remain to be explored, such as whether this phenomenon influences specific genes, how paralogs are affected by genome doubling, and what is the importance of the variability of homeologous expression bias to genotype differences. This study reports the expressed sequence tag assembly of the allopolyploid Coffea arabica and one of its direct ancestors, Coffea canephora. The assembly was used for the discovery of single nucleotide polymorphisms through the identification of high-quality discrepancies in overlapped expressed sequence tags and for gene expression information indirectly estimated by the transcript redundancy. Sequence diversity profiles were evaluated within C. arabica (Ca) and C. canephora (Cc) and used to deduce the transcript contribution of the Coffea eugenioides (Ce) ancestor. The assignment of the C. arabica haplotypes to the C. canephora (CaCc) or C. eugenioides (CaCe) ancestral genomes allowed us to analyze gene expression contributions of each subgenome in C. arabica. In silico data were validated by the quantitative polymerase chain reaction and allele-specific combination TaqMAMA-based method. The presence of differential expression of C. arabica homeologous genes and its implications in coffee gene expression, ontology, and physiology are discussed. PMID:20864545

  10. Genetic diversity in domesticated soybean (Glycine max) and its wild progenitor (Glycine soja) for simple sequence repeat and single-nucleotide polymorphism loci.


    Li, Ying-Hui; Li, Wei; Zhang, Chen; Yang, Liang; Chang, Ru-Zhen; Gaut, Brandon S; Qiu, Li-Juan


    • The study of genetic diversity between a crop and its wild relatives may yield fundamental insights into evolutionary history and the process of domestication. • In this study, we genotyped a sample of 303 accessions of domesticated soybean (Glycine max) and its wild progenitor Glycine soja with 99 microsatellite markers and 554 single-nucleotide polymorphism (SNP) markers. • The simple sequence repeat (SSR) loci averaged 21.5 alleles per locus and overall Nei's gene diversity of 0.77. The SNPs had substantially lower genetic diversity (0.35) than SSRs. A SSR analyses indicated that G. soja exhibited higher diversity than G. max, but SNPs provided a slightly different snapshot of diversity between the two taxa. For both marker types, the primary division of genetic diversity was between the wild and domesticated accessions. Within taxa, G. max consisted of four geographic regions in China. G. soja formed six subgroups. Genealogical analyses indicated that cultivated soybean tended to form a monophyletic clade with respect to G. soja. • G. soja and G. max represent distinct germplasm pools. Limited evidence of admixture was discovered between these two species. Overall, our analyses are consistent with the origin of G. max from regions along the Yellow River of China.

  11. Characterization of a mini core collection of Japanese wheat varieties using single-nucleotide polymorphisms generated by genotyping-by-sequencing

    PubMed Central

    Kobayashi, Fuminori; Tanaka, Tsuyoshi; Kanamori, Hiroyuki; Wu, Jianzhong; Katayose, Yuichi; Handa, Hirokazu


    A core collection of Japanese wheat varieties (JWC) consisting of 96 accessions was established based on their passport data and breeding pedigrees. To clarify the molecular basis of the JWC collection, genome-wide single-nucleotide polymorphism (SNP) genotyping was performed using the genotyping-by-sequencing (GBS) approach. Phylogenetic tree and population structure analyses using these SNP data revealed the genetic diversity and relationships among the JWC accessions, classifying them into four groups; “varieties in the Hokkaido area”, “modern varieties in the northeast part of Japan”, “modern varieties in the southwest part of Japan” and “classical varieties including landraces”. This clustering closely reflected the history of wheat breeding in Japan. Furthermore, to demonstrate the utility of the JWC collection, we performed a genome-wide association study (GWAS) for three traits, namely, “days to heading in autumn sowing”, “days to heading in spring sowing” and “culm length”. We found significantly associated SNP markers with each trait, and some of these were closely linked to known major genes for heading date or culm length on the genetic map. Our study indicates that this JWC collection is a useful set of germplasm for basic and applied research aimed at understanding and utilizing the genetic diversity among Japanese wheat varieties. PMID:27162493

  12. Analysis of single nucleotide polymorphism via genotyping-by-sequencing in the gall midge Mayetiola Destructor (Hessian Fly)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genotyping-by-sequencing (GBS) is a recently developed technology that has been used to identify DNA markers and map genes for specific traits in many organisms. The gall midge Mayetiola destructor, commonly known as Hessian fly, is a global destructive pest of wheat. In this study, we identified ...

  13. Restriction site-associated DNA sequencing generates high-quality single nucleotide polymorphisms for assessing hybridization between bighead and silver carp in the United States and China.


    Lamer, James T; Sass, Greg G; Boone, Jason Q; Arbieva, Zarema H; Green, Stefan J; Epifanio, John M


    Bighead carp (Hypophthalmichthys nobilis) and silver carp (H. molitrix) are invasive species and listed as US federally injurious species under the Lacy Act. They have established populations in much of the Mississippi River Basin (MRB; Mississippi, Illinois, and Missouri rivers) and are capable of producing fertile hybrids and complex introgression. Characterizing the composition of this admixture requires a large set of high-quality, evolutionarily conserved, diagnostic genetic markers to aid in the identification and management of these species in the midst of morphological ambiguity. Restriction site-associated DNA (RAD) sequencing of 45 barcoded bighead and silver carp from the United States and China produced reads that were aligned to the silver carp transcriptome yielded 261 candidate single nucleotide polymorphisms (SNPs) with fixed allelic differences between the two species. We selected the highest quality 112 SNP loci for validation using 194 putative pure-species and F1 hybrids from the MRB and putative bighead carp and silver carp pure species from China (Amur, Pearl and Yangtze rivers). Fifty SNPs were omitted due to design/amplification failure or lack of diagnostic utility. A total of 57 species-diagnostic SNPs conserved between carp species in US and Chinese rivers were identified; 32 were annotated to functional gene loci. Twenty-seven of the 181 (15%) putative pure species were identified as hybrid backcrosses after validation, including three backcrosses from the Amur River, where hybridization has not been documented previously. The 57 SNPs identified through RAD sequencing provide a diagnostic tool to detect population admixture and to identify hybrid and pure-species Asian carps in the United States and China.

  14. Deep Sequencing of Distinct Preparations of the Live Attenuated Varicella-Zoster Virus Vaccine Reveals a Conserved Core of Attenuating Single-Nucleotide Polymorphisms

    PubMed Central

    Yamanishi, Koichi; Gomi, Yasuyuki; Gershon, Anne A.; Breuer, Judith


    ABSTRACT The continued success of the live attenuated varicella-zoster virus vaccine in preventing varicella-zoster and herpes zoster is well documented, as are many of the mutations that contribute to the attenuation of the vOka virus for replication in skin. At least three different preparations of vOka are marketed. Here, we show using deep sequencing of seven batches of vOka vaccine (including ZostaVax, VariVax, VarilRix, and the Oka/Biken working seed) from three different manufacturers (VariVax, GSK, and Biken) that 137 single-nucleotide polymorphism (SNP) mutations are present in all vaccine batches. This includes six sites at which the vaccine allele is fixed or near fixation, which we speculate are likely to be important for attenuation. We also show that despite differences in the vaccine populations between preparations, batch-to-batch variation is minimal, as is the number and frequency of mutations unique to individual batches. This suggests that the vaccine manufacturing processes are not introducing new mutations and that, notwithstanding the mixture of variants present, VZV live vaccines are extremely stable. IMPORTANCE The continued success of vaccinations to prevent chickenpox and shingles, combined with the extremely low incidence of adverse reactions, indicates the quality of these vaccines. The vaccine itself is comprised of a heterogeneous live attenuated virus population and thus requires deep-sequencing technologies to explore the differences and similarities in the virus populations between different preparations and batches of the vaccines. Our data demonstrate minimal variation between batches, an important safety feature, and provide new insights into the extent of the mutations present in this attenuated virus. PMID:27440875

  15. Restriction site-associated DNA sequencing generates high-quality single nucleotide polymorphisms for assessing hybridization between bighead and silver carp in the United States and China.


    Lamer, James T; Sass, Greg G; Boone, Jason Q; Arbieva, Zarema H; Green, Stefan J; Epifanio, John M


    Bighead carp (Hypophthalmichthys nobilis) and silver carp (H. molitrix) are invasive species and listed as US federally injurious species under the Lacy Act. They have established populations in much of the Mississippi River Basin (MRB; Mississippi, Illinois, and Missouri rivers) and are capable of producing fertile hybrids and complex introgression. Characterizing the composition of this admixture requires a large set of high-quality, evolutionarily conserved, diagnostic genetic markers to aid in the identification and management of these species in the midst of morphological ambiguity. Restriction site-associated DNA (RAD) sequencing of 45 barcoded bighead and silver carp from the United States and China produced reads that were aligned to the silver carp transcriptome yielded 261 candidate single nucleotide polymorphisms (SNPs) with fixed allelic differences between the two species. We selected the highest quality 112 SNP loci for validation using 194 putative pure-species and F1 hybrids from the MRB and putative bighead carp and silver carp pure species from China (Amur, Pearl and Yangtze rivers). Fifty SNPs were omitted due to design/amplification failure or lack of diagnostic utility. A total of 57 species-diagnostic SNPs conserved between carp species in US and Chinese rivers were identified; 32 were annotated to functional gene loci. Twenty-seven of the 181 (15%) putative pure species were identified as hybrid backcrosses after validation, including three backcrosses from the Amur River, where hybridization has not been documented previously. The 57 SNPs identified through RAD sequencing provide a diagnostic tool to detect population admixture and to identify hybrid and pure-species Asian carps in the United States and China. PMID:23957862

  16. Population genetic structure in farm and feral American mink (Neovison vison) inferred from RAD sequencing-generated single nucleotide polymorphisms.


    Thirstrup, J P; Ruiz-Gonzalez, A; Pujolar, J M; Larsen, P F; Jensen, J; Randi, E; Zalewski, A; Pertoldi, C


    Feral American mink populations (), derived from mink farms, are widespread in Europe. In this study we investigated genetic diversity and genetic differentiation between feral and farm mink using a panel of genetic markers (194 SNP) generated from RAD sequencing data. Sampling included a total of 211 individuals from 14 populations, 4 feral and 10 from farms, the latter including a total of 7 color types (Brown, Black, Mahogany, Sapphire, White, Pearl, and Silver). Our study revealed similar low levels of genetic diversity in both farm and feral mink. Results are consistent with small effective population size as a consequence of line selection in the farms and founder effects of a few escapees from the farms in feral populations. Moderately high genetic differentiation was found between farm and feral animals, suggesting a scenario in which wild populations were founded from farm escapes a few decades ago. Currently, escapes and gene flow are probably limited. Genetic differentiation was higher among farm color types than among farms, consistent with line selection using few individuals to create the lines. Finally, no indications of inbreeding were found in either farm or feral samples, with significant negative values found in most farm samples, showing farms are successful in avoiding inbreeding. PMID:26440156

  17. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα)-encoding (GNAS) genomic imprinting domain are associated with performance traits

    PubMed Central


    Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs) spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS) domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486) were located upstream of the GNAS gene, while one SNP (rs41694646) was located in the second intron of the GNAS gene. The final SNP (rs41694656) was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646) is associated (P ≤ 0.05) with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf) and gestation length. Association (P ≤ 0.01) with direct calving difficulty (i.e. due to calf size) and maternal calving difficulty (i.e. due to the maternal pelvic width size) was also observed at the rs43101491 SNP. Following

  18. Genome-Wide Patterns of Nucleotide Polymorphism in Domesticated Rice

    PubMed Central

    Hernandez, Ryan D; Boyko, Adam; Fledel-Alon, Adi; York, Thomas L; Polato, Nicholas R; Olsen, Kenneth M; Nielsen, Rasmus; McCouch, Susan R; Bustamante, Carlos D; Purugganan, Michael D


    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models to explain contemporary patterns of polymorphisms in rice, including a (i) selectively neutral population bottleneck model, (ii) bottleneck plus migration model, (iii) multiple selective sweeps model, and (iv) bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been the dominant demographic model for domesticated species, cannot explain the derived nucleotide polymorphism site frequency spectrum in rice. Instead, a bottleneck model that incorporates selective sweeps, or a more complex demographic model that includes subdivision and gene flow, are more plausible explanations for patterns of variation in domesticated rice varieties. If selective sweeps are indeed the explanation for the observed nucleotide data of domesticated rice, it suggests that strong selection can leave its imprint on genome-wide polymorphism patterns, contrary to expectations that selection results only in a local signature of variation. PMID:17907810

  19. Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

  20. Nucleotide sequences encoding a thermostable alkaline protease


    Wilson, David B.; Lao, Guifang


    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

  1. Nucleotide sequences encoding a thermostable alkaline protease


    Wilson, D.B.; Lao, G.


    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

  2. Single nucleotide polymorphism discovery in barley using autoSNPdb.


    Duran, Chris; Appleby, Nikki; Vardy, Megan; Imelfort, Michael; Edwards, David; Batley, Jacqueline


    Molecular markers are used to provide the link between genotype and phenotype, for the production of molecular genetic maps and to assess genetic diversity within and between related species. Single nucleotide polymorphisms (SNPs) are the most abundant molecular genetic marker. SNPs can be identified in silico, but care must be taken to ensure that the identified SNPs reflect true genetic variation and are not a result of errors associated with DNA sequencing. The SNP detection method autoSNP has been developed to identify SNPs from sequence data for any species. Confidence in the predicted SNPs is based on sequence redundancy, and haplotype co-segregation scores are calculated for a further independent measure of confidence. We have extended the autoSNP method to produce autoSNPdb, which integrates SNP and gene annotation information with a graphical viewer. We have applied this software to public barley expressed sequences, and the resulting database is available over the Internet. SNPs can be viewed and searched by sequence, functional annotation or predicted synteny with a reference genome, in this case rice. The correlation between SNPs and barley cultivar, expressed tissue type and development stage has been collated for ease of exploration. An average of one SNP per 240 bp was identified, with SNPs more prevalent in the 5' regions and simple sequence repeat (SSR) flanking sequences. Overall, autoSNPdb can provide a wealth of genetic polymorphism information for any species for which sequence data are available. PMID:19386041

  3. Long-range correlations in nucleotide sequences

    NASA Astrophysics Data System (ADS)

    Peng, C.-K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Sciortino, F.; Simons, M.; Stanley, H. E.


    DNA SEQUENCES have been analysed using models, such as an it-step Markov chain, that incorporate the possibility of short-range nucleotide correlations1. We propose here a method for studying the stochastic properties of nucleotide sequences by constructing a 1:1 map of the nucleotide sequence onto a walk, which we term a 'DNA walk'. We then use the mapping to provide a quantitative measure of the correlation between nucleotides over long distances along the DNA chain. Thus we uncover in the nucleotide sequence a remarkably long-range power law correlation that implies a new scale-invariant property of DNA. We find such long-range correlations in intron-containing genes and in nontranscribed regulatory DNA sequences, but not in complementary DNA sequences or intron-less genes.

  4. Long-range correlations in nucleotide sequences

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Sciortino, F.; Simons, M.; Stanley, H. E.


    DNA sequences have been analysed using models, such as an n-step Markov chain, that incorporate the possibility of short-range nucleotide correlations. We propose here a method for studying the stochastic properties of nucleotide sequences by constructing a 1:1 map of the nucleotide sequence onto a walk, which we term a 'DNA walk'. We then use the mapping to provide a quantitative measure of the correlation between nucleotides over long distances along the DNA chain. Thus we uncover in the nucleotide sequence a remarkably long-range power law correlation that implies a new scale-invariant property of DNA. We find such long-range correlations in intron-containing genes and in nontranscribed regulatory DNA sequences, but not in complementary DNA sequences or intron-less genes.

  5. Electroanalysis of single-nucleotide polymorphism by hairpin DNA architectures.


    Abi, Alireza; Ferapontova, Elena E


    Genetic analysis of infectious and genetic diseases and cancer diagnostics require the development of efficient tools for fast and reliable analysis of single-nucleotide polymorphism (SNP) in targeted DNA and RNA sequences often responsible for signalling disease onset. Here, we highlight the main trends in the development of electrochemical genosensors for sensitive and selective detection of SNP that are based on hairpin DNA architectures exhibiting better SNP recognition properties compared with linear DNA probes. SNP detection by electrochemical hairpin DNA beacons is discussed, and comparative analysis of the existing SNP sensing strategies based on enzymatic and nanoparticle signal amplification schemes is presented.

  6. From Single Nucleotide Polymorphism to Transcriptional Mechanism

    PubMed Central

    Martini, Sebastian; Nair, Viji; Patel, Sanjeevkumar R.; Eichinger, Felix; Nelson, Robert G.; Weil, E. Jennifer; Pezzolesi, Marcus G.; Krolewski, Andrzej S.; Randolph, Ann; Keller, Benjamin J.; Werner, Thomas; Kretzler, Matthias


    Genome-wide association studies have proven to be highly effective at defining relationships between single nucleotide polymorphisms (SNPs) and clinical phenotypes in complex diseases. Establishing a mechanistic link between a noncoding SNP and the clinical outcome is a significant hurdle in translating associations into biological insight. We demonstrate an approach to assess the functional context of a diabetic nephropathy (DN)-associated SNP located in the promoter region of the gene FRMD3. The approach integrates pathway analyses with transcriptional regulatory pattern-based promoter modeling and allows the identification of a transcriptional framework affected by the DN-associated SNP in the FRMD3 promoter. This framework provides a testable hypothesis for mechanisms of genomic variation and transcriptional regulation in the context of DN. Our model proposes a possible transcriptional link through which the polymorphism in the FRMD3 promoter could influence transcriptional regulation within the bone morphogenetic protein (BMP)-signaling pathway. These findings provide the rationale to interrogate the biological link between FRMD3 and the BMP pathway and serve as an example of functional genomics-based hypothesis generation. PMID:23434934

  7. Genetic epidemiology of single-nucleotide polymorphisms.


    Collins, A; Lonjou, C; Morton, N E


    On the causal hypothesis, most genetic determinants of disease are single-nucleotide polymorphisms (SNPs) that are likely to be selected as markers for positional cloning. On the proximity hypothesis, most disease determinants will not be included among markers but may be detected through linkage disequilibrium with other SNPs. In that event, allelic association among SNPs is an essential factor in positional cloning. Recent simulation based on monotonic population expansion suggests that useful association does not usually extend beyond 3 kb. This is contradicted by significant disequilibrium at much greater distances, with corresponding reduction in the number of SNPs required for a cost-effective genome scan. A plausible explanation is that cyclical expansions follow population bottlenecks that establish new disequilibria. Data on more than 1,000 locus pairs indicate that most disequilibria trace to the Neolithic, with no apparent difference between haplotypes that are random or selected through a major disease gene. Short duration may be characteristic of alleles contributing to disease susceptibility and haplotypes characteristic of particular ethnic groups. Alleles that are highly polymorphic in all ethnic groups may be older, neutral, or advantageous, in weak disequilibrium with nearby markers, and therefore less useful for positional cloning of disease genes. Significant disequilibrium at large distance makes the number of suitably chosen SNPs required for genome screening as small as 30,000, or 1 per 100 kb, with greater density (including less common SNPs) reserved for candidate regions.

  8. Y-Single Nucleotide Polymorphisms Diversity in Chinese Indigenous Horse.


    Han, Haoyuan; Zhang, Qin; Gao, Kexin; Yue, Xiangpeng; Zhang, Tao; Dang, Ruihua; Lan, Xianyong; Chen, Hong; Lei, Chuzhao


    In contrast to high genetic diversity of mitochondrial DNA (mtDNA), equine Y chromosome shows extremely low variability, implying limited patrilines in the domesticated horse. In this study, we applied direct sequencing and restriction fragment length polymorphism (RFLP) methods to investigate the polymorphisms of 33 Y chromosome specific loci in 304 Chinese indigenous horses from 13 breeds. Consequently, two Y-single nucleotide polymorphisms (SNPs) (Y-45701/997 and Y-50869) and one Y-indel (Y-45288) were identified. Of those, the Y-50869 (T>A) revealed the highest variation frequency (24.67%), whereas it was only 3.29% and 1.97% in Y-45288 (T/-) and Y-45701/997 (G>T) locus, respectively. These three mutations accounted for 27.96% of the total samples and identified five Y-SNP haplotypes, demonstrating genetic diversity of Y chromosome in Chinese horses. In addition, all the five Y-SNP haplotypes were shared by different breeds. Among 13 horse breeds analyzed, Balikun horse displayed the highest nucleotide diversity (π = 5.6×10(-4)) and haplotype diversity (h = 0.527), while Ningqiang horse showed the lowest nucleotide diversity (π = 0.00000) and haplotype diversity (h = 0.000). The results also revealed that Chinese horses had a different polymorphic pattern of Y chromosome from European and American horses. In conclusion, Chinese horses revealed genetic diversity of Y chromosome, however more efforts should be made to better understand the domestication and paternal origin of Chinese indigenous horses.

  9. Y-Single Nucleotide Polymorphisms Diversity in Chinese Indigenous Horse

    PubMed Central

    Han, Haoyuan; Zhang, Qin; Gao, Kexin; Yue, Xiangpeng; Zhang, Tao; Dang, Ruihua; Lan, Xianyong; Chen, Hong; Lei, Chuzhao


    In contrast to high genetic diversity of mitochondrial DNA (mtDNA), equine Y chromosome shows extremely low variability, implying limited patrilines in the domesticated horse. In this study, we applied direct sequencing and restriction fragment length polymorphism (RFLP) methods to investigate the polymorphisms of 33 Y chromosome specific loci in 304 Chinese indigenous horses from 13 breeds. Consequently, two Y-single nucleotide polymorphisms (SNPs) (Y-45701/997 and Y-50869) and one Y-indel (Y-45288) were identified. Of those, the Y-50869 (T>A) revealed the highest variation frequency (24.67%), whereas it was only 3.29% and 1.97% in Y-45288 (T/-) and Y-45701/997 (G>T) locus, respectively. These three mutations accounted for 27.96% of the total samples and identified five Y-SNP haplotypes, demonstrating genetic diversity of Y chromosome in Chinese horses. In addition, all the five Y-SNP haplotypes were shared by different breeds. Among 13 horse breeds analyzed, Balikun horse displayed the highest nucleotide diversity (π = 5.6×10−4) and haplotype diversity (h = 0.527), while Ningqiang horse showed the lowest nucleotide diversity (π = 0.00000) and haplotype diversity (h = 0.000). The results also revealed that Chinese horses had a different polymorphic pattern of Y chromosome from European and American horses. In conclusion, Chinese horses revealed genetic diversity of Y chromosome, however more efforts should be made to better understand the domestication and paternal origin of Chinese indigenous horses. PMID:26104513

  10. Characterization of 22 novel single nucleotide polymorphism markers in steelhead and rainbow trout

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Thirty-two individuals representing coastal and inland populations of steelhead and rainbow trout (Oncorhynchus mykiss) were sequenced at 15 ESTs and 9 microsatellite loci to identify single nucleotide polymorphisms (SNPs). Sixty-two polymorphisms were discovered during the screen and 13 were devel...

  11. Single nucleotide polymorphism analysis using different colored dye dimer probes

    NASA Astrophysics Data System (ADS)

    Marmé, Nicole; Friedrich, Achim; Denapaite, Dalia; Hakenbeck, Regine; Knemeyer, Jens-Peter


    Fluorescence quenching by dye dimer formation has been utilized to develop hairpin-structured DNA probes for the detection of a single nucleotide polymorphism (SNP) in the penicillin target gene pbp2x, which is implicated in the penicillin resistance of Streptococcus pneumoniae. We designed two specific DNA probes for the identification of the pbp2x genes from a penicillin susceptible strain R6 and a resistant strain Streptococcus mitis 661 using green-fluorescent tetramethylrhodamine (TMR) and red-fluorescent DY-636, respectively. Hybridization of each of the probes to its respective target DNA sequence opened the DNA hairpin probes, consequently breaking the nonfluorescent dye dimers into fluorescent species. This hybridization of the target with the hairpin probe achieved single nucleotide specific detection at nanomolar concentrations via increased fluorescence.

  12. Single Nucleotide Polymorphisms and Linkage Disequilibrium in Sunflower

    PubMed Central

    Kolkman, Judith M.; Berry, Simon T.; Leon, Alberto J.; Slabaugh, Mary B.; Tang, Shunxue; Gao, Wenxiang; Shintani, David K.; Burke, John M.; Knapp, Steven J.


    Genetic diversity in modern sunflower (Helianthus annuus L.) cultivars (elite oilseed inbred lines) has been shaped by domestication and breeding bottlenecks and wild and exotic allele introgression−the former narrowing and the latter broadening genetic diversity. To assess single nucleotide polymorphism (SNP) frequencies, nucleotide diversity, and linkage disequilibrium (LD) in modern cultivars, alleles were resequenced from 81 genic loci distributed throughout the sunflower genome. DNA polymorphisms were abundant; 1078 SNPs (1/45.7 bp) and 178 insertions-deletions (INDELs) (1/277.0 bp) were identified in 49.4 kbp of DNA/genotype. SNPs were twofold more frequent in noncoding (1/32.1 bp) than coding (1/62.8 bp) sequences. Nucleotide diversity was only slightly lower in inbred lines (θ = 0.0094) than wild populations (θ = 0.0128). Mean haplotype diversity was 0.74. When extraploted across the genome (∼3500 Mbp), sunflower was predicted to harbor at least 76.4 million common SNPs among modern cultivar alleles. LD decayed more slowly in inbred lines than wild populations (mean LD declined to 0.32 by 5.5 kbp in the former, the maximum physical distance surveyed), a difference attributed to domestication and breeding bottlenecks. SNP frequencies and LD decay are sufficient in modern sunflower cultivars for very high-density genetic mapping and high-resolution association mapping. PMID:17660563

  13. Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina).


    Ferber, Steven; Reusch, Thorsten B H; Stam, Wytze T; Olsen, Jeanine L


    We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database (V1.2.1). SNP loci were genotyped using a single-base-extension approach which facilitated high-throughput genotyping with minimal optimization time. These markers show a wide range of variability among 25 eelgrass populations and will be useful for population genetic studies including evaluation of population structure, historical demography, and phylogeography. Potential applications include haplotype inference of physically linked SNPs and identification of genes under selection for temperature and desiccation stress.

  14. Novel microsatellite markers and single nucleotide polymorphisms refine the tylosis with oesophageal cancer (TOC) minimal region on 17q25 to 42.5 kb: sequencing does not identify the causative gene.


    Langan, Joanne E; Cole, Charlotte G; Huckle, Elisabeth J; Byrne, Shaun; McRonald, Fiona E; Rowbottom, Lynn; Ellis, Anthony; Shaw, Joan M; Leigh, Irene M; Kelsell, David P; Dunham, Ian; Field, John K; Risk, Janet M


    Tylosis (focal non-epidermolytic palmoplantar keratoderma) is associated with the early onset of squamous cell oesophageal cancer in three families. Linkage and haplotype analyses have previously mapped the tylosis with oesophageal cancer ( TOC) locus to a 500-kb region on chromosome 17q25 that has also been implicated in sporadically occurring squamous cell oesophageal cancer. In the current study, 17 additional putative microsatellite markers were identified within this 500-kb region by using sequence data and seven of these were shown to be polymorphic in the UK and US families. In addition, our complete sequence analysis of the non-repetitive parts of the TOC minimal region identified 53 novel and six known single nucleotide polymorphisms (SNPs) in one or both of these families. Further fine mapping of the TOC disease locus by haplotype analysis of the seven polymorphic markers and 21 of the 59 SNPs allowed the reduction of the minimal region to 42.5 kb. One known and two putative genes are located within this region but none of these genes shows tylosis-specific mutations within their protein-coding regions. Alternative mechanisms of disease gene action must therefore be considered.

  15. Discovery of nucleotide polymorphisms in the Musa gene pool by Ecotilling.


    Till, Bradley J; Jankowicz-Cieslak, Joanna; Sági, László; Huynh, Owen A; Utsushi, Hiroe; Swennen, Rony; Terauchi, Ryohei; Mba, Chikelu


    Musa (banana and plantain) is an important genus for the global export market and in local markets where it provides staple food for approximately 400 million people. Hybridization and polyploidization of several (sub)species, combined with vegetative propagation and human selection have produced a complex genetic history. We describe the application of the Ecotilling method for the discovery and characterization of nucleotide polymorphisms in diploid and polyploid accessions of Musa. We discovered over 800 novel alleles in 80 accessions. Sequencing and band evaluation shows Ecotilling to be a robust and accurate platform for the discovery of polymorphisms in homologous and homeologous gene targets. In the process of validating the method, we identified two single nucleotide polymorphisms that may be deleterious for the function of a gene putatively important for phototropism. Evaluation of heterozygous polymorphism and haplotype blocks revealed a high level of nucleotide diversity in Musa accessions. We further applied a strategy for the simultaneous discovery of heterozygous and homozygous polymorphisms in diploid accessions to rapidly evaluate nucleotide diversity in accessions of the same genome type. This strategy can be used to develop hypotheses for inheritance patterns of nucleotide polymorphisms within and between genome types. We conclude that Ecotilling is suitable for diversity studies in Musa, that it can be considered for functional genomics studies and as tool in selecting germplasm for traditional and mutation breeding approaches.

  16. Discovery of nucleotide polymorphisms in the Musa gene pool by Ecotilling.


    Till, Bradley J; Jankowicz-Cieslak, Joanna; Sági, László; Huynh, Owen A; Utsushi, Hiroe; Swennen, Rony; Terauchi, Ryohei; Mba, Chikelu


    Musa (banana and plantain) is an important genus for the global export market and in local markets where it provides staple food for approximately 400 million people. Hybridization and polyploidization of several (sub)species, combined with vegetative propagation and human selection have produced a complex genetic history. We describe the application of the Ecotilling method for the discovery and characterization of nucleotide polymorphisms in diploid and polyploid accessions of Musa. We discovered over 800 novel alleles in 80 accessions. Sequencing and band evaluation shows Ecotilling to be a robust and accurate platform for the discovery of polymorphisms in homologous and homeologous gene targets. In the process of validating the method, we identified two single nucleotide polymorphisms that may be deleterious for the function of a gene putatively important for phototropism. Evaluation of heterozygous polymorphism and haplotype blocks revealed a high level of nucleotide diversity in Musa accessions. We further applied a strategy for the simultaneous discovery of heterozygous and homozygous polymorphisms in diploid accessions to rapidly evaluate nucleotide diversity in accessions of the same genome type. This strategy can be used to develop hypotheses for inheritance patterns of nucleotide polymorphisms within and between genome types. We conclude that Ecotilling is suitable for diversity studies in Musa, that it can be considered for functional genomics studies and as tool in selecting germplasm for traditional and mutation breeding approaches. PMID:20589365

  17. Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli 0157:H7

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Escherichia coli O157:H7 is a zoonotic human pathogen for which cattle are an important reservoir host. Using both previously published and new sequencing data, a 48-locus single nucleotide polymorphism (SNP) based typing panel was developed that redundantly identified eleven genogroups that span ...

  18. Subtyping of Salmonella enterica subspecies I using single nucleotide polymorphisms in adenylate cyclase (cyaA)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Methods to rapidly identify serotypes of Salmonella enterica subspecies I are of vital importance for protecting the safety of food. To supplement the serotyping method dkgB-linked intergenic sequence ribotyping (ISR), single nucleotide polymorphisms (SNPs) were characterized within adenylate cyclas...

  19. High-throughput pyrosequencing for analysis of single-nucleotide polymorphisms

    NASA Astrophysics Data System (ADS)

    Ronaghi, Mostafa


    Pyrosequencing is a DNA sequencing technique that takes advantage of the cooperativity of four enzymes in a single- tube to determine the nucleotide composition of a DNA fragment in real-time. In this manuscript we describe the methodology and the use of this technology for analysis of single nucleotide polymorphisms, although, this technique has also been used for sequence determination of difficult secondary structures, mutation detection, EST sequencing, virus and bacteria typing, and re-sequencing of disease genes. Recent break-through has enabled long read data up to 200 nucleotides to be obtained in a single run. Automated microtiter plate based Pyrosequencing systems have been developed allowing DNA analyses of between 5000 to 50,000 samples per day. We are now miniaturizing this technique to reduce the cost for sequencing by at least two order of magnitudes. The array format proofs the feasibility of this system for DNA sequencing.

  20. Complete Nucleotide Sequence of Tn10

    PubMed Central

    Chalmers, Ronald; Sewitz, Sven; Lipkow, Karen; Crellin, Paul


    The complete nucleotide sequence of Tn10 has been determined. The dinucleotide signature and percent G+C of the sequence had no discontinuities, indicating that Tn10 constitutes a homogeneous unit. The new sequence contained three new open reading frames corresponding to a glutamate permease, repressors of heavy metal resistance operons, and a hypothetical protein in Bacillus subtilis. The glutamate permease was fully functional when expressed, but Tn10 did not protect Escherichia coli from the toxic effects of various metals. PMID:10781570

  1. Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.


    Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

  2. Targeted Amplicon Sequencing for Single-Nucleotide-Polymorphism Genotyping of Attaching and Effacing Escherichia coli O26:H11 Cattle Strains via a High-Throughput Library Preparation Technique.


    Ison, Sarah A; Delannoy, Sabine; Bugarel, Marie; Nagaraja, Tiruvoor G; Renter, David G; den Bakker, Henk C; Nightingale, Kendra K; Fach, Patrick; Loneragan, Guy H


    Enterohemorrhagic Escherichia coli (EHEC) O26:H11, a serotype within Shiga toxin-producing E. coli (STEC) that causes severe human disease, has been considered to have evolved from attaching and effacing E. coli (AEEC) O26:H11 through the acquisition of a Shiga toxin-encoding gene. Targeted amplicon sequencing using next-generation sequencing technology of 48 phylogenetically informative single-nucleotide polymorphisms (SNPs) and three SNPs differentiating Shiga toxin-positive (stx-positive) strains from Shiga toxin-negative (stx-negative) strains were used to infer the phylogenetic relationships of 178 E. coli O26:H11 strains (6 stx-positive strains and 172 stx-negative AEEC strains) from cattle feces to 7 publically available genomes of human clinical strains. The AEEC cattle strains displayed synonymous SNP genotypes with stx2-positive sequence type 29 (ST29) human O26:H11 strains, while stx1 ST21 human and cattle strains clustered separately, demonstrating the close phylogenetic relatedness of these Shiga toxin-negative AEEC cattle strains and human clinical strains. With the exception of seven stx-negative strains, five of which contained espK, three stx-related SNPs differentiated the STEC strains from non-STEC strains, supporting the hypothesis that these AEEC cattle strains could serve as a potential reservoir for new or existing pathogenic human strains. Our results support the idea that targeted amplicon sequencing for SNP genotyping expedites strain identification and genetic characterization of E. coli O26:H11, which is important for food safety and public health.

  3. Targeted Amplicon Sequencing for Single-Nucleotide-Polymorphism Genotyping of Attaching and Effacing Escherichia coli O26:H11 Cattle Strains via a High-Throughput Library Preparation Technique

    PubMed Central

    Delannoy, Sabine; Bugarel, Marie; Nagaraja, Tiruvoor G.; Renter, David G.; den Bakker, Henk C.; Nightingale, Kendra K.; Fach, Patrick; Loneragan, Guy H.


    Enterohemorrhagic Escherichia coli (EHEC) O26:H11, a serotype within Shiga toxin-producing E. coli (STEC) that causes severe human disease, has been considered to have evolved from attaching and effacing E. coli (AEEC) O26:H11 through the acquisition of a Shiga toxin-encoding gene. Targeted amplicon sequencing using next-generation sequencing technology of 48 phylogenetically informative single-nucleotide polymorphisms (SNPs) and three SNPs differentiating Shiga toxin-positive (stx-positive) strains from Shiga toxin-negative (stx-negative) strains were used to infer the phylogenetic relationships of 178 E. coli O26:H11 strains (6 stx-positive strains and 172 stx-negative AEEC strains) from cattle feces to 7 publically available genomes of human clinical strains. The AEEC cattle strains displayed synonymous SNP genotypes with stx2-positive sequence type 29 (ST29) human O26:H11 strains, while stx1 ST21 human and cattle strains clustered separately, demonstrating the close phylogenetic relatedness of these Shiga toxin-negative AEEC cattle strains and human clinical strains. With the exception of seven stx-negative strains, five of which contained espK, three stx-related SNPs differentiated the STEC strains from non-STEC strains, supporting the hypothesis that these AEEC cattle strains could serve as a potential reservoir for new or existing pathogenic human strains. Our results support the idea that targeted amplicon sequencing for SNP genotyping expedites strain identification and genetic characterization of E. coli O26:H11, which is important for food safety and public health. PMID:26567298

  4. On signal sequence polymorphisms and diseases of distribution.

    PubMed Central

    Rosenblum, J S; Gilula, N B; Lerner, R A


    We report a previously unappreciated property of the signals that target organelle-specific proteins to their subcellular sites of action. Such targeting sequences are shown to be polymorphic. We discovered this polymorphism when we cloned the mitochondrial manganese-containing superoxide dismutase from cell lines of normal individuals and patients with genetic diseases of premature aging and compared their sequences to each other and to those previously reported. The polymorphism consists of a single nucleotide change in the region of the DNA that encodes the signal sequence such that either an alanine or valine is present. Subsequently, eight cell lines were analyzed and all three possible combinations of the two signal sequences were observed. Such signal sequence polymorphisms could result in diseases of distribution, where essential proteins are not properly targeted, thereby leading to absolute or relative deficiencies of critical enzymes within specific cellular compartments. Progeria and related syndromes may be diseases of distribution. Images Fig. 1 Fig. 2 PMID:8633092

  5. Single nucleotide polymorphism markers for genetic mapping in Drosophila melanogaster

    SciTech Connect

    Hoskins, Roger A.; Phan, Alexander C.; Naeemuddin, Mohammed; Mapa, Felipa A.; Ruddy, David A.; Ryan, Jessica J.; Young, Lynn M.; Wells, Trent; Kopczynski, Casey; Ellis, Michael C.


    For nearly a century, genetic analysis in Drosophila melanogaster has been a powerful tool for analyzing gene function, yet Drosophila lacks the molecular genetic mapping tools that have recently revolutionized human, mouse and plant genetics. Here, we describe the systematic characterization of a dense set of molecular markers in Drosophila using an STS-based physical map of the genome. We identify 474 biallelic markers in standard laboratory strains of Drosophila that the genome. The majority of these markers are single nucleotide polymorphisms (SNPs) and sequences for these variants are provided in an accessible format. The average density of the new markers is 1 marker per 225 kb on the autosomes and 1 marker per 1 Mb on the X chromosome. We include in this survey a set of P-element strains that provide additional utility for high-resolution mapping. We demonstrate one application of the new markers in a simple set of crosses to map a mutation in the hedgehog gene to an interval of <1 Mb. This new map resource significantly increases the efficiency and resolution of recombination mapping and will be of immediate value to the Drosophila research community.

  6. Single nucleotide polymorphisms of Kit gene in Chinese indigenous horses.


    Han, Haoyuan; Mao, Chunchun; Chen, Ningbo; Lan, Xianyong; Chen, Hong; Lei, Chuzhao; Dang, Ruihua


    Kit gene is a genetic determinant of horse white coat color which has been a highly valued trait in horses for at least 2,000 years. Single nucleotide polymorphisms (SNPs) in Kit are of importance due to their strong associations with melanoblast survival during embryonic development. In this study, a mutation analysis of all 21 Kit exons in 14 Chinese domestic horse breeds revealed six SNPs (g.91214T>G, g.143245T>G, g.164297C>T, g.170189C>T, g.171356C>G, and g.171471G>A), which located in 5'-UTR region, intron 6, exon 15, exon 20, intron 20, and exon 21 of the equine Kit gene, respectively. Subsequently, these six SNPs loci were genotyped in 632 Chinese horses by PCR-RFLP or direct sequencing. The six SNPs together defined 18 haplotypes, demonstrating abundant haplotype diversities in Chinese horses. All the mutant alleles and haplotypes were shared among different breeds. But fewer mutations were detected in horses from China than that from abroad, indicating that Chinese horses belong to a more ancient genetic pool. This study will provide fundamental genetic information for evaluating the genetic diversity of Kit gene in Chinese indigenous horse breeds.

  7. Single nucleotide polymorphisms of Kit gene in Chinese indigenous horses.


    Han, Haoyuan; Mao, Chunchun; Chen, Ningbo; Lan, Xianyong; Chen, Hong; Lei, Chuzhao; Dang, Ruihua


    Kit gene is a genetic determinant of horse white coat color which has been a highly valued trait in horses for at least 2,000 years. Single nucleotide polymorphisms (SNPs) in Kit are of importance due to their strong associations with melanoblast survival during embryonic development. In this study, a mutation analysis of all 21 Kit exons in 14 Chinese domestic horse breeds revealed six SNPs (g.91214T>G, g.143245T>G, g.164297C>T, g.170189C>T, g.171356C>G, and g.171471G>A), which located in 5'-UTR region, intron 6, exon 15, exon 20, intron 20, and exon 21 of the equine Kit gene, respectively. Subsequently, these six SNPs loci were genotyped in 632 Chinese horses by PCR-RFLP or direct sequencing. The six SNPs together defined 18 haplotypes, demonstrating abundant haplotype diversities in Chinese horses. All the mutant alleles and haplotypes were shared among different breeds. But fewer mutations were detected in horses from China than that from abroad, indicating that Chinese horses belong to a more ancient genetic pool. This study will provide fundamental genetic information for evaluating the genetic diversity of Kit gene in Chinese indigenous horse breeds. PMID:27348891

  8. Discovery of nucleotide polymorphisms in the Musa gene pool by Ecotilling

    PubMed Central

    Jankowicz-Cieslak, Joanna; Sági, László; Huynh, Owen A.; Utsushi, Hiroe; Swennen, Rony; Terauchi, Ryohei; Mba, Chikelu


    Musa (banana and plantain) is an important genus for the global export market and in local markets where it provides staple food for approximately 400 million people. Hybridization and polyploidization of several (sub)species, combined with vegetative propagation and human selection have produced a complex genetic history. We describe the application of the Ecotilling method for the discovery and characterization of nucleotide polymorphisms in diploid and polyploid accessions of Musa. We discovered over 800 novel alleles in 80 accessions. Sequencing and band evaluation shows Ecotilling to be a robust and accurate platform for the discovery of polymorphisms in homologous and homeologous gene targets. In the process of validating the method, we identified two single nucleotide polymorphisms that may be deleterious for the function of a gene putatively important for phototropism. Evaluation of heterozygous polymorphism and haplotype blocks revealed a high level of nucleotide diversity in Musa accessions. We further applied a strategy for the simultaneous discovery of heterozygous and homozygous polymorphisms in diploid accessions to rapidly evaluate nucleotide diversity in accessions of the same genome type. This strategy can be used to develop hypotheses for inheritance patterns of nucleotide polymorphisms within and between genome types. We conclude that Ecotilling is suitable for diversity studies in Musa, that it can be considered for functional genomics studies and as tool in selecting germplasm for traditional and mutation breeding approaches. Electronic supplementary material The online version of this article (doi:10.1007/s00122-010-1395-5) contains supplementary material, which is available to authorized users. PMID:20589365

  9. Genomic reduction assisted single nucleotide polymorphism discovery using 454-pyrosequencing.


    Maughan, Peter J; Udall, Joshua A; Jellen, Eric N


    We report the development of a simple genomic reduction protocol based on 454-pyrosequencing technology that discovers large numbers of single nucleotide polymorphisms (SNP) from pooled DNA samples. The method is based on the conservation of restriction endonuclease sites across samples and biotin separation for genomic reduction and the addition of multiplex identifier (MID) barcodes to each of the pooled samples to allow for postsequencing deconvolution of the pooled DNA fragments and SNP discovery. PMID:25373757

  10. Polymorphix: a sequence polymorphism database.


    Bazin, Eric; Duret, Laurent; Penel, Simon; Galtier, Nicolas


    Within-species sequence variation data are of special interest since they contain information about recent population/species history, and the molecular evolutionary forces currently in action in natural populations. These data, however, are presently dispersed within generalist databases, and are difficult to access. To solve this problem, we have developed Polymorphix, a database dedicated to sequence polymorphism. It contains within-species homologous sequence families built using EMBL/GenBank under suitable similarity and bibliographic criteria. Polymorphix is an ACNUC structured database allowing both simple and complex queries for population genomic studies. Alignments within families as well as phylogenetic trees can be download. When available, outgroups are included in the alignment. Polymorphix contains sequences from the nuclear, mitochondrial and chloroplastic genomes of every eukaryote species represented in EMBL. It can be accessed by a web interface (

  11. A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

  12. Network analysis of single nucleotide polymorphisms in asthma

    PubMed Central

    Renkonen, Jutta; Joenväärä, Sakari; Parviainen, Ville; Mattila, Pirkko; Renkonen, Risto


    Background: Asthma is a chronic inflammatory disease of the airways with a complex genetic background. In this study, we carried out a meta-analysis of single nucleotide polymorphisms (SNPs) thought to be associated with asthma. Methods: The literature (PubMed) was searched for SNPs within genes relevant in asthma. The SNP-modified genes were converted to corresponding proteins, and their protein–protein interactions were searched from six different databases. This interaction network was analyzed using annotated vocabularies (ontologies), such as the Gene Ontology and Nature pathway interaction databases. Results: In total, 127 genes with SNPs related to asthma were found in the literature. The corresponding proteins were then entered into a large protein–protein interaction network with the help of various databases. Ninety-six SNP-related proteins had more than one interacting protein each, and a network containing 309 proteins and 644 connections was generated. This network was significantly enriched with a gene ontology entitled “protein binding” and several of its daughter categories, including receptor binding and cytokine binding, when compared with the background human proteome. In the detailed analysis, the chemokine network, including eight proteins and 13 toll-like receptors, were shown to interact with each other. Of great interest are the nonsynonymous SNPs which code for an alternative amino acid sequence of proteins and, of the toll-like receptor network, TLR1, TLR4, TLR5, TLR6, TLR10, IL4R, and IL13 are among these. Conclusions: Protein binding, toll-like receptors, and chemokines dominated in the asthma-related protein interaction network. Systems level analysis of allergy-related mutations can provide new insights into the pathogenetic mechanisms of disease. PMID:21437052

  13. A new single nucleotide polymorphism in the ryanodine gene of chicken skeletal muscle.


    Droval, A A; Binneck, E; Marin, S R R; Paião, F G; Oba, A; Nepomuceno, A L; Shimokomaki, M


    Some genes affect meat quality in chickens. We looked for polymorphisms in the Gallus gallus α-RyR gene (homologous to RyR 1) that could be associated with PSE (pale, soft and exudative) meat. Because RyR genes are over 100,000 bp long and code for proteins with about 5000 amino acids, primers were designed to amplify a fragment of hotspot region 2, a region with a high density of mutations in other species. Total blood DNA was extracted from 50 birds, 25 that had PSE meat and 25 normal chickens. The DNA samples were amplified by PCR, cloned, sequenced, and used to identify single nucleotide polymorphisms (SNPs). The amplified fragment of α-RyR was 604 nucleotides in length; 181 nucleotides were similar to two exons from a hypothetical turkey cDNA sequence for α-RyR. A non-synonymous nucleotide substitution (G/A) was identified in at least one of the three sequenced clones obtained from nine animals, six PSE (HAL+) birds and three normal (HAL-) birds; they were heterozygous for this mutation. This SNP causes a change from Val to Met in the α-RYR protein. Since the frequencies of this SNP were not significantly different in the PSE versus normal chickens, it appears that this mutation (in heterozygosity) does not alter the structure or function of the muscle protein, making it an inappropriate candidate as a genetic marker for PSE meat.

  14. Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

    SciTech Connect

    Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A. . E-mail:


    Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes.

  15. Allele-specific qRT-PCR demonstrates superior detection of single nucleotide polymorphisms as genetic markers for West Nile virus compared to Luminex® and quantitative sequencing.


    Worwa, Gabriella; Andrade, Christy C; Thiemann, Tara C; Park, Bborie; Maharaj, Payal D; Anishchenko, Michael; Brault, Aaron C; Reisen, William K


    To enable in vivo and in vitro competitive fitness comparisons among West Nile viruses (WNV), three reference viruses were marked genetically by site-directed mutagenesis with five synonymous nucleotide substitutions in the envelope gene region of the genome. Phenotypic neutrality of the mutants was assessed experimentally by competitive replication in cell culture and genetic stability of the substituted nucleotides was confirmed by direct sequencing. Luminex(®) technology, quantitative sequencing and quantitative RT-PCR (qRT-PCR) were compared in regard to specificity, sensitivity and accuracy for quantitation of wildtype and genetically marked viruses in mixed samples based on RNA obtained from samples of known viral titers. Although Luminex(®) technology and quantitative sequencing provided semi-quantitative or qualitative measurements, a sequence-specific primer extension approach using a specific reverse primer set in singleplex qRT-PCR demonstrated the best quantitation and specificity in the detection of RNA from wildtype and mutant viruses.

  16. Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

  17. Computational Analysis of Single Nucleotide Polymorphisms Associated with Altered Drug Responsiveness in Type 2 Diabetes

    PubMed Central

    Costa, Valerio; Federico, Antonio; Pollastro, Carla; Ziviello, Carmela; Cataldi, Simona; Formisano, Pietro; Ciccodicola, Alfredo


    Type 2 diabetes (T2D) is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9) or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG). However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP), currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing. PMID:27347941

  18. Computational Analysis of Single Nucleotide Polymorphisms Associated with Altered Drug Responsiveness in Type 2 Diabetes.


    Costa, Valerio; Federico, Antonio; Pollastro, Carla; Ziviello, Carmela; Cataldi, Simona; Formisano, Pietro; Ciccodicola, Alfredo


    Type 2 diabetes (T2D) is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9) or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG). However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene-currently annotated as intronic-fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP), currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing. PMID:27347941

  19. Single nucleotide polymorphism analysis reveals heterogeneity within a seedling tree population of a polyembryonic mango cultivar.


    Winterhagen, Patrick; Wünsche, Jens-Norbert


    Within a polyembryonic mango seedling tree population, the genetic background of individuals should be identical because vigorous plants for cultivation are expected to develop from nucellar embryos representing maternal clones. Due to the fact that the mango cultivar 'Hôi' is assigned to the polyembryonic ecotype, an intra-cultivar variability of ethylene receptor genes was unexpected. Ethylene receptors in plants are conserved, but the number of receptors or receptor isoforms is variable regarding different plant species. However, it is shown here that the ethylene receptor MiETR1 is present in various isoforms within the mango cultivar 'Hôi'. The investigation of single nucleotide polymorphisms revealed that different MiETR1 isoforms can not be discriminated simply by individual single nucleotide exchanges but by the specific arrangement of single nucleotide polymorphisms at certain positions in the exons of MiETR1. Furthermore, an MiETR1 isoform devoid of introns in the genomic sequence was identified. The investigation demonstrates some limitations of high resolution melting and ScreenClust analysis and points out the necessity of sequencing to identify individual isoforms and to determine the variability within the tree population. PMID:27093244

  20. Development and evaluation of single-nucleotide polymorphism markers in allotetraploid rapeseed (Brassica napus L.).


    Westermeier, Peter; Wenzel, Gerhard; Mohler, Volker


    Single-nucleotide polymorphisms (SNPs) and insertion-deletions (INDELs) are currently the important classes of genetic markers for major crop species. In this study, methods for developing SNP markers in rapeseed (Brassica napus L.) and their in silico mapping and use for genotyping are demonstrated. For the development of SNP and INDEL markers, 181 fragments from 121 different gene sequences spanning 86 kb were examined. A combination of different selection methods (genome-specific amplification, hetero-duplex analysis and sequence analysis) allowed the detection of 18 singular fragments that showed a total of 87 SNPs and 6 INDELs between 6 different rapeseed varieties. The average frequency of sequence polymorphism was estimated to be one SNP every 247 bp and one INDEL every 3,583 bp. Most SNPs and INDELs were found in non-coding regions. Polymorphism information content values for SNP markers ranged between 0.02 and 0.50 in a set of 86 varieties. Using comparative genetics data for B. napus and Arabidopsis thaliana, an allocation of SNP markers to linkage groups in rapeseed was achieved: a unique location was determined for seven gene sequences; two and three possible locations were found for six and four sequences, respectively. The results demonstrate the usefulness of existing genomic resources for SNP discovery in rapeseed.

  1. Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing.


    Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación


    A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R(2) = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells. PMID:27120517

  2. Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing.


    Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación


    A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R(2) = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.

  3. Current research status, databases and application of single nucleotide polymorphism.


    Javed, R; Mukesh


    Single Nucleotide Polymorphisms (SNPs) are the most frequent form of DNA variation in the genome. SNPs are genetic markers which are bi-allelic in nature and grow at a very fast rate. Current genomic databases contain information on several million SNPs. More than 6 million SNPs have been identified and the information is publicly available through the efforts of the SNP Consortium and others data bases. The NCBI plays a major role in facillating the identification and cataloging of SNPs through creation and maintenance of the public SNP database (dbSNP) by the biomedical community worldwide and stimulate many areas of biological research including the identification of the genetic components of disease. In this review article, we are compiling the existing SNP databases, research status and their application. PMID:21717869

  4. Single nucleotide polymorphisms in type 2 diabetes among Hispanic adults.


    Watson, Amanda L; Hu, Jie; Chiu, Norman H L


    In this pilot study, we explore the genetic variation that may relate to type 2 diabetes (T2D) among Hispanic adults. The genotypes of 36 Hispanic adults were analyzed by using the Cardio-Metabochip. The goal is to identify single nucleotide polymorphisms (SNPs) associated to T2D among Hispanic adults. A total of 26 SNPs were identified to be associated with T2D among Hispanic adults. None of these SNPs have been reported for T2D. By using the principle components analysis to analyze the genotype of 26 SNPs in 36 samples, the samples obtained from diabetic patients could be distinguished from the control samples. The findings support genetic involvement in T2D among Hispanic adults.

  5. Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms

    PubMed Central

    Zhang, Wei; Qi, Weihong; Albert, Thomas J.; Motiwala, Alifiya S.; Alland, David; Hyytia-Trees, Eija K.; Ribot, Efrain M.; Fields, Patricia I.; Whittam, Thomas S.; Swaminathan, Bala


    Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7 × 10−9 per site per year), we estimate that the most recent common ancestor of the contemporary β-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens. PMID:16606700

  6. Dynamic programming for single nucleotide polymorphism ID identification in systematic association studies.


    Yang, Cheng-Hong; Chuang, Li-Yeh; Cheng, Yu-Huei; Wen, Cheng-Hao; Chang, Hsueh-Wei


    Single nucleotide polymorphisms (SNPs) play an important role in personalized medicine. However, the SNP data reported in many association studies provide only the SNP nucleotide/amino acid position, without providing the SNP ID recorded in National Center for Biotechnology Information databases. A tool with the ability to provide SNP ID identification, with a user-friendly interface, is needed. In this paper, a dynamic programming algorithm was used to compare homologs when the processed input sequence is aligned with the SNP FASTA database. Our novel system provides a web-based tool that uses the National Center for Biotechnology Information dbSNP database, which provides SNP sequence identification and SNP FASTA formats. Freely selectable sequence formats for alignment can be used, including general sequence formats (ACGT, [dNTP1/dNTP2] or IUPAC formats) and orientation with bidirectional sequence matching. In contrast to the National Center for Biotechnology Information SNP-BLAST, the proposed system always provides the correct targeted SNP ID (SNP hit), as well as nearby SNPs (flanking hits), arranged in their chromosomal order and contig positions. The system also solves problems inherent in SNP-BLAST, which cannot always provide the correct SNP ID for a given input sequence. Therefore, this system constitutes a novel application which uses dynamic programming to identify SNP IDs from the literature and keyed-in sequences for systematic association studies. It is freely available at

  7. Preterm birth and single nucleotide polymorphisms in cytokine genes

    PubMed Central

    Zhu, Qin; Sun, Jian


    Preterm birth (PTB) is an important issue in neonates because of its complications as well as high morbidity and mortality. The prevalence of PTB is approximately 12-13% in USA and 5-9% in many other developed countries. China represents 7.8% (approximately one million) of 14.9 million babies born prematurely annually worldwide. The rate of PTB is still increasing. Both genetic susceptibility and environmental factors are the major causes of PTB. Inflammation is regarded as an enabling characteristic factor of PTB. The aim of this review is to summarize the current literatures to illustrate the role of single nucleotide polymorphisms (SNPs) of cytokine genes in PTB. These polymorphisms are different among different geographic regions and different races, thus different populations may have different risk factors of PTB. SNPs affect the ability to metabolize poisonous substances and determine inflammation susceptibility, which in turn has an influence on reproduction-related risks and on delivery outcomes after exposure to environmental toxicants and pathogenic organisms. PMID:26835330

  8. Development of 101 novel EST-derived single nucleotide polymorphism markers for Zhikong scallop ( Chlamys farreri)

    NASA Astrophysics Data System (ADS)

    Li, Jiqin; Bao, Zhenmin; Li, Ling; Wang, Xiaojian; Wang, Shi; Hu, Xiaoli


    Zhikong scallop ( Chlamys farreri) is an important maricultured species in China. Many researches on this species, such as population genetics and QTL fine-mapping, need a large number of molecular markers. In this study, based on the expressed sequence tags (EST), a total of 300 putative single nucleotide polymorphisms (SNPs) were selected and validated using high resolution melting (HRM) technology with unlabeled probe. Of them, 101 (33.7%) were found to be polymorphic in 48 individuals from 4 populations. Further evaluation with 48 individuals from Qingdao population showed that all the polymorphic loci had two alleles with the minor allele frequency ranged from 0.046 to 0.500. The observed and expected heterozygosities ranged from 0.000 to 0.925 and from 0.089 to 0.505, respectively. Fifteen loci deviated significantly from Hardy-Weinberg equilibrium and significant linkage disequilibrate was detected in one pair of markers. BLASTx gave significant hits for 72 of the 101 polymorphic SNP-containing ESTs. Thirty four polymorphic SNP loci were predicted to be non-synonymous substitutions as they caused either the change of codons (33 SNPs) or pretermination of translation (1 SNP). The markers developed can be used for the population studies and genetic improvement on Zhikong scallop.

  9. Nucleotide sequence of 3' untranslated portion of human alpha globin mRNA.

    PubMed Central

    Wilson, J T; deRiel, J K; Forget, B G; Marotta, C A; Weissman, S M


    We have determined the nucleotide sequence of 75 nucleotides of the 3'-untranslated portion of normal human alpha globin mRNA which corresponds to the elongated amino acid sequence of the chain termination mutant Hb Constant Spring. This was accomplished by sequence analysis of cDNA fragments obtained by restriction endonuclease or T4 endonuclease IV cleavage of human globin cDNA synthesized from globin mRNA by use of viral reverse transcriptase. Analysis of cRNA synthesized from cDNA by use of RNA polymerase provided additional confirmatory sequence information. Possible polymorphism has been identified at one site of the sequence. Our sequence overlaps with, and extends the sequence of 43 nucleotides determined by Proudfood and coworkers for the very 3'-terminal portion of human alpha globin mRNA. The complete 3'-untranslated sequence of human alpha globin mRNA (112 nucleotides including termination codon) shows little homology to that of the human or rabbit beta globin mRNAs except for the presence of the hexanucleotide sequence AAUAAA which is found in most eukaryotic mRNAs near the 3'-terminal poly (A). Images PMID:909779

  10. A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms

    SciTech Connect

    Wong, G K; Hillier, L; Brandstrom, M; Croojmans, R; Ovcharenko, I; Gordon, L; Stubbs, L; Lucas, S; Glavina, T; Kaiser, P; Gunnarsson, U; Webber, C; Overton, I


    We describe a genetic variation map for the chicken genome containing 2.8 million single nucleotide polymorphisms (SNPs), based on a comparison of the sequences of 3 domestic chickens (broiler, layer, Silkie) to their wild ancestor Red Jungle Fowl (RJF). Subsequent experiments indicate that at least 90% are true SNPs, and at least 70% are common SNPs that segregate in many domestic breeds. Mean nucleotide diversity is about 5 SNP/kb for almost every possible comparison between RJF and domestic lines, between two different domestic lines, and within domestic lines--contrary to the idea that domestic animals are highly inbred relative to their wild ancestors. In fact, most of the SNPs originated prior to domestication, and there is little to no evidence of selective sweeps for adaptive alleles on length scales of greater than 100 kb.

  11. Genotyping single nucleotide polymorphisms using different molecular beacon multiplexed within a suspended core optical fiber.


    Nguyen, Linh Viet; Giannetti, Sara; Warren-Smith, Stephen; Cooper, Alan; Selleri, Stefano; Cucinotta, Annamaria; Monro, Tanya


    We report a novel approach to genotyping single nucleotide polymorphisms (SNPs) using molecular beacons in conjunction with a suspended core optical fiber (SCF). Target DNA sequences corresponding to the wild- or mutant-type have been accurately recognized by immobilizing two different molecular beacons on the core of a SCF. The two molecular beacons differ by one base in the loop-probe and utilize different fluorescent indicators. Single-color fluorescence enhancement was obtained when the immobilized SCFs were filled with a solution containing either wild-type or mutant-type sequence (homozygous sample), while filling the immobilized SCF with solution containing both wild- and mutant-type sequences resulted in dual-color fluorescence enhancement, indicating a heterozygous sample. The genotyping was realized amplification-free and with ultra low-volume for the required DNA solution (nano-liter). This is, to our knowledge, the first genotyping device based on the combination of optical fiber and molecular beacons.

  12. Subtyping of Salmonella enterica Subspecies I Using Single-Nucleotide Polymorphisms in Adenylate Cyclase

    PubMed Central

    Abdo, Zaid; Byers, Sara Overstreet; Kriebel, Patrick; Rothrock, Michael J.


    Abstract Methods to rapidly identify serotypes of Salmonella enterica subspecies I are of vital importance for protecting the safety of food. To supplement the serotyping method dkgB-linked intergenic sequence ribotyping (ISR), single-nucleotide polymorphisms were characterized within adenylate cyclase (cyaA). The National Center for Biotechnology Information (NCBI) database had 378 cyaA sequences from S. enterica subspecies I, which included 42 unique DNA sequences and 19 different amino acid sequences. Five representative isolates, namely serotypes Typhimurium, Kentucky, Enteritidis phage type PT4, and two variants of Enteritidis phage type PT13a, were differentiated within a microsphere-based fluidics system in cyaA by allele-specific primer extension. Validation against 25 poultry-related environmental Salmonella isolates representing 11 serotypes yielded a ∼89% success rate at identifying the serotype of the isolate, and a different region could be targeted to achieve 100%. When coupled with ISR, all serotypes were differentiated. Phage lineages of serotype Enteritidis 13a and 4 were identified, and a biofilm-forming strain of PT13a was differentiated from a smooth phenotype within phage type. Comparative ranking of mutation indices to genes such as the tRNA transferases, the diguanylate cyclases, and genes used for multilocus sequence typing indicated that cyaA is an appropriate gene for assessing epidemiological trends of Salmonella because of its relative stability in nucleotide composition. PMID:27035032

  13. Pyrosequencing with di-base addition for single nucleotide polymorphism genotyping.


    Pu, Dan; Mao, Chengguang; Cui, Lunbiao; Shi, Zhiyang; Xiao, Pengfeng


    We develop color code-based pyrosequencing with di-base addition for analysis of single nucleotide polymorphisms (SNPs). When a di-base is added into the polymerization, one or several two-color code(s) containing the type and the number of incorporated nucleotides will be produced. The code information obtained in a single run is useful to genotype SNPs as each allelic variant will give a specific pattern compared to the two other variants. Special care has to be taken while designing the di-base dispensation order. Here, we present a detailed protocol for establishing sequence-specific di-base addition to avoid nonsynchronous extension at the SNP sites. By using this technology, as few as 50 copies of DNA templates were accurately sequenced. Higher signals were produced and thus a relatively lower sample amount was required. Furthermore, the read length of per flow was increased, making simultaneous identification of multiple SNPs in a single sequencing run possible. Validation of the method was performed by using templates with two SNPs covering 37 bp and with three SNPs covering 58 bp as well as 82 bp. These SNPs were successfully genotyped by using only a sequencing primer in a single PCR/sequencing run. Our results demonstrated that this technology could be potentially developed into a powerful methodology to accurately determine SNPs so as to diagnose clinical settings.

  14. Pyrosequencing with di-base addition for single nucleotide polymorphism genotyping.


    Pu, Dan; Mao, Chengguang; Cui, Lunbiao; Shi, Zhiyang; Xiao, Pengfeng


    We develop color code-based pyrosequencing with di-base addition for analysis of single nucleotide polymorphisms (SNPs). When a di-base is added into the polymerization, one or several two-color code(s) containing the type and the number of incorporated nucleotides will be produced. The code information obtained in a single run is useful to genotype SNPs as each allelic variant will give a specific pattern compared to the two other variants. Special care has to be taken while designing the di-base dispensation order. Here, we present a detailed protocol for establishing sequence-specific di-base addition to avoid nonsynchronous extension at the SNP sites. By using this technology, as few as 50 copies of DNA templates were accurately sequenced. Higher signals were produced and thus a relatively lower sample amount was required. Furthermore, the read length of per flow was increased, making simultaneous identification of multiple SNPs in a single sequencing run possible. Validation of the method was performed by using templates with two SNPs covering 37 bp and with three SNPs covering 58 bp as well as 82 bp. These SNPs were successfully genotyped by using only a sequencing primer in a single PCR/sequencing run. Our results demonstrated that this technology could be potentially developed into a powerful methodology to accurately determine SNPs so as to diagnose clinical settings. PMID:26935928

  15. Assessment of the Geographic Origins of Pinewood Nematode Isolates via Single Nucleotide Polymorphism in Effector Genes

    PubMed Central

    Figueiredo, Joana; Simões, Maria José; Gomes, Paula; Barroso, Cristina; Pinho, Diogo; Conceição, Luci; Fonseca, Luís; Abrantes, Isabel; Pinheiro, Miguel; Egas, Conceição


    The pinewood nematode, Bursaphelenchus xylophilus, is native to North America but it only causes damaging pine wilt disease in those regions of the world where it has been introduced. The accurate detection of the species and its dispersal routes are thus essential to define effective control measures. The main goals of this study were to analyse the genetic diversity among B. xylophilus isolates from different geographic locations and identify single nucleotide polymorphism (SNPs) markers for geographic origin, through a comparative transcriptomic approach. The transcriptomes of seven B. xylophilus isolates, from Continental Portugal (4), China (1), Japan (1) and USA (1), were sequenced in the next generation platform Roche 454. Analysis of effector gene transcripts revealed inter-isolate nucleotide diversity that was validated by Sanger sequencing in the genomic DNA of the seven isolates and eight additional isolates from different geographic locations: Madeira Island (2), China (1), USA (1), Japan (2) and South Korea (2). The analysis identified 136 polymorphic positions in 10 effector transcripts. Pairwise comparison of the 136 SNPs through Neighbor-Joining and the Maximum Likelihood methods and 5-mer frequency analysis with the alignment-independent bilinear multivariate modelling approach correlated the SNPs with the isolates geographic origin. Furthermore, the SNP analysis indicated a closer proximity of the Portuguese isolates to the Korean and Chinese isolates than to the Japanese or American isolates. Each geographic cluster carried exclusive alleles that can be used as SNP markers for B. xylophilus isolate identification. PMID:24391785

  16. Assessment of the geographic origins of pinewood nematode isolates via single nucleotide polymorphism in effector genes.


    Figueiredo, Joana; Simões, Maria José; Gomes, Paula; Barroso, Cristina; Pinho, Diogo; Conceição, Luci; Fonseca, Luís; Abrantes, Isabel; Pinheiro, Miguel; Egas, Conceição


    The pinewood nematode, Bursaphelenchus xylophilus, is native to North America but it only causes damaging pine wilt disease in those regions of the world where it has been introduced. The accurate detection of the species and its dispersal routes are thus essential to define effective control measures. The main goals of this study were to analyse the genetic diversity among B. xylophilus isolates from different geographic locations and identify single nucleotide polymorphism (SNPs) markers for geographic origin, through a comparative transcriptomic approach. The transcriptomes of seven B. xylophilus isolates, from Continental Portugal (4), China (1), Japan (1) and USA (1), were sequenced in the next generation platform Roche 454. Analysis of effector gene transcripts revealed inter-isolate nucleotide diversity that was validated by Sanger sequencing in the genomic DNA of the seven isolates and eight additional isolates from different geographic locations: Madeira Island (2), China (1), USA (1), Japan (2) and South Korea (2). The analysis identified 136 polymorphic positions in 10 effector transcripts. Pairwise comparison of the 136 SNPs through Neighbor-Joining and the Maximum Likelihood methods and 5-mer frequency analysis with the alignment-independent bilinear multivariate modelling approach correlated the SNPs with the isolates geographic origin. Furthermore, the SNP analysis indicated a closer proximity of the Portuguese isolates to the Korean and Chinese isolates than to the Japanese or American isolates. Each geographic cluster carried exclusive alleles that can be used as SNP markers for B. xylophilus isolate identification.

  17. Naked-eye fingerprinting of single nucleotide polymorphisms on psoriasis patients

    NASA Astrophysics Data System (ADS)

    Valentini, Paola; Marsella, Alessandra; Tarantino, Paolo; Mauro, Salvatore; Baglietto, Silvia; Congedo, Maurizio; Paolo Pompa, Pier


    We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics.We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02200f

  18. Reading biological processes from nucleotide sequences

    NASA Astrophysics Data System (ADS)

    Murugan, Anand

    Cellular processes have traditionally been investigated by techniques of imaging and biochemical analysis of the molecules involved. The recent rapid progress in our ability to manipulate and read nucleic acid sequences gives us direct access to the genetic information that directs and constrains biological processes. While sequence data is being used widely to investigate genotype-phenotype relationships and population structure, here we use sequencing to understand biophysical mechanisms. We present work on two different systems. First, in chapter 2, we characterize the stochastic genetic editing mechanism that produces diverse T-cell receptors in the human immune system. We do this by inferring statistical distributions of the underlying biochemical events that generate T-cell receptor coding sequences from the statistics of the observed sequences. This inferred model quantitatively describes the potential repertoire of T-cell receptors that can be produced by an individual, providing insight into its potential diversity and the probability of generation of any specific T-cell receptor. Then in chapter 3, we present work on understanding the functioning of regulatory DNA sequences in both prokaryotes and eukaryotes. Here we use experiments that measure the transcriptional activity of large libraries of mutagenized promoters and enhancers and infer models of the sequence-function relationship from this data. For the bacterial promoter, we infer a physically motivated 'thermodynamic' model of the interaction of DNA-binding proteins and RNA polymerase determining the transcription rate of the downstream gene. For the eukaryotic enhancers, we infer heuristic models of the sequence-function relationship and use these models to find synthetic enhancer sequences that optimize inducibility of expression. Both projects demonstrate the utility of sequence information in conjunction with sophisticated statistical inference techniques for dissecting underlying biophysical

  19. Single Nucleotide Polymorphism Clustering in Systemic Autoimmune Diseases

    PubMed Central

    Charlon, Thomas; Bossini-Castillo, Lara; Carmona, F. David; Di Cara, Alessandro; Wojcik, Jérôme; Voloshynovskiy, Sviatoslav


    Systemic Autoimmune Diseases, a group of chronic inflammatory conditions, have variable symptoms and difficult diagnosis. In order to reclassify them based on genetic markers rather than clinical criteria, we performed clustering of Single Nucleotide Polymorphisms. However naive approaches tend to group patients primarily by their geographic origin. To reduce this “ancestry signal”, we developed SNPClust, a method to select large sources of ancestry-independent genetic variations from all variations detected by Principal Component Analysis. Applied to a Systemic Lupus Erythematosus case control dataset, SNPClust successfully reduced the ancestry signal. Results were compared with association studies between the cases and controls without or with reference population stratification correction methods. SNPClust amplified the disease discriminating signal and the ratio of significant associations outside the HLA locus was greater compared to population stratification correction methods. SNPClust will enable the use of ancestry-independent genetic information in the reclassification of Systemic Autoimmune Diseases. SNPClust is available as an R package and demonstrated on the public Human Genome Diversity Project dataset at PMID:27490238

  20. Single nucleotide polymorphism-based dispersal estimates using noninvasive sampling

    PubMed Central

    Norman, Anita J; Spong, Göran


    Quantifying dispersal within wild populations is an important but challenging task. Here we present a method to estimate contemporary, individual-based dispersal distance from noninvasively collected samples using a specialized panel of 96 SNPs (single nucleotide polymorphisms). One main issue in conducting dispersal studies is the requirement for a high sampling resolution at a geographic scale appropriate for capturing the majority of dispersal events. In this study, fecal samples of brown bear (Ursus arctos) were collected by volunteer citizens, resulting in a high sampling resolution spanning over 45,000 km2 in Gävleborg and Dalarna counties in Sweden. SNP genotypes were obtained for unique individuals sampled (n = 433) and subsequently used to reconstruct pedigrees. A Mantel test for isolation by distance suggests that the sampling scale was appropriate for females but not for males, which are known to disperse long distances. Euclidean distance was estimated between mother and offspring pairs identified through the reconstructed pedigrees. The mean dispersal distance was 12.9 km (SE 3.2) and 33.8 km (SE 6.8) for females and males, respectively. These results were significantly different (Wilcoxon’s rank-sum test: P-value = 0.02) and are in agreement with the previously identified pattern of male-biased dispersal. Our results illustrate the potential of using a combination of noninvasively collected samples at high resolution and specialized SNPs for pedigree-based dispersal models. PMID:26357536

  1. ADH single nucleotide polymorphism associations with alcohol metabolism in vivo

    PubMed Central

    Birley, Andrew J.; James, Michael R.; Dickson, Peter A.; Montgomery, Grant W.; Heath, Andrew C.; Martin, Nicholas G.; Whitfield, John B.


    We have previously found that variation in alcohol metabolism in Europeans is linked to the chromosome 4q region containing the ADH gene family. We have now typed 103 single nucleotide polymorphisms (SNPs) across this region to test for allelic associations with variation in blood and breath alcohol concentrations after an alcohol challenge. In vivo alcohol metabolism was modelled with three parameters that identified the absorption and rise of alcohol concentration following ingestion, and the rate of elimination. Alleles of ADH7 SNPs were associated with the early stages of alcohol metabolism, with additional effects in the ADH1A, ADH1B and ADH4 regions. Rate of elimination was associated with SNPs in the intragenic region between ADH7 and ADH1C, and across ADH1C and ADH1B. SNPs affecting alcohol metabolism did not correspond to those reported to affect alcohol dependence or alcohol-related disease. The combined SNP associations with early- and late-stage metabolism only account for approximately 20% of the total genetic variance linked to the ADH region, and most of the variance for in vivo alcohol metabolism linked to this region is yet to be explained. PMID:19193628

  2. Single Nucleotide Polymorphism Clustering in Systemic Autoimmune Diseases.


    Charlon, Thomas; Martínez-Bueno, Manuel; Bossini-Castillo, Lara; Carmona, F David; Di Cara, Alessandro; Wojcik, Jérôme; Voloshynovskiy, Sviatoslav; Martín, Javier; Alarcón-Riquelme, Marta E


    Systemic Autoimmune Diseases, a group of chronic inflammatory conditions, have variable symptoms and difficult diagnosis. In order to reclassify them based on genetic markers rather than clinical criteria, we performed clustering of Single Nucleotide Polymorphisms. However naive approaches tend to group patients primarily by their geographic origin. To reduce this "ancestry signal", we developed SNPClust, a method to select large sources of ancestry-independent genetic variations from all variations detected by Principal Component Analysis. Applied to a Systemic Lupus Erythematosus case control dataset, SNPClust successfully reduced the ancestry signal. Results were compared with association studies between the cases and controls without or with reference population stratification correction methods. SNPClust amplified the disease discriminating signal and the ratio of significant associations outside the HLA locus was greater compared to population stratification correction methods. SNPClust will enable the use of ancestry-independent genetic information in the reclassification of Systemic Autoimmune Diseases. SNPClust is available as an R package and demonstrated on the public Human Genome Diversity Project dataset at PMID:27490238

  3. Mapping of complex traits by single-nucleotide polymorphisms.

    PubMed Central

    Zhao, L P; Aragaki, C; Hsu, L; Quiaoit, F


    Molecular geneticists are developing the third-generation human genome map with single-nucleotide polymorphisms (SNPs), which can be assayed via chip-based microarrays. One use of these SNP markers is the ability to locate loci that may be responsible for complex traits, via linkage/linkage-disequilibrium analysis. In this communication, we describe a semiparametric method for combined linkage/linkage-disequilibrium analysis using SNP markers. Asymptotic results are obtained for the estimated parameters, and the finite-sample properties are evaluated via a simulation study. We also applied this technique to a simulated genome-scan experiment for mapping a complex trait with two major genes. This experiment shows that separate linkage and linkage-disequilibrium analyses correctly detected the signals of both major genes; but the rates of false-positive signals seem high. When linkage and linkage-disequilibrium signals were combined, the analysis yielded much stronger and clearer signals for the presence of two major genes than did two separate analyses. PMID:9634510

  4. Single Nucleotide Polymorphism in Patients with Moyamoya Disease

    PubMed Central


    Moyamoya disease (MMD) is a chronic, progressive, cerebrovascular occlusive disorder that displays various clinical features and results in cerebral infarct or hemorrhagic stroke. Specific genes associated with the disease have not yet been identified, making identification of at-risk patients difficult before clinical manifestation. Familial MMD is not uncommon, with as many as 15% of MMD patients having a family history of the disease, suggesting a genetic etiology. Studies of single nucleotide polymorphisms (SNPs) in MMD have mostly focused on mechanical stress on vessels, endothelium, and the relationship to atherosclerosis. In this review, we discuss SNPs studies targeting the genetic etiology of MMD. Genetic analyses in familial MMD and genome-wide association studies represent promising strategies for elucidating the pathophysiology of this condition. This review also discusses future research directions, not only to offer new insights into the origin of MMD, but also to enhance our understanding of the genetic aspects of MMD. There have been several SNP studies of MMD. Current SNP studies suggest a genetic contribution to MMD, but further reliable and replicable data are needed. A large cohort or family-based design would be important. Modern SNP studies of MMD depend on novel genetic, experimental, and database methods that will hopefully hasten the arrival of a consensus conclusion. PMID:26180609

  5. Nucleotide sequence of SHV-2 beta-lactamase gene

    SciTech Connect

    Garbarg-Chenon, A.; Godard, V.; Labia, R.; Nicolas, J.C. )


    The nucleotide sequence of plasmid-mediated beta-lactamase SHV-2 from Salmonella typhimurium (SHV-2pHT1) was determined. The gene was very similar to chromosomally encoded beta-lactamase LEN-1 of Klebsiella pneumoniae. Compared with the sequence of the Escherichia coli SHV-2 enzyme (SHV-2E.coli) obtained by protein sequencing, the deduced amino acid sequence of SHV-2pHT1 differed by three amino acid substitutions.

  6. Single nucleotide polymorphisms in nucleotide excision repair genes, cancer treatment, and head and neck cancer survival

    PubMed Central

    Wyss, Annah B.; Weissler, Mark C.; Avery, Christy L.; Herring, Amy H.; Bensen, Jeannette T.; Barnholtz-Sloan, Jill S.; Funkhouser, William K.


    Purpose Head and neck cancers (HNC) are commonly treated with radiation and platinum-based chemotherapy, which produce bulky DNA adducts to eradicate cancerous cells. Because nucleotide excision repair (NER) enzymes remove adducts, variants in NER genes may be associated with survival among HNC cases both independently and jointly with treatment. Methods Cox proportional hazards models were used to estimate race-stratified (White, African American) hazard ratios (HRs) and 95 % confidence intervals for overall (OS) and disease-specific (DS) survival based on treatment (combinations of surgery, radiation, and chemotherapy) and 84 single nucleotide polymorphisms (SNPs) in 15 NER genes among 1,227 HNC cases from the Carolina Head and Neck Cancer Epidemiology Study. Results None of the NER variants evaluated were associated with survival at a Bonferroni-corrected alpha of 0.0006. However, rs3136038 [OS HR = 0.79 (0.65, 0.97), DS HR = 0.69 (0.51, 0.93)] and rs3136130 [OS HR = 0.78 (0.64, 0.96), DS HR = 0.68 (0.50, 0.92)] of ERCC4 and rs50871 [OS HR = 0.80 (0.64, 1.00), DS HR = 0.67 (0.48, 0.92)] of ERCC2 among Whites, and rs2607755 [OS HR = 0.62 (0.45, 0.86), DS HR = 0.51 (0.30, 0.86)] of XPC among African Americans were suggestively associated with survival at an uncorrected alpha of 0.05. Three SNP-treatment joint effects showed possible departures from additivity among Whites. Conclusions Our study, a large and extensive evaluation of SNPs in NER genes and HNC survival, identified mostly null associations, though a few variants were suggestively associated with survival and potentially interacted additively with treatment. PMID:24487794

  7. [Tabular excel editor for analysis of aligned nucleotide sequences].


    Demkin, V V


    Excel platform was used for transition of results of multiple aligned nucleotide sequences obtained using the BLAST network service to the form appropriate for visual analysis and editing. Two macros operators for MS Excel 2007 were constructed. The array of aligned sequences transformed into Excel table and processed using macros operators is more appropriate for analysis than initial html data.

  8. Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing

    NASA Astrophysics Data System (ADS)

    Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación


    A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori

  9. Plasmonics nanoprobes: detection of single-nucleotide polymorphisms in the breast cancer BRCA1 gene.


    Wabuyele, Musundi B; Yan, Fei; Vo-Dinh, Tuan


    This paper describes the application of plasmonics-based nanoprobes that combine the modulation of the plasmonics effect to change the surface-enhanced Raman scattering (SERS) of a Raman label and the specificity of a DNA hairpin loop sequence to recognize and discriminate a variety of molecular target sequences. Hybridization with target DNA opens the hairpin and physically separates the Raman label from the metal nanoparticle thus reducing the plasmonics effect and quenching the SERS signal of the label. We have successfully demonstrated the specificity and selectivity of the nanoprobes in the detection of a single-nucleotide polymorphism (SNP) in the breast cancer BRCA1 gene in a homogenous solution at room temperature. In addition, the potential application of plasmonics nanoprobes for quantitative DNA diagnostic testing is discussed.

  10. [Single nucleotide polymorphism and its application in allogeneic hematopoietic stem cell transplantation--review].


    Li, Su-Xia


    Single nucleotide polymorphism (SNP) is the third genetic marker after restriction fragment length polymorphism (RFLP) and short tandem repeat. It represents the most density genetic variability in the human genome and has been widely used in gene location, cloning, and research of heredity variation, as well as parenthood identification in forensic medicine. As steady heredity polymorphism, single nucleotide polymorphism is becoming the focus of attention in monitoring chimerism and minimal residual disease in the patients after allogeneic hematopoietic stem cell transplantation. The article reviews SNP heredity characterization, analysis techniques and its applications in allogeneic stem cell transplantation and other fields.

  11. 77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request. SUMMARY: The United States....'' SUPPLEMENTARY INFORMATION: I. Abstract Patent applications that contain nucleotide and/or amino acid...

  12. Nucleotide sequence stability of the genome of hepatitis delta virus.

    PubMed Central

    Netter, H J; Wu, T T; Bockol, M; Cywinski, A; Ryu, W S; Tennant, B C; Taylor, J M


    Cultured cells were cotransfected with a fully sequenced 1,679-base cDNA clone of human hepatitis delta virus (HDV) RNA genome and a cDNA for the genome of woodchuck hepatitis virus (WHV). The HDV particles released were able to infect a woodchuck that was chronically infected with WHV. The HDV so produced was passaged a total of six times in woodchucks in order to determine the stability of the HDV nucleotide sequence. During a final chronic infection with such virus, liver RNA was extracted, and the HDV nucleotide sequence for the 352-base region, positions 905 to 1256, was obtained. By means of PCR, we obtained double-stranded cDNA both for direct sequencing and also for molecular cloning followed by sequencing. By direct sequencing, we found that a consensus sequence existed and was identical to the original sequence. From the sequences of 31 clones, we found 32% (10 of 31) to be identical to the original single nucleotide sequence. For the remainder, there were neither insertions nor deletions but there was a small number of single-nucleotide changes. These changes were predominantly transitions rather than transversions. Furthermore, the transitions were largely of just two types, uridine to cytidine and adenosine to guanosine. Of the 40 changes detected on HDV, 35% (14 of 40) occurred within an eight-nucleotide region that included position 1012, previously shown to be a site of RNA editing. These findings may have significant implications regarding both the stability of the HDV RNA genome and the mechanism of RNA editing. PMID:7853505

  13. The nucleotide sequence of cowpea mosaic virus B RNA

    PubMed Central

    Lomonossoff, G.P.; Shanks, M.


    The complete sequence of the bottom component RNA (B RNA) of cowpea mosaic virus (CPMV) has been determined. Restriction enzyme fragments of double-stranded cDNA were cloned in M13 and the sequence of the inserts was determined by a combination of enzymatic and chemical sequencing techniques. Additional sequence information was obtained by primed synthesis on first strand cDNA. The complete sequence deduced is 5889 nucleotides long excluding the 3' poly(A), and contains an open reading frame sufficient to code for a polypeptide of mol. wt. 207 760. The coding region is flanked by a 5' leader sequence of 206 nucleotides and a 3' non-coding region of 82 residues which does not contain a polyadenylation signal. PMID:16453487

  14. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    SciTech Connect

    Lo, A.; Yang, H.L.


    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  15. Single nucleotide polymorphisms in DKK3 gene are associated with prostate cancer risk and progression

    PubMed Central

    Kim, Min Su; Lee, Ha Na; Kim, Hae Jong; Myung, Soon Chul


    ABSTRACT We had investigated whether sequence variants within DKK3 gene are associated with the development of prostate cancer in a Korean study cohort. We evaluated the association between 53 single nucleotide polymorphisms (SNPs) in the DKK3 gene and prostate cancer risk as well as clinical characteristics (PSA, clinical stage, pathological stage and Gleason score) in Korean men (272 prostate cancer subjects and 173 benign prostate hyperplasia subjects) using unconditional logistic regression analysis. Of the 53 SNPs and 25 common haplotypes, 5 SNPs and 4 haplotypes were associated with prostate cancer risk (P=0.02–0.04); 3 SNPs and 2 haplotypes were significantly associated with susceptibility to prostate cancer, however 2 SNPs and 2 haplotypes exhibited a significant protective effect on prostate cancer. Logistic analyses of the DKK3 gene polymorphisms with several prostate cancer related factors showed that several SNPs were significant; three SNPs and two haplotypes to PSA level, three SNPs and two haplotypes to clinical stage, nine SNPs and two haplotype to pathological stage, one SNP and one haplotypes to Gleason score. To the author's knowledge, this is the first report documenting that DKK3 polymorphisms are not only associated with prostate cancer but also related to prostate cancer-related factors. PMID:26689513

  16. The application and performance of single nucleotide polymorphism markers for population genetic analyses of Lepidoptera

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Single nucleotide polymorphisms (SNPs) are nucleotide substitution mutations that tend to be at high densities within eukaryotic genomes. The development of assays that detect allelic variation at SNP loci is attractive for genome mapping, population genetics, and phylogeographic applications. A p...

  17. High-speed droplet-allele-specific polymerase chain reaction for genotyping of single nucleotide polymorphisms.


    Matsuda, Kazuyuki; Honda, Takayuki


    Single nucleotide alternations such as single nucleotide polymorphisms (SNPs) or single nucleotide mutations are useful genetic markers for molecular diagnosis, prognosis, drug response, and predisposition to diseases. Rapid identification of SNPs or mutations is clinically important, especially for determining drug responses and selection of molecular-targeted therapy. Here, we describe a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) by using our droplet-PCR machine (droplet-AS-PCR).

  18. Single nucleotide polymorphisms in the mitochondrial displacement loop and outcome of esophageal squamous cell carcinoma

    PubMed Central


    Backgroud Accumulation of single nucleotide polymorphisms (SNPs) in the displacement loop (D-loop) of mitochondrial DNA (mtDNA) has been described for different types of cancers and might be associated with cancer risk and disease outcome. We used a population-based series of esophageal squamous cell carcinoma (ESCC) patients for investigating the prediction power of SNPs in mitochondrial D-loop. Methods The D-loop region of mtDNA was sequenced for 60 ESCC patients recorded in the Fourth Hospital of Hebei Medical University between 2003 and 2004. The 5 year survival curve were calculated with the Kaplan-Meier method and compared by the log-rank test at each SNP site, a multivariate survival analysis was also performed with the Cox proportional hazards method. Results The SNP sites of nucleotides 16274G/A, 16278C/T and 16399A/G were identified for prediction of post-operational survival by the log-rank test. In an overall multivariate analysis, the 16278 and 16399 alleles were identified as independent predictors of ESCC outcome. The length of survival of patients with the minor allele 16278T genotype was significantly shorter than that of patients with 16278C at the 16278 site (relative risk, 3.001; 95% CI, 1.029 - 8.756; p = 0.044). The length of survival of patients with the minor allele 16399G genotype was significantly shorter than that of patients with the more frequent allele 16399A at the 16399 site in ESCC patients (relative risk, 3.483; 95% CI, 1.068 - 11.359; p = 0.039). Conclusion Genetic polymorphisms in the D-loop are independent prognostic markers for patients with ESCC. Accordingly, the analysis of genetic polymorphisms in the mitochondrial D-loop can help identify patient subgroups at high risk of a poor disease outcome. PMID:21110870

  19. Identification of a Novel Single Nucleotide Polymorphism in Porcine Beta-Defensin-1 Gene.


    Pruthviraj, D R; Usha, A P; Venkatachalapathy, R T


    Porcine beta-defensin-1 (PBD-1) gene plays an important role in the innate immunity of pigs. The peptide encoded by this gene is an antimicrobial peptide that has direct activity against a wide range of microbes. This peptide is involved in the co-creation of an antimicrobial barrier in the oral cavity of pigs. The objective of the present study was to detect polymorphisms, if any, in exon-1 and exon-2 regions of PBD-1 gene in Large White Yorkshire (LWY) and native Ankamali pigs of Kerala, India. Blood samples were collected from 100 pigs and genomic DNA was isolated using phenol chloroform method. The quantity of DNA was assessed in a spectrophotometer and quality by gel electrophoresis. Exon-1 and exon-2 regions of PBD-1 gene were amplified by polymerase chain reaction (PCR) and the products were subjected to single strand conformation polymorphism (SSCP) analysis. Subsequent silver staining of the polyacrylamide gels revealed three unique SSCP banding patterns in each of the two exons. The presence of single nucleotide polymorphisms (SNPs) was confirmed by nucleotide sequencing of the PCR products. A novel SNP was found in the 5'-UTR region of exon-1 and a SNP was detected in the mature peptide coding region of exon-2. In exon-1, the pooled population frequencies of GG, GT, and TT genotypes were 0.67, 0.30, and 0.03, respectively. GG genotype was predominant in both the breeds whereas TT genotype was not detected in LWY breed. Similarly, in exon-2, the pooled population frequencies of AA, AG, and GG genotypes were 0.50, 0.27, and 0.23, respectively. AA genotype was predominant in LWY pigs whereas GG genotype was predominant in native pigs. These results suggest that there exists a considerable genetic variation at PBD-1 locus and further association studies may help in development of a PCR based genotyping test to select pigs with better immunity. PMID:26950860

  20. Identification of a Novel Single Nucleotide Polymorphism in Porcine Beta-Defensin-1 Gene.


    Pruthviraj, D R; Usha, A P; Venkatachalapathy, R T


    Porcine beta-defensin-1 (PBD-1) gene plays an important role in the innate immunity of pigs. The peptide encoded by this gene is an antimicrobial peptide that has direct activity against a wide range of microbes. This peptide is involved in the co-creation of an antimicrobial barrier in the oral cavity of pigs. The objective of the present study was to detect polymorphisms, if any, in exon-1 and exon-2 regions of PBD-1 gene in Large White Yorkshire (LWY) and native Ankamali pigs of Kerala, India. Blood samples were collected from 100 pigs and genomic DNA was isolated using phenol chloroform method. The quantity of DNA was assessed in a spectrophotometer and quality by gel electrophoresis. Exon-1 and exon-2 regions of PBD-1 gene were amplified by polymerase chain reaction (PCR) and the products were subjected to single strand conformation polymorphism (SSCP) analysis. Subsequent silver staining of the polyacrylamide gels revealed three unique SSCP banding patterns in each of the two exons. The presence of single nucleotide polymorphisms (SNPs) was confirmed by nucleotide sequencing of the PCR products. A novel SNP was found in the 5'-UTR region of exon-1 and a SNP was detected in the mature peptide coding region of exon-2. In exon-1, the pooled population frequencies of GG, GT, and TT genotypes were 0.67, 0.30, and 0.03, respectively. GG genotype was predominant in both the breeds whereas TT genotype was not detected in LWY breed. Similarly, in exon-2, the pooled population frequencies of AA, AG, and GG genotypes were 0.50, 0.27, and 0.23, respectively. AA genotype was predominant in LWY pigs whereas GG genotype was predominant in native pigs. These results suggest that there exists a considerable genetic variation at PBD-1 locus and further association studies may help in development of a PCR based genotyping test to select pigs with better immunity.

  1. Identification of a Novel Single Nucleotide Polymorphism in Porcine Beta-Defensin-1 Gene

    PubMed Central

    Pruthviraj, D. R.; Usha, A. P.; Venkatachalapathy, R. T.


    Porcine beta-defensin-1 (PBD-1) gene plays an important role in the innate immunity of pigs. The peptide encoded by this gene is an antimicrobial peptide that has direct activity against a wide range of microbes. This peptide is involved in the co-creation of an antimicrobial barrier in the oral cavity of pigs. The objective of the present study was to detect polymorphisms, if any, in exon-1 and exon-2 regions of PBD-1 gene in Large White Yorkshire (LWY) and native Ankamali pigs of Kerala, India. Blood samples were collected from 100 pigs and genomic DNA was isolated using phenol chloroform method. The quantity of DNA was assessed in a spectrophotometer and quality by gel electrophoresis. Exon-1 and exon-2 regions of PBD-1 gene were amplified by polymerase chain reaction (PCR) and the products were subjected to single strand conformation polymorphism (SSCP) analysis. Subsequent silver staining of the polyacrylamide gels revealed three unique SSCP banding patterns in each of the two exons. The presence of single nucleotide polymorphisms (SNPs) was confirmed by nucleotide sequencing of the PCR products. A novel SNP was found in the 5′-UTR region of exon-1 and a SNP was detected in the mature peptide coding region of exon-2. In exon-1, the pooled population frequencies of GG, GT, and TT genotypes were 0.67, 0.30, and 0.03, respectively. GG genotype was predominant in both the breeds whereas TT genotype was not detected in LWY breed. Similarly, in exon-2, the pooled population frequencies of AA, AG, and GG genotypes were 0.50, 0.27, and 0.23, respectively. AA genotype was predominant in LWY pigs whereas GG genotype was predominant in native pigs. These results suggest that there exists a considerable genetic variation at PBD-1 locus and further association studies may help in development of a PCR based genotyping test to select pigs with better immunity. PMID:26950860

  2. Moss Phylogeny Reconstruction Using Nucleotide Pangenome of Complete Mitogenome Sequences.


    Goryunov, D V; Nagaev, B E; Nikolaev, M Yu; Alexeevski, A V; Troitsky, A V


    Stability of composition and sequence of genes was shown earlier in 13 mitochondrial genomes of mosses (Rensing, S. A., et al. (2008) Science, 319, 64-69). It is of interest to study the evolution of mitochondrial genomes not only at the gene level, but also on the level of nucleotide sequences. To do this, we have constructed a "nucleotide pangenome" for mitochondrial genomes of 24 moss species. The nucleotide pangenome is a set of aligned nucleotide sequences of orthologous genome fragments covering the totality of all genomes. The nucleotide pangenome was constructed using specially developed new software, NPG-explorer (NPGe). The stable part of the mitochondrial genome (232 stable blocks) is shown to be, on average, 45% of its length. In the joint alignment of stable blocks, 82% of positions are conserved. The phylogenetic tree constructed with the NPGe program is in good correlation with other phylogenetic reconstructions. With the NPGe program, 30 blocks have been identified with repeats no shorter than 50 bp. The maximal length of a block with repeats is 140 bp. Duplications in the mitochondrial genomes of mosses are rare. On average, the genome contains about 500 bp in large duplications. The total length of insertions and deletions was determined in each genome. The losses and gains of DNA regions are rather active in mitochondrial genomes of mosses, and such rearrangements presumably can be used as additional markers in the reconstruction of phylogeny. PMID:26615445

  3. Single nucleotide polymorphism isolated from a novel EST dataset in garden asparagus (Asparagus officinalis L.).


    Mercati, Francesco; Riccardi, Paolo; Leebens-Mack, Jim; Abenavoli, Maria Rosa; Falavigna, Agostino; Sunseri, Francesco


    Single nucleotide polymorphisms (SNPs) and simple sequence repeats (SSR) are abundant and evenly distributed co-dominant molecular markers in plant genomes. SSRs are valuable for marker assisted breeding and positional cloning of genes associated traits of interest. Although several high throughput platforms have been developed to identify SNP and SSR markers for analysis of segregant plant populations, breeding in garden asparagus (Asparagus officinalis L.) has been limited by a low content of such markers. In this study massively parallel GS-FLX pyro-sequencing technology (454 Life Sciences) has been used to sequence and compare transcriptome from two genotypes: a rust tolerant male (1770) and a susceptible female (G190). A total of 122,963 and 99,368 sequence reads, with an average length of 245.7bp, have been recovered from accessions 1770 and 190 respectively. A computational pipeline has been used to predict and visually inspect putative SNPs and SSR sequences. Analysis of Gene Ontology (GO) slim annotation assignments for all assembled uniscripts indicated that the 24,403 assemblies represent genes from a broad array of functions. Further, over 1800 putative SNPs and 1000 SSRs were detected. One hundred forty-four SNPs together with 60 selected SSRs were validated and used to develop a preliminary genetic map by using a large BC(1) population, derived from 1770 and G190. The abundance of SNPs and SSRs provides a foundation for the development of saturated genetic maps and their utilization in assisted asparagus breeding programs.

  4. Single nucleotide polymorphism isolated from a novel EST dataset in garden asparagus (Asparagus officinalis L.).


    Mercati, Francesco; Riccardi, Paolo; Leebens-Mack, Jim; Abenavoli, Maria Rosa; Falavigna, Agostino; Sunseri, Francesco


    Single nucleotide polymorphisms (SNPs) and simple sequence repeats (SSR) are abundant and evenly distributed co-dominant molecular markers in plant genomes. SSRs are valuable for marker assisted breeding and positional cloning of genes associated traits of interest. Although several high throughput platforms have been developed to identify SNP and SSR markers for analysis of segregant plant populations, breeding in garden asparagus (Asparagus officinalis L.) has been limited by a low content of such markers. In this study massively parallel GS-FLX pyro-sequencing technology (454 Life Sciences) has been used to sequence and compare transcriptome from two genotypes: a rust tolerant male (1770) and a susceptible female (G190). A total of 122,963 and 99,368 sequence reads, with an average length of 245.7bp, have been recovered from accessions 1770 and 190 respectively. A computational pipeline has been used to predict and visually inspect putative SNPs and SSR sequences. Analysis of Gene Ontology (GO) slim annotation assignments for all assembled uniscripts indicated that the 24,403 assemblies represent genes from a broad array of functions. Further, over 1800 putative SNPs and 1000 SSRs were detected. One hundred forty-four SNPs together with 60 selected SSRs were validated and used to develop a preliminary genetic map by using a large BC(1) population, derived from 1770 and G190. The abundance of SNPs and SSRs provides a foundation for the development of saturated genetic maps and their utilization in assisted asparagus breeding programs. PMID:23415335

  5. Single nucleotide polymorphism profiling assay to confirm the identity of human tissues.


    Huijsmans, Ronald; Damen, Jan; van der Linden, Hans; Hermans, Mirjam


    To identify issues of sample mix-ups, various molecular techniques are currently used. These techniques, however, are time consuming and require experience and/or DNA sequencing equipment or have a relatively high risk of errors because of contamination. Therefore, a quick and straightforward single nucleotide polymorphism (SNP) profiling assay was developed to link human tissues to a source. SNPs are common sequence variations in the human genome, and each individual has a unique combination of these nucleotide variations. Using potentially mislabeled paraffin-embedded tissues, DNA was extracted and SNP profiles were determined by real-time polymerase chain reaction analysis of the purified DNA using a selection of 10 commercially available SNP amplification assays. These profiles were compared with profiles of the supposed owners. All issues (34 in total) of potential sample mix-ups during the last 3 years were adequately solved, with six cases described here. The SNP profiling assay provides a quick (within 24 hours), easy, and reliable way to link human samples to a source, without polymerase chain reaction postprocessing. The chance for two randomly chosen individuals to have an identical profile is 1 in 18,000. Solving potential sample mix-ups will secure downstream evaluations and critical decisions concerning the patients involved. PMID:17384212

  6. Single Nucleotide Polymorphisms in Pediatric Idiopathic Nephrotic Syndrome

    PubMed Central

    Suvanto, Maija; Jahnukainen, Timo; Kestilä, Marjo; Jalanko, Hannu


    Polymorphic variants in several molecules involved in the glomerular function and drug metabolism have been implicated in the pathophysiology of pediatric idiopathic nephrotic syndrome (INS), but the results remain inconsistent. We analyzed the association of eleven allelic variants in eight genes (angiopoietin-like 4 (ANGPTL4), glypican 5 (GPC5), interleukin-13 (IL-13), macrophage migration inhibitory factor (MIF), neural nitric oxide synthetase (nNOS), multidrug resistance-1 (MDR1), glucocorticoid-induced transcript-1 (GLCCI1), and nuclear receptor subfamily-3 (NR3C1)) in 100 INS patients followed up till adulthood. We genotyped variants using PCR and direct sequencing and evaluated estimated haplotypes of MDR1 variants. The analysis revealed few differences in SNP genotype frequencies between patients and controls, or in clinical parameters among the patients. Genotype distribution of MDR1 SNPs rs1236, rs2677, and rs3435 showed significant (p < 0.05) association with different medication regimes (glucocorticoids only versus glucocorticoids plus additional immunosuppressives). Some marginal association was detected between ANGPTL4, GPC5, GLCCI1, and NR3C1 variants and different medication regimes, number of relapses, and age of onset. Conclusion. While MDR1 variant genotype distribution associated with different medication regimes, the other analyzed gene variants showed only little or marginal clinical relevance in INS. PMID:27247801

  7. Epidemic population structure of extraintestinal pathogenic Escherichia coli determined by single nucleotide polymorphism pyrosequencing.


    Fernández-Romero, Natalia; Romero-Gómez, María Pilar; Gómez-Gil, María Rosa; Mingorance, Jesús


    We have developed an MLST-based scheme for typing Escherichia coli isolates using pyrosequencing of single nucleotide polymorphic positions (SNP). The SNP sequences are converted into allelic patterns and analyzed using the same approach used for MLST analyses. We have tested the method in two unselected collections of clinical isolates of E. coli obtained from blood and urine cultures. The two collections had a similar structure, 25% of the profiles (representing 68% of the isolates) were common to both, and 62% of the profiles (nearly 20% of the isolates) were unique. The four major profiles accounted for 44% of the isolates, and among these the most frequent one was related to the pandemic ST131 clone. The method is easy to implement and might be useful for typing large microbial collections. PMID:21723423

  8. A Locked Nucleic Acid Probe Based on Selective Salt-Induced Effect Detects Single Nucleotide Polymorphisms

    PubMed Central

    Zhang, Jing; Wu, Huizhe; Chen, Qiuchen; Zhao, Pengfei; Zhao, Haishan; Yao, Weifan; Wei, Minjie


    Detection of single based genetic mutation by using oligonucleotide probes is one of the common methods of detecting single nucleotide polymorphisms at known loci. In this paper, we demonstrated a hybridization system which included a buffer solution that produced selective salt-induced effect and a locked nucleic acid modified 12 nt oligonucleotide probe. The hybridization system is suitable for hybridization under room temperature. By using magnetic nanoparticles as carriers for PCR products, the SNPs (MDR1 C3435T/A) from 45 volunteers were analyzed, and the results were consistent with the results from pyrophosphoric acid sequencing. The method presented in this paper differs from the traditional method of using molecular beacons to detect SNPs in that it is suitable for research institutions lacking real-time quantitative PCR detecting systems, to detect PCR products at room temperature. PMID:26347880

  9. Nanoparticle-based detection and quantification of DNA with single nucleotide polymorphism (SNP) discrimination selectivity

    PubMed Central

    Qin, Wei Jie; Yung, Lin Yue Lanry


    Sequence-specific DNA detection is important in various biomedical applications such as gene expression profiling, disease diagnosis and treatment, drug discovery and forensic analysis. Here we report a gold nanoparticle-based method that allows DNA detection and quantification and is capable of single nucleotide polymorphism (SNP) discrimination. The precise quantification of single-stranded DNA is due to the formation of defined nanoparticle-DNA conjugate groupings in the presence of target/linker DNA. Conjugate groupings were characterized and quantified by gel electrophoresis. A linear correlation between the amount of target DNA and conjugate groupings was found. For SNP detection, single base mismatch discrimination was achieved for both the end- and center-base mismatch. The method described here may be useful for the development of a simple and quantitative DNA detection assay. PMID:17720714

  10. Information capacity of nucleotide sequences and its applications.


    Sadovsky, M G


    The information capacity of nucleotide sequences is defined through the specific entropy of frequency dictionary of a sequence determined with respect to another one containing the most probable continuations of shorter strings. This measure distinguishes a sequence both from a random one, and from ordered entity. A comparison of sequences based on their information capacity is studied. An order within the genetic entities is found at the length scale ranged from 3 to 8. Some other applications of the developed methodology to genetics, bioinformatics, and molecular biology are discussed.

  11. Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm

    PubMed Central

    Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng


    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. ‘Cayenne’, ‘Spanish’, ‘Queen’) was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops. PMID:26640697

  12. Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm.


    Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng


    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops. PMID:26640697

  13. Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm.


    Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng


    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops.

  14. [Nucleotide polymorphism and molecular evolution of the LRR region in potato late blight resistance gene Rpi-blb2].


    You, Lu-Peng; Miao, Jing; Zou, Ai-Lan; Qi, Jin-Liang; Yang, Yong-Hua


    Rpi-blb2, which is originally derived from Solanum bulbocastanum, is a broad-spectrum potato late blight resistance gene and belongs to the NBS-LRR family. Here, the LRR homologues of Rpi-blb2 were cloned with PCR method from 40 potato cultivars (including 20 resistant potato cultivars and 20 susceptible ones) and 7 wild potato populations. Then, the similarities of the sequences, polymorphic (segregating) sites, and nucleotide diversities were estimated by bioinformatic methods. The results showed that high nucleotide polymorphism and some hot-spot mutations existed in the LRR region of Rpi-blb2. The test of Ka/Ks ratio showed that the function of LRR was conserved because of the purifying selection, although different positions of the Rpi-blb2 LRR region were under different selection pressures. Moreover, the LRR region of Rpi-blb2 had no clear differentiation between the cultivated and wild potatoes. PMID:22522166

  15. Characterization of single nucleotide polymorphism markers for the green sea turtle (Chelonia mydas).


    Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A


    We present data on 29 new single nucleotide polymorphism assays for the green sea turtle, Chelonia mydas. DNA extracts from 39 green turtles were used for two methods of single nucleotide polymorphism discovery. The first approach employed an amplified fragment length polymorphism technique. The second technique screened a microsatellite library. Allele-specific amplification assays were developed for high-throughput single nucleotide polymorphism genotyping and tested on two Pacific C. mydas nesting populations. Observed heterozygosities ranged from 0 to 0.95 for a Hawaiian population and from 0 to 0.85 for a Galapagos population. Each of the populations had one locus out of Hardy-Weinberg equilibrium, SSCM2b and SSCM5 for Hawaii and Galapagos, respectively. No loci showed significant genotypic linkage disequilibrium across an expanded set of four Pacific nesting populations. However, two loci, SSCM4 and SSCM10b showed linkage disequilibrium across three populations indicating possible association.

  16. The human myelin oligodendrocyte glycoprotein (MOG) gene: Complete nucleotide sequence and structural characterization

    SciTech Connect

    Paule Roth, M.; Malfroy, L.; Offer, C.; Sevin, J.; Enault, G.; Borot, N.; Pontarotti, P.; Coppin, H.


    Human myelin oligodendrocyte glycoprotein (MOG), a myelin component of the central nervous system, is a candidate target antigen for autoimmune-mediated demyelination. We have isolated and sequenced part of a cosmid clone that contains the entire human MOG gene. The primary nuclear transcript, extending from the putative start of transcription to the site of poly(A) addition, is 15,561 nucleotides in length. The human MOG gene contains 8 exons, separated by 7 introns; canonical intron/exon boundary sites are observed at each junction. The introns vary in size from 242 to 6484 bp and contain numerous repetitive DNA elements, including 14 Alu sequences within 3 introns. Another Alu element is located in the 3{prime}-untranslated region of the gene. Alu sequences were classified with respect to subfamily assignment. Seven hundred sixty-three nucleotides 5{prime} of the transcription start and 1214 nucleotides 3{prime} of the poly(A) addition sites were also sequenced. The 5{prime}-flanking region revealed the presence of several consensus sequences that could be relevant in the transcription of the MOG gene, in particular binding sites in common with other myelin gene promoters. Two polymorphic intragenic dinucleotide (CA){sub n} and tetranucleotide (TAAA){sub n} repeats were identified and may provide genetic marker tools for association and linkage studies. 50 refs., 3 figs., 3 tabs.

  17. Single nucleotide polymorphism screening, molecular characterization, and evolutionary aspects of chicken Piwi genes.


    Wang, H Z; Ma, T; Chang, G B; Wan, F; Liu, X P; Lu, L; Xu, L; Chen, J; Chen, G H


    The P-element-induced wimpy testis (Piwi) gene is involved in germline stem cell self-renewal, meiosis, RNA silencing, and transcriptional regulation. Piwi genes are relatively well conserved in many species, but their function in poultry species is unclear. In this study, Piwi genes were sequenced using a target-sequence capture assay in quail and 28 breeds of chicken. Single nucleotide polymorphisms (SNPs) and evolutionary aspects of these chicken breeds were then analyzed. We found that SNP sites existed mainly in the introns of a few chicken breeds, and we selected an SNP on intron 4 for further verification by Sanger sequencing, the results of which were similar to those obtained by the target-capture sequencing assay. The evolutionary analysis revealed that there were more mutations in the Chahua and Leghorn breeds than in the other breeds, and that the phylogenetic tree was divided into four main categories that suggested that Piwi is evolutionarily conserved, and mutations in the introns might be associated with gametogenesis. The screened SNPs can be used as candidate markers for Piwi, and our results provide basic information for the further study of Piwi function in poultry.

  18. High volume molecular genetic identification of single nucleotide polymorphisms using Genetic Bit Analysis Application to human genetic diagnosis

    SciTech Connect

    Boyce-Jacino, M.T.; Reynolds, J.; Nikiforov, T.


    The most common type of genetic disease-associated mutation is the single nucleotide polymorphism (SNP). Because most genetic diseases can be caused by multiple SNPs in the same gene, effective routine diagnosis of complex genetic diseases is dependent on a simple and reliable method of interrogating SNP sites. Molecular Tool`s solid phase assay capable of direct genotyping (single base sequencing) of SNP sites, Genetic Bit Analysis (GBA), involves hybridization-capture of a single-stranded PCR product to a sequence-specific, microtiter plate-bound oligonucleotide primer. The captured PCR product then acts as template for single-base extension of the capture primer across the polymorphic site, enabling direct determination of the base composition of the polymorphism through a simple colormetric assay. Genotyping in a high volume, semi-automated, processing system with a current capacity of 100 SNP interrogations per technician per day enables the screening of candidate mutations rapidly and cost-effectively, critically important to comprehensive genetic diagnosis. Using this gel-free technology, we have developed prototype diagnostic tests for CFTR and ApoE polymorphisms which enable direct sequencing of the polymorphic base at each site of interest. Routine clinical diagnosis of genetically complex diseases such as cystic fibrosis is dependent on this combination of robust biochemistry and simple format. Additionally, the ability to transfer the format and biochemistry to any disease gene of interest enables the broad application of this technology to clinical diagnostics, especially for genetically complex diseases.

  19. Method for the detection of specific nucleic acid sequences by polymerase nucleotide incorporation


    Castro, Alonso


    A method for rapid and efficient detection of a target DNA or RNA sequence is provided. A primer having a 3'-hydroxyl group at one end and having a sequence of nucleotides sufficiently homologous with an identifying sequence of nucleotides in the target DNA is selected. The primer is hybridized to the identifying sequence of nucleotides on the DNA or RNA sequence and a reporter molecule is synthesized on the target sequence by progressively binding complementary nucleotides to the primer, where the complementary nucleotides include nucleotides labeled with a fluorophore. Fluorescence emitted by fluorophores on single reporter molecules is detected to identify the target DNA or RNA sequence.

  20. Alu-associated enhancement of single nucleotide polymorphisms in the human genome.


    Ng, Siu-Kin; Xue, Hong


    Identifying features shaping the architecture of sequence variations is important for understanding genome evolution and mapping disease loci. In this study, high-resolution scanning of Alu-centered alignments of the human genome sequences has revealed a striking elevation of the frequency of single nucleotide polymorphisms (SNP) in the body and tail of Alu sequences compared to flanking regions. This enhancement in SNP density is evident for all twenty-four chromosomes, and in both the Alu-body and Alu-tail, which together may be referred to as the Alu-SNPs. Reduced levels of Alu-SNPs in the sex chromosomes, especially in the non-recombining NRY region of the Y chromosome, are consistent with recombination events playing an important role in the enhancement. The Alu elements are unstable recombination-mutation hotspots in the human genome, and it is suggested that the Alu-SNPs represent a key manifestation of this instability. Variations in Alu-SNPs among the HapMap populations of northern and western European ancestry (CEU), Han Chinese from Beijing (CHB), Japanese from Tokyo (JPT), and Yoruba from Ibadan, Nigeria (YRI) indicate that the Alu-SNPs provide useful sequence markers, in addition to the Alu-insertion polymorphisms themselves, for the delineation of human genome evolution. That Alu-SNP levels are highest in the youngest Alu-Y, intermediate in the Alu-S of intermediate age, and lowest in the oldest Alu-J is consistent with the occurrence of not only genetic drift but also natural selection on the Alu-SNPs. Such evolutionary selection in turn suggests that Alu-SNPs might include potential sites of disease association, and therefore deserve detailed investigation. PMID:16380220

  1. A single nucleotide polymorphism of the TNRC9 gene associated with breast cancer risk in Chinese Han women.


    Chen, F; Zhou, J; Xue, Y; Yang, S; Xiong, M; Li, Y; Liu, Q


    A single nucleotide polymorphism (SNP) in the TNRC9 gene was identified as a breast cancer susceptibility genetic variant in recent genome-wide association studies of women of European ancestry. We investigated whether TNRC9 polymorphisms are associated with risk of breast cancer in Chinese women of the Han nationality. We genotyped the SNPs rs3803662, rs1362548, rs1123428 in 870 women, including 388 breast cancer patients and 482 healthy controls, via the PCR-single strand conformation polymorphism procedure and by sequence detection. We found that the T allele and the TT genotype of the SNP rs38033662 is significantly associated with risk for breast cancer in Chinese Han women; however, no significant association was found for rs1362548 or rs1123428. We conclude that SNP rs3803662 is a putative risk factor for breast cancer in Chinese Han women.

  2. The nucleotide sequence of cloned wheat dwarf virus DNA

    PubMed Central

    MacDowell, S. W.; Macdonald, H.; Hamilton, W. D. O.; Coutts, R. H. A.; Buck, K. W.


    Restriction analysis and cloning of virus-specific double-stranded DNA isolated from plants infected with wheat dwarf virus (WDV) indicated that the virus genome, like that of maize streak virus (MSV), consists of a single DNA circle. The complete nucleotide sequence of cloned WDV DNA (2749 nucleotides) has been determined. Comparison of the potential coding regions in WDV DNA with those in the DNA of two strains of MSV suggests that these viruses encode at least two functional proteins, the coat protein read in the virion (+) DNA sense and a composite protein, formed from two open reading regions, in the complementary (−) DNA sense. Although WDV and MSV are serologically unrelated their coat proteins showed 35% direct amino acid sequence and their DNAs showed 46% nucleotide sequence homology. There was too little homology between the DNAs of WDV and those of two geminiviruses with bipartite genomes, cassava latent virus (CLV) and tomato golden mosaic virus (TGMV), to align the sequences. However comparison of the amino acid sequences of predicted proteins of WDV, MSV, TGMV and CLV revealed clear relationships between these viruses and suggested that the monopartite and the bipartite geminiviruses have a common ancestral origin. Four inverted repeat sequences which have the potential to form hairpin structures of △G≥-14 kcal/mol were detected in WDV DNA. The sequence TAATATTAC present in the loop of one of these hairpins is conserved in similar putative structures in MSV DNA and in both DNA components of CLV and TGMV and may function as a recognition sequence for a protein involved in virus DNA replication. PMID:15938050

  3. Association between Single Nucleotide Polymorphisms of the Major Histocompatibility Complex Class II Gene and Newcastle Disease Virus Titre and Body Weight in Leung Hang Khao Chickens

    PubMed Central

    Molee, A.; Kongroi, K.; Kuadsantia, P.; Poompramun, C.; Likitdecharote, B.


    The aim of the present study was to investigate the effect of single nucleotide polymorphisms in the major histocompatibility complex (MHC) class II gene on resistance to Newcastle disease virus and body weight of the Thai indigenous chicken, Leung Hang Khao (Gallus gallus domesticus). Blood samples were collected for single nucleotide polymorphism analysis from 485 chickens. Polymerase chain reaction sequencing was used to classify single nucleotide polymorphisms of class II MHC. Body weights were measured at the ages of 3, 4, 5, and 7 months. Titres of Newcastle disease virus at 2 weeks to 7 months were determined and the correlation between body weight and titre was analysed. The association between single nucleotide polymorphisms and body weight and titre were analysed by a generalized linear model. Seven single nucleotide polymorphisms were identified: C125T, A126T, C209G, C242T, A243T, C244T, and A254T. Significant correlations between log titre and body weight were found at 2 and 4 weeks. Associations between single nucleotide polymorphisms and titre were found for C209G and A254T, and between all single nucleotide polymorphisms (except A243T) and body weight. The results showed that class II MHC is associated with both titre of Newcastle disease virus and body weight in Leung Hang Khao chickens. This is of concern because improved growth traits are the main goal of breeding selection. Moreover, the results suggested that MHC has a pleiotropic effect on the titre and growth performance. This mechanism should be investigated in a future study. PMID:26732325

  4. Assessment of Linkage Disequilibrium in Potato Genome With Single Nucleotide Polymorphism Markers

    PubMed Central

    Simko, Ivan; Haynes, Kathleen G.; Jones, Richard W.


    The extent of linkage disequilibrium (LD) is an important factor in designing association mapping experiments. Unlike other plant species that have been analyzed so far for the extent of LD, cultivated potato (Solanum tuberosum L.), an outcrossing species, is a highly heterozygous autotetraploid. The favored genotypes of modern cultivars are maintained by vegetative propagation through tubers. As a first step in the LD analysis, we surveyed both coding and noncoding regions of 66 DNA fragments from 47 accessions for single nucleotide polymorphism (SNP). In the process, we combined information from the potato SNP database with experimental SNP detection. The total length of all analyzed fragments was >25 kb, and the number of screened sequence bases reached almost 1.4 million. Average nucleotide polymorphism (θ = 11.5 × 10−3) and diversity (π = 14.6 × 10−3) was high compared to the other plant species. The overall Tajima's D value (0.5) was not significant, but indicates a deficit of low-frequency alleles relative to expectation. To eliminate the possibility that an elevated D value occurs due to population subdivision, we assessed the population structure with probabilistic statistics. The analysis did not reveal any significant subdivision, indicating a relatively homogenous population structure. However, the analysis of individual fragments revealed the presence of subgroups in the fragment closely linked to the R1 resistance gene. Data pooled from all fragments show relatively fast decay of LD in the short range (r2 = 0.208 at 1 kb) but slow decay afterward (r2 = 0.137 at ∼70 kb). The estimate from our data indicates that LD in potato declines below 0.10 at a distance of ∼10 cM. We speculate that two conflicting factors play a vital role in shaping LD in potato: the outcrossing mating type and the very limited number of meiotic generations. PMID:16783002

  5. Role of single nucleotide polymorphisms in pharmacogenomics and their association with human diseases.


    Chaudhary, Renu; Singh, Bharat; Kumar, Manish; Gakhar, Surendra K; Saini, Adesh K; Parmar, Virinder S; Chhillar, Anil K


    Global statistical data shed light on an alarming trend that every year thousands of people die due to adverse drug reactions as each individual responds in a different way to the same drug. Pharmacogenomics has come up as a promising field in drug development and clinical medication in the past few decades. It has emerged as a ray of hope in preventing patients from developing potentially fatal complications due to adverse drug reactions. Pharmacogenomics also minimizes the exposure to drugs that are less/non-effective and sometimes even found toxic for patients. It is well reported that drugs elicit different responses in different individuals due to variations in the nucleotide sequences of genes encoding for biologically important molecules (drug-metabolizing enzymes, drug targets and drug transporters). Single nucleotide polymorphisms (SNPs), the most common type of polymorphism found in the human genome is believed to be the main reason behind 90% of all types of genetic variations among the individuals. Therefore, pharmacogenomics may be helpful in answering the question as to how inherited differences in a single gene have a profound effect on the mobilization and biological action of a drug. In the present review, we have discussed clinically relevant examples of SNP in associated diseases that can be utilized as markers for "better management of complex diseases" and attempted to correlate the drug response with genetic variations. Attention is also given towards the therapeutic consequences of inherited differences at the chromosomal level and how associated drug disposition and/or drug targets differ in various diseases as well as among the individuals. PMID:25996670

  6. Association between single nucleotide polymorphisms in p53 and abortion in Thoroughbred mares.


    Leon, Priscila Marques Moura de; Campos, Vinicus Farias; Thurow, Helena Strelow; Hartwig, Fernando Pires; Selau, Lisiane Priscila; Dellagostin, Odir Antonio; Neto, José Braccini; Deschamps, João Carlos; Seixas, Fabiana Kömmling; Collares, Tiago


    Single nucleotide polymorphisms (SNPs) in the p53 gene have been studied extensively in humans. The aims of this study were to determine the frequency of the Arg/Pro SNP in p53 in Thoroughbred mares on one stud in Brazil and to correlate p53 genotypes with reproductive performance. SNPs were detected by PCR-restriction fragment length polymorphism in blood samples from 105 horses and confirmed by sequencing. The allele frequency in Thoroughbred mares at codon 72 in exon 4 was 73.3% Arg/Pro, 17.1% Arg/Arg and 9.6% Pro/Pro. The presence of Arg/Pro was significantly associated with abortion (P=0.02), while Pro/Pro mares had a lower probability of abortion (P<0.05). Using a logistic regression model, the dominance effect was significant (P=0.044; odds ratio 7.94) for abortion and additive effects were not significant (P=0.26). p53 may play a role in equine reproduction.

  7. Single nucleotide polymorphism of FSHβ gene associated with reproductive traits in Japanese flounder ( Paralichthys olivaceus)

    NASA Astrophysics Data System (ADS)

    He, Feng; Wen, Haishen; Yu, Dahui; Li, Jifang; Shi, Bao; Chen, Caifang; Zhang, Jiaren; Jin, Guoxiong; Chen, Xiaoyan; Shi, Dan; Yang, Yanping


    Follicle stimulating hormone β (FSHβ) of Japanese flounder ( Paralichthys olivaceus) plays a key role in the regulation of gonadal development. This study aimed to investigate molecular genetic characteristics of the FSHβ gene and elucidate the effects of single nucleotide polymorphisms (SNPs) of FSHβ on reproductive traits in Japanese flounder. We used polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) and sequencing of the FSHβ gene in 60 individuals. We identified only an SNP (T/C) in the coding region of exon3 of FSHβ. The SNP (T/C) did not lead to amino acid changes at the position 340 bp of FSHβ gene. Statistical analysis showed that the SNP was significantly associated with testosterone (T) level and gonadosomatic index (GSI) ( P < 0.05). Individuals with genotype TC of the SNP had significantly higher serum T levels and GSI ( P < 0.05) than that of genotype CC. Therefore, FSHβ gene could be a useful molecular marker in selection for prominent reproductive trait in Japanese Flounder.

  8. Role of six single nucleotide polymorphisms, risk factors in coronary disease, in OLR1 alternative splicing

    PubMed Central

    Tejedor, J. Ramón; Tilgner, Hagen; Iannone, Camilla; Guigó, Roderic; Valcárcel, Juan


    The OLR1 gene encodes the oxidized low-density lipoprotein receptor (LOX-1), which is responsible for the cellular uptake of oxidized LDL (Ox-LDL), foam cell formation in atheroma plaques and atherosclerotic plaque rupture. Alternative splicing (AS) of OLR1 exon 5 generates two protein isoforms with antagonistic functions in Ox-LDL uptake. Previous work identified six single nucleotide polymorphisms (SNPs) in linkage disequilibrium that influence the inclusion levels of OLR1 exon 5 and correlate with the risk of cardiovascular disease. Here we use minigenes to recapitulate the effects of two allelic series (Low- and High-Risk) on OLR1 AS and identify one SNP in intron 4 (rs3736234) as the main contributor to the differences in exon 5 inclusion, while the other SNPs in the allelic series attenuate the drastic effects of this key SNP. Bioinformatic, proteomic, mutational and functional high-throughput analyses allowed us to define regulatory sequence motifs and identify SR protein family members (SRSF1, SRSF2) and HMGA1 as factors involved in the regulation of OLR1 AS. Our results suggest that antagonism between SRSF1 and SRSF2/HMGA1, and differential recognition of their regulatory motifs depending on the identity of the rs3736234 polymorphism, influence OLR1 exon 5 inclusion and the efficiency of Ox-LDL uptake, with potential implications for atherosclerosis and coronary disease. PMID:25904137

  9. Detection of mandarin in orange juice by single-nucleotide polymorphism qPCR assay.


    Aldeguer, Miriam; López-Andreo, María; Gabaldón, José A; Puyet, Antonio


    A dual-probe real time PCR (qPCR) DNA-based analysis was devised for the identification of mandarin in orange juice. A single nucleotide polymorphism at the trnL-trnF intergenic region of the chloroplast chromosome was confirmed in nine orange (Citrus sinensis) and thirteen commercial varieties of mandarin, including Citrus reticulata and Citrus unshiu species and a mandarin × tangelo hybrid. Two short minor-groove binding fluorescent probes targeting the polymorphic sequence were used in the dual-probe qPCR, which allowed the detection of both species in single-tube reactions. The similarity of PCR efficiencies allowed a simple estimation of the ratio mandarin/orange in the juice samples, which correlated to the measured difference of threshold cycle values for both probes. The limit of detection of the assay was 5% of mandarin in orange juice, both when the juice was freshly prepared (not from concentrate) or reconstituted from concentrate, which would allow the detection of fraudulently added mandarin juice. The possible use of the dual-probe system for quantitative measurements was also tested on fruit juice mixtures. qPCR data obtained from samples containing equal amounts of mandarin and orange juice revealed that the mandarin target copy number was approximately 2.6-fold higher than in orange juice. The use of a matrix-adapted control as calibrator to compensate the resulting C(T) bias allowed accurate quantitative measurements to be obtained.

  10. Detection of mandarin in orange juice by single-nucleotide polymorphism qPCR assay.


    Aldeguer, Miriam; López-Andreo, María; Gabaldón, José A; Puyet, Antonio


    A dual-probe real time PCR (qPCR) DNA-based analysis was devised for the identification of mandarin in orange juice. A single nucleotide polymorphism at the trnL-trnF intergenic region of the chloroplast chromosome was confirmed in nine orange (Citrus sinensis) and thirteen commercial varieties of mandarin, including Citrus reticulata and Citrus unshiu species and a mandarin × tangelo hybrid. Two short minor-groove binding fluorescent probes targeting the polymorphic sequence were used in the dual-probe qPCR, which allowed the detection of both species in single-tube reactions. The similarity of PCR efficiencies allowed a simple estimation of the ratio mandarin/orange in the juice samples, which correlated to the measured difference of threshold cycle values for both probes. The limit of detection of the assay was 5% of mandarin in orange juice, both when the juice was freshly prepared (not from concentrate) or reconstituted from concentrate, which would allow the detection of fraudulently added mandarin juice. The possible use of the dual-probe system for quantitative measurements was also tested on fruit juice mixtures. qPCR data obtained from samples containing equal amounts of mandarin and orange juice revealed that the mandarin target copy number was approximately 2.6-fold higher than in orange juice. The use of a matrix-adapted control as calibrator to compensate the resulting C(T) bias allowed accurate quantitative measurements to be obtained. PMID:24128588

  11. Identification of relevant single-nucleotide polymorphisms in Pneumocystis jirovecii: relationship with clinical data.


    Esteves, F; Gaspar, J; Marques, T; Leite, R; Antunes, F; Mansinho, K; Matos, O


    Pneumocystis jirovecii is a poorly understood pathogen that causes opportunistic pneumonia (Pneumocystis pneumonia (PcP)) in patients with AIDS. The present study was aimed at correlating genetic differences in P. jirovecii isolates and clinical patient data. A description of genetic diversity in P. jirovecii isolates from human immunodeficiency virus-positive patients, based on the identification of multiple single-nucleotide polymorphisms (SNPs) at five distinct loci encoding mitochondrial large-subunit rRNA (mtLSU rRNA), cytochrome b (CYB), superoxide dismutase (SOD), dihydrofolate reductase (DHFR), and dihydropteroate synthase (DHPS), was achieved using PCR with DNA sequencing and restriction fragment length polymorphism analysis. The statistical analysis revealed several interesting correlations among the four most relevant SNPs (mt85, SOD110, SOD215, and DHFR312) and specific clinical parameters: mt85C was associated with undiagnosed or atypical PcP episodes and favourable follow-up; SOD215C was associated with favourable follow-up; and DHFR312T was associated with PcP cases presenting moderate to high parasite burdens. The genotypes mt85C/SOD215C and SOD110T/SOD215C were found to be associated with less virulent P. jirovecii infections, whereas the genotype SOD110T/SOD215T was found to be related to more virulent PcP episodes. The present work demonstrated that potential P. jirovecii haplotypes may be related to the clinical data and outcome of PcP.

  12. The primary nucleotide sequence of U4 RNA.


    Reddy, R; Henning, D; Busch, H


    U4 RNA is one of the "capped" nuclear snRNAs recently found to be precipitable by anti-Sm antibodies as ribonucleoprotein particles. U4 RNA, along with other snRNAs, has been implicated in hnRNA processing, mRNA transport, or both (Lerner, M. R., Boyle, J., Mount, S., Wolin, S., and Steitz, J. A. (1980) Nature 283, 220-224). Since the proteins bound to different snRNAs appear to be the same, the functions of different snRNPs might be dependent on the RNA components. To help understand the function of U4 RNP, the nucleotide sequence of U4 RNA was determined. The sequence is (formula see text) In addition to the modified nucleotides in the "cap," U4 RNA contains Am at position 63 and m6A at position 98. It also exhibited A-C microheterogeneity at position 97. PMID:6162848

  13. Nucleotide-Specific Contrast for DNA Sequencing by Electron Spectroscopy.


    Mankos, Marian; Persson, Henrik H J; N'Diaye, Alpha T; Shadman, Khashayar; Schmid, Andreas K; Davis, Ronald W


    DNA sequencing by imaging in an electron microscope is an approach that holds promise to deliver long reads with low error rates and without the need for amplification. Earlier work using transmission electron microscopes, which use high electron energies on the order of 100 keV, has shown that low contrast and radiation damage necessitates the use of heavy atom labeling of individual nucleotides, which increases the read error rates. Other prior work using scattering electrons with much lower energy has shown to suppress beam damage on DNA. Here we explore possibilities to increase contrast by employing two methods, X-ray photoelectron and Auger electron spectroscopy. Using bulk DNA samples with monomers of each base, both methods are shown to provide contrast mechanisms that can distinguish individual nucleotides without labels. Both spectroscopic techniques can be readily implemented in a low energy electron microscope, which may enable label-free DNA sequencing by direct imaging. PMID:27149617

  14. Nucleotide-Specific Contrast for DNA Sequencing by Electron Spectroscopy

    PubMed Central

    Schmid, Andreas K.; Davis, Ronald W.


    DNA sequencing by imaging in an electron microscope is an approach that holds promise to deliver long reads with low error rates and without the need for amplification. Earlier work using transmission electron microscopes, which use high electron energies on the order of 100 keV, has shown that low contrast and radiation damage necessitates the use of heavy atom labeling of individual nucleotides, which increases the read error rates. Other prior work using scattering electrons with much lower energy has shown to suppress beam damage on DNA. Here we explore possibilities to increase contrast by employing two methods, X-ray photoelectron and Auger electron spectroscopy. Using bulk DNA samples with monomers of each base, both methods are shown to provide contrast mechanisms that can distinguish individual nucleotides without labels. Both spectroscopic techniques can be readily implemented in a low energy electron microscope, which may enable label-free DNA sequencing by direct imaging. PMID:27149617

  15. Short PNA molecular beacons for real-time PCR allelic discrimination of single nucleotide polymorphisms.


    Petersen, Kenneth; Vogel, Ulla; Rockenbauer, Eszter; Nielsen, Kirsten Vang; Kølvraa, Steen; Bolund, Lars; Nexø, Bjørn


    The typing of a single nucleotide polymorphism with DNA probes is sometimes problematic because of the limited discriminating power of long DNA probes. As an alternative to existing assays, we have developed a real-time PCR assay for the genotyping of single nucleotide polymorphisms using short peptide nucleic acid (PNA) molecular beacons. A single nucleotide polymorphism in exon 6 of the XPD gene was chosen as the model system. The genotyping experiments were performed in the ABI 7700 using beacons labeled with either fluorescein or JOE, and in the Lightcycler using a fluorescein labeled beacon. QSY-7 was used as the quencher in all the beacons. The result of the genotyping was the same on both instruments and was in agreement with a previously performed RFLP genotyping of 79 samples. The length of PNA molecular beacons is significantly shorter than that of TaqMan or Lightcycler probes, making probe design and genotype discrimination easier.

  16. Reduced X-linked nucleotide polymorphism in Drosophila simulans.


    Begun, D J; Whitley, P


    Population genetic theory predicts that selectively driven changes of allele frequency for both beneficial and deleterious mutants reduce polymorphism at tightly linked sites. All else being equal, these reductions in polymorphism are expected to be greater when recombination rates are lower. Therefore, the empirical observation of a positive correlation between recombination rates and amounts of DNA polymorphism across the Drosophila melanogaster genome can be explained by two very different types of natural selection. Here, we evaluate alternative models of effects of selection on linked sites by comparison of X-linked and autosomal variation. We present polymorphism data from 40 genes distributed across chromosome arms X and 3R of Drosophila simulans, a sibling species of D. melanogaster. We find significantly less silent polymorphism in D. simulans on the X chromosome than on 3R, but no difference between arms for silent divergence between species. This pattern is incompatible with predictions from theoretical studies on the effect of negative selection on linked sites. We propose that some form of positive selection having greater effects on sex chromosomes than on autosomes is the better explanation for the D. simulans data.

  17. Identification of novel single nucleotide polymorphisms (SNPs) in deer (Odocoileus spp.) using the BovineSNP50 BeadChip.


    Haynes, Gwilym D; Latch, Emily K


    Single nucleotide polymorphisms (SNPs) are growing in popularity as a genetic marker for investigating evolutionary processes. A panel of SNPs is often developed by comparing large quantities of DNA sequence data across multiple individuals to identify polymorphic sites. For non-model species, this is particularly difficult, as performing the necessary large-scale genomic sequencing often exceeds the resources available for the project. In this study, we trial the Bovine SNP50 BeadChip developed in cattle (Bos taurus) for identifying polymorphic SNPs in cervids Odocoileus hemionus (mule deer and black-tailed deer) and O. virginianus (white-tailed deer) in the Pacific Northwest. We found that 38.7% of loci could be genotyped, of which 5% (n = 1068) were polymorphic. Of these 1068 polymorphic SNPs, a mixture of putatively neutral loci (n = 878) and loci under selection (n = 190) were identified with the F(ST)-outlier method. A range of population genetic analyses were implemented using these SNPs and a panel of 10 microsatellite loci. The three types of deer could readily be distinguished with both the SNP and microsatellite datasets. This study demonstrates that commercially developed SNP chips are a viable means of SNP discovery for non-model organisms, even when used between very distantly related species (the Bovidae and Cervidae families diverged some 25.1-30.1 million years before present).

  18. The complete nucleotide sequence of pelargonium leaf curl virus.


    McGavin, Wendy J; MacFarlane, Stuart A


    Investigation of a tombusvirus isolated from tulip plants in Scotland revealed that it was pelargonium leaf curl virus (PLCV) rather than the originally suggested tomato bushy stunt virus. The complete sequence of the PLCV genome was determined for the first time, revealing it to be 4789 nucleotides in size and to have an organization similar to that of the other, previously described tombusviruses. Primers derived from the sequence were used to construct a full-length infectious clone of PLCV that recapitulates the disease symptoms of leaf curling in systemically infected pelargonium plants.

  19. The complete nucleotide sequence of pelargonium leaf curl virus.


    McGavin, Wendy J; MacFarlane, Stuart A


    Investigation of a tombusvirus isolated from tulip plants in Scotland revealed that it was pelargonium leaf curl virus (PLCV) rather than the originally suggested tomato bushy stunt virus. The complete sequence of the PLCV genome was determined for the first time, revealing it to be 4789 nucleotides in size and to have an organization similar to that of the other, previously described tombusviruses. Primers derived from the sequence were used to construct a full-length infectious clone of PLCV that recapitulates the disease symptoms of leaf curling in systemically infected pelargonium plants. PMID:26906694

  20. Fluorogenic sequencing using halogen-fluorescein-labeled nucleotides.


    Chen, Zitian; Duan, Haifeng; Qiao, Shuo; Zhou, Wenxiong; Qiu, Haiwei; Kang, Li; Xie, X Sunney; Huang, Yanyi


    Fluorogenic sequencing is a sequencing-by-synthesis technology that combines the advantages of pyrosequencing and fluorescence detection. With native duplex DNA as the major product, we employ polymerase to incorporate the complement- arily matched terminal phosphate-labeled fluorogenic nucleotides into the DNA template and release halogen-fluorescein as the reporter. This red-emitting fluorophore successfully avoids spectral overlap with the autofluorescence background of the flow chip. We fully characterized the enzymatic reaction kinetics of the new substrates, and performed a 35-base sequencing experiment with 60 reaction cycles. Our achievement expands the substrate repertoire for fluorogenic sequencing, and extends the spectral range to obtain better signal-to-background performance.

  1. Single nucleotide polymorphisms in rye (Secale cereale L.): discovery, frequency, and applications for genome mapping and diversity studies.


    Varshney, R K; Beier, U; Khlestkina, E K; Kota, R; Korzun, V; Graner, A; Börner, A


    To elucidate the potential of single nucleotide polymorphism (SNP) markers in rye, a set of 48 barley EST (expressed sequence tag) primer pairs was employed to amplify from DNA prepared from five rye inbred lines. A total of 96 SNPs and 26 indels (insertion-deletions) were defined from the sequences of 14 of the resulting amplicons, giving an estimated frequency of 1 SNP per 58 bp and 1 indel per 214 bp in the rye transcriptome. A mean of 3.4 haplotypes per marker with a mean expected heterozygosity of 0.66 were observed. The nucleotide diversity index (pi) was estimated to be in the range 0.0059-0.0530. To improve assay cost-effectiveness, 12 of the 14 SNPs were converted to a cleaved amplified polymorphic sequence (CAPS) format. The resulting 12 SNP loci mapped to chromosomes 1R, 3R, 4R, 5R, 6R, and 7R, at locations consistent with their known map positions in barley. SNP genotypic data were compared with genomic simple sequence repeat (SSR) and EST-derived SSR genotypic data collected from the same templates. This showed a broad equivalence with respect to genetic diversity between these different data types. PMID:17345059

  2. Nucleotide sequence of the hypervariable region of the human C2 gene

    SciTech Connect

    Zhu, Z.B.; Volanakis, J.V. )


    It has been previously suggested that the multiallelic Bam H1/Sst I RFLPs of the human C2 gene arose through deletion/insertion of a tandemly-repeated minisatellite region. In this study the authors subcloned and sequenced the Sst I polymorphic fragment of the b haplotype of the C2 gene. This restriction fragment is 2,450 bp long and maps 1,550 bp 3{prime} of exon 3. Its nucleotide sequence is characterized by the presence of at least 4 different repeated regions varying in size from 18 to 58 bp. One of these regions starting at position 1,413 is 48 bp long and is repeated five times. The first 3 repeats are in tandem and are separated by 72 bp from two additional tandem repeats. Sequence homology among the 5 repeats ranges between 93 and 98%. Eighty three percent of the nucleotides of the repeated-region are G or C. It seems likely that this nucleotide repeat resulted in the multiallelic RFLPs through a mechanism of unequal recombination or replication slippage.

  3. Novel Single Nucleotide Polymorphism-Based Assay for Genotyping Mycobacterium avium subsp. paratuberculosis

    PubMed Central

    Goldstone, Robert J.; McLuckie, Joyce; Smith, David G. E.


    Typing of Mycobacterium avium subspecies paratuberculosis strains presents a challenge, since they are genetically monomorphic and traditional molecular techniques have limited discriminatory power. The recent advances and availability of whole-genome sequencing have extended possibilities for the characterization of Mycobacterium avium subspecies paratuberculosis, and whole-genome sequencing can provide a phylogenetic context to facilitate global epidemiology studies. In this study, we developed a single nucleotide polymorphism (SNP) assay based on PCR and restriction enzyme digestion or sequencing of the amplified product. The SNP analysis was performed using genome sequence data from 133 Mycobacterium avium subspecies paratuberculosis isolates with different genotypes from 8 different host species and 17 distinct geographic regions around the world. A total of 28,402 SNPs were identified among all of the isolates. The minimum number of SNPs required to distinguish between all of the 133 genomes was 93 and between only the type C isolates was 41. To reduce the number of SNPs and PCRs required, we adopted an approach based on sequential detection of SNPs and a decision tree. By the analysis of 14 SNPs Mycobacterium avium subspecies paratuberculosis isolates can be characterized within 14 phylogenetic groups with a higher discriminatory power than mycobacterial interspersed repetitive unit–variable number tandem repeat assay and other typing methods. Continuous updating of genome sequences is needed in order to better characterize new phylogenetic groups and SNP profiles. The novel SNP assay is a discriminative, simple, reproducible method and requires only basic laboratory equipment for the large-scale global typing of Mycobacterium avium subspecies paratuberculosis isolates. PMID:26677250

  4. Novel Single Nucleotide Polymorphism-Based Assay for Genotyping Mycobacterium avium subsp. paratuberculosis.


    Leão, Célia; Goldstone, Robert J; Bryant, Josephine; McLuckie, Joyce; Inácio, João; Smith, David G E; Stevenson, Karen


    Typing of Mycobacterium avium subspecies paratuberculosis strains presents a challenge, since they are genetically monomorphic and traditional molecular techniques have limited discriminatory power. The recent advances and availability of whole-genome sequencing have extended possibilities for the characterization of Mycobacterium avium subspecies paratuberculosis, and whole-genome sequencing can provide a phylogenetic context to facilitate global epidemiology studies. In this study, we developed a single nucleotide polymorphism (SNP) assay based on PCR and restriction enzyme digestion or sequencing of the amplified product. The SNP analysis was performed using genome sequence data from 133 Mycobacterium avium subspecies paratuberculosis isolates with different genotypes from 8 different host species and 17 distinct geographic regions around the world. A total of 28,402 SNPs were identified among all of the isolates. The minimum number of SNPs required to distinguish between all of the 133 genomes was 93 and between only the type C isolates was 41. To reduce the number of SNPs and PCRs required, we adopted an approach based on sequential detection of SNPs and a decision tree. By the analysis of 14 SNPs Mycobacterium avium subspecies paratuberculosis isolates can be characterized within 14 phylogenetic groups with a higher discriminatory power than mycobacterial interspersed repetitive unit-variable number tandem repeat assay and other typing methods. Continuous updating of genome sequences is needed in order to better characterize new phylogenetic groups and SNP profiles. The novel SNP assay is a discriminative, simple, reproducible method and requires only basic laboratory equipment for the large-scale global typing of Mycobacterium avium subspecies paratuberculosis isolates.

  5. Discovery and verification of functional single nucleotide polymorphisms in regulatory genomic regions: Current and developing technologies

    PubMed Central

    Chorley, Brian N.; Wang, Xuting; Campbell, Michelle R.; Pittman, Gary S.; Noureddine, Maher A.; Bell, Douglas A.


    The most common form of genetic variation, single nucleotide polymorphisms or SNPs, can affect the way an individual responds to the environment and modify disease risk. Although most of the millions of SNPs have little or no effect on gene regulation and protein activity, there are many circumstances where base changes can have deleterious effects. Non-synonymous SNPs that result in amino acid changes in proteins have been studied because of their obvious impact on protein activity. It is well known that SNPs within regulatory regions of the genome can result in disregulation of gene transcription. However, the impact of SNPs located in putative regulatory regions, or rSNPs, is harder to predict for two primary reasons. First, the mechanistic roles of non-coding genomic sequence remain poorly defined. Second, experimental validation of the functional consequences of rSNPs is often slow and laborious. In this review, we summarize traditional and novel methodologies for candidate rSNPs selection, in particular in silico techniques that aid in candidate rSNP selection. Additionally we will discuss molecular biological techniques that assess the impact of rSNPs on binding of regulatory machinery, as well as functional consequences on transcription. Standard techniques such as EMSA and luciferase reporter constructs are still widely used to assess effects of rSNPs on binding and gene transcription; however, these protocols are often bottlenecks in the discovery process. Therefore, we highlight novel and developing high-throughput protocols that promise to aid in shortening the process of rSNP validation. Given the large amount of genomic information generated from a multitude of re-sequencing and genome-wide SNP array efforts, future focus should be to develop validation techniques that will allow greater understanding of the impact these polymorphisms have on human health and disease. PMID:18565787

  6. Comparing compressed sequences for faster nucleotide BLAST searches.


    Cameron, Michael; Williams, Hugh E


    Molecular biologists, geneticists, and other life scientists use the BLAST homology search package as their first step for discovery of information about unknown or poorly annotated genomic sequences. There are two main variants of BLAST: BLASTP for searching protein collections and BLASTN for nucleotide collections. Surprisingly, BLASTN has had very little attention; for example, the algorithms it uses do not follow those described in the 1997 BLAST paper and no exact description has been published. It is important that BLASTN is state-of-the-art: Nucleotide collections such as GenBank dwarf the protein collections in size, they double in size almost yearly, and they take many minutes to search on modern general purpose workstations. This paper proposes significant improvements to the BLASTN algorithms. Each of our schemes is based on compressed bytepacked formats that allow queries and collection sequences to be compared four bases at a time, permitting very fast query evaluation using lookup tables and numeric comparisons. Our most significant innovations are two new, fast gapped alignment schemes that allow accurate sequence alignment without decompression of the collection sequences. Overall, our innovations more than double the speed of BLASTN with no effect on accuracy and have been integrated into our new version of BLAST that is freely available for download from PMID:17666756

  7. Comparing compressed sequences for faster nucleotide BLAST searches.


    Cameron, Michael; Williams, Hugh E


    Molecular biologists, geneticists, and other life scientists use the BLAST homology search package as their first step for discovery of information about unknown or poorly annotated genomic sequences. There are two main variants of BLAST: BLASTP for searching protein collections and BLASTN for nucleotide collections. Surprisingly, BLASTN has had very little attention; for example, the algorithms it uses do not follow those described in the 1997 BLAST paper and no exact description has been published. It is important that BLASTN is state-of-the-art: Nucleotide collections such as GenBank dwarf the protein collections in size, they double in size almost yearly, and they take many minutes to search on modern general purpose workstations. This paper proposes significant improvements to the BLASTN algorithms. Each of our schemes is based on compressed bytepacked formats that allow queries and collection sequences to be compared four bases at a time, permitting very fast query evaluation using lookup tables and numeric comparisons. Our most significant innovations are two new, fast gapped alignment schemes that allow accurate sequence alignment without decompression of the collection sequences. Overall, our innovations more than double the speed of BLASTN with no effect on accuracy and have been integrated into our new version of BLAST that is freely available for download from

  8. Investigating single nucleotide polymorphism (SNP) density in the human genome and its implications for molecular evolution.


    Zhao, Zhongming; Fu, Yun-Xin; Hewett-Emmett, David; Boerwinkle, Eric


    We investigated the single nucleotide polymorphism (SNP) density across the human genome and in different genic categories using two SNP databases: Celera's CgsSNP, which includes SNPs identified by comparing genomic sequences, and Celera's RefSNP, which includes SNPs from a variety of sources and is biased toward disease-associated genes. Based on CgsSNP, the average numbers of SNPs per 10 kb was 8.33, 8.44, and 8.09 in the human genome, in intergenic regions, and in genic regions, respectively. In genic regions, the SNP density in intronic, exonic and adjoining untranslated regions was 8.21, 5.28, and 7.51 SNPs per 10 kb, respectively. The pattern of SNP density based on RefSNP was different from that based on CgsSNP, emphasizing its utility for genotype-phenotype association studies but not for most population genetic studies. The number of SNPs per chromosome was correlated with chromosome length, but the density of SNPs estimated by CgsSNP was not significantly correlated with the GC content of the chromosome. Based on CgsSNP, the ratio of nonsense to missense mutations (0.027), the ratio of missense to silent mutations (1.15), and the ratio of non-synonymous to synonymous mutations (1.18) was less than half of that expected in a human protein coding sequence under the neutral mutation theory, reflecting a role for natural selection, especially purifying selection. PMID:12909357

  9. Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates.


    Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew


    Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains.

  10. Bioinformatics of varicella-zoster virus: Single nucleotide polymorphisms define clades and attenuated vaccine genotypes

    PubMed Central

    Chow, Vincent T.; Tipples, Graham A.; Grose, Charles


    Varicella zoster virus (VZV) is one of the human herpesviruses. To date, over 40 complete VZV genomes have been sequenced and analyzed. The VZV genome contains around 125,000 base pairs including 70 open reading frames (ORFs). Enumeration of single nucleotide polymorphisms (SNPs) has determined that the following ORFs are the most variable (in descending order): 62, 22, 29, 28, 37, 21, 54, 31, 1 and 55. ORF 62 is the major immediate early regulatory VZV gene. Further SNP analysis across the entire genome has led to the observation that VZV strains can be broadly grouped into clades within a phylogenetic tree. VZV strains collected in Singapore provided important sequence data for construction of the phylogenetic tree. Currently 5 VZV clades are recognized; they have been designated clades 1 through 5. Clades 1 and 3 include European/North American strains; clade 2 includes Asian strains, especially from Japan; and clade 5 includes strains from India. Clade 4 includes some strains from Europe, but its geographic origins need further documentation.. Within clade 1, five variant viruses have been isolated with a missense mutation in the gE (ORF 68) glycoprotein; these strains have an altered increased cell spread phenotype. Bioinformatics analyses of the attenuated vaccine strains have also been performed, with a subsequent discovery of a stop-codon SNP in ORFO as a likely attenuation determinant. Taken together, these VZV bioinformatics analyses have provided enormous insights into VZV phylogenetics as well as VZV SNPs associated with attenuation. PMID:23183312

  11. Extremely low nucleotide polymorphism in Pinus krempfii Lecomte, a unique flat needle pine endemic to Vietnam

    PubMed Central

    Wang, Baosheng; Khalili Mahani, Marjan; Ng, Wei Lun; Kusumi, Junko; Phi, Hai Hong; Inomata, Nobuyuki; Wang, Xiao-Ru; Szmidt, Alfred E


    Pinus krempfii Lecomte is a morphologically and ecologically unique pine, endemic to Vietnam. It is regarded as vulnerable species with distribution limited to just two provinces: Khanh Hoa and Lam Dong. Although a few phylogenetic studies have included this species, almost nothing is known about its genetic features. In particular, there are no studies addressing the levels and patterns of genetic variation in natural populations of P. krempfii. In this study, we sampled 57 individuals from six natural populations of P. krempfii and analyzed their sequence variation in ten nuclear gene regions (approximately 9 kb) and 14 mitochondrial (mt) DNA regions (approximately 10 kb). We also analyzed variation at seven chloroplast (cp) microsatellite (SSR) loci. We found very low haplotype and nucleotide diversity at nuclear loci compared with other pine species. Furthermore, all investigated populations were monomorphic across all mitochondrial DNA (mtDNA) regions included in our study, which are polymorphic in other pine species. Population differentiation at nuclear loci was low (5.2%) but significant. However, structure analysis of nuclear loci did not detect genetically differentiated groups of populations. Approximate Bayesian computation (ABC) using nuclear sequence data and mismatch distribution analysis for cpSSR loci suggested recent expansion of the species. The implications of these findings for the management and conservation of P. krempfii genetic resources were discussed. PMID:25360263

  12. Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates.


    Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew


    Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains. PMID:26130851

  13. Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates

    PubMed Central

    Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew


    Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains. PMID:26130851

  14. [Association between single nucleotide polymorphism of MC4R gene and carcass traits in rabbits].


    Jiang, Mei-Shan; Chen, Shi-Yi; Lai, Song-Jia; Deng, Xiao-Song; Chen, Yun; Wan, Jie


    Single nucleotide polymorphisms in the coding sequence of melanoeortin-4 receptor (MC4R) gene were detected by PCR-SSCP and DNA sequencing method in Harbin white rabbit, Tianfu black rabbit, Belgian hare, ZIKA rabbit, and California rabbit breeds. A-->G conversion mutation at base position 237 was found with high frequency in Harbin white rabbit, Belgian hare, and Zika rabbit and low frequency in Tianfu black rabbit and California rabbit. The allele A was pre-dominant allele for each of meat rabbit breeds. AA genotype frequency was higher than AG genotype in the five studied rabbit breeds. GLM analysis for the effect of genotypes on performance traits demonstrated that AG genotype was significantly associated with body weight, eviscerated weight and feed conversion efficiency (P<0.05), but not significantly associated with cooking loss (P>0.05). It was concluded from the results that MC4R gene could be a candidate modifier gene that affects or controls body weight and carcass traits of rabbit.

  15. [Association between single nucleotide polymorphism of MC4R gene and carcass traits in rabbits].


    Jiang, Mei-Shan; Chen, Shi-Yi; Lai, Song-Jia; Deng, Xiao-Song; Chen, Yun; Wan, Jie


    Single nucleotide polymorphisms in the coding sequence of melanoeortin-4 receptor (MC4R) gene were detected by PCR-SSCP and DNA sequencing method in Harbin white rabbit, Tianfu black rabbit, Belgian hare, ZIKA rabbit, and California rabbit breeds. A-->G conversion mutation at base position 237 was found with high frequency in Harbin white rabbit, Belgian hare, and Zika rabbit and low frequency in Tianfu black rabbit and California rabbit. The allele A was pre-dominant allele for each of meat rabbit breeds. AA genotype frequency was higher than AG genotype in the five studied rabbit breeds. GLM analysis for the effect of genotypes on performance traits demonstrated that AG genotype was significantly associated with body weight, eviscerated weight and feed conversion efficiency (P<0.05), but not significantly associated with cooking loss (P>0.05). It was concluded from the results that MC4R gene could be a candidate modifier gene that affects or controls body weight and carcass traits of rabbit. PMID:19073572

  16. Bioinformatics comparison of sulfate-reducing metabolism nucleotide sequences

    NASA Astrophysics Data System (ADS)

    Tremberger, G.; Dehipawala, Sunil; Nguyen, A.; Cheung, E.; Sullivan, R.; Holden, T.; Lieberman, D.; Cheung, T.


    The sulfate-reducing bacteria can be traced back to 3.5 billion years ago. The thermodynamics details of the sulfur cycle have been well documented. A recent sulfate-reducing bacteria report (Robator, Jungbluth, et al , 2015 Jan, Front. Microbiol) with Genbank nucleotide data has been analyzed in terms of the sulfite reductase (dsrAB) via fractal dimension and entropy values. Comparison to oil field sulfate-reducing sequences was included. The AUCG translational mass fractal dimension versus ATCG transcriptional mass fractal dimension for the low temperature dsrB and dsrA sequences reported in Reference Thirteen shows correlation R-sq ~ 0.79 , with a probably of about 3% in simulation. A recent report of using Cystathionine gamma-lyase sequence to produce CdS quantum dot in a biological method, where the sulfur is reduced just like in the H2S production process, was included for comparison. The AUCG mass fractal dimension versus ATCG mass fractal dimension for the Cystathionine gamma-lyase sequences was found to have R-sq of 0.72, similar to the low temperature dissimilatory sulfite reductase dsr group with 3% probability, in contrary to the oil field group having R-sq ~ 0.94, a high probable outcome in the simulation. The other two simulation histograms, namely, fractal dimension versus entropy R-sq outcome values, and di-nucleotide entropy versus mono-nucleotide entropy R-sq outcome values are also discussed in the data analysis focusing on low probability outcomes.

  17. Evidence for Balancing Selection from Nucleotide Sequence Analyses of Human G6PD

    PubMed Central

    Verrelli, Brian C.; McDonald, John H.; Argyropoulos, George; Destro-Bisol, Giovanni; Froment, Alain; Drousiotou, Anthi; Lefranc, Gerard; Helal, Ahmed N.; Loiselet, Jacques; Tishkoff, Sarah A.


    Glucose-6-phosphate dehydrogenase (G6PD) mutations that result in reduced enzyme activity have been implicated in malarial resistance and constitute one of the best examples of selection in the human genome. In the present study, we characterize the nucleotide diversity across a 5.2-kb region of G6PD in a sample of 160 Africans and 56 non-Africans, to determine how selection has shaped patterns of DNA variation at this gene. Our global sample of enzymatically normal B alleles and A, A−, and Med alleles with reduced enzyme activities reveals many previously uncharacterized silent-site polymorphisms. In comparison with the absence of amino acid divergence between human and chimpanzee G6PD sequences, we find that the number of G6PD amino acid polymorphisms in human populations is significantly high. Unlike many other G6PD-activity alleles with reduced activity, we find that the age of the A variant, which is common in Africa, may not be consistent with the recent emergence of severe malaria and therefore may have originally had a historically different adaptive function. Overall, our observations strongly support previous genotype-phenotype association studies that proposed that balancing selection maintains G6PD deficiencies within human populations. The present study demonstrates that nucleotide sequence analyses can reveal signatures of both historical and recent selection in the genome and may elucidate the impact that infectious disease has had during human evolution. PMID:12378426

  18. Cytochrome b nucleotide sequence variation among the Atlantic Alcidae.


    Friesen, V L; Montevecchi, W A; Davidson, W S


    Analysis of cytochrome b nucleotide sequences of the six extant species of Atlantic alcids and a gull revealed an excess of adenines and cytosines and a deficit of guanines at silent sites on the coding strand. Phylogenetic analyses grouped the sequences of the common (Uria aalge) and Brünnich's (U. lomvia) guillemots, followed by the razorbill (Alca torda) and little auk (Alle alle). The black guillemot (Cepphus grylle) sequence formed a sister taxon, and the puffin (Fratercula arctica) fell outside the other alcids. Phylogenetic comparisons of substitutions indicated that mutabilities of bases did not differ, but that C was much more likely to be incorporated than was G. Imbalances in base composition appear to result from a strand bias in replication errors, which may result from selection on secondary RNA structure and/or the energetics of codon-anticodon interactions. PMID:7916741

  19. Detection of protein similarities using nucleotide sequence databases.


    Henikoff, S; Wallace, J C


    A simple procedure is described for finding similarities between proteins using nucleotide sequence databases. The approach is illustrated by several examples of previously unknown correspondences with important biological implications: Drosophila elongation factor Tu is shown to be encoded by two genes that are differently expressed during development; a cluster of three Drosophila genes likely encode maltases; a flesh-fly fat body protein resembles the hypothesized Drosophila alcohol dehydrogenase ancestral protein; an unknown protein encoded at the multifunctional E. coli hisT locus resembles aspartate beta-semialdehyde dehydrogenase; and the E. coli tyrR protein is related to nitrogen regulatory proteins. These and other matches were discovered using a personal computer of the type available in most laboratories collecting DNA sequence data. As relatively few sequences were sampled to find these matches, it is likely that much of the existing data has not been adequately examined.

  20. Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.


    Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T


    This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments.

  1. Association of single nucleotide polymorphisms in candidate genes residing under quantitative trait loci in beef cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objective was to assess the association of single nucleotide polymorphisms (SNP) developed on candidate genes residing under previously identified quantitative trait loci for marbling score and meat tenderness. Two hundred five SNP were identified on twenty candidate genes. Genes selected under ...

  2. Increasing the number of single nucleotide polymorphisms used in genomic evaluation of dairy cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    GeneSeek designed a new version of the GeneSeek Genomic Profiler HD BeadChip for Dairy Cattle, which had >77,000 single nucleotide polymorphisms (SNPs). A set of >140,000 SNPs was selected that included all SNPs on the existing GeneSeek chip, all SNPs used in U.S. national genomic evaluations, SNPs ...

  3. Verification of genetic identity of introduced cacao germplasm in Ghana using single nucleotide polymorphism (SNP) markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Accurate identification of individual genotypes is important for cacao (Theobroma cacao L.) breeding, germplasm conservation and seed propagation. The development of single nucleotide polymorphism (SNP) markers in cacao offers an effective way to use a high-throughput genotyping system for cacao gen...

  4. Assessment of the nucleotide sequence variability in the bovine T-cell receptor alpha delta joining gene region.


    Fries, R; Ewald, D; Thaller, G; Buitkamp, J


    The sequence of 2,193 nucleotides from the bovine T-cell receptor alpha/delta joining gene region (TCRADJ) was determined and compared with the corresponding human and murine sequences. The identity was 75.3% for the comparison of the Bos taurus vs. the Homo sapiens sequence and 63.8% for the Bos taurus vs. the Mus musculus sequence. This comparison permitted the identification of the putatively functional elements within the bovine sequence. Direct sequencing of 2,110 nucleotides in nine animals revealed 12 variable sites. Estimates, based on direct sequencing in three Holstein Friesian animals, for the two measures of sequence variability, nucleotide polymorphism (u) and nucleotide diversity (p), were 0.00050 (60.00036) and 0.00077 (60.00056), respectively. The test statistic, Tajima's D, for the comparison of the two measures indicates that the difference between u and p is close to significance (P < 0.05), suggesting the possibility of selective forces acting on the studied genomic region. Allelic variation at 5 of the 12 variable sites was analysed in 359 animals (48 Anatolian Black, 56 Braunvieh, 115 Fleckvieh, 47 Holstein Friesian, 50 Simmental and 43 Pinzgauer) using the oligonucleotide ligation assay (OLA) in combination with the enzyme linked immunoabsorbant assay (ELISA). Nine unambiguous haplotypes could be derived based on animals with a maximum of one heterozygous site. Four to seven haplotypes were present in the different breeds. When taking into account the frequencies of the haplotypes in the different breeds, especially in Anatolian Black, an ancestral cattle population, we could establish the likely phylogenetic relationships of the haplotypes. Such haplotype trees are the basis for cladistic candidate gene analysis. Our study demonstrates that the systematic search of single nucleotide polymorphisms (SNPs) is useful for analysing all aspects of variability of a given genomic region.

  5. Nucleotide sequence and expression of a Drosophila metallothionein.


    Lastowski-Perry, D; Otto, E; Maroni, G


    A Drosophila melanogaster cDNA clone was isolated based on its more intense hybridization to RNA sequences from copper-fed larvae than from control larval RNA. This clone showed strong hybridization to mouse metallothionein I cDNA at reduced stringency. Its nucleotide sequence includes an open reading segment which codes for a 40-amino acid protein; this protein is identified as metallothionein based on its similarity to the amino-terminal portion of mammalian and crab metalloproteins. The 10 cysteine residues present occur in five pairs of near vicinal cysteines (Cys-X-Cys). This cDNA sequence hybridized to a 400-nucleotide polyadenylated RNA whose presence in the cells of the alimentary canal of larvae was stimulated by ingestion of cadmium or copper; in other tissues this RNA was present at much lower levels. Mercury, silver, and zinc induced metallothionein to a lesser extent. The level of metallothionein RNA increased very soon after the initiation of metal treatment and reached a maximum after approximately 36 h. PMID:2578462

  6. Nucleotide sequence of the vaccinia virus hemagglutinin gene.


    Shida, H


    Vaccinia virus hemagglutinin (HA) is expressed at late time of infection cycle, and it is nonessential for virus growth. Location of the HA structural gene was determined by hybrid-arrested and hybrid-selected translation methods at the right terminus of the HindIII A fragment. The position of the HA gene was confirmed by the production of the complete HA protein in the cells transfected with the plasmid containing that region. Examination of this nucleotide sequence revealed the positions of cleavage sites for a number of restriction endonucleases. The deduced amino acid sequence revealed that the HA protein is a member of typical surface membrane glycoproteins. Comparison of the nucleotide sequence upstream of the HA coding region with corresponding region of other late genes suggested the existence of the consensus decanucleotides TTCATTTa/tGT between 34 to 18 bp upstream to the initiation codon followed by a cluster of A or T, a unique feature of the late genes of vaccinia virus. These results in conjunction with the ease of isolating HA- mutants provide a basis for a new site suitable for inserting foreign genes.

  7. Blau syndrome polymorphisms in NOD2 identify nucleotide hydrolysis and helical domain 1 as signalling regulators.


    Parkhouse, Rhiannon; Boyle, Joseph P; Monie, Tom P


    Understanding how single nucleotide polymorphisms (SNPs) lead to disease at a molecular level provides a starting point for improved therapeutic intervention. SNPs in the innate immune receptor nucleotide oligomerisation domain 2 (NOD2) can cause the inflammatory disorders Blau Syndrome (BS) and early onset sarcoidosis (EOS) through receptor hyperactivation. Here, we show that these polymorphisms cluster into two primary locations: the ATP/Mg(2+)-binding site and helical domain 1. Polymorphisms in these two locations may consequently dysregulate ATP hydrolysis and NOD2 autoinhibition, respectively. Complementary mutations in NOD1 did not mirror the NOD2 phenotype, which indicates that NOD1 and NOD2 are activated and regulated by distinct methods. PMID:25093298

  8. C868T single nucleotide polymorphism and HIV type 1 disease progression among postpartum women in Kenya.


    Choi, Robert Y; Fowke, Keith R; Juno, Jennifer; Lohman-Payne, Barbara; Oyugi, Julius O; Brown, Elizabeth R; Bosire, Rose; John-Stewart, Grace; Farquhar, Carey


    The C868T single nucleotide polymorphism in the CD4 receptor encodes an amino acid substitution of tryptophan for arginine in the third domain. Previous studies suggest that C868T increases the risk of HIV-1 acquisition; however, the influence of this single nucleotide polymorphism (SNP) on disease progression has not been established. The presence of the C868T polymorphism was not statistically significantly associated with HIV-1 disease progression outcomes in a cohort of postpartum Kenyan women.

  9. Single nucleotide polymorphisms in genes associated with isoniazid resistance in Mycobacterium tuberculosis.


    Ramaswamy, Srinivas V; Reich, Robert; Dou, Shu-Jun; Jasperse, Linda; Pan, Xi; Wanger, Audrey; Quitugua, Teresa; Graviss, Edward A


    Isoniazid (INH) is a central component of drug regimens used worldwide to treat tuberculosis. Previous studies have identified resistance-associated mutations in katG, inhA, kasA, ndh, and the oxyR-ahpC intergenic region. DNA microarray-based experiments have shown that INH induces several genes in Mycobacterium tuberculosis that encode proteins physiologically relevant to the drug's mode of action. To gain further insight into the molecular genetic basis of INH resistance, 20 genes implicated in INH resistance were sequenced for INH resistance-associated mutations. Thirty-eight INH-monoresistant clinical isolates and 86 INH-susceptible isolates of M. tuberculosis were obtained from the Texas Department of Health and the Houston Tuberculosis Initiative. Epidemiologic independence was established for all isolates by IS6110 restriction fragment length polymorphism analysis. Susceptible isolates were matched with resistant isolates by molecular genetic group and IS6110 profiles. Spoligotyping was done with isolates with five or fewer IS6110 copies. A major genetic group was established on the basis of the polymorphisms in katG codon 463 and gyrA codon 95. MICs were determined by the E-test. Semiquantitative catalase assays were performed with isolates with mutations in the katG gene. When the 20 genes were sequenced, it was found that 17 (44.7%) INH-resistant isolates had a single-locus, resistance-associated mutation in the katG, mabA, or Rv1772 gene. Seventeen (44.7%) INH-resistant isolates had resistance-associated mutations in two or more genes, and 76% of all INH-resistant isolates had a mutation in the katG gene. Mutations were also identified in the fadE24, Rv1592c, Rv1772, Rv0340, and iniBAC genes, recently shown by DNA-based microarray experiments to be upregulated in response to INH. In general, the MICs were higher for isolates with mutations in katG and the isolates had reduced catalase activities. The results show that a variety of single nucleotide

  10. Association analysis of single nucleotide polymorphisms in candidate genes with root traits in maize (Zea mays L.) seedlings.


    Kumar, Bharath; Abdel-Ghani, Adel H; Pace, Jordon; Reyes-Matamoros, Jenaro; Hochholdinger, Frank; Lübberstedt, Thomas


    Several genes involved in maize root development have been isolated. Identification of SNPs associated with root traits would enable the selection of maize lines with better root architecture that might help to improve N uptake, and consequently plant growth particularly under N deficient conditions. In the present study, an association study (AS) panel consisting of 74 maize inbred lines was screened for seedling root traits in 6, 10, and 14-day-old seedlings. Allele re-sequencing of candidate root genes Rtcl, Rth3, Rum1, and Rul1 was also carried out in the same AS panel lines. All four candidate genes displayed different levels of nucleotide diversity, haplotype diversity and linkage disequilibrium. Gene based association analyses were carried out between individual polymorphisms in candidate genes, and root traits measured in 6, 10, and 14-day-old maize seedlings. Association analyses revealed several polymorphisms within the Rtcl, Rth3, Rum1, and Rul1 genes associated with seedling root traits. Several nucleotide polymorphisms in Rtcl, Rth3, Rum1, and Rul1 were significantly (P<0.05) associated with seedling root traits in maize suggesting that all four tested genes are involved in the maize root development. Thus considerable allelic variation present in these root genes can be exploited for improving maize root characteristics.

  11. Tetra Primer ARMS PCR Optimization to Detect Single Nucleotide Polymorphisms of the CYP2E1 Gene.


    Suhda, Saihas; Paramita, Dewi Kartikawati; Fachiroh, Jajah


    Single nucleotide polymorphism (SNP) detection has been used extensively for genetic association studies of diseases including cancer. For mass, yet accurate and more economic SNP detection we have optimized tetra primer amplification refractory mutation system polymerase chain reaction (ARMS PCR) to detect three SNPs in the cytochrome P450 2E1 (CYP2E1) gene locus; i.e. rs3813865, rs2070672 and rs3813867. The optimization system strategies used were (1) designing inner and outer primers; (2) determining of their optimum primer concentration ratios; and (3) determining of the optimum PCR annealing temperature. The tetra primer ARMS PCR result could be directly observed using agarose gel electrophoresis. The method succesfully determined three SNPs in CYP2E1 locus, the results being consistent with validation using DNA sequencing and restriction fragment length polymorphisms (RFLP). PMID:27509930

  12. Tetra Primer ARMS PCR Optimization to Detect Single Nucleotide Polymorphisms of the CYP2E1 Gene.


    Suhda, Saihas; Paramita, Dewi Kartikawati; Fachiroh, Jajah


    Single nucleotide polymorphism (SNP) detection has been used extensively for genetic association studies of diseases including cancer. For mass, yet accurate and more economic SNP detection we have optimized tetra primer amplification refractory mutation system polymerase chain reaction (ARMS PCR) to detect three SNPs in the cytochrome P450 2E1 (CYP2E1) gene locus; i.e. rs3813865, rs2070672 and rs3813867. The optimization system strategies used were (1) designing inner and outer primers; (2) determining of their optimum primer concentration ratios; and (3) determining of the optimum PCR annealing temperature. The tetra primer ARMS PCR result could be directly observed using agarose gel electrophoresis. The method succesfully determined three SNPs in CYP2E1 locus, the results being consistent with validation using DNA sequencing and restriction fragment length polymorphisms (RFLP).

  13. Single nucleotide polymorphisms in the dystroglycan gene do not correlate with disease severity in hereditary inclusion body myopathy.


    Gottlieb, Emily; Ciccone, Carla; Darvish, Daniel; Naiem-Cohen, Shahrouz; Dalakas, Marinos C; Savelkoul, Paul J; Krasnewich, Donna M; Gahl, William A; Huizing, Marjan


    Aberrant glycosylation of dystroglycan occurs in certain muscular dystrophies, including hereditary inclusion body myopathy (HIBM). HIBM harbors a widely varying clinical severity and age of onset, which raised the suspicion of the presence of disease modifier genes. We considered the highly polymorphic dystroglycan gene (DAG1) as a feasible candidate modifier gene. DAG1 genomic DNA was sequenced for 32 HIBM patients, mainly of Persian-Jewish descent. Five novel DAG1 single nucleotide polymorphisms (SNPs) were identified, bringing the total number of SNPs to 19. However, no direct correlation between DAG1 SNPs and clinical severity of HIBM could be detected. Several identified SNPs substitute an amino acid and might modulate dystroglycan function or glycosylation status, and deserve further research. These data are valuable for future studies on the role of DAG1 in HIBM and other muscular dystrophies, especially those dystrophies that involve abnormal glycosylation of dystroglycan.

  14. On-chip detection of a single nucleotide polymorphism without polymerase amplification

    PubMed Central

    Han, Jinhee; Tan, Matthew; Sudheendra, Lakshmana; Weiss, Robert H.; Kennedy, Ian M.


    A nanoparticle-assembled photonic crystal (PC) array was used to detect single nucleotide polymorphism (SNP). The assay platform with PC nanostructure enhanced the fluorescent signal from nanoparticle-hybridized DNA complexes due to phase matching of excitation and emission. Nanoparticles coupled with probe DNA were trapped into nanowells in an array by using an electrophoretic particle entrapment system. The PC/DNA assay platform was able to identify a 1 base pair (bp) difference in synthesized nucleotide sequences that mimicked the mutation seen in a feline model of human autosomal dominant polycystic kidney disease (PKD) with a sensitivity of 0.9 fg/mL (50 aM)-sensitivity, which corresponds to 30 oligos/array. The reliability of the PC/DNA assay platform to detect SNP in a real sample was demonstrated by using genomic DNA (gDNA) extracted from the urine and blood of two PKD− wild type and three PKD positive cats. The standard curves for PKD positive (PKD+) and negative (PKD−) DNA were created using two feline-urine samples. An additional three urine samples were analyzed in a similar fashion and showed satisfactory agreement with the standard curve, confirming the presence of the mutation in affected urine. The limit of detection (LOD) was 0.005 ng/mL which corresponds to 6 fg per array for gDNA in urine and blood. The PC system demonstrated the ability to detect a number of genome equivalents for the PKD SNP that was very similar to the results reported with real time polymerase chain reaction (PCR). The favorable comparison with quantitative PCR suggests that the PC technology may find application well beyond the detection of the PKD SNP, into areas where a simple, cheap and portable nucleic acid analysis is desirable. PMID:25580203

  15. Single nucleotide polymorphisms concordant with the horned/polled trait in Holsteins

    PubMed Central

    Cargill, Edward J; Nissing, Nick J; Grosz, Michael D


    Background Cattle that naturally do not grow horns are referred to as polled, a trait inherited in a dominant Mendelian fashion. Previous studies have localized the polled mutation (which is unknown) to the proximal end of bovine chromosome 1 in a region approximately 3 Mb in size. While a polled genetic test, Tru-Polled™, is commercially available from MetaMorphix Inc., Holsteins are not a validated breed for this test. Findings Approximately 160 kb were sequenced within the known polled region from 12 polled and 12 horned Holsteins. Analysis of the polymorphisms identified 13 novel single nucleotide polymorphisms (SNPs) that are concordant with the horned/polled trait. Three of the 13 SNPs are located in gene coding or regulatory regions (e.g., the untranslated region, or UTR) where one is located in the 3'UTR of a gene and the other two are located in the 5'UTR and coding region (synonymous SNP) of another gene. The 3'UTR of genes have been shown to be targets of microRNAs regulating gene expression. In silico analysis indicates the 3'UTR SNP may disrupt a microRNA target site. Conclusion These 13 novel SNPs concordant with the horned/polled trait in Holsteins represent a test panel for the breed and this is the first report to the authors' knowledge of SNPs within gene coding or regulatory regions concordant with the horned/polled trait in cattle. These SNPs will require further testing for verification and further study to determine if the 3'UTR SNP may have a functional effect on the polled trait in Holsteins. PMID:19063733

  16. TRPC6 Single Nucleotide Polymorphisms and Progression of Idiopathic Membranous Nephropathy

    PubMed Central

    Hofstra, Julia M.; Coenen, Marieke J. H.; Schijvenaars, Mascha M. V. A. P.; Berden, Jo H. M.; van der Vlag, Johan; Hoefsloot, Lies H.; Knoers, Nine V. A. M.; Wetzels, Jack F. M.; Nijenhuis, Tom


    Background Activating mutations in the Transient Receptor Potential channel C6 (TRPC6) cause autosomal dominant focal segmental glomerular sclerosis (FSGS). TRPC6 expression is upregulated in renal biopsies of patients with idiopathic membranous glomerulopathy (iMN) and animal models thereof. In iMN, disease progression is characterized by glomerulosclerosis. In addition, a context-dependent TRPC6 overexpression was recently suggested in complement-mediated podocyte injury in e.g. iMN. Hence, we hypothesized that genetic variants in TRPC6 might affect susceptibility to development or progression of iMN. Methods & Results Genomic DNA was isolated from blood samples of 101 iMN patients and 292 controls. By direct sequencing of the entire TRPC6 gene, 13 single nucleotide polymorphisms (SNPs) were identified in the iMN cohort, two of which were causing an amino acid substitution (rs3802829; Pro15Ser and rs36111323, Ala404Val). No statistically significant differences in genotypes or allele frequencies between patients and controls were observed. Clinical outcome in patients was determined (remission n = 26, renal failure n = 46, persistent proteinuria n = 29, follow-up median 80 months {range 51–166}). The 13 identified SNPs showed no association with remission or renal failure. There were no differences in genotypes or allele frequencies between patients in remission and progressors. Conclusions Our data suggest that TRPC6 polymorphisms do not affect susceptibility to iMN, or clinical outcome in iMN. PMID:25019165

  17. A single nucleotide polymorphism in NEUROD1 is associated with production traits in Nelore beef cattle.


    de Oliveira, P S N; Tizioto, P C; Malago, W; do Nascimento, M L; Cesar, A S M; Diniz, W J S; de Souza, M M; Lanna, D P D; Tullio, R R; Mourão, G B; de A Mudadu, M; Coutinho, L L; de A Regitano, L C


    Feed efficiency and carcass characteristics are late-measured traits. The detection of molecular markers associated with them can help breeding programs to select animals early in life, and to predict breeding values with high accuracy. The objective of this study was to identify polymorphisms in the functional and positional candidate gene NEUROD1 (neurogenic differentiation 1), and investigate their associations with production traits in reference families of Nelore cattle. A total of 585 steers were used, from 34 sires chosen to represent the variability of this breed. By sequencing 14 animals with extreme residual feed intake (RFI) values, seven single nucleotide polymorphisms (SNPs) in NEUROD1 were identified. The investigation of marker effects on the target traits RFI, backfat thickness (BFT), ribeye area (REA), average body weight (ABW), and metabolic body weight (MBW) was performed with a mixed model using the restricted maximum likelihood method. SNP1062, which changes cytosine for guanine, had no significant association with RFI or REA. However, we found an additive effect on ABW (P ≤ 0.05) and MBW (P ≤ 0.05), with an estimated allele substitution effect of -1.59 and -0.93 kg0.75, respectively. A dominant effect of this SNP for BFT was also found (P ≤ 0.010). Our results are the first that identify NEUROD1 as a candidate that affects BFT, ABW, and MBW. Once confirmed, the inclusion of this SNP in dense panels may improve the accuracy of genomic selection for these traits in Nelore beef cattle as this SNP is not currently represented on SNP chips. PMID:27420997

  18. Role of two single nucleotide polymorphisms in secreted frizzled related protein 1 and bladder cancer risk.


    Rogler, Anja; Hoja, Sabine; Socher, Eileen; Nolte, Elke; Wach, Sven; Wieland, Wolf; Hofstädter, Ferdinand; Goebell, Peter J; Wullich, Bernd; Hartmann, Arndt; Stoehr, Robert


    In this study, we determined the genotype distribution of two single nucleotide polymorphisms (SNPs) in secreted frizzled related protein 1 (SFRP1), rs3242 and rs921142, in a Caucasian bladder cancer case-control study. Allelic variants of the SNPs were determined using restriction fragment length polymorphism (RFLP) analysis and partly verified by sequencing analysis. Overall, DNA from 188 consecutive and 215 early-onset bladder cancer patients (≤45 years) as well as from 332 controls was investigated. Potential microRNA binding sites were determined for rs3242, and microRNA expression was analysed in cell lines and tumour specimens. We observed a remarkable distribution difference in rs3242 between bladder cancer patients and healthy controls (p=0.05). Additionally, we found a significant difference in genotype distribution (p=0.032), resulting from the difference of early-onset patients and the control group (p=0.007). The risk allele T showed increased frequency in the early-onset patient group (p=0.002). Genotype-dependent differences of microRNA binding capacity were predicted in SFRP1 mRNA for two microRNAs. Hsa-miR-3646 showed strong expression in cell lines and tumour tissue, whereas hsa-miR-603 exhibited weak expression. The rs921142 SNP showed no significant association with bladder cancer risk. This is the first study to describe an association of the SFRP1 SNP rs3242 and bladder cancer risk as well as the influence of rs3242 on genotype-dependent microRNA capacity on SFRP1 mRNA. The onset of bladder seems to be associated with the increased occurrence of the T-allele in rs3242. PMID:24133576

  19. Role of two single nucleotide polymorphisms in secreted frizzled related protein 1 and bladder cancer risk

    PubMed Central

    Rogler, Anja; Hoja, Sabine; Socher, Eileen; Nolte, Elke; Wach, Sven; Wieland, Wolf; Hofstädter, Ferdinand; Goebell, Peter J; Wullich, Bernd; Hartmann, Arndt; Stoehr, Robert


    In this study, we determined the genotype distribution of two single nucleotide polymorphisms (SNPs) in secreted frizzled related protein 1 (SFRP1), rs3242 and rs921142, in a Caucasian bladder cancer case-control study. Allelic variants of the SNPs were determined using restriction fragment length polymorphism (RFLP) analysis and partly verified by sequencing analysis. Overall, DNA from 188 consecutive and 215 early-onset bladder cancer patients (≤45 years) as well as from 332 controls was investigated. Potential microRNA binding sites were determined for rs3242, and microRNA expression was analysed in cell lines and tumour specimens. We observed a remarkable distribution difference in rs3242 between bladder cancer patients and healthy controls (p=0.05). Additionally, we found a significant difference in genotype distribution (p=0.032), resulting from the difference of early-onset patients and the control group (p=0.007). The risk allele T showed increased frequency in the early-onset patient group (p=0.002). Genotype-dependent differences of microRNA binding capacity were predicted in SFRP1 mRNA for two microRNAs. Hsa-miR-3646 showed strong expression in cell lines and tumour tissue, whereas hsa-miR-603 exhibited weak expression. The rs921142 SNP showed no significant association with bladder cancer risk. This is the first study to describe an association of the SFRP1 SNP rs3242 and bladder cancer risk as well as the influence of rs3242 on genotype-dependent microRNA capacity on SFRP1 mRNA. The onset of bladder seems to be associated with the increased occurrence of the T-allele in rs3242. PMID:24133576

  20. Nucleotide sequence of Bacillus phage Nf terminal protein gene.

    PubMed Central

    Leavitt, M C; Ito, J


    The nucleotide sequence of Bacillus phage Nf gene E has been determined. Gene E codes for phage terminal protein which is the primer necessary for the initiation of DNA replication. The deduced amino acid sequence of Nf terminal protein is approximately 66% homologous with the terminal proteins of Bacillus phages PZA and luminal diameter 29, and shows similar hydropathy and secondary structure predictions. A serine which has been identified as the residue which covalently links the protein to the 5' end of the genome in luminal diameter 29, is conserved in all three phages. The hydropathic and secondary structural environment of this serine is similar in these phage terminal proteins and also similar to the linking serine of adenovirus terminal protein. PMID:3601672

  1. LMNA gene single nucleotide polymorphisms in dilated cardiomyopathy of Han children

    PubMed Central

    Xie, Li-Jian; Xiao, Ting-Ting; Huang, Min; Shen, Jie


    Objective: To investigate whether LMNA gene mutation is associated with dilated cardiomyopathy (DCM) in Chinese Han Race children. Methods: DNA was isolated from 78 patients with DCM and 100 healthy Chinese children who served as controls. 12 exons in the functional regions and the adjacent part of introns of the LMNA gene were amplified with polymerase chain reactions (PCR) and the PCR products were sequenced with DNA sequencer. We compared the DNA sequence with Blast software online PubMed website. The differences of allele and genotype between the groups were detected by χ2 test. Results: No disease-causing mutation in LMNA gene was found in all DCM patients. Three nonsense single nucleotide polymorphisms (SNPs) were identified. ① The first is c.1908C>T (H566H, rs4641) which was located at exon 10 of LMNA gene. It was found in 29 DCM cases and 15 control subjects. Compared to healthy controls, the frequency of TT and TC genotypes, and the C allele were significantly increased in DCM patients (P<0.05). ② The second was c.861C>T (A287A, rs5380) which was located at exon 5 of LMNA gene. It was found in 9 DCM cases and 2 control subjects. The frequency of TC genotype was significantly increased in DCM patients (P<0.05). ③ The third was c.1338C>T (D446D, rs5058) which located at exon 7 of LMNA gene. It was found in 8 DCM cases and 3 control subjects. The frequency of TC genotype was significantly increased in DCM patients (P<0.05). Conclusion: The SNP of LMNA gene may be associated with the susceptivity of DCM in Chinese Han children. PMID:26379929

  2. Prospecting for pig single nucleotide polymorphisms in the human genome: have we struck gold?


    Grapes, L; Rudd, S; Fernando, R L; Megy, K; Rocha, D; Rothschild, M F


    Gene-to-gene variation in the frequency of single nucleotide polymorphisms (SNPs) has been observed in humans, mice, rats, primates and pigs, but a relationship across species in this variation has not been described. Here, the frequency of porcine coding SNPs (cSNPs) identified by in silico methods, and the frequency of murine cSNPs, were compared with the frequency of human cSNPs across homologous genes. From 150,000 porcine expressed sequence tag (EST) sequences, a total of 452 SNP-containing sequence clusters were found, totalling 1394 putative SNPs. All the clustered porcine EST annotations and SNP data have been made publicly available at Human and murine cSNPs were identified from dbSNP and were characterized as either validated or total number of cSNPs (validated plus non-validated) for comparison purposes. The correlation between in silico pig cSNP and validated human cSNP densities was found to be 0.77 (p < 0.00001) for a set of 25 homologous genes, while a correlation of 0.48 (p < 0.0005) was found for a primarily random sample of 50 homologous human and mouse genes. This is the first evidence of conserved gene-to-gene variability in cSNP frequency across species and indicates that site-directed screening of porcine genes that are homologous to cSNP-rich human genes may rapidly advance cSNP discovery in pigs. PMID:16706918

  3. Genome nucleotide composition shapes variation in simple sequence repeats.


    Tian, Xiangjun; Strassmann, Joan E; Queller, David C


    Simple sequence repeats (SSRs) or microsatellites are a common component of genomes but vary greatly across species in their abundance. We tested the hypothesis that this variation is due in part to AT/GC content of genomes, with genomes biased toward either high AT or high CG generating more short random repeats that are long enough to enhance expansion through slippage during replication. To test this hypothesis, we identified repeats with perfect tandem iterations of 1-6 bp from 25 protists with complete or near-complete genome sequences. As expected, the density and the frequency are highly related to genome AT content, with excellent fits to quadratic regressions with minima near a 50% AT content and rising toward both extremes. Within species, the same trends hold, except the limited variation in AT content within each species places each mainly on the descending (GC rich), middle, or ascending (AT rich) part of the curve. The base usages of repeat motifs are also significantly correlated with genome nucleotide compositions: Percentages of AT-rich motifs rise with the increase of genome AT content but vice versa for GC-rich subgroups. Amino acid homopolymer repeats also show the expected quadratic relationship, with higher abundance in species with AT content biased in either direction. Our results show that genome nucleotide composition explains up to half of the variance in the abundance and motif constitution of SSRs.

  4. Single nucleotide polymorphisms in microRNA binding sites of oncogenes: implications in cancer and pharmacogenomics.


    Manikandan, Mayakannan; Munirajan, Arasambattu Kannan


    Cancer, a complex genetic disease involving uncontrolled cell proliferation, is caused by inactivation of tumor suppressor genes and activation of oncogenes. A vast majority of these cancer causing genes are known targets of microRNAs (miRNAs) that bind to complementary sequences in 3' untranslated regions (UTR) of messenger RNAs and repress them from translation. Single Nucleotide Polymorphisms (SNPs) occurring naturally in such miRNA binding regions can alter the miRNA:mRNA interaction and can significantly affect gene expression. We hypothesized that 3'UTR SNPs in miRNA binding sites of proto-oncogenes could abrogate their post-transcriptional regulation, resulting in overexpression of oncogenic proteins, tumor initiation, progression, and modulation of drug response in cancer patients. Therefore, we developed a systematic computational pipeline that integrates data from well-established databases, followed stringent selection criteria and identified a panel of 30 high-confidence SNPs that may impair miRNA target sites in the 3' UTR of 54 mRNA transcripts of 24 proto-oncogenes. Further, 8 SNPs amidst them had the potential to determine therapeutic outcome in cancer patients. Functional annotation suggested that altogether these SNPs occur in proto-oncogenes enriched for kinase activities. We provide detailed in silico evidence for the functional effect of these candidate SNPs in various types of cancer.

  5. SNPer: an R library for quantitative variant analysis on single nucleotide polymorphisms among influenza virus populations.


    Sangket, Unitsa; Vijasika, Sukanya; Noh, Hasnee; Chantratita, Wasun; Klungthong, Chonticha; Yoon, In Kyu; Fernandez, Stefan; Rutvisuttinunt, Wiriya


    Influenza virus (IFV) can evolve rapidly leading to genetic drifts and shifts resulting in human and animal influenza epidemics and pandemics. The genetic shift that gave rise to the 2009 influenza A/H1N1 pandemic originated from a triple gene reassortment of avian, swine and human IFVs. More minor genetic alterations in genetic drift can lead to influenza drug resistance such as the H274Y mutation associated with oseltamivir resistance. Hence, a rapid tool to detect IFV mutations and the potential emergence of new virulent strains can better prepare us for seasonal influenza outbreaks as well as potential pandemics. Furthermore, identification of specific mutations by closely examining single nucleotide polymorphisms (SNPs) in IFV sequences is essential to classify potential genetic markers associated with potentially dangerous IFV phenotypes. In this study, we developed a novel R library called "SNPer" to analyze quantitative variants in SNPs among IFV subpopulations. The computational SNPer program was applied to three different subpopulations of published IFV genomic information. SNPer queried SNPs data and grouped the SNPs into (1) universal SNPs, (2) likely common SNPs, and (3) unique SNPs. SNPer outperformed manual visualization in terms of time and labor. SNPer took only three seconds with no errors in SNP comparison events compared with 40 hours with errors using manual visualization. The SNPer tool can accelerate the capacity to capture new and potentially dangerous IFV strains to mitigate future influenza outbreaks. PMID:25876137

  6. Varietal identification of tea (Camellia sinensis) using nanofluidic array of single nucleotide polymorphism (SNP) markers

    PubMed Central

    Fang, Wan-Ping; Meinhardt, Lyndel W; Tan, Hua-Wei; Zhou, Lin; Mischke, Sue; Zhang, Dapeng


    Apart from water, tea is the world’s most widely consumed beverage. Tea is produced in more than 50 countries with an annual production of approximately 4.7 million tons. The market segment for specialty tea has been expanding rapidly owing to increased demand, resulting in higher revenues and profits for tea growers and the industry. Accurate varietal identification is critically important to ensure traceability and authentication of premium tea products, which in turn contribute to on-farm conservation of tea genetic diversity. Using a set of single nucleotide polymorphism (SNP) markers developed from the expressed sequence tag (EST) database of Camilla senensis, we genotyped deoxyribonucleic acid (DNA) samples extracted from a diverse group of tea varieties, including both fresh and processed commercial loose-leaf teas. The validation led to the designation of 60 SNPs that unambiguously identified all 40 tested tea varieties with high statistical rigor (p<0.0001). Varietal authenticity and genetic relationships among the analyzed cultivars were further characterized by ordination and Bayesian clustering analysis. These SNP markers, in combination with a high-throughput genotyping protocol, effectively established and verified specific DNA fingerprints for all tested tea varieties. This method provides a powerful tool for variety authentication and quality control for the tea industry. It is also highly useful for the management of tea genetic resources and breeding, where accurate and efficient genotype identification is essential. PMID:26504544

  7. A Single Nucleotide Polymorphism in Human APOBEC3C Enhances Restriction of Lentiviruses

    PubMed Central

    Wittkopp, Cristina J.; Adolph, Madison B.; Wu, Lily I.; Chelico, Linda; Emerman, Michael


    Humans express seven human APOBEC3 proteins, which can inhibit viruses and endogenous retroelements through cytidine deaminase activity. The seven paralogs differ in the potency of their antiviral effects, as well as in their antiviral targets. One APOBEC3, APOBEC3C, is exceptional as it has been found to only weakly block viruses and endogenous retroelements compared to other APOBEC3s. However, our positive selection analyses suggest that APOBEC3C has played a role in pathogen defense during primate evolution. Here, we describe a single nucleotide polymorphism in human APOBEC3C, a change from serine to isoleucine at position 188 (I188) that confers potent antiviral activity against HIV-1. The gain-of-function APOBEC3C SNP results in increased enzymatic activity and hypermutation of target sequences when tested in vitro, and correlates with increased dimerization of the protein. The I188 is widely distributed in human African populations, and is the ancestral primate allele, but is not found in chimpanzees or gorillas. Thus, while other hominids have lost activity of this antiviral gene, it has been maintained, or re-acquired, as a more active antiviral gene in a subset of humans. Taken together, our results suggest that APOBEC3C is in fact involved in protecting hosts from lentiviruses. PMID:27732658

  8. A molecular beacon microarray based on a quantum dot label for detecting single nucleotide polymorphisms.


    Guo, Qingsheng; Bai, Zhixiong; Liu, Yuqian; Sun, Qingjiang


    In this work, we report the application of streptavidin-coated quantum dot (strAV-QD) in molecular beacon (MB) microarray assays by using the strAV-QD to label the immobilized MB, avoiding target labeling and meanwhile obviating the use of amplification. The MBs are stem-loop structured oligodeoxynucleotides, modified with a thiol and a biotin at two terminals of the stem. With the strAV-QD labeling an "opened" MB rather than a "closed" MB via streptavidin-biotin reaction, a sensitive and specific detection of label-free target DNA sequence is demonstrated by the MB microarray, with a signal-to-background ratio of 8. The immobilized MBs can be perfectly regenerated, allowing the reuse of the microarray. The MB microarray also is able to detect single nucleotide polymorphisms, exhibiting genotype-dependent fluorescence signals. It is demonstrated that the MB microarray can perform as a 4-to-2 encoder, compressing the genotype information into two outputs.

  9. Novel biosensing methodologies for improving the detection of single nucleotide polymorphism.


    Chang, Kai; Deng, Shaoli; Chen, Ming


    The growing volume of sequence data confirm more and more candidate single nucleotide polymorphisms (SNPs), which are believed to reveal the genetic basis of individual susceptibility to disease and the diverse responses to treatment. There is therefore an urgent demand for developing the sensitive, rapid, easy-to-use, and cost-effective method to identify SNPs. During the last two decades, biosensing techniques have been developed by integrating the unique specificity of biological reactions and the high sensitivity of physical sensors, which provided significant advantages for the detection of SNPs. In this feature article, we focused attention on the strategies of SNP genotyping based on biosensors, including nucleic acid analogs, surface ligation reaction, single base extension, mismatch binding protein, molecular beacon, rolling circle amplification, and strand-displacement amplification. In addition, the perspectives on their advantages, current limitations, and future trends were also discussed. The biosensing technique would provide a promising alternative for the detection of SNPs, and pave the way for the diagnosis of genetic diseases and the design of appropriate treatments.

  10. Digital camera and smartphone as detectors in paper-based chemiluminometric genotyping of single nucleotide polymorphisms.


    Spyrou, Elena M; Kalogianni, Despina P; Tragoulias, Sotirios S; Ioannou, Penelope C; Christopoulos, Theodore K


    Chemi(bio)luminometric assays have contributed greatly to various areas of nucleic acid analysis due to their simplicity and detectability. In this work, we present the development of chemiluminometric genotyping methods in which (a) detection is performed by using either a conventional digital camera (at ambient temperature) or a smartphone and (b) a lateral flow assay configuration is employed for even higher simplicity and suitability for point of care or field testing. The genotyping of the C677T single nucleotide polymorphism (SNP) of methylenetetrahydropholate reductase (MTHFR) gene is chosen as a model. The interrogated DNA sequence is amplified by polymerase chain reaction (PCR) followed by a primer extension reaction. The reaction products are captured through hybridization on the sensing areas (spots) of the strip. Streptavidin-horseradish peroxidase conjugate is used as a reporter along with a chemiluminogenic substrate. Detection of the emerging chemiluminescence from the sensing areas of the strip is achieved by digital camera or smartphone. For this purpose, we constructed a 3D-printed smartphone attachment that houses inexpensive lenses and converts the smartphone into a portable chemiluminescence imager. The device enables spatial discrimination of the two alleles of a SNP in a single shot by imaging of the strip, thus avoiding the need of dual labeling. The method was applied successfully to genotyping of real clinical samples. Graphical abstract Paper-based genotyping assays using digital camera and smartphone as detectors.

  11. Melting analysis on microbeads in rapid temperature-gradient inside microchannels for single nucleotide polymorphisms detection.


    Li, Kan-Chien; Ding, Shih-Torng; Lin, En-Chung; Wang, Lon Alex; Lu, Yen-Wen


    A continuous-flow microchip with a temperature gradient in microchannels was utilized to demonstrate spatial melting analysis on microbeads for clinical Single Nucleotide Polymorphisms (SNPs) genotyping on animal genomic DNA. The chip had embedded heaters and thermometers, which created a rapid and yet stable temperature gradient between 60 °C and 85 °C in a short distance as the detection region. The microbeads, which served as mobile supports carrying the target DNA and fluorescent dye, were transported across the temperature gradient. As the surrounding temperature increased, the fluorescence signals of the microbeads decayed with this relationship being acquired as the melting curve. Fast DNA denaturation, as a result of the improved heat transfer and thermal stability due to scaling, was also confirmed. Further, each individual microbead could potentially bear different sequences and pass through the detection region, one by one, for a series of melting analysis, with multiplex, high-throughput capability being possible. A prototype was tested with target DNA samples in different genotypes (i.e., wild and mutant types) with a SNP location from Landrace sows. The melting temperatures were obtained and compared to the ones using a traditional tube-based approach. The results showed similar levels of SNP discrimination, validating our proposed technique for scanning homozygotes and heterozygotes to distinguish single base changes for disease research, drug development, medical diagnostics, agriculture, and animal production.

  12. Mining the transcriptomes of four commercially important shellfish species for single nucleotide polymorphisms within biomineralization genes.


    Vendrami, David L J; Shah, Abhijeet; Telesca, Luca; Hoffman, Joseph I


    Transcriptional profiling not only provides insights into patterns of gene expression, but also generates sequences that can be mined for molecular markers, which in turn can be used for population genetic studies. As part of a large-scale effort to better understand how commercially important European shellfish species may respond to ocean acidification, we therefore mined the transcriptomes of four species (the Pacific oyster Crassostrea gigas, the blue mussel Mytilus edulis, the great scallop Pecten maximus and the blunt gaper Mya truncata) for single nucleotide polymorphisms (SNPs). Illumina data for C. gigas, M. edulis and P. maximus and 454 data for M. truncata were interrogated using GATK and SWAP454 respectively to identify between 8267 and 47,159 high quality SNPs per species (total=121,053 SNPs residing within 34,716 different contigs). We then annotated the transcripts containing SNPs to reveal homology to diverse genes. Finally, as oceanic pH affects the ability of organisms to incorporate calcium carbonate, we honed in on genes implicated in the biomineralization process to identify a total of 1899 SNPs in 157 genes. These provide good candidates for biomarkers with which to study patterns of selection in natural or experimental populations.

  13. Patterns of nucleotide polymorphism distinguish temperate and tropical wild isolates of Caenorhabditis briggsae.


    Cutter, Asher D; Félix, Marie-Anne; Barrière, Antoine; Charlesworth, Deborah


    Caenorhabditis briggsae provides a natural comparison species for the model nematode C. elegans, given their similar morphology, life history, and hermaphroditic mode of reproduction. Despite C. briggsae boasting a published genome sequence and establishing Caenorhabditis as a model genus for genetics and development, little is known about genetic variation across the geographic range of this species. In this study, we greatly expand the collection of natural isolates and characterize patterns of nucleotide variation for six loci in 63 strains from three continents. The pattern of polymorphisms reveals differentiation between C. briggsae strains found in temperate localities in the northern hemisphere from those sampled near the Tropic of Cancer, with diversity within the tropical region comparable to what is found for C. elegans in Europe. As in C. elegans, linkage disequilibrium is pervasive, although recombination is evident among some variant sites, indicating that outcrossing has occurred at a low rate in the history of the sample. In contrast to C. elegans, temperate regions harbor extremely little variation, perhaps reflecting colonization and recent expansion of C. briggsae into northern latitudes. We discuss these findings in relation to their implications for selection, demographic history, and the persistence of self-fertilization.

  14. A single nucleotide polymorphism analysis of the LAMA1 gene in Japanese patients with high myopia

    PubMed Central

    Sasaki, Sayaka; Ota, Masao; Meguro, Akira; Nishizaki, Ritsuko; Okada, Eiichi; Mok, Jeewon; Kimura, Tetusya; Oka, Akira; Katsuyama, Yoshihiko; Ohno, Shigeaki; Inoko, Hidetoshi; Mizuki, Nobuhisa


    Although a myopia susceptibility gene has not yet been elucidated, ten candidate regions (MYP1–MYP10) have been associated with myopia by linkage analysis employing large pedigrees. We report herein on the results of our analysis pertaining to polymorphisms of LAMA1 (alpha subunit of laminin), a promising candidate gene for high myopia present in the MYP2 region of Japanese subjects with high myopia. Three hundred and thirty Japanese subjects with high myopia at a level of greater than −9.25 D and ethnically and sex matched 330 normal controls without high myopia was enrolled in this study. The thirteen SNPs located on the LAMA1 gene were analyzed using PCR and SNP-specific fluorogenic probes. Two of the SNPs were monomorphic and none of the 11 SNPs showed statistically significant association with high myopia in the Japanese population. There is no convincing evidence to prove a connection between nucleotide sequence variations in LAMA1 and high myopia. The pairwise linkage disequilibrium (LD) mapping disclosed a strong value (D' > 0.8) and narrow ranged block within these SNPs. PMID:19668483

  15. The bovine 5' AMPK gene family: mapping and single nucleotide polymorphism detection.


    McKay, Stephanie D; White, Stephen N; Kata, Srinivas R; Loan, Raymond; Womack, James E


    The 5'-AMP-activated protein kinase (AMPK) family is an ancient stress response system whose primary function is regulation of cellular ATP. Activation of AMPK, which is instigated by environmental and nutritional stresses, initiates energy-conserving measures that protect the cell by inhibition and phosphorylation of key enzymes in energy-consuming biochemical pathways. The seven genes that comprise the bovine AMPK family were mapped in cattle by using a radiation hybrid panel. The seven genes mapped to six different cattle chromosomes, each with a LOD score greater than 10.0. PRKAA1 mapped to BTA 20, PRKAA2 and PRKAB2 to BTA 3, PRKAB1 to BTA 17, PRKAG1 to BTA 5, PRKAG2 to BTA 4, and PRKAG3 to BTA 2. Five of the seven genes mapped to regions expected from human/cattle comparative maps. PRKAB2 and PRKAG3, however, have not been mapped in humans. We predict these genes to be located on HSA 1 and 2, respectively. Additionally, one synonymous and one non-synonymous single nucleotide polymorphism (SNP) were detected in PRKAG3 in Bos taurus cattle. In an effort to determine ancestral origins, various herds of mixed breed cattle as well as other ruminant species were characterized for sequence variation in this region of PRKAG3. Owing to the physiological importance of this gene family, we believe that its individual genes are candidate genes for conferring resistance to diseases in cattle.

  16. Discovering All Transcriptome Single-Nucleotide Polymorphisms and Scanning for Selection Signatures in Ducks (Anas platyrhynchos)

    PubMed Central

    Lin, Ruiyi; Du, Xiaoyong; Peng, Sixue; Yang, Liubin; Ma, Yunlong; Gong, Yanzhang; Li, Shijun


    The duck is one of the most economically important waterfowl as a source of meat, eggs, and feathers. Characterizing the genetic variation in duck species is an important step toward linking genes or genomic regions with phenotypes. Human-driven selection during duck domestication and subsequent breed formation has likely left detectable signatures in duck genome. In this study, we employed a panel of >1.4 million single-nucleotide polymorphisms (SNPs) identified from the RNA sequencing (RNA-seq) data of 15 duck individuals. The density of the resulting SNPs is significantly positively correlated with the density of genes across the duck genome, which demonstrates that the usage of the RNA-seq data allowed us to enrich variant functional categories, such as coding exons, untranslated regions (UTRs), introns, and downstream/upstream. We performed a complete scan of selection signatures in the ducks using the composite likelihood ratio (CLR) and found 76 candidate regions of selection, many of which harbor genes related to phenotypes relevant to the function of the digestive system and fat metabolism, including TCF7L2, EIF2AK3, ELOVL2, and fatty acid-binding protein family. This study illustrates the potential of population genetic approaches for identifying genomic regions affecting domestication-related phenotypes and further helps to increase the known genetic information about this economically important animal. PMID:26819540

  17. Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis


    McCready, Paula M.; Radnedge, Lyndsay; Andersen, Gary L.; Ott, Linda L.; Slezak, Thomas R.; Kuczmarski, Thomas A.; Motin, Vladinir L.


    Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  18. Nucleotide sequences specific to Brucella and methods for the detection of Brucella

    SciTech Connect

    McCready, Paula M.; Radnedge, Lyndsay; Andersen, Gary L.; Ott, Linda L.; Slezak, Thomas R.; Kuczmarski, Thomas A.


    Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  19. Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis


    McCready, Paula M.; Radnedge, Lyndsay; Andersen, Gary L.; Ott, Linda L.; Slezak, Thomas R.; Kuczmarski, Thomas A.; Vitalis, Elizabeth A


    Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  20. Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis


    McCready, Paula M.; Radnedge, Lyndsay; Andersen, Gary L.; Ott, Linda L.; Slezak, Thomas R.; Kuczmarski, Thomas A.; Vitalis, Elizabeth A


    Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  1. Prion sequence polymorphisms and chronic wasting disease resistance in Illinois white-tailed deer (Odocoileus virginianus).


    Kelly, Amy C; Mateus-Pinilla, Nohra E; Diffendorfer, Jay; Jewell, Emily; Ruiz, Marilyn O; Killefer, John; Shelton, Paul; Beissel, Tom; Novakofski, Jan


    Nucleic acid sequences of the prion gene (PRNP) were examined and genotypes compiled for 76 white-tailed deer from northern Illinois, which previously tested positive for chronic wasting disease (CWD), and 120 negative animals selected to control for geographic location and age. Nine nucleotide polymorphisms, seven silent and two coding, were found in the sampled population. All observed polymorphisms except two of very low frequency were observed in both negative and positive animals, although five polymorphic loci had significantly different distributions of alleles between infected and non-infected individuals. Nucleotide base changes 60C/T, 285A/C, 286G/A and 555C/T were observed with higher than expected frequencies in CWD negative animals suggesting disease resistance, while 153C/T was observed more than expected in positive animals, suggesting susceptibility. The two coding polymorphisms, 285A/C (Q95H) and 286G/A (G96S), have been described in white-tailed deer populations sampled in Colorado and Wisconsin. Frequency distributions of coding polymorphisms in Wisconsin and Illinois deer populations were different, an unexpected result considering the sampled areas are less than 150 km apart. The total number of polymorphisms per animal, silent or coding, was negatively correlated to disease status. The potential importance of silent polymorphisms (60C/T, 153C/T, 555C/T), either individually or cumulatively, in CWD disease status has not been previously reported.

  2. Generalized Levy-walk model for DNA nucleotide sequences

    NASA Technical Reports Server (NTRS)

    Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Simons, M.; Stanley, H. E.


    We propose a generalized Levy walk to model fractal landscapes observed in noncoding DNA sequences. We find that this model provides a very close approximation to the empirical data and explains a number of statistical properties of genomic DNA sequences such as the distribution of strand-biased regions (those with an excess of one type of nucleotide) as well as local changes in the slope of the correlation exponent alpha. The generalized Levy-walk model simultaneously accounts for the long-range correlations in noncoding DNA sequences and for the apparently paradoxical finding of long subregions of biased random walks (length lj) within these correlated sequences. In the generalized Levy-walk model, the lj are chosen from a power-law distribution P(lj) varies as lj(-mu). The correlation exponent alpha is related to mu through alpha = 2-mu/2 if 2 < mu < 3. The model is consistent with the finding of "repetitive elements" of variable length interspersed within noncoding DNA.

  3. Nucleotide polymorphisms and protein structure changes in the Fg16 gene of Fusarium graminearum sensu stricto.


    Abedi-Tizaki, Mostafa; Zafari, Doustmorad


    Fusarium graminearum is one of the most important causes of wheat scab in different parts of the world. This fungus is able to produce widespread trichothecene mycotoxins such as nivalenol (NIV) and deoxynivalenol (DON) which are harmful for both human and animals. The Fg16 target is located in chromosome 1 of the F. graminearum genome coding for a hypothetical protein whose function is not yet known. The Fg16 gene is involved in lipid biosynthesis and leads to sexual development during colonization in wheat stalks. This gene is used to detect F. graminearum and determine the lineage of F. graminearum complex species. In the present study, polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP) and DNA sequencing methods were employed in screening for genetic variation in 172 F. graminearum s.s. isolates. The PCR reaction forced the amplification of 410-bp fragments of Fg16. Two single nucleotide polymorphisms (T82C and A352T) and one amino acid exchange (C65S) with three patterns (TA/TA, CT/CT and TA/CT genotypes) were found in the Fg16 gene fragment. Two haplotypes, 1A and 1B, were identified within F. graminearum s.s. populations in northern and western regions of Iran. Two different secondary structures of protein were predicted for CT/CT and TA/CT genotypes of Fg16 gene. The average diversity levels detected were relatively high (He: 0.3238; Heu: 0.334; Ho: 0.2894; mean PIC: 0.514; mean Shannon's information index: 0.4132; mean number of alleles per locus: 1.473). On the basis of the obtained results, it was revealed that the Fg16 gene had a high degree of polymorphism that can be considered for future control programming strategies and thus the associations between the SSCP patterns with different traits of F. graminearum such as wheat colonization, perithecium formation on stalk tissues and lineage discrimination should be investigated. PMID:27222818

  4. Single-Nucleotide Polymorphism to Associate Cancer Risk.


    Shaw, Victoria; Bullock, Katie; Greenhalf, William


    Genetic heterogeneity explains variation in predisposition for cancer. Whole-genome analysis allows risk to be quantified, giving better targeted screening and quantification of the personalized risk posed by environmental factors. Array-based approaches to whole-genome analysis are rapidly being overtaken by next-generation sequencing (NGS). In this review the different platforms currently available for NGS are compared and the opportunities and risks of this approach are discussed: including the informatics packages required and the ethical issues. Methods applicable to the personal genome machine (PGM) are given as an example of workflows.

  5. A single nucleotide polymorphism in the promoter region of let-7 family is associated with lung cancer risk in Chinese.


    Shen, L Q; Xie, Y Z; Qian, X F; Zhuang, Z X; Jiao, Y; Qi, X F


    Lung cancer is a complex polygenic disease and many genetic factors are involved in the development of the disease. As one of the most important and widely studied families of microRNA, let-7 appears to play an important role in initiation and progression of lung cancer. Any small changes in miRNA level or its target point can cause significant changes in gene function. In this study, we examined whether a single-nucleotide polymorphism in the promoter region of the let-7 family (rs10877887) is associated with the susceptibility to and prognosis of lung adenocarcinoma cancer. A hospital-based case-control research model was used in our study. The single-nucleotide polymorphism was genotyped in 69 lung cancer patients and 75 healthy controls by direct sequencing. The correlation between rs10877887 genotypes and the susceptibility to lung cancer was evaluated using an unconditional logistic regression model. Populations with the CT+CC genotype had a significantly increased AC risk compared to those with the TT genotype (CT+CC vs TT: P = 0.043, OR = 2.032, 95%CI = 1.018-4.054). Furthermore, the risk effect was greater in subgroups of females over 60 years old (CT+CC vs TT: OR = 6.857, 95%CI = 1.425-33.008, P = 0.012), and the C allele were confirmed to be a risk factor related to lung cancer in these females (P = 0.012). The single-nucleotide polymorphism rs10877887 in the promoter region of the let-7 family was found to be responsible for the susceptibility to lung adenocarcinoma cancer in Chinese individuals. This association was significantly stronger in females who were more than 60 years old.

  6. Genome-wide single-nucleotide polymorphism analysis defines haplotype patterns in mouse

    PubMed Central

    Wiltshire, Tim; Pletcher, Mathew T.; Batalov, Serge; Barnes, S. Whitney; Tarantino, Lisa M.; Cooke, Michael P.; Wu, Hua; Smylie, Kevin; Santrosyan, Andrey; Copeland, Neal G.; Jenkins, Nancy A.; Kalush, Francis; Mural, Richard J.; Glynne, Richard J.; Kay, Steve A.; Adams, Mark D.; Fletcher, Colin F.


    The nature and organization of polymorphisms, or differences, between genomes of individuals are of great interest, because these variations can be associated with or even underlie phenotypic traits, including disease susceptibility. To gain insight into the genetic and evolutionary factors influencing such biological variation, we have examined the arrangement (haplotype) of single-nucleotide polymorphisms across the genomes of eight inbred strains of mice. These analyses define blocks of high or low diversity, often extending across tens of megabases that are delineated by abrupt transitions. These observations provide a striking contrast to the haplotype structure of the human genome. PMID:12612341

  7. Nucleotide polymorphism and natural selection at the pantophysin (Pan I) locus in the Atlantic cod, Gadus morhua (L.).

    PubMed Central

    Pogson, G H


    Molecular studies of nucleotide sequence variation have rarely attempted to test hypotheses related to geographically varying patterns of natural selection. The present study tested the role of spatially varying selection in producing significant linkage disequilibrium and large differences in the frequencies of two common alleles at the pantophysin (Pan I) locus among five populations of the Atlantic cod, Gadus morhua. Nucleotide sequences of 124 Pan I alleles showed strong evidence for an unusual mix of balancing and directional selection but no evidence of stable geographically varying selection. The alleles were highly divergent at both the nucleotide level (differing on average by 19 mutations) and at amino acid level (each having experienced three amino acid substitutions since diverging from a common ancestral allele). All six amino acid substitutions occurred in a 56-residue intravesicular loop (IV1 domain) of the vesicle protein and each involved a radical change. An analysis of molecular variation revealed significant heterogeneity in the frequencies of recently derived mutations segregating within both allelic classes, suggesting that two selective sweeps may be presently occurring among populations. The dynamic nature of the Pan I polymorphism in G. morhua and clear departure from equilibrium conditions invalidate a simple model of spatially varying selection. PMID:11139512

  8. Molecular Epidemiology of Mycoplasma pneumoniae: Genotyping Using Single Nucleotide Polymorphisms and SNaPshot Technology

    PubMed Central

    Touati, A.; Blouin, Y.; Sirand-Pugnet, P.; Renaudin, H.; Oishi, T.; Vergnaud, G.; Bébéar, C.


    Molecular typing of Mycoplasma pneumoniae is an important tool for identifying grouped cases and investigating outbreaks. In the present study, we developed a new genotyping method based on single nucleotide polymorphisms (SNPs) selected from the whole-genome sequencing of eight M. pneumoniae strains, using the SNaPshot minisequencing assay. Eight SNPs, localized in housekeeping genes, predicted lipoproteins, and adhesin P1 genes were selected for genotyping. These SNPs were evaluated on 140 M. pneumoniae clinical isolates previously genotyped by multilocus variable-number tandem-repeat analysis (MLVA-5) and adhesin P1 typing. This method was also adapted for direct use with clinical samples and evaluated on 51 clinical specimens. The analysis of the clinical isolates using the SNP typing method showed nine distinct SNP types with a Hunter and Gaston diversity index (HGDI) of 0.836, which is higher than the HGDI of 0.583 retrieved for the MLVA-4 typing method, where the nonstable Mpn1 marker was removed. A strong correlation with the P1 adhesin gene typing results was observed. The congruence was poor between MLVA-5 and SNP typing, indicating distinct genotyping schemes. Combining the results increased the discriminatory power. This new typing method based on SNPs and the SNaPshot technology is a method for rapid M. pneumoniae typing directly from clinical specimens, which does not require any sequencing step. This method is based on stable markers and provides information distinct from but complementary to MLVA typing. The combined use of SNPs and MLVA typing provides powerful discrimination of strains. PMID:26202117

  9. Identification of single-nucleotide polymorphism markers associated with cortisol response to crowding in rainbow trout.


    Liu, Sixin; Vallejo, Roger L; Gao, Guangtu; Palti, Yniv; Weber, Gregory M; Hernandez, Alvaro; Rexroad, Caird E


    Understanding stress responses is essential for improving animal welfare and increasing agriculture production efficiency. Previously, we reported microsatellite markers associated with quantitative trait loci (QTL) affecting plasma cortisol response to crowding in rainbow trout. In this study, our main objectives were to identify single-nucleotide polymorphism (SNP) markers associated with cortisol response to crowding in rainbow trout using both GWAS (genome-wide association studies) and QTL mapping methods and to employ rapidly expanding genomic resources for rainbow trout toward the identification of candidate genes affecting this trait. A three-generation F2 mapping family (2008052) was genotyped using RAD-seq (restriction-site-associated DNA sequencing) to identify 4874 informative SNPs. GWAS identified 26 SNPs associated with cortisol response to crowding whereas QTL mapping revealed two significant QTL on chromosomes Omy8 and Omy12, respectively. Positional candidate genes were identified using marker sequences to search the draft genome assembly of rainbow trout. One of the genes in the QTL interval on Omy12 is a putative serine/threonine protein kinase gene that was differentially expressed in the liver in response to handling and confinement stress in our previous study. A homologue of this gene was differentially expressed in zebrafish embryos exposed to diclofenac, a nonsteroidal anti-inflammatory drug (NSAID) and an environmental toxicant. NSAIDs have been shown to affect the cortisol response in rainbow trout; therefore, this gene is a good candidate based on its physical position and expression. However, the reference genome resources currently available for rainbow trout require continued improvement as demonstrated by the unmapped SNPs and the putative assembly errors detected in this study.

  10. Identification of Single Nucleotide Polymorphism Marker and Association Analysis of Marbling Score in Fas Gene of Hanwoo.


    Kim, Seung-Chang; Lee, Seung-Hwan; Lee, Ji-Woong; Kim, Tae-Hun; Choi, Bong-Hwan


    The Fas (APO-1, TNFRSF6) gene known as a member of the tumor necrosis factor receptor superfamily was selected for DNA marker development in Korean cattle. It is a cell membrane protein and mediates programmed cell death (apoptosis). We discovered single nucleotide polymorphisms (SNPs) within Fas gene in order to develop novel DNA markers related to economical traits at the genomic level. The sequences of whole exon and 1 kb range of both front and back of the gene were determined by direct-sequencing methods using 24 cattle. A total of 55 SNPs were discovered and we selected 31 common polymorphic sites considering their allele frequencies, haplotype-tagging status and linkage disequilibrium (LD) for genotyping in larger-scale subjects. The SNPs were confirmed genotype through the SNaPshot method (n = 274) and were examined for a possible genetic association between Fas polymorphisms and marbling score. So, the SNPs that were identified significant are g.30256G>C, g.31474C>A, g.31940A>G, and g.32982G>A. These results suggest that SNPs of Fas gene were associated with intramuscular fat content of meat quality traits in Korean cattle.

  11. Reverse random amplified microsatellite polymorphism reveals enhanced polymorphisms in the 3' end of simple sequence repeats in the pepper genome.


    Min, Woong-Ki; Han, Jung-Heon; Kang, Won-Hee; Lee, Heung-Ryul; Kim, Byung-Dong


    Microsatellites or simple sequence repeats (SSR) are widely distributed in eukaryotic genomes and are informative genetic markers. Despite many advantages of SSR markers such as a high degree of allelic polymorphisms, co-dominant inheritance, multi-allelism, and genome-wide coverage in various plant species, they also have shortcomings such as low polymorphic rates between genetically close lines, especially in Capsicum annuum. We developed an alternative technique to SSR by normalizing and alternating anchored primers in random amplified microsatellite polymorphisms (RAMP). This technique, designated reverse random amplified microsatellite polymorphism (rRAMP), allows the detection of nucleotide variation in the 3' region flanking an SSR using normalized anchored and random primer combinations. The reproducibility and frequency of polymorphic loci in rRAMP was vigorously enhanced by translocation of the 5' anchor of repeat sequences to the 3' end position and selective use of moderate arbitrary primers. In our study, the PCR banding pattern of rRAMP was highly dependent on the frequency of repeat motifs and primer combinations with random primers. Linkage analysis showed that rRAMP markers were well scattered on an intra-specific pepper map. Based on these results, we suggest that this technique is useful for studying genetic diversity, molecular fingerprinting, and rapidly constructing molecular maps for diverse plant species. PMID:18483466

  12. High resolution melting method to detect single nucleotide polymorphism of VKORC1 and CYP2C9.


    Chen, Chunxia; Li, Siyue; Lu, Xiaojun; Tan, Bin; Huang, Chunyan; Qin, Li


    Single nucleotide polymorphisms (SNPs) of VKORC (1173T/C, rs9934438) and CYP2C9 (1075A/C, rs1057910) are major contributory factors on the sensitivity of warfarin in Chinese. Analysis of the two genomic loci could help warfarin treatment individual from bleeding or thrombosis events. An assay with the advantages of simplicity, speed, high sensitivity and low cost for genotyping is calling for clinical laboratories. High resolution method (HRM) meets these callings, but no study with large sample tested its performance in genotyping of rs9934438 and rs1057910. In this study, we identified polymorphisms of rs9934438 and rs1057910 in 255 unrelated Chinese heart valve replacement patients of Han ethnic group from West China Hospital. The two genomic loci were genotyped by HRM using LightCycler® 480 High Resolution Melting Master on LightCycler® 480 Real-Time PCR instruments (Roche Diagnostics), and all amplified PCR products were sent for direct DNA sequencing. The genotyping of rs1057910 between HRM and sequencing showed perfect 100% concordance. While the concordance of rs9934438 between HRM and sequencing was 99.2%. Unexpected mutation interfered genotyping results of HRM when genotyping rs9934438. HRM is a valuable technique for genotype detection of rs9934438 and rs1057910 to assess individual sensitivity to warfarin, where DNA sequencing is added inevitably sometimes.

  13. Empirical Bayes Estimation of Coalescence Times from Nucleotide Sequence Data.


    King, Leandra; Wakeley, John


    We demonstrate the advantages of using information at many unlinked loci to better calibrate estimates of the time to the most recent common ancestor (TMRCA) at a given locus. To this end, we apply a simple empirical Bayes method to estimate the TMRCA. This method is both asymptotically optimal, in the sense that the estimator converges to the true value when the number of unlinked loci for which we have information is large, and has the advantage of not making any assumptions about demographic history. The algorithm works as follows: we first split the sample at each locus into inferred left and right clades to obtain many estimates of the TMRCA, which we can average to obtain an initial estimate of the TMRCA. We then use nucleotide sequence data from other unlinked loci to form an empirical distribution that we can use to improve this initial estimate. PMID:27440864

  14. Cloning, nucleotide sequence, and expression of Achromobacter protease I gene.


    Ohara, T; Makino, K; Shinagawa, H; Nakata, A; Norioka, S; Sakiyama, F


    Achromobacter protease I (API) is a lysine-specific serine protease which hydrolyzes specifically the lysyl peptide bond. A gene coding for API was cloned from Achromobacter lyticus M497-1. Nucleotide sequence of the cloned DNA fragment revealed that the gene coded for a single polypeptide chain of 653 amino acids. The N-terminal 205 amino acids, including signal peptide and the threonine/serine-rich C-terminal 180 amino acids are flanking the 268 amino acid-mature protein which was identified by protein sequencing. Escherichia coli carrying a plasmid containing the cloned API gene overproduced and secreted a protein of Mr 50,000 (API') into the periplasm. This protein exhibited a distinct endopeptidase activity specific for lysyl bonds as well. The N-terminal amino acid sequence of API' was the same as mature API, suggesting that the enzyme retained the C-terminal extended peptide chain. The present experiments indicate that API, an extracellular protease produced by gram-negative bacteria, is synthesized in vivo as a precursor protein bearing long extended peptide chains at both N and C termini. PMID:2684982

  15. Complete nucleotide sequence of Nootka lupine vein-clearing virus.


    Robertson, Nancy L; Côté, Fabien; Paré, Christine; Leblanc, Eric; Bergeron, Michel G; Leclerc, Denis


    The complete genome sequence of Nootka lupine vein-clearing virus (NLVCV) was determined to be 4,172 nucleotides in length containing four open reading frames (ORFs) with a similar genetic organization of virus species in the genus Carmovirus, family Tombusviridae. The order and gene product size, starting from the 5'-proximal ORF consisted of: (1) polymerase/replicase gene, ORF1 (p27) and ORF1RT (readthrough) (p87), (2) movement proteins ORF2 (p7) and ORF3 (p9), and, (3) the 3'-proximal coat protein ORF4, (p37). The genomic 5'- and 3'-proximal termini contained a short (59 nt) and a relatively longer 405 nt untranslated region, respectively. The longer replicase gene product contained the GDD motif common to RNA-dependent RNA polymerases. Phylogenetically, NLVCV formed a subgroup with the following four carmoviruses when separately comparing the amino acids of the coat protein or replicase protein: Angelonia flower break virus (AnFBV), Carnation mottle virus (CarMV), Pelargonium flower break virus (PFBV), and Saguaro cactus virus (SgCV). Whole genome nucleotide analysis (percent identities) among the carmoviruses with NLVCV suggested a similar pattern. The species demarcation criteria in the genus Carmovirus for the amino acid sequence identity of the polymerase (<52%) and coat (<41%) protein genes restricted NLVCV as a distinct species, and instead, placed it as a tentative strain of CarMV, PFBV, or SgCV when both the polymerase and CP were used as the determining factors. In contrast, the species criteria that included different host ranges with no overlap and lack of serology relatedness between NLVCV and the carmoviruses, suggested that NLVCV was a distinct species. The relatively low cutoff percentages allowed for the polymerase and CP genes to dictate the inclusion/exclusion of a distinct carmovirus species should be reevaluated. Therefore, at this time we have concluded that NLVCV should be classified as a tentative new species in the genus Carmovirus

  16. Genome-wide association study reveals five nucleotide sequence variants for carcass traits in beef cattle.


    Kim, Y; Ryu, J; Woo, J; Kim, J B; Kim, C Y; Lee, C


    Genetic associations of nucleotide sequence variants with carcass traits in beef cattle were investigated using a genome-wide single nucleotide polymorphism (SNP) assay. Three hundred and thirteen Korean cattle were genotyped with the Illumina BovineSNP50 BeadChip, and 39,129 SNPs from 311 animals were analysed for each carcass phenotype after filtering by quality assurance. Five sequence markers were associated with one of the meat quantity or quality traits; rs109593638 on chromosome 3 with marbling score, rs109821175 on chromosome 11 and rs110862496 on chromosome 13 with backfat thickness (BFT), and rs110228023 on chromosome 6 and rs110201414 on chromosome 16 with eye muscle area (EMA) (P < 1.27 × 10(-6) , Bonferonni P < 0.05). The ss96319521 SNP, located within a gene with functions of muscle development, dishevelled homolog 1 (DVL1), would be a desirable candidate marker. Individuals with genotype CC at this gene appeared to have increased both EMA and carcass weight. Fine-mapping would be required to refine each of the five association signals shown in the current study for future application in marker-assisted selection for genetic improvement of beef quality and quantity.

  17. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.


    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M


    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  18. Multilocus patterns of nucleotide polymorphism and demographic change in Taxodium distichum (Cupressaceae) in the lower Mississippi River alluvial valley

    USGS Publications Warehouse

    Kusumi, Junko; Zidong, Li; Kado, Tomoyuki; Tsumura, Yoshihiko; Middleton, Beth A.; Tachida, Hidenori


    Conclusions: Taxodium distichum had significantly higher nucleotide variation than C. japonica, and its patterns of polymorphism contrasted strikingly with those of the latter, which previously has been inferred to have experienced a reduction in population size.

  19. DNA sequencing using differential extension with nucleotide subsets (DENS).

    PubMed Central

    Raja, M C; Zevin-Sonkin, D; Shwartzburd, J; Rozovskaya, T A; Sobolev, I A; Chertkov, O; Ramanathan, V; Lvovsky, L; Ulanovsky, L E


    Here we describe template directed enzymatic synthesis of unique primers, avoiding the chemical synthesis step in primer walking. We have termed this conceptually new technique DENS (differential extension with nucleotide subsets). DENS works by selectively extending a short primer, making it a long one at the intended site only. The procedure starts with a limited initial extension of the primer (at 20-30 degrees C) in the presence of only two out of the four possible dNTPs. The primer is extended by 6-9 bases or longer at the intended priming site, which is deliberately selected, (as is the two-dNTP set), to maximize the extension length. The subsequent termination reaction at 60-65 degrees C then accepts the extended primer at the intended site, but not at alternative sites, where the initial extension (if any) is generally much shorter. DENS allows the use of primers as long as 8mers (degenerate in two positions) which prime much more strongly than modular primers involving 5-7mers and which (unlike the latter) can be used with thermostable polymerases, thus allowing cycle-sequencing with dye-terminators compatible with Taq DNA polymerase, as well as making double-stranded DNA sequencing more robust. PMID:9016632

  20. Nucleotide sequence determines the accelerated rate of point mutations.


    Kini, R Manjunatha; Chinnasamy, Arunkumar


    Although the theory of evolution was put forth about 150 years ago our understanding of how molecules drive evolution remains poor. It is well-established that proteins evolve at different rates, essentially based on their functional role and three-dimensional structure. However, the highly variable rates of evolution of different proteins - especially the rapidly evolving ones - within a single organism are poorly understood. Using examples of genes for fast-evolving toxins and human hereditary diseases, we show for the first time that specific nucleotide sequences appear to determine point mutation rates. Based on mutation rates, we have classified triplets (not just codons) into stable, unstable and intermediate groups. Toxin genes contain a relatively higher percentage of unstable triplets in their exons compared to introns, whereas non-toxin genes contain a higher percentage of unstable triplets in their introns. Thus the distribution of stable and unstable triplets is correlated with and may explain the accelerated evolution of point mutations in toxins. Similarly, at the genomic level, lower organisms with genes that evolve faster contain a higher percentage of unstable triplets compared to higher organisms. These findings show that mutation rates of proteins, and hence of the organisms, are DNA sequence-dependent and thus provide a proximate mechanism of evolution at the molecular level. PMID:20362603

  1. Single nucleotide polymorphism analysis of the endopolygalacturonase gene in peach and its potential use in crossbreeding programs.


    Jiao, Y; Ma, R; Yu, M


    Single nucleotide polymorphisms (SNPs) are the most abundant sequence variations found in plant genomes and are widely used as molecular genetic markers in genetic diversity studies and crossbreeding programs. In this study, we examined 113 DNA sequences of the endopolygalacturonase (endo-PG) gene from 67 peach accessions and found a total of 56 SNPs and 6 insertion/deletions (indels), with a frequency of 3, 1, and 3% for the transitions, transversions, and indels, respectively. Meanwhile, the majority of the observed SNPs were found in the intron regions, while only 2 variable sites and a single indel were detected in the exon regions. A dendrogram was obtained using neighbor-joining cluster analysis and divided into 2 main groups, providing evidence that most of the accessions of the clingstone nonmelting flesh phenotypes generally clustered together and were comparatively nonrelated to the "stony hard" peach cultivars, which were in a different branch altogether. Furthermore, 4 major haplotypes were formed and 3 cleaved amplified polymorphic sequence primer sets were mined according to fruit texture and stone adhesion, displaying their potential as candidate molecular markers for discriminating genotypes. This research will assist peach genetic enhancement by introducing a novel crossbreeding strategy. PMID:25966181

  2. The nucleotide sequence of the uvrD gene of E. coli.

    PubMed Central

    Finch, P W; Emmerson, P T


    The nucleotide sequence of a cloned section of the E. coli chromosome containing the uvrD gene has been determined. The coding region for the UvrD protein consists of 2,160 nucleotides which would direct the synthesis of a polypeptide 720 amino acids long with a calculated molecular weight of 82 kd. The predicted amino acid sequence of the UvrD protein has been compared with the amino acid sequences of other known adenine nucleotide binding proteins and a common sequence has been identified, thought to contribute towards adenine nucleotide binding. PMID:6379604

  3. Single-nucleotide polymorphism genotyping on optical thin-film biosensor chips

    PubMed Central

    Zhong, Xiao-bo; Reynolds, Robert; Kidd, Judith R.; Kidd, Kenneth K.; Jenison, Robert; Marlar, Richard A.; Ward, David C.


    Single-nucleotide polymorphisms (SNPs) constitute the bulk of human genetic variation and provide excellent markers to identify genetic factors contributing to complex disease susceptibility. A rapid, sensitive, and inexpensive assay is important for large-scale SNP scoring. Here we report the development of a multiplex SNP detection system using silicon chips coated to create a thin-film optical biosensor. Allele-discriminating, aldehyde-labeled oligonucleotides are arrayed and covalently attached to a hydrazinederivatized chip surface. Target sequences (e.g., PCR amplicons) then are hybridized in the presence of a mixture of biotinylated detector probes, one for each SNP, and a thermostable DNA ligase. After a stringent wash (0.01 M NaOH), ligation of biotinylated detector probes to perfectly matched capture oligomers is visualized as a color change on the chip surface (gold to blue/purple) after brief incubations with an anti-biotin IgG-horseradish peroxidase conjugate and a precipitable horseradish peroxidase substrate. Testing of PCR fragments is completed in 30–40 min. Up to several hundred SNPs can be assayed on a 36-mm2 chip, and SNP scoring can be done by eye or with a simple digital-camera system. This assay is extremely robust, exhibits high sensitivity and specificity, and is format-flexible and economical. In studies of mutations associated with risk for venous thrombosis and genotyping/haplotyping of African-American samples, we document high-fidelity analysis with 0 misassignments in 500 assays performed in duplicate. PMID:12975525

  4. Assessing patterns of hybridization between North Atlantic eels using diagnostic single-nucleotide polymorphisms.


    Pujolar, J M; Jacobsen, M W; Als, T D; Frydenberg, J; Magnussen, E; Jónsson, B; Jiang, X; Cheng, L; Bekkevold, D; Maes, G E; Bernatchez, L; Hansen, M M


    The two North Atlantic eel species, the European eel (Anguilla anguilla) and the American eel (Anguilla rostrata), spawn in partial sympatry in the Sargasso Sea, providing ample opportunity to interbreed. In this study, we used a RAD (Restriction site Associated DNA) sequencing approach to identify species-specific diagnostic single-nucleotide polymorphisms (SNPs) and design a low-density array that combined with screening of a diagnostic mitochondrial DNA marker. Eels from Iceland (N=159) and from the neighboring Faroe Islands (N=29) were genotyped, along with 94 larvae (49 European and 45 American eel) collected in the Sargasso Sea. Our SNP survey showed that the majority of Icelandic eels are pure European eels but there is also an important contribution of individuals of admixed ancestry (10.7%). Although most of the hybrids were identified as F1 hybrids from European eel female × American eel male crosses, backcrosses were also detected, including a first-generation backcross (F1 hybrid × pure European eel) and three individuals identified as second-generation backcrosses originating from American eel × F1 hybrid backcrosses interbreeding with pure European eels. In comparison, no hybrids were observed in the Faroe Islands, the closest bodies of land to Iceland. It is possible that hybrids show an intermediate migratory behaviour between the two parental species that ultimately brings hybrid larvae to the shores of Iceland, situated roughly halfway between the Sargasso Sea and Europe. Only two hybrids were observed among Sargasso Sea larvae, both backcrosses, but no F1 hybrids, that points to temporal variation in the occurrence of hybridization.

  5. Assessing patterns of hybridization between North Atlantic eels using diagnostic single-nucleotide polymorphisms.


    Pujolar, J M; Jacobsen, M W; Als, T D; Frydenberg, J; Magnussen, E; Jónsson, B; Jiang, X; Cheng, L; Bekkevold, D; Maes, G E; Bernatchez, L; Hansen, M M


    The two North Atlantic eel species, the European eel (Anguilla anguilla) and the American eel (Anguilla rostrata), spawn in partial sympatry in the Sargasso Sea, providing ample opportunity to interbreed. In this study, we used a RAD (Restriction site Associated DNA) sequencing approach to identify species-specific diagnostic single-nucleotide polymorphisms (SNPs) and design a low-density array that combined with screening of a diagnostic mitochondrial DNA marker. Eels from Iceland (N=159) and from the neighboring Faroe Islands (N=29) were genotyped, along with 94 larvae (49 European and 45 American eel) collected in the Sargasso Sea. Our SNP survey showed that the majority of Icelandic eels are pure European eels but there is also an important contribution of individuals of admixed ancestry (10.7%). Although most of the hybrids were identified as F1 hybrids from European eel female × American eel male crosses, backcrosses were also detected, including a first-generation backcross (F1 hybrid × pure European eel) and three individuals identified as second-generation backcrosses originating from American eel × F1 hybrid backcrosses interbreeding with pure European eels. In comparison, no hybrids were observed in the Faroe Islands, the closest bodies of land to Iceland. It is possible that hybrids show an intermediate migratory behaviour between the two parental species that ultimately brings hybrid larvae to the shores of Iceland, situated roughly halfway between the Sargasso Sea and Europe. Only two hybrids were observed among Sargasso Sea larvae, both backcrosses, but no F1 hybrids, that points to temporal variation in the occurrence of hybridization. PMID:24424165

  6. Assessing patterns of hybridization between North Atlantic eels using diagnostic single-nucleotide polymorphisms

    PubMed Central

    Pujolar, J M; Jacobsen, M W; Als, T D; Frydenberg, J; Magnussen, E; Jónsson, B; Jiang, X; Cheng, L; Bekkevold, D; Maes, G E; Bernatchez, L; Hansen, M M


    The two North Atlantic eel species, the European eel (Anguilla anguilla) and the American eel (Anguilla rostrata), spawn in partial sympatry in the Sargasso Sea, providing ample opportunity to interbreed. In this study, we used a RAD (Restriction site Associated DNA) sequencing approach to identify species-specific diagnostic single-nucleotide polymorphisms (SNPs) and design a low-density array that combined with screening of a diagnostic mitochondrial DNA marker. Eels from Iceland (N=159) and from the neighboring Faroe Islands (N=29) were genotyped, along with 94 larvae (49 European and 45 American eel) collected in the Sargasso Sea. Our SNP survey showed that the majority of Icelandic eels are pure European eels but there is also an important contribution of individuals of admixed ancestry (10.7%). Although most of the hybrids were identified as F1 hybrids from European eel female × American eel male crosses, backcrosses were also detected, including a first-generation backcross (F1 hybrid × pure European eel) and three individuals identified as second-generation backcrosses originating from American eel × F1 hybrid backcrosses interbreeding with pure European eels. In comparison, no hybrids were observed in the Faroe Islands, the closest bodies of land to Iceland. It is possible that hybrids show an intermediate migratory behaviour between the two parental species that ultimately brings hybrid larvae to the shores of Iceland, situated roughly halfway between the Sargasso Sea and Europe. Only two hybrids were observed among Sargasso Sea larvae, both backcrosses, but no F1 hybrids, that points to temporal variation in the occurrence of hybridization. PMID:24424165

  7. An expanded sequence context model broadly explains variability in polymorphism levels across the human genome.


    Aggarwala, Varun; Voight, Benjamin F


    The rate of single-nucleotide polymorphism varies substantially across the human genome and fundamentally influences evolution and incidence of genetic disease. Previous studies have only considered the immediately flanking nucleotides around a polymorphic site--the site's trinucleotide sequence context--to study polymorphism levels across the genome. Moreover, the impact of larger sequence contexts has not been fully clarified, even though context substantially influences rates of polymorphism. Using a new statistical framework and data from the 1000 Genomes Project, we demonstrate that a heptanucleotide context explains >81% of variability in substitution probabilities, highlighting new mutation-promoting motifs at ApT dinucleotide, CAAT and TACG sequences. Our approach also identifies previously undocumented variability in C-to-T substitutions at CpG sites, which is not immediately explained by differential methylation intensity. Using our model, we present informative substitution intolerance scores for genes and a new intolerance score for amino acids, and we demonstrate clinical use of the model in neuropsychiatric diseases. PMID:26878723

  8. An expanded sequence context model broadly explains variability in polymorphism levels across the human genome

    PubMed Central

    Aggarwala, Varun; Voight, Benjamin F.


    The rate of single nucleotide polymorphism varies substantially across the human genome and fundamentally influences evolution and incidence of genetic disease. Previous studies have only considered the immediate flanking nucleotides around a polymorphic site –the site’s trinucleotide sequence context– to study polymorph levels across the genome. Moreover, the impact of larger sequence contexts has not been fully clarified, even though context substantially influences rates of polymorphism. Using a new statistical framework and data from the 1000 Genomes Project, we demonstrate that a heptanucleotide context explains >81% of variability in substitution probabilities, revealing new mutation-promoting motifs at ApT dinucleotide, CAAT, and TACG sequences. Our approach also identifies previously undocumented variability in C-to-T substitutions at CpG sites, which is not immediately explained by differential methylation intensity. Using our model, we present informative substitution intolerance scores for genes and a new intolerance score for amino acids, and we demonstrate clinical use of the model in neuropsychiatric diseases. PMID:26878723

  9. An expanded sequence context model broadly explains variability in polymorphism levels across the human genome.


    Aggarwala, Varun; Voight, Benjamin F


    The rate of single-nucleotide polymorphism varies substantially across the human genome and fundamentally influences evolution and incidence of genetic disease. Previous studies have only considered the immediately flanking nucleotides around a polymorphic site--the site's trinucleotide sequence context--to study polymorphism levels across the genome. Moreover, the impact of larger sequence contexts has not been fully clarified, even though context substantially influences rates of polymorphism. Using a new statistical framework and data from the 1000 Genomes Project, we demonstrate that a heptanucleotide context explains >81% of variability in substitution probabilities, highlighting new mutation-promoting motifs at ApT dinucleotide, CAAT and TACG sequences. Our approach also identifies previously undocumented variability in C-to-T substitutions at CpG sites, which is not immediately explained by differential methylation intensity. Using our model, we present informative substitution intolerance scores for genes and a new intolerance score for amino acids, and we demonstrate clinical use of the model in neuropsychiatric diseases.

  10. Spatially localized generation of nucleotide sequence-specific DNA damage

    PubMed Central

    Oh, Dennis H.; King, Brett A.; Boxer, Steven G.; Hanawalt, Philip C.


    Psoralens linked to triplex-forming oligonucleotides (psoTFOs) have been used in conjunction with laser-induced two-photon excitation (TPE) to damage a specific DNA target sequence. To demonstrate that TPE can initiate photochemistry resulting in psoralen–DNA photoadducts, target DNA sequences were incubated with psoTFOs to form triple-helical complexes and then irradiated in liquid solution with pulsed 765-nm laser light, which is half the quantum energy required for conventional one-photon excitation, as used in psoralen + UV A radiation (320–400 nm) therapy. Target DNA acquired strand-specific psoralen monoadducts in a light dose-dependent fashion. To localize DNA damage in a model tissue-like medium, a DNA–psoTFO mixture was prepared in a polyacrylamide gel and then irradiated with a converging laser beam targeting the rear of the gel. The highest number of photoadducts formed at the rear while relatively sparing DNA at the front of the gel, demonstrating spatial localization of sequence-specific DNA damage by TPE. To assess whether TPE treatment could be extended to cells without significant toxicity, cultured monolayers of normal human dermal fibroblasts were incubated with tritium-labeled psoralen without TFO to maximize detectable damage and irradiated by TPE. DNA from irradiated cells treated with psoralen exhibited a 4- to 7-fold increase in tritium activity relative to untreated controls. Functional survival assays indicated that the psoralen–TPE treatment was not toxic to cells. These results demonstrate that DNA damage can be simultaneously manipulated at the nucleotide level and in three dimensions. This approach for targeting photochemical DNA damage may have photochemotherapeutic applications in skin and other optically accessible tissues. PMID:11572980

  11. Spatially localized generation of nucleotide sequence-specific DNA damage.


    Oh, D H; King, B A; Boxer, S G; Hanawalt, P C


    Psoralens linked to triplex-forming oligonucleotides (psoTFOs) have been used in conjunction with laser-induced two-photon excitation (TPE) to damage a specific DNA target sequence. To demonstrate that TPE can initiate photochemistry resulting in psoralen-DNA photoadducts, target DNA sequences were incubated with psoTFOs to form triple-helical complexes and then irradiated in liquid solution with pulsed 765-nm laser light, which is half the quantum energy required for conventional one-photon excitation, as used in psoralen + UV A radiation (320-400 nm) therapy. Target DNA acquired strand-specific psoralen monoadducts in a light dose-dependent fashion. To localize DNA damage in a model tissue-like medium, a DNA-psoTFO mixture was prepared in a polyacrylamide gel and then irradiated with a converging laser beam targeting the rear of the gel. The highest number of photoadducts formed at the rear while relatively sparing DNA at the front of the gel, demonstrating spatial localization of sequence-specific DNA damage by TPE. To assess whether TPE treatment could be extended to cells without significant toxicity, cultured monolayers of normal human dermal fibroblasts were incubated with tritium-labeled psoralen without TFO to maximize detectable damage and irradiated by TPE. DNA from irradiated cells treated with psoralen exhibited a 4- to 7-fold increase in tritium activity relative to untreated controls. Functional survival assays indicated that the psoralen-TPE treatment was not toxic to cells. These results demonstrate that DNA damage can be simultaneously manipulated at the nucleotide level and in three dimensions. This approach for targeting photochemical DNA damage may have photochemotherapeutic applications in skin and other optically accessible tissues. PMID:11572980

  12. Phosphodiesterase 3A rs7134375 single nucleotide polymorphism and serum lipid levels

    PubMed Central



    The association between the phosphodiesterase 3A (PDE3A) rs7134375 single nucleotide polymorphism (SNP) and serum lipid levels are not well understood in the general population. The present study was performed in order to detect the association between the rs7134375 SNP and serum lipid levels in the Guangxi Mulao and Han populations. The genotypes of the PDE3A rs7134375 SNP in 761 subjects of the Mulao population and 774 subjects of the Han Chinese population were determined by polymerase chain reaction and restriction fragment length polymorphism combined with gel electrophoresis, and then confirmed by direct sequencing. It was observed that serum low-density lipoprotein cholesterol and apolipoprotein B levels were higher in the Mulao population than in the Han population (P<0.05 for each). The frequencies of the C and A alleles were 72.14 and 27.86% in the Mulao population, and 78.55 and 21.45% in the Han population (P<0.01), respectively. The frequencies of the CC, CA and AA genotypes were 52.04, 40.21 and 7.75% in the Mulao population, and 61.50, 34.11 and 4.39% in the Han population (P<0.01), respectively. The frequencies of the C and A alleles were 74.89 and 25.11% in Mulao females, and 68.08 and 31.92% in Mulao males (P<0.01), respectively. The serum triglyceride (TG) levels were different among the genotypes in the Mulao population; however, not in the Han population (P<0.01), and the A allele carriers exhibited lower TG levels than the A allele noncarriers. The serum lipid parameters were also correlated with several environmental factors in the two ethnic groups (P<0.05-0.001). It was concluded that the genotypic and allelic frequencies of the rs7134375 SNP are different between the Mulao and Han populations. In addition, the PDE3A rs7134375 SNP is associated with serum TG levels in the Mulao population, however, not in the Han population. PMID:24604378

  13. Methodology for single nucleotide polymorphism selection in promoter regions for clinical use. An example of its applicability

    PubMed Central

    Marques, Herlander; Freitas, José; Medeiros, Rui; Longatto-Filho, Adhemar


    Genetic variability in humans can explain many differences in disease risk factors. Polymorphism-related studies focus mainly on the single nucleotide polymorphisms (SNPs) of coding regions of the genes. SNPs on DNA binding motifs of the promoter region have been less explored. On a recent study of SNPs in patients with non-Hodgkin lymphomas we faced the problem of SNP selection from promoter regions and developed a practical methodology for clinical studies. The process consists in identifying SNPs in the coding and promoter regions of the antigen-processing system using the ‘dbSNP’ database. With the ‘HapMap’ program, we select SNPs with frequencies >20% in Caucasian populations. For coding regions, we sought biologically and clinically relevant SNPs described in the literature. For the promoter regions, we determined their chromosomal location on ‘QiagenSABioscience’ site database. The nucleotide sequence of ancestral and variant alleles is available in the ‘dbSNP’. These sequences were used in ‘Promoter TESS’ to determine binding differences of transcription factors. Each sequence may have affinity to different TFs. Thus, SNP selection on the promoter regions was based in the differences on TF binding pattern between the old and the new allele. The potential clinical relevance of the new TFs was also evaluated before the final selection. With this approach, we found that almost half of the relevant SNP fall within the promoter region. In conclusion, we were able to develop a methodology of oriented selection of promoter regions of human genes, comparing the TF with affinity to the ancestral allele with the TF to a variant allele. We selected those SNPs that change the TF’s affinity to a pattern with functional significance. PMID:27766139

  14. Identification of Pyrus single nucleotide polymorphisms (SNPs) and evaluation for genetic mapping in European pear and interspecific Pyrus hybrids.


    Montanari, Sara; Saeed, Munazza; Knäbel, Mareike; Kim, YoonKyeong; Troggio, Michela; Malnoy, Mickael; Velasco, Riccardo; Fontana, Paolo; Won, KyungHo; Durel, Charles-Eric; Perchepied, Laure; Schaffer, Robert; Wiedow, Claudia; Bus, Vincent; Brewer, Lester; Gardiner, Susan E; Crowhurst, Ross N; Chagné, David


    We have used new generation sequencing (NGS) technologies to identify single nucleotide polymorphism (SNP) markers from three European pear (Pyrus communis L.) cultivars and subsequently developed a subset of 1096 pear SNPs into high throughput markers by combining them with the set of 7692 apple SNPs on the IRSC apple Infinium® II 8K array. We then evaluated this apple and pear Infinium® II 9K SNP array for large-scale genotyping in pear across several species, using both pear and apple SNPs. The segregating populations employed for array validation included a segregating population of European pear ('Old Home'×'Louise Bon Jersey') and four interspecific breeding families derived from Asian (P. pyrifolia Nakai and P. bretschneideri Rehd.) and European pear pedigrees. In total, we mapped 857 polymorphic pear markers to construct the first SNP-based genetic maps for pear, comprising 78% of the total pear SNPs included in the array. In addition, 1031 SNP markers derived from apple (13% of the total apple SNPs included in the array) were polymorphic and were mapped in one or more of the pear populations. These results are the first to demonstrate SNP transferability across the genera Malus and Pyrus. Our construction of high density SNP-based and gene-based genetic maps in pear represents an important step towards the identification of chromosomal regions associated with a range of horticultural characters, such as pest and disease resistance, orchard yield and fruit quality.

  15. Association of single nucleotide polymorphism rs6983267 with the risk of prostate cancer

    PubMed Central

    Yang, Yuan; Wang, Wenjing; Zhang, Liangcai; Zhang, Shihua; Liu, Guiyou; Yu, Yingcui; Liao, Mingzhi


    Many studies have investigated the association between single nucleotide polymorphism (SNP) rs6983267 and the risk of prostate cancer. However, results of these studies are inconsistent. Therefore, we summarised available data and performed a meta-analysis to determine this association. Relevant articles were identified by searching the PubMed, Web of Science and Embase database. Odds ratios (ORs) with 95% confidence intervals (CIs) were calculated using random effects model. We used dominant model (GG + TG vs TT), recessive model (GG vs TG + TT) and additive model (GG +TT vs TG) to determine the association between the rs6983267 polymorphism and risk of prostate cancer. Summary, 9 studies involving 8726 participants were included in this meta-analysis. Overall, though no association was observed between the rs6983267 polymorphism and risk of prostate cancer, subgroup analysis according to ethnicity showed a significant association between the rs6983267 polymorphism and risk of prostate cancer among white European men [recessive model: GG vs TG + TT, OR=1.21, (95% CI: 1.03, 1.42), P=0.02]. Our results indicate that the GG genotype of the rs6983267 polymorphism will increase individual susceptibility to prostate cancer in white European men. PMID:27009866

  16. Association of single nucleotide polymorphism rs6983267 with the risk of prostate cancer.


    Yang, Yuan; Wang, Wenjing; Zhang, Liangcai; Zhang, Shihua; Liu, Guiyou; Yu, Yingcui; Liao, Mingzhi


    Many studies have investigated the association between single nucleotide polymorphism (SNP) rs6983267 and the risk of prostate cancer. However, results of these studies are inconsistent. Therefore, we summarised available data and performed a meta-analysis to determine this association. Relevant articles were identified by searching the PubMed, Web of Science and Embase database. Odds ratios (ORs) with 95% confidence intervals (CIs) were calculated using random effects model. We used dominant model (GG + TG vs TT), recessive model (GG vs TG + TT) and additive model (GG +TT vs TG) to determine the association between the rs6983267 polymorphism and risk of prostate cancer. Summary, 9 studies involving 8726 participants were included in this meta-analysis. Overall, though no association was observed between the rs6983267 polymorphism and risk of prostate cancer, subgroup analysis according to ethnicity showed a significant association between the rs6983267 polymorphism and risk of prostate cancer among white European men [recessive model: GG vs TG + TT, OR=1.21, (95% CI: 1.03, 1.42), P=0.02]. Our results indicate that the GG genotype of the rs6983267 polymorphism will increase individual susceptibility to prostate cancer in white European men.

  17. rs621554 single nucleotide polymorphism of DLC1 is associated with breast cancer susceptibility and prognosis.


    Ding, Xia; Gao, Sumei; Yang, Qifeng


    Deleted in liver cancer 1 (DLC1) on chromosome 8p22, is an important tumor suppressor gene originally identified to be deleted in hepatocellular carcinoma. It can regulate the structure of the actin cytoskeleton and inhibit cell proliferation, motility and angiogenesis, which predominantly depends on its homology to rat RhoGAP. There are many genetic variants in DLC1, which may influence its antitumor efficacy. The rs621554 (IVS19+108C>T) polymorphism is a synonymous single nucleotide polymorphism (SNP) previously found to be associated with hepatocellular carcinoma. In the present study, 453 patients with breast cancer and 330 healthy females were analyzed using a cycling probe method. It was determined that the rs621554 polymorphism of DLC1 was associated with breast cancer susceptibility, with the CC and CT genotypes resulting in a higher risk of developing breast cancer. In regard to clinicopathological variables, it was demonstrated that the CT and CC genotype were associated with tumor size, lymph node metastasis and progesterone receptor status. Patients with the CT and CC genotype had shorter disease-free survival and overall survival rates compared with those with the TT genotype. Additionally, it was demonstrated that the rs621554 polymorphism was correlated with DLC1 expression at the mRNA level. These results suggested that the rs621554 polymorphism is associated with breast cancer susceptibility and prognosis, and may serve as a biomarker for breast cancer development and progression.

  18. Role of ADAM33 gene and associated single nucleotide polymorphisms in asthma.


    Sharma, Neeraj; Tripathi, Priya; Awasthi, Shally


    Asthma is a multifactorial disorder, primarily resulting from interactions between genetic and environmental factors. ADAM33 gene (located on chromosome 20p13) has been reported to play an important role in asthma. This review article is intended to include all of the publications, to date, which have assessed the association of ADAM33 gene polymorphisms as well as have shown the role of ADAM33 gene in airway remodeling and their expression with asthma. A PubMed search was performed for studies published between 1990 and 2010. The terms "ADAM33," "ADAM33 gene and asthma," and "ADAM33 gene polymorphisms" were used as search criteria. Based on available literature we can only speculate its role in the morphogenesis and functions of the lung. Fourteen studies conducted in different populations were found showing an association of ADAM33 gene polymorphisms with asthma. However, none of the single nucleotide polymorphisms (SNPs) of ADAM33 gene had found association with asthma across all ethnic groups. Because higher expression of ADAM33 is found in the fibroblast and smooth muscle cells of the lung, over- or underexpression of ADAM33 gene may result in alterations in airway remodeling and repair processes. However, no SNP of ADAM33 gene showed significant associations with asthma across all ethnic groups; the causative polymorphism, if any, still has to be identified.

  19. Single nucleotide polymorphism profiling across the methotrexate pathway in normal subjects and patients with rheumatoid arthritis.


    Ranganathan, Prabha; Culverhouse, Robert; Marsh, Sharon; Ahluwalia, Ranjeet; Shannon, William D; Eisen, Seth; McLeod, Howard L


    Methotrexate (MTX) is a commonly used disease-modifying antirheumatic drug in rheumatoid arthritis (RA). Polymorphisms occur in several genes encoding key enzymes in the folic acid pathway, which is influenced by MTX, but have not been evaluated in patients with RA. The effect of race on allele frequency has also not been evaluated. In this study, the allele frequencies of polymorphisms in six key enzymes in the MTX-folate pathway in patients with RA and healthy controls, including several common racial groups were studied. European- and African-American patients with RA and European and African healthy controls were genotyped for 22 genetic loci in six genes in the MTX cellular pathway. Differences in genotype distributions between the different racial groups were evaluated using chi(2) tests. Allele frequencies were significantly different (p < 0.001) for eight single nucleotide polymorphisms between the European and African controls. The allele frequencies of two polymorphisms showed significant differences (p < 0.001) between the African- and European-American patients with RA. Thus, racial differences exist between the allele frequencies of several polymorphisms in enzymes in the MTX-folate pathway in patients with RA and healthy controls. Whether such differences contribute to a differential response to MTX in patients with RA deserves to be investigated.

  20. Sequencing-based typing reveals new insight in HLA-DPA1 polymorphism.


    Rozemuller, E H; Bouwens, A G; van Oort, E; Versluis, L F; Marsh, S G; Bodmer, J G; Tilanus, M G


    An HLA-DPA1 sequencing-based typing (SBT) system has been developed to identify DPA1 alleles. Up to now eight DPA1 alleles have been defined. Six can be discriminated based upon exon 2 polymorphism. The three subtypes of DPA1*01: DPA1*0101, DPA1*0102 and DPA1*0103, have identical exon 2 sequences but show differences in exon 4. Exon 4 sequences were known for only the three DPA1*01 subtypes and for DPA1*0201. We now present additional sequence information for exon 4 and the unknown segments at the 3' end of exon 2. Additionally with the use of this sequencing technique it is also possible to identify previously unidentified polymorphism. We have studied the exon 2 and exon 4 polymorphism of DPA1 in 40 samples which include all known DPA1 alleles. A new allele, DPA1*01 new, was identified which differs by one nucleotide in exon 2 from DPA1*0103, resulting in an aspartic acid at codon 28. The DPA1*01 subtypes DPA1*0101 and DPA1*0102 could not be confirmed in samples which previously were used to define these subtypes, and consequently they do not exist. The exon 4 sequence of DPA1*0201 is corrected based on sequence data of DAUDI, the cell line in which DPA1*0202 was originally defined. The exon 4 regions of the remaining four alleles were resolved: the exon 4 regions of the alleles DPA1*02021 and DPA1*02022 were found to be identical to the--corrected--DPA1*0201 whereas the exon 4 region of DPA1*0301 differs by one nucleotide compared to DPA1*0103. The DPA1*0401 exon 4 region differs by one nucleotide compared to the corrected DPA1*0201.(ABSTRACT TRUNCATED AT 250 WORDS)

  1. Single Nucleotide Polymorphisms in Nucleotide Excision Repair Genes, Cigarette Smoking, and the Risk of Head and Neck Cancer

    PubMed Central

    Wyss, Annah B.; Herring, Amy H.; Avery, Christy L.; Weissler, Mark C.; Bensen, Jeannette T.; Barnholtz-Sloan, Jill S.; Funkhouser, William K.; Olshan, Andrew F.


    Background Cigarette smoking is associated with increased head and neck cancer (HNC) risk. Tobacco-related carcinogens are known to cause bulky DNA adducts. Nucleotide excision repair (NER) genes encode enzymes that remove adducts and may be independently associated with HNC, as well as modifiers of the association between smoking and HNC. Methods Using population-based case-control data from the Carolina Head and Neck Cancer Epidemiology Study (1,227 cases, 1,325 controls), race-stratified (white, African American) conventional and hierarchical logistic regression models were utilized to estimate odds ratios (OR) with 95% intervals (I) for the independent and joint effects of cigarette smoking and 84 single nucleotide polymorphisms (SNPs) from 15 NER genes on HNC risk. Results The odds of HNC were elevated among ever cigarette smokers, and increased with smoking duration and frequency. Among whites, rs4150403 on ERCC3 was associated with increased HNC odds (AA+AG vs. GG, OR=1.28, 95% I=1.01,1.61). Among African Americans, rs4253132 on ERCC6 was associated with decreased HNC odds (CC+CT vs. TT, OR=0.62, 95% I=0.45,0.86). Interactions between ever cigarette smoking and three SNPs (rs4253132 on ERCC6, rs2291120 on DDB2, and rs744154 on ERCC4) suggested possible departures from additivity among whites. Conclusions We did not find associations between some previously studied NER variants and HNC. We did identify new associations between two SNPs and HNC and three suggestive cigarette-SNP interactions to consider in future studies. Impact We conducted one of the most comprehensive evaluations of NER variants, identifying a few SNPs from biologically plausible candidate genes associated with HNC and possibly interacting with cigarette smoking. PMID:23720401

  2. Studying Bordetella pertussis populations by use of SNPeX, a simple high-throughput single nucleotide polymorphism typing method.


    Zeddeman, Anne; Witteveen, Sandra; Bart, Marieke J; van Gent, Marjolein; van der Heide, Han G J; Heuvelman, Kees J; Schouls, Leo M; Mooi, Frits R


    Large outbreaks of pertussis occur despite vaccination. A first step in the analyses of outbreaks is strain typing. However, the typing of Bordetella pertussis, the causative agent of pertussis, is problematic because the available assays are insufficiently discriminatory, not unequivocal, time-consuming, and/or costly. Here, we describe a single nucleotide primer extension assay for the study of B. pertussis populations, SNPeX (single nucleotide primer extension), which addresses these problems. The assay is based on the incorporation of fluorescently labeled dideoxynucleotides (ddNTPs) at the 3' end of allele-specific poly(A)-tailed primers and subsequent analysis with a capillary DNA analyzer. Each single nucleotide polymorphism (SNP) primer has a specific length, and as a result, up to 20 SNPs can be determined in one SNPeX reaction. Importantly, PCR amplification of target DNA is not required. We selected 38 SNPeX targets from the whole-genome sequencing data of 74 B. pertussis strains collected from across the world. The SNPeX-based phylogenetic trees preserved the general tree topology of B. pertussis populations based on whole-genome sequencing, with a minor loss of details. We envisage a strategy whereby SNP types (SnpTs) are quickly identified with the SNPeX assay during an outbreak, followed by whole-genome sequencing (WGS) of a limited number of isolates representing predominant SnpTs and the incorporation of novel SNPs in the SNPeX assay. The flexibility of the SNPeX assay allows the method to evolve along with the pathogen, making it a promising method for studying outbreaks of B. pertussis and other pathogens.

  3. Studying Bordetella pertussis populations by use of SNPeX, a simple high-throughput single nucleotide polymorphism typing method.


    Zeddeman, Anne; Witteveen, Sandra; Bart, Marieke J; van Gent, Marjolein; van der Heide, Han G J; Heuvelman, Kees J; Schouls, Leo M; Mooi, Frits R


    Large outbreaks of pertussis occur despite vaccination. A first step in the analyses of outbreaks is strain typing. However, the typing of Bordetella pertussis, the causative agent of pertussis, is problematic because the available assays are insufficiently discriminatory, not unequivocal, time-consuming, and/or costly. Here, we describe a single nucleotide primer extension assay for the study of B. pertussis populations, SNPeX (single nucleotide primer extension), which addresses these problems. The assay is based on the incorporation of fluorescently labeled dideoxynucleotides (ddNTPs) at the 3' end of allele-specific poly(A)-tailed primers and subsequent analysis with a capillary DNA analyzer. Each single nucleotide polymorphism (SNP) primer has a specific length, and as a result, up to 20 SNPs can be determined in one SNPeX reaction. Importantly, PCR amplification of target DNA is not required. We selected 38 SNPeX targets from the whole-genome sequencing data of 74 B. pertussis strains collected from across the world. The SNPeX-based phylogenetic trees preserved the general tree topology of B. pertussis populations based on whole-genome sequencing, with a minor loss of details. We envisage a strategy whereby SNP types (SnpTs) are quickly identified with the SNPeX assay during an outbreak, followed by whole-genome sequencing (WGS) of a limited number of isolates representing predominant SnpTs and the incorporation of novel SNPs in the SNPeX assay. The flexibility of the SNPeX assay allows the method to evolve along with the pathogen, making it a promising method for studying outbreaks of B. pertussis and other pathogens. PMID:25568442

  4. Using molecular beacons to detect single-nucleotide polymorphisms with real-time PCR.


    Mhlanga, M M; Malmberg, L


    Detection of single-nucleotide polymorphisms (SNPs) in high-throughput studies promises to be an expanding field of molecular medicine in the near future. Highly specific, simple, and accessible methods are needed to meet the rigorous requirements of single-nucleotide detection needed in pharmacogenomic studies, linkage analysis, and the detection of pathogens. Molecular beacons present such a solution for the high-throughput screening of SNPs in homogeneous assays using the polymerase chain reaction (PCR). Molecular beacons are probes that fluoresce on hybridization to their perfectly complementary targets. In recent years they have emerged as a leading genetic analysis tool in a wide range of contexts from quantification of RNA transcripts, to probes on microarrays, to single-nucleotide polymorphism detection. The majority of these methods use PCR to obtain sufficient amounts of sample to analyze. The use of molecular beacons with other amplification schemes has been reliably demonstrated, though PCR remains the method of choice. Here we discuss and present how to design and use molecular beacons to achieve reliable SNP genotyping and allele discrimination in real-time PCR. In addition, we provide a new means of analyzing data outputs from such real-time PCR assays that compensates for differences between sample condition, assay conditions, variations in fluorescent signal, and amplification efficiency. The mechanisms by which molecular beacons are able to have extraordinary specificity are also presented. PMID:11846616

  5. Nucleotide sequence and temporal expression of a baculovirus regulatory gene.


    Guarino, L A; Summers, M D


    The nucleotide sequence of a trans-activating regulatory gene (IE-1) of the baculovirus Autographa californica nuclear polyhedrosis virus has been determined. This gene encodes a protein of 581 amino acids with a predicted molecular weight of 66,856. A DNA fragment containing the entire coding sequence of IE-1 was inserted downstream of an RNA promoter. Subsequent cell-free transcription and translation directed the synthesis of a single peptide with an apparent molecular weight of 70,000. Quantitative S1 nuclease analysis indicated that IE-1 was maximally synthesized during a 1-h virus adsorption period and that steady-state levels of IE-1 message were maintained during the first 24 h of infection. Northern blot hybridization indicated that several late transcripts which overlap the IE-1 gene were transcribed from both strands. The precise locations of the 5' and 3' ends of these overlapping transcripts were mapped using S1 nuclease. The overlapping transcripts were grouped in two transcriptional units. One unit was composed of IE-1 and overlapping gamma transcripts which initiated upstream of IE-1 and terminated downstream of IE-1. The other unit, transcribed from the opposite strand, consisted of gamma transcripts with coterminal 5' ends and extended 3' ends. The shorter, more abundant transcripts in this unit overlapped 30 to 40 bases of IE-1 at the 3' end, while the longer transcripts overlapped the entire IE-1 gene. Transcription of several early A. californica nuclear polyhedrosis virus genes, in addition to 39K, was shown to be trans-activated by IE-1, indicating that IE-1 may have a central role in the regulation of beta-gene expression. PMID:16789264

  6. Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.


    Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T


    Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

  7. Association of the DIO2 gene single nucleotide polymorphisms with recurrent depressive disorder.


    Gałecka, Elżbieta; Talarowska, Monika; Orzechowska, Agata; Górski, Paweł; Bieńkiewicz, Małgorzata; Szemraj, Janusz


    Genetic factors may play a role in the etiology of depressive disorder. The type 2 iodothyronine deiodinase gene (DIO2) encoding the enzyme catalyzing the conversion of T4 to T3 is suggested to play a role in the recurrent depressive disorder (rDD). The current study investigates whether a specific single nucleotide polymorphism (SNP) of the DIO2 gene, Thr92Ala (T/C); rs 225014 or ORFa-Gly3Asp (C/T); rs 12885300, correlate with the risk for recurrent depression. Genotypes for these two single nucleotide polymorphisms (SNPs) were determined in 179 patients meeting the ICD-10 criteria for rDD group and in 152 healthy individuals (control group) using a polymerase chain reaction (PCR) based method. The specific variant of the DIO2 gene, namely the CC genotype of the Thr92Ala polymorphism, was more frequently found in healthy subjects than in patients with depression, what suggests that it could potentially serve as a marker of a lower risk for recurrent depressive disorder. The distribution of four haplotypes was also significantly different between the two study groups with the TC (Thr-Gly) haplotype more frequently detected in patients with depression. In conclusion, data generated from this study suggest for the first time that DIO2 gene may play a role in the etiology of the disease, and thus should be further investigated. PMID:26098717

  8. [Single-nucleotide polymorphism in populations of sockeye salmon Oncorhynchus nerka from Kamchatka Peninsula].


    Khrustaleva, A M; Gritsenko, O F; Klovach, N V


    The genetic polymorphism of 45 single-nucleotide polymorphism loci was examined in the four largest wild populations of sockeye salmon Oncorhynchusnerka from drainages of the Asian coast of the Pacific Ocean (Eastern and Western Kamchatka). It was demonstrated that sockeye salmon from the Palana River were considerably different from all other populations examined. The most probable explanation of the observed differences is the suggestion on possible demographic events in the history of this population associated with the decrease in its effective number. To study the origin, colonization patterns, and evolution of Asian sockeye salmon, as well as to resolve some of the applied tasks, like population assignment and genetic identification, a differentiation approach to SNP-marker selection was suggested. Adaptively important loci that evolve under the pressure of balancing (stabilizing) selection were identified, thanks to which the number of loci that provide the baseline classification error rates in the population assignment tests was reduced to 30. It was demonstrated that SNPs located in the MHC2 and GPH genes were affected by diversifying selection. Procedures for selecting single-nucleotide polymorphisms for phylogenetic studies of Asian sockeye salmon were suggested. Using principal-component analysis, 17 loci that adequately reproduce genetic differentiation within arid among the regions of the origin of Kamchatka sockeye salmon, were selected. PMID:25470934

  9. [Single-nucleotide polymorphism in populations of sockeye salmon Oncorhynchus nerka from Kamchatka Peninsula].



    The genetic polymorphism of 45 single-nucleotide polymorphism loci was examined in the four largest wild populations of sockeye salmon Oncorhynchusnerka from drainages of the Asian coast of the Pacific Ocean (Eastern and Western Kamchatka). It was demonstrated that sockeye salmon from the Palana River were considerably different from all other populations examined. The most probable explanation of the observed differences is the suggestion on possible demographic events in the history of this population associated with the decrease in its effective number. To study the origin, colonization patterns, and evolution of Asian sockeye salmon, as well as to resolve some of the applied tasks, like population assignment and genetic identification, a differentiation approach to SNP-marker selection was suggested. Adaptively important loci that evolve under the pressure of balancing (stabilizing) selection were identified, thanks to which the number of loci that provide the baseline classification error rates in the population assignment tests was reduced to 30. It was demonstrated that SNPs located in the MHC2 and GPH genes were affected by diversifying selection. Procedures for selecting single-nucleotide polymorphisms for phylogenetic studies of Asian sockeye salmon were suggested. Using principal-component analysis, 17 loci that adequately reproduce genetic differentiation within arid among the regions of the origin of Kamchatka sockeye salmon, were selected. PMID:25508561

  10. Single nucleotide polymorphisms of mitochondrial DNA HVS-I and HVS-II in Chinese Bai ethnic group.


    Chen, Feng; Yin, Cai-Yong; Qian, Xiao-Qin; Fan, Han-Ting; Deng, Ya-Jun; Zhang, Yu-Dang; Meng, Hao-Tian; Shen, Chun-Mei; Yang, Chun-Hua; Jin, Rui; Zhu, Bo-Feng; Xu, Peng


    For forensic and population genetic purposes, a total of 125 unrelated volunteers' blood samples were collected from Chinese Bai ethnic minority group to analyze sequence variation of two hypervariable segments (HVS-I and HVS-II) in the mitochondrial DNA control region. Comparing the HVS-I and HVS-II sequences of the 125 Chinese Bais to the Anderson reference sequence, we found 86 polymorphic loci in HVS-I and 40 in HVS-II in mitochondrial DNA sequences of the Chinese Bai ethnic minority group, which defined 93 and 53 different haplotypes, respectively. Haplotype diversity and the mean pairwise differences were 0.992 ± 0.003 and 6.553 in HVS-I, and 0.877 ± 0.027 and 2.407 in HVS-II, respectively. We defined four macrohaplogroups R, M, N and D with the proportions ranging from 9.6% to 40.0%. With the analysis of the hypervariable domain from nucleotide 16 180-16 193 in HVS-I, our study revealed new haplotypes of sequence variations. In addition, the Fst metric, phylogenetic tree, and principal component analysis demonstrated a close genetic relationship between the Bai group and Chinese Han populations from South China, Changsha, and Guangdong. The results support that the Bai group is a multiorigin ethnic minority that has merged with the Chinese Han population.

  11. Simple Sequence Repeats in Escherichia coli: Abundance, Distribution, Composition, and Polymorphism

    PubMed Central

    Gur-Arie, Riva; Cohen, Cyril J.; Eitan, Yuval; Shelef, Leora; Hallerman, Eric M.; Kashi, Yechezkel


    Computer-based genome-wide screening of the DNA sequence of Escherichia coli strain K12 revealed tens of thousands of tandem simple sequence repeat (SSR) tracts, with motifs ranging from 1 to 6 nucleotides. SSRs were well distributed throughout the genome. Mononucleotide SSRs were over-represented in noncoding regions and under-represented in open reading frames (ORFs). Nucleotide composition of mono- and dinucleotide SSRs, both in ORFs and in noncoding regions, differed from that of the genomic region in which they occurred, with 93% of all mononucleotide SSRs proving to be of A or T. Computer-based analysis of the fine position of every SSR locus in the noncoding portion of the genome relative to downstream ORFs showed SSRs located in areas that could affect gene regulation. DNA sequences at 14 arbitrarily chosen SSR tracts were compared among E. coli strains. Polymorphisms of SSR copy number were observed at four of seven mononucleotide SSR tracts screened, with all polymorphisms occurring in noncoding regions. SSR polymorphism could prove important as a genome-wide source of variation, both for practical applications (including rapid detection, strain identification, and detection of loci affecting key phenotypes) and for evolutionary adaptation of microbes.[The sequence data described in this paper have been submitted to the GenBank data library under accession numbers AF209020–209030 and AF209508–209518.] PMID:10645951

  12. In Silico Model-Driven Assessment of the Effects of Single Nucleotide Polymorphisms (SNPs) on Human Red Blood Cell Metabolism

    PubMed Central

    Jamshidi, Neema; Wiback, Sharon J.; Palsson, Bernhard Ø.


    The completion of the human genome project and the construction of single nucleotide polymorphism (SNP) maps have lead to significant efforts to find SNPs that can be linked to pathophysiology. In silico models of complete biochemical reaction networks relate a cell's individual reactions to the function of the entire network. Sequence variations can in turn be related to kinetic properties of individual enzymes, thus allowing an in silico model-driven assessment of the effects of defined SNPs on overall cellular functions. This process is applied to defined SNPs in two key enzymes of human red blood cell metabolism: glucose-6-phosphate dehydrogenase and pyruvate kinase. The results demonstrate the utility of in silico models in providing insight into differences between red cell function in patients with chronic and nonchronic anemia. In silico models of complex cellular processes are thus likely to aid in defining and understanding key SNPs in human pathophysiology. PMID:12421755

  13. A gold nanoparticles-based colorimetric test to detect single nucleotide polymorphisms for improvement of personalized therapy of psoriasis

    NASA Astrophysics Data System (ADS)

    Marsella, Alessandra; Valentini, Paola; Tarantino, Paolo; Congedo, Maurizio; Pompa, Pier Paolo


    We report a simple, rapid and low-cost test, based on gold nanoparticles, for the naked-eye colorimetric detection of a signature of single nucleotide polymorphisms (SNPs) relevant for the personalized medicine of psoriasis patients. We validated the colorimetric assay on real-world DNA samples from a cohort of 30 psoriasis patients and we compared the results, in double-blind, with those obtained with two state-of-the-art instrumental techniques, namely reverse dot blotting and direct sequencing, finding 100% agreement. We demonstrated high accuracy, sensitivity and specificity of the colorimetric test that can be easily adapted for the genotypization of different SNPs, important for the pharmacogenomics of various diseases, and in other fields, such as food traceability and population structure analysis.

  14. Identification of Single Nucleotide Polymorphisms and analysis of Linkage Disequilibrium in sunflower elite inbred lines using the candidate gene approach

    PubMed Central

    Fusari, Corina M; Lia, Verónica V; Hopp, H Esteban; Heinz, Ruth A; Paniego, Norma B


    Background Association analysis is a powerful tool to identify gene loci that may contribute to phenotypic variation. This includes the estimation of nucleotide diversity, the assessment of linkage disequilibrium structure (LD) and the evaluation of selection processes. Trait mapping by allele association requires a high-density map, which could be obtained by the addition of Single Nucleotide Polymorphisms (SNPs) and short insertion and/or deletions (indels) to SSR and AFLP genetic maps. Nucleotide diversity analysis of randomly selected candidate regions is a promising approach for the success of association analysis and fine mapping in the sunflower genome. Moreover, knowledge of the distance over which LD persists, in agronomically meaningful sunflower accessions, is important to establish the density of markers and the experimental design for association analysis. Results A set of 28 candidate genes related to biotic and abiotic stresses were studied in 19 sunflower inbred lines. A total of 14,348 bp of sequence alignment was analyzed per individual. In average, 1 SNP was found per 69 nucleotides and 38 indels were identified in the complete data set. The mean nucleotide polymorphism was moderate (θ = 0.0056), as expected for inbred materials. The number of haplotypes per region ranged from 1 to 9 (mean = 3.54 ± 1.88). Model-based population structure analysis allowed detection of admixed individuals within the set of accessions examined. Two putative gene pools were identified (G1 and G2), with a large proportion of the inbred lines being assigned to one of them (G1). Consistent with the absence of population sub-structuring, LD for G1 decayed more rapidly (r2 = 0.48 at 643 bp; trend line, pooled data) than the LD trend line for the entire set of 19 individuals (r2 = 0.64 for the same distance). Conclusion Knowledge about the patterns of diversity and the genetic relationships between breeding materials could be an invaluable aid in crop improvement

  15. Associations between Single-Nucleotide Polymorphisms in Corticotropin-Releasing Hormone-Related Genes and Irritable Bowel Syndrome

    PubMed Central

    Sasaki, Ayaka; Sato, Naoko; Suzuki, Naoki; Kano, Michiko; Tanaka, Yukari; Kanazawa, Motoyori; Aoki, Masashi; Fukudo, Shin


    Irritable bowel syndrome (IBS) is a common functional disorder with distinct features of stress-related pathophysiology. A key mediator of the stress response is corticotropin-releasing hormone (CRH). Although some candidate genes have been identified in stress-related disorders, few studies have examined CRH-related gene polymorphisms. Therefore, we tested our hypothesis that single-nucleotide polymorphisms (SNPs) in CRH-related genes influence the features of IBS. Methods: In total, 253 individuals (123 men and 130 women) participated in this study. They comprised 111 IBS individuals and 142 healthy controls. The SNP genotypes in CRH (rs28364015 and rs6472258) and CRH-binding protein (CRH-BP) (rs10474485) were determined by direct sequencing and real-time polymerase chain reaction. The emotional states of the subjects were evaluated using the State-Trait Anxiety Inventory, Perceived Stress Scale, and the Self-rating Depression Scale. Results: Direct sequencing of the rs28364015 SNP of CRH revealed no genetic variation among the study subjects. There was no difference in the genotype distributions and allele frequencies of rs6472258 and rs10474485 between IBS individuals and controls. However, IBS subjects with diarrhea symptoms without the rs10474485 A allele showed a significantly higher emotional state score than carriers. Conclusions: These results suggest that the CRH and CRH-BP genes have no direct effect on IBS status. However, the CRH-BP SNP rs10474485 has some effect on IBS-related emotional abnormalities and resistance to psychosocial stress. PMID:26882083

  16. Genetic diversity and relatedness of sweet cherry (prunus avium L.) cultivars based on single nucleotide polymorphic markers.


    Fernandez I Marti, Angel; Athanson, Blessing; Koepke, Tyson; Font I Forcada, Carolina; Dhingra, Amit; Oraguzie, Nnadozie


    Most previous studies on genetic fingerprinting and cultivar relatedness in sweet cherry were based on isoenzyme, RAPD, and simple sequence repeat (SSR) markers. This study was carried out to assess the utility of single nucleotide polymorphism (SNP) markers generated from 3' untranslated regions (UTR) for genetic fingerprinting in sweet cherry. A total of 114 sweet cherry germplasm representing advanced selections, commercial cultivars, and old cultivars imported from different parts of the world were screened with seven SSR markers developed from other Prunus species and with 40 SNPs obtained from 3' UTR sequences of Rainier and Bing sweet cherry cultivars. Both types of marker study had 99 accessions in common. The SSR data was used to validate the SNP results. Results showed that the average number of alleles per locus, mean observed heterozygosity, expected heterozygosity, and polymorphic information content values were higher in SSRs than in SNPs although both set of markers were similar in their grouping of the sweet cherry accessions as shown in the dendrogram. SNPs were able to distinguish sport mutants from their wild type germplasm. For example, "Stella" was separated from "Compact Stella." This demonstrates the greater power of SNPs for discriminating mutants from their original parents than SSRs. In addition, SNP markers confirmed parentage and also determined relationships of the accessions in a manner consistent with their pedigree relationships. We would recommend the use of 3' UTR SNPs for genetic fingerprinting, parentage verification, gene mapping, and study of genetic diversity in sweet cherry.

  17. Integrative Transcriptome, Genome and Quantitative Trait Loci Resources Identify Single Nucleotide Polymorphisms in Candidate Genes for Growth Traits in Turbot.


    Robledo, Diego; Fernández, Carlos; Hermida, Miguel; Sciara, Andrés; Álvarez-Dios, José Antonio; Cabaleiro, Santiago; Caamaño, Rubén; Martínez, Paulino; Bouza, Carmen


    Growth traits represent a main goal in aquaculture breeding programs and may be related to adaptive variation in wild fisheries. Integrating quantitative trait loci (QTL) mapping and next generation sequencing can greatly help to identify variation in candidate genes, which can result in marker-assisted selection and better genetic structure information. Turbot is a commercially important flatfish in Europe and China, with available genomic information on QTLs and genome mapping. Muscle and liver RNA-seq from 18 individuals was carried out to obtain gene sequences and markers functionally related to growth, resulting in a total of 20,447 genes and 85,344 single nucleotide polymorphisms (SNPs). Many growth-related genes and SNPs were identified and placed in the turbot genome and genetic map to explore their co-localization with growth-QTL markers. Forty-five SNPs on growth-related genes were selected based on QTL co-localization and relevant function for growth traits. Forty-three SNPs were technically feasible and validated in a wild Atlantic population, where 91% were polymorphic. The integration of functional and structural genomic resources in turbot provides a practical approach for QTL mining in this species. Validated SNPs represent a useful set of growth-related gene markers for future association, functional and population studies in this flatfish species. PMID:26901189

  18. Integrative Transcriptome, Genome and Quantitative Trait Loci Resources Identify Single Nucleotide Polymorphisms in Candidate Genes for Growth Traits in Turbot

    PubMed Central

    Robledo, Diego; Fernández, Carlos; Hermida, Miguel; Sciara, Andrés; Álvarez-Dios, José Antonio; Cabaleiro, Santiago; Caamaño, Rubén; Martínez, Paulino; Bouza, Carmen


    Growth traits represent a main goal in aquaculture breeding programs and may be related to adaptive variation in wild fisheries. Integrating quantitative trait loci (QTL) mapping and next generation sequencing can greatly help to identify variation in candidate genes, which can result in marker-assisted selection and better genetic structure information. Turbot is a commercially important flatfish in Europe and China, with available genomic information on QTLs and genome mapping. Muscle and liver RNA-seq from 18 individuals was carried out to obtain gene sequences and markers functionally related to growth, resulting in a total of 20,447 genes and 85,344 single nucleotide polymorphisms (SNPs). Many growth-related genes and SNPs were identified and placed in the turbot genome and genetic map to explore their co-localization with growth-QTL markers. Forty-five SNPs on growth-related genes were selected based on QTL co-localization and relevant function for growth traits. Forty-three SNPs were technically feasible and validated in a wild Atlantic population, where 91% were polymorphic. The integration of functional and structural genomic resources in turbot provides a practical approach for QTL mining in this species. Validated SNPs represent a useful set of growth-related gene markers for future association, functional and population studies in this flatfish species. PMID:26901189

  19. DigiPINS: a database for vertebrate exonic single nucleotide polymorphisms and its application to cancer association studies.


    Navratil, Vincent; Penel, Simon; Delmotte, Stéphane; Mouchiroud, Dominique; Gautier, Christian; Aouacheria, Abdel


    Single nucleotide polymorphisms (SNPs), which are the most abundant form of genetic variations in numerous organisms, have emerged as important tools for the study of complex genetic traits and deciphering of genome evolution. High-throughput genome sequencing projects worldwide provide an unprecedented opportunity for whole-genome SNP analysis in a variety of species. To facilitate SNP discovery in vertebrates, we have developed a web-based, user-friendly, and fully automated application, DigiPINS, for genome-wide identification of exonic SNPs from EST data. Currently, the database can be used to the mining of exonic SNPs in six complete genomes (Homo sapiens, Mus musculus, Rattus norvegicus, Canis familiaris, Gallus gallus and Danio rerio). In addition to providing information on sequence conservation, DigiPINS allows compilation of comprehensive sets of polymorphisms within cancer candidate genes or identification of novel cancer markers, making it potentially useful for cancer association studies. The DigiPINS server is available via the internet at

  20. The nucleotide sequence of the amiE gene of Pseudomonas aeruginosa.


    Brammar, W J; Charles, I G; Matfield, M; Liu, C P; Drew, R E; Clarke, P H


    The nucleotide sequence of the amiE gene, encoding the aliphatic amidase of Pseudomonas aeruginosa, has been determined. The sequence of 1038 nucleotides shows a strong bias in favour of codons with G or C in the third position, and only 44 different codons are utilised.

  1. Prioritizing sequence polymorphisms for potential association with phenotype

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The millions of SNP, insertions and deletions revealed by next generation sequencing (NGS), are certain to include polymorphisms responsible for phenotypic variation. Distinguishing causal from benign variants may allow genomic predictions that are robust across populations. While variants underly...

  2. Phylogenetic classification of Escherichia coli O157:H7 strains of human and bovine origin using a novel set of nucleotide polymorphisms

    PubMed Central

    Clawson, Michael L; Keen, James E; Smith, Timothy PL; Durso, Lisa M; McDaneld, Tara G; Mandrell, Robert E; Davis, Margaret A; Bono, James L


    Background Cattle are a reservoir of Shiga toxin-producing Escherichia coli O157:H7 (STEC O157), and are known to harbor subtypes not typically found in clinically ill humans. Consequently, nucleotide polymorphisms previously discovered via strains originating from human outbreaks may be restricted in their ability to distinguish STEC O157 genetic subtypes present in cattle. The objectives of this study were firstly to identify nucleotide polymorphisms in a diverse sampling of human and bovine STEC O157 strains, secondly to classify strains of either bovine or human origin by polymorphism-derived genotypes, and finally to compare the genotype diversity with pulsed-field gel electrophoresis (PFGE), a method currently used for assessing STEC O157 diversity. Results High-throughput 454 sequencing of pooled STEC O157 strain DNAs from human clinical cases (n = 91) and cattle (n = 102) identified 16,218 putative polymorphisms. From those, 178 were selected primarily within genomic regions conserved across E. coli serotypes and genotyped in 261 STEC O157 strains. Forty-two unique genotypes were observed that are tagged by a minimal set of 32 polymorphisms. Phylogenetic trees of the genotypes are divided into clades that represent strains of cattle origin, or cattle and human origin. Although PFGE diversity surpassed genotype diversity overall, ten PFGE patterns each occurred with multiple strains having different genotypes. Conclusions Deep sequencing of pooled STEC O157 DNAs proved highly effective in polymorphism discovery. A polymorphism set has been identified that characterizes genetic diversity within STEC O157 strains of bovine origin, and a subset observed in human strains. The set may complement current techniques used to classify strains implicated in disease outbreaks. PMID:19463166

  3. PupaSuite: finding functional single nucleotide polymorphisms for large-scale genotyping purposes.


    Conde, Lucía; Vaquerizas, Juan M; Dopazo, Hernán; Arbiza, Leonardo; Reumers, Joke; Rousseau, Frederic; Schymkowitz, Joost; Dopazo, Joaquín


    We have developed a web tool, PupaSuite, for the selection of single nucleotide polymorphisms (SNPs) with potential phenotypic effect, specifically oriented to help in the design of large-scale genotyping projects. PupaSuite uses a collection of data on SNPs from heterogeneous sources and a large number of pre-calculated predictions to offer a flexible and intuitive interface for selecting an optimal set of SNPs. It improves the functionality of PupaSNP and PupasView programs and implements new facilities such as the analysis of user's data to derive haplotypes with functional information. A new estimator of putative effect of polymorphisms has been included that uses evolutionary information. Also SNPeffect database predictions have been included. The PupaSuite web interface is accessible through and through

  4. Multicolor fluorescence detection for single nucleotide polymorphism genotyping using a filter-less fluorescence detector

    NASA Astrophysics Data System (ADS)

    Yamasaki, Keita; Nakazawa, Hirokazu; Misawa, Nobuo; Ishida, Makoto; Sawada, Kazuaki


    Single nucleotide polymorphism (SNP) analysis that is commonly performed using fluorescence is important in drug development and pathology research. In this study, to facilitate the analysis, multicolor fluorescence detection for SNP genotyping using a filter-less fluorescence detector (FFD) was investigated. FFDs do not require any optical filters for multicolor fluorescence detection. From the experimental results, FFD could identify 0 μM, 1 μM, and 10 μM solutions of Texas Red and fluorescein isothiocyanate. Moreover, a mixture of Texas Red and 6-FAM could be detected in the SNP genotyping simulation. Therefore, a small and low-cost SNP genotyping system is feasible.

  5. Predicting responses to sunitinib using single nucleotide polymorphisms: Progress and recommendations for future trials.


    Ganapathi, Ram N; Bukowski, Ronald M


    Targeted therapy with tyrosine kinase inhibitors has led to a substantial improvement in the standard of care for patients with advanced or metastatic clear cell renal cell carcinoma. Because the mechanism of action, metabolism and transport of tyrosine kinase inhibitors can affect outcome and toxicity, several investigators have pursued the identification of single nucleotide polymorphisms (SNPs) in genes associated with these actions. We discuss SNPs associated with outcome and toxicity following sunitinib therapy and provide recommendations for future trials to facilitate the use of SNPs in personalized therapy for this disease.

  6. Contribution of protein Z gene single-nucleotide polymorphism to systemic lupus erythematosus in Egyptian patients.


    Yousry, Sherif M; Shahin, Rasha M H; El Refai, Rasha M


    Protein Z has been reported to exert an important role in inhibiting coagulation. Polymorphisms in the protein Z gene (PROZ) may affect protein Z levels and thus play a role in thrombosis. This study aimed to investigate the prevalence and clinical significance of protein Z gene G79A polymorphism in Egyptian patients with systemic lupus erythematosus (SLE). We studied the distribution of the protein Z gene (rs17882561) (G79A) single-nucleotide polymorphism by PCR-restriction fragment length polymorphism in 100 Egyptian patients with SLE and 100 age, sex, and ethnically matched controls. There was no statistically significant difference in the distribution of the genotypes between SLE patients and the control group in our study (P = 0.103). But a statistically significant difference in the frequency of the alleles between SLE patients and controls was observed (P = 0.024). Also a significant association was detected between protein Z genotypes (and also A allele) and thrombosis, which is one of the manifestations of SLE (P = 0.004 and P = 0.001, respectively). Moreover, we observed a significant association between the protein Z AA and GA genotypes (and also A allele) and the presence of anticardiolipin antibodies (P = 0.016 and P = 0.004, respectively). The minor A allele of the G79A polymorphism in the protein Z gene might contribute to the genetic susceptibility of SLE in Egyptian patients. Also, an influence for this polymorphism on some of the disease manifestations has been elucidated, so protein Z G79A AG/AA may be a risk factor for thrombosis.

  7. Single nucleotide polymorphisms in the human corticosteroid-binding globulin promoter alter transcriptional activity.


    Li, Yue; Wu, Liang; Lei, JingHui; Zhu, Cheng; Wang, HongMei; Yu, XiaoGuang; Lin, HaiYan


    Corticosteroid-binding globulin (CBG) is a high-affinity plasma protein that transports glucocorticoids and progesterone. Others and we have reported non-synonymous single nucleotide polymorphisms (SNPs) that influence CBG production or steroid-binding activity. However, no promoter polymorphisms affecting the transcription of human CBG gene (Cbg) have been reported. In the present study we investigated function implications of six promoter SNPs, including -26 C/G, -54 C/T, -144 G/C, -161 A/G, -205 C/A, and -443/-444 AG/-, five of which are located within the first 205 base pairs of 5'-flanking region and close to the highly conserved footprinted elements, TATA-box, or CCAAT-box. Luciferase reporter assays demonstrated that basal activity of the promoter carrying -54 T or -161 G was significantly enhanced. The first three polymorphisms, -26 C/G, -54 C/T, and -144 G/C located close to the putative hepatic nuclear factor (HNF) 1 binding elements, altered the transactivation effect of HNF1β. We also found a negative promoter response to dexamethasone-activated glucocorticoid receptor (GR) α, although none of the SNPs affected its transrepression function. Our results suggest that human Cbg -26 C/G, -54 C/T, -144 G/C, and -161 A/G promoter polymorphisms alter transcriptional activity, and further studies are awaited to explore their association with physiological and pathological conditions.

  8. Association of single nucleotide polymorphisms in cell cycle regulatory genes with oral cancer susceptibility.


    Murali, Abitha; Nalinakumari, K R; Thomas, Shaji; Kannan, S


    Alterations in the regulation of the cell cycle are strongly linked to tumorigenesis, so genetic variants in genes critical to control of the cycle are good candidates to have their association with susceptibility to oral cancer assessed. In this hospital-based, case-control study of 445 patients who had been newly-diagnosed with oral cancer and 449 unaffected controls, we used a multigenic approach to examine the associations among a panel of 10 selected polymorphisms in the pathway of the cell cycle that were possibly susceptible to oral cancer. Six of 9 single nucleotide polymorphisms in the cell cycle showed significant risks for oral cancer, the highest risk being evident for p27 (rs34329; Odds ratio 3.05, 95% CI 2.12 to 4.40). A significant risk of oral cancer was also evident for individual polymorphisms of cyclin E (rs1406), cyclin H (rs3093816), cyclin D1-1 (rs647451), cyclin D2 (rs3217901) and Rb1-2 (rs3092904). The risk of oral cancer increased significantly as the number of unfavourable genotypes in the pathway increased, and so the results point to a stronger combined effect of polymorphisms in important cell cycle regulatory genes on predisposition to oral cancer. PMID:24947332

  9. Complete nucleotide sequence of the temperate bacteriophage LBR48, a new member of the family Myoviridae.


    Jang, Se Hwan; Yoon, Bo Hyun; Chang, Hyo Ihl


    The complete genomic sequence of LBR48, a temperate bacteriophage induced from a lysogenic strain of Lactobacillus brevis, was found to be 48,211 nucleotides long and to contain 90 putative open reading frames. Based on structural characteristics obtained from microscopic analysis and nucleic acid sequence determination, phage LBR48 can be classified as a member of the family Myoviridae. Analysis of the genome showed the conserved gene order of previously reported phages of the family Siphoviridae from lactic acid bacteria, despite low nucleotide sequence similarity. Analysis of the attachment sites revealed 15-nucleotide-long core sequences. PMID:20976608

  10. Ultrahigh-density linkage map for cultivated cucumber (Cucumis sativus L.) using a single-nucleotide polymorphism genotyping array.


    Rubinstein, Mor; Katzenellenbogen, Mark; Eshed, Ravit; Rozen, Ada; Katzir, Nurit; Colle, Marivi; Yang, Luming; Grumet, Rebecca; Weng, Yiqun; Sherman, Amir; Ophir, Ron


    Genotyping arrays are tools for high-throughput genotyping, which is beneficial in constructing saturated genetic maps and therefore high-resolution mapping of complex traits. Since the report of the first cucumber genome draft, genetic maps have been constructed mainly based on simple-sequence repeats (SSRs) or on combinations of SSRs and sequence-related amplified polymorphism (SRAP). In this study, we developed the first cucumber genotyping array consisting of 32,864 single-nucleotide polymorphisms (SNPs). These markers cover the cucumber genome with a median interval of ~2 Kb and have expected genotype calls in parents/F1 hybridizations as a training set. The training set was validated with Fluidigm technology and showed 96% concordance with the genotype calls in the parents/F1 hybridizations. Application of the genotyping array was illustrated by constructing a 598.7 cM genetic map based on a '9930' × 'Gy14' recombinant inbred line (RIL) population comprised of 11,156 SNPs. Marker collinearity between the genetic map and reference genomes of the two parents was estimated at R2 = 0.97. We also used the array-derived genetic map to investigate chromosomal rearrangements, regional recombination rate, and specific regions with segregation distortions. Finally, 82% of the linkage-map bins were polymorphic in other cucumber variants, suggesting that the array can be applied for genotyping in other lines. The genotyping array presented here, together with the genotype calls of the parents/F1 hybridizations as a training set, should be a powerful tool in future studies with high-throughput cucumber genotyping. An ultrahigh-density linkage map constructed by this genotyping array on RIL population may be invaluable for assembly improvement, and for mapping important cucumber QTLs.

  11. Ultrahigh-Density Linkage Map for Cultivated Cucumber (Cucumis sativus L.) Using a Single-Nucleotide Polymorphism Genotyping Array

    PubMed Central

    Rubinstein, Mor; Katzenellenbogen, Mark; Eshed, Ravit; Rozen, Ada; Katzir, Nurit; Colle, Marivi; Yang, Luming; Grumet, Rebecca; Weng, Yiqun; Sherman, Amir; Ophir, Ron


    Genotyping arrays are tools for high-throughput genotyping, which is beneficial in constructing saturated genetic maps and therefore high-resolution mapping of complex traits. Since the report of the first cucumber genome draft, genetic maps have been constructed mainly based on simple-sequence repeats (SSRs) or on combinations of SSRs and sequence-related amplified polymorphism (SRAP). In this study, we developed the first cucumber genotyping array consisting of 32,864 single-nucleotide polymorphisms (SNPs). These markers cover the cucumber genome with a median interval of ~2 Kb and have expected genotype calls in parents/F1 hybridizations as a training set. The training set was validated with Fluidigm technology and showed 96% concordance with the genotype calls in the parents/F1 hybridizations. Application of the genotyping array was illustrated by constructing a 598.7 cM genetic map based on a ‘9930’ × ‘Gy14’ recombinant inbred line (RIL) population comprised of 11,156 SNPs. Marker collinearity between the genetic map and reference genomes of the two parents was estimated at R2 = 0.97. We also used the array-derived genetic map to investigate chromosomal rearrangements, regional recombination rate, and specific regions with segregation distortions. Finally, 82% of the linkage-map bins were polymorphic in other cucumber variants, suggesting that the array can be applied for genotyping in other lines. The genotyping array presented here, together with the genotype calls of the parents/F1 hybridizations as a training set, should be a powerful tool in future studies with high-throughput cucumber genotyping. An ultrahigh-density linkage map constructed by this genotyping array on RIL population may be invaluable for assembly improvement, and for mapping important cucumber QTLs. PMID:25874931

  12. Genotyping Single Nucleotide Polymorphisms and Copy Number Variability of the FCGRs Expressed on NK Cells.


    Erbe, Amy K; Wang, Wei; Gallenberger, Mikayla; Hank, Jacquelyn A; Sondel, Paul M


    Natural killer (NK) cells are one of the main effector immune cells involved in antibody-dependent cell-mediated cytotoxicity (ADCC). Upon recognition of cell-bound IgG antibodies, which occurs through Fc gamma receptors (FCGRs) expressed on the cell surface of NK cells, NK cells become activated and lyse target tumor or infected cells. The FCGRs, FCGR3A and FCGR2C, expressed on the surface of NK cells have single nucleotide polymorphisms (SNPs) that result in differential activity of NK cells. In addition to SNP genetic variation within each of these genes, the FCGRs are subject to copy number variation (CNV), which leads to variable protein expression levels on the cell surface. Studies have found that FCGR genotype for FCGR3A and FCGR2C is associated with variation in the response to immunotherapy.Due to high sequence homology within FCGR3 and FCGR2 families, there are difficulties associated with genotyping these specific receptors related to cross-amplification of non-targeted FCGRs. To improve specificity for both FCGR3A and FCGR2C, Rnase-H (RH) primers were designed to amplify specifically FCGR3A (while not co-amplifying FCGR3B) and FCGR2C (while not co-amplifying FCGR2B). In addition, fluorescently labeled locked nucleic acid (LNA) probes provide additional precision for determination of the SNPs within both FCGR3A and FCGR2C. For CNV determination, separate fluorescently labeled probes for FCGR3A, and for FCGR2C, can be used with the same RH primers for each gene. These probes can be combined in the same well with control primers/probe for a known diploid gene and used to calculate the copy number of both FCGR3A and FCGR2C. Here we provide new detailed methodology that allows for the specific amplification of these FCGRs in a single PCR reaction, allowing for genotyping of both the SNPs and CNVs using real-time PCR.

  13. Significant association of methylenetetrahydrofolate reductase single nucleotide polymorphisms with prostate cancer susceptibility in taiwan.


    Wu, Hsi-Chin; Chang, Chao-Hsiang; Tsai, Ru-Yin; Lin, Chih-Hsueh; Wang, Rou-Fen; Tsai, Chia-Wen; Chen, Kuen-Bao; Yao, Chun-Hsu; Chiu, Chang-Fang; Bau, Da-Tian; Lin, Cheng-Chieh


    Prostate cancer is the most common cause of cancer death in men and is a major health problem worldwide. Methylene tetrahydrofolate reductase (MTHFR) plays an important role in folate metabolism and is also an important source of DNA methylation and DNA synthesis (nucleotide synthesis). To assess the association and interaction of genotypic polymorphisms in MTHFR and lifestyle factors with prostate cancer in Taiwan, we investigated two well-known polymorphic variants of MTHFR, C677T (rs1801133) and A1298C (rs1801131), analyzed the association of specific genotypes with prostate cancer susceptibility, and discussed their joint effects with individual habits on prostate cancer risk. In total, 218 patients with prostate cancer and 436 healthy controls recruited from the China Medical Hospital in central Taiwan were genotyped for these polymorphisms with prostate cancer susceptibility. We found the MTHFR C677T but not the A1298C genotype was differently distributed between the prostate cancer and control groups. The T allele of MTHFR C677T conferred a significantly (p=0.0011) decreased risk of prostate cancer. As for the A1298C polymorphism, there was no difference in distribution between the prostate cancer and control groups. Gene interactions with smoking were significant for MTHFR C677T polymorphism. The MTHFR C677T CT and TT genotypes in association with smoking conferred a decreased risk of 0.501 (95% confidence interval=0.344-0.731) for prostate cancer. Our results provide the first evidence that the C allele of MTHFR C677T may be associated with the development of prostate cancer and may be a novel useful marker for primary prevention and anticancer intervention.

  14. Nucleotide sequence of HS-beta satellite DNA from kangaroo rat Dipodomys ordii.


    Fry, K; Poon, R; Whitcome, P; Idriss, J; Salser, W; Mazrimas, J; Hatch, F


    The sequence of the highly repetitive satellite HS-beta DNA fraction from kangaroo rat Dipodomys ordii was determined independently by RNA and DNA sequencing techniques. A basic iterated sequence of 10 nucleotides with several mutational variations was found. Base-composition data are consistent with the proposed sequence and revealed a high content of 5-methylcytosine. DNA and RNA sequencing techniques used gave identical results, showing that the fidelity of synthesis of riboguanidine-substituted DNA under our conditions is adequate for nucleotide sequence studies.

  15. Single nucleotide polymorphisms in the bovine genome are associated with the number of oocytes collected during ovum pick up.


    Santos-Biase, W K F; Biase, F H; Buratini, J; Balieiro, J; Watanabe, Y F; Accorsi, M F; Ferreira, C R; Stranieri, P; Caetano, A R; Meirelles, F V


    The number of follicles recruited in each estrous cycle has gained practical importance in artificial reproductive technology, as it determines the oocyte yield from ultrasound-guided ovum pickup for in vitro embryo production. We aimed to identify single nucleotide polymorphisms (SNPs) in bovine genes related to reproductive physiology and evaluate the association between the candidate SNPs and the number of oocytes collected from ultrasound-guided ovum pickup. We sequenced genomic segments of GDF9, FGF8, FGF10 and BMPR2 and identified seventeen SNPs in the Bos taurus and Bos indicus breeds. Two SNPs cause amino acid changes in the proteins GDF9 and FGF8. Three SNPs in GDF9, FGF8 and BMPR2 were genotyped in 217 Nelore cows (B. indicus), while two previously identified mutations in LHCGR and mitochondrial DNA (mtDNA) were genotyped in the same group. The polymorphisms in GDF9, FGF8, BMRP2 and LHCGR were significantly associated (P<0.01) with the number of oocytes collected by ovum pickup, whereas the SNP in the mtDNA was not. In addition, we estimated an allelic substitution effect of 1.13±0.01 (P<0.01) oocytes for the SNP in the FGF8 gene. The results we report herein provide further evidence to support the hypothesis that genetic variability is an important component of the number of antral follicles in the bovine ovary.

  16. Genetic association of single nucleotide polymorphisms in dystrobrevin binding protein 1 gene with schizophrenia in a Malaysian population.


    Tan, Grace Kang Ning; Tee, Shiau Foon; Tang, Pek Yee


    Dystrobrevin binding protein 1 (DTNBP1) gene is pivotal in regulating the glutamatergic system. Genetic variants of the DTNBP1 affect cognition and thus may be particularly relevant to schizophrenia. We therefore evaluated the association of six single nucleotide polymorphisms (SNPs) with schizophrenia in a Malaysian population (171 cases; 171 controls). Associations between these six SNPs and schizophrenia were tested in two stages. Association signals with p < 0.05 and minor allele frequency > 0.05 in stage 1 were followed by genotyping the SNPs in a replication phase (stage 2). Genotyping was performed with sequenced specific primer (PCR-SSP) and restriction fragment length polymorphism (PCR-RFLP). In our sample, we found significant associations between rs2619522 (allele p = 0.002, OR = 1.902, 95%CI = 1.266 - 2.859; genotype p = 0.002) and rs2619528 (allele p = 0.008, OR = 1.606, 95%CI = 1.130 - 2.281; genotype p = 6.18 × 10(-5)) and schizophrenia. Given that these two SNPs may be associated with the pathophysiology of schizophrenia, further studies on the other DTNBP1 variants are warranted.

  17. Analysis of Horse Myostatin Gene and Identification of Single Nucleotide Polymorphisms in Breeds of Different Morphological Types

    PubMed Central

    Dall'Olio, Stefania; Fontanesi, Luca; Nanni Costa, Leonardo; Tassinari, Marco; Minieri, Laura; Falaschini, Adalberto


    Myostatin (MSTN) is a negative modulator of muscle mass. We characterized the horse (Equus caballus) MSTN gene and identified and analysed single nucleotide polymorphisms (SNPs) in breeds of different morphological types. Sequencing of coding, untranslated, intronic, and regulatory regions of MSTN gene in 12 horses from 10 breeds revealed seven SNPs: two in the promoter, four in intron 1, and one in intron 2. The SNPs of the promoter (GQ183900:g.26T>C and GQ183900:g.156T>C, the latter located within a conserved TATA-box like motif) were screened in 396 horses from 16 breeds. The g.26C and the g.156C alleles presented higher frequency in heavy (brachymorphic type) than in light breeds (dolichomorphic type such as Italian Trotter breed). The significant difference of allele frequencies for the SNPs at the promoter and analysis of molecular variance (AMOVA) on haplotypes indicates that these polymorphisms could be associated with variability of morphology traits in horse breeds. PMID:20706663

  18. Association between single-nucleotide polymorphisms of fatty acid synthase gene and meat quality traits in Datong Yak (Bos grunniens).


    Chu, M; Wu, X Y; Guo, X; Pei, J; Jiao, F; Fang, H T; Liang, C N; Ding, X Z; Bao, P J; Yan, P


    Fatty acid synthase (FASN) is a key enzyme in fatty acid anabolism that plays an important role in the fat deposit of eukaryotic cells. Therefore, in this study, we detected 2 novel single-nucleotide polymorphisms (SNPs) in the FASN gene in 313 adult individuals of Datong yak using polymerase chain reaction-single strand conformation polymorphism and DNA sequencing techniques. SNP g.5477C>T is located in intron 3 of FASN, and 3 genotypes, HH, HG, and GG, were detected in this mutation site. SNP g.16930T>A is located in exon 37 of FASN, and 2 genotypes, EE and EF, were detected in this site. Association analysis of these 2 SNPs with meat quality traits showed that in SNP g.5477C>T, yaks with the HH genotype and HG genotype had significantly higher intramuscular fat content than individuals with the GG genotype (P < 0.01). In SNP g.16930T>A, yaks with the EE genotype also had significantly higher IMF content than individuals with the EF genotype (P < 0.01). The results indicate that FASN may be used as a candidate gene affecting intramuscular fat content in Datong yaks.

  19. Genetic association of single nucleotide polymorphisms in dystrobrevin binding protein 1 gene with schizophrenia in a Malaysian population

    PubMed Central

    Tan, Grace Kang Ning; Tee, Shiau Foon; Tang, Pek Yee


    Dystrobrevin binding protein 1 (DTNBP1) gene is pivotal in regulating the glutamatergic system. Genetic variants of the DTNBP1 affect cognition and thus may be particularly relevant to schizophrenia. We therefore evaluated the association of six single nucleotide polymorphisms (SNPs) with schizophrenia in a Malaysian population (171 cases; 171 controls). Associations between these six SNPs and schizophrenia were tested in two stages. Association signals with p < 0.05 and minor allele frequency > 0.05 in stage 1 were followed by genotyping the SNPs in a replication phase (stage 2). Genotyping was performed with sequenced specific primer (PCR-SSP) and restriction fragment length polymorphism (PCR-RFLP). In our sample, we found significant associations between rs2619522 (allele p = 0.002, OR = 1.902, 95%CI = 1.266 – 2.859; genotype p = 0.002) and rs2619528 (allele p = 0.008, OR = 1.606, 95%CI = 1.130 – 2.281; genotype p = 6.18 × 10−5) and schizophrenia. Given that these two SNPs may be associated with the pathophysiology of schizophrenia, further studies on the other DTNBP1 variants are warranted. PMID:26273215

  20. Association study of interleukin-1 family and interleukin-6 gene single nucleotide polymorphisms in recurrent aphthous stomatitis.


    Najafi, S; Yousefi, H; Mohammadzadeh, M; Bidoki, A Z; Firouze Moqadam, I; Farhadi, E; Amirzargar, A A; Rezaei, N


    Recurrent aphthous stomatitis (RAS) is a common painful, ulcerative oral inflammatory disorder with unknown aetiology. Immune system and aberrant cytokine cascade deemed to be critical in outbreaks of RAS ulcers. Interleukin-1 (IL-1) and IL-6 are the most potent pro-inflammatory cytokines. Single nucleotide polymorphisms (SNPs) of IL-1 and IL-6 genes can affect the secretion of these cytokines. The aim of this study was to investigate the association between RAS and IL-6 and IL-1 in Iranian subjects with minor RAS. Genomic DNA was obtained from 64 Iranian patients with RAS. IL-1α C -889 T, IL-1β C -511 T, IL-1β C +3962 T, IL-1R C pst-I 1970 T, IL-1Ra C Mspa-I11100 T, IL-6 C -174 G and IL-6 A nt +565 G polymorphisms were determined using polymerase chain reaction with sequence-specific primers (PCR-SSP). The frequency of C -174 C genotype in the patients group was significantly different from the healthy control. No other significant differences were found in genotype and alleles frequencies between the two groups. These results indicate that certain SNPs of IL-6 gene at position -174 which located in promoter have association with predisposition of individuals to RAS. PMID:26385127

  1. Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli.

    PubMed Central

    Brosius, J; Palmer, M L; Kennedy, P J; Noller, H F


    The complete nucleotide sequence of the 16S RNA gene from the rrnB cistron of Escherichia coli has been determined by using three rapid DNA sequencing methods. Nearly all of the structure has been confirmed by two to six independent sequence determinations on both DNA strands. The length of the 16S rRNA chain inferred from the DNA sequence is 1541 nucleotides, in close agreement with previous estimates. We note discrepancies between this sequence and the most recent version of it reported from direct RNA sequencing [Ehresmann, C., Stiegler, P., Carbon, P. & Ebel, J.P. (1977) FEBS Lett. 84, 337-341]. A few of these may be explained by heterogeneity among 16S rRNA sequences from different cistrons. No nucleotide sequences were found in the 16S rRNA gene that cannot be reconciled with RNase digestion products of mature 16S rRNA. Images PMID:368799

  2. Regulatory single nucleotide polymorphisms at the beginning of intron 2 of the human KRAS gene.


    Antontseva, Elena V; Matveeva, Marina Yu; Bondar, Natalia P; Kashina, Elena V; Leberfarb, Elena Yu; Bryzgalov, Leonid O; Gervas, Polina A; Ponomareva, Anastasia A; Cherdyntseva, Nadezhda V; Orlov, Yury L; Merkulova, Tatiana I


    There are two regulatory single nucleotide polymorphisms (rSNPs) at the beginning of the second intron of the mouse K-ras gene that are strongly associated with lung cancer susceptibility. We performed functional analysis of three SNPs (rs12228277: T greater than A, rs12226937: G greater than A, and rs61761074: T greater than G) located in the same region of human KRAS. We found that rs12228277 and rs61761074 result in differential binding patterns of lung nuclear proteins to oligonucleotide probes corresponding two alternative alleles; in both cases, the transcription factor NF-Y is involved. G greater than A substitution (rs12226937) had no effect on the binding of lung nuclear proteins. However, all the nucleotide substitutions under study showed functional effects in a luciferase reporter assay. Among them, rs61761074 demonstrated a significant correlation with allele frequency in non-small-cell lung cancer (NSCLC). Taken together, the results of our study suggest that a T greater than G substitution at nucleotide position 615 in the second intron of the KRAS gene (rs61761074) may represent a promising genetic marker of NSCLC. PMID:26648033

  3. The development and characterization of a 57K single nucleotide polymorphism array for rainbow trout.


    Palti, Y; Gao, G; Liu, S; Kent, M P; Lien, S; Miller, M R; Rexroad, C E; Moen, T


    In this study, we describe the development and characterization of the first high-density single nucleotide polymorphism (SNP) genotyping array for rainbow trout. The SNP array is publically available from a commercial vendor (Affymetrix). The SNP genotyping quality was high, and validation rate was close to 90%. This is comparable to other farm animals and is much higher than previous smaller scale SNP validation studies in rainbow trout. High quality and integrity of the genotypes are evident from sample reproducibility and from nearly 100% agreement in genotyping results from other methods. The array is very useful for rainbow trout aquaculture populations with more than 40 900 polymorphic markers per population. For wild populations that were confounded by a smaller sample size, the number of polymorphic markers was between 10 577 and 24 330. Comparison between genotypes from individual populations suggests good potential for identifying candidate markers for populations' traceability. Linkage analysis and mapping of the SNPs to the reference genome assembly provide strong evidence for a wide distribution throughout the genome with good representation in all 29 chromosomes. A total of 68% of the genome scaffolds and contigs were anchored through linkage analysis using the SNP array genotypes, including ~20% of the genome assembly that has not been previously anchored to chromosomes.

  4. Single Nucleotide Polymorphism Discovery in Bovine Pituitary Gland Using RNA-Seq Technology.


    Pareek, Chandra Shekhar; Smoczyński, Rafał; Kadarmideen, Haja N; Dziuba, Piotr; Błaszczyk, Paweł; Sikora, Marcin; Walendzik, Paulina; Grzybowski, Tomasz; Pierzchała, Mariusz; Horbańczuk, Jarosław; Szostak, Agnieszka; Ogluszka, Magdalena; Zwierzchowski, Lech; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Wąsowicz, Krzysztof; Gelfand, Brian; Feng, Yaping; Kumar, Dibyendu


    Examination of bovine pituitary gland transcriptome by strand-specific RNA-seq allows detection of putative single nucleotide polymorphisms (SNPs) within potential candidate genes (CGs) or QTLs regions as well as to understand the genomics variations that contribute to economic trait. Here we report a breed-specific model to successfully perform the detection of SNPs in the pituitary gland of young growing bulls representing Polish Holstein-Friesian (HF), Polish Red, and Hereford breeds at three developmental ages viz., six months, nine months, and twelve months. A total of 18 bovine pituitary gland polyA transcriptome libraries were prepared and sequenced using the Illumina NextSeq 500 platform. Sequenced FastQ databases of all 18 young bulls were submitted to NCBI-SRA database with NCBI-SRA accession numbers SRS1296732. For the investigated young bulls, a total of 113,882,3098 raw paired-end reads with a length of 156 bases were obtained, resulting in an approximately 63 million paired-end reads per library. Breed-wise, a total of 515.38, 215.39, and 408.04 million paired-end reads were obtained for Polish HF, Polish Red, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed 93.04%, 94.39%, and 83.46% of the mapped sequencing reads were properly paired to the Polish HF, Polish Red, and Hereford breeds, respectively. Constructed breed-specific SNP-db of three cattle breeds yielded at 13,775,885 SNPs. On an average 765,326 breed-specific SNPs per young bull were identified. Using two stringent filtering parameters, i.e., a minimum 10 SNP reads per base with an accuracy ≥ 90% and a minimum 10 SNP reads per base with an accuracy = 100%, SNP-db records were trimmed to construct a highly reliable SNP-db. This resulted in a reduction of 95,7% and 96,4% cut-off mark of constructed raw SNP-db. Finally, SNP discoveries using RNA-Seq data were validated by KASP™ SNP genotyping assay. The comprehensive QTLs/CGs analysis of 76 QTLs

  5. Single Nucleotide Polymorphism Discovery in Bovine Pituitary Gland Using RNA-Seq Technology

    PubMed Central

    Pareek, Chandra Shekhar; Smoczyński, Rafał; Kadarmideen, Haja N.; Dziuba, Piotr; Błaszczyk, Paweł; Sikora, Marcin; Walendzik, Paulina; Grzybowski, Tomasz; Pierzchała, Mariusz; Horbańczuk, Jarosław; Szostak, Agnieszka; Ogluszka, Magdalena; Zwierzchowski, Lech; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Wąsowicz, Krzysztof; Gelfand, Brian; Feng, Yaping; Kumar, Dibyendu


    Examination of bovine pituitary gland transcriptome by strand-specific RNA-seq allows detection of putative single nucleotide polymorphisms (SNPs) within potential candidate genes (CGs) or QTLs regions as well as to understand the genomics variations that contribute to economic trait. Here we report a breed-specific model to successfully perform the detection of SNPs in the pituitary gland of young growing bulls representing Polish Holstein-Friesian (HF), Polish Red, and Hereford breeds at three developmental ages viz., six months, nine months, and twelve months. A total of 18 bovine pituitary gland polyA transcriptome libraries were prepared and sequenced using the Illumina NextSeq 500 platform. Sequenced FastQ databases of all 18 young bulls were submitted to NCBI-SRA database with NCBI-SRA accession numbers SRS1296732. For the investigated young bulls, a total of 113,882,3098 raw paired-end reads with a length of 156 bases were obtained, resulting in an approximately 63 million paired-end reads per library. Breed-wise, a total of 515.38, 215.39, and 408.04 million paired-end reads were obtained for Polish HF, Polish Red, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed 93.04%, 94.39%, and 83.46% of the mapped sequencing reads were properly paired to the Polish HF, Polish Red, and Hereford breeds, respectively. Constructed breed-specific SNP-db of three cattle breeds yielded at 13,775,885 SNPs. On an average 765,326 breed-specific SNPs per young bull were identified. Using two stringent filtering parameters, i.e., a minimum 10 SNP reads per base with an accuracy ≥ 90% and a minimum 10 SNP reads per base with an accuracy = 100%, SNP-db records were trimmed to construct a highly reliable SNP-db. This resulted in a reduction of 95,7% and 96,4% cut-off mark of constructed raw SNP-db. Finally, SNP discoveries using RNA-Seq data were validated by KASP™ SNP genotyping assay. The comprehensive QTLs/CGs analysis of 76 QTLs

  6. Targeted Sequencing Reveals Large-Scale Sequence Polymorphism in Maize Candidate Genes for Biomass Production and Composition

    PubMed Central

    Ulpinnis, Chris; Scholz, Uwe; Altmann, Thomas


    A major goal of maize genomic research is to identify sequence polymorphisms responsible for phenotypic variation in traits of economic importance. Large-scale detection of sequence variation is critical for linking genes, or genomic regions, to phenotypes. However, due to its size and complexity, it remains expensive to generate whole genome sequences of sufficient coverage for divergent maize lines, even with access to next generation sequencing (NGS) technology. Because methods involving reduction of genome complexity, such as genotyping-by-sequencing (GBS), assess only a limited fraction of sequence variation, targeted sequencing of selected genomic loci offers an attractive alternative. We therefore designed a sequence capture assay to target 29 Mb genomic regions and surveyed a total of 4,648 genes possibly affecting biomass production in 21 diverse inbred maize lines (7 flints, 14 dents). Captured and enriched genomic DNA was sequenced using the 454 NGS platform to 19.6-fold average depth coverage, and a broad evaluation of read alignment and variant calling methods was performed to select optimal procedures for variant discovery. Sequence alignment with the B73 reference and de novo assembly identified 383,145 putative single nucleotide polymorphisms (SNPs), of which 42,685 were non-synonymous alterations and 7,139 caused frameshifts. Presence/absence variation (PAV) of genes was also detected. We found that substantial sequence variation exists among genomic regions targeted in this study, which was particularly evident within coding regions. This diversification has the potential to broaden functional diversity and generate phenotypic variation that may lead to new adaptations and the modification of important agronomic traits. Further, annotated SNPs identified here will serve as useful genetic tools and as candidates in searches for phenotype-altering DNA variation. In summary, we demonstrated that sequencing of captured DNA is a powerful approach for

  7. [Evolution of non-coding nucleotide sequences in Newcastle disease virus genomes ].


    Xu, Huaiying; Qin, Zhuoming; Qi, Lihong; Zhang, Wei; Wang, Youling; Liu, Jinhua


    [OBJECTIVE] Although much is done in the coding genes of Newcastle disease virus (NDV) , limited papers can be found with non-coding sequences. In this paper, the evolution tendency of non-coding sequences was studied. [METHODS] NDV strain LC12 isolated from duck with egg drop syndrome in 2012, and others 35 strains genome cDNA of different NDV genotype were sought and obtained from GenBank. Analytical approaches including nucleotide homology, nucleotide alignment and phylogenetic tree were associated with the leading sequences, trailer sequences, intergenic sequences (IGS), and coding gene between 5 'and 3' UTR nucleotide, respectively. [RESULTS] The location and the length of the non-coding sequences highly conserve, and the variation trend of non-coding sequences is synchronous with the entire genomes and coding genes. [ CONCLUSION] The molecular variation of the coding gene was indistinguishable with the non-coding gene in view of the NDV genome. PMID:25522596

  8. Single nucleotide polymorphisms in G protein signaling pathway genes in preeclampsia.


    Kvehaugen, Anne Stine; Melien, Oyvind; Holmen, Oddgeir Lingaas; Laivuori, Hannele; Oian, Pål; Andersgaard, Alice Beathe; Dechend, Ralf; Staff, Anne Cathrine


    Preeclampsia is a pregnancy specific disorder and a risk factor for later cardiovascular disease. The cause and detailed pathophysiology remains unknown. G protein signaling is involved in a variety of physiological processes, including blood pressure regulation. We assessed whether distributions of 3 single nucleotide polymorphisms in genes coding for components of G protein signaling pathways that have been associated with hypertension differ between women with preeclampsia and normotensive pregnant women; the G protein β3 subunit gene (GNB3) C825T polymorphism (rs5443), the angiotensin II type 1 receptor gene (AGTR1) 3'UTR A1166C polymorphism (rs5186), and the regulator of G protein signaling 2 gene (RGS2) 3'UTR C1114G polymorphism (rs4606). Two separate Norwegian study populations were used; a large population based study and a smaller, but clinically well-described pregnancy biobank. A descriptive study of 43 women with eclampsia was additionally included. In the population-based study, an increased odds of preeclampsia (odds ratio, 1.21; [95% confidence interval, 1.05-1.40]; P=0.009) and recurrent preeclampsia (odds ratio, 1.43; [95% confidence interval, 1.06-1.92];, P=0.017) was found in women carrying the rs4606 CG or GG genotype. In early-onset preeclamptic patients with decidual spiral artery biopsies available (n=24), the rs4606 CG or GG genotype was more frequent in those with acute atherosis (resembling early stage of atherosclerosis) compared with those without: odds ratio, 15.0; (95% confidence interval, 2.02-111.2); P=0.004. No association was found between preeclampsia and the rs5443 or the rs5186. The genotype distribution in eclamptic women was not different from preeclamptic women. In conclusion, RGS2 rs4606 may affect the risk and progression of preeclampsia.

  9. Diversity of preferred nucleotide sequences around the translation initiation codon in eukaryote genomes.


    Nakagawa, So; Niimura, Yoshihito; Gojobori, Takashi; Tanaka, Hiroshi; Miura, Kin-ichiro


    Understanding regulatory mechanisms of protein synthesis in eukaryotes is essential for the accurate annotation of genome sequences. Kozak reported that the nucleotide sequence GCCGCC(A/G)CCAUGG (AUG is the initiation codon) was frequently observed in vertebrate genes and that this 'consensus' sequence enhanced translation initiation. However, later studies using invertebrate, fungal and plant genes reported different 'consensus' sequences. In this study, we conducted extensive comparative analyses of nucleotide sequences around the initiation codon by using genomic data from 47 eukaryote species including animals, fungi, plants and protists. The analyses revealed that preferred nucleotide sequences are quite diverse among different species, but differences between patterns of nucleotide bias roughly reflect the evolutionary relationships of the species. We also found strong biases of A/G at position -3, A/C at position -2 and C at position +5 that were commonly observed in all species examined. Genes with higher expression levels showed stronger signals, suggesting that these nucleotides are responsible for the regulation of translation initiation. The diversity of preferred nucleotide sequences around the initiation codon might be explained by differences in relative contributions from two distinct patterns, GCCGCCAUG and AAAAAAAUG, which implies the presence of multiple molecular mechanisms for controlling translation initiation.

  10. Development of a single nucleotide polymorphism genotyping microarray platform for the identification of bovine milk protein genetic polymorphisms.


    Chessa, S; Chiatti, F; Ceriotti, G; Caroli, A; Consolandi, C; Pagnacco, G; Castiglioni, B


    The objective of this study was to develop and validate a fast method for typing the main mutations of bovine milk protein genes by using microarray technology. An approach based on the ligation detection reaction (LDR) and a universal array (UA) was used. Polymorphisms in both the coding and noncoding sequences of alpha(S1)-casein, beta-casein, kappa-casein, and beta-lactoglobulin genes were considered because of their well-known effects on milk composition and cheese production. A total of 22 polymorphic sites, corresponding to 21 different variants, were included in the diagnostic microarray. First, a multiplex PCR was developed to amplify all the DNA target sequences simultaneously. Second, the LDR-UA assay was implemented. The method was validated by analyzing 100 Italian Friesian DNA samples, which were also genotyped by conventional methods both at the protein level by means of milk isoelectrofocusing and at the molecular level using PCR-RFLP and PCR-single strand conformation polymorphism techniques. The genotypes obtained using the LDR-UA approach were in full agreement with those obtained by the conventional analyses. An important result of the LDR-UA assay was a more accurate genotyping of the different milk protein alleles than was found with conventional typing methods. At the kappa-casein gene, in fact, 4 samples were heterozygous (3 reference samples and 1 validation sample) for an allele coding for Thr(136) and Ala(148). This variant, which can be considered as the wild type of the genus Bos, is not usually identifiable by the conventional typing methods used. The multiplex PCR-LDR-UA approach developed provides for an accurate, inexpensive, and high-throughput assay that does not exhibit false positive or false negative signals, thus making it highly suitable for animal genotyping.

  11. Geographical differences associated with single-nucleotide polymorphisms (SNPs) in nine gene targets among resistant clinical isolates of Mycobacterium tuberculosis.


    Hoshide, Matt; Qian, Lishi; Rodrigues, Camilla; Warren, Rob; Victor, Tommie; Evasco, Henry B; Tupasi, Thelma; Crudu, Valeriu; Douglas, James T


    Alternative diagnostic methods, such as sequence-based techniques, are necessary for increasing the proportion of tuberculosis cases tested for drug resistance. Despite the abundance of data on drug resistance, isolates can display phenotypic resistance but lack any distinguishable markers. Furthermore, because resistance-conferring mutations develop under antibiotic pressure, different drug regimens could favor unique single-nucleotide polymorphisms (SNPs) in different geographical regions. A total of 407 isolates were collected from four geographical regions with a high prevalence of drug-resistant tuberculosis (India, Moldova, the Philippines, and South Africa). The "hot spot" or promoter sequences of nine genes (rpoB, gyrA, gyrB, katG, inhA promoter, ahpC promoter, eis promoter, rrs, and tlyA) associated with resistance to four types of antibiotics (rifampin, isoniazid, fluoroquinolones, and aminoglycosides) were analyzed for markers. Four genes contributed largely to resistance (rpoB, gyrA, rrs, and katG), two genes contributed moderately to resistance (the eis and inhA promoters), and three genes contributed little or no resistance (gyrB, tlyA, and the ahpC promoter) in clinical isolates. Several geographical differences were found, including a double mutation in rpoB found in 37.1% of isolates from South Africa, the C→T mutation at position -12 of the eis promoter found exclusively in 60.6% of isolates from Moldova, and the G→A mutation at position -46 of the ahpC promoter found only in India. These differences in polymorphism frequencies emphasize the uniqueness of isolates found in different geographical regions. The inclusion of several genes provided a moderate increase in sensitivity, and elimination of the examination of other genes might increase efficiency.

  12. Genetic Diversity and Relatedness of Sweet Cherry (Prunus Avium L.) Cultivars Based on Single Nucleotide Polymorphic Markers

    PubMed Central

    Fernandez i Marti, Angel; Athanson, Blessing; Koepke, Tyson; Font i Forcada, Carolina; Dhingra, Amit; Oraguzie, Nnadozie


    Most previous studies on genetic fingerprinting and cultivar relatedness in sweet cherry were based on isoenzyme, RAPD, and simple sequence repeat (SSR) markers. This study was carried out to assess the utility of single nucleotide polymorphism (SNP) markers generated from 3′ untranslated regions (UTR) for genetic fingerprinting in sweet cherry. A total of 114 sweet cherry germplasm representing advanced selections, commercial cultivars, and old cultivars imported from different parts of the world were screened with seven SSR markers developed from other Prunus species and with 40 SNPs obtained from 3′ UTR sequences of Rainier and Bing sweet cherry cultivars. Both types of marker study had 99 accessions in common. The SSR data was used to validate the SNP results. Results showed that the average number of alleles per locus, mean observed heterozygosity, expected heterozygosity, and polymorphic information content values were higher in SSRs than in SNPs although both set of markers were similar in their grouping of the sweet cherry accessions as shown in the dendrogram. SNPs were able to distinguish sport mutants from their wild type germplasm. For example, “Stella” was separated from “Compact Stella.” This demonstrates the greater power of SNPs for discriminating mutants from their original parents than SSRs. In addition, SNP markers confirmed parentage and also determined relationships of the accessions in a manner consistent with their pedigree relationships. We would recommend the use of 3′ UTR SNPs for genetic fingerprinting, parentage verification, gene mapping, and study of genetic diversity in sweet cherry. PMID:22737155

  13. A toll-like receptor 3 single nucleotide polymorphism in Japanese patients with sarcoidosis.


    Ikezoe, K; Handa, T; Tanizawa, K; Kubo, T; Ito, I; Sokai, A; Nakatsuka, Y; Nagai, S; Izumi, T; Mishima, M


    Toll-like receptor 3 (TLR3) may be associated with T helper 1 immune response. This study aimed to investigate the role of a functional TLR3 single nucleotide polymorphism (SNP) in sarcoidosis. We genotyped 220 Japanese patients with sarcoidosis and 140 controls for TLR3 SNP rs3775291 to analyze its association with susceptibility to sarcoidosis and assessed its relationship to clinical features in 172 patients over 2 years. The TLR3 rs3775291 genotype was not significantly associated with disease susceptibility. However, patients with cardiac sarcoidosis (CS) significantly more frequently had the TT genotype (p < 0.01) or the T allele (p < 0.05) than those patients without CS. We conclude that TLR3 SNP rs3775291 may affect cardiac involvement in Japanese patients with sarcoidosis.

  14. Estimating the genetic variance of major depressive disorder due to all single nucleotide polymorphisms.


    Lubke, Gitta H; Hottenga, Jouke Jan; Walters, Raymond; Laurin, Charles; de Geus, Eco J C; Willemsen, Gonneke; Smit, Jan H; Middeldorp, Christel M; Penninx, Brenda W J H; Vink, Jacqueline M; Boomsma, Dorret I


    Genome-wide association studies of psychiatric disorders have been criticized for their lack of explaining a considerable proportion of the heritability established in twin and family studies. Genome-wide association studies of major depressive disorder in particular have so far been unsuccessful in detecting genome-wide significant single nucleotide polymorphisms (SNPs). Using two recently proposed methods designed to estimate the heritability of a phenotype that is attributable to genome-wide SNPs, we show that SNPs on current platforms contain substantial information concerning the additive genetic variance of major depressive disorder. To assess the consistency of these two methods, we analyzed four other complex phenotypes from different domains. The pattern of results is consistent with estimates of heritability obtained in twin studies carried out in the same population.

  15. Multiplex single-nucleotide polymorphism typing of the human Y chromosome using TaqMan probes

    PubMed Central


    Background The analysis of human Y-chromosome variation in the context of population genetics and forensics requires the genotyping of dozens to hundreds of selected single-nucleotide polymorphisms (SNPs). In the present study, we developed a 121-plex (121 SNPs in a single array) TaqMan array capable of distinguishing most haplogroups and subhaplogroups on the Y-chromosome human phylogeny in Europe. Results We present data from 264 samples from several European areas and ethnic groups. The array developed in this study shows >99% accuracy of assignation to the Y human phylogeny (with an average call rate of genotypes >96%). Conclusions We have created and evaluated a robust and accurate Y-chromosome multiplex which minimises the possible errors due to mixup when typing the same sample in several independent reactions. PMID:21627798

  16. Estimating population size using single-nucleotide polymorphism-based pedigree data.


    Spitzer, Robert; Norman, Anita J; Schneider, Michael; Spong, Göran


    Reliable population estimates are an important aspect of sustainable wildlife management and conservation but can be difficult to obtain for rare and elusive species. Here, we test a new census method based on pedigree reconstruction recently developed by Creel and Rosenblatt (2013). Using a panel of 96 single-nucleotide polymorphisms (SNPs), we genotyped fecal samples from two Swedish brown bear populations for pedigree reconstruction. Based on 433 genotypes from central Sweden (CS) and 265 from northern Sweden (NS), the population estimates (N = 630 for CS, N = 408 for NS) fell within the 95% CI of the official estimates. The precision and accuracy improved with increasing sampling intensity. Like genetic capture-mark-recapture methods, this method can be applied to data from a single sampling session. Pedigree reconstruction combined with noninvasive genetic sampling may thus augment population estimates, particularly for rare and elusive species for which sampling may be challenging.

  17. A functional single nucleotide polymorphism of SET8 is prognostic for breast cancer.


    Liu, Ben; Zhang, Xining; Song, Fengju; Liu, Qun; Dai, Hongji; Zheng, Hong; Cui, Ping; Zhang, Lina; Zhang, Wei; Chen, Kexin


    A single-nucleotide polymorphism (SNP) locus rs16917496 (T > C) within the 3'-untranslated region (3'-UTR) of SET8 was associated with susceptibility in several malignancies including breast cancer. To further elucidate the prognostic relevance of this SNP in breast cancer, we conducted a clinical study as well as SET8 expression analysis in a cohort of 1,190 breast cancer patients. We demonstrated the expression levels of SET8 in TT genotype were higher than in CC genotypes, and high levels of SET8 were associated with poor survival. SET8 expression was significantly higher in breast tumor tissue than in paired adjacent normal tissue. In addition, survival analysis in 315 patients showed SNP rs16917496 was an independent prognostic factor of breast cancer outcome with TT genotype associated with poor survival compared with CC/CT genotypes. Thus, this SNP may serve as a genetic prognostic factor and a treatment target for breast cancer. Future studies are warranted.

  18. Analysis of single nucleotide polymorphism among Varicella-Zoster Virus and identification of vaccine-specific sites.


    Jeon, Jeong Seon; Won, Youn Hee; Kim, In Kyo; Ahn, Jin Hyun; Shin, Ok Sarah; Kim, Jung Hwan; Lee, Chan Hee


    Varicella-zoster virus (VZV) is a causative agent for chickenpox and zoster. Live attenuated vaccines have been developed based on Oka and MAV/06 strains. In order to understand the molecular mechanisms of attenuation, complete genome sequences of vaccine and wild-type strains were compared and single nucleotide polymorphism (SNP) was analyzed. ORF22 and ORF62 contained the highest number of SNPs. The detailed analysis of the SNPs suggested 24 potential vaccine-specific sites. All the mutational events found in vaccine-specific sites were transitional, and most of them were substitution of AT to GC pair. Interestingly, 18 of the vaccine-specific sites of the vaccine strains appeared to be genetically heterogeneous. The probability of a single genome of vaccine strain to contain all 24 vaccine-type sequences was calculated to be less than 4%. The average codon adaptation index (CAI) value of the vaccine strains was significantly lower than the CAI value of the clinical strains.

  19. Identification of Novel GRM1 Mutations and Single Nucleotide Polymorphisms in Prostate Cancer Cell Lines and Tissues

    PubMed Central

    Ali, Shafat; Shourideh, Mojgan; Koochekpour, Shahriar


    Metabotropic glutamate receptor 1 (GRM1) signaling has been implicated in benign and malignant disorders including prostate cancer (PCa). To further explore the role of genetic alterations of GRM1 in PCa, we screened the entire human GRM1 gene including coding sequence, exon-intron junctions, and flanking untranslated regions (UTRs) for the presence of mutations and single nucleotide polymorphisms (SNPs) in several PCa cell lines and matched tumor-normal tissues from Caucasian Americans (CAs) and African Americans (AAs). We used bidirectional sequencing, allele-specific PCR, and bioinformatics to identify the genetic changes in GRM1 and to predict their functional role. A novel missense mutation identified at C1744T (582 Pro > Ser) position of GRM1 gene in a primary AA-PCa cell line (E006AA) was predicted to affect the protein stability and functions. Another novel mutation identified at exon-intron junction of exon-8 in C4-2B cell line resulted in alteration of the GRM1 splicing donor site. In addition, we found missense SNP at T2977C (993 Ser > Pro) position and multiple non-coding mutations and SNPs in 3′-UTR of GRM1 gene in PCa cell lines and tissues. These novel mutations may contribute to the disease by alterations in GRM1 gene splicing, receptor activation, and post-receptor downstream signaling. PMID:25062106

  20. Analysis of single nucleotide polymorphism among Varicella-Zoster Virus and identification of vaccine-specific sites.


    Jeon, Jeong Seon; Won, Youn Hee; Kim, In Kyo; Ahn, Jin Hyun; Shin, Ok Sarah; Kim, Jung Hwan; Lee, Chan Hee


    Varicella-zoster virus (VZV) is a causative agent for chickenpox and zoster. Live attenuated vaccines have been developed based on Oka and MAV/06 strains. In order to understand the molecular mechanisms of attenuation, complete genome sequences of vaccine and wild-type strains were compared and single nucleotide polymorphism (SNP) was analyzed. ORF22 and ORF62 contained the highest number of SNPs. The detailed analysis of the SNPs suggested 24 potential vaccine-specific sites. All the mutational events found in vaccine-specific sites were transitional, and most of them were substitution of AT to GC pair. Interestingly, 18 of the vaccine-specific sites of the vaccine strains appeared to be genetically heterogeneous. The probability of a single genome of vaccine strain to contain all 24 vaccine-type sequences was calculated to be less than 4%. The average codon adaptation index (CAI) value of the vaccine strains was significantly lower than the CAI value of the clinical strains. PMID:27376245

  1. Cloning and nucleotide sequence of the aroA gene of Bordetella pertussis.

    PubMed Central

    Maskell, D J; Morrissey, P; Dougan, G


    The aroA locus of Bordetella pertussis, encoding 5-enolpyruvylshikimate 3-phosphate synthase, has been cloned into Escherichia coli by using a cosmid vector. The gene is expressed in E. coli and complemented an E. coli aroA mutant. The nucleotide sequence of the B. pertussis aroA gene was determined and contains an open reading frame encoding 442 amino acids, with a calculated molecular weight for 5-enolpyruvylshikimate 3-phosphate synthase of 46,688. The amino acid sequence derived from the nucleotide sequence shows homology with the published amino acid sequences of aroA gene products of other microorganisms. PMID:2897356

  2. Evaluation of intra- and interspecific divergence of satellite DNA sequences by nucleotide frequency calculation and pairwise sequence comparison

    PubMed Central


    Satellite DNA sequences are known to be highly variable and to have been subjected to concerted evolution that homogenizes member sequences within species. We have analyzed the mode of evolution of satellite DNA sequences in four fishes from the genus Diplodus by calculating the nucleotide frequency of the sequence array and the phylogenetic distances between member sequences. Calculation of nucleotide frequency and pairwise sequence comparison enabled us to characterize the divergence among member sequences in this satellite DNA family. The results suggest that the evolutionary rate of satellite DNA in D. bellottii is about two-fold greater than the average of the other three fishes, and that the sequence homogenization event occurred in D. puntazzo more recently than in the others. The procedures described here are effective to characterize mode of evolution of satellite DNA. PMID:12734555

  3. Evaluation of intra- and interspecific divergence of satellite DNA sequences by nucleotide frequency calculation and pairwise sequence comparison.


    Kato, Mikio


    Satellite DNA sequences are known to be highly variable and to have been subjected to concerted evolution that homogenizes member sequences within species. We have analyzed the mode of evolution of satellite DNA sequences in four fishes from the genus Diplodus by calculating the nucleotide frequency of the sequence array and the phylogenetic distances between member sequences. Calculation of nucleotide frequency and pairwise sequence comparison enabled us to characterize the divergence among member sequences in this satellite DNA family. The results suggest that the evolutionary rate of satellite DNA in D. bellottii is about two-fold greater than the average of the other three fishes, and that the sequence homogenization event occurred in D. puntazzo more recently than in the others. The procedures described here are effective to characterize mode of evolution of satellite DNA. PMID:12734555

  4. Investigation of single nucleotide polymorphism loci susceptible to degradation by ultraviolet light.


    Machida, Mitsuyo; Taki, Takashi; Shimada, Ryo; Kibayashi, Kazuhiko


    DNA in biological fluids is often degraded by environmental factors. Given that single nucleotide polymorphism (SNP) analyses require shorter amplicons than short tandem repeat (STR) analyses do, their use in human identification using degraded samples has recently attracted attention. Although various SNP loci are used to analyze degraded samples, it is unclear which ones are more appropriate. To characterize and identify SNP loci that are susceptible or resistant to degradation, we artificially degraded DNA, obtained from buccal swabs from 11 volunteers, by exposure to ultraviolet (UV) light for different durations (254 nm for 5, 15, 30, 60, or 120 min) and analyzed the resulting SNP loci. DNA degradation was assessed using gel electrophoresis, STR, and SNP profiling. DNA fragmentation occurred within 5 min of UV irradiation, and successful STR and SNP profiling decreased with increasing duration. However, 73% of SNP loci were still detected correctly in DNA samples irradiated for 120 min, a dose that rendered STR loci undetectable. The unsuccessful SNP typing and the base call failure of nucleotides neighboring the SNPs were traced to rs1031825, and we found that this SNP was susceptible to UV light. When comparing the detection efficiencies of STR and SNP loci, SNP typing was more successful than STR typing, making it effective when using degraded DNA. However, it is important to use rs1031825 with caution when interpreting SNP analyses of degraded DNA.

  5. Investigation of single nucleotide polymorphism loci susceptible to degradation by ultraviolet light.


    Machida, Mitsuyo; Taki, Takashi; Shimada, Ryo; Kibayashi, Kazuhiko


    DNA in biological fluids is often degraded by environmental factors. Given that single nucleotide polymorphism (SNP) analyses require shorter amplicons than short tandem repeat (STR) analyses do, their use in human identification using degraded samples has recently attracted attention. Although various SNP loci are used to analyze degraded samples, it is unclear which ones are more appropriate. To characterize and identify SNP loci that are susceptible or resistant to degradation, we artificially degraded DNA, obtained from buccal swabs from 11 volunteers, by exposure to ultraviolet (UV) light for different durations (254 nm for 5, 15, 30, 60, or 120 min) and analyzed the resulting SNP loci. DNA degradation was assessed using gel electrophoresis, STR, and SNP profiling. DNA fragmentation occurred within 5 min of UV irradiation, and successful STR and SNP profiling decreased with increasing duration. However, 73% of SNP loci were still detected correctly in DNA samples irradiated for 120 min, a dose that rendered STR loci undetectable. The unsuccessful SNP typing and the base call failure of nucleotides neighboring the SNPs were traced to rs1031825, and we found that this SNP was susceptible to UV light. When comparing the detection efficiencies of STR and SNP loci, SNP typing was more successful than STR typing, making it effective when using degraded DNA. However, it is important to use rs1031825 with caution when interpreting SNP analyses of degraded DNA. PMID:27570235

  6. Single nucleotide polymorphisms in Brahman steers and their association with carcass and tenderness traits.


    Smith, T; Thomas, M G; Bidner, T D; Paschal, J C; Franke, D E


    Data from purebred Brahman steers (N = 467) were used to study the association of single nucleotide polymorphisms (SNP) with carcass traits and measures of tenderness. Fall weaned calves were grazed and fed in a subtropical environment and then harvested for processing in a commercial facility. Carcass data were recorded 24 h postmortem. Muscle samples and primal ribs were obtained to measure calpastatin activity and shear force. DNA was used to determine genotypes of thyroglobulin (TG5), calpastatin (CAST) and mu-calpain (CAPN 316 and CAPN 4751) SNP. Minor allele frequencies for CAST, CAPN 316 and CAPN 4751 were 0.342, 0.031, and 0.051, respectively. CAST genotypes were associated with calpastatin enzyme activity (P < 0.01) and shear force of steaks aged for 14-day postmortem (P < 0.05). CAPN 316 genotypes were also associated with variation in shear force of steaks aged for 14 days (P < 0.05). CAPN 4751 genotypes approached significance for association with shear force of steaks after 7 and 14 days (P < 0.08). Genotypes for TG5 were non-polymorphic (i.e., minor allele frequency = 0.004) and omitted from further analyses. Neither CAST nor CAPN SNP was associated with variation in other carcass traits. PMID:19224465

  7. A STAT6 Intronic Single-Nucleotide Polymorphism is Associated with Clinical Malaria in Ghanaian Children.


    Amoako-Sakyi, Daniel; Adukpo, Selorme; Kusi, Kwadwo A; Dodoo, Daniel; Ofori, Michael F; Adjei, George O; Edoh, Dominic E; Asmah, Richard H; Brown, Charles; Adu, Bright; Obiri-Yeboah, Dorcas; Futagbi, Godfred; Abubakari, Sharif Buari; Troye-Blomberg, Marita; Akanmori, Bartholomew D; Goka, Bamenla Q; Arko-Mensah, John; Gyan, Ben A


    Malaria pathogenesis may be influenced by IgE responses and cytokine cross-regulation. Several mutations in the IL-4/STAT6 signaling pathway can alter cytokine cross-regulation and IgE responses during a Plasmodium falciparum malarial infection. This study investigated the relationship between a STAT6 intronic single-nucleotide polymorphism (rs3024974), total IgE, cytokines, and malaria severity in 238 Ghanaian children aged between 0.5 and 13 years. Total IgE and cytokine levels were measured by ELISA, while genotyping was done by polymerase chain reaction-restriction fragment length polymorphism (RFLP). Compared with healthy controls, heterozygosity protected against clinical malaria: uncomplicated malaria (odds ratios [OR] = 0.13, P < 0.001), severe malarial anemia (OR = 0.18, P < 0.001), and cerebral malaria (OR = 0.39, P = 0.022). Levels of total IgE significantly differed among malaria phenotypes (P = 0.044) and rs3024974 genotypes (P = 0.037). Neither cytokine levels nor IL-6/IL-10 ratios were associated with malaria phenotypes or rs3024974 genotypes. This study suggests a role for rs3024974 in malaria pathogenesis and offers further insights into an IL-4/STAT6 pathway mutation in malaria pathogenesis. PMID:27279750

  8. Single nucleotide polymorphism in the neuroplastin locus associates with cortical thickness and intellectual ability in adolescents.


    Desrivières, S; Lourdusamy, A; Tao, C; Toro, R; Jia, T; Loth, E; Medina, L M; Kepa, A; Fernandes, A; Ruggeri, B; Carvalho, F M; Cocks, G; Banaschewski, T; Barker, G J; Bokde, A L W; Büchel, C; Conrod, P J; Flor, H; Heinz, A; Gallinat, J; Garavan, H; Gowland, P; Brühl, R; Lawrence, C; Mann, K; Martinot, M L P; Nees, F; Lathrop, M; Poline, J-B; Rietschel, M; Thompson, P; Fauth-Bühler, M; Smolka, M N; Pausova, Z; Paus, T; Feng, J; Schumann, G


    Despite the recognition that cortical thickness is heritable and correlates with intellectual ability in children and adolescents, the genes contributing to individual differences in these traits remain unknown. We conducted a large-scale association study in 1583 adolescents to identify genes affecting cortical thickness. Single-nucleotide polymorphisms (SNPs; n=54,837) within genes whose expression changed between stages of growth and differentiation of a human neural stem cell line were selected for association analyses with average cortical thickness. We identified a variant, rs7171755, associating with thinner cortex in the left hemisphere (P=1.12 × 10(-)(7)), particularly in the frontal and temporal lobes. Localized effects of this SNP on cortical thickness differently affected verbal and nonverbal intellectual abilities. The rs7171755 polymorphism acted in cis to affect expression in the human brain of the synaptic cell adhesion glycoprotein-encoding gene NPTN. We also found that cortical thickness and NPTN expression were on average higher in the right hemisphere, suggesting that asymmetric NPTN expression may render the left hemisphere more sensitive to the effects of NPTN mutations, accounting for the lateralized effect of rs7171755 found in our study. Altogether, our findings support a potential role for regional synaptic dysfunctions in forms of intellectual deficits. PMID:24514566

  9. Association of single nucleotide polymorphism rs3803662 with the risk of breast cancer

    PubMed Central

    Yang, Yuan; Wang, Wenjing; Liu, Guiyou; Yu, Yingcui; Liao, Mingzhi


    Large scale association studies have identified the single nucleotide polymorphism rs3803662 associated with breast cancer risk. However, the sample size of most studies is too small. Here, we performed this meta-analysis to make the result more convincing. Relevant articles published up to 2016 were identified by searching the PubMed database. 13 studies, involving a total of 29405 participants, were included in the meta-analysis. Odds Ratios (ORs) with 95% confidence intervals (CIs) was calculated with random or fixed effects model. All data analyses were analyzed by Review Manger 5.3 software. In Caucasian subgroup: Dominant model (TT + CT vs CC): OR = 1.17 (1.06, 1.29), Recessive model (TT vs CT + CC): OR = 1.25 (1.13, 1.39) and Allele frequency (T vs C): OR = 1.15 (1.08, 1.22). The present meta-analysis suggests that rs3803662 polymorphism is significantly associated with breast cancer risk in Caucasian women, and we did not find the association in Asian women. PMID:27350156

  10. Discovery and characterization of single nucleotide polymorphisms in coho salmon, Oncorhynchus kisutch.


    Starks, Hilary A; Clemento, Anthony J; Garza, John Carlos


    Molecular population genetic analyses have become an integral part of ecological investigation and population monitoring for conservation and management. Microsatellites have been the molecular marker of choice for such applications over the last several decades, but single nucleotide polymorphism (SNP) markers are rapidly expanding beyond model organisms. Coho salmon (Oncorhynchus kisutch) is native to the north Pacific Ocean and its tributaries, where it is the focus of intensive fishery and conservation activities. As it is an anadromous species, coho salmon typically migrate across multiple jurisdictional boundaries, complicating management and requiring shared data collection methods. Here, we describe the discovery and validation of a suite of novel SNPs and associated genotyping assays which can be used in the genetic analyses of this species. These assays include 91 that are polymorphic in the species and one that discriminates it from a sister species, Chinook salmon. We demonstrate the utility of these SNPs for population assignment and phylogeographic analyses, and map them against the draft trout genome. The markers constitute a large majority of all SNP markers described for coho salmon and will enable both population- and pedigree-based analyses across the southern part of the species native range. PMID:25965351

  11. Association of single nucleotide polymorphism rs3803662 with the risk of breast cancer.


    Yang, Yuan; Wang, Wenjing; Liu, Guiyou; Yu, Yingcui; Liao, Mingzhi


    Large scale association studies have identified the single nucleotide polymorphism rs3803662 associated with breast cancer risk. However, the sample size of most studies is too small. Here, we performed this meta-analysis to make the result more convincing. Relevant articles published up to 2016 were identified by searching the PubMed database. 13 studies, involving a total of 29405 participants, were included in the meta-analysis. Odds Ratios (ORs) with 95% confidence intervals (CIs) was calculated with random or fixed effects model. All data analyses were analyzed by Review Manger 5.3 software. In Caucasian subgroup: Dominant model (TT + CT vs CC): OR = 1.17 (1.06, 1.29), Recessive model (TT vs CT + CC): OR = 1.25 (1.13, 1.39) and Allele frequency (T vs C): OR = 1.15 (1.08, 1.22). The present meta-analysis suggests that rs3803662 polymorphism is significantly associated with breast cancer risk in Caucasian women, and we did not find the association in Asian women.

  12. Single-nucleotide polymorphism analysis of GH, GHR, and IGF-1 genes in minipigs.


    Tian, Y G; Yue, M; Gu, Y; Gu, W W; Wang, Y J


    Tibetan (TB) and Bama (BM) miniature pigs are two popular pig breeds that are used as experimental animals in China due to their small body size. Here, we analyzed single-nucleotide polymorphisms (SNPs) in gene fragments that are closely related to growth traits [growth hormone (GH), growth hormone receptor (GHR), and insulin-like growth factor (IGF)-1)] in these pig breeds and a large white (LW) control pig breed. On the basis of the analysis of 100 BMs, 108 TBs, and 50 LWs, the polymorphic distribution levels of GH, GHR, and IGF-1 were significantly different among these three pig breeds. According to correlation analyses between SNPs and five growth traits--body weight (BW), body length (BL), withers height (WH), chest circumference (CC), and abdomen circumference (AC)--three SNP loci in BMs and four SNP loci in TBs significantly affected growth traits. Three SNP sites in BMs and four SNP sites in TBs significantly affected growth traits. SNPs located in the GH gene fragment significantly affected BL and CC at locus 12 and BL at locus 45 in BMs, and also BW, WH, CC, and AC at locus 45 and WH and CC at locus 93 in TBs. One SNP at locus 85 in the BM GHR gene fragment significantly affected all growth traits. All indices were significantly reduced with a mixture of alleles at locus 85. These results provide more information regarding the genetic background of these minipig species and indicate useful selection markers for pig breeding programs. PMID:25098617

  13. Differentiation of drug and non-drug Cannabis using a single nucleotide polymorphism (SNP) assay.


    Rotherham, D; Harbison, S A


    Cannabis sativa is both an illegal drug and a legitimate crop. The differentiation of illegal drug Cannabis from non-drug forms of Cannabis is relevant in the context of the growth of fibre and seed oil varieties of Cannabis for commercial purposes. This differentiation is currently determined based on the levels of tetrahydrocannabinol (THC) in adult plants. DNA based methods have the potential to assay Cannabis material unsuitable for analysis using conventional means including seeds, pollen and severely degraded material. The purpose of this research was to develop a single nucleotide polymorphism (SNP) assay for the differentiation of "drug" and "non-drug"Cannabis plants. An assay was developed based on four polymorphisms within a 399 bp fragment of the tetrahydrocannabinolic acid (THCA) synthase gene, utilising the snapshot multiplex kit. This SNP assay was tested on 94 Cannabis plants, which included 10 blind samples, and was able to differentiate between "drug" and "non-drug"Cannabis in all cases, while also differentiating between Cannabis and other species. Non-drug plants were found to be homozygous at the four sites assayed while drug Cannabis plants were either homozygous or heterozygous.

  14. Paclitaxel sensitivity in relation to ABCB1 expression, efflux and single nucleotide polymorphisms in ovarian cancer

    PubMed Central

    Gao, Bo; Russell, Amanda; Beesley, Jonathan; Chen, Xiao Qing; Healey, Sue; Henderson, Michelle; Wong, Mark; Emmanuel, Catherine; Galletta, Laura; Johnatty, Sharon E.; Bowtell, David; Bowtell, David; Chenevix-Trench, Georgia; deFazio, Anna; Gertig, Dorota; Green, Adle; Webb, Penelope; Hung, Jillian; Moore, Sue; Traficante, Nadia; Fereday, Sian; Harrap, Karen; Sadkowsky, Troy; Pandeya, Nirmala; Stuart-Harris, Robin; Kirsten, Fred; Rutovitz, Josie; Clingan, Peter; Glasgow, Amanda; Proietto, Anthony; Braye, Stephen; Otton, Greg; Shannon, Jennifer; Bonaventura, Tony; Stewart, James; Begbie, Stephen; Friedlander, Michael; Bell, David; Baron-Hay, Sally; Ferrier, Alan; Gard, Greg; Nevell, David; Pavlakis, Nick; Valmadre, Sue; Young, Barbara; Camaris, Catherine; Crouch, Roger; Edwards, Lyndal; Hacker, Neville; Marsden, Donald; Robertson, Greg; Beale, Phillip; Beith, Jane; Carter, Jonothan; Dalrymple, Chris; Hamilton, Anne; Houghton, Roger; Russell, Peter; Links, Matthew; Grygiel, John; Hill, Jane; Brand, Alison; Byth, Karen; Jaworski, Richard; Harnett, Paul; Sharma, Raghwa; Achen, Anita; Wain, Gerard; Ward, Bruce; Papadimos, David; Crandon, Alex; Cummings, Margaret; Horwood, Ken; Obermair, Andreas; Perrin, Lew; Wyld, David; Nicklin, Jim; Davy, Margaret; Oehler, Martin K; Hall, Chris; Dodd, Tom; Healy, Tabitha; Pittman, Ken; Henderson, Doug; Miller, John; Pierdes, John; Blomfield, Penny; Challis, David; McIntosh, Robert; Parker, Andrew; Brown, Bob; Rome, Robert; Allen, David; Grant, Peter; Hyde, Simon; Laurie, Rohan; Robbie, Melissa; Healy, David; Jobling, Tom; Manolitsas, Tom; McNealage, Jane; Rogers, Peter; Susil, Beatrice; Sumithran, Eric; Simpson, Ian; Phillips, Kelly; Rischin, Danny; Fox, Stephen; Johnson, Daryl; Waring, Paul; Lade, Stephen; Loughrey, Maurice; O’Callaghan, Neil; Murray, William; Billson, Virginia; Pyman, Jan; Neesham, Debra; Quinn, Michael; Underhill, Craig; Bell, Richard; Ng, Leong-Fook; Blum, Robert; Ganju, Vinod; Hammond, Ian; Leung, Yee; McCartney, Anthony; Buck, Martin; Haviv, Izak; Purdie, David; Whiteman, David; Zeps, Nikolajs; Malt, Mary-Rose; Mellon, Anne; Robertson, Randall; Bergh, Trish Vanden; Jones, Marian; Mackenzie, Patricia; Maidens, Jane; Nattress, Kath; Chiew, Yoke-Eng; Stenlake, Annie; Sullivan, Helen; Alexander, Barbara; Ashover, Pat; Brown, Sue; Corrish, Tracy; Green, Lyn; Jackman, Leah; Ferguson, Kaltin; Martin, Karen; Martyn, Adam; Ranieri, Barbara; White, Jo; Jayde, Victoria; Bowes, Leanne; Mamers, Pamela; Galletta, Laura; Giles, Debra; Hendley, Joy; Alsop, Katherine; Schmidt, Trudy; Shirley, Helen; Ball, Colleen; Young, Cherry; Viduka, Suzanna; Tran, Hoa; Bilic, Sanela; Glavinas, Lydia; Brooks, Julia; Haber, Michelle; Norris, Murray; Harnett, Paul; Chenevix-Trench, Georgia; Balleine, Rosemary L.; deFazio, Anna


    ABCB1 (adenosine triphosphate-binding cassette transporter B1) mediates cellular elimination of many chemotherapeutic agents including paclitaxel, which is commonly used to treat ovarian cancer. A significant association between common single nucleotide polymorphisms (SNPs) in ABCB1 and progression-free survival has been reported in patients with ovarian cancer. Variable paclitaxel clearance due to genotype specific differences in ABCB1 activity in cancer cells and/or normal tissues may underlie the association. Using cell-based models, we evaluated the correlations between ABCB1 expression, polymorphisms, transporter activity and paclitaxel sensitivity in ovarian cancer (n = 10) and lymphoblastoid (n = 19) cell lines. Close associations between ABCB1 expression, transporter function and paclitaxel sensitivity were found in lymphoblastoid cell lines, although we could not demonstrate an association with common SNPs. In ovarian cancer cell lines, ABCB1 expression was low and the association between expression and function was lost. These results suggest that ABCB1 related survival difference in ovarian cancer patients is more likely to be due to differential whole body paclitaxel clearance mediated by normal cells rather than a direct effect on cancer cells. PMID:24810093

  15. Single nucleotide polymorphisms of ataxia telangiectasia mutated and the risk of papillary thyroid carcinoma.


    Song, Chang Myeon; Kwon, Tack-Kyun; Park, Byung Lae; Ji, Yong Bae; Tae, Kyung


    Genetic factors associated with susceptibility to papillary thyroid carcinoma (PTC) are not well known. We evaluated the association between single nucleotide polymorphisms (SNPs) of ataxia telangiectasia mutated (ATM) and the risk of PTC. A total of 437 histologically confirmed PTC cases and 184 cancer-free controls without thyroid nodules were recruited. Genotypes with respect to five ATM SNPs (rs189037, rs664677, rs373759, rs664143, and rs4585) were determined by the TaqMan assay, and odds ratios and 95% confidence intervals were obtained by logistic regression analysis. Linkage disequilibria and haplotypes were examined from the genotype data. When evaluated separately the genotype distributions of the five ATM SNPs were similar in the PTC cases and controls. Three ATM SNPs (rs373759, rs664143, and rs4585) were found to be in strong linkage disequilibrium (D' = 1.00, P < 0.001). When the three haplotypes (C-A-G), (T-G-T), and (C-G-T) of these three ATM SNP sites were analyzed, ATM haplotype (C-G-T) +/- was associated with a lower risk of PTC than ATM haplotype (C-G-T) -/- (P = 0.03) after adjusting for age and gender. Our results suggest that genetic polymorphisms of ATM may play an important role in the development of thyroid cancer in the Korean population.

  16. The role of Vitamin D level and related single nucleotide polymorphisms in Crohn's disease.


    Carvalho, Andre Y O M; Bishop, Karen S; Han, Dug Yeo; Ellett, Stephanie; Jesuthasan, Amalini; Lam, Wen J; Ferguson, Lynnette R


    New Zealand has one of the highest rates of Crohn's Disease (CD) in the world, and there is much speculation as to why this might be. A high risk of CD has been associated with deficient or insufficient levels of Vitamin D (Vit D), lifestyle as well as various genetic polymorphisms. In this study we sought to analyse the relevance of serum Vit D levels, lifestyle and genotype to CD status. Serum samples were analysed for 25-OH-Vitamin D levels. DNA was isolated from blood and cheek-swabs, and Sequenom and ImmunoChip techniques were used for genotyping. Serum Vit D levels were significantly lower in CD patients (mean = 49.5 mg/L) than those found in controls (mean = 58.9 mg/L, p = 4.74 × 10⁻⁶). A total of seven single nucleotide polymorphisms were examined for effects on serum Vit D levels, with adjustment for confounding variables. Two variants: rs731236[A] (VDR) and rs732594[A] (SCUBE3) showed a significant association with serum Vit D levels in CD patients. Four variants: rs7975232[A] (VDR), rs732594[A] (SCUBE3), and rs2980[T] and rs2981[A] (PHF-11) showed a significant association with serum Vit D levels in the control group. This study demonstrates a significant interaction between Vit D levels and CD susceptibility, as well as a significant association between Vit D levels and genotype.

  17. Single nucleotide polymorphisms in Brahman steers and their association with carcass and tenderness traits.


    Smith, T; Thomas, M G; Bidner, T D; Paschal, J C; Franke, D E


    Data from purebred Brahman steers (N = 467) were used to study the association of single nucleotide polymorphisms (SNP) with carcass traits and measures of tenderness. Fall weaned calves were grazed and fed in a subtropical environment and then harvested for processing in a commercial facility. Carcass data were recorded 24 h postmortem. Muscle samples and primal ribs were obtained to measure calpastatin activity and shear force. DNA was used to determine genotypes of thyroglobulin (TG5), calpastatin (CAST) and mu-calpain (CAPN 316 and CAPN 4751) SNP. Minor allele frequencies for CAST, CAPN 316 and CAPN 4751 were 0.342, 0.031, and 0.051, respectively. CAST genotypes were associated with calpastatin enzyme activity (P < 0.01) and shear force of steaks aged for 14-day postmortem (P < 0.05). CAPN 316 genotypes were also associated with variation in shear force of steaks aged for 14 days (P < 0.05). CAPN 4751 genotypes approached significance for association with shear force of steaks after 7 and 14 days (P < 0.08). Genotypes for TG5 were non-polymorphic (i.e., minor allele frequency = 0.004) and omitted from further analyses. Neither CAST nor CAPN SNP was associated with variation in other carcass traits.

  18. Assessing the association of single nucleotide polymorphisms at the thyroglobulin gene with carcass traits in beef cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objective of this study was to assess the association of single nucleotide polymorphisms in the thyroglobulin gene, including a previously reported marker in current industry use, with marbling score in beef cattle. Three populations, designated GPE6, GPE7, and GPE8, were studied. The GPE6 pop...

  19. Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

    Technology Transfer Automated Retrieval System (TEKTRAN)

    High-density single nucleotide polymorphism (SNP) genotyping chips are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships among individuals in populations and studying marker-trait associations in mapping experiments. We developed a genotyping array includ...

  20. Single nucleotide polymorphisms in uracil-processing genes, intake of one-carbon nutrients and breast cancer risk

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background/Objectives: The misincorporation of uracil into DNA leads to genomic instability. In a previous study, some of us identified four common single nucleotide polymorphisms (SNPs) in uracil-processing genes (rs2029166 and rs7296239 in SMUG1, rs34259 in UNG and rs4775748 in DUT) that were asso...

  1. Distribution of cytokine gene single nucleotide polymorphisms among a multi-ethnic Iranian population

    PubMed Central

    Kurdistani, Zana Karimi; Saberi, Samaneh; Talebkhan, Yeganeh; Oghalaie, Akbar; Esmaeili, Maryam; Mohajerani, Nazanin; Bababeik, Maryam; Hassanpour, Parisa; Barani, Shaghik; Farjaddoost, Ameneh; Ebrahimzadeh, Fatemeh; Trejaut, Jean; Mohammadi, Marjan


    Background: Cytokine gene single nucleotide polymorphisms (SNPs) are widely used to study susceptibility to complex diseases and as a tool for anthropological studies. Materials and Methods: To investigate cytokine SNPs in an Iranian multi-ethnic population, we have investigated 10 interleukin (IL) SNPs (IL-1β (C-511T, T-31C), IL-2 (G-384T), IL-4 (C-590T), IL-6 (G-174C), IL-8 (T-251A), IL-10 (G-1082A, C-819T, C-592A) and tumor necrosis factor-alpha (TNF-α) (G-308A) in 415 Iranian subjects comprising of 6 different ethnicities. Allelic and genotypic frequencies as well as Hardy-Weinberg equilibrium (HWE) were calculated by PyPop software. Population genetic indices including observed heterozygosity (Ho), expected heterozygosity (He), fixation index (FIS), the effective number of alleles (Ne) and polymorphism information content (PIC) were derived using Popgene 32 software. Multidimensional scaling (MDS) was constructed using Reynold's genetic distance obtained from the frequencies of cytokine gene polymorphism. Results: Genotypic distributions were consistent with the HWE assumptions, except for 3 loci (IL-4-590, IL-8-251 and IL-10-819) in Fars and 4 loci (IL-4-590, IL-6-174, IL-10-1082 and TNF-α-308) in Turks. Pairwise assessment of allelic frequencies, detected differences at the IL-4-590 locus in Gilakis versus Kurds (P = 0.028) and Lurs (P = 0.022). Mazanis and Gilakis displayed the highest (Ho= 0.50 ± 0.24) and lowest (Ho= 0.34 ± 0.16) mean observed heterozygosity, respectively. Conclusions: MDS analysis of our study population, in comparison with others, revealed that Iranian ethnicities except Kurds and Mazanis were tightly located within a single cluster with closest genetic affinity to Europeans. PMID:26436076

  2. Breast cancer risk, dietary intake, and methylenetetrahydrofolate reductase (MTHFR)single nucleotide polymorphisms.


    Alshatwi, Ali A


    Diet plays an important role in DNA methylation, synthesis, and repair; intake has been associated with breast cancer. The folate-metabolizing enzyme, methylenetetrahydrofolate reductase (MTHFR) is polymorphic at nucleotides 677 (C-->T), resulting in allozymes with altered activity and is thus believed to cause interindividual differences in cancer risk susceptibility. I evaluated this polymorphism and its effect on the food intake and breast cancer risk association in a population-based case-control study of 100 breast cancer cases and 100 controls using a real-time PCR based assay. All subjects completed in-person interviews, which included a food-frequency questionnaire. Unconditional logistic regression models were used to calculate odds ratios and their 95% confidence intervals, after adjusting for potential confounding factors. Cases and controls were similar in the distribution ofMTHFRpolymorphisms at codon 677 (41.4% cases and 41.8% controls carried theTallele). An inverse association of breast cancer risk with food intake was observed in all genotype groups, particularly among subjects with the677TTgenotype. Compared with those with the677CCgenotype and high food intake frequency, the adjusted odds ratios (95% confidence intervals) associated with low food intake were 1.94 (1.15-3.26), 2.17 (1.34-3.51), and 2.51 (1.37-4.60) for subjects who hadCC,CT, andTTgenotypes (Pfor interaction, 0.05). Results of this study suggest that theMTHFR C677T polymorphism may modify the association between dietary intake and breast cancer risk. PMID:20417243

  3. Single nucleotide polymorphisms in toll-like receptor 6 are associated with altered lipopeptide- and mycobacteria-induced IL-6 secretion

    PubMed Central

    Shehu Shey, Muki; Randhawa, April Kaur; Bowmaker, Mark; Smith, Elizabeth; Jens Scriba, Thomas; de Kock, Marwou; Mahomed, Hassan; Hussey, Gregory; Richard Hawn, Thomas; Albert Hanekom, Willem


    Toll-like receptors (TLRs) are critical mediators of the immune response to pathogens. The influence of human TLR6 polymorphisms on susceptibility to infection is only partially understood. Most microbes contain lipopeptides recognized by TLR2/1 or TLR2/6 heterodimers. Our aim was to determine whether single nucleotide polymorphisms (SNPs) in TLR6 are associated with altered immune responses to lipopeptides and whole mycobacteria. We sequenced the TLR6 coding region in 100 healthy South African adults to assess genetic variation and determined associations between polymorphisms and lipopeptide- and mycobacteria-induced IL-6 production in whole blood. We found 2 polymorphisms, C745T and G1083C that were associated with altered IL-6 secretion. G1083C was associated with altered IL-6 levels in response to lipopeptides, Mycobacterium tuberculosis lysate (Mtb, P = 0.018) and BCG (P = 0.039). The 745T allele was also associated with lower NF-κB signaling in response to di-acylated lipopeptide, PAM2 (P = 0.019) or Mtb (P = 0.026) in a HEK293 cell line reconstitution assay, compared with the 745C allele. We conclude that TLR6 polymorphisms may be associated with altered lipopeptide-induced cytokine responses and recognition of Mtb. These studies provide new insight into the role of TLR6 variation and the innate immune response to human infection. PMID:20445564

  4. Single nucleotide polymorphisms in premature ovarian failure-associated genes in a Chinese Hui population

    PubMed Central



    Premature ovarian failure (POF) is an ovarian defect characterized by the premature depletion of ovarian follicles in individuals <40 years old, and is a major cause of infertility in females. Genetic factors are considered to be responsible for the development of POF, however, the exact pathogenesis remains to be elucidated in the majority of cases. In the present study, the single nucleotide polymorphisms (SNPs) of growth differentiation factor 9 (GDF9), bone morphogenetic protein 15 (BMP15), inhibin βB (INHBB) and follicle stimulating hormone receptor (FSHR) genes were investigated, and their association with POF in a Chinese Hui population of the Ningxia Hui Autonomous Region in western China was evaluated. Peripheral blood samples were collected from 63 patients diagnosed with POF (POF group) and 58 normal control individuals (control group), from which the genomic DNA was isolated. The GDF9, BMP15, INHBB and FSHR genes were amplified using polymerase chain reaction assays, and their SNPs were determined by sequencing. In the four SNPs identified across the GDF9 loci, D57Y (169G>T), rs1049127 (546G>A), rs254286 (447C>T) and rs254285 (969C>G), the frequencies of the 546G>A genotype and allele A were significantly higher in the POF group, compared with the normal control group (34.92, vs. 6.90%; P<0.05 and 19.05, vs. 3.23%; P<0.05, repsectively), while no significant differences were observed in the occur rence of the c.447C>T and c.969C>G mutations between the two groups (60.32, vs. 50% and 50.79, vs. 55.17%, repsectively). The c.169G>T mutation within the GDF9 gene was only detected in two patients with POF, and the mutation did not occur in the normal control group. A total of three SNPs were detected within the BMP15 gene, including rs3810682 (−9C>G), rs79377927 (788_789insTCT) and rs17003221 (852C>T), and no significant differences were observed in the frequencies of the 9C>G and 852C>T genotypes between the POF and control groups (7.94, vs. 6.90% and 4

  5. Single nucleotide polymorphisms in premature ovarian failure-associated genes in a Chinese Hui population.


    Ma, Lili; Chen, Yan; Mei, Si; Liu, Chunlian; Ma, Xiaohong; Li, Yongli; Jiang, Yinzhi; Ha, Lingxia; Xu, Xian


    Premature ovarian failure (POF) is an ovarian defect characterized by the premature depletion of ovarian follicles in individuals <40 years old, and is a major cause of infertility in females. Genetic factors are considered to be responsible for the development of POF, however, the exact pathogenesis remains to be elucidated in the majority of cases. In the present study, the single nucleotide polymorphisms (SNPs) of growth differentiation factor 9 (GDF9), bone morphogenetic protein 15 (BMP15), inhibin βB (INHBB) and follicle stimulating hormone receptor (FSHR) genes were investigated, and their association with POF in a Chinese Hui population of the Ningxia Hui Autonomous Region in western China was evaluated. Peripheral blood samples were collected from 63 patients diagnosed with POF (POF group) and 58 normal control individuals (control group), from which the genomic DNA was isolated. The GDF9, BMP15, INHBB and FSHR genes were amplified using polymerase chain reaction assays, and their SNPs were determined by sequencing. In the four SNPs identified across the GDF9 loci, D57Y (169G>T), rs1049127 (546G>A), rs254286 (447C>T) and rs254285 (969C>G), the frequencies of the 546G>A genotype and allele A were significantly higher in the POF group, compared with the normal control group (34.92, vs. 6.90%; P<0.05 and 19.05, vs. 3.23%; P<0.05, respectively), while no significant differences were observed in the occurrence of the c.447C>T and c.969C>G mutations between the two groups (60.32, vs. 50% and 50.79, vs. 55.17%, respectively). The c.169G>T mutation within the GDF9 gene was only detected in two patients with POF, and the mutation did not occur in the normal control group. A total of three SNPs were detected within the BMP15 gene, including rs3810682 (-9C>G), rs79377927 (788_789insTCT) and rs17003221 (852C>T), and no significant differences were observed in the frequencies of the -9C>G and 852C>T genotypes between the POF and control groups (7.94, vs. 6.90% and 4

  6. Linkage mapping and nucleotide polymorphisms of the 6-SFT gene of cool-season grasses.


    Wei, J Z; Chatterton, N J; Larson, S R; Wang, R R


    Fructan plays an important role as an alternate carbohydrate and may contribute to drought and cold-stress tolerances in various plant species. The gene coding for sucrose:fructan 6-fructosyltransferase (6-SFT; EC, an enzyme that catalyzes the formation and extension of beta-2,6-linked fructans (levans), is important to fructan synthesis in many cool-season grasses, including cereal species. In this study, we compared a conserved sequence from the 6-SFT gene in barley with comparable sequences in 20 other cool-season grasses. We detected several DNA length polymorphisms, including variations in one simple-sequence repeat (SSR) in a 6-SFT intron of the barley cultivars Steptoe and Morex. Using the 'Steptoe' x 'Morex' doubled-haploid mapping population, the 6-SFT gene was genetically mapped to the distal region in the short arm of barley chromosome 1 (7H), where it is closely linked with trait locus Rpg1. Primers designed from other conserved regions of the barley 6-SFT gene successfully amplified 351- or 354-bp sequences of this gene from diverse cool season grass species. Sequence identities of the PCR products were greater than 80% among the 21 species. Phylogeny, as determined using these DNA sequences, is similar to that obtained from rDNA ITS sequences, and congruent with our current knowledge of genome relationships.

  7. Complete nucleotide sequences of two adjacent early vaccinia virus genes located within the inverted terminal repetition.


    Venkatesan, S; Gershowitz, A; Moss, B


    The proximal part of the 10,000-base pair (bp) inverted terminal repetition of vaccinia virus DNA encodes at least three early mRNAs. A 2,236-bp segment of the repetition was sequenced to characterize two of the genes. This task was facilitated by constructing a series of recombinants containing overlapping deletions; oligonucleotide linkers with synthetic restriction sites provided points for radioactive labeling before sequencing by the chemical degradation method of Maxam and Gilbert (Methods Enzymol. 65:499-560, 1980). The ends of the transcripts were mapped by hybridizing labeled DNA fragments to early viral RNA and resolving nuclease S1-protected fragments in sequencing gels, by sequencing cDNA clones, and from the lengths of the RNAs. The nucleotide sequences for at least 60 bp upstream of both transcriptional initiation sites are more than 80% adenine . thymine rich and contain long runs of adenines and thymines with some homology to procaryotic and eucaryotic consensus sequences. The gene transcribed in the rightward direction encodes an RNA of approximately 530 nucleotides with a single open reading frame of 420 nucleotides. Preceding the first AUG, there is a heptanucleotide that can hybridize to the 3' end of 18S rRNA with only one mismatch. The derived amino acid sequence of the protein indicated a molecular weight of 15,500. The gene transcribed in the leftward direction encodes an RNA 1,000 to 1,100 nucleotides long with an open reading frame of 996 nucleotides and a leader sequence of only 5 to 6 nucleotides. The derived amino acid sequence of this protein indicated a molecular weight of 38,500. The 3' ends of the two transcripts were located within 100 bp of each other. Although there are adenine . thymine-rich clusters near the putative transcriptional termination sites, specific AATAAA polyadenylic acid signal sequences are absent.

  8. Influence of a nucleotide oligomerization domain 1 (NOD1) polymorphism and NOD2 mutant alleles on Crohn's disease phenotype

    PubMed Central

    Cantó, Elisabet; Ricart, Elena; Busquets, David; Monfort, David; García-Planella, Esther; González, Dolors; Balanzó, Joaquim; Rodríguez-Sánchez, José L; Vidal, Sílvia


    AIM: To examine genetic variation of nucleotide oligomerization domain 1 (NOD1) and NOD2, their respective influences on Crohn's disease phenotype and gene-gene interactions. METHODS: (ND1+32656*1) NOD1 polymorphism and SNP8, SNP12 and SNP13 of NOD2 were analyzed in 97 patients and 50 controls. NOD2 variants were determined by reaction restriction fragment length polymorphism analysis. NOD1 genotyping and NOD2 variant confirmation were performed by specific amplification and sequencing. RESULTS: The distribution of NOD1 polymorphism in patients was different from controls (P = 0.045) and not altered by existence of NOD2 mutations. In this cohort, 30.92% patients and 6% controls carried at least one NOD2 variant (P < 0.001) with R702W being the most frequent variant. Presence of at least one NOD2 mutation was inversely associated with colon involvement (9.09% with colon vs 36.4% with ileal or ileocolonic involvement, P = 0.04) and indicative of risk of penetrating disease (52.63% with penetrating vs 25.64% with non-penetrating or stricturing behavior, P = 0.02). L1007finsC and double NOD2 mutation conferred the highest risk for severity of disease (26.3% with penetrating disease vs 3.8% with non-penetrating or stricturing behavior presented L1007finsC, P = 0.01 and 21.0% with penetrating disease vs 2.5% with non-penentrating or stricturing behavior carried double NOD2 mutation, P = 0.007). Exclusion of patients with NOD2 mutations from phenotype/NOD1-genotype analysis revealed higher prevalence of *1*1 genotype in groups of younger age at onset and colonic location. CONCLUSION: This study suggests population differences in the inheritance of risk NOD1 polymorphism and NOD2 mutations. Although no interaction between NOD1-NOD2 was noticed, a relationship between disease location and Nod-like receptor molecules was established. PMID:17907287

  9. StructMAn: annotation of single-nucleotide polymorphisms in the structural context

    PubMed Central

    Gress, Alexander; Ramensky, Vasily; Büch, Joachim; Keller, Andreas; Kalinina, Olga V.


    The next generation sequencing technologies produce unprecedented amounts of data on the genetic sequence of individual organisms. These sequences carry a substantial amount of variation that may or may be not related to a phenotype. Phenotypically important part of this variation often comes in form of protein-sequence altering (non-synonymous) single nucleotide variants (nsSNVs). Here we present StructMAn, a Web-based tool for annotation of human and non-human nsSNVs in the structural context. StructMAn analyzes the spatial location of the amino acid residue corresponding to nsSNVs in the three-dimensional (3D) protein structure relative to other proteins, nucleic acids and low molecular-weight ligands. We make use of all experimentally available 3D structures of query proteins, and also, unlike other tools in the field, of structures of proteins with detectable sequence identity to them. This allows us to provide a structural context for around 20% of all nsSNVs in a typical human sequencing sample, for up to 60% of nsSNVs in genes related to human diseases and for around 35% of nsSNVs in a typical bacterial sample. Each nsSNV can be visualized and inspected by the user in the corresponding 3D structure of a protein or protein complex. The StructMAn server is available at PMID:27150811

  10. Complete sequence and polymorphisms of female Ruditapes philippinarum (Mollusca: Bivalvia) mitochondria genome.


    Hwang, Jae Yeon; Han, Geon Goo; Park, Jung Youn; Kim, Eun-Mi; An, Cheul Min; Kang, Jung-Ha; Choi, Yun-Jaie; Kim, Eun Bae


    Mitogenome of female Ruditapes philippinarum organism was sequenced, and genomic variation and phylogeny were examined in this study. Length of the mitogenome was 22 089 bp showing 94.28% of sequence identity with previously reported sequence. Total 707 single nucleotide polymorphisms, SNPs, were detected and 50 residues were non-synonymous SNPs among the 202 SNPs in protein-coding genes. Deleted genomic fragments with of 265 bp and 322 bp were observed in non-coding regions, ND2 to ND4L and ND4L to tRNA(Ile), respectively. Phylogenic analysis confirmed that used organisms were female R. philippinarum, and the species has closer evolutionary distance with genus Paphia rather than genus Meretrix. Our finding will be help to set an insight for population and evolutionary genomics of Veneroida clams as well as application to marine industry.

  11. [Identification and nucleotide polymorphisms in Brassica rapa genes coding cold shock domain proteins (CSDP)].


    Ryzhova, N N; Filiushin, M A; Artemeva, A M; Berdnikova, M V; Taranov, V V; Babakov, A V; Kochieva, E Z


    Full-length BrCSDP2 and BrCSDP4 cold shock gene sequences of Brassica rapa are obtained. It is shown that the isolated genes belong to a group AtCSP2/AtCSP4 of Arabidopsis thaliana and TsCSDP2/TsCSDP4 of Thellungiella salsuginea genes encoding proteins with a cold shock domain (CSD) and two zinc finger motives. The structure and the allelic variants of these genes are described and characterized. It is shown that the identified allelic polymorphism is due to both of point substitutions and small indels. Coefficients of total genetic similarity ranged from 1.0 to 0.53. In tern the genetic similarity coefficient for BrCSDP2 and AtCSDP2 was 0.89, and for BrCSDP4 and AtCSDP4 was 0.85.Translation in silico of gene sequences has revealed amino acid substitutions in the protein sequence, but no significant correlation between the detected polymorphism and signs of resistance to cold stress were found.

  12. Single nucleotide polymorphisms in interleukin-6 and their association with venous thromboembolism.


    Yadav, Umesh; Mahemuti, Ailiman; Hu, Xuemei; Abudureheman, Kailibinure; Xia, Yuning; Tang, Baopeng; Upur, Halmurat


    The aim of the present study was to reveal the contribution of single nucleotide polymorphisms of the interleukin‑6 (IL‑6) gene and the progression of venous thromboembolism (VTE). A case‑control study composed of 246 VTE patients, including 160 from the Han population (76 males and 84 females, mean age 57.41±13.25 years), 86 from the Uyghur population (41 males and 45 females, mean age 51.61±13.73 years) and 292 gender and ethnicity‑matched control participants, including 170 from the Han population (91 males and 79 females, mean age 55.82±11.83 years) and 122 from the Uyghur population (64 males and 58 females, mean age 53.52±13.64 years) were enrolled in the present study. The results demonstrated that the serum levels of IL‑6, C‑reactive protein (CRP), D‑dimer, fibrinogen, plasminogen activator inhibitor‑1 and leptin were significantly higher in the VTE group compared with the control group (P<0.05). The frequencies of the ‑572C/G promoter polymorphisms of the IL‑6 genotypes CC, CG and GG were identified to be 34, 48 and 18% in the Han population and 33, 47 and 20% in the Uyghur population, respectively. The allele frequency distributions of the C and G alleles were 58 and 42% in the Han population and 56 and 43% in the Uyghur population, respectively. Significant differences were identified in the ‑572C/G promoter polymorphisms between the VTE group and the control group (P<0.05). For the ‑597G/A polymorphism, all individuals carried the GG and GA genotype; AA genotypes were not detected. Logistic regression analysis was used to identify the risk factors for VTE, adjusting by confounding factors, the results of which demonstrated that the CC homozygote of the IL‑6 ‑572G/C, CRP, IL‑6 and high‑density lipoprotein‑cholesterol were independent risk factors of VTE (P<0.05). In conclusion, the ‑572G/C genotype of IL‑6 may be a genetic marker of VTE in the Han and Uyghur populations. PMID:25625484

  13. The nucleotide sequences of 5S rRNAs from three ciliated protozoa.

    PubMed Central

    Kumazaki, T; Hori, H; Osawa, S; Mita, T; Higashinakagawa, T


    The nucleotide sequences of 5S rRNAs from three ciliated protozoa, Paramecium tetraurelia, Tetrahymena thermophila and Blepharisma japonicum have been determined. All of them are 120 nucleotides long and the sequence of probable tRNA binding site of position 41-44 is GAAC which is characteristic of the plant 5S rRNAs. The sequence similarity percents are 87% (Paramecium/Tetrahymena), 86% (Paramecium/Blepharisma) and 79% (Tetrahymena/Blepharisma), suggesting a close relationship of these three ciliates. PMID:7122243

  14. Correlation between single nucleotide polymorphisms in hypoxia-related genes and susceptibility to acute high-altitude pulmonary edema.


    Wu, A L; Xiong, Y S; Li, Z Q; Liu, Y G; Quan, Q; Wu, L J


    This study aimed to explore the relationship between genetic changes and high-altitude pulmonary edema (HAPE) susceptibility, and to screen for the key single nucleotide polymorphism (SNP) loci in the HAPE-susceptibility gene, by investigating the SNPs occurring in hypoxia-related genes in HAPE-susceptible and control (non-susceptible) populations. This research was conducted on Han recruits, who travelled to the Lhasa plateau (altitude, 3658 m). Ten loci located on ten genes extracted from the HAPE and healthy populations were amplified by polymerase chain reaction, and subsequently sequenced. The investigated genes included those coding for aldosterone synthase 2 (CYP11B2), angiotensin-converting enzyme (ACE), heat-shock protein 70 (HSP70), nuclear factor kappa B (NF-κB), surfactant protein A2 (SP-A2), plasminogen activator inhibitor-1 (PAI-1), nitric oxide synthetase (NOS), vascular endothelial growth factor (VEGF), prolyl hydroxylase (EGLN1), and zinc finger protein A20. The gene distribution of each SNP loci and its correlation with HAPE was analyzed. Statistical analyses of the genotype frequencies of the SNPs revealed significant differences in the ACE (rs4309), EGLN1 (rs480902), SP-A2 (rs1965708), HSP70 (rs1008438), PAI-1 (rs1799889), and NOS (rs199983) expressions between the HAPE and healthy control groups (P < 0.05); therefore, these SNP loci were believed to indicate HAPE susceptibility. HAPE is correlated with multiple- SNP loci. A correlation analysis between genetic polymorphism and HAPE susceptibility revealed that 6 hypoxia-related genes were key sites accounting for HAPE. These findings could help assess the risk of HAPE in populations expressing different genotypes, in order to reduce the occurrence of HAPE. PMID:26436397

  15. Identification and genotyping of feline infectious peritonitis-associated single nucleotide polymorphisms in the feline interferon-γ gene.


    Hsieh, Li-En; Chueh, Ling-Ling


    Feline infectious peritonitis (FIP) is an immune-mediated, highly lethal disease caused by feline coronavirus (FCoV) infection. Currently, no protective vaccine or effective treatment for the disease is available. Studies have found that some cats survive the challenge of virulent FCoV isolates. Since cellular immunity is thought to be critical in preventing FIP and because diseased cats often show a significant decrease in interferon-γ (IFN-γ) production, we investigated whether single nucleotide polymorphisms (SNP) in the feline IFN-γ gene (fIFNG) are associated with the outcome of infection. A total of 82 asymptomatic and 63 FIP cats were analyzed, and 16 SNP were identified in intron 1 of fIFNG. Among these SNP, the fFING + 428 T allele was shown to be a FIP-resistant allele (p = 0.03), and the heterozygous genotypes 01C/T and +408C/T were found to be FIP-susceptible factors (p = 0.004). Furthermore, an fIFNG + 428 resistant allele also showed a clear correlation with the plasma level of IFN-γ in FIP cats. For the identification of these three FIP-related SNP, genotyping methods were established using amplification refractory mutation system PCR (ARMS-PCR) and restriction fragment length polymorphisms (RFLP), and the different genotypes could easily be identified without sequencing. The identification of additional FIP-related SNP will allow the selection of resistant cats and decrease the morbidity of the cat population to FIP.

  16. Single-nucleotide polymorphism rs41736 located in MET was significantly associated with prognosis of small cell lung cancer patients.


    Cao, Xu; Hong, Xuan; Jia, Xiaoli; Zhang, Liping; Chen, Gang


    MET has been suggested to have an intimate relationship with small cell lung cancer (SCLC) and might be a promising therapeutic target. To date, relatively limited reports have been explored on MET mutational status in SCLC patients. To investigate the relationship between MET mutations and SCLC, 68 Chinese patients surgically treated for SCLC were enrolled. MET mutational analyses were performed in tumors, adjacent normal tissues as well as in lymph nodes with no metastasis nonadherent to tumor tissues using Sanger sequencing after PCR. The same mutation types were found in tumors, adjacent normal tissues as well as lymph nodes, including the only missense mutation N375S encoding semaphorin domain in exon 2 in 4 patients (5.9%), one single-nucleotide polymorphism (SNP) rs35775721: C>T also encoding semaphorin domain as heterozygous in 10 cases (14.7%) and another SNP rs41736: C>T encoding tyrosine kinase domain in exon 20 existing in 49 cases (72.1%). In survival analysis, the wild genotype CC-carriers of rs41736 conferred a significantly shorter progression-free survival (PFS) and overall survival (OS) compared to CT + TT-carriers (HR 0.455, 95% CI 0.229-0.904; HR 0.226, 95% CI 0.099-0.515, for PFS and OS, respectively) in limited-stage SCLC patients. We also found that the lymph node status was significantly associated with OS, and the shorter OS was present in positive group (HR 2.187, 95% CI 1.170-4.088). In this study, rs41736 polymorphism of MET was first found to be associated with prognosis of limited-stage SCLC patients and could be considered as a prognostic marker for limited-stage SCLC.

  17. Single nucleotide polymorphism discovery in TBX1 in individuals with and without 22q11.2 deletion syndrome

    PubMed Central

    Heike, Carrie L.; Starr, Jacqueline R.; Rieder, Mark J.; Cunningham, Michael L.; Edwards, Karen L.; Stanaway, Ian; Crawford, Dana C.


    BACKGROUND Children with 22q11.2 deletion syndrome (22q11.2DS) have a wide range of clinical features. TBX1 has been proposed as a candidate gene for some of the features in this condition. Polymorphisms in the non-deleted TBX1, which may affect the function of the sole TBX1 gene in individuals with the 22q11.2DS, may be a key to understanding the phenotypic variability among individuals with a shared deletion. Comprehensive single nucleotide polymorphism (SNP) discovery by resequencing candidate genes can identify genetic variants that influence a given phenotype. The purpose of this study was to further characterize the sequence variability in TBX1 by identifying all common SNPs in this gene. METHODS We resequenced TBX1 in 29 children with a documented 22q11.2 deletion and 95 non-deleted, healthy individuals. We estimated allele frequencies, performed tagSNP selection, and inferred haplotypes. We also compared SNP frequencies between 22q11.2DS and control samples. RESULTS We identified 355 biallelic markers among the 190 chromosomes resequenced in the control panel. The vast majority of the markers identified were SNPs (n=331), and the remainder indels (n=24). We did not identify SNPs or indels in the cis- regulatory element (FOX–binding site) upstream of TBX1. In children with 22q11.2DS we detected 187 biallelic markers, six of which were indels. Four of the seven coding SNPs identified in the controls were identified in children with 22q11.2DS. CONCLUSIONS This comprehensive SNP discovery data can be used to select SNPs to genotype for future association studies assessing the role of TBX1 and phenotypic variability in individuals with 22q11.2DS. PMID:19645056

  18. [Microchip electrophoresis coupled with multiplex allele-specific am-plification for typing multiple single nucleotide polymorphisms (SNPs) simultaneously].


    Wang, Wei-Peng; Zhou, Guo-Hua


    A new method of DNA adapter ligation-mediated allele-specific amplification (ALM-ASA) was developed for typing multiple single nucleotide polymorphisms (SNPs) on the platform of microchip electrophoresis. Using seven SNPs of 794C>T, 1274C>T, 2143T>C, 2766T>del, 3298G>A, 5200G>A, and 5277C>T in the interleukin 1B (IL1B) gene as a target object, a long DNA fragment containing the seven SNPs of interest was pre-amplified to enhance the specificity. The pre-amplified DNA fragment was digested by a restriction endonuclease to form sticky ends; and then the adapter was ligated to either end of the digested fragment. Using the adapter-ligated fragments as templates, a 7-plex allele-specific amplification was performed by 7 allele-specific primers and a universal primer in one tube. The allele-specific products amplified were separated by chip electrophoresis and the types of SNPs were easily discriminated by the product sizes. The seven SNPs in IL1B gene in 48 healthy Chinese were successfully typed by microchip electrophoresis and the results coincided with those by PCR-restriction fragment length polymorphism and sequencing method. The method established was accurate and can be used to type multiple SNPs simultaneously. In combination with microchip electrophoresis for readout, ALM-ASA assay can be used for fast SNP detection with a small amount of sample. Using self-prepared gel matrix and reused chips for analysis, the SNP can be typed at an ultra low cost.

  19. Identification and genotyping of feline infectious peritonitis-associated single nucleotide polymorphisms in the feline interferon-γ gene

    PubMed Central


    Feline infectious peritonitis (FIP) is an immune-mediated, highly lethal disease caused by feline coronavirus (FCoV) infection. Currently, no protective vaccine or effective treatment for the disease is available. Studies have found that some cats survive the challenge of virulent FCoV isolates. Since cellular immunity is thought to be critical in preventing FIP and because diseased cats often show a significant decrease in interferon-γ (IFN-γ) production, we investigated whether single nucleotide polymorphisms (SNP) in the feline IFN-γ gene (fIFNG) are associated with the outcome of infection. A total of 82 asymptomatic and 63 FIP cats were analyzed, and 16 SNP were identified in intron 1 of fIFNG. Among these SNP, the fFING + 428 T allele was shown to be a FIP-resistant allele (p = 0.03), and the heterozygous genotypes 01C/T and +408C/T were found to be FIP-susceptible factors (p = 0.004). Furthermore, an fIFNG + 428 resistant allele also showed a clear correlation with the plasma level of IFN-γ in FIP cats. For the identification of these three FIP-related SNP, genotyping methods were established using amplification refractory mutation system PCR (ARMS-PCR) and restriction fragment length polymorphisms (RFLP), and the different genotypes could easily be identified without sequencing. The identification of additional FIP-related SNP will allow the selection of resistant cats and decrease the morbidity of the cat population to FIP. PMID:24886103

  20. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.


    Hori, H; Osawa, S; Iwabuchi, M


    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  1. Nucleotide sequences of 5S rRNAs from four jellyfishes.


    Hori, H; Ohama, T; Kumazaki, T; Osawa, S


    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica.

  2. Nucleotide sequences of 5S rRNAs from four jellyfishes.


    Hori, H; Ohama, T; Kumazaki, T; Osawa, S


    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  3. Diverse nucleotide compositions and sequence fluctuation in Rubisco protein genes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Dehipawala, S.; Cheung, E.; Bienaime, R.; Ye, J.; Tremberger, G., Jr.; Schneider, P.; Lieberman, D.; Cheung, T.


    The Rubisco protein-enzyme is arguably the most abundance protein on Earth. The biology dogma of transcription and translation necessitates the study of the Rubisco genes and Rubisco-like genes in various species. Stronger correlation of fractal dimension of the atomic number fluctuation along a DNA sequence with Shannon entropy has been observed in the studied Rubisco-like gene sequences, suggesting a more diverse evolutionary pressure and constraints in the Rubisco sequences. The strategy of using metal for structural stabilization appears to be an ancient mechanism, with data from the porphobilinogen deaminase gene in Capsaspora owczarzaki and Monosiga brevicollis. Using the chi-square distance probability, our analysis supports the conjecture that the more ancient Rubisco-like sequence in Microcystis aeruginosa would have experienced very different evolutionary pressure and bio-chemical constraint as compared to Bordetella bronchiseptica, the two microbes occupying either end of the correlation graph. Our exploratory study would indicate that high fractal dimension Rubisco sequence would support high carbon dioxide rate via the Michaelis- Menten coefficient; with implication for the control of the whooping cough pathogen Bordetella bronchiseptica, a microbe containing a high fractal dimension Rubisco-like sequence (2.07). Using the internal comparison of chi-square distance probability for 16S rRNA (~ E-22) versus radiation repair Rec-A gene (~ E-05) in high GC content Deinococcus radiodurans, our analysis supports the conjecture that high GC content microbes containing Rubisco-like sequence are likely to include an extra-terrestrial origin, relative to Deinococcus radiodurans. Similar photosynthesis process that could utilize host star radiation would not compete with radiation resistant process from the biology dogma perspective in environments such as Mars and exoplanets.

  4. Detection of sequence polymorphisms in red junglefowl and White Leghorn ESTs.


    Fitzsimmons, C J; Savolainen, P; Amini, B; Hjälm, G; Lundeberg, J; Andersson, L


    Over 16,000 high quality expressed sequence tags (ESTs) from red junglefowl (RJ) and White Leghorn (WL) brain and testis cDNA libraries were generated. Here, we have used this resource for detection of single nucleotide polymorphisms (SNPs), and also completed full-length sequencing of 46 pairs of clones, representing the same gene from both the RJ and WL libraries. From the main set of ESTs, which were assembled using Phrap, 746 putative SNPs were identified, of which 76% were transitions and 24% were transversions. A subset of SNPs was evaluated by sequence analysis of five RJ and five WL birds. Nine of 12 SNPs were verified in this limited sample, suggesting that a majority of the putative polymorphisms documented in this study represent real SNPs. During full-length sequencing of the 46 RJ/WL clones 100 SNPs were identified, which translated to a frequency of 1.90 SNPs/1000 bp. The number of transitions and transversions were 77% and 23%, respectively, and the proportion of non-synonymous vs. synonymous SNPs was 20% and 80%, respectively. Four large insertions/deletions were identified between the RJ and WL full-length sequences, and they appear to represent different splice variants. PMID:15373743

  5. Typing Candida Species Using Microsatellite Length Polymorphism and Multilocus Sequence Typing.


    Garcia-Hermoso, Dea; Desnos-Ollivier, Marie; Bretagne, Stéphane


    To gain more insight into the epidemiological relationships between isolates of Candida spp. obtained from various origins, several molecular typing techniques have been developed. Two methods have emerged in the 2000s as soon as enough knowledge of the Candida spp. genomes was available to choose adequate loci and primers, namely microsatellite length polymorphism (MLP) and multilocus sequence typing (MLST). To contrast with previous PCR-based methods, specific amplifications with stringent conditions easily reproducible are the basis of MLP and MLST. MLST relies on Sanger sequencing to detect single-nucleotide polymorphisms within housekeeping genes. MLP needs a first in silico step to select tandemly repeated stretches of two to five nucleotides. One of the two primers used to amplify a microsatellite locus is labeled and fragment sizing is automatically performed using high-resolution electrophoresis platforms. MLST provides results easily comparable between laboratories and active MLST schemes are publicly available for the main Candida species. For comparative studies, MLP needs standards to compensate for the electrophoretic variations depending on the platforms used. Both methods can help us gain insight into the genetic relatedness of fungal isolates, both with advantages and drawbacks, and the choice of one method rather than the other depends on the task in question.

  6. Single nucleotide polymorphisms of cathepsin S and the risks of asthma attack induced by acaroid mites

    PubMed Central

    Li, Chaopin; Chen, Qi; Jiang, Yuxin; Liu, Zhiming


    To investigate association between the three single nucleotide polymorphisms (SNPs, rs146456111, rs143154304 and rs147260142) in cathepsin S (Cat S) and the risks of allergic asthma attack induced by the acaroid mites in the Chinese population. A case-control study was performed in 412 cases and 454 volunteers/controls to evaluate the effects of three SNPs in Cat S on the risks of asthma attack. The genotypes were determined using polymerase chain reaction (PCR) and cleaved amplification polymorphism sequence-tagged sites (PCR-RFLP). The frequencies of genotypes and alleles in these SNPs in the asthmatic group were also analyzed between the two groups. The locus of rs146456111 in Cat S gene, the allele frequency of A and C in asthmatic group were significantly different from the control group (χ2 = 184.425, P = 0.000), and the difference was significant regarding the distribution of the genotypes (AA, AC, and CC) between asthmatic subjects and normal controls (χ2 = 177.915, P = 0.000). Logistic regression analysis revealed that the AC, CC, and AC + CC genotypes were significantly increased with the risk of asthma (AC vs. AA, OR = 4.013, 95% CI = 2.989-4.751, P = 0.000; CC vs. AA, OR = 3.167, 95% CI = 2.483-3.785, P = 0.000; AC + CC vs. AA, OR = 3.418, 95% CI = 2.381-4.214, P = 0.000, respectively), compared with AA genotype. Moreover, by comparison with allele A, allele C (OR = 2.187, 95% CI = 1.743-2.281, P < 0.001) tended to increase the risk of asthma; For the locus of rs143154304, compared with the allele frequency G with A in control group, there was no difference (χ2 = 1.434, P = 0.231) in that of asthmatic group, as well as the distributions of the genotypes (AA, AG, and GG) between asthmatic subjects and normal controls (χ2 = 1.997, P = 0.369); Logistic regression analysis showed that the AG, GG, and AG + GG genotypes were no risk to asthma (AG vs. AA, OR = 0.991, 95% CI = 0.625-1.507, P = 0.968; GG vs. AA, OR = 0.812, 95% CI = 0.525-1.258, P = 0

  7. Single nucleotide polymorphisms of cathepsin S and the risks of asthma attack induced by acaroid mites.


    Li, Chaopin; Chen, Qi; Jiang, Yuxin; Liu, Zhiming


    To investigate association between the three single nucleotide polymorphisms (SNPs, rs146456111, rs143154304 and rs147260142) in cathepsin S (Cat S) and the risks of allergic asthma attack induced by the acaroid mites in the Chinese population. A case-control study was performed in 412 cases and 454 volunteers/controls to evaluate the effects of three SNPs in Cat S on the risks of asthma attack. The genotypes were determined using polymerase chain reaction (PCR) and cleaved amplification polymorphism sequence-tagged sites (PCR-RFLP). The frequencies of genotypes and alleles in these SNPs in the asthmatic group were also analyzed between the two groups. The locus of rs146456111 in Cat S gene, the allele frequency of A and C in asthmatic group were significantly different from the control group (χ(2) = 184.425, P = 0.000), and the difference was significant regarding the distribution of the genotypes (AA, AC, and CC) between asthmatic subjects and normal controls (χ(2) = 177.915, P = 0.000). Logistic regression analysis revealed that the AC, CC, and AC + CC genotypes were significantly increased with the risk of asthma (AC vs. AA, OR = 4.013, 95% CI = 2.989-4.751, P = 0.000; CC vs. AA, OR = 3.167, 95% CI = 2.483-3.785, P = 0.000; AC + CC vs. AA, OR = 3.418, 95% CI = 2.381-4.214, P = 0.000, respectively), compared with AA genotype. Moreover, by comparison with allele A, allele C (OR = 2.187, 95% CI = 1.743-2.281, P < 0.001) tended to increase the risk of asthma; For the locus of rs143154304, compared with the allele frequency G with A in control group, there was no difference (χ(2) = 1.434, P = 0.231) in that of asthmatic group, as well as the distributions of the genotypes (AA, AG, and GG) between asthmatic subjects and normal controls (χ(2) = 1.997, P = 0.369); Logistic regression analysis showed that the AG, GG, and AG + GG genotypes were no risk to asthma (AG vs. AA, OR = 0.991, 95% CI = 0.625-1.507, P = 0.968; GG vs. AA, OR = 0.812, 95% CI = 0.525-1.258, P

  8. Comparative Analysis of Disease-Linked Single Nucleotide Polymorphic Markers from Brassica rapa for Their Applicability to Brassica oleracea

    PubMed Central

    Cho, Young-Il; Ahn, Yul-Kyun; Tripathi, Swati; Kim, Jeong-Ho; Lee, Hye-Eun; Kim, Do-Sun


    Numerous studies using single nucleotide polymorphisms (SNPs) have been conducted in humans, and other animals, and in major crops, including rice, soybean, and Chinese cabbage. However, the number of SNP studies in cabbage is limited. In this present study, we evaluated whether 7,645 SNPs previously identified as molecular markers linked to disease resistance in the Brassica rapa genome could be applied to B. oleracea. In a BLAST analysis using the SNP sequences of B. rapa and B. oleracea genomic sequence data registered in the NCBI database, 256 genes for which SNPs had been identified in B. rapa were found in B. oleracea. These genes were classified into three functional groups: molecular function (64 genes), biological process (96 genes), and cellular component (96 genes). A total of 693 SNP markers, including 145 SNP markers [BRH—developed from the B. rapa genome for high-resolution melt (HRM) analysis], 425 SNP markers (BRP—based on the B. rapa genome that could be applied to B. oleracea), and 123 new SNP markers (BRS—derived from BRP and designed for HRM analysis), were investigated for their ability to amplify sequences from cabbage genomic DNA. In total, 425 of the SNP markers (BRP-based on B. rapa genome), selected from 7,645 SNPs, were successfully applied to B. oleracea. Using PCR, 108 of 145 BRH (74.5%), 415 of 425 BRP (97.6%), and 118 of 123 BRS (95.9%) showed amplification, suggesting that it is possible to apply SNP markers developed based on the B. rapa genome to B. oleracea. These results provide valuable information that can be utilized in cabbage genetics and breeding programs using molecular markers derived from other Brassica species. PMID:25790283

  9. Comparative analysis of disease-linked single nucleotide polymorphic markers from Brassica rapa for their applicability to Brassica oleracea.


    Cho, Young-Il; Ahn, Yul-Kyun; Tripathi, Swati; Kim, Jeong-Ho; Lee, Hye-Eun; Kim, Do-Sun


    Numerous studies using single nucleotide polymorphisms (SNPs) have been conducted in humans, and other animals, and in major crops, including rice, soybean, and Chinese cabbage. However, the number of SNP studies in cabbage is limited. In this present study, we evaluated whether 7,645 SNPs previously identified as molecular markers linked to disease resistance in the Brassica rapa genome could be applied to B. oleracea. In a BLAST analysis using the SNP sequences of B. rapa and B. oleracea genomic sequence data registered in the NCBI database, 256 genes for which SNPs had been identified in B. rapa were found in B. oleracea. These genes were classified into three functional groups: molecular function (64 genes), biological process (96 genes), and cellular component (96 genes). A total of 693 SNP markers, including 145 SNP markers [BRH--developed from the B. rapa genome for high-resolution melt (HRM) analysis], 425 SNP markers (BRP--based on the B. rapa genome that could be applied to B. oleracea), and 123 new SNP markers (BRS--derived from BRP and designed for HRM analysis), were investigated for their ability to amplify sequences from cabbage genomic DNA. In total, 425 of the SNP markers (BRP-based on B. rapa genome), selected from 7,645 SNPs, were successfully applied to B. oleracea. Using PCR, 108 of 145 BRH (74.5%), 415 of 425 BRP (97.6%), and 118 of 123 BRS (95.9%) showed amplification, suggesting that it is possible to apply SNP markers developed based on the B. rapa genome to B. oleracea. These results provide valuable information that can be utilized in cabbage genetics and breeding programs using molecular markers derived from other Brassica species.

  10. Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

    PubMed Central

    Wang, Shichen; Wong, Debbie; Forrest, Kerrie; Allen, Alexandra; Chao, Shiaoman; Huang, Bevan E; Maccaferri, Marco; Salvi, Silvio; Milner, Sara G; Cattivelli, Luigi; Mastrangelo, Anna M; Whan, Alex; Stephen, Stuart; Barker, Gary; Wieseke, Ralf; Plieske, Joerg; International Wheat Genome Sequencing Consortium; Lillemo, Morten; Mather, Diane; Appels, Rudi; Dolferus, Rudy; Brown-Guedira, Gina; Korol, Abraham; Akhunova, Alina R; Feuillet, Catherine; Salse, Jerome; Morgante, Michele; Pozniak, Curtis; Luo, Ming-Cheng; Dvorak, Jan; Morell, Matthew; Dubcovsky, Jorge; Ganal, Martin; Tuberosa, Roberto; Lawley, Cindy; Mikoulitch, Ivan; Cavanagh, Colin; Edwards, Keith J; Hayden, Matthew; Akhunov, Eduard


    High-density single nucleotide polymorphism (SNP) genotyping arrays are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships between individuals in populations and studying marker–trait associations in mapping experiments. We developed a genotyping array including about 90 000 gene-associated SNPs and used it to characterize genetic variation in allohexaploid and allotetraploid wheat populations. The array includes a significant fraction of common genome-wide distributed SNPs that are represented in populations of diverse geographical origin. We used density-based spatial clustering algorithms to enable high-throughput genotype calling in complex data sets obtained for polyploid wheat. We show that these model-free clustering algorithms provide accurate genotype calling in the presence of multiple clusters including clusters with low signal intensity resulting from significant sequence divergence at the target SNP site or gene deletions. Assays that detect low-intensity clusters can provide insight into the distribution of presence–absence variation (PAV) in wheat populations. A total of 46 977 SNPs from the wheat 90K array were genetically mapped using a combination of eight mapping populations. The developed array and cluster identification algorithms provide an opportunity to infer detailed haplotype structure in polyploid wheat and will serve as an invaluable resource for diversity studies and investigating the genetic basis of trait variation in wheat. PMID:24646323

  11. Identification of single nucleotide polymorphism markers associated with bacterial cold water disease resistance and spleen size in rainbow trout.


    Liu, Sixin; Vallejo, Roger L; Palti, Yniv; Gao, Guangtu; Marancik, David P; Hernandez, Alvaro G; Wiens, Gregory D


    Bacterial cold water disease (BCWD) is one of the frequent causes of elevated mortality in salmonid aquaculture. Previously, we identified and validated microsatellites on chromosome Omy19 associated with QTL (quantitative trait loci) for BCWD resistance and spleen size in rainbow trout. Recently, SNPs (single nucleotide polymorphism) have become the markers of choice for genetic analyses in rainbow trout as they are highly abundant, cost-effective and are amenable for high throughput genotyping. The objective of this study was to identify SNP markers associated with BCWD resistance and spleen size using both genome-wide association studies (GWAS) and linkage-based QTL mapping approaches. A total of 298 offspring from the two half-sib families used in our previous study to validate the significant BCWD QTL on chromosome Omy19 were genotyped with RAD-seq (restriction-site-associated DNA sequencing), and 7,849 informative SNPs were identified. Based on GWAS, 18 SNPs associated with BCWD resistance and 20 SNPs associated with spleen size were identified. Linkage-based QTL mapping revealed three significant QTL for BCWD resistance. In addition to the previously validated dam-derived QTL on chromosome Omy19, two significant BCWD QTL derived from the sires were identified on chromosomes Omy8 and Omy25, respectively. A sire-derived significant QTL for spleen size on chromosome Omy2 was detected. The SNP markers reported in this study will facilitate fine mapping to identify positional candidate genes for BCWD resistance in rainbow trout. PMID:26442114

  12. Identification of single nucleotide polymorphism markers associated with bacterial cold water disease resistance and spleen size in rainbow trout

    PubMed Central

    Liu, Sixin; Vallejo, Roger L.; Palti, Yniv; Gao, Guangtu; Marancik, David P.; Hernandez, Alvaro G.; Wiens, Gregory D.


    Bacterial cold water disease (BCWD) is one of the frequent causes of elevated mortality in salmonid aquaculture. Previously, we identified and validated microsatellites on chromosome Omy19 associated with QTL (quantitative trait loci) for BCWD resistance and spleen size in rainbow trout. Recently, SNPs (single nucleotide polymorphism) have become the markers of choice for genetic analyses in rainbow trout as they are highly abundant, cost-effective and are amenable for high throughput genotyping. The objective of this study was to identify SNP markers associated with BCWD resistance and spleen size using both genome-wide association studies (GWAS) and linkage-based QTL mapping approaches. A total of 298 offspring from the two half-sib families used in our previous study to validate the significant BCWD QTL on chromosome Omy19 were genotyped with RAD-seq (restriction-site-associated DNA sequencing), and 7,849 informative SNPs were identified. Based on GWAS, 18 SNPs associated with BCWD resistance and 20 SNPs associated with spleen size were identified. Linkage-based QTL mapping revealed three significant QTL for BCWD resistance. In addition to the previously validated dam-derived QTL on chromosome Omy19, two significant BCWD QTL derived from the sires were identified on chromosomes Omy8 and Omy25, respectively. A sire-derived significant QTL for spleen size on chromosome Omy2 was detected. The SNP markers reported in this study will facilitate fine mapping to identify positional candidate genes for BCWD resistance in rainbow trout. PMID:26442114

  13. Identification of unbalanced genome copy number abnormalities in patients with multiple myeloma by single-nucleotide polymorphism genotyping microarray analysis.


    Kamada, Yuhei; Sakata-Yanagimoto, Mamiko; Sanada, Masashi; Sato-Otsubo, Aiko; Enami, Terukazu; Suzukawa, Kazumi; Kurita, Naoki; Nishikii, Hidekazu; Yokoyama, Yasuhisa; Okoshi, Yasushi; Hasegawa, Yuichi; Ogawa, Seishi; Chiba, Shigeru


    Single-nucleotide polymorphism genotyping microarray (SNP array) analysis provides detailed information on chromosomal copy number aberrations. To obtain detailed information on genomic abnormalities related to pathogenesis or prognosis of multiple myeloma (MM), we performed 250K SNP array analysis in 39 MM patients and 11 cell lines. We identified an accumulation of deletions and uniparental disomies at 22q12.1. Among the hyperdiploid MM cases, chromosomal imbalance at this locus was associated with poor prognosis. On sequencing, we also found a mutation in the seizure-related 6 homolog (mouse)-like (SEZ6L) gene located at ch.22q12.1 in an MM cell line, NOP1. We further found isolated deletions in 17 genes, five of which are known tumor suppressor genes. Of these, deletion of protein tyrosine phosphatase, receptor type D (PTPRD) was found in three samples, including two patients. Consistent with previous reports, non-hyperdiploid MM, deletion of 13q (del13q) and gain of 1q in non-hyperdiploid MMs were predictive of poor prognosis (p = 0.039, p = 0.049, and p = 0.013, respectively). However, our analysis revealed that unless accompanied by gain of 1q, the prognosis of non-hyperdiploid MM was as good as that of hyperdiploid MM. Thus, SNP array analysis provides significant information useful to understanding the pathogenesis and prognosis of MM.

  14. Protein variation in Adh and Adh-related in Drosophila pseudoobscura. Linkage disequilibrium between single nucleotide polymorphisms and protein alleles.

    PubMed Central

    Schaeffer, S W; Walthour, C S; Toleno, D M; Olek, A T; Miller, E L


    A 3.5-kb segment of the alcohol dehydrogenase (Adh) region that includes the Adh and Adh-related genes was sequenced in 139 Drosophila pseudoobscura strains collected from 13 populations. The Adh gene encodes four protein alleles and rejects a neutral model of protein evolution with the McDonald-Kreitman test, although the number of segregating synonymous sites is too high to conclude that adaptive selection has operated. The Adh-related gene encodes 18 protein haplotypes and fails to reject an equilibrium neutral model. The populations fail to show significant geographic differentiation of the Adh-related haplotypes. Eight of 404 single nucleotide polymorphisms (SNPs) in the Adh region were in significant linkage disequilibrium with three ADHR protein alleles. Coalescent simulations with and without recombination were used to derive the expected levels of significant linkage disequilibrium between SNPs and 18 protein haplotypes. Maximum levels of linkage disequilibrium are expected for protein alleles at moderate frequencies. In coalescent models without recombination, linkage disequilibrium decays between SNPs and high frequency haplotypes because common alleles mutate to haplotypes that are rare or that reach moderate frequency. The implication of this study is that linkage disequilibrium mapping has the highest probability of success with disease-causing alleles at frequencies of 10%. PMID:11606543

  15. Single-nucleotide polymorphism PCR for the detection of Mycoplasma pneumoniae and determination of macrolide resistance in respiratory samples.


    Ji, Misuk; Lee, Nam-Sihk; Oh, Ji-Min; Jo, Ji Yoon; Choi, Eun Hwa; Yoo, Soo Jin; Kim, Hyo-Bin; Hwang, Sang-Hyun; Choi, Sang-Ho; Lee, Sang-Oh; Kim, Mi-Na; Sung, Heungsup


    The aim of this study was to develop a single-nucleotide polymorphism (SNP) PCR assay to be performed directly on respiratory samples for the simultaneous detection of Mycoplasma pneumoniae and its 23S rRNA gene mutations, which are responsible for macrolide resistance. For multiplex SNP PCR, two outer primers for amplification of the 23S rRNA gene and two mutant-specific primers for the discrimination of single base changes were designed. A total of 73M. pneumoniae-positive samples and 100M. pneumoniae-negative samples were analyzed using this assay. By SNP PCR, we detected two mutations conferring high-level macrolide resistance in 22 samples (A2063G from 20 and A2064G from 2 samples); these results are identical to those produced by the 23S rRNA gene sequencing of M. pneumoniae-positive samples. Thus, this assay can be used as a practical method for the simultaneous detection of M. pneumoniae and mutations associated with macrolide resistance directly from respiratory samples. PMID:24780151

  16. TP53 and MDM2 single nucleotide polymorphisms influence survival in non-del(5q) myelodysplastic syndromes

    PubMed Central

    Sallman, David A.; Basiorka, Ashley A.; Irvine, Brittany A.; Zhang, Ling; Epling-Burnette, P.K.; Rollison, Dana E.; Mallo, Mar; Sokol, Lubomir; Solé, Francesc; Maciejewski, Jaroslaw; List, Alan F.


    P53 is a key regulator of many cellular processes and is negatively regulated by the human homolog of murine double minute-2 (MDM2) E3 ubiquitin ligase. Single nucleotide polymorphisms (SNPs) of either gene alone, and in combination, are linked to cancer susceptibility, disease progression, and therapy response. We analyzed the interaction of TP53 R72P and MDM2 SNP309 SNPs in relationship to outcome in patients with myelodysplastic syndromes (MDS). Sanger sequencing was performed on DNA isolated from 208 MDS cases. Utilizing a novel functional SNP scoring system ranging from +2 to −2 based on predicted p53 activity, we found statistically significant differences in overall survival (OS) (p = 0.02) and progression-free survival (PFS) (p = 0.02) in non-del(5q) MDS patients with low functional scores. In univariate analysis, only IPSS and the functional SNP score predicted OS and PFS in non-del(5q) patients. In multivariate analysis, the functional SNP score was independent of IPSS for OS and PFS. These data underscore the importance of TP53 R72P and MDM2 SNP309 SNPs in MDS, and provide a novel scoring system independent of IPSS that is predictive for disease outcome. PMID:26416416

  17. Genomewide single nucleotide polymorphism discovery in Atlantic salmon (Salmo salar): validation in wild and farmed American and European populations.


    Yáñez, J M; Naswa, S; López, M E; Bassini, L; Correa, K; Gilbey, J; Bernatchez, L; Norris, A; Neira, R; Lhorente, J P; Schnable, P S; Newman, S; Mileham, A; Deeb, N; Di Genova, A; Maass, A


    A considerable number of single nucleotide polymorphisms (SNPs) are required to elucidate genotype-phenotype associations and determine the molecular basis of important traits. In this work, we carried out de novo SNP discovery accounting for both genome duplication and genetic variation from American and European salmon populations. A total of 9 736 473 nonredundant SNPs were identified across a set of 20 fish by whole-genome sequencing. After applying six bioinformatic filtering steps, 200 K SNPs were selected to develop an Affymetrix Axiom(®) myDesign Custom Array. This array was used to genotype 480 fish representing wild and farmed salmon from Europe, North America and Chile. A total of 159 099 (79.6%) SNPs were validated as high quality based on clustering properties. A total of 151 509 validated SNPs showed a unique position in the genome. When comparing these SNPs against 238 572 markers currently available in two other Atlantic salmon arrays, only 4.6% of the SNP overlapped with the panel developed in this study. This novel high-density SNP panel will be very useful for the dissection of economically and ecologically relevant traits, enhancing breeding programmes through genomic selection as well as supporting genetic studies in both wild and farmed populations of Atlantic salmon using high-resolution genomewide information. PMID:26849107

  18. A common IL-13 Arg130Gln single nucleotide polymorphism among Chinese atopy patients with allergic rhinitis.


    Wang, Min; Xing, Zhi-Min; Lu, Chao; Ma, You-Xiang; Yu, De-Lin; Yan, Zheng; Wang, Shen-Wu; Yu, Li-Sheng


    Allergic rhinitis is a major public health problem and has seen its prevalence increase during the past few decades. Interleukin 13 (IL-13) has been implicated in the pathogenesis and in the regulation of immunoglobulin E (IgE) production. Single nucleotide polymorphisms (SNPs) have been found in both the coding sequence and the promoter region of IL-13, and such SNPs have been associated with allergic asthma. We have investigated whether IL-13 SNPs are associated with allergic rhinitis. Among 188 Chinese adult patients with allergic rhinitis and 87 normal controls, no significant difference was found in either allele or haplotype frequency of the SNPs between the two groups. Within patients, there was a significant association of the IL-13 Arg130Gln SNP, but not of the IL-13 promoter -1112(C/T) SNP, with serum total IgE levels. Patients with a Gln/Gln genotype showed much higher serum total IgE than those with an Arg/Arg genotype. When tested for serum-specific IgE, patients allergic to Derp 1, but not those allergic to Artemisia pollen, showed a significant association with the IL-13 promoter SNP. Thus, our results suggest a possible involvement of IL-13 SNPs in the regulation of IgE production in response to allergens in this Chinese population. PMID:12928861

  19. TP53 and MDM2 single nucleotide polymorphisms influence survival in non-del(5q) myelodysplastic syndromes.


    McGraw, Kathy L; Cluzeau, Thomas; Sallman, David A; Basiorka, Ashley A; Irvine, Brittany A; Zhang, Ling; Epling-Burnette, P K; Rollison, Dana E; Mallo, Mar; Sokol, Lubomir; Solé, Francesc; Maciejewski, Jaroslaw; List, Alan F


    P53 is a key regulator of many cellular processes and is negatively regulated by the human homolog of murine double minute-2 (MDM2) E3 ubiquitin ligase. Single nucleotide polymorphisms (SNPs) of either gene alone, and in combination, are linked to cancer susceptibility, disease progression, and therapy response. We analyzed the interaction of TP53 R72P and MDM2 SNP309 SNPs in relationship to outcome in patients with myelodysplastic syndromes (MDS). Sanger sequencing was performed on DNA isolated from 208 MDS cases. Utilizing a novel functional SNP scoring system ranging from +2 to -2 based on predicted p53 activity, we found statistically significant differences in overall survival (OS) (p = 0.02) and progression-free survival (PFS) (p = 0.02) in non-del(5q) MDS patients with low functional scores. In univariate analysis, only IPSS and the functional SNP score predicted OS and PFS in non-del(5q) patients. In multivariate analysis, the functional SNP score was independent of IPSS for OS and PFS. These data underscore the importance of TP53 R72P and MDM2 SNP309 SNPs in MDS, and provide a novel scoring system independent of IPSS that is predictive for disease outcome. PMID:26416416

  20. TranslatorX: multiple alignment of nucleotide sequences guided by amino acid translations.


    Abascal, Federico; Zardoya, Rafael; Telford, Maximilian J


    We present TranslatorX, a web server designed to align protein-coding nucleotide sequences based on their corresponding amino acid translations. Many comparisons between biological sequences (nucleic acids and proteins) involve the construction of multiple alignments. Alignments represent a statement regarding the homology between individual nucleotides or amino acids within homologous genes. As protein-coding DNA sequences evolve as triplets of nucleotides (codons) and it is known that sequence similarity degrades more rapidly at the DNA than at the amino acid level, alignments are generally more accurate when based on amino acids than on their corresponding nucleotides. TranslatorX novelties include: (i) use of all documented genetic codes and the possibility of assigning different genetic codes for each sequence; (ii) a battery of different multiple alignment programs; (iii) translation of ambiguous codons when possible; (iv) an innovative criterion to clean nucleotide alignments with GBlocks based on protein information; and (v) a rich output, including Jalview-powered graphical visualization of the alignments, codon-based alignments coloured according to the corresponding amino acids, measures of compositional bias and first, second and third codon position specific alignments. The TranslatorX server is freely available at

  1. Methods for making nucleotide probes for sequencing and synthesis

    SciTech Connect

    Church, George M; Zhang, Kun; Chou, Joseph


    Compositions and methods for making a plurality of probes for analyzing a plurality of nucleic acid samples are provided. Compositions and methods for analyzing a plurality of nucleic acid samples to obtain sequence information in each nucleic acid sample are also provided.

  2. The nucleotide sequence of Saccharomyces cerevisiae chromosome XII.


    Johnston, M; Hillier, L; Riles, L; Albermann, K; André, B; Ansorge, W; Benes, V; Brückner, M; Delius, H; Dubois, E; Düsterhöft, A; Entian, K D; Floeth, M; Goffeau, A; Hebling, U; Heumann, K; Heuss-Neitzel, D; Hilbert, H; Hilger, F; Kleine, K; Kötter, P; Louis, E J; Messenguy, F; Mewes, H W; Hoheisel, J D


    The yeast Saccharomyces cerevisiae is the pre-eminent organism for the study of basic functions of eukaryotic cells. All of the genes of this simple eukaryotic cell have recently been revealed by an international collaborative effort to determine the complete DNA sequence of its nuclear genome. Here we describe some of the features of chromosome XII.

  3. Finding similar nucleotide sequences using network BLAST searches.


    Ladunga, Istvan


    The Basic Local Alignment Search Tool (BLAST) is a keystone of bioinformatics due to its performance and user-friendliness. Beginner and intermediate users will learn how to design and submit blastn and Megablast searches on the Web pages at the National Center for Biotechnology Information. We map nucleic acid sequences to genomes, find identical or similar mRNA, expressed sequence tag, and noncoding RNA sequences, and run Megablast searches, which are much faster than blastn. Understanding results is assisted by taxonomy reports, genomic views, and multiple alignments. We interpret expected frequency thresholds, biological significance, and statistical significance. Weak hits provide no evidence, but hints for further analyses. We find genes that may code for homologous proteins by translated BLAST. We reduce false positives by filtering out low-complexity regions. Parsed BLAST results can be integrated into analysis pipelines. Links in the output connect to Entrez, PUBMED, structural, sequence, interaction, and expression databases. This facilitates integration with a wide spectrum of biological knowledge. PMID:19496060

  4. Nucleotide sequence of a human tRNA gene heterocluster

    SciTech Connect

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.


    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both (3'-/sup 32/P)-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these ..gamma..-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues.

  5. Nucleotide sequence conservation in paramyxoviruses; the concept of codon constellation.


    Rima, Bert K


    The stability and conservation of the sequences of RNA viruses in the field and the high error rates measured in vitro are paradoxical. The field stability indicates that there are very strong selective constraints on sequence diversity. The nature of these constraints is discussed. Apart from constraints on variation in cis-acting RNA and the amino acid sequences of viral proteins, there are other ones relating to the presence of specific dinucleotides such CpG and UpA as well as the importance of RNA secondary structures and RNA degradation rates. Recent other constraints identified in other RNA viruses, such as effects of secondary RNA structure on protein folding or modification of cellular tRNA complements, are also discussed. Using the family Paramyxoviridae, I show that the codon usage pattern (CUP) is (i) specific for each virus species and (ii) that it is markedly different from the host - it does not vary even in vaccine viruses that have been derived by passage in a number of inappropriate host cells. The CUP might thus be an additional constraint on variation, and I propose the concept of codon constellation to indicate the informational content of the sequences of RNA molecules relating not only to stability and structure but also to the efficiency of translation of a viral mRNA resulting from the CUP and the numbers and position of rare codons.

  6. Water buffalo (Bubalus bubalis): complete nucleotide mitochondrial genome sequence.


    Parma, Pietro; Erra-Pujada, Marta; Feligini, Maria; Greppi, Gianfranco; Enne, Giuseppe


    In this work, we report the whole sequence of the water buffalo (Bubalus bubalis) mitochondrial genome. The water buffalo mt molecule is 16.355 base pair length and shows a genome organization similar to those reported for other mitochondrial genome. These new data provide an useful tool for many research area, i.e. evolutionary study and identification of food origin.

  7. Nucleotide sequence of the tobacco (Nicotiana tabacum) anionic peroxidase gene

    SciTech Connect

    Diaz-De-Leon, F.; Klotz, K.L.; Lagrimini, L.M. )


    Peroxidases have been implicated in numerous physiological processes including lignification (Grisebach, 1981), wound-healing (Espelie et al., 1986), phenol oxidation (Lagrimini, 1991), pathogen defense (Ye et al., 1990), and the regulation of cell elongation through the formation of interchain covalent bonds between various cell wall polymers (Fry, 1986; Goldberg et al., 1986; Bradley et al., 1992). However, a complete description of peroxidase action in vivo is not available because of the vast number of potential substrates and the existence of multiple isoenzymes. The tobacco anionic peroxidase is one of the better-characterized isoenzymes. This enzyme has been shown to oxidize a number of significant plant secondary compounds in vitro including cinnamyl alcohols, phenolic acids, and indole-3-acetic acid (Maeder, 1980; Lagrimini, 1991). A cDNA encoding the enzyme has been obtained, and this enzyme was shown to be expressed at the highest levels in lignifying tissues (xylem and tracheary elements) and also in epidermal tissue (Lagrimini et al., 1987). It was shown at this time that there were four distinct copies of the anionic peroxidase gene in tobacco (Nicotiana tabacum). A tobacco genomic DNA library was constructed in the [lambda]-phase EMBL3, from which two unique peroxidase genes were sequenced. One of these clones, [lambda]POD1, was designated as a pseudogene when the exonic sequences were found to differ from the cDNA sequences by 1%, and several frame shifts in the coding sequences indicated a dysfunctional gene (the authors' unpublished results). The other clone, [lambda]POD3, described in this manuscript, was designated as the functional tobacco anionic peroxidase gene because of 100% homology with the cDNA. Significant structural elements include an AS-2 box indicated in shoot-specific expression (Lam and Chua, 1989), a TATA box, and two intervening sequences. 10 refs., 1 tab.

  8. Translational Medicine and Reliability of Single-Nucleotide Polymorphism Studies: Can We Believe in SNP Reports or Not?

    PubMed Central

    Valachis, Antonis; Mauri, Davide; Neophytou, Christodoulos; Polyzos, Nikolaos P.; Tsali, Lampriani; Garras, Antonios; Papanikolau, Evangelos G.


    Background: The number of genetic association studies is increasing exponentially. Nonetheless, genetic association reports are prone to potential biases which may influence the reported outcome. Aim: We hypothesized that positive outcome for a determined polymorphism might be over-reported across genetic association studies analysing a small number of polymorphisms, when compared to studies analysing the same polymorphism together with a high number of other polymorphisms. Methods: We systematically reviewed published reports on the association of glutathione s-transferase (GST) single-nucleotide polymorphisms (SNPs) and cancer outcome. Result: We identified 79 eligible trials. Most of the studies examined the GSTM1, theGSTP1 Ile105Val mutation, and GSTT1polymorphisms (n = 54, 57 and 46, respectively). Studies analysing one to three polymorphisms (n = 39) were significantly more likely to present positive outcomes, compared to studies examining more than 3 polymorphisms (n=40) p = 0.004; this was particularly evident for studies analysing the GSTM1polymorphism (p =0.001). We found no significant associations between journal impact factor, number of citations, and probability of publishing positive studies or studies with 1-3 polymorphisms examined. Conclusions: We propose a new subtype of publication bias in genetic association studies. Positive results for genetic association studies analysing a small number of polymorphisms (n = 1-3) should be evaluated extremely cautiously, because a very large number of such studies are inconclusive and statistically under-powered. Indeed, publication of misleading reports may affect harmfully medical decision-making and use of resources, both in clinical and pharmacological development setting. PMID:21897762

  9. Kelvin probe force microscopy of DNA-capped nanoparticles for single-nucleotide polymorphism detection

    NASA Astrophysics Data System (ADS)

    Lee, Hyungbeen; Lee, Sang Won; Lee, Gyudo; Lee, Wonseok; Lee, Jeong Hoon; Hwang, Kyo Seon; Yang, Jaemoon; Lee, Sang Woo; Yoon, Dae Sung


    Kelvin probe force microscopy (KPFM) is a robust toolkit for profiling the surface potential (SP) of biomolecular interactions between DNAs and/or proteins at the single molecule level. However, it has often suffered from background noise and low throughput due to instrumental or environmental constraints, which is regarded as limiting KPFM applications for detection of minute changes in the molecular structures such as single-nucleotide polymorphism (SNP). Here, we show KPFM imaging of DNA-capped nanoparticles (DCNP) that enables SNP detection of the BRCA1 gene owing to sterically well-adjusted DNA-DNA interactions that take place within the confined spaces of DCNP. The average SP values of DCNP interacting with BRCA1 SNP were found to be lower than the DCNP reacting with normal (non-mutant) BRCA1 gene. We also demonstrate that SP characteristics of DCNP with different substrates (e.g., Au, Si, SiO2, and Fe) provide us with a chance to attenuate or augment the SP signal of DCNP without additional enhancement of instrumentation capabilities.Kelvin probe force microscopy (KPFM) is a robust toolkit for profiling the surface potential (SP) of biomolecular interactions between DNAs and/or proteins at the single molecule level. However, it has often suffered from background noise and low throughput due to instrumental or environmental constraints, which is regarded as limiting KPFM applications for detection of minute changes in the molecular structures such as single-nucleotide polymorphism (SNP). Here, we show KPFM imaging of DNA-capped nanoparticles (DCNP) that enables SNP detection of the BRCA1 gene owing to sterically well-adjusted DNA-DNA interactions that take place within the confined spaces of DCNP. The average SP values of DCNP interacting with BRCA1 SNP were found to be lower than the DCNP reacting with normal (non-mutant) BRCA1 gene. We also demonstrate that SP characteristics of DCNP with different substrates (e.g., Au, Si, SiO2, and Fe) provide us with a

  10. Analysis of sequence polymorphism and population structure of tomato chlorotic dwarf viroid and potato spindle tuber viroid in viroid-infected tomato plants.


    Nie, Xianzhou


    The sequence polymorphism and population structure of Tomato chlorotic dwarf viroid (TCDVd) (isolate Trust) and Potato tuber spindle viroid (PSTVd) (isolate FN) in tomato plants were investigated. Of the 9 and 35 TCDVd clones sequenced from 2 different TCDVd-infected plants, 2 and 4 sequence variants were identified, respectively, leading to a total of 4 sequence variants of 360 nucleotides in length. Variant I was identical to AF162131, the first TCDVd sequence to be reported, and the rest exhibited 1 to 3 nucleotide differences, all in the T(R) domain, from AF162131/variant I. Of the 33 and 29 PSTVd clones sequenced from 2 different PSTVd-infected plants, 8 and 9 sequence variants were found, respectively, leading to a total of 15 variants ranging in length from 356 to 359 nucleotides. The variant I was identical to EF044303, a PSTVd reported in Russia. The rest exhibited 1 to 11 nucleotide differences scattering in all five domains from EF044303/variant I. The results demonstrated for the first time that TCDVd, like many other viroids including PSTVd, exists in host plants as a collective group comprised of various sequence variants. However, in comparison to PSTVd, TCDVd is less polymorphic in tomato plants as fewer variants and lower haplotype/nucleotide diversities were observed. PMID:22816033

  11. Analysis of Sequence Polymorphism and Population Structure of Tomato chlorotic dwarf viroid and Potato spindle tuber viroid in Viroid-Infected Tomato Plants

    PubMed Central

    Nie, Xianzhou


    The sequence polymorphism and population structure of Tomato chlorotic dwarf viroid (TCDVd) (isolate Trust) and Potato tuber spindle viroid (PSTVd) (isolate FN) in tomato plants were investigated. Of the 9 and 35 TCDVd clones sequenced from 2 different TCDVd-infected plants, 2 and 4 sequence variants were identified, respectively, leading to a total of 4 sequence variants of 360 nucleotides in length. Variant I was identical to AF162131, the first TCDVd sequence to be reported, and the rest exhibited 1 to 3 nucleotide differences, all in the TR domain, from AF162131/variant I. Of the 33 and 29 PSTVd clones sequenced from 2 different PSTVd-infected plants, 8 and 9 sequence variants were found, respectively, leading to a total of 15 variants ranging in length from 356 to 359 nucleotides. The variant I was identical to EF044303, a PSTVd reported in Russia. The rest exhibited 1 to 11 nucleotide differences scattering in all five domains from EF044303/variant I. The results demonstrated for the first time that TCDVd, like many other viroids including PSTVd, exists in host plants as a collective group comprised of various sequence variants. However, in comparison to PSTVd, TCDVd is less polymorphic in tomato plants as fewer variants and lower haplotype/nucleotide diversities were observed. PMID:22816033

  12. Functional and Structural Consequences of Damaging Single Nucleotide Polymorphisms in Human Prostate Cancer Predisposition Gene RNASEL.


    Datta, Amit; Mazumder, Md Habibul Hasan; Chowdhury, Afrin Sultana; Hasan, Md Anayet


    A commonly diagnosed cancer, prostate cancer (PrCa), is being regulated by the gene RNASEL previously known as PRCA1 codes for ribonuclease L which is an integral part of interferon regulated system that mediates antiviral and antiproliferative role of the interferons. Both somatic and germline mutations have been implicated to cause prostate cancer. With an array of available Single Nucleotide Polymorphism data on dbSNP this study is designed to sort out functional SNPs in RNASEL by implementing different authentic computational tools such as SIFT, PolyPhen, SNPs&GO, Fathmm, ConSurf, UTRScan, PDBsum, Tm-Align, I-Mutant, and Project HOPE for functional and structural assessment, solvent accessibility, molecular dynamics, and energy minimization study. Among 794 RNASEL SNP entries 124 SNPs were found nonsynonymous from which SIFT predicted 13 nsSNPs as nontolerable whereas PolyPhen-2 predicted 28. SNPs found on the 3' and 5' UTR were also assessed. By analyzing six tools having different perspectives an aggregate result was produced where nine nsSNPs were found to be most likely to exert deleterious effect. 3D models of mutated proteins were generated to determine the functional and structural effect of the mutations on ribonuclease L. The initial findings were reinforced by the results from I-Mutant and Project HOPE as these tools predicted significant structural and functional instability of the mutated proteins. Expasy-ProSit tool defined the mutations to be situated in the functional domains of the protein. Considering previous analysis this study revealed a conclusive result deducing the available SNP data on the database by identifying the most damaging three nsSNP rs151296858 (G59S), rs145415894 (A276V), and rs35896902 (R592H). As such studies involving polymorphisms of RNASEL were none to be found, the results of the current study would certainly be helpful in future prospects concerning prostate cancer in males. PMID:26236721

  13. Associations Between Single-Nucleotide Polymorphisms and Epidural Ropivacaine Consumption in Patients Undergoing Breast Cancer Surgery

    PubMed Central

    Liu, Jing; Jiang, Yongdong; Pang, Da; Xi, Hongjie; Liu, Yan


    Up to date, few published studies indicated the associations between genetic polymorphisms and epidural local anesthetics consumption. In this study, we investigated the associations between seven single-nucleotide polymorphisms (SNPs) and epidural ropivacaine consumption during breast cancer surgery in women from northeastern China. These seven SNPs (rs3803662 and rs12443621 in TNCR9, rs889312 in MAP3K1, rs3817198 in LSP1, rs13387042 at 2q35, rs13281615 at 8q24, and rs2046210 at 6q25.1) were identified by recent genome-wide association studies associated with tumor susceptibility. A total of 418 breast cancer women received thoracic epidural anesthesia with ropivacaine for elective mastectomy with axillary clearance. Their blood samples were genotyped for the seven SNPs using the SNaPshot method. For SNP rs13281615, the subjects with genotype AG and GG consumed a greater amount of the total epidural ropivacaine and the mean ropivacaine dose than the subjects with genotype AA (p=0.047 and p=0.003, respectively). Furthermore, no statistical differences were found in the total dose of ropivacaine, the mean consumption of ropivacaine, the onset of ropivacaine, or the initial dose of lidocaine among the three genotypic groups for the other six SNPs studied. Our study indicated that SNP rs13281615 at 8q24 was associated with the consumption of epidural ropivacaine during breast cancer surgery in northeastern Chinese women. It might provide new insights into the mechanisms of ropivacaine action and metabolism and facilitate the development of personalized medicine. PMID:23577780

  14. Single-nucleotide polymorphism associations in common with immune responses to measles and rubella vaccines.


    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A


    Single-nucleotide polymorphisms (SNPs) in candidate immune response genes were evaluated for associations with measles- and rubella-specific neutralizing antibodies, interferon (IFN)-γ, and interleukin (IL)-6 secretion in two separate association analyses in a cohort of healthy immunized subjects. We identified six SNP associations shared between the measles-specific and rubella-specific immune responses, specifically neutralizing antibody titers (DDX58), secreted IL-6 (IL10RB, IL12B), and secreted IFN-γ (IFNAR2, TLR4). An intronic SNP (rs669260) in the antiviral innate immune receptor gene, DDX58, was significantly associated with increased neutralizing antibody titers for both measles and rubella viral antigens post-MMR vaccination (p values 0.02 and 0.0002, respectively). Significant associations were also found between IL10RB (rs2284552; measles study p value 0.006, rubella study p value 0.00008) and IL12B (rs2546893; measles study p value 0.005, rubella study p value 0.03) gene polymorphisms and variations in both measles- and rubella virus-specific IL-6 responses. We also identified associations between individual SNPs in the IFNAR2 and TLR4 genes that were associated with IFN-γ secretion for both measles and rubella vaccine-specific immune responses. These results are the first to indicate that there are SNP associations in common across measles and rubella vaccine immune responses and that SNPs from multiple genes involved in innate and adaptive immune response regulation may contribute to the overall human antiviral response.

  15. Host nucleotide polymorphism in hepatitis B virus-associated hepatocellular carcinoma

    PubMed Central

    Mathew, Shilu; Abdel-Hafiz, Hany; Raza, Abbas; Fatima, Kaneez; Qadri, Ishtiaq


    Hepatocellular carcinoma (HCC) is etiologically linked with hepatitis B virus (HBV) and is the leading cause of death amongst 80% of HBV patients. Among HBV affected patients, genetic factors are also involved in modifying the risk factors of HCC. However, the genetic factors that regulate progression to HCC still remain to be determined. In this review, we discuss several single nucleotide polymorphisms (SNPs) which were reportedly associated with increased or reduced risk of HCC occurrence in patients with chronic HBV infection such as cyclooxygenase (COX)-2 expression specifically at COX-2 -1195G/A in Chinese, Turkish and Egyptian populations, tumor necrosis factor α and the three most commonly studied SNPs: PAT-/+, Lys939Gln (A33512C, rs2228001) and Ala499Val (C21151T, rs2228000). In genome-wide association studies, strong associations have also been found at loci 1p36.22, 11q22.3, 6p21 (rs1419881, rs3997872, rs7453920 and rs7768538), 8p12 (rs2275959 and rs37821974) and 22q11.21. The genes implicated in these studies include HLA-DQB2, HLA-DQA1, TCF19, HLA-C, UBE2L3, LTL, FDX1, MICA, UBE4B and PG. The SNPs found to be associated with the above-mentioned genes still require validation in association studies in order to be considered good prognostic candidates for HCC. Screening of these polymorphisms is very beneficial in clinical experiments to stratify the higher or lower risk for HCC and may help in designing effective and efficient HCC surveillance programs for chronic HBV-infected patients if further genetic vulnerabilities are detected. PMID:27057306

  16. Functional analysis of non-synonymous single nucleotide polymorphisms in human SLC26A9

    PubMed Central

    Chen, An-Ping; Chang, Min-Hwang; Romero, Michael F.


    Slc26 anion transporters play crucial roles in transepithelial Cl− absorption and HCO3− secretion; Slc26 protein mutations lead to several diseases. Slc26a9 functions as a Cl− channel and electrogenic Cl−-HCO3− exchanger, and can interact with CFTR. Slc26a9(−/−) mice have reduced gastric acid secretion, yet no human disease is currently associated with SLC26A9 coding mutations. Therefore, we tested the function of non-synonymous, coding, single nucleotide polymorphisms (cSNPs) of SLC26A9. Presently, eight cSNPs are NCBI-documented: Y70N, T127N, I384T, R575W, P606L, V622L, V744M and H748R. Using two-electrode voltage-clamp and anion selective electrodes, we measured the biophysical consequences of these cSNPs. Y70N (cytoplasmic N-terminus) displays higher channel activity and enhanced Cl−-HCO3− exchange. T127N (transmembrane) results in smaller halide currents but not for SCN−. V622L (STAS domain) and V744M (STAS adjacent) decreased plasma membrane expression which partially accounts for decreased whole cell currents. Nevertheless, V622L transport is reduced to ~50%. SLC26A9 polymorphisms lead to several function modifications (increased activity, decreased activity, altered protein expression) which could lead to a spectrum of pathophysiologies. Thus, knowing an individual’s SLC26A9 genetics becomes important for understanding disease potentially caused by SLC26A9 mutations or modifying diseases, e.g., cystic fibrosis. Our results also provide a framework to understand SLC26A9 transport modalities and structure-function relationships. PMID:22544634

  17. Single nucleotide polymorphisms predisposing to asthma in children of Mauritian Indian and Chinese Han ethnicity.


    Ramphul, K; Lv, J; Hua, L; Liu, Q H; Fang, D Z; Ji, R X; Bao, Y X


    Our objective was to investigate the distributions of six single nucleotide polymorphisms (SNPs) MS4A2 E237G, MS4A2 C-109T, ADRB2 R16G, IL4RA I75V, IL4 C-590T, and IL13 C1923T in Mauritian Indian and Chinese Han children with asthma. This case-control association study enrolled 382 unrelated Mauritian Indian children, 193 with asthma and 189 healthy controls, and 384 unrelated Chinese Han children, 192 with asthma and 192 healthy controls. The SNP loci were genotyped using polymerase chain reaction (PCR)-restriction fragment length polymorphism for the Chinese Han samples and TaqMan real-time quantitative PCR for the Mauritian Indian samples. In the Mauritian Indian children, there was a significant difference in the distribution of IL13 C1923T between the asthma and control groups (P=0.033). The frequency of IL13 C1923T T/T in the Mauritian Indian asthma group was significantly higher than in the control group [odds ratio (OR)=2.119, 95% confidence interval=1.048-4.285]. The Chinese Han children with asthma had significantly higher frequencies of MS4A2 C-109T T/T (OR=1.961, P=0.001) and ADRB2 R16G A/A (OR=2.575, P=0.000) than the control group. The IL13 C1923T locus predisposed to asthma in Mauritian Indian children, which represents an ethnic difference from the Chinese Han population. The MS4A2 C-109T T/T and ADRB2 R16G A/A genotypes were associated with asthma in the Chinese Han children.

  18. Genome-wide single nucleotide polymorphisms reveal population history and adaptive divergence in wild guppies.


    Willing, Eva-Maria; Bentzen, Paul; van Oosterhout, Cock; Hoffmann, Margarete; Cable, Joanne; Breden, Felix; Weigel, Detlef; Dreyer, Christine


    Adaptation of guppies (Poecilia reticulata) to contrasting upland and lowland habitats has been extensively studied with respect to behaviour, morphology and life history traits. Yet population history has not been studied at the whole-genome level. Although single nucleotide polymorphisms (SNPs) are the most abundant form of variation in many genomes and consequently very informative for a genome-wide picture of standing natural variation in populations, genome-wide SNP data are rarely available for wild vertebrates. Here we use genetically mapped SNP markers to comprehensively survey genetic variation within and among naturally occurring guppy populations from a wide geographic range in Trinidad and Venezuela. Results from three different clustering methods, Neighbor-net, principal component analysis (PCA) and Bayesian analysis show that the population substructure agrees with geographic separation and largely with previously hypothesized patterns of historical colonization. Within major drainages (Caroni, Oropouche and Northern), populations are genetically similar, but those in different geographic regions are highly divergent from one another, with some indications of ancient shared polymorphisms. Clear genomic signatures of a previous introduction experiment were seen, and we detected additional potential admixture events. Headwater populations were significantly less heterozygous than downstream populations. Pairwise F(ST) values revealed marked differences in allele frequencies among populations from different regions, and also among populations within the same region. F(ST) outlier methods indicated some regions of the genome as being under directional selection. Overall, this study demonstrates the power of a genome-wide SNP data set to inform for studies on natural variation, adaptation and evolution of wild populations.

  19. AML outcome: role of nucleotide excision repair polymorphisms in intermediate risk patients

    PubMed Central

    Strom, Sara S; Estey, Elihu H; Outschoorn, Ubaldo Martinez; Guillermo, Garcia-Manero


    Purpose Acute Myeloid Leukemia (AML) is frequently associated with genetic abnormalities. Based on pre-treatment cytogenetics, patients are classified into favorable, intermediate and poor subgroups. Cytogenetics predicts treatment outcome for the favorable and poor subgroups but not for the intermediate subgroup. Polymorphisms within the nucleotide excision repair (NER) pathway may lead to inter-individual differences in DNA repair capacity (DRC) which could influence outcome. Methods We studied the role of 6 polymorphisms (ERCC1 Gln504Lys, XPD Lys751Gln, XPC Ala499Val, XPC Lys939Gln, XPG Asp1104His, and CCNH Val270Ala) within NER pathway on overall and disease-free survival among 170 adult de-novo AML patients with intermediate cytogenetics [diploid (n=117); non-diploid (n=53)], treated with induction chemotherapy. Kaplan-Meier methods and Cox proportional hazards models were performed. Results Diploid patients with the XPD AC/CC genotype survived shorter than those with the wild-type (AA) genotype (median survival 22 vs. 40 months, log-rank p = 0.03). Similarly diploid patients with XPC CT/TT genotype survived shorter than those with the wild-type (CC) genotype (median survival 15 vs. 30 months, log-rank p = 0.02). Among diploid patients, after adjusting for clinical and socio-demographic variables, patients carrying both XPD AC/CC and XPC CT/TT had a greater than two-fold increased risk of dying compared to those with the wild-type genotypes (HR=2.49; 95%CI: 1.06–5.85). No significant associations were observed for disease-free survival in AML patients. Conclusion By reduced DRC, this combined genotype may result in greater susceptibility to treatment effects decreasing overall survival. These findings could in the future help in selecting treatment strategies for patients with normal cytogenetics. PMID:20141440

  20. Association of a single nucleotide polymorphism in titin gene with marbling in Japanese Black beef cattle

    PubMed Central

    Yamada, Takahisa; Sasaki, Seiki; Sukegawa, Shin; Yoshioka, Sachiyo; Takahagi, Youichi; Morita, Mitsuo; Murakami, Hiroshi; Morimatsu, Fumiki; Fujita, Tatsuo; Miyake, Takeshi; Sasaki, Yoshiyuki


    Background Marbling defined by the amount and distribution of intramuscular fat is an economically important trait of beef cattle in Japan. We have recently reported that single nucleotide polymorphisms (SNPs) in the endothelial differentiation, sphingolipid G-protein-coupled receptor, 1 (EDG1) gene were associated with marbling in Japanese Black beef cattle. As well as EDG1, the titin (TTN) gene, involved in myofibrillogenesis, has been previously shown to possess expression difference in musculus longissimus muscle between low-marbled and high-marbled steer groups, and to be located within genomic region of a quantitative trait locus for marbling. Thus TTN was considered as a positional functional candidate for the gene responsible for marbling. In this study, we explored SNP in TTN and analyzed association of the SNP with marbling. Findings A SNP in the promoter region of TTN, referred to as g.231054C>T, was the only difference detected between high- and low-marbled steer groups. The SNP was associated with marbling in 3 experiments using 101 sires (P = 0.004), 848 paternal half-sib progeny steers from 5 sires heterozygous for the g.231054C>T (P = 0.046), and 820 paternal half-sib progeny steers from 3 sires homozygous for C allele at the g.231054C>T (P = 0.051), in Japanese Black beef cattle. The effect of genotypes of the SNP on subcutaneous fat thickness was not statistically significant (P > 0.05). Conclusion These findings suggest that in addition to the EDG1 SNPs, the TTN SNP polymorphism is associated with marbling and may be useful for effective marker-assisted selection to increase the levels of marbling in Japanese Black beef cattle. Further replicate studies will be needed to confirm the allelic association observed here, and to expand the results to evaluate all possible genotypic combinations of alleles. PMID:19419586

  1. Mitochondrial bioenergetics and drug-induced toxicity in a panel of mouse embryonic fibroblasts with mitochondrial DNA single nucleotide polymorphisms

    SciTech Connect

    Pereira, Claudia V.; Oliveira, Paulo J.; Will, Yvonne; Nadanaciva, Sashi


    Mitochondrial DNA (mtDNA) variations including single nucleotide polymorphisms (SNPs) have been proposed to be involved in idiosyncratic drug reactions. However, current in vitro and in vivo models lack the genetic diversity seen in the human population. Our hypothesis is that different cell strains with distinct mtDNA SNPs may have different mitochondrial bioenergetic profiles and may therefore vary in their response to drug-induced toxicity. Therefore, we used an in vitro system composed of four strains of mouse embryonic fibroblasts (MEFs) with mtDNA polymorphisms. We sequenced mtDNA from embryonic fibroblasts isolated from four mouse strains, C57BL/6J, MOLF/EiJ, CZECHII/EiJ and PERA/EiJ, with the latter two being sequenced for the first time. The bioenergetic profile of the four strains of MEFs was investigated at both passages 3 and 10. Our results showed that there were clear differences among the four strains of MEFs at both passages, with CZECHII/EiJ having a lower mitochondrial robustness when compared to C57BL/6J, followed by MOLF/EiJ and PERA/EiJ. Seven drugs known to impair mitochondrial function were tested for their effect on the ATP content of the four strains of MEFs in both glucose- and galactose-containing media. Our results showed that there were strain-dependent differences in the response to some of the drugs. We propose that this model is a useful starting point to study compounds that may cause mitochondrial off-target toxicity in early stages of drug development, thus decreasing the number of experimental animals used. -- Highlights: ► mtDNA SNPs may be linked to individual predisposition to drug-induced toxicity. ► CZECHII/EiJ and PERA/EiJ mtDNA was sequenced for the first time in this study. ► Strain-dependent mitochondrial capacity differences were measured. ► Strain-dependent differences in response to mitochondrial toxicants were observed.

  2. Genome-wide patterns of recombination, linkage disequilibrium and nucleotide diversity from pooled resequencing and single nucleotide polymorphism genotyping unlock the evolutionary history of Eucalyptus grandis.


    Silva-Junior, Orzenil B; Grattapaglia, Dario


    We used high-density single nucleotide polymorphism (SNP) data and whole-genome pooled resequencing to examine the landscape of population recombination (ρ) and nucleotide diversity (ϴw ), assess the extent of linkage disequilibrium (r(2) ) and build the highest density linkage maps for Eucalyptus. At the genome-wide level, linkage disequilibrium (LD) decayed within c. 4-6 kb, slower than previously reported from candidate gene studies, but showing considerable variation from absence to complete LD up to 50 kb. A sharp decrease in the estimate of ρ was seen when going from short to genome-wide inter-SNP distances, highlighting the dependence of this parameter on the scale of observation adopted. Recombination was correlated with nucleotide diversity, gene density and distance from the centromere, with hotspots of recombination enriched for genes involved in chemical reactions and pathways of the normal metabolic processes. The high nucleotide diversity (ϴw = 0.022) of E. grandis revealed that mutation is more important than recombination in shaping its genomic diversity (ρ/ϴw = 0.645). Chromosome-wide ancestral recombination graphs allowed us to date the split of E. grandis (1.7-4.8 million yr ago) and identify a scenario for the recent demographic history of the species. Our results have considerable practical importance to Genome Wide Association Studies (GWAS), while indicating bright prospects for genomic prediction of complex phenotypes in eucalypt breeding.

  3. Statistical analysis of nucleotide runs in coding and noncoding DNA sequences.


    Sprizhitsky YuA; Nechipurenko YuD; Alexandrov, A A; Volkenstein, M V


    A statistical analysis of the occurrence of particular nucleotide runs in DNA sequences of different species has been carried out. There are considerable differences of run distributions in DNA sequences of procaryotes, invertebrates and vertebrates. There is an abundance of short runs (1-2 nucleotides long) in the coding sequences and there is a deficiency of such runs in the noncoding regions. However, some interesting exceptions from this rule exist for the run distribution of adenine in procaryotes and for the arrangement of purine-pyrimidine runs in eucaryotes. The similarity in the distributions of such runs in the coding and noncoding regions may be due to some structural features of the DNA molecule as a whole. Runs of guanine (or cytosine) of three to six nucleotides occur predominantly in noncoding DNA regions in eucaryotes, especially in vertebrates.

  4. Association Between Single Nucleotide Polymorphism +276G > T (rs1501299) in ADIPOQ and Endometrial Cancer.


    Bieńkiewicz, Jan; Smolarz, Beata; Malinowski, Andrzej


    Current literature gives evidence of an indisputable role adiponectin plays in adipose tissue metabolism and obesity-related diseases. Moreover, latest research efforts focus on linking genetic markers of this adipocytokine's gene (ADIPOQ) with cancer. Aim of this study was to determine the genotype distribution of single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ and an attempt to identify the impact this polymorphism exerts on endometrial cancer risk in obese females. The test group comprised 90 women treated surgically for endometrial cancer between 2000 and 2012 in the Department of Surgical & Endoscopic Gynecology and Gynecologic Oncology, Polish Mothers' Memorial Hospital - Research Institute, Lodz, Poland. 90 individuals treated in the parallel period for uterine fibroids constituted the control group. Patients within both groups were stratified according to BMI into: lean, overweight and obese subjects. Statistical analysis was performed between two major groups and, furthermore, within the abovementioned subgroups. The analysis revealed that allele G of the investigated polymorphism in obese women with endometrial cancer is significantly more frequent, and allele T is significantly less frequent than in lean controls. However, no significant correlation was observed between the polymorphism and endometrial cancer in lean and overweight females. Single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ may be considered to be a risk factor of endometrial cancer. Further research on SNP in EC is warranted to obtain more conclusive outcomes. PMID:26386690

  5. Association Between Single Nucleotide Polymorphism +276G > T (rs1501299) in ADIPOQ and Endometrial Cancer.


    Bieńkiewicz, Jan; Smolarz, Beata; Malinowski, Andrzej


    Current literature gives evidence of an indisputable role adiponectin plays in adipose tissue metabolism and obesity-related diseases. Moreover, latest research efforts focus on linking genetic markers of this adipocytokine's gene (ADIPOQ) with cancer. Aim of this study was to determine the genotype distribution of single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ and an attempt to identify the impact this polymorphism exerts on endometrial cancer risk in obese females. The test group comprised 90 women treated surgically for endometrial cancer between 2000 and 2012 in the Department of Surgical & Endoscopic Gynecology and Gynecologic Oncology, Polish Mothers' Memorial Hospital - Research Institute, Lodz, Poland. 90 individuals treated in the parallel period for uterine fibroids constituted the control group. Patients within both groups were stratified according to BMI into: lean, overweight and obese subjects. Statistical analysis was performed between two major groups and, furthermore, within the abovementioned subgroups. The analysis revealed that allele G of the investigated polymorphism in obese women with endometrial cancer is significantly more frequent, and allele T is significantly less frequent than in lean controls. However, no significant correlation was observed between the polymorphism and endometrial cancer in lean and overweight females. Single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ may be considered to be a risk factor of endometrial cancer. Further research on SNP in EC is warranted to obtain more conclusive outcomes.

  6. Comparative screening of single nucleotide polymorphisms in β-casein and κ-casein gene in different livestock breeds of India.


    Singh, Lakshya Veer; Jayakumar, S; Sharma, Anurodh; Gupta, Shishir Kumar; Dixit, S P; Gupta, Neelam; Gupta, S C


    The most polymorphic milk protein gene is β-casein; 13 protein variants are known in cattle. Milk protein genetic polymorphism has received considerable research interest in recent years because of possible associations between milk protein and economically important traits in livestock. The present study was undertaken to explore the genetic polymorphisms in exon 7 of β-casein and exon 4 of κ-casein genes in Arunachali yaks (Bos grunniens), Sahiwal (Bos indicus) cattle, malpura sheep (Ovis aries) and Gaddi goat (Capra hircus). Results of the study revealed presence of 11 SNP variants in all livestock species. Four SNPs were observed in Bos indicus; two SNPs in Bos grunniens; three SNPs in Ovis aries and three SNPs in Capra hircus. These variations are found to be synonymous in nature as these variations do not result in their corresponding amino acids. A total of five polymorphic sites have been described at the κ-casein (CSN3) locus in the Indian domestic Gaddi goat (Capra hircus) when compared with exotic goat (X60763) while sequence analysis of κ-casein gene in sheep showed three novel nucleotide changes in malpura sheep when compared with the exotic sheep (AY237637). These results highlight the importance of taking into consideration the CSN3 SNPs when performing selection for milk composition in dairy livestock breeds.

  7. Comparative screening of single nucleotide polymorphisms in β-casein and κ-casein gene in different livestock breeds of India

    PubMed Central

    Singh, Lakshya Veer; Jayakumar, S.; Sharma, Anurodh; Gupta, Shishir Kumar; Dixit, S.P.; Gupta, Neelam; Gupta, S.C.


    Abstracts The most polymorphic milk protein gene is β-casein; 13 protein variants are known in cattle. Milk protein genetic polymorphism has received considerable research interest in recent years because of possible associations between milk protein and economically important traits in livestock. The present study was undertaken to explore the genetic polymorphisms in exon 7 of β-casein and exon 4 of κ-casein genes in Arunachali yaks (Bos grunniens), Sahiwal (Bos indicus) cattle, malpura sheep (Ovis aries) and Gaddi goat (Capra hircus). Results of the study revealed presence of 11 SNP variants in all livestock species. Four SNPs were observed in Bos indicus; two SNPs in Bos grunniens; three SNPs in Ovis aries and three SNPs in Capra hircus. These variations are found to be synonymous in nature as these variations do not result in their corresponding amino acids. A total of five polymorphic sites have been described at the κ-casein (CSN3) locus in the Indian domestic Gaddi goat (Capra hircus) when compared with exotic goat (X60763) while sequence analysis of κ-casein gene in sheep showed three novel nucleotide changes in malpura sheep when compared with the exotic sheep (AY237637). These results highlight the importance of taking into consideration the CSN3 SNPs when performing selection for milk composition in dairy livestock breeds. PMID:25905036



    Pothuraju, M; Mishra, S K; Kumar, S N; Mohamed, N F; Kataria, R S; Yadav, D K; Arora, R


    The present study was undertaken to identify polymorphism in the coding sequence of GDF8gene across indigenous meat type sheep breeds. A 1647 bp sequence was generated, encompassing 208 bp of the 5'UTR, 1128 bp of coding region (exon1, 2 and 3) as well as 311 bp of 3'UTR. The sheep and goat GDF8 gene sequences were observed to be highly conserved as compared to cattle, buffalo, horse and pig. Several nucleotide variations were observed across coding sequence of GDF8 gene in Indian sheep. Three polymorphic sites were identified in the 5'UTR, one in exon 1 and one in the exon 2 regions. Both SNPs in the exonic region were found to be non-synonymous. The mutations c.539T > G and c.821T > A discovered in this study in the exon 1 and exon 2, respectively, have not been previously reported. The information generated provides preliminary indication of the functional diversity present in Indian sheep at the coding region of GDF8gene. The novel as well as the previously reported SNPs discovered in the Indian sheep warrant further analysis to see whether they affect the phenotype. Future studies will need to establish the affect of reported SNPs in the expression of the GDF8 gene in Indian sheep population. PMID:26845859

  9. Nucleotide sequence of equine caspase-1 cDNA.


    Wardlow, S; Penha-Goncalves, M N; Argyle, D J; Onions, D E; Nicolson, L


    Caspases are a family of cysteine proteases which have important roles in activation of cytokines and in apoptosis. Caspase-1, or interleukin-1 beta converting enzyme (ICE), promotes maturation of interleukin-1 beta (IL-1 beta) and interleukin-18 (IL-18) by proteolytic cleavage of precursor forms to generate biologically active peptides. We report the cloning and sequencing of equine caspase-1 cDNA. Equine caspase-1 is 405 amino acids in length and has 72% and 63% identity to human and mouse caspase-1, respectively, at the amino acid level. Sites of proteolytic cleavage and catalytic activity as identified in human caspase-1, are conserved. PMID:10376217

  10. HIV-1 Promoter Single Nucleotide Polymorphisms Are Associated with Clinical Disease Severity

    PubMed Central

    Feng, Rui; Moldover, Brian; Passic, Shendra; Aiamkitsumrit, Benjamas; Dampier, Will; Wojno, Adam; Kilareski, Evelyn; Blakey, Brandon; Ku, Tse-Sheun Jade; Shah, Sonia; Sullivan, Neil T.; Jacobson, Jeffrey M.; Wigdahl, Brian


    The large majority of human immunodeficiency virus type 1 (HIV-1) markers of disease progression/severity previously identified have been associated with alterations in host genetic and immune responses, with few studies focused on viral genetic markers correlate with changes in disease severity. This study presents a cross-sectional/longitudinal study of HIV-1 single nucleotide polymorphisms (SNPs) contained within the viral promoter or long terminal repeat (LTR) in patients within the Drexel Medicine CNS AIDS Research and Eradication Study (CARES) Cohort. HIV-1 LTR SNPs were found to associate with the classical clinical disease parameters CD4+ T-cell count and log viral load. They were found in both defined and undefined transcription factor binding sites of the LTR. A novel SNP identified at position 108 in a known COUP (chicken ovalbumin upstream promoter)/AP1 transcription factor binding site was significantly correlated with binding phenotypes that are potentially the underlying cause of the associated clinical outcome (increase in viral load and decrease in CD4+ T-cell count). PMID:27100290

  11. Common single nucleotide polymorphisms in immunoregulatory genes and multiple myeloma risk among women in Connecticut

    PubMed Central

    Lee, Kyoung-Mu; Baris, Dalsu; Zhang, Yawei; Hosgood, H. Dean; Menashe, Idan; Yeager, Meredith; Zahm, Shelia Hoar; Wang, Sophia S.; Purdue, Mark P.; Chanock, Stephen; Zheng, Tongzhang; Rothman, Nathaniel; Lan, Qing


    In light of the relationship between immune system dysregulation and multiple myeloma (MM) risk, we investigated whether genetic variation in 92 immune function genes among 77 gene regions are associated with MM susceptibility in a population-based case-control study (108 cases and 482 controls) conducted among Caucasian women in Connecticut. Tagging single-nucleotide polymorphisms (SNPs; N=870) were selected using a pairwise linkage-disequilibrium based algorithm. Odds ratios (ORs) and 95% confidence intervals (CIs) for SNP genotypes were estimated using unconditional logistic regression. Tests of association for gene regions were conducted using the minP test. We applied the false discovery rate (FDR) method to the minP test results as a means of controlling for multiple comparisons. The CD4 gene region located on 12p13-q13 (minP=0.0009), had an FDR value < 0.1. In this region, a total of six tag SNPs in two genes (CD4 and LAG3) were significantly associated with MM risk (Ptrend<0.05), with the strongest association observed for the CD4 variant rs11064392 (ORAG/GG=2.53, 95% CI=1.59–4.02). Our findings suggest that genetic variation in CD4 may influence susceptibility to MM. Additional studies are needed to replicate these findings and, more generally, to explore the manner in which genes receptors may influence the pathogenesis of this poorly understood malignancy. PMID:20568250

  12. Alteration of Antiviral Signalling by Single Nucleotide Polymorphisms (SNPs) of Mitochondrial Antiviral Signalling Protein (MAVS)

    PubMed Central

    Xing, Fei; Matsumiya, Tomoh; Hayakari, Ryo; Yoshida, Hidemi; Kawaguchi, Shogo; Takahashi, Ippei; Nakaji, Shigeyuki; Imaizumi, Tadaatsu


    Genetic variation is associated with diseases. As a type of genetic variation occurring with certain regularity and frequency, the single nucleotide polymorphism (SNP) is attracting more and more attention because of its great value for research and real-life application. Mitochondrial antiviral signalling protein (MAVS) acts as a common adaptor molecule for retinoic acid-inducible gene-I (RIG-I)-like receptors (RLRs), which can recognize foreign RNA, including viral RNA, leading to the induction of type I interferons (IFNs). Therefore, MAVS is thought to be a crucial molecule in antiviral innate immunity. We speculated that genetic variation of MAVS may result in susceptibility to infectious diseases. To assess the risk of viral infection based on MAVS variation, we tested the effects of twelve non-synonymous MAVS coding-region SNPs from the National Center for Biotechnology Information (NCBI) database that result in amino acid substitutions. We found that five of these SNPs exhibited functional alterations. Additionally, four resulted in an inhibitory immune response, and one had the opposite effect. In total, 1,032 human genomic samples obtained from a mass examination were genotyped at these five SNPs. However, no homozygous or heterozygous variation was detected. We hypothesized that these five SNPs are not present in the Japanese population and that such MAVS variations may result in serious immune diseases. PMID:26954674

  13. Estrogen receptor alpha single nucleotide polymorphism as predictor of diabetes type 2 risk in hypogonadal men.


    Linnér, Carl; Svartberg, Johan; Giwercman, Aleksander; Giwercman, Yvonne Lundberg


    Estradiol (E2) is, apart from its role as a reproductive hormone, also important for cardiac function and bone maturation in both genders. It has also been shown to play a role in insulin production, energy expenditure and in inducing lipolysis. The aim of the study was to investigate if low circulating testosterone or E2 levels in combination with variants in the estrogen receptor alpha (ESR1) and estrogen receptor beta (ESR2) genes were of importance for the risk of type-2 diabetes. The single nucleotide polymorphisms rs2207396 and rs1256049, in ESR1 and ESR2, respectively, were analysed by allele specific PCR in 172 elderly men from the population-based Tromsø study. The results were adjusted for age. In individuals with low total (≤11 nmol/L) or free testosterone (≤0.18 nmol/L) being carriers of the variant A-allele in ESR1 was associated with 7.3 and 15.9 times, respectively, increased odds ratio of being diagnosed with diabetes mellitus type 2 (p = 0.025 and p = 0.018, respectively). Lower concentrations of E2 did not seem to increase the risk of being diagnosed with diabetes. In conclusion, in hypogonadal men, the rs2207396 variant in ESR1 predicts the risk of type 2 diabetes.

  14. Feasibility of mitochondrial single nucleotide polymorphisms to detect and identify Aspergillus fumigatus in clinical samples.


    Oliveira, Manuela; Lackner, Michaela; Amorim, António; Araujo, Ricardo


    Invasive aspergillosis (IA) is a concerning fungal infection among immunocompromised patients due to the poor outcomes in its treatment related with the delay in an accurate diagnosis. Therefore, this study aimed to select informative mitochondrial single nucleotide polymorphism (SNP) markers suitable for detection and identification of Aspergillus fumigatus in clinical specimens. Four mitochondrial SNP markers were selected (Cox_488, CytB_246, Nad1_802, and NC_171) and tested on clinical and environmental strains of Fumigati and non-Fumigati Aspergillus species (n=105). These markers were tested on clinical samples (n=37) obtained from patients with aspergillosis. The Cox_488 SNP was detected in all clinical samples, whereas complete profiles detecting all 4 SNPs were only obtained from 6 samples (1 lung biopsy, 2 abscesses, and 3 bronchoalveolar lavages) from patients with a probable or proven Aspergillus infection. The mitSNApfu approach based on mitochondrial markers constitutes a new and promising diagnostic approach that was applied successfully on clinical specimens from patients with proven or probable IA. Nevertheless, the assay requires further optimization (in respect to extraction procedures) and clinical validation to allow its application in routine diagnostics.

  15. Methods for human demographic inference using haplotype patterns from genomewide single-nucleotide polymorphism data.


    Lohmueller, Kirk E; Bustamante, Carlos D; Clark, Andrew G


    We propose a novel approximate-likelihood method to fit demographic models to human genomewide single-nucleotide polymorphism (SNP) data. We divide the genome into windows of constant genetic map width and then tabulate the number of distinct haplotypes and the frequency of the most common haplotype for each window. We summarize the data by the genomewide joint distribution of these two statistics-termed the HCN statistic. Coalescent simulations are used to generate the expected HCN statistic for different demographic parameters. The HCN statistic provides additional information for disentangling complex demography beyond statistics based on single-SNP frequencies. Application of our method to simulated data shows it can reliably infer parameters from growth and bottleneck models, even in the presence of recombination hotspots when properly modeled. We also examined how practical problems with genomewide data sets, such as errors in the genetic map, haplotype phase uncertainty, and SNP ascertainment bias, affect our method. Several modifications of our method served to make it robust to these problems. We have applied our method to data collected by Perlegen Sciences and find evidence for a severe population size reduction in northwestern Europe starting 32,500-47,500 years ago.

  16. A single nucleotide polymorphism in BMP15 is associated with high response to ovarian stimulation.


    Hanevik, Hans Ivar; Hilmarsen, Hilde Tveitan; Skjelbred, Camilla Furu; Tanbo, Tom; Kahn, Jarl A


    There is substantial variability in ovarian response to exogenous gonadotrophins in women undergoing ovarian stimulation for IVF. Genetic variation in signalling pathways of the ovary may influence ovarian stimulation outcome. One previous study showed an association between single nucleotide polymorphisms (SNP) in the gene for bone morphogenetic protein 15 (BMP15) and ovarian hyperstimulation syndrome (OHSS). This article presents a retrospective case-controlled genetic-association study designed to test the association between SNP in the BMP15 gene and two clinically important outcomes of ovarian stimulation: low and high response. Blood samples from 53 high responders, 38 low responders and 100 controls were analysed for five SNP of interest. Odds ratios (OR) and 95% confidence intervals (95% CI) were estimated by a multivariate logistic regression model. We found an association between the BMP15 -9G allele and high response to ovarian stimulation (OR=2.7, 95% CI=1.3-5.7). This association confirms previous findings in a different population and strengthens the case for an association between this SNP and ovarian stimulation outcome.

  17. Association of Single Nucleotide Polymorphisms with Atrial Fibrillation and the Outcome after Catheter Ablation

    PubMed Central

    Hu, Yu-Feng; Wang, Hsueh-Hsiao; Yeh, Hung-I; Lee, Kun-Tai; Lin, Yenn-Jiang; Chang, Shih-Lin; Lo, Li-Wei; Tuan, Ta-Chuan; Li, Cheng-Hung; Chao, Tze-Fan; Chung, Fa-Po; Liao, Jo-Nan; Tang, Paul Wei Hua; Tsai, Wei-Chung; Chiou, Chuen-Wang; Chen, Shih-Ann


    Background The association of gene variants with atrial fibrillation (AF) type and the recurrence of AF after catheter ablation in Taiwan is still unclear. In this study, we aimed to investigate the relationships between gene variants, AF type, and the recurrence of AF. Methods In our investigation, we examined 383 consecutive patients with AF (61.9 ± 14.0 years; 63% men); of these 383 patients, 189 underwent catheter ablation for drug-refractory AF. Thereafter, the single nucleotide polymorphisms rs2200733, and rs7193343 were genotyped using real-time polymerase chain reaction. Results The rs7193343 variant was independently associated with non-paroxysmal AF (non-PAF). In the PAF group, the rs7193343 variant was independently associated with AF recurrence after catheter ablation. However, the rs2200733 variant was not associated with AF recurrence in this group. The combination of the rs7193343 and rs2200733 risk alleles was associated with a better predictive power in the PAF patients. In contrast, in the non-PAF group, the SNPs were not associated with recurrence. The rs7193343 and rs2200733 variants were not associated with different atrial voltage and activation times. Conclusions The rs7193343 variants were associated with AF recurrence after catheter ablation in PAF patients but not in non-PAF patients. The rs7193343 CC variant was independently associated with non-PAF. PMID:27713600

  18. Bayesian pedigree inference with small numbers of single nucleotide polymorphisms via a factor-graph representation.


    Anderson, Eric C; Ng, Thomas C


    We develop a computational framework for addressing pedigree inference problems using small numbers (80-400) of single nucleotide polymorphisms (SNPs). Our approach relaxes the assumptions, which are commonly made, that sampling is complete with respect to the pedigree and that there is no genotyping error. It relies on representing the inferred pedigree as a factor graph and invoking the Sum-Product algorithm to compute and store quantities that allow the joint probability of the data to be rapidly computed under a large class of rearrangements of the pedigree structure. This allows efficient MCMC sampling over the space of pedigrees, and, hence, Bayesian inference of pedigree structure. In this paper we restrict ourselves to inference of pedigrees without loops using SNPs assumed to be unlinked. We present the methodology in general for multigenerational inference, and we illustrate the method by applying it to the inference of full sibling groups in a large sample (n=1157) of Chinook salmon typed at 95 SNPs. The results show that our method provides a better point estimate and estimate of uncertainty than the currently best-available maximum-likelihood sibling reconstruction method. Extensions of this work to more complex scenarios are briefly discussed. PMID:26450523

  19. High-throughput genotyping of single nucleotide polymorphisms with rolling circle amplification

    PubMed Central

    Faruqi, A Fawad; Hosono, Seiyu; Driscoll, Mark D; Dean, Frank B; Alsmadi, Osama; Bandaru, Rajanikanta; Kumar, Gyanendra; Grimwade, Brian; Zong, Qiuling; Sun, Zhenyu; Du, Yuefen; Kingsmore, Stephen; Knott, Tim; Lasken, Roger S


    Background Single nucleotide polymorphisms (SNPs) are the foundation of powerful complex trait and pharmacogenomic analyses. The availability of large SNP databases, however, has emphasized a need for inexpensive SNP genotyping methods of commensurate simplicity, robustness, and scalability. We describe a solution-based, microtiter plate method for SNP genotyping of human genomic DNA. The method is based upon allele discrimination by ligation of open circle probes followed by rolling circle amplification of the signal using fluorescent primers. Only the probe with a 3' base complementary to the SNP is circularized by ligation. Results SNP scoring by ligation was optimized to a 100,000 fold discrimination against probe mismatched to the SNP. The assay was used to genotype 10 SNPs from a set of 192 genomic DNA samples in a high-throughput format. Assay directly from genomic DNA eliminates the need to preamplify the target as done for many other genotyping methods. The sensitivity of the assay was demonstrated by genotyping from 1 ng of genomic DNA. We demonstrate that the assay can detect a single molecule of the circularized probe. Conclusions Compatibility with homogeneous formats and the ability to assay small amounts of genomic DNA meets the exacting requirements of automated, high-throughput SNP scoring. PMID:11511324

  20. Functional Implications of the CLOCK 3111T/C Single-Nucleotide Polymorphism

    PubMed Central

    Ozburn, Angela R.; Purohit, Kush; Parekh, Puja K.; Kaplan, Gabrielle N.; Falcon, Edgardo; Mukherjee, Shibani; Cates, Hannah M.; McClung, Colleen A.


    Circadian rhythm disruptions are prominently associated with bipolar disorder (BD). Circadian rhythms are regulated by the molecular clock, a family of proteins that function together in a transcriptional–translational feedback loop. The CLOCK protein is a key transcription factor of this feedback loop, and previous studies have found that manipulations of the Clock gene are sufficient to produce manic-like behavior in mice (1). The CLOCK 3111T/C single-nucleotide polymorphism (SNP; rs1801260) is a genetic variation of the human CLOCK gene that is significantly associated with increased frequency of manic episodes in BD patients (2). The 3111T/C SNP is located in the 3′-untranslated region of the CLOCK gene. In this study, we sought to examine the functional implications of the human CLOCK 3111T/C SNP by transfecting a mammalian cell line (mouse embryonic fibroblasts isolated from Clock−/− knockout mice) with pcDNA plasmids containing the human CLOCK gene with either the T or C SNP at position 3111. We then measured circadian gene expression over a 24-h time period. We found that the CLOCK3111C SNP resulted in higher mRNA levels than the CLOCK 3111T SNP. Furthermore, we found that Per2, a transcriptional target of CLOCK, was also more highly expressed with CLOCK 3111C expression, indicating that the 3′-UTR SNP affects the expression, function, and stability of CLOCK mRNA. PMID:27148095

  1. Single nucleotide polymorphisms to discriminate different classes of hybrid between wild Atlantic salmon and aquaculture escapees.


    Pritchard, Victoria L; Erkinaro, Jaakko; Kent, Matthew P; Niemelä, Eero; Orell, Panu; Lien, Sigbjørn; Primmer, Craig R


    Many wild Atlantic salmon (Salmo salar) populations are threatened by introgressive hybridization from domesticated fish that have escaped from aquaculture facilities. A detailed understanding of the hybridization dynamics between wild salmon and aquaculture escapees requires discrimination of different hybrid classes; however, markers currently available to discriminate the two types of parental genome have limited power to do this. Using a high-density Atlantic salmon single nucleotide polymorphism (SNP) array, in combination with pooled-sample allelotyping and an Fst outlier approach, we identified 200 SNPs that differentiated an important Atlantic salmon stock from the escapees potentially hybridizing with it. By simulating multiple generations of wild-escapee hybridization, involving wild populations in two major phylogeographic lineages and a genetically diverse set of escapees, we showed that both the complete set of SNPs and smaller subsets could reliably assign individuals to different hybrid classes up to the third hybrid (F3) generation. This set of markers will be a useful tool for investigating the genetic interactions between native wild fish and aquaculture escapees in many Atlantic salmon populations. PMID:27606009

  2. Single nucleotide polymorphism array analysis defines a specific genetic fingerprint for well-differentiated cutaneous SCCs.


    Purdie, Karin J; Harwood, Catherine A; Gulati, Abha; Chaplin, Tracy; Lambert, Sally R; Cerio, Rino; Kelly, Gavin P; Cazier, Jean-Baptiste; Young, Bryan D; Leigh, Irene M; Proby, Charlotte M


    Cutaneous squamous cell carcinomas (cSCCs) are the second most frequent cancers in fair-skinned populations; yet, because of their genetic heterogeneity, the key molecular events in cSCC tumorigenesis remain poorly defined. We have used single nucleotide polymorphism microarray analysis to examine genome-wide allelic imbalance in 60 cSCCs using paired non-tumor samples. The most frequent recurrent aberrations were loss of heterozygosity at 3p and 9p, observed in 39 (65%) and 45 (75%) tumors, respectively. Microdeletions at 9p23 within the protein tyrosine phosphatase receptor type D (PTPRD) locus were identified in 9 (15%) samples, supporting a tumor suppressor role for PTPRD in cSCC. In addition, microdeletions at 3p14.2 were detected in 3 (5%) cSCCs, implicating the fragile histidine triad (FHIT) gene as a possible target for inactivation. Statistical analysis revealed that well-differentiated cSCCs demonstrated significantly fewer aberrations than moderately and poorly differentiated cSCCs; yet, despite a lower rate of allelic imbalance, some specific aberrations were observed equally frequently in both groups. No correlation was established between the frequency of chromosomal aberrations and immune or human papillomavirus status. Our data suggest that well-differentiated tumors are a genetically distinct subpopulation of cSCC.

  3. HIV-1 Promoter Single Nucleotide Polymorphisms Are Associated with Clinical Disease Severity.


    Nonnemacher, Michael R; Pirrone, Vanessa; Feng, Rui; Moldover, Brian; Passic, Shendra; Aiamkitsumrit, Benjamas; Dampier, Will; Wojno, Adam; Kilareski, Evelyn; Blakey, Brandon; Ku, Tse-Sheun Jade; Shah, Sonia; Sullivan, Neil T; Jacobson, Jeffrey M; Wigdahl, Brian


    The large majority of human immunodeficiency virus type 1 (HIV-1) markers of disease progression/severity previously identified have been associated with alterations in host genetic and immune responses, with few studies focused on viral genetic markers correlate with changes in disease severity. This study presents a cross-sectional/longitudinal study of HIV-1 single nucleotide polymorphisms (SNPs) contained within the viral promoter or long terminal repeat (LTR) in patients within the Drexel Medicine CNS AIDS Research and Eradication Study (CARES) Cohort. HIV-1 LTR SNPs were found to associate with the classical clinical disease parameters CD4+ T-cell count and log viral load. They were found in both defined and undefined transcription factor binding sites of the LTR. A novel SNP identified at position 108 in a known COUP (chicken ovalbumin upstream promoter)/AP1 transcription factor binding site was significantly correlated with binding phenotypes that are potentially the underlying cause of the associated clinical outcome (increase in viral load and decrease in CD4+ T-cell count).

  4. Single Nucleotide Polymorphism Identification in Polyploids: A Review, Example, and Recommendations.


    Clevenger, Josh; Chavarro, Carolina; Pearl, Stephanie A; Ozias-Akins, Peggy; Jackson, Scott A


    Understanding the relationship between genotype and phenotype is a major biological question and being able to predict phenotypes based on molecular genotypes is integral to molecular breeding. Whole-genome duplications have shaped the history of all flowering plants and present challenges to elucidating the relationship between genotype and phenotype, especially in neopolyploid species. Although single nucleotide polymorphisms (SNPs) have become popular tools for genetic mapping, discovery and application of SNPs in polyploids has been difficult. Here, we summarize common experimental approaches to SNP calling, highlighting recent polyploid successes. To examine the impact of software choice on these analyses, we called SNPs among five peanut genotypes using different alignment programs (BWA-mem and Bowtie 2) and variant callers (SAMtools, GATK, and Freebayes). Alignments produced by Bowtie 2 and BWA-mem and analyzed in SAMtools shared 24.5% concordant SNPs, and SAMtools, GATK, and Freebayes shared 1.4% concordant SNPs. A subsequent analysis of simulated Brassica napus chromosome 1A and 1C genotypes demonstrated that, of the three software programs, SAMtools performed with the highest sensitivity and specificity on Bowtie 2 alignments. These results, however, are likely to vary among species, and we therefore propose a series of best practices for SNP calling in polyploids.

  5. Single nucleotide polymorphism-based microarray analysis for the diagnosis of hydatidiform moles

    PubMed Central



    In clinical diagnostics, single nucleotide polymorphism (SNP)-based microarray analysis enables the detection of copy number variations (CNVs), as well as copy number neutral regions, that are absent of heterozygosity throughout the genome. The aim of the present study was to evaluate the effectiveness and sensitivity of SNP-based microarray analysis in the diagnosis of hydatidiform mole (HM). By using whole-genome SNP microarray analysis, villous genotypes were detected, and the ploidy of villous tissue was determined to identify HMs. A total of 66 villous tissues and two twin tissues were assessed in the present study. Among these samples, 11 were triploid, one was tetraploid, 23 were abnormal aneuploidy, three were complete genome homozygosity, and the remaining ones were normal ploidy. The most noteworthy finding of the present study was the identification of six partial HMs and three complete HMs from those samples that were not identified as being HMs on the basis of the initial diagnosis of experienced obstetricians. This study has demonstrated that the application of an SNP-based microarray analysis was able to increase the sensitivity of diagnosis for HMs with partial and complete HMs, which makes the identification of these diseases at an early gestational age possible. PMID:27151252

  6. Single Nucleotide Polymorphism Array Genotyping is Equivalent to Metaphase Cytogenetics for Diagnosis of Turner Syndrome

    PubMed Central

    Prakash, Siddharth; Guo, Dongchuan; Maslen, Cheryl L.; Silberbach, Michael; Investigators, GenTAC; Milewicz, Dianna; Bondy, Carolyn A.


    Background Turner syndrome (TS) is a developmental disorder caused by partial or complete monosomy for the X chromosome in 1:2500 females. We hypothesized that single nucleotide polymorphism (SNP) array genotyping can provide superior resolution in comparison to metaphase karyotype analysis to facilitate genotype-phenotype correlations. Methods We genotyped 187 TS patients with 733,000 SNP marker arrays. All cases met diagnostic criteria for TS based on karyotypes (60%) or characteristic physical features. SNP array results confirmed the diagnosis of TS in 100% of cases. Results We identified a single X chromosome (45,X) in 113 cases. In 58 additional cases (31%), other mosaic cell lines were present including isochromosomes (16%), rings (5%) and Xp deletions (8%). The remaining cases were mosaic for monosomy X and normal male or female cell lines. Array-based models of X chromosome structure were compatible with karyotypes in 104 of 116 comparable cases (90%). We found that SNP array data did not detect X;autosome translocations (3 cases), but did identify 2 derivative Y chromosomes and 13 large copy number variants that were not detected by karyotyping. Conclusions Our data is the first systematic comparison between the two methods and supports the utility of SNP array genotyping to address clinical and research questions in TS. PMID:23743550

  7. Wireless electrochemiluminescence bipolar electrode array for visualized genotyping of single nucleotide polymorphism.


    Khoshfetrat, Seyyed Mehdi; Ranjbari, Mitra; Shayan, Mohsen; Mehrgardi, Masoud A; Kiani, Abolfazl


    The development of simple, inexpensive, hand-held, user-friendly biosensor for high throughput and multiplexed genotyping of various single nucleotide polymorphisms (SNPs) in a single run experiment by a nonspecialist user is the main challenge in the analysis of DNA. Visualizing the signal and possibility to monitor SNPs by a digital camera opens a new horizon for the routine applications. In the present manuscript, a novel wireless electrochemiluminescence (ECL) DNA array is introduced for the visualized genotyping of different SNPs on the basis of ECL of luminol/hydrogen peroxide system on a bipolar electrode (BPE) array platform. After modification of anodic poles of the array with the DNA probe and its hybridization with the targets, genotyping of various SNPs is carried out by exposing the array to different monobase modified luminol-platinum nanoparticles (M-L-PtNPs). Upon the hybridization of M-L-PtNPs to mismatch sites, the ECL of luminol is followed using a photomultiplier tube (PMT) or digital camera and the images are analyzed by ImageJ software. This biosensor can detect even thermodynamically stable SNP (G-T mismatches) in the range of 2-600 pM. Also, by combining the advantages of BPE and the high visual sensitivity of ECL, it could be easily expected to achieve sensitive screening of different SNPs. The present biosensor demonstrates the capability for the discrimination between PCR products of normal, heterozygous, and homozygous beta thalassemia genetic disorders. PMID:26176414

  8. Pairwise Kinship Analysis by the Index of Chromosome Sharing Using High-Density Single Nucleotide Polymorphisms

    PubMed Central

    Morimoto, Chie; Manabe, Sho; Kawaguchi, Takahisa; Kawai, Chihiro; Fujimoto, Shuntaro; Hamano, Yuya; Yamada, Ryo; Matsuda, Fumihiko; Tamaki, Keiji


    We developed a new approach for pairwise kinship analysis in forensic genetics based on chromosomal sharing between two individuals. Here, we defined “index of chromosome sharing” (ICS) calculated using 174,254 single nucleotide polymorphism (SNP) loci typed by SNP microarray and genetic length of the shared segments from the genotypes of two individuals. To investigate the expected ICS distributions from first- to fifth-degree relatives and unrelated pairs, we used computationally generated genotypes to consider the effect of linkage disequilibrium and recombination. The distributions were used for probabilistic evaluation of the pairwise kinship analysis, such as likelihood ratio (LR) or posterior probability, without allele frequencies and haplotype frequencies. Using our method, all actual sample pairs from volunteers showed significantly high LR values (i.e., ≥ 108); therefore, we can distinguish distant relationships (up to the fifth-degree) from unrelated pairs based on LR. Moreover, we can determine accurate degrees of kinship in up to third-degree relationships with a probability of > 80% using the criterion of posterior probability ≥ 0.90, even if the kinship of the pair is totally unpredictable. This approach greatly improves pairwise kinship analysis of distant relationships, specifically in cases involving identification of disaster victims or missing persons. PMID:27472558

  9. Bioanalytical approaches for the detection of single nucleotide polymorphisms by Surface Plasmon Resonance biosensors.


    Ermini, Maria Laura; Mariani, Stefano; Scarano, Simona; Minunni, Maria


    The mapping of specific single nucleotide polymorphisms (SNPs) in patients' genome is a main goal in theranostics, aiming to the development of therapies based on personalized medicine. In this review, Surface Plasmon Resonance (SPR) and Surface Plasmon Resonance imaging (SPRi) biosensors applied to the recognition of SNPs were reviewed, since these technologies are emerging in clinical diagnosis as powerful tools thanks to their analytical features, mainly the real-time and label-free monitoring based on array format for parallel analysis. Since the literature is heterogeneous, a critical classification and a systemic comparison of the analytical performances of published methods were here reviewed on the basis of the analytical strategy and the assay design. In particular, the use of helping agents (i.e. proteins, nanoparticles (NPs), intercalating agents) or artificial DNAs, often coupled to SPR to achieve allele discrimination and/or enhanced sensitivity, were here revised and classified. Finally, the real suitability of SPR biosensors to clinical diagnostics for SNPs detection was addressed by comparing their features and performances with those of other biosensors based on other techniques (e.g. electrochemical biosensors).

  10. A study of single nucleotide polymorphisms of GRIN2B in schizophrenia from Chinese Han population.


    Guo, Zhenming; Niu, Weibo; Bi, Yan; Zhang, Rui; Ren, Decheng; Hu, Jiaxin; Huang, Xiaoye; Wu, Xi; Cao, Yanfei; Yang, Fengping; Wang, Lu; Li, Weidong; Li, Xingwang; Xu, Yifeng; He, Lin; Yu, Tao; He, Guang


    Schizophrenia is a severe and complex mental disorder with high heritability. There is evidence that mutations in the gene of Nmethyl-d-aspartate-type glutamate receptors (NMDAR) are associated with schizophrenia. GRIN2B encodes a subunit of NMDARs, and has been identified as a candidate gene for many psychiatric disorders, especially schizophrenia. In this study, we investigated whether single nucleotide polymorphisms (SNPs) in GRIN2B were associated with schizophrenia. Four SNPs (rs890, rs1806191, rs219872, rs172677) were genotyped in 752 schizophrenic patients and 846 healthy controls of the Chinese Han population. Our results indicate differences in allele and genotype frequencies of rs890 between case and control. These results were assessed by adapting different genetic models (codominant, dominant, recessive, overdominant, log-additive models). After controlling for confounding factors including sex and age, rs890 remained associated with schizophrenia. In addition, rs890 and rs1806191 were found to form a haplotype associated with schizophrenia. In summary, our results indicate that the GRIN2B SNP rs890 might be associated with schizophrenia in the Chinese Han population. PMID:27453061

  11. Role of the DGAT gene C79T single-nucleotide polymorphism in French obese subjects.


    Coudreau, Sylvie Kipfer; Tounian, Patrick; Bonhomme, Geneviève; Froguel, Philippe; Girardet, Jean-Philippe; Guy-Grand, Bernard; Basdevant, Arnaud; Clément, Karine


    Acyl-coenzyme A, diacylglycerol acyltransferase (DGAT), is a key enzyme involved in adipose-cell triglyceride storage. A 79-bp T-to-C single-nucleotide polymorphism (SNP) on the 3' region of the DGAT transcriptional site has been reported to increase promoter activity and is associated with higher BMI in Turkish women. To validate the possible role of this genetic variant in obesity, as well as the variant's possible cellular-functional significance, we performed an association study between the T79C change and several obesity-related phenotypes in 1357 obese French adults and children. The prevalence of the T79C SNP was similar between obese adults and children when each group was compared with the controls. (CC genotype carrier frequencies were 0.25 to 0.29 in the obese groups and 0.21 in controls; p > 0.05.) In each of the obese adult and child groups studied, the T79C variant was not found to be associated with any of the obesity-related phenotypes tested. Although the T79C SNP of the DGAT gene was studied in several groups of white subjects, the association between this SNP and obesity-related phenotypes, previously described, was not confirmed in our population.

  12. A Bioinformatics Approach to Prioritize Single Nucleotide Polymorphisms in TLRs Signaling Pathway Genes.


    Alipoor, Behnam; Ghaedi, Hamid; Omrani, Mir Davood; Bastami, Milad; Meshkani, Reza; Golmohammadi, Taghi


    It has been suggested that single nucleotide polymorphisms (SNPs) in genes involved in Toll-like receptors (TLRs) pathway may exhibit broad effects on function of this network and might contribute to a range of human diseases. However, the extent to which these variations affect TLR signaling is not well understood. In this study, we adopted a bioinformatics approach to predict the consequences of SNPs in TLRs network. The consequences of non-synonymous coding SNPs (nsSNPs) were predicted by SIFT, PolyPhen, PANTHER, SNPs&GO, I-Mutant, ConSurf and NetSurf tools. Structural visualization of wild type and mutant protein was performed using the project HOPE and Swiss PDB viewer. The influence of 5'-UTR and 3'- UTR SNPs were analyzed by appropriate computational approaches. Nineteen nsSNPs in TLRs pathway genes were found to have deleterious consequences as predicted by the combination of different algorithms. Moreover, our results suggested that SNPs located at UTRs of TLRs pathway genes may potentially influence binding of transcription factors or microRNAs. By applying a pathway-based bioinformatics analysis of genetic variations, we provided a prioritized list of potentially deleterious variants. These findings may facilitate the selection of proper variants for future functional and/or association studies. PMID:27478803

  13. A functional single nucleotide polymorphism of SET8 is prognostic for breast cancer

    PubMed Central

    Song, Fengju; Liu, Qun; Dai, Hongji; Zheng, Hong; Cui, Ping; Zhang, Lina; Zhang, Wei; Chen, Kexin


    A single-nucleotide polymorphism (SNP) locus rs16917496 (T > C) within the 3′-untranslated region (3′-UTR) of SET8 was associated with susceptibility in several malignancies including breast cancer. To further elucidate the prognostic relevance of this SNP in breast cancer, we conducted a clinical study as well as SET8 expression analysis in a cohort of 1,190 breast cancer patients. We demonstrated the expression levels of SET8 in TT genotype were higher than in CC genotypes, and high levels of SET8 were associated with poor survival. SET8 expression was significantly higher in breast tumor tissue than in paired adjacent normal tissue. In addition, survival analysis in 315 patients showed SNP rs16917496 was an independent prognostic factor of breast cancer outcome with TT genotype associated with poor survival compared with CC/CT genotypes. Thus, this SNP may serve as a genetic prognostic factor and a treatment target for breast cancer. Future studies are warranted. PMID:27144429

  14. Linkage Disequilibrium Mapping via Cladistic Analysis of Single-Nucleotide Polymorphism Haplotypes