Variation in the Nucleotide Sequence of Cottontail Rabbit Papillomavirus a and b Subtypes Affects Wart Regression and Malignant Transformation and Level of Viral Replication in Domestic Rabbits

PubMed Central

Salmon, Jérôme; Nonnenmacher, Mathieu; Cazé, Sandrine; Flamant, Patricia; Croissant, Odile; Orth, Gérard; Breitburd, Françoise

2000-01-01

We previously reported the partial characterization of two cottontail rabbit papillomavirus (CRPV) subtypes with strikingly divergent E6 and E7 oncoproteins. We report now the complete nucleotide sequences of these subtypes, referred to as CRPVa4 (7,868 nucleotides) and CRPVb (7,867 nucleotides). The CRPVa4 and CRPVb genomes differed at 238 (3%) nucleotide positions, whereas CRPVa4 and the prototype CRPV differed by only 5 nucleotides. The most variable region (7% nucleotide divergence) included the long regulatory region (LRR) and the E6 and E7 genes. A mutation in the stop codon resulted in an 8-amino-acid-longer CRPVb E4 protein, and a nucleotide deletion reduced the coding capacity of the E5 gene from 101 to 25 amino acids. In domestic rabbits homozygous for a specific haplotype of the DRA and DQA genes of the major histocompatibility complex, warts induced by CRPVb DNA or a chimeric genome containing the CRPVb LRR/E6/E7 region showed an early regression, whereas warts induced by CRPVa4 or a chimeric genome containing the CRPVa4 LRR/E6/E7 region persisted and evolved into carcinomas. In contrast, most CRPVa, CRPVb, and chimeric CRPV DNA-induced warts showed no early regression in rabbits homozygous for another DRA-DQA haplotype. Little, if any, viral replication is usually observed in domestic rabbit warts. When warts induced by CRPVa and CRPVb virions and DNA were compared, the number of cells positive for viral DNA or capsid antigens was found to be greater by 1 order of magnitude for specimens induced by CRPVb. Thus, both sequence variation in the LRR/E6/E7 region and the genetic constitution of the host influence the expression of the oncogenic potential of CRPV. Furthermore, intratype variation may overcome to some extent the host restriction of CRPV replication in domestic rabbits. PMID:11044121

Nonneutral mitochondrial DNA variation in humans and chimpanzees

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nachman, M.W.; Aquadro, C.F.; Brown, W.M.

1996-03-01

We sequenced the NADH dehydrogenase subunit 3 (ND3) gene from a sample of 61 humans, five common chimpanzees, and one gorilla to test whether patterns of mitochondrial DNA (mtDNA) variation are consistent with a neutral model of molecular evolution. Within humans and within chimpanzees, the ratio of replacement to silent nucleotide substitutions was higher than observed in comparisons between species, contrary to neutral expectations. To test the generality of this result, we reanalyzed published human RFLP data from the entire mitochondrial genome. Gains of restriction sites relative to a known human mtDNA sequence were used to infer unambiguous nucleotide substitutions.more » We also compared the complete mtDNA sequences of three humans. Both the RFLP data and the sequence data reveal a higher ratio of replacement to silent nucleotide substitutions within humans than is seen between species. This pattern is observed at most or all human mitochondrial genes and is inconsistent with a strictly neutral model. These data suggest that many mitochondrial protein polymorphisms are slightly deleterious, consistent with studies of human mitochondrial diseases. 59 refs., 2 figs., 8 tabs.« less

Sequence polymorphism data of the hypervariable regions of mitochondrial DNA in the Yadav population of Haryana.

PubMed

Verma, Kapil; Sharma, Sapna; Sharma, Arun; Dalal, Jyoti; Bhardwaj, Tapeshwar

2018-06-01

Genetic variations among humans occur both within and among populations and range from single nucleotide changes to multiple-nucleotide variants. These multiple-nucleotide variants are useful for studying the relationships among individuals or various population groups. The study of human genetic variations can help scientists understand how different population groups are biologically related to one another. Sequence analysis of hypervariable regions of human mitochondrial DNA (mtDNA) has been successfully used for the genetic characterization of different population groups for forensic purposes. It is well established that different ethnic or population groups differ significantly in their mtDNA distributions. In the last decade, very little research has been conducted on mtDNA variations in the Indian population, although such data would be useful for elucidating the history of human population expansion across the world. Moreover, forensic studies on mtDNA variations in the Indian subcontinent are also scarce, particularly in the northern part of India. In this report, variations in the hypervariable regions of mtDNA were analyzed in the Yadav population of Haryana. Different molecular diversity indices were computed. Further, the obtained haplotypes were classified into different haplogroups and the phylogenetic relationship between different haplogroups was inferred.

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

PubMed

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

[Sequencing and analysis of complete genome of rabies viruses isolated from Chinese Ferret-Badger and dog in Zhejiang province].

PubMed

Lei, Yong-Liang; Wang, Xiao-Guang; Tao, Xiao-Yan; Li, Hao; Meng, Sheng-Li; Chen, Xiu-Ying; Liu, Fu-Ming; Ye, Bi-Feng; Tang, Qing

2010-01-01

Based on sequencing the full-length genomes of four Chinese Ferret-Badger and dog, we analyze the properties of rabies viruses genetic variation in molecular level, get the information about rabies viruses prevalence and variation in Zhejiang, and enrich the genome database of rabies viruses street strains isolated from China. Rabies viruses in suckling mice were isolated, overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses from Chinese Ferret-Badger, dog, sika deer, vole, used vaccine strain were determined. The four full-length genomes were sequenced completely and had the same genetic structure with the length of 11, 923 nts or 11, 925 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions(IGRs), 423 nts-Pseudogene-like sequence (psi), 70 nts-Trailer. The four full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by BLAST and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the four full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so the nucleotide mutations happened in these four genomes were most synonymous mutations. Compared with the reference rabies viruses, the lengths of the five protein coding regions had no change, no recombination, only with a few point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the four genomes were similar to the reference vaccine or street strains. And the four strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessed the distinct district characteristics of China. Therefore, these four rabies viruses are likely to be street viruses already existing in the natural world.

Greater numbers of nucleotide substitutions are introduced into the genomic RNA of bovine viral diarrhea virus during acute infections of pregnant cattle than of non-pregnant cattle.

PubMed

Neill, John D; Newcomer, Benjamin W; Marley, Shonda D; Ridpath, Julia F; Givens, M Daniel

2012-08-06

Bovine viral diarrhea virus (BVDV) strains circulating in livestock herds show significant sequence variation. Conventional wisdom states that most sequence variation arises during acute infections in response to immune or other environmental pressures. A recent study showed that more nucleotide changes were introduced into the BVDV genomic RNA during the establishment of a single fetal persistent infection than following a series of acute infections of naïve cattle. However, it was not known if nucleotide changes were introduce when the virus crossed the placenta and infected the fetus or during the acute infection of the dam. The sequence of the open reading frame (ORF) from viruses isolated from four acutely infected pregnant heifers following exposure to persistently infected (PI) calves was compared to the sequences of the virus from the progenitor PI calf and the virus from the resulting progeny PI calf to determine when genetic change was introduced. This was compared to genetic change found in viruses isolated from a pregnant PI cow and its PI calf, and in three viruses isolated from acutely infected, non-pregnant cattle exposed to PI calves. Most genetic changes previously identified between the progenitor and progeny PI viruses were in place in the acute phase viruses isolated from the dams six days post-exposure to the progenitor PI calf. Additionally, each progeny PI virus had two to three unique nucleotide substitutions that were introduced in crossing the placenta and infection of the fetus. The nucleotide sequence of two acute phase viruses isolated from steers exposed to PI calves revealed that six and seven nucleotide changes were introduced during the acute infection. The sequence of the BVDV-2 virus isolated from an acute infection of a PI calf (BVDV-1a) co-housed with a BVDV-2 PI calf had ten nucleotides that were different from the progenitor PI virus. Finally, twenty nucleotide changes were identified in the PI virus of a calf born to a PI dam. These results demonstrate that nucleotide changes are introduced into the BVDV infecting pregnant cattle at rates of 2.3 to 8 fold higher then during the acute infection of non-pregnant animals.

Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes

USDA-ARS?s Scientific Manuscript database

Technical Abstract: 20-75 CHARACTER LINES A strategy for a genome-wide assessment of nucleotide diversity in a polyploid species must minimize the inclusion of homoeologous sequences into diversity estimates and reliably allocate individual haplotypes into respective genomes. In this study, nucle...

Characterization of four species of Trichuris (Nematoda: Enoplida) by their second internal transcribed spacer ribosomal DNA sequence.

PubMed

Oliveros, R; Cutillas, C; De Rojas, M; Arias, P

2000-12-01

Adult worms of Trichuris ovis and T. globulosa were collected from Ovis aries (sheep) and Capra hircus (goats). T. suis was isolated from Sus scrofa domestica (swine) and T. leporis was isolated from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and a ribosomal internal transcribed spacer (ITS2) was amplified and sequenced using polymerase-chain-reaction (PCR) techniques. The ITS2 of T. ovis and T. globulosa was 407 nucleotides in length and had a GC content of about 62%. Furthermore, the ITS2 of T. suis and T. leporis was 534 and 418 nucleotides in length and had a GC content of about 64.8% and 62.4%, respectively. There was evidence of slight variation in the sequence within individuals of all species analyzed, indicating intraindividual variation in the sequence of different copies of the ribosomal DNA. Furthermore, low-level intraspecific variation was detected. Sequence analyses of ITS2 products of T. ovis and T. globulosa demonstrated no sequence difference between them. Nevertheless, differences were detected between the ITS2 sequences of T. suis, T. leporis, and T. ovis, indicating that Trichuris species can reliably be differentiated by their ITS2 sequences and PCR-linked restriction-fragment-length polymorphism (RFLP).

A novel representation of the conformational structure of transfer RNAs. Correlation of the folding patterns of the polynucleotide chain with the base sequence and the nucleotide backbone torsions.

PubMed Central

Srinivasan, A R; Yathindra, N

1977-01-01

A novel description of the conformational characteristics of all the individual nucleotides and the phosphodiesters in tRNAs is presented in the form of a circular plot. This representation furnishes information of the base sequence with the folding patterns of the polynucleotide chain as one traverses along the circumference and with the individual nucleotide and phosphodiester linkage torsions along the radii. The circular plot obtained for yeast tRNAPhe strikingly distinguishes the helical and the loop regions. The variation of the different nucleotide torsions along the entire chain length and their effect on the secondary helical and tertiary loop regions become readily apparent. PMID:339206

A survey of copy number variation in the porcine genome detected from whole-genome sequence

USDA-ARS?s Scientific Manuscript database

An important challenge to post-genomic biology is relating observed phenotypic variation to the underlying genotypic variation. Genome-wide association studies (GWAS) have made thousands of connections between single nucleotide polymorphisms (SNPs) and phenotypes, implicating regions of the genome t...

Predicted stem-loop structures and variation in nucleotide sequence of 3' noncoding regions among animal calicivirus genomes.

PubMed

Seal, B S; Neill, J D; Ridpath, J F

1994-07-01

Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.

Annotate-it: a Swiss-knife approach to annotation, analysis and interpretation of single nucleotide variation in human disease

PubMed Central

2012-01-01

The increasing size and complexity of exome/genome sequencing data requires new tools for clinical geneticists to discover disease-causing variants. Bottlenecks in identifying the causative variation include poor cross-sample querying, constantly changing functional annotation and not considering existing knowledge concerning the phenotype. We describe a methodology that facilitates exploration of patient sequencing data towards identification of causal variants under different genetic hypotheses. Annotate-it facilitates handling, analysis and interpretation of high-throughput single nucleotide variant data. We demonstrate our strategy using three case studies. Annotate-it is freely available and test data are accessible to all users at http://www.annotate-it.org. PMID:23013645

Genomic stability of adipogenic human adenovirus 36.

PubMed

Nam, J-H; Na, H-N; Atkinson, R L; Dhurandhar, N V

2014-02-01

Human adenovirus Ad36 increases adiposity in several animal models, including rodents and non-human primates. Importantly, Ad36 is associated with human obesity, which has prompted research to understand its epidemiology and to develop a vaccine to prevent a subgroup of obesity. For this purpose, understanding the genomic stability of Ad36 in vivo and in vitro infections is critical. Here, we examined whether in vitro cell passaging over a 14-year period introduced any genetic variation in Ad36. We sequenced the whole genome of Ad36-which was plaque purified in 1998 from the original strain obtained from American Type Culture Collection, and passaged approximately 12 times over the past 14 years (Ad36-2012). This DNA sequence was compared with a previously published sequence of Ad36 likely obtained from the same source (Ad36-1988). Compared with Ad36-1988, only two nucleotides were altered in Ad36-2012: a T insertion at nucleotide 1862, which may induce early termination of the E1B viral protein, and a T➝C transition at nucleotide 26 136. Virus with the T insertion (designated Ad36-2012-T6) was mixed with wild-type virus lacking the T insertion (designated Ad36-2012-T5) in the viral stock. The transition at nucleotide 26 136 does not change the encoded amino acid (aspartic acid) in the pVIII viral protein. The rate of genetic variation in Ad36 is ∼2.37 × 10(-6) mutations/nucleotide/passage. Of particular importance, there were no mutations in the E4orf1 gene, the critical gene for producing obesity. This very-low-variation rate should reduce concerns about genetic variability when developing Ad36 vaccines or developing assays for detecting Ad36 infection in populations.

Phylogenetic Network for European mtDNA

PubMed Central

Finnilä, Saara; Lehtonen, Mervi S.; Majamaa, Kari

2001-01-01

The sequence in the first hypervariable segment (HVS-I) of the control region has been used as a source of evolutionary information in most phylogenetic analyses of mtDNA. Population genetic inference would benefit from a better understanding of the variation in the mtDNA coding region, but, thus far, complete mtDNA sequences have been rare. We determined the nucleotide sequence in the coding region of mtDNA from 121 Finns, by conformation-sensitive gel electrophoresis and subsequent sequencing and by direct sequencing of the D loop. Furthermore, 71 sequences from our previous reports were included, so that the samples represented all the mtDNA haplogroups present in the Finnish population. We found a total of 297 variable sites in the coding region, which allowed the compilation of unambiguous phylogenetic networks. The D loop harbored 104 variable sites, and, in most cases, these could be localized within the coding-region networks, without discrepancies. Interestingly, many homoplasies were detected in the coding region. Nucleotide variation in the rRNA and tRNA genes was 6%, and that in the third nucleotide positions of structural genes amounted to 22% of that in the HVS-I. The complete networks enabled the relationships between the mtDNA haplogroups to be analyzed. Phylogenetic networks based on the entire coding-region sequence in mtDNA provide a rich source for further population genetic studies, and complete sequences make it easier to differentiate between disease-causing mutations and rare polymorphisms. PMID:11349229

Full genome sequence of Rocio virus reveal substantial variations from the prototype Rocio virus SPH 34675 sequence.

PubMed

Setoh, Yin Xiang; Amarilla, Alberto A; Peng, Nias Y; Slonchak, Andrii; Periasamy, Parthiban; Figueiredo, Luiz T M; Aquino, Victor H; Khromykh, Alexander A

2018-01-01

Rocio virus (ROCV) is an arbovirus belonging to the genus Flavivirus, family Flaviviridae. We present an updated sequence of ROCV strain SPH 34675 (GenBank: AY632542.4), the only available full genome sequence prior to this study. Using next-generation sequencing of the entire genome, we reveal substantial sequence variation from the prototype sequence, with 30 nucleotide differences amounting to 14 amino acid changes, as well as significant changes to predicted 3'UTR RNA structures. Our results present an updated and corrected sequence of a potential emerging human-virulent flavivirus uniquely indigenous to Brazil (GenBank: MF461639).

Single nucleotide variations: Biological impact and theoretical interpretation

PubMed Central

Katsonis, Panagiotis; Koire, Amanda; Wilson, Stephen Joseph; Hsu, Teng-Kuei; Lua, Rhonald C; Wilkins, Angela Dawn; Lichtarge, Olivier

2014-01-01

Genome-wide association studies (GWAS) and whole-exome sequencing (WES) generate massive amounts of genomic variant information, and a major challenge is to identify which variations drive disease or contribute to phenotypic traits. Because the majority of known disease-causing mutations are exonic non-synonymous single nucleotide variations (nsSNVs), most studies focus on whether these nsSNVs affect protein function. Computational studies show that the impact of nsSNVs on protein function reflects sequence homology and structural information and predict the impact through statistical methods, machine learning techniques, or models of protein evolution. Here, we review impact prediction methods and discuss their underlying principles, their advantages and limitations, and how they compare to and complement one another. Finally, we present current applications and future directions for these methods in biological research and medical genetics. PMID:25234433

Mitochondrial genome nucleotide substitution pattern between domesticated silkmoth, Bombyx mori, and its wild ancestors, Chinese Bombyx mandarina and Japanese Bombyx mandarina

PubMed Central

2010-01-01

Bombyx mori and Bombyx mandarina are morphologically and physiologically similar. In this study, we compared the nucleotide variations in the complete mitochondrial (mt) genomes between the domesticated silkmoth, B. mori, and its wild ancestors, Chinese B. mandarina (ChBm) and Japanese B. mandarina (JaBm). The sequence divergence and transition mutation ratio between B. mori and ChBm are significantly smaller than those observed between B. mori and JaBm. The preference of transition by DNA strands between B. mori and ChBm is consistent with that between B. mori and JaBm, however, the regional variation in nucleotide substitution rate shows a different feature. These results suggest that the ChBm mt genome is not undergoing the same evolutionary process as JaBm, providing evidence for selection on mtDNA. Moreover, investigation of the nucleotide sequence divergence in the A+T-rich region of Bombyx mt genomes also provides evidence for the assumption that the A+T-rich region might not be the fastest evolving region of the mtDNA of insects. PMID:21637625

[Complete genome sequencing and analyses of rabies viruses isolated from wild animals (Chinese Ferret-Badger) in Zhejiang province].

PubMed

Lei, Yong-Liang; Wang, Xiao-Guang; Liu, Fu-Ming; Chen, Xiu-Ying; Ye, Bi-Feng; Mei, Jian-Hua; Lan, Jin-Quan; Tang, Qing

2009-08-01

Based on sequencing the full-length genomes of two Chinese Ferret-Badger, we analyzed the properties of rabies viruses genetic variation in molecular level to get information on prevalence and variation of rabies viruses in Zhejiang, and to enrich the genome database of rabies viruses street strains isolated from Chinese wildlife. Overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses of the N genes from Chinese Ferret-Badger, sika deer, vole, dog. Vaccine strains were then determined. The two full-length genomes were completely sequenced to find out that they had the same genetic structure with 11 923 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions (IGRs), 423 nts-Pseudogene-like sequence (Psi), 70 nts-Trailer. The two full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by blast and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the two full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so that the nucleotide mutations happened in these two genomes were most probably as synonymous mutations. Compared to the referenced rabies viruses, the lengths of the five protein coding regions did not show any changes or recombination, but only with a few-point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the two ferret badgers genomes were similar to the referenced vaccine or street strains. The two strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessing the distinct geographyphic characteristics of China. All the evidence suggested a cue that these two ferret badgers rabies viruses were likely to be street virus that already circulating in wildlife.

Differential sequence diversity at merozoite surface protein-1 locus of Plasmodium knowlesi from humans and macaques in Thailand.

PubMed

Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai

2013-08-01

To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

Developing 100K Affymetrix Axiom SNP Array for Polyploid Sugarcane

USDA-ARS?s Scientific Manuscript database

Sugarcane genotyping or fingerprinting has long been a daunting task due to its high polyploidy level with large number of chromosomes. Single nucleotide polymorphisms (SNPs) are very abundant DNA sequence variations in the genomes. With the advance of next generation sequencing (NGS) technologies, ...

Fluorescent signatures for variable DNA sequences

PubMed Central

Rice, John E.; Reis, Arthur H.; Rice, Lisa M.; Carver-Brown, Rachel K.; Wangh, Lawrence J.

2012-01-01

Life abounds with genetic variations writ in sequences that are often only a few hundred nucleotides long. Rapid detection of these variations for identification of genetic diseases, pathogens and organisms has become the mainstay of molecular science and medicine. This report describes a new, highly informative closed-tube polymerase chain reaction (PCR) strategy for analysis of both known and unknown sequence variations. It combines efficient quantitative amplification of single-stranded DNA targets through LATE-PCR with sets of Lights-On/Lights-Off probes that hybridize to their target sequences over a broad temperature range. Contiguous pairs of Lights-On/Lights-Off probes of the same fluorescent color are used to scan hundreds of nucleotides for the presence of mutations. Sets of probes in different colors can be combined in the same tube to analyze even longer single-stranded targets. Each set of hybridized Lights-On/Lights-Off probes generates a composite fluorescent contour, which is mathematically converted to a sequence-specific fluorescent signature. The versatility and broad utility of this new technology is illustrated in this report by characterization of variant sequences in three different DNA targets: the rpoB gene of Mycobacterium tuberculosis, a sequence in the mitochondrial cytochrome C oxidase subunit 1 gene of nematodes and the V3 hypervariable region of the bacterial 16 s ribosomal RNA gene. We anticipate widespread use of these technologies for diagnostics, species identification and basic research. PMID:22879378

Translational genomics for analysis of complex traits in peanut and sorghum

USDA-ARS?s Scientific Manuscript database

The integration of sequencing and genotype data from natural variation studies (by whole genome resequencing [wgs] or genotype by sequencing [gbs]), transcriptome (RNA-seq) and mutant analysis (also by wgs) facilitated the development of DNA markers in the form of single nucleotide polymorphic (SNP)...

Development and utilization of 100K SNP array in Saccharum Spp.

USDA-ARS?s Scientific Manuscript database

Sugarcane genotyping or fingerprinting has long been a daunting task due to its high polyploidy level with large number of chromosomes. Single nucleotide polymorphisms (SNPs) are very abundant DNA sequence variations in the genome. With the advance of next generation sequencing (NGS) technologies, m...

Genetic diversity among isolates of Autographa californica multiple nucleopolyhedrovirus

USDA-ARS?s Scientific Manuscript database

Our knowledge of genetic variation at the nucleotide sequence level of Autographa californica multiple nucleopolyhedrovirus (AcMNPV; Baculoviridae: Alphabaculovirus) derives from complete genome sequences of the C6 clonal isolate of AcMNPV and the R1 and CL3 clonal isolates of AcMNPV variants Rachip...

Tandemly repeated sequences in mtDNA control region of whitefish, Coregonus lavaretus.

PubMed

Brzuzan, P

2000-06-01

Length variation of the mitochondrial DNA control region was observed with PCR amplification of a sample of 138 whitefish (Coregonus lavaretus). Nucleotide sequences of representative PCR products showed that the variation was due to the presence of an approximately 100-bp motif tandemly repeated two, three, or five times in the region between the conserved sequence block-3 (CSB-3) and the gene for phenylalanine tRNA. This is the first report on the tandem array composed of long repeat units in mitochondrial DNA of salmonids.

Sequence variation and phylogenetic analysis of envelope glycoprotein of hepatitis G virus.

PubMed

Lim, M Y; Fry, K; Yun, A; Chong, S; Linnen, J; Fung, K; Kim, J P

1997-11-01

A transfusion-transmissible agent provisionally designated hepatitis G virus (HGV) was recently identified. In this study, we examined the variability of the HGV genome by analysing sequences in the putative envelope region from 72 isolates obtained from diverse geographical sources. The 1561 nucleotide sequence of the E1/E2/NS2a region of HGV was determined from 12 isolates, and compared with three published sequences. The most variability was observed in 400 nucleotides at the N terminus of E2. We next analysed this 400 nucleotide envelope variable region (EV) from an additional 60 HGV isolates. This sequence varied considerably among the 75 isolates, with overall identity ranging from 79.3% to 99.5% at the nucleotide level, and from 83.5% to 100% at the amino acid level. However, hypervariable regions were not identified. Phylogenetic analyses indicated that the 75 HGV isolates belong to a single genotype. A single-tier distribution of evolutionary distances was observed among the 15 E1/E2/NS2a sequences and the 75 EV sequences. In contrast, 11 isolates of HCV were analysed and showed a three-tiered distribution, representing genotypes, subtypes, and isolates. The 75 isolates of HGV fell into four clusters on the phylogenetic tree. Tight geographical clustering was observed among the HGV isolates from Japan and Korea.

Simian immunodeficiency viruses from African green monkeys display unusual genetic diversity.

PubMed Central

Johnson, P R; Fomsgaard, A; Allan, J; Gravell, M; London, W T; Olmsted, R A; Hirsch, V M

1990-01-01

African green monkeys are asymptomatic carriers of simian immunodeficiency viruses (SIV), commonly called SIVagm. As many as 50% of African green monkeys in the wild may be SIV seropositive. This high seroprevalence rate and the potential for genetic variation of lentiviruses suggested to us that African green monkeys may harbor widely differing genotypes of SIVagm. To investigate this hypothesis, we determined the entire nucleotide sequence of an infectious proviral molecular clone of SIVagm (155-4) and partial sequences (long terminal repeat and Gag) of three other distinct SIVagm isolates (90, gri-1, and ver-1). Comparisons among the SIVagm isolates revealed extreme diversity at the nucleotide and amino acid levels. Long terminal repeat nucleotide sequences varied up to 35% and Gag protein sequences varied up to 30%. The variability among SIVagm isolates exceeded the variability among any other group of primate lentiviruses. Our data suggest that SIVagm has been in the African green monkey population for a long time and may be the oldest primate lentivirus group in existence. PMID:2304139

3D RNA and functional interactions from evolutionary couplings

PubMed Central

Weinreb, Caleb; Riesselman, Adam; Ingraham, John B.; Gross, Torsten; Sander, Chris; Marks, Debora S.

2016-01-01

Summary Non-coding RNAs are ubiquitous, but the discovery of new RNA gene sequences far outpaces research on their structure and functional interactions. We mine the evolutionary sequence record to derive precise information about function and structure of RNAs and RNA-protein complexes. As in protein structure prediction, we use maximum entropy global probability models of sequence co-variation to infer evolutionarily constrained nucleotide-nucleotide interactions within RNA molecules, and nucleotide-amino acid interactions in RNA-protein complexes. The predicted contacts allow all-atom blinded 3D structure prediction at good accuracy for several known RNA structures and RNA-protein complexes. For unknown structures, we predict contacts in 160 non-coding RNA families. Beyond 3D structure prediction, evolutionary couplings help identify important functional interactions, e.g., at switch points in riboswitches and at a complex nucleation site in HIV. Aided by accelerating sequence accumulation, evolutionary coupling analysis can accelerate the discovery of functional interactions and 3D structures involving RNA. PMID:27087444

Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

PubMed

Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

2009-08-13

Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

High-resolution genetic map for understanding the effect of genome-wide recombination rate, selection sweep and linkage disequilibrium on nucleotide diversity in watermelon

USDA-ARS?s Scientific Manuscript database

Genotyping by sequencing (GBS) technology was used to identify a set of 9,933 single nucleotide polymorphism (SNP) markers for constructing a high-resolution genetic map of 1,087 cM for watermelon. The genome-wide variation of recombination rate (GWRR) across the map was evaluated and a positive co...

[Identification and phylogenetic application of unique nucleotide sequence of nad7 intron2 in Rhodiola (Crassulaceae) species].

PubMed

Deng, Ke-Jun; Yang, Zu-Jun; Liu, Cheng; Zhao, Wei; Liu, Chang; Feng, Juan; Ren, Zheng-Long

2007-03-01

Genetic characterization of 9 populations of Rhodiola crenulata, R. fastigiata and R. sachalinensis (Crassulaceae) species from Sichuan and Jilin Provinces of China, was investigated using the conserved primer of nad7 intron 2. All PCR products about 800 bp long were shorter than other Crassulaceae plants, which were used as molecular markers to identify the Rhodiola species. The sequence of the products indicated that total exon of 53 bp and intron of 738 bp exhibit only 9 nucleotide variations. Blasting the nad7 sequences to GenBank and the phylogenetic analysis showed that the sequence of Rhodiola species was clusted independently, and the length was smaller than all the registered sequences of higher plants. The result suggests that the Rhiodola species had a unique sequence in this gene region, which might be related to the special growth condition.

Identification and Characterization of Novel Variations in Platelet G-Protein Coupled Receptor (GPCR) Genes in Patients Historically Diagnosed with Type 1 von Willebrand Disease.

PubMed

Stockley, Jacqueline; Nisar, Shaista P; Leo, Vincenzo C; Sabi, Essa; Cunningham, Margaret R; Eikenboom, Jeroen C; Lethagen, Stefan; Schneppenheim, Reinhard; Goodeve, Anne C; Watson, Steve P; Mundell, Stuart J; Daly, Martina E

2015-01-01

The clinical expression of type 1 von Willebrand disease may be modified by co-inheritance of other mild bleeding diatheses. We previously showed that mutations in the platelet P2Y12 ADP receptor gene (P2RY12) could contribute to the bleeding phenotype in patients with type 1 von Willebrand disease. Here we investigated whether variations in platelet G protein-coupled receptor genes other than P2RY12 also contributed to the bleeding phenotype. Platelet G protein-coupled receptor genes P2RY1, F2R, F2RL3, TBXA2R and PTGIR were sequenced in 146 index cases with type 1 von Willebrand disease and the potential effects of identified single nucleotide variations were assessed using in silico methods and heterologous expression analysis. Seven heterozygous single nucleotide variations were identified in 8 index cases. Two single nucleotide variations were detected in F2R; a novel c.-67G>C transversion which reduced F2R transcriptional activity and a rare c.1063C>T transition predicting a p.L355F substitution which did not interfere with PAR1 expression or signalling. Two synonymous single nucleotide variations were identified in F2RL3 (c.402C>G, p.A134 =; c.1029 G>C p.V343 =), both of which introduced less commonly used codons and were predicted to be deleterious, though neither of them affected PAR4 receptor expression. A third single nucleotide variation in F2RL3 (c.65 C>A; p.T22N) was co-inherited with a synonymous single nucleotide variation in TBXA2R (c.6680 C>T, p.S218 =). Expression and signalling of the p.T22N PAR4 variant was similar to wild-type, while the TBXA2R variation introduced a cryptic splice site that was predicted to cause premature termination of protein translation. The enrichment of single nucleotide variations in G protein-coupled receptor genes among type 1 von Willebrand disease patients supports the view of type 1 von Willebrand disease as a polygenic disorder.

Mapping copy number variation by population-scale genome sequencing.

PubMed

Mills, Ryan E; Walter, Klaudia; Stewart, Chip; Handsaker, Robert E; Chen, Ken; Alkan, Can; Abyzov, Alexej; Yoon, Seungtai Chris; Ye, Kai; Cheetham, R Keira; Chinwalla, Asif; Conrad, Donald F; Fu, Yutao; Grubert, Fabian; Hajirasouliha, Iman; Hormozdiari, Fereydoun; Iakoucheva, Lilia M; Iqbal, Zamin; Kang, Shuli; Kidd, Jeffrey M; Konkel, Miriam K; Korn, Joshua; Khurana, Ekta; Kural, Deniz; Lam, Hugo Y K; Leng, Jing; Li, Ruiqiang; Li, Yingrui; Lin, Chang-Yun; Luo, Ruibang; Mu, Xinmeng Jasmine; Nemesh, James; Peckham, Heather E; Rausch, Tobias; Scally, Aylwyn; Shi, Xinghua; Stromberg, Michael P; Stütz, Adrian M; Urban, Alexander Eckehart; Walker, Jerilyn A; Wu, Jiantao; Zhang, Yujun; Zhang, Zhengdong D; Batzer, Mark A; Ding, Li; Marth, Gabor T; McVean, Gil; Sebat, Jonathan; Snyder, Michael; Wang, Jun; Ye, Kenny; Eichler, Evan E; Gerstein, Mark B; Hurles, Matthew E; Lee, Charles; McCarroll, Steven A; Korbel, Jan O

2011-02-03

Genomic structural variants (SVs) are abundant in humans, differing from other forms of variation in extent, origin and functional impact. Despite progress in SV characterization, the nucleotide resolution architecture of most SVs remains unknown. We constructed a map of unbalanced SVs (that is, copy number variants) based on whole genome DNA sequencing data from 185 human genomes, integrating evidence from complementary SV discovery approaches with extensive experimental validations. Our map encompassed 22,025 deletions and 6,000 additional SVs, including insertions and tandem duplications. Most SVs (53%) were mapped to nucleotide resolution, which facilitated analysing their origin and functional impact. We examined numerous whole and partial gene deletions with a genotyping approach and observed a depletion of gene disruptions amongst high frequency deletions. Furthermore, we observed differences in the size spectra of SVs originating from distinct formation mechanisms, and constructed a map of SV hotspots formed by common mechanisms. Our analytical framework and SV map serves as a resource for sequencing-based association studies.

Comparison and correlation of Simple Sequence Repeats distribution in genomes of Brucella species

PubMed Central

Kiran, Jangampalli Adi Pradeep; Chakravarthi, Veeraraghavulu Praveen; Kumar, Yellapu Nanda; Rekha, Somesula Swapna; Kruti, Srinivasan Shanthi; Bhaskar, Matcha

2011-01-01

Computational genomics is one of the important tools to understand the distribution of closely related genomes including simple sequence repeats (SSRs) in an organism, which gives valuable information regarding genetic variations. The central objective of the present study was to screen the SSRs distributed in coding and non-coding regions among different human Brucella species which are involved in a range of pathological disorders. Computational analysis of the SSRs in the Brucella indicates few deviations from expected random models. Statistical analysis also reveals that tri-nucleotide SSRs are overrepresented and tetranucleotide SSRs underrepresented in Brucella genomes. From the data, it can be suggested that over expressed tri-nucleotide SSRs in genomic and coding regions might be responsible in the generation of functional variation of proteins expressed which in turn may lead to different pathogenicity, virulence determinants, stress response genes, transcription regulators and host adaptation proteins of Brucella genomes. Abbreviations SSRs - Simple Sequence Repeats, ORFs - Open Reading Frames. PMID:21738309

Typing and comparative genome analysis of Brucella melitensis isolated from Lebanon.

PubMed

Abou Zaki, Natalia; Salloum, Tamara; Osman, Marwan; Rafei, Rayane; Hamze, Monzer; Tokajian, Sima

2017-10-16

Brucella melitensis is the main causative agent of the zoonotic disease brucellosis. This study aimed at typing and characterizing genetic variation in 33 Brucella isolates recovered from patients in Lebanon. Bruce-ladder multiplex PCR and PCR-RFLP of omp31, omp2a and omp2b were performed. Sixteen representative isolates were chosen for draft-genome sequencing and analyzed to determine variations in virulence, resistance, genomic islands, prophages and insertion sequences. Comparative whole-genome single nucleotide polymorphism analysis was also performed. The isolates were confirmed to be B. melitensis. Genome analysis revealed multiple virulence determinants and efflux pumps. Genome comparisons and single nucleotide polymorphisms divided the isolates based on geographical distribution but revealed high levels of similarity between the strains. Sequence divergence in B. melitensis was mainly due to lateral gene transfer of mobile elements. This is the first report of an in-depth genomic characterization of B. melitensis in Lebanon. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Parallel gene analysis with allele-specific padlock probes and tag microarrays

PubMed Central

Banér, Johan; Isaksson, Anders; Waldenström, Erik; Jarvius, Jonas; Landegren, Ulf; Nilsson, Mats

2003-01-01

Parallel, highly specific analysis methods are required to take advantage of the extensive information about DNA sequence variation and of expressed sequences. We present a scalable laboratory technique suitable to analyze numerous target sequences in multiplexed assays. Sets of padlock probes were applied to analyze single nucleotide variation directly in total genomic DNA or cDNA for parallel genotyping or gene expression analysis. All reacted probes were then co-amplified and identified by hybridization to a standard tag oligonucleotide array. The technique was illustrated by analyzing normal and pathogenic variation within the Wilson disease-related ATP7B gene, both at the level of DNA and RNA, using allele-specific padlock probes. PMID:12930977

Role of DNA conformation & energetic insights in Msx-1-DNA recognition as revealed by molecular dynamics studies on specific and nonspecific complexes.

PubMed

Kachhap, Sangita; Singh, Balvinder

2015-01-01

In most of homeodomain-DNA complexes, glutamine or lysine is present at 50th position and interacts with 5th and 6th nucleotide of core recognition region. Molecular dynamics simulations of Msx-1-DNA complex (Q50-TG) and its variant complexes, that is specific (Q50K-CC), nonspecific (Q50-CC) having mutation in DNA and (Q50K-TG) in protein, have been carried out. Analysis of protein-DNA interactions and structure of DNA in specific and nonspecific complexes show that amino acid residues use sequence-dependent shape of DNA to interact. The binding free energies of all four complexes were analysed to define role of amino acid residue at 50th position in terms of binding strength considering the variation in DNA on stability of protein-DNA complexes. The order of stability of protein-DNA complexes shows that specific complexes are more stable than nonspecific ones. Decomposition analysis shows that N-terminal amino acid residues have been found to contribute maximally in binding free energy of protein-DNA complexes. Among specific protein-DNA complexes, K50 contributes more as compared to Q50 towards binding free energy in respective complexes. The sequence dependence of local conformation of DNA enables Q50/Q50K to make hydrogen bond with nucleotide(s) of DNA. The changes in amino acid sequence of protein are accommodated and stabilized around TAAT core region of DNA having variation in nucleotides.

An analytical framework for whole-genome sequence association studies and its implications for autism spectrum disorder.

PubMed

Werling, Donna M; Brand, Harrison; An, Joon-Yong; Stone, Matthew R; Zhu, Lingxue; Glessner, Joseph T; Collins, Ryan L; Dong, Shan; Layer, Ryan M; Markenscoff-Papadimitriou, Eirene; Farrell, Andrew; Schwartz, Grace B; Wang, Harold Z; Currall, Benjamin B; Zhao, Xuefang; Dea, Jeanselle; Duhn, Clif; Erdman, Carolyn A; Gilson, Michael C; Yadav, Rachita; Handsaker, Robert E; Kashin, Seva; Klei, Lambertus; Mandell, Jeffrey D; Nowakowski, Tomasz J; Liu, Yuwen; Pochareddy, Sirisha; Smith, Louw; Walker, Michael F; Waterman, Matthew J; He, Xin; Kriegstein, Arnold R; Rubenstein, John L; Sestan, Nenad; McCarroll, Steven A; Neale, Benjamin M; Coon, Hilary; Willsey, A Jeremy; Buxbaum, Joseph D; Daly, Mark J; State, Matthew W; Quinlan, Aaron R; Marth, Gabor T; Roeder, Kathryn; Devlin, Bernie; Talkowski, Michael E; Sanders, Stephan J

2018-05-01

Genomic association studies of common or rare protein-coding variation have established robust statistical approaches to account for multiple testing. Here we present a comparable framework to evaluate rare and de novo noncoding single-nucleotide variants, insertion/deletions, and all classes of structural variation from whole-genome sequencing (WGS). Integrating genomic annotations at the level of nucleotides, genes, and regulatory regions, we define 51,801 annotation categories. Analyses of 519 autism spectrum disorder families did not identify association with any categories after correction for 4,123 effective tests. Without appropriate correction, biologically plausible associations are observed in both cases and controls. Despite excluding previously identified gene-disrupting mutations, coding regions still exhibited the strongest associations. Thus, in autism, the contribution of de novo noncoding variation is probably modest in comparison to that of de novo coding variants. Robust results from future WGS studies will require large cohorts and comprehensive analytical strategies that consider the substantial multiple-testing burden.

A combination of PhP typing and β-d-glucuronidase gene sequence variation analysis for differentiation of Escherichia coli from humans and animals.

PubMed

Masters, N; Christie, M; Katouli, M; Stratton, H

2015-06-01

We investigated the usefulness of the β-d-glucuronidase gene variance in Escherichia coli as a microbial source tracking tool using a novel algorithm for comparison of sequences from a prescreened set of host-specific isolates using a high-resolution PhP typing method. A total of 65 common biochemical phenotypes belonging to 318 E. coli strains isolated from humans and domestic and wild animals were analysed for nucleotide variations at 10 loci along a 518 bp fragment of the 1812 bp β-d-glucuronidase gene. Neighbour-joining analysis of loci variations revealed 86 (76.8%) human isolates and 91.2% of animal isolates were correctly identified. Pairwise hierarchical clustering improved assignment; where 92 (82.1%) human and 204 (99%) animal strains were assigned to their respective cluster. Our data show that initial typing of isolates and selection of common types from different hosts prior to analysis of the β-d-glucuronidase gene sequence improves source identification. We also concluded that numerical profiling of the nucleotide variations can be used as a valuable approach to differentiate human from animal E. coli. This study signifies the usefulness of the β-d-glucuronidase gene as a marker for differentiating human faecal pollution from animal sources.

Role of promoter DNA sequence variations on the binding of EGR1 transcription factor.

PubMed

Mikles, David C; Schuchardt, Brett J; Bhat, Vikas; McDonald, Caleb B; Farooq, Amjad

2014-05-01

In response to a wide variety of stimuli such as growth factors and hormones, EGR1 transcription factor is rapidly induced and immediately exerts downstream effects central to the maintenance of cellular homeostasis. Herein, our biophysical analysis reveals that DNA sequence variations within the target gene promoters tightly modulate the energetics of binding of EGR1 and that nucleotide substitutions at certain positions are much more detrimental to EGR1-DNA interaction than others. Importantly, the reduction in binding affinity poorly correlates with the loss of enthalpy and gain of entropy-a trend indicative of a complex interplay between underlying thermodynamic factors due to the differential role of water solvent upon nucleotide substitution. We also provide a rationale for the physical basis of the effect of nucleotide substitutions on the EGR1-DNA interaction at atomic level. Taken together, our study bears important implications on understanding the molecular determinants of a key protein-DNA interaction at the cross-roads of human health and disease. Copyright © 2014 Elsevier Inc. All rights reserved.

Isolation and molecular characterization of partial FSH and LH receptor genes in Arabian camels (Camelus dromedarius)

PubMed Central

Jelokhani-Niaraki, Saber; Tahmoorespur, Mojtaba; Bitaraf-Sani, Morteza

2015-01-01

Very little is known about LHR and FSHR genes of domestic dromedary camels. The main objective of this study was to determine and analyze partial genomic regions of FSHR and LHR genes in dromedary camels for the first time. To this end, a total of50 DNA samples belonging to dromedary camels raised in Iran were sent for sequencing (25 samples of each gene). We compared the nucleotide sequences of Camelus dromedarius with corresponding sequences of previously published FSHR and LHR genes in bactrian camels and other species. According to the data, the same nucleotide variation was identified in both regions of the two camel species. The alignment of deduced protein sequences of the two different species revealed an amino acid variation at the FSHR region. No evidence of amino acid variation was observed, however, in LHR sequences. Phylogenetic analysis indicated that both camel species had a close relationship and clustered together in a separate branch. This was further confirmed by genetic distance values illustrating significant sequence identity between Camelus dromedarius and Camelus bactrianus. Interestingly, sequence comparisons revealed heterozygote patterns in FSHR sequences isolated from dromedary camels of Iran. In comparison to other species, this camel contains three amino acid substitutions at 5, 67, and 105 positions in the FSHR coding region. These positions are found exclusively in camels and can be considered as species specific. The results of our study can be used for hormone functionality research (FSHR and LHR) as well as reproduction-linked polymorphisms and breeding programs. PMID:27844002

Isolation and molecular characterization of partial FSH and LH receptor genes in Arabian camels (Camelus dromedarius).

PubMed

Jelokhani-Niaraki, Saber; Tahmoorespur, Mojtaba; Bitaraf-Sani, Morteza

2015-06-01

Very little is known about LHR and FSHR genes of domestic dromedary camels. The main objective of this study was to determine and analyze partial genomic regions of FSHR and LHR genes in dromedary camels for the first time. To this end, a total of50 DNA samples belonging to dromedary camels raised in Iran were sent for sequencing (25 samples of each gene). We compared the nucleotide sequences of Camelus dromedarius with corresponding sequences of previously published FSHR and LHR genes in bactrian camels and other species. According to the data, the same nucleotide variation was identified in both regions of the two camel species. The alignment of deduced protein sequences of the two different species revealed an amino acid variation at the FSHR region. No evidence of amino acid variation was observed, however, in LHR sequences. Phylogenetic analysis indicated that both camel species had a close relationship and clustered together in a separate branch. This was further confirmed by genetic distance values illustrating significant sequence identity between Camelus dromedarius and Camelus bactrianus . Interestingly, sequence comparisons revealed heterozygote patterns in FSHR sequences isolated from dromedary camels of Iran. In comparison to other species, this camel contains three amino acid substitutions at 5, 67, and 105 positions in the FSHR coding region. These positions are found exclusively in camels and can be considered as species specific. The results of our study can be used for hormone functionality research ( FSHR and LHR ) as well as reproduction-linked polymorphisms and breeding programs.

Genetic variation of coat protein gene among the isolates of Rice tungro spherical virus from tungro-endemic states of the India.

PubMed

Mangrauthia, Satendra K; Malathi, P; Agarwal, Surekha; Ramkumar, G; Krishnaveni, D; Neeraja, C N; Madhav, M Sheshu; Ladhalakshmi, D; Balachandran, S M; Viraktamath, B C

2012-06-01

Rice tungro disease, one of the major constraints to rice production in South and Southeast Asia, is caused by a combination of two viruses: Rice tungro spherical virus (RTSV) and Rice tungro bacilliform virus (RTBV). The present study was undertaken to determine the genetic variation of RTSV population present in tungro endemic states of Indian subcontinent. Phylogenetic analysis based on coat protein sequences showed distinct divergence of Indian RTSV isolates into two groups; one consisted isolates from Hyderabad (Andhra Pradesh), Cuttack (Orissa), and Puducherry and another from West Bengal, Coimbatore (Tamil Nadu), and Kanyakumari (Tamil Nadu). The results obtained from phylogenetic study were further supported with the SNPs (single nucleotide polymorphism), INDELs (insertion and deletion) and evolutionary distance analysis. In addition, sequence difference count matrix revealed 2-68 nucleotides differences among all the Indian RTSV isolates taken in this study. However, at the protein level these differences were not significant as revealed by Ka/Ks ratio calculation. Sequence identity at nucleotide and amino acid level was 92-100% and 97-100%, respectively, among Indian isolates of RTSV. Understanding of the population structure of RTSV from tungro endemic regions of India would potentially provide insights into the molecular diversification of this virus.

Gene expression divergence and nucleotide differentiation between males of different color morphs and mating strategies in the ruff

PubMed Central

Ekblom, Robert; Farrell, Lindsay L; Lank, David B; Burke, Terry

2012-01-01

By next generation transcriptome sequencing, it is possible to obtain data on both nucleotide sequence variation and gene expression. We have used this approach (RNA-Seq) to investigate the genetic basis for differences in plumage coloration and mating strategies in a non-model bird species, the ruff (Philomachus pugnax). Ruff males show enormous variation in the coloration of ornamental feathers, used for individual recognition. This polymorphism is linked to reproductive strategies, with dark males (Independents) defending territories on leks against other Independents, whereas white morphs (Satellites) co-occupy Independent's courts without agonistic interactions. Previous work found a strong genetic component for mating strategy, but the genes involved were not identified. We present feather transcriptome data of more than 6,000 de-novo sequenced ruff genes (although with limited coverage for many of them). None of the identified genes showed significant expression divergence between males, but many genetic markers showed nucleotide differentiation between different color morphs and mating strategies. These include several feather keratin genes, splicing factors, and the Xg blood-group gene. Many of the genes with significant genetic structure between mating strategies have not yet been annotated and their functions remain to be elucidated. We also conducted in-depth investigations of 28 pre-identified coloration candidate genes. Two of these (EDNRB and TYR) were specifically expressed in black- and rust-colored males, respectively. We have demonstrated the utility of next generation transcriptome sequencing for identifying and genotyping large number of genetic markers in a non-model species without previous genomic resources, and highlight the potential of this approach for addressing the genetic basis of ecologically important variation. PMID:23145334

Nucleotide diversity at two phytochrome loci along a latitudinal cline in Pinus sylvestris.

PubMed

García-Gil, M R; Mikkonen, M; Savolainen, O

2003-05-01

Forest tree species provide many examples of well-studied adaptive differentiation, where the search for the underlying genes might be possible. In earlier studies and in our common conditions in a greenhouse, northern populations set bud earlier than southern ones. A difference in latitude of origin of one degree corresponded to a change of 1.4 days in number of days to terminal bud set of seedlings. Earlier physiological and ecological genetics work in conifers and other plants have suggested that such variation could be governed by phytochromes. Nucleotide variation was examined at two phytochrome loci (PHYP and PHYO, homologues of the Arabidopsis thaliana PHYB and PHYA, respectively) in three populations: northern Finland, southern Finland and northern Spain. In our samples of 12-15 sequences (2980 and 1156 base pairs at the two loci) we found very low nonsynonymous variation; pi was 0.0003 and 0.0002 at PHYP and PHYO loci, respectively. There was no functional differentiation between populations at the photosensory domains of either locus. The overall silent variation was also low, only 0.0024 for the PHYP locus. The low estimates of silent variation are consistent with the estimated low synonymous substitution rates between Pinus sylvestris and Picea abies at the PHYO locus. Despite the low level of nucleotide variation, haplotypic diversity was relatively high (0.42 and 0.41 for fragments of 1156 nucleotides) at the two loci.

Within-Host Variations of Human Papillomavirus Reveal APOBEC Signature Mutagenesis in the Viral Genome.

PubMed

Hirose, Yusuke; Onuki, Mamiko; Tenjimbayashi, Yuri; Mori, Seiichiro; Ishii, Yoshiyuki; Takeuchi, Takamasa; Tasaka, Nobutaka; Satoh, Toyomi; Morisada, Tohru; Iwata, Takashi; Miyamoto, Shingo; Matsumoto, Koji; Sekizawa, Akihiko; Kukimoto, Iwao

2018-06-15

Persistent infection with oncogenic human papillomaviruses (HPVs) causes cervical cancer, accompanied by the accumulation of somatic mutations into the host genome. There are concomitant genetic changes in the HPV genome during viral infection; however, their relevance to cervical carcinogenesis is poorly understood. Here, we explored within-host genetic diversity of HPV by performing deep-sequencing analyses of viral whole-genome sequences in clinical specimens. The whole genomes of HPV types 16, 52, and 58 were amplified by type-specific PCR from total cellular DNA of cervical exfoliated cells collected from patients with cervical intraepithelial neoplasia (CIN) and invasive cervical cancer (ICC) and were deep sequenced. After constructing a reference viral genome sequence for each specimen, nucleotide positions showing changes with >0.5% frequencies compared to the reference sequence were determined for individual samples. In total, 1,052 positions of nucleotide variations were detected in HPV genomes from 151 samples (CIN1, n = 56; CIN2/3, n = 68; ICC, n = 27), with various numbers per sample. Overall, C-to-T and C-to-A substitutions were the dominant changes observed across all histological grades. While C-to-T transitions were predominantly detected in CIN1, their prevalence was decreased in CIN2/3 and fell below that of C-to-A transversions in ICC. Analysis of the trinucleotide context encompassing substituted bases revealed that TpCpN, a preferred target sequence for cellular APOBEC cytosine deaminases, was a primary site for C-to-T substitutions in the HPV genome. These results strongly imply that the APOBEC proteins are drivers of HPV genome mutation, particularly in CIN1 lesions. IMPORTANCE HPVs exhibit surprisingly high levels of genetic diversity, including a large repertoire of minor genomic variants in each viral genotype. Here, by conducting deep-sequencing analyses, we show for the first time a comprehensive snapshot of the within-host genetic diversity of high-risk HPVs during cervical carcinogenesis. Quasispecies harboring minor nucleotide variations in viral whole-genome sequences were extensively observed across different grades of CIN and cervical cancer. Among the within-host variations, C-to-T transitions, a characteristic change mediated by cellular APOBEC cytosine deaminases, were predominantly detected throughout the whole viral genome, most strikingly in low-grade CIN lesions. The results strongly suggest that within-host variations of the HPV genome are primarily generated through the interaction with host cell DNA-editing enzymes and that such within-host variability is an evolutionary source of the genetic diversity of HPVs. Copyright © 2018 American Society for Microbiology.

The population genomics of rhesus macaques (Macaca mulatta) based on whole-genome sequences

PubMed Central

Xue, Cheng; Raveendran, Muthuswamy; Harris, R. Alan; Fawcett, Gloria L.; Liu, Xiaoming; White, Simon; Dahdouli, Mahmoud; Rio Deiros, David; Below, Jennifer E.; Salerno, William; Cox, Laura; Fan, Guoping; Ferguson, Betsy; Horvath, Julie; Johnson, Zach; Kanthaswamy, Sree; Kubisch, H. Michael; Liu, Dahai; Platt, Michael; Smith, David G.; Sun, Binghua; Vallender, Eric J.; Wang, Feng; Wiseman, Roger W.; Chen, Rui; Muzny, Donna M.; Gibbs, Richard A.; Yu, Fuli; Rogers, Jeffrey

2016-01-01

Rhesus macaques (Macaca mulatta) are the most widely used nonhuman primate in biomedical research, have the largest natural geographic distribution of any nonhuman primate, and have been the focus of much evolutionary and behavioral investigation. Consequently, rhesus macaques are one of the most thoroughly studied nonhuman primate species. However, little is known about genome-wide genetic variation in this species. A detailed understanding of extant genomic variation among rhesus macaques has implications for the use of this species as a model for studies of human health and disease, as well as for evolutionary population genomics. Whole-genome sequencing analysis of 133 rhesus macaques revealed more than 43.7 million single-nucleotide variants, including thousands predicted to alter protein sequences, transcript splicing, and transcription factor binding sites. Rhesus macaques exhibit 2.5-fold higher overall nucleotide diversity and slightly elevated putative functional variation compared with humans. This functional variation in macaques provides opportunities for analyses of coding and noncoding variation, and its cellular consequences. Despite modestly higher levels of nonsynonymous variation in the macaques, the estimated distribution of fitness effects and the ratio of nonsynonymous to synonymous variants suggest that purifying selection has had stronger effects in rhesus macaques than in humans. Demographic reconstructions indicate this species has experienced a consistently large but fluctuating population size. Overall, the results presented here provide new insights into the population genomics of nonhuman primates and expand genomic information directly relevant to primate models of human disease. PMID:27934697

Intraspecific variation between the ITS sequences of Toxocara canis, Toxocara cati and Toxascaris leonina from different host species in south-western Poland.

PubMed

Fogt-Wyrwas, R; Mizgajska-Wiktor, H; Pacoń, J; Jarosz, W

2013-12-01

Some parasitic nematodes can inhabit different definitive hosts, which raises the question of the intraspecific variability of the nematode genotype affecting their preferences to choose particular species as hosts. Additionally, the issue of a possible intraspecific DNA microheterogeneity in specimens from different parts of the world seems to be interesting, especially from the evolutionary point of view. The problem was analysed in three related species - Toxocara canis, Toxocara cati and Toxascaris leonina - specimens originating from Central Europe (Poland). Using specific primers for species identification, internal transcribed spacer (ITS)-1 and ITS-2 regions were amplified and then sequenced. The sequences obtained were compared with sequences previously described for specimens originating from other geographical locations. No differences in nucleotide sequences were established in T. canis isolated from two different hosts (dogs and foxes). A comparison of ITS sequences of T. canis from Poland with sequences deposited in GenBank showed that the scope of intraspecific variability of the species did not exceed 0.4%, while in T. cati the differences did not exceed 2%. Significant differences were found in T. leonina, where ITS-1 differed by 3% and ITS-2 by as much as 7.4% in specimens collected from foxes in Poland and dogs in Australia. Such scope of differences in the nucleotide sequence seems to exceed the intraspecific variation of the species.

High Degree of Interlaboratory Reproducibility of Human Immunodeficiency Virus Type 1 Protease and Reverse Transcriptase Sequencing of Plasma Samples from Heavily Treated Patients

PubMed Central

Shafer, Robert W.; Hertogs, Kurt; Zolopa, Andrew R.; Warford, Ann; Bloor, Stuart; Betts, Bradley J.; Merigan, Thomas C.; Harrigan, Richard; Larder, Brendon A.

2001-01-01

We assessed the reproducibility of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) and protease sequencing using cryopreserved plasma aliquots obtained from 46 heavily treated HIV-1-infected individuals in two laboratories using dideoxynucleotide sequencing. The rates of complete sequence concordance between the two laboratories were 99.1% for the protease sequence and 99.0% for the RT sequence. Approximately 90% of the discordances were partial, defined as one laboratory detecting a mixture and the second laboratory detecting only one of the mixture's components. Only 0.1% of the nucleotides were completely discordant between the two laboratories, and these were significantly more likely to occur in plasma samples with lower plasma HIV-1 RNA levels. Nucleotide mixtures were detected at approximately 1% of the nucleotide positions, and in every case in which one laboratory detected a mixture, the second laboratory either detected the same mixture or detected one of the mixture's components. The high rate of concordance in detecting mixtures and the fact that most discordances between the two laboratories were partial suggest that most discordances were caused by variation in sampling of the HIV-1 quasispecies by PCR rather than by technical errors in the sequencing process itself. PMID:11283081

Genetic variation among the Mapuche Indians from the Patagonian region of Argentina: mitochondrial DNA sequence variation and allele frequencies of several nuclear genes.

PubMed

Ginther, C; Corach, D; Penacino, G A; Rey, J A; Carnese, F R; Hutz, M H; Anderson, A; Just, J; Salzano, F M; King, M C

1993-01-01

DNA samples from 60 Mapuche Indians, representing 39 maternal lineages, were genetically characterized for (1) nucleotide sequences of the mtDNA control region; (2) presence or absence of a nine base duplication in mtDNA region V; (3) HLA loci DRB1 and DQA1; (4) variation at three nuclear genes with short tandem repeats; and (5) variation at the polymorphic marker D2S44. The genetic profile of the Mapuche population was compared to other Amerinds and to worldwide populations. Two highly polymorphic portions of the mtDNA control region, comprising 650 nucleotides, were amplified by the polymerase chain reaction (PCR) and directly sequenced. The 39 maternal lineages were defined by two or three generation families identified by the Mapuches. These 39 lineages included 19 different mtDNA sequences that could be grouped into four classes. The same classes of sequences appear in other Amerinds from North, Central, and South American populations separated by thousands of miles, suggesting that the origin of the mtDNA patterns predates the migration to the Americas. The mtDNA sequence similarity between Amerind populations suggests that the migration throughout the Americas occurred rapidly relative to the mtDNA mutation rate. HLA DRB1 alleles 1602 and 1402 were frequent among the Mapuches. These alleles also occur at high frequency among other Amerinds in North and South America, but not among Spanish, Chinese or African-American populations. The high frequency of these alleles throughout the Americas, and their specificity to the Americas, supports the hypothesis that Mapuches and other Amerind groups are closely related.(ABSTRACT TRUNCATED AT 250 WORDS)

Development and evaluation of a high density genotyping 'Axiom_Arachis' array with 58K SNPs for accelerating genetics and breeding in groundnut

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) are the most abundant DNA sequence variation in the genomes which can be used to associate genotypic variation to the phenotype. Therefore, availability of a high-density SNP array with uniform genome coverage can advance genetic studies and breeding applicatio...

Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer).

PubMed

Chelomina, Galina N; Rozhkovan, Konstantin V; Voronova, Anastasia N; Burundukova, Olga L; Muzarok, Tamara I; Zhuravlev, Yuri N

2016-04-01

Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440-640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine.

Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer)

PubMed Central

Chelomina, Galina N.; Rozhkovan, Konstantin V.; Voronova, Anastasia N.; Burundukova, Olga L.; Muzarok, Tamara I.; Zhuravlev, Yuri N.

2015-01-01

Background Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. Methods The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. Results In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440–640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. Conclusion This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine. PMID:27158239

Proteogenomics: Integrating Next-Generation Sequencing and Mass Spectrometry to Characterize Human Proteomic Variation

NASA Astrophysics Data System (ADS)

Sheynkman, Gloria M.; Shortreed, Michael R.; Cesnik, Anthony J.; Smith, Lloyd M.

2016-06-01

Mass spectrometry-based proteomics has emerged as the leading method for detection, quantification, and characterization of proteins. Nearly all proteomic workflows rely on proteomic databases to identify peptides and proteins, but these databases typically contain a generic set of proteins that lack variations unique to a given sample, precluding their detection. Fortunately, proteogenomics enables the detection of such proteomic variations and can be defined, broadly, as the use of nucleotide sequences to generate candidate protein sequences for mass spectrometry database searching. Proteogenomics is experiencing heightened significance due to two developments: (a) advances in DNA sequencing technologies that have made complete sequencing of human genomes and transcriptomes routine, and (b) the unveiling of the tremendous complexity of the human proteome as expressed at the levels of genes, cells, tissues, individuals, and populations. We review here the field of human proteogenomics, with an emphasis on its history, current implementations, the types of proteomic variations it reveals, and several important applications.

Proteogenomics: Integrating Next-Generation Sequencing and Mass Spectrometry to Characterize Human Proteomic Variation

PubMed Central

Sheynkman, Gloria M.; Shortreed, Michael R.; Cesnik, Anthony J.; Smith, Lloyd M.

2016-01-01

Mass spectrometry–based proteomics has emerged as the leading method for detection, quantification, and characterization of proteins. Nearly all proteomic workflows rely on proteomic databases to identify peptides and proteins, but these databases typically contain a generic set of proteins that lack variations unique to a given sample, precluding their detection. Fortunately, proteogenomics enables the detection of such proteomic variations and can be defined, broadly, as the use of nucleotide sequences to generate candidate protein sequences for mass spectrometry database searching. Proteogenomics is experiencing heightened significance due to two developments: (a) advances in DNA sequencing technologies that have made complete sequencing of human genomes and transcriptomes routine, and (b) the unveiling of the tremendous complexity of the human proteome as expressed at the levels of genes, cells, tissues, individuals, and populations. We review here the field of human proteogenomics, with an emphasis on its history, current implementations, the types of proteomic variations it reveals, and several important applications. PMID:27049631

A set of tetra-nucleotide core motif SSR markers for efficient identification of potato (Solanum tuberosum) cultivars.

PubMed

Kishine, Masahiro; Tsutsumi, Katsuji; Kitta, Kazumi

2017-12-01

Simple sequence repeat (SSR) is a popular tool for individual fingerprinting. The long-core motif (e.g. tetra-, penta-, and hexa-nucleotide) simple sequence repeats (SSRs) are preferred because they make it easier to separate and distinguish neighbor alleles. In the present study, a new set of 8 tetra-nucleotide SSRs in potato ( Solanum tuberosum ) is reported. By using these 8 markers, 72 out of 76 cultivars obtained from Japan and the United States were clearly discriminated, while two pairs, both of which arose from natural variation, showed identical profiles. The combined probability of identity between two random cultivars for the set of 8 SSR markers was estimated to be 1.10 × 10 -8 , confirming the usefulness of the proposed SSR markers for fingerprinting analyses of potato.

Molecular identification of Trichuris vulpis and Trichuris suis isolated from different hosts.

PubMed

Cutillas, Cristina; de Rojas, Manuel; Ariza, Concepción; Ubeda, José Manuel; Guevara, Diego

2007-01-01

Trichuris suis was isolated from the cecum of two different hosts (Sus scrofa domestica -- swine and Sus scrofa scrofa -- wild boar) and Trichuris vulpis from dogs in Sevilla, Spain. Genomic DNA was isolated and internal transcribed spacers (ITS)1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced using polymerase chain reaction techniques. The sequence of T. suis from both hosts was 1,396 bp in length while that of T. vulpis was 1,044 bp. ITS1 of both populations isolated of T. suis was 661 nucleotides in length, while the ITS2 was 534 nucleotides in length. Furthermore, the ITS1 of T. vulpis was 410 nucleotides in length, while the ITS2 was 433 nucleotides in length. One hundred fifty-four nucleotides were observed along the 5.8S gene of T. suis and T. vulpis. Intraindividual and intraspecific variations were detected in the rDNA of both species. The presence of microsatellites was observed in all the individuals assayed. Sequence analysis of the ITSs and the 5.8S gene has demonstrated no sequence differences between T. suis isolated from both hosts (S. scrofa domestica -- swine and S. scrofa scrofa -- wild boar). Nevertheless, clear differences were detected between the ITS1 and ITS2 of T. suis and T. vulpis. Furthermore, a comparative molecular analysis between both species and the previously published ITS1-5.8S-ITS2 sequence data of Trichuris ovis, Trichuris leporis, Trichuris muris, Trichuris arvicolae, and Trichuris skrjabini was carried out. A common homology zone was detected in the ITS1 sequence of all species of trichurids.

Genetic variation in potential Giardia vaccine candidates cyst wall protein 2 and α1-giardin.

PubMed

Radunovic, Matej; Klotz, Christian; Saghaug, Christina Skår; Brattbakk, Hans-Richard; Aebischer, Toni; Langeland, Nina; Hanevik, Kurt

2017-08-01

Giardia is a prevalent intestinal parasitic infection. The trophozoite structural protein a1-giardin (a1-g) and the cyst protein cyst wall protein 2 (CWP2) have shown promise as Giardia vaccine antigen candidates in murine models. The present study assesses the genetic diversity of a1-g and CWP2 between and within assemblages A and B in human clinical isolates. a1-g and CWP2 sequences were acquired from 15 Norwegian isolates by PCR amplification and 20 sequences from German cultured isolates by whole genome sequencing. Sequences were aligned to reference genomes from assemblage A2 and B to identify genetic variance. Genetic diversity was found between assemblage A and B reference sequences for both a1-g (90.8% nucleotide identity) and CWP2 (82.5% nucleotide identity). However, for a1-g, this translated into only 3 amino acid (aa) substitutions, while for CWP2 there were 41 aa substitutions, and also one aa deletion. Genetic diversity within assemblage B was larger; nucleotide identity 92.0% for a1-g and 94.3% for CWP2, than within assemblage A (nucleotide identity 99.0% for a1-g and 99.7% for CWP2). For CWP2, the diversity on both nucleotide and protein level was higher in the C-terminal end. Predicted antigenic epitopes were not affected for a1-g, but partially for CWP2. Despite genetic diversity in a1-g, we found aa sequence, characteristics, and antigenicity to be well preserved. CWP2 showed more aa variance and potential antigenic differences. Several CWP2 antigens might be necessary in a future Giardia vaccine to provide cross protection against both Giardia assemblages infecting humans.

HLA DNA Sequence Variation among Human Populations: Molecular Signatures of Demographic and Selective Events

PubMed Central

Buhler, Stéphane; Sanchez-Mazas, Alicia

2011-01-01

Molecular differences between HLA alleles vary up to 57 nucleotides within the peptide binding coding region of human Major Histocompatibility Complex (MHC) genes, but it is still unclear whether this variation results from a stochastic process or from selective constraints related to functional differences among HLA molecules. Although HLA alleles are generally treated as equidistant molecular units in population genetic studies, DNA sequence diversity among populations is also crucial to interpret the observed HLA polymorphism. In this study, we used a large dataset of 2,062 DNA sequences defined for the different HLA alleles to analyze nucleotide diversity of seven HLA genes in 23,500 individuals of about 200 populations spread worldwide. We first analyzed the HLA molecular structure and diversity of these populations in relation to geographic variation and we further investigated possible departures from selective neutrality through Tajima's tests and mismatch distributions. All results were compared to those obtained by classical approaches applied to HLA allele frequencies. Our study shows that the global patterns of HLA nucleotide diversity among populations are significantly correlated to geography, although in some specific cases the molecular information reveals unexpected genetic relationships. At all loci except HLA-DPB1, populations have accumulated a high proportion of very divergent alleles, suggesting an advantage of heterozygotes expressing molecularly distant HLA molecules (asymmetric overdominant selection model). However, both different intensities of selection and unequal levels of gene conversion may explain the heterogeneous mismatch distributions observed among the loci. Also, distinctive patterns of sequence divergence observed at the HLA-DPB1 locus suggest current neutrality but old selective pressures on this gene. We conclude that HLA DNA sequences advantageously complement HLA allele frequencies as a source of data used to explore the genetic history of human populations, and that their analysis allows a more thorough investigation of human MHC molecular evolution. PMID:21408106

A global reference for human genetic variation

PubMed Central

2016-01-01

The 1000 Genomes Project set out to provide a comprehensive description of common human genetic variation by applying whole-genome sequencing to a diverse set of individuals from multiple populations. Here we report completion of the project, having reconstructed the genomes of 2,504 individuals from 26 populations using a combination of low-coverage whole-genome sequencing, deep exome sequencing, and dense microarray genotyping. We characterized a broad spectrum of genetic variation, in total over 88 million variants (84.7 million single nucleotide polymorphisms (SNPs), 3.6 million short insertions/deletions (indels), and 60,000 structural variants), all phased onto high-quality haplotypes. This resource includes >99% of SNP variants with a frequency of >1% for a variety of ancestries. We describe the distribution of genetic variation across the global sample, and discuss the implications for common disease studies. PMID:26432245

Isolation and characterization of NBS–LRR resistance gene analogues from mango

PubMed Central

Lei, Xintao; Yao, Quansheng; Xu, Xuerong; Liu, Yang

2014-01-01

The nucleotide-binding site (NBS)–leucine-rich repeat (LRR) gene family is a class of R genes in plants. NBS genes play a very important role in disease defence. To further study the variation and homology of mango NBS–LRR genes, 16 resistance gene analogues (RGAs) (GenBank accession number HM446507-22) were isolated from the polymerase chain reaction fragments and sequenced by using two degenerate primer sets. The total nucleotide diversity index Pi was 0.362, and 236 variation sites were found among 16 RGAs. The degree of homology between the RGAs varied from 44.4% to 98.5%. Sixteen RGAs could be translated into amino sequences. The high level of this homology in the protein sequences of the P-loop and kinase-2 of the NBS domain between the RGAs isolated in this study and previously characterized R genes indicated that these cloned sequences belonged to the NBS–LRR gene family. Moreover, these 16 RGAs could be classified into the non-TIR–NBS–LRR gene family because only tryptophan (W) could be claimed as the final residual of the kinase-2 domain of all RGAs isolated here. From our results, we concluded that our mango NBS–LRR genes possessed a high level of variation from the mango genome, which may allow mango to recognize many different pathogenic virulence factors. PMID:26740762

Two missense mutations in melanocortin 1 receptor (MC1R) are strongly associated with dark ventral coat color in reindeer (Rangifer tarandus).

PubMed

Våge, D I; Nieminen, M; Anderson, D G; Røed, K H

2014-10-01

The protein-coding region of melanocortin 1 receptor (MC1R) was sequenced to identify potential variation affecting coat color in reindeer (Rangifer tarandus). A T→C sequence variation at nucleotide position 218 (c.218T>C) causing an amino acid (aa) change from methionine to threonine at aa position 73 (p.Met73Thr) was identified. In addition, a T→G sequence variation was found at nucleotide position 839 (c.839T>G), causing phenylalanine to be exchanged by cysteine at aa position 280 (p.Phe280Cys). The two sequence variants (c.218C and c.839G) were found to be closely associated with a darker belly coat compared with animals not having any of these two variants. The aa acid change p.Met73Thr affects the same position as p.Met73Lys previously reported to give constitutive activation of MC1R in black sheep (Ovis aries), whereas p.Phe280Cys is identical to one of two variants previously reported to be associated with dark coat color in Arctic fox (Alopex lagopus), supporting that the two variants found in reindeer are functional. The complete absence of Thr73 and Cys280 among the 51 wild reindeer analyzed provides some evidence that these variants are more common in the domestic herds. © 2014 Stichting International Foundation for Animal Genetics.

Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

PubMed

de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

2015-01-01

The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Quantitative trait nucleotide analysis using Bayesian model selection.

PubMed

Blangero, John; Goring, Harald H H; Kent, Jack W; Williams, Jeff T; Peterson, Charles P; Almasy, Laura; Dyer, Thomas D

2005-10-01

Although much attention has been given to statistical genetic methods for the initial localization and fine mapping of quantitative trait loci (QTLs), little methodological work has been done to date on the problem of statistically identifying the most likely functional polymorphisms using sequence data. In this paper we provide a general statistical genetic framework, called Bayesian quantitative trait nucleotide (BQTN) analysis, for assessing the likely functional status of genetic variants. The approach requires the initial enumeration of all genetic variants in a set of resequenced individuals. These polymorphisms are then typed in a large number of individuals (potentially in families), and marker variation is related to quantitative phenotypic variation using Bayesian model selection and averaging. For each sequence variant a posterior probability of effect is obtained and can be used to prioritize additional molecular functional experiments. An example of this quantitative nucleotide analysis is provided using the GAW12 simulated data. The results show that the BQTN method may be useful for choosing the most likely functional variants within a gene (or set of genes). We also include instructions on how to use our computer program, SOLAR, for association analysis and BQTN analysis.

Human Genome Sequencing in Health and Disease

PubMed Central

Gonzaga-Jauregui, Claudia; Lupski, James R.; Gibbs, Richard A.

2013-01-01

Following the “finished,” euchromatic, haploid human reference genome sequence, the rapid development of novel, faster, and cheaper sequencing technologies is making possible the era of personalized human genomics. Personal diploid human genome sequences have been generated, and each has contributed to our better understanding of variation in the human genome. We have consequently begun to appreciate the vastness of individual genetic variation from single nucleotide to structural variants. Translation of genome-scale variation into medically useful information is, however, in its infancy. This review summarizes the initial steps undertaken in clinical implementation of personal genome information, and describes the application of whole-genome and exome sequencing to identify the cause of genetic diseases and to suggest adjuvant therapies. Better analysis tools and a deeper understanding of the biology of our genome are necessary in order to decipher, interpret, and optimize clinical utility of what the variation in the human genome can teach us. Personal genome sequencing may eventually become an instrument of common medical practice, providing information that assists in the formulation of a differential diagnosis. We outline herein some of the remaining challenges. PMID:22248320

Model-based quality assessment and base-calling for second-generation sequencing data.

PubMed

Bravo, Héctor Corrada; Irizarry, Rafael A

2010-09-01

Second-generation sequencing (sec-gen) technology can sequence millions of short fragments of DNA in parallel, making it capable of assembling complex genomes for a small fraction of the price and time of previous technologies. In fact, a recently formed international consortium, the 1000 Genomes Project, plans to fully sequence the genomes of approximately 1200 people. The prospect of comparative analysis at the sequence level of a large number of samples across multiple populations may be achieved within the next five years. These data present unprecedented challenges in statistical analysis. For instance, analysis operates on millions of short nucleotide sequences, or reads-strings of A,C,G, or T's, between 30 and 100 characters long-which are the result of complex processing of noisy continuous fluorescence intensity measurements known as base-calling. The complexity of the base-calling discretization process results in reads of widely varying quality within and across sequence samples. This variation in processing quality results in infrequent but systematic errors that we have found to mislead downstream analysis of the discretized sequence read data. For instance, a central goal of the 1000 Genomes Project is to quantify across-sample variation at the single nucleotide level. At this resolution, small error rates in sequencing prove significant, especially for rare variants. Sec-gen sequencing is a relatively new technology for which potential biases and sources of obscuring variation are not yet fully understood. Therefore, modeling and quantifying the uncertainty inherent in the generation of sequence reads is of utmost importance. In this article, we present a simple model to capture uncertainty arising in the base-calling procedure of the Illumina/Solexa GA platform. Model parameters have a straightforward interpretation in terms of the chemistry of base-calling allowing for informative and easily interpretable metrics that capture the variability in sequencing quality. Our model provides these informative estimates readily usable in quality assessment tools while significantly improving base-calling performance. © 2009, The International Biometric Society.

PopHuman: the human population genomics browser

PubMed Central

Mulet, Roger; Villegas-Mirón, Pablo; Hervas, Sergi; Sanz, Esteve; Velasco, Daniel; Bertranpetit, Jaume; Laayouni, Hafid

2018-01-01

Abstract The 1000 Genomes Project (1000GP) represents the most comprehensive world-wide nucleotide variation data set so far in humans, providing the sequencing and analysis of 2504 genomes from 26 populations and reporting >84 million variants. The availability of this sequence data provides the human lineage with an invaluable resource for population genomics studies, allowing the testing of molecular population genetics hypotheses and eventually the understanding of the evolutionary dynamics of genetic variation in human populations. Here we present PopHuman, a new population genomics-oriented genome browser based on JBrowse that allows the interactive visualization and retrieval of an extensive inventory of population genetics metrics. Efficient and reliable parameter estimates have been computed using a novel pipeline that faces the unique features and limitations of the 1000GP data, and include a battery of nucleotide variation measures, divergence and linkage disequilibrium parameters, as well as different tests of neutrality, estimated in non-overlapping windows along the chromosomes and in annotated genes for all 26 populations of the 1000GP. PopHuman is open and freely available at http://pophuman.uab.cat. PMID:29059408

Proteogenomic Investigation of Strain Variation in Clinical Mycobacterium tuberculosis Isolates.

PubMed

Heunis, Tiaan; Dippenaar, Anzaan; Warren, Robin M; van Helden, Paul D; van der Merwe, Ruben G; Gey van Pittius, Nicolaas C; Pain, Arnab; Sampson, Samantha L; Tabb, David L

2017-10-06

Mycobacterium tuberculosis consists of a large number of different strains that display unique virulence characteristics. Whole-genome sequencing has revealed substantial genetic diversity among clinical M. tuberculosis isolates, and elucidating the phenotypic variation encoded by this genetic diversity will be of the utmost importance to fully understand M. tuberculosis biology and pathogenicity. In this study, we integrated whole-genome sequencing and mass spectrometry (GeLC-MS/MS) to reveal strain-specific characteristics in the proteomes of two clinical M. tuberculosis Latin American-Mediterranean isolates. Using this approach, we identified 59 peptides containing single amino acid variants, which covered ∼9% of all coding nonsynonymous single nucleotide variants detected by whole-genome sequencing. Furthermore, we identified 29 distinct peptides that mapped to a hypothetical protein not present in the M. tuberculosis H37Rv reference proteome. Here, we provide evidence for the expression of this protein in the clinical M. tuberculosis SAWC3651 isolate. The strain-specific databases enabled confirmation of genomic differences (i.e., large genomic regions of difference and nonsynonymous single nucleotide variants) in these two clinical M. tuberculosis isolates and allowed strain differentiation at the proteome level. Our results contribute to the growing field of clinical microbial proteogenomics and can improve our understanding of phenotypic variation in clinical M. tuberculosis isolates.

Diff-seq: A high throughput sequencing-based mismatch detection assay for DNA variant enrichment and discovery

PubMed Central

Karas, Vlad O; Sinnott-Armstrong, Nicholas A; Varghese, Vici; Shafer, Robert W; Greenleaf, William J; Sherlock, Gavin

2018-01-01

Abstract Much of the within species genetic variation is in the form of single nucleotide polymorphisms (SNPs), typically detected by whole genome sequencing (WGS) or microarray-based technologies. However, WGS produces mostly uninformative reads that perfectly match the reference, while microarrays require genome-specific reagents. We have developed Diff-seq, a sequencing-based mismatch detection assay for SNP discovery without the requirement for specialized nucleic-acid reagents. Diff-seq leverages the Surveyor endonuclease to cleave mismatched DNA molecules that are generated after cross-annealing of a complex pool of DNA fragments. Sequencing libraries enriched for Surveyor-cleaved molecules result in increased coverage at the variant sites. Diff-seq detected all mismatches present in an initial test substrate, with specific enrichment dependent on the identity and context of the variation. Application to viral sequences resulted in increased observation of variant alleles in a biologically relevant context. Diff-Seq has the potential to increase the sensitivity and efficiency of high-throughput sequencing in the detection of variation. PMID:29361139

PSSRdb: a relational database of polymorphic simple sequence repeats extracted from prokaryotic genomes.

PubMed

Kumar, Pankaj; Chaitanya, Pasumarthy S; Nagarajaram, Hampapathalu A

2011-01-01

PSSRdb (Polymorphic Simple Sequence Repeats database) (http://www.cdfd.org.in/PSSRdb/) is a relational database of polymorphic simple sequence repeats (PSSRs) extracted from 85 different species of prokaryotes. Simple sequence repeats (SSRs) are the tandem repeats of nucleotide motifs of the sizes 1-6 bp and are highly polymorphic. SSR mutations in and around coding regions affect transcription and translation of genes. Such changes underpin phase variations and antigenic variations seen in some bacteria. Although SSR-mediated phase variation and antigenic variations have been well-studied in some bacteria there seems a lot of other species of prokaryotes yet to be investigated for SSR mediated adaptive and other evolutionary advantages. As a part of our on-going studies on SSR polymorphism in prokaryotes we compared the genome sequences of various strains and isolates available for 85 different species of prokaryotes and extracted a number of SSRs showing length variations and created a relational database called PSSRdb. This database gives useful information such as location of PSSRs in genomes, length variation across genomes, the regions harboring PSSRs, etc. The information provided in this database is very useful for further research and analysis of SSRs in prokaryotes.

Characterization of durum wheat high molecular weight glutenin subunits Bx20 and By20 sequences by a molecular and proteomic approach.

PubMed

Santagati, Vito Davide; Sestili, Francesco; Lafiandra, Domenico; D'Ovidio, Renato; Rogniaux, Helene; Masci, Stefania

2016-07-01

Wheat high molecular weight glutenin subunit variation is important because of its great influence on glutenin polymer structure, that is related to dough technological properties. Among the different subunits, the pair Bx20 and By20 is known to have a negative effect on quality, but the reasons are not clear: Bx20 has two cysteines, which theoretically make this subunit a chain extender of the glutenin polymer, just like the other Bx subunits, showing four cysteines, two of which should be involved in intra-molecular disulfide bonds. By20 has never been characterized so far at molecular level. Here we report the nucleotide sequences of Bx20 and By20 genes isolated from the durum wheat cultivar 'Lira 45' and the validation of the corresponding deduced amino acid sequences by using MALDI-TOF and LC-MS/MS. Four nucleotide differences were identified in the Bx20 gene with respect to the deduced sequence present in NCBI, causing two amino acid substitutions. For the By20 subunit, nucleotide and amino acid sequences revealed a great similarity to By15, both at gene and protein levels, showing five nucleotide changes generating two amino acid differences. No evidence of post-translational modifications has been found. Hypotheses are formulated in regard to relationships with technological quality. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

PubMed Central

Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko

2014-01-01

The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5′-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 · 10−14 cm2 and 7.06 · 10−14 cm2. The highest cross section was found for 5′-TT(ATA)3TT and 5′-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy. PMID:25487346

Pan-genome multilocus sequence typing and outbreak-specific reference-based single nucleotide polymorphism analysis to resolve two concurrent Staphylococcus aureus outbreaks in neonatal services.

PubMed

Roisin, S; Gaudin, C; De Mendonça, R; Bellon, J; Van Vaerenbergh, K; De Bruyne, K; Byl, B; Pouseele, H; Denis, O; Supply, P

2016-06-01

We used a two-step whole genome sequencing analysis for resolving two concurrent outbreaks in two neonatal services in Belgium, caused by exfoliative toxin A-encoding-gene-positive (eta+) methicillin-susceptible Staphylococcus aureus with an otherwise sporadic spa-type t209 (ST-109). Outbreak A involved 19 neonates and one healthcare worker in a Brussels hospital from May 2011 to October 2013. After a first episode interrupted by decolonization procedures applied over 7 months, the outbreak resumed concomitantly with the onset of outbreak B in a hospital in Asse, comprising 11 neonates and one healthcare worker from mid-2012 to January 2013. Pan-genome multilocus sequence typing, defined on the basis of 42 core and accessory reference genomes, and single-nucleotide polymorphisms mapped on an outbreak-specific de novo assembly were used to compare 28 available outbreak isolates and 19 eta+/spa-type t209 isolates identified by routine or nationwide surveillance. Pan-genome multilocus sequence typing showed that the outbreaks were caused by independent clones not closely related to any of the surveillance isolates. Isolates from only ten cases with overlapping stays in outbreak A, including four pairs of twins, showed no or only a single nucleotide polymorphism variation, indicating limited sequential transmission. Detection of larger genomic variation, even from the start of the outbreak, pointed to sporadic seeding from a pre-existing exogenous source, which persisted throughout the whole course of outbreak A. Whole genome sequencing analysis can provide unique fine-tuned insights into transmission pathways of complex outbreaks even at their inception, which, with timely use, could valuably guide efforts for early source identification. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Genome sequence variation in the constricta strain dramatically alters the protein interaction and localization map of Potato yellow dwarf virus

USDA-ARS?s Scientific Manuscript database

The genome sequence of the constricta strain of Potato yellow dwarf virus (CYDV) was determined to be 12,792 nucleotides long and organized into seven open reading frames with the gene order 3’-N-X-P-Y-M-G-L-5’, which encodes the nucleocapsid, phosphoprotein, movement, matrix, glycoprotein and RNA-d...

Molecular phylogeny of Coxsackievirus A16 in Shenzhen, China, from 2005 to 2009.

PubMed

Zong, Wenping; He, Yaqing; Yu, Shouyi; Yang, Hong; Xian, Huixia; Liao, Yuxue; Hu, Guifang

2011-04-01

Phylogenetic analysis of a Coxsackievirus A16 (CA16) sequence from Shenzhen, China, and other Chinese and international CA16 sequences revealed a pattern of endemic cocirculation of strains of clusters B2a and B2b within subtype B2 viruses. Amino acid evolution and nucleotide variation in the VP1 region were slight for 5 years.

Construction of a large collection of small genome variations in French dairy and beef breeds using whole-genome sequences.

PubMed

Boussaha, Mekki; Michot, Pauline; Letaief, Rabia; Hozé, Chris; Fritz, Sébastien; Grohs, Cécile; Esquerré, Diane; Duchesne, Amandine; Philippe, Romain; Blanquet, Véronique; Phocas, Florence; Floriot, Sandrine; Rocha, Dominique; Klopp, Christophe; Capitan, Aurélien; Boichard, Didier

2016-11-15

In recent years, several bovine genome sequencing projects were carried out with the aim of developing genomic tools to improve dairy and beef production efficiency and sustainability. In this study, we describe the first French cattle genome variation dataset obtained by sequencing 274 whole genomes representing several major dairy and beef breeds. This dataset contains over 28 million single nucleotide polymorphisms (SNPs) and small insertions and deletions. Comparisons between sequencing results and SNP array genotypes revealed a very high genotype concordance rate, which indicates the good quality of our data. To our knowledge, this is the first large-scale catalog of small genomic variations in French dairy and beef cattle. This resource will contribute to the study of gene functions and population structure and also help to improve traits through genotype-guided selection.

Genomic profiling of plastid DNA variation in the Mediterranean olive tree

PubMed Central

2011-01-01

Background Characterisation of plastid genome (or cpDNA) polymorphisms is commonly used for phylogeographic, population genetic and forensic analyses in plants, but detecting cpDNA variation is sometimes challenging, limiting the applications of such an approach. In the present study, we screened cpDNA polymorphism in the olive tree (Olea europaea L.) by sequencing the complete plastid genome of trees with a distinct cpDNA lineage. Our objective was to develop new markers for a rapid genomic profiling (by Multiplex PCRs) of cpDNA haplotypes in the Mediterranean olive tree. Results Eight complete cpDNA genomes of Olea were sequenced de novo. The nucleotide divergence between olive cpDNA lineages was low and not exceeding 0.07%. Based on these sequences, markers were developed for studying two single nucleotide substitutions and length polymorphism of 62 regions (with variable microsatellite motifs or other indels). They were then used to genotype the cpDNA variation in cultivated and wild Mediterranean olive trees (315 individuals). Forty polymorphic loci were detected on this sample, allowing the distinction of 22 haplotypes belonging to the three Mediterranean cpDNA lineages known as E1, E2 and E3. The discriminating power of cpDNA variation was particularly low for the cultivated olive tree with one predominating haplotype, but more diversity was detected in wild populations. Conclusions We propose a method for a rapid characterisation of the Mediterranean olive germplasm. The low variation in the cultivated olive tree indicated that the utility of cpDNA variation for forensic analyses is limited to rare haplotypes. In contrast, the high cpDNA variation in wild populations demonstrated that our markers may be useful for phylogeographic and populations genetic studies in O. europaea. PMID:21569271

Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer.

PubMed

Wojcik, Sylwia E; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z; Rai, Kanti R; Kipps, Thomas J; Keating, Michael J; Croce, Carlo M; Calin, George A

2010-02-01

Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas.

Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer

PubMed Central

Wojcik, Sylwia E.; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S.; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z.; Rai, Kanti R.; Kipps, Thomas J.; Keating, Michael J.

2010-01-01

Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas. PMID:19926640

Major histocompatibility complex variation in the endangered Przewalski's horse.

PubMed Central

Hedrick, P W; Parker, K M; Miller, E L; Miller, P S

1999-01-01

The major histocompatibility complex (MHC) is a fundamental part of the vertebrate immune system, and the high variability in many MHC genes is thought to play an essential role in recognition of parasites. The Przewalski's horse is extinct in the wild and all the living individuals descend from 13 founders, most of whom were captured around the turn of the century. One of the primary genetic concerns in endangered species is whether they have ample adaptive variation to respond to novel selective factors. In examining 14 Przewalski's horses that are broadly representative of the living animals, we found six different class II DRB major histocompatibility sequences. The sequences showed extensive nonsynonymous variation, concentrated in the putative antigen-binding sites, and little synonymous variation. Individuals had from two to four sequences as determined by single-stranded conformation polymorphism (SSCP) analysis. On the basis of the SSCP data, phylogenetic analysis of the nucleotide sequences, and segregation in a family group, we conclude that four of these sequences are from one gene (although one sequence codes for a nonfunctional allele because it contains a stop codon) and two other sequences are from another gene. The position of the stop codon is at the same amino-acid position as in a closely related sequence from the domestic horse. Because other organisms have extensive variation at homologous loci, the Przewalski's horse may have quite low variation in this important adaptive region. PMID:10430594

A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, G K; Hillier, L; Brandstrom, M

2005-02-20

We describe a genetic variation map for the chicken genome containing 2.8 million single nucleotide polymorphisms (SNPs), based on a comparison of the sequences of 3 domestic chickens (broiler, layer, Silkie) to their wild ancestor Red Jungle Fowl (RJF). Subsequent experiments indicate that at least 90% are true SNPs, and at least 70% are common SNPs that segregate in many domestic breeds. Mean nucleotide diversity is about 5 SNP/kb for almost every possible comparison between RJF and domestic lines, between two different domestic lines, and within domestic lines--contrary to the idea that domestic animals are highly inbred relative to theirmore » wild ancestors. In fact, most of the SNPs originated prior to domestication, and there is little to no evidence of selective sweeps for adaptive alleles on length scales of greater than 100 kb.« less

Global sequence diversity of the lactate dehydrogenase gene in Plasmodium falciparum.

PubMed

Simpalipan, Phumin; Pattaradilokrat, Sittiporn; Harnyuttanakorn, Pongchai

2018-01-09

Antigen-detecting rapid diagnostic tests (RDTs) have been recommended by the World Health Organization for use in remote areas to improve malaria case management. Lactate dehydrogenase (LDH) of Plasmodium falciparum is one of the main parasite antigens employed by various commercial RDTs. It has been hypothesized that the poor detection of LDH-based RDTs is attributed in part to the sequence diversity of the gene. To test this, the present study aimed to investigate the genetic diversity of the P. falciparum ldh gene in Thailand and to construct the map of LDH sequence diversity in P. falciparum populations worldwide. The ldh gene was sequenced for 50 P. falciparum isolates in Thailand and compared with hundreds of sequences from P. falciparum populations worldwide. Several indices of molecular variation were calculated, including the proportion of polymorphic sites, the average nucleotide diversity index (π), and the haplotype diversity index (H). Tests of positive selection and neutrality tests were performed to determine signatures of natural selection on the gene. Mean genetic distance within and between species of Plasmodium ldh was analysed to infer evolutionary relationships. Nucleotide sequences of P. falciparum ldh could be classified into 9 alleles, encoding 5 isoforms of LDH. L1a was the most common allelic type and was distributed in P. falciparum populations worldwide. Plasmodium falciparum ldh sequences were highly conserved, with haplotype and nucleotide diversity values of 0.203 and 0.0004, respectively. The extremely low genetic diversity was maintained by purifying selection, likely due to functional constraints. Phylogenetic analysis inferred the close genetic relationship of P. falciparum to malaria parasites of great apes, rather than to other human malaria parasites. This study revealed the global genetic variation of the ldh gene in P. falciparum, providing knowledge for improving detection of LDH-based RDTs and supporting the candidacy of LDH as a therapeutic drug target.

Genetic diversity based on 28S rDNA sequences among populations of Culex quinquefasciatus collected at different locations in Tamil Nadu, India.

PubMed

Sakthivelkumar, S; Ramaraj, P; Veeramani, V; Janarthanan, S

2015-09-01

The basis of the present study was to distinguish the existence of any genetic variability among populations of Culex quinquefasciatus which would be a valuable tool in the management of mosquito control programmes. In the present study, population of Cx. quinquefasciatus collected at different locations in Tamil Nadu were analyzed for their genetic variation based on 28S rDNA D2 region nucleotide sequences. A high degree of genetic polymorphism was detected in the sequences of D2 region of 28S rDNA on the predicted secondary structures in spite of high nucleotide sequence similarity. The findings based on secondary structure using rDNA sequences suggested the existence of a complex genotypic diversity of Cx. quinquefasciatus population collected at different locations of Tamil Nadu, India. This complexity in genetic diversity in a single mosquito population collected at different locations is considered an important issue towards their influence and nature of vector potential of these mosquitoes.

Cytogenetic Diversity of Simple Sequences Repeats in Morphotypes of Brassica rapa ssp. chinensis

PubMed Central

Zheng, Jin-shuang; Sun, Cheng-zhen; Zhang, Shu-ning; Hou, Xi-lin; Bonnema, Guusje

2016-01-01

A significant fraction of the nuclear DNA of all eukaryotes is comprised of simple sequence repeats (SSRs). Although these sequences are widely used for studying genetic variation, linkage mapping and evolution, little attention had been paid to the chromosomal distribution and cytogenetic diversity of these sequences. In this paper, we report the distribution characterization of mono-, di-, and tri-nucleotide SSRs in Brassica rapa ssp. chinensis. Fluorescence in situ hybridization was used to characterize the cytogenetic diversity of SSRs among morphotypes of B. rapa ssp. chinensis. The proportion of different SSR motifs varied among morphotypes of B. rapa ssp. chinensis, with tri-nucleotide SSRs being more prevalent in the genome of B. rapa ssp. chinensis. We determined the chromosomal locations of mono-, di-, and tri-nucleotide repeat loci. The results showed that the chromosomal distribution of SSRs in the different morphotypes is non-random and motif-dependent, and allowed us to characterize the relative variability in terms of SSR numbers and similar chromosomal distributions in centromeric/peri-centromeric heterochromatin. The differences between SSR repeats with respect to abundance and distribution indicate that SSRs are a driving force in the genomic evolution of B. rapa species. Our results provide a comprehensive view of the SSR sequence distribution and evolution for comparison among morphotypes B. rapa ssp. chinensis. PMID:27507974

Cytogenetic Diversity of Simple Sequences Repeats in Morphotypes of Brassica rapa ssp. chinensis.

PubMed

Zheng, Jin-Shuang; Sun, Cheng-Zhen; Zhang, Shu-Ning; Hou, Xi-Lin; Bonnema, Guusje

2016-01-01

A significant fraction of the nuclear DNA of all eukaryotes is comprised of simple sequence repeats (SSRs). Although these sequences are widely used for studying genetic variation, linkage mapping and evolution, little attention had been paid to the chromosomal distribution and cytogenetic diversity of these sequences. In this paper, we report the distribution characterization of mono-, di-, and tri-nucleotide SSRs in Brassica rapa ssp. chinensis. Fluorescence in situ hybridization was used to characterize the cytogenetic diversity of SSRs among morphotypes of B. rapa ssp. chinensis. The proportion of different SSR motifs varied among morphotypes of B. rapa ssp. chinensis, with tri-nucleotide SSRs being more prevalent in the genome of B. rapa ssp. chinensis. We determined the chromosomal locations of mono-, di-, and tri-nucleotide repeat loci. The results showed that the chromosomal distribution of SSRs in the different morphotypes is non-random and motif-dependent, and allowed us to characterize the relative variability in terms of SSR numbers and similar chromosomal distributions in centromeric/peri-centromeric heterochromatin. The differences between SSR repeats with respect to abundance and distribution indicate that SSRs are a driving force in the genomic evolution of B. rapa species. Our results provide a comprehensive view of the SSR sequence distribution and evolution for comparison among morphotypes B. rapa ssp. chinensis.

Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.

1991-02-15

In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5{prime} end of the mutation site, and either an {alpha}-{sup 32}P-labeled nucleotide corresponding tomore » the normal coding sequence at the mutation site or an {alpha}-{sup 32}P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3{prime} to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation.« less

Characterizing novel endogenous retroviruses from genetic variation inferred from short sequence reads

PubMed Central

Mourier, Tobias; Mollerup, Sarah; Vinner, Lasse; Hansen, Thomas Arn; Kjartansdóttir, Kristín Rós; Guldberg Frøslev, Tobias; Snogdal Boutrup, Torsten; Nielsen, Lars Peter; Willerslev, Eske; Hansen, Anders J.

2015-01-01

From Illumina sequencing of DNA from brain and liver tissue from the lion, Panthera leo, and tumor samples from the pike-perch, Sander lucioperca, we obtained two assembled sequence contigs with similarity to known retroviruses. Phylogenetic analyses suggest that the pike-perch retrovirus belongs to the epsilonretroviruses, and the lion retrovirus to the gammaretroviruses. To determine if these novel retroviral sequences originate from an endogenous retrovirus or from a recently integrated exogenous retrovirus, we assessed the genetic diversity of the parental sequences from which the short Illumina reads are derived. First, we showed by simulations that we can robustly infer the level of genetic diversity from short sequence reads. Second, we find that the measures of nucleotide diversity inferred from our retroviral sequences significantly exceed the level observed from Human Immunodeficiency Virus infections, prompting us to conclude that the novel retroviruses are both of endogenous origin. Through further simulations, we rule out the possibility that the observed elevated levels of nucleotide diversity are the result of co-infection with two closely related exogenous retroviruses. PMID:26493184

Genetic similarity between Taenia solium cysticerci collected from the two distant endemic areas in North and North East India.

PubMed

Sharma, Monika; Devi, Kangjam Rekha; Sehgal, Rakesh; Narain, Kanwar; Mahanta, Jagadish; Malla, Nancy

2014-01-01

Taenia solium taeniasis/cysticercosis is a major public health problem in developing countries. This study reports genotypic analysis of T. solium cysticerci collected from two different endemic areas of North (Chandigarh) and North East India (Dibrugarh) by the sequencing of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The variation in cox1 sequences of samples collected from these two different geographical regions located at a distance of 2585 km was minimal. Alignment of the nucleotide sequences with different species of Taenia showed the similarity with Asian genotype of T. solium. Among 50 isolates, 6 variant nucleotide positions (0.37% of total length) were detected. These results suggest that population in these geographical areas are homogenous. Copyright © 2013 Elsevier B.V. All rights reserved.

Combined hairpin-antisense compositions and methods for modulating expression

DOEpatents

Shanklin, John; Nguyen, Tam

2014-08-05

A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

Combined hairpin-antisense compositions and methods for modulating expression

DOEpatents

Shanklin, John; Nguyen, Tam Huu

2015-11-24

A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

The Mouse Genomes Project: a repository of inbred laboratory mouse strain genomes.

PubMed

Adams, David J; Doran, Anthony G; Lilue, Jingtao; Keane, Thomas M

2015-10-01

The Mouse Genomes Project was initiated in 2009 with the goal of using next-generation sequencing technologies to catalogue molecular variation in the common laboratory mouse strains, and a selected set of wild-derived inbred strains. The initial sequencing and survey of sequence variation in 17 inbred strains was completed in 2011 and included comprehensive catalogue of single nucleotide polymorphisms, short insertion/deletions, larger structural variants including their fine scale architecture and landscape of transposable element variation, and genomic sites subject to post-transcriptional alteration of RNA. From this beginning, the resource has expanded significantly to include 36 fully sequenced inbred laboratory mouse strains, a refined and updated data processing pipeline, and new variation querying and data visualisation tools which are available on the project's website ( http://www.sanger.ac.uk/resources/mouse/genomes/ ). The focus of the project is now the completion of de novo assembled chromosome sequences and strain-specific gene structures for the core strains. We discuss how the assembled chromosomes will power comparative analysis, data access tools and future directions of mouse genetics.

iMETHYL: an integrative database of human DNA methylation, gene expression, and genomic variation.

PubMed

Komaki, Shohei; Shiwa, Yuh; Furukawa, Ryohei; Hachiya, Tsuyoshi; Ohmomo, Hideki; Otomo, Ryo; Satoh, Mamoru; Hitomi, Jiro; Sobue, Kenji; Sasaki, Makoto; Shimizu, Atsushi

2018-01-01

We launched an integrative multi-omics database, iMETHYL (http://imethyl.iwate-megabank.org). iMETHYL provides whole-DNA methylation (~24 million autosomal CpG sites), whole-genome (~9 million single-nucleotide variants), and whole-transcriptome (>14 000 genes) data for CD4 + T-lymphocytes, monocytes, and neutrophils collected from approximately 100 subjects. These data were obtained from whole-genome bisulfite sequencing, whole-genome sequencing, and whole-transcriptome sequencing, making iMETHYL a comprehensive database.

Clan Genomics and the Complex Architecture of Human Disease

PubMed Central

Belmont, John W.; Boerwinkle, Eric

2013-01-01

Human diseases are caused by alleles that encompass the full range of variant types, from single-nucleotide changes to copy-number variants, and these variations span a broad frequency spectrum, from the very rare to the common. The picture emerging from analysis of whole-genome sequences, the 1000 Genomes Project pilot studies, and targeted genomic sequencing derived from very large sample sizes reveals an abundance of rare and private variants. One implication of this realization is that recent mutation may have a greater influence on disease susceptibility or protection than is conferred by variations that arose in distant ancestors. PMID:21962505

Structure and Temporal Dynamics of Populations within Wheat Streak Mosaic Virus Isolates

PubMed Central

Hall, Jeffrey S.; French, Roy; Morris, T. Jack; Stenger, Drake C.

2001-01-01

Variation within the Type and Sidney 81 strains of wheat streak mosaic virus was assessed by single-strand conformation polymorphism (SSCP) analysis and confirmed by nucleotide sequencing. Limiting-dilution subisolates (LDSIs) of each strain were evaluated for polymorphism in the P1, P3, NIa, and CP cistrons. Different SSCP patterns among LDSIs of a strain were associated with single-nucleotide substitutions. Sidney 81 LDSI-S10 was used as founding inoculum to establish three lineages each in wheat, corn, and barley. The P1, HC-Pro, P3, CI, NIa, NIb, and CP cistrons of LDSI-S10 and each lineage at passages 1, 3, 6, and 9 were evaluated for polymorphism. By passage 9, each lineage differed in consensus sequence from LDSI-S10. The majority of substitutions occurred within NIa and CP, although at least one change occurred in each cistron except HC-Pro and P3. Most consensus sequence changes among lineages were independent, with substitutions accumulating over time. However, LDSI-S10 bore a variant nucleotide (G6016) in NIa that was restored to A6016 in eight of nine lineages by passage 6. This near-global reversion is most easily explained by selection. Examination of nonconsensus variation revealed a pool of unique substitutions (singletons) that remained constant in frequency during passage, regardless of the host species examined. These results suggest that mutations arising by viral polymerase error are generated at a constant rate but that most newly generated mutants are sequestered in virions and do not serve as replication templates. Thus, a substantial fraction of variation generated is static and has yet to be tested for relative fitness. In contrast, nonsingleton variation increased upon passage, suggesting that some mutants do serve as replication templates and may become established in a population. Replicated mutants may or may not rise to prominence to become the consensus sequence in a lineage, with the fate of any particular mutant subject to selection and stochastic processes such as genetic drift and population growth factors. PMID:11581391

Balancing Selection on a Regulatory Region Exhibiting Ancient Variation That Predates Human–Neandertal Divergence

PubMed Central

Iskow, Rebecca C.; Austermann, Christian; Scharer, Christopher D.; Raj, Towfique; Boss, Jeremy M.; Sunyaev, Shamil; Price, Alkes; Stranger, Barbara; Simon, Viviana; Lee, Charles

2013-01-01

Ancient population structure shaping contemporary genetic variation has been recently appreciated and has important implications regarding our understanding of the structure of modern human genomes. We identified a ∼36-kb DNA segment in the human genome that displays an ancient substructure. The variation at this locus exists primarily as two highly divergent haplogroups. One of these haplogroups (the NE1 haplogroup) aligns with the Neandertal haplotype and contains a 4.6-kb deletion polymorphism in perfect linkage disequilibrium with 12 single nucleotide polymorphisms (SNPs) across diverse populations. The other haplogroup, which does not contain the 4.6-kb deletion, aligns with the chimpanzee haplotype and is likely ancestral. Africans have higher overall pairwise differences with the Neandertal haplotype than Eurasians do for this NE1 locus (p<10−15). Moreover, the nucleotide diversity at this locus is higher in Eurasians than in Africans. These results mimic signatures of recent Neandertal admixture contributing to this locus. However, an in-depth assessment of the variation in this region across multiple populations reveals that African NE1 haplotypes, albeit rare, harbor more sequence variation than NE1 haplotypes found in Europeans, indicating an ancient African origin of this haplogroup and refuting recent Neandertal admixture. Population genetic analyses of the SNPs within each of these haplogroups, along with genome-wide comparisons revealed significant FST (p = 0.00003) and positive Tajima's D (p = 0.00285) statistics, pointing to non-neutral evolution of this locus. The NE1 locus harbors no protein-coding genes, but contains transcribed sequences as well as sequences with putative regulatory function based on bioinformatic predictions and in vitro experiments. We postulate that the variation observed at this locus predates Human–Neandertal divergence and is evolving under balancing selection, especially among European populations. PMID:23593015

Screening of reproduction-related single-nucleotide variations from MeDIP-seq data in sheep.

PubMed

Cao, Jiaxue; Wei, Caihong; Zhang, Shuzhen; Capellini, Terence D; Zhang, Li; Zhao, Fuping; Li, Li; Zhong, Tao; Wang, Linjie; Du, Lixin; Zhang, Hongping

2016-11-01

Extensive variation in reproduction has arisen in Chinese Mongolian sheep during recent domestication. Hu and Small-tailed Han sheep, for example, have become non-seasonal breeders and exhibit higher fecundity than Tan and Ujumqin breeds. We therefore scanned reproduction-related single-nucleotide variations from methylated DNA-immunoprecipitation sequencing data generated from each of those four breeds to uncover potential mechanisms underlying this breed variation. We generated a high-quality map of single nucleotide variations (SNVs) in DNA methylation enriched regions, and found that the majority of variants are located within non-coding regions. We identified 359 SNVs within the Sheep Quantitative Trait Locus (QTL) database. Nineteen of these SNVs associated with the Aseasonal Reproduction QTL, and 10 out of the 19 reside close to genes with known reproduction functions. We also identified the well-known FecB mutation in high-fecundity sheep (Hu and Small-tailed Han sheep). When we applied these FecB finding to our breeding system, we improved lambing rate by 175%. In summary, this study provided strong candidate SNVs associated with sheep fecundity that can serve as targets for functional testing and to enhance selective breeding strategies. Mol. Reprod. Dev. 83: 958-967, 2016 © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Inter- and intraspecific mitochondrial DNA variation in North American bears (Ursus)

USGS Publications Warehouse

Cronin, Matthew A.; Amstrup, Steven C.; Garner, Gerald W.; Vyse, Ernest R.

1991-01-01

We assessed mitochondrial DNA variation in North American black bears (Ursus americanus), brown bears (Ursus arctos), and polar bears (Ursus maritimus). Divergent mitochondrial DNA haplotypes (0.05 base substitutions per nucleotide) were identified in populations of black bears from Montana and Oregon. In contrast, very similar haplotypes occur in black bears across North America. This discordance of haplotype phylogeny and geographic distribution indicates that there has been maintenance of polymorphism and considerable gene flow throughout the history of the species. Intraspecific mitochondrial DNA sequence divergence in brown bears and polar bears is lower than in black bears. The two morphological forms of U. arctos, grizzly and coastal brown bears, are not in distinct mtDNA lineages. Interspecific comparisons indicate that brown bears and polar bears share similar mitochondrial DNA (0.023 base substitutions per nucleotide) which is quite divergent (0.078 base substitutions per nucleotide) from that of black bears. High mitochondrial DNA divergence within black bears and paraphyletic relationships of brown and polar bear mitochondrial DNA indicate that intraspecific variation across species' ranges should be considered in phylogenetic analyses of mitochondrial DNA.

Distinguishing functional polymorphism from random variation in the sequences of >10,000 HLA-A, -B and -C alleles.

PubMed

Robinson, James; Guethlein, Lisbeth A; Cereb, Nezih; Yang, Soo Young; Norman, Paul J; Marsh, Steven G E; Parham, Peter

2017-06-01

HLA class I glycoproteins contain the functional sites that bind peptide antigens and engage lymphocyte receptors. Recently, clinical application of sequence-based HLA typing has uncovered an unprecedented number of novel HLA class I alleles. Here we define the nature and extent of the variation in 3,489 HLA-A, 4,356 HLA-B and 3,111 HLA-C alleles. This analysis required development of suites of methods, having general applicability, for comparing and analyzing large numbers of homologous sequences. At least three amino-acid substitutions are present at every position in the polymorphic α1 and α2 domains of HLA-A, -B and -C. A minority of positions have an incidence >1% for the 'second' most frequent nucleotide, comprising 70 positions in HLA-A, 85 in HLA-B and 54 in HLA-C. The majority of these positions have three or four alternative nucleotides. These positions were subject to positive selection and correspond to binding sites for peptides and receptors. Most alleles of HLA class I (>80%) are very rare, often identified in one person or family, and they differ by point mutation from older, more common alleles. These alleles with single nucleotide polymorphisms reflect the germ-line mutation rate. Their frequency predicts the human population harbors 8-9 million HLA class I variants. The common alleles of human populations comprise 42 core alleles, which represent all selected polymorphism, and recombinants that have assorted this polymorphism.

Distinguishing functional polymorphism from random variation in the sequences of >10,000 HLA-A, -B and -C alleles

PubMed Central

Cereb, Nezih; Yang, Soo Young; Marsh, Steven G. E.; Parham, Peter

2017-01-01

HLA class I glycoproteins contain the functional sites that bind peptide antigens and engage lymphocyte receptors. Recently, clinical application of sequence-based HLA typing has uncovered an unprecedented number of novel HLA class I alleles. Here we define the nature and extent of the variation in 3,489 HLA-A, 4,356 HLA-B and 3,111 HLA-C alleles. This analysis required development of suites of methods, having general applicability, for comparing and analyzing large numbers of homologous sequences. At least three amino-acid substitutions are present at every position in the polymorphic α1 and α2 domains of HLA-A, -B and -C. A minority of positions have an incidence >1% for the ‘second’ most frequent nucleotide, comprising 70 positions in HLA-A, 85 in HLA-B and 54 in HLA-C. The majority of these positions have three or four alternative nucleotides. These positions were subject to positive selection and correspond to binding sites for peptides and receptors. Most alleles of HLA class I (>80%) are very rare, often identified in one person or family, and they differ by point mutation from older, more common alleles. These alleles with single nucleotide polymorphisms reflect the germ-line mutation rate. Their frequency predicts the human population harbors 8–9 million HLA class I variants. The common alleles of human populations comprise 42 core alleles, which represent all selected polymorphism, and recombinants that have assorted this polymorphism. PMID:28650991

The diploid genome sequence of an Asian individual

PubMed Central

Wang, Jun; Wang, Wei; Li, Ruiqiang; Li, Yingrui; Tian, Geng; Goodman, Laurie; Fan, Wei; Zhang, Junqing; Li, Jun; Zhang, Juanbin; Guo, Yiran; Feng, Binxiao; Li, Heng; Lu, Yao; Fang, Xiaodong; Liang, Huiqing; Du, Zhenglin; Li, Dong; Zhao, Yiqing; Hu, Yujie; Yang, Zhenzhen; Zheng, Hancheng; Hellmann, Ines; Inouye, Michael; Pool, John; Yi, Xin; Zhao, Jing; Duan, Jinjie; Zhou, Yan; Qin, Junjie; Ma, Lijia; Li, Guoqing; Yang, Zhentao; Zhang, Guojie; Yang, Bin; Yu, Chang; Liang, Fang; Li, Wenjie; Li, Shaochuan; Li, Dawei; Ni, Peixiang; Ruan, Jue; Li, Qibin; Zhu, Hongmei; Liu, Dongyuan; Lu, Zhike; Li, Ning; Guo, Guangwu; Zhang, Jianguo; Ye, Jia; Fang, Lin; Hao, Qin; Chen, Quan; Liang, Yu; Su, Yeyang; san, A.; Ping, Cuo; Yang, Shuang; Chen, Fang; Li, Li; Zhou, Ke; Zheng, Hongkun; Ren, Yuanyuan; Yang, Ling; Gao, Yang; Yang, Guohua; Li, Zhuo; Feng, Xiaoli; Kristiansen, Karsten; Wong, Gane Ka-Shu; Nielsen, Rasmus; Durbin, Richard; Bolund, Lars; Zhang, Xiuqing; Li, Songgang; Yang, Huanming; Wang, Jian

2009-01-01

Here we present the first diploid genome sequence of an Asian individual. The genome was sequenced to 36-fold average coverage using massively parallel sequencing technology. We aligned the short reads onto the NCBI human reference genome to 99.97% coverage, and guided by the reference genome, we used uniquely mapped reads to assemble a high-quality consensus sequence for 92% of the Asian individual's genome. We identified approximately 3 million single-nucleotide polymorphisms (SNPs) inside this region, of which 13.6% were not in the dbSNP database. Genotyping analysis showed that SNP identification had high accuracy and consistency, indicating the high sequence quality of this assembly. We also carried out heterozygote phasing and haplotype prediction against HapMap CHB and JPT haplotypes (Chinese and Japanese, respectively), sequence comparison with the two available individual genomes (J. D. Watson and J. C. Venter), and structural variation identification. These variations were considered for their potential biological impact. Our sequence data and analyses demonstrate the potential usefulness of next-generation sequencing technologies for personal genomics. PMID:18987735

Substantial Regional Variation in Substitution Rates in the Human Genome: Importance of GC Content, Gene Density, and Telomere-Specific Effects

NASA Astrophysics Data System (ADS)

Arndt, Peter F.; Hwa, Terence; Petrov, Dmitri A.

2005-06-01

This study presents the first global, 1 Mbp level analysis of patterns of nucleotide substitutions along the human lineage. The study is based on the analysis of a large amount of repetitive elements deposited into the human genome since the mammalian radiation, yielding a number of results that would have been difficult to obtain using the more conventional comparative method of analysis. This analysis revealed substantial and consistent variability of rates of substitution, with the variability ranging up to 2-fold among different regions. The rates of substitutions of C or G nucleotides with A or T nucleotides vary much more sharply than the reverse rates suggesting that much of that variation is due to differences in mutation rates rather than in the probabilities of fixation of C/G vs. A/T nucleotides across the genome. For all types of substitution we observe substantially more hotspots than coldspots, with hotspots showing substantial clustering over tens of Mbp's. Our analysis revealed that GC-content of surrounding sequences is the best predictor of the rates of substitution. The pattern of substitution appears very different near telomeres compared to the rest of the genome and cannot be explained by the genome-wide correlations of the substitution rates with GC content or exon density. The telomere pattern of substitution is consistent with natural selection or biased gene conversion acting to increase the GC-content of the sequences that are within 10-15 Mbp away from the telomere.

Multilocus analysis of nucleotide variation and speciation in three closely related Populus (Salicaceae) species.

PubMed

Du, Shuhui; Wang, Zhaoshan; Ingvarsson, Pär K; Wang, Dongsheng; Wang, Junhui; Wu, Zhiqiang; Tembrock, Luke R; Zhang, Jianguo

2015-10-01

Historical tectonism and climate oscillations can isolate and contract the geographical distributions of many plant species, and they are even known to trigger species divergence and ultimately speciation. Here, we estimated the nucleotide variation and speciation in three closely related Populus species, Populus tremuloides, P. tremula and P. davidiana, distributed in North America and Eurasia. We analysed the sequence variation in six single-copy nuclear loci and three chloroplast (cpDNA) fragments in 497 individuals sampled from 33 populations of these three species across their geographic distributions. These three Populus species harboured relatively high levels of nucleotide diversity and showed high levels of nucleotide differentiation. Phylogenetic analysis revealed that P. tremuloides diverged earlier than the other two species. The cpDNA haplotype network result clearly illustrated the dispersal route from North America to eastern Asia and then into Europe. Molecular dating results confirmed that the divergence of these three species coincided with the sundering of the Bering land bridge in the late Miocene and a rapid uplift of the Qinghai-Tibetan Plateau around the Miocene/Pliocene boundary. Vicariance-driven successful allopatric speciation resulting from historical tectonism and climate oscillations most likely played roles in the formation of the disjunct distributions and divergence of these three Populus species. © 2015 John Wiley & Sons Ltd.

E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China

PubMed Central

Wen, Qiang; Wang, Tao; Mu, Xuemei; Chenzhang, Yuwei; Cao, Man

2017-01-01

Cancer of the cervix is associated with infection by certain types of human papillomavirus (HPV). The gene variants differ in immune responses and oncogenic potential. The E6 and E7 proteins encoded by high-risk HPV play a key role in cellular transformation. HPV-33 and HPV-58 types are highly prevalent among Chinese women. To study the gene intratypic variations, polymorphisms and positive selections of HPV-33 and HPV-58 E6/E7 in southwest China, HPV-33 (E6, E7: n = 216) and HPV-58 (E6, E7: n = 405) E6 and E7 genes were sequenced and compared to others submitted to GenBank. Phylogenetic trees were constructed by Maximum-likelihood and the Kimura 2-parameters methods by MEGA 6 (Molecular Evolutionary Genetics Analysis version 6.0). The diversity of secondary structure was analyzed by PSIPred software. The selection pressures acting on the E6/E7 genes were estimated by PAML 4.8 (Phylogenetic Analyses by Maximun Likelihood version4.8) software. The positive sites of HPV-33 and HPV-58 E6/E7 were contrasted by ClustalX 2.1. Among 216 HPV-33 E6 sequences, 8 single nucleotide mutations were observed with 6/8 non-synonymous and 2/8 synonymous mutations. The 216 HPV-33 E7 sequences showed 3 single nucleotide mutations that were non-synonymous. The 405 HPV-58 E6 sequences revealed 8 single nucleotide mutations with 4/8 non-synonymous and 4/8 synonymous mutations. Among 405 HPV-58 E7 sequences, 13 single nucleotide mutations were observed with 10/13 non-synonymous mutations and 3/13 synonymous mutations. The selective pressure analysis showed that all HPV-33 and 4/6 HPV-58 E6/E7 major non-synonymous mutations were sites of positive selection. All variations were observed in sites belonging to major histocompatibility complex and/or B-cell predicted epitopes. K93N and R145 (I/N) were observed in both HPV-33 and HPV-58 E6. PMID:28141822

Updating Our View of Organelle Genome Nucleotide Landscape

PubMed Central

Smith, David Roy

2012-01-01

Organelle genomes show remarkable variation in architecture and coding content, yet their nucleotide composition is relatively unvarying across the eukaryotic domain, with most having a high adenine and thymine (AT) content. Recent studies, however, have uncovered guanine and cytosine (GC)-rich mitochondrial and plastid genomes. These sequences come from a small but eclectic list of species, including certain green plants and animals. Here, I review GC-rich organelle DNAs and the insights they have provided into the evolution of nucleotide landscape. I emphasize that GC-biased mitochondrial and plastid DNAs are more widespread than once thought, sometimes occurring together in the same species, and suggest that the forces biasing their nucleotide content can differ both among and within lineages, and may be associated with specific genome architectural features and life history traits. PMID:22973299

Whole-Genome Sequence Variation among Multiple Isolates of Pseudomonas aeruginosa

PubMed Central

Spencer, David H.; Kas, Arnold; Smith, Eric E.; Raymond, Christopher K.; Sims, Elizabeth H.; Hastings, Michele; Burns, Jane L.; Kaul, Rajinder; Olson, Maynard V.

2003-01-01

Whole-genome shotgun sequencing was used to study the sequence variation of three Pseudomonas aeruginosa isolates, two from clonal infections of cystic fibrosis patients and one from an aquatic environment, relative to the genomic sequence of reference strain PAO1. The majority of the PAO1 genome is represented in these strains; however, at least three prominent islands of PAO1-specific sequence are apparent. Conversely, ∼10% of the sequencing reads derived from each isolate fail to align with the PAO1 backbone. While average sequence variation among all strains is roughly 0.5%, regions of pronounced differences were evident in whole-genome scans of nucleotide diversity. We analyzed two such divergent loci, the pyoverdine and O-antigen biosynthesis regions, by complete resequencing. A thorough analysis of isolates collected over time from one of the cystic fibrosis patients revealed independent mutations resulting in the loss of O-antigen synthesis alternating with a mucoid phenotype. Overall, we conclude that most of the PAO1 genome represents a core P. aeruginosa backbone sequence while the strains addressed in this study possess additional genetic material that accounts for at least 10% of their genomes. Approximately half of these additional sequences are novel. PMID:12562802

Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome

PubMed Central

Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

2014-01-01

Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield. PMID:25333064

Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

PubMed

Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

2014-09-01

Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

Structural requirements for recognition of the HLA-Dw14 class II epitope: A key HLA determinant associated with rheumatoid arthritis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hiraiwa, Akikazu; Yamanaka, Katsuo; Kwok, W.W.

Although HLA genes have been shown to be associated with certain diseases, the basis for this association is unknown. Recent studies, however, have documented patterns of nucleotide sequence variation among some HLA genes associated with a particular disease. For rheumatoid arthritis, HLA genes in most patients have a shared nucleotide sequence encoding a key structural element of an HLA class II polypeptide; this sequence element is critical for the interaction of the HLA molecule with antigenic peptides and with responding T cells, suggestive of a direct role for this sequence element in disease susceptibility. The authors describe the serological andmore » cellular immunologic characteristics encoded by this rheumatoid arthritis-associated sequence element. Site-directed mutagenesis of the DRB1 gene was used to define amino acids critical for antibody and T-cell recognition of this structural element, focusing on residues that distinguish the rheumatoid arthritis-associated alleles Dw4 and Dw14 from a closely related allele, Dw10, not associated with disease. Both the gain and loss of rheumatoid arthritis-associated epitopes were highly dependent on three residues within a discrete domain of the HLA-DR molecule. Recognition was most strongly influenced by the following amino acids (in order): 70 > 71 > 67. Some alloreactive T-cell clones were also influenced by amino acid variation in portions of the DR molecule lying outside the shared sequence element.« less

PopHuman: the human population genomics browser.

PubMed

Casillas, Sònia; Mulet, Roger; Villegas-Mirón, Pablo; Hervas, Sergi; Sanz, Esteve; Velasco, Daniel; Bertranpetit, Jaume; Laayouni, Hafid; Barbadilla, Antonio

2018-01-04

The 1000 Genomes Project (1000GP) represents the most comprehensive world-wide nucleotide variation data set so far in humans, providing the sequencing and analysis of 2504 genomes from 26 populations and reporting >84 million variants. The availability of this sequence data provides the human lineage with an invaluable resource for population genomics studies, allowing the testing of molecular population genetics hypotheses and eventually the understanding of the evolutionary dynamics of genetic variation in human populations. Here we present PopHuman, a new population genomics-oriented genome browser based on JBrowse that allows the interactive visualization and retrieval of an extensive inventory of population genetics metrics. Efficient and reliable parameter estimates have been computed using a novel pipeline that faces the unique features and limitations of the 1000GP data, and include a battery of nucleotide variation measures, divergence and linkage disequilibrium parameters, as well as different tests of neutrality, estimated in non-overlapping windows along the chromosomes and in annotated genes for all 26 populations of the 1000GP. PopHuman is open and freely available at http://pophuman.uab.cat. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

DNA Sequence Polymorphism of the Lactate Dehydrogenase Genefrom Iranian Plasmodium vivax and Plasmodium falciparum Isolates.

PubMed

Getacher Feleke, Daniel; Nateghpour, Mehdi; Motevalli Haghi, Afsaneh; Hajjaran, Homa; Farivar, Leila; Mohebali, Mehdi; Raoofian, Reza

2015-01-01

Parasite lactate dehydrogenase (pLDH) is extensively employed as malaria rapid diagnostic tests (RDTs). Moreover, it is a well-known drug target candidate. However, the genetic diversity of this gene might influence performance of RDT kits and its drug target candidacy. This study aimed to determine polymorphism of pLDH gene from Iranian isolates of P. vivax and P. falciparum. Genomic DNA was extracted from whole blood of microscopically confirmed P. vivax and P. falciparum infected patients. pLDH gene of P. falciparum and P. vivax was amplified using conventional PCR from 43 symptomatic malaria patients from Sistan and Baluchistan Province, Southeast Iran from 2012 to 2013. Sequence analysis of 15 P. vivax LDH showed fourteen had 100% identity with P. vivax Sal-1 and Belem strains. Two nucleotide substitutions were detected with only one resulted in amino acid change. Analysis of P. falciparum LDH sequences showed six of the seven sequences had 100% homology with P. falciparum 3D7 and Mzr-1. Moreover, PfLDH displayed three nucleotide changes that resulted in changing only one amino acid. PvLDH and PfLDH showed 75%-76% nucleotide and 90.4%-90.76% amino acid homology. pLDH gene from Iranian P. falciparum and P. vivax isolates displayed 98.8-100% homology with 1-3 nucleotide substitutions. This indicated this gene was relatively conserved. Additional studies can be done weather this genetic variation can influence the performance of pLDH based RDTs or not.

Population-genomic variation within RNA viruses of the Western honey bee, Apis mellifera, inferred from deep sequencing

PubMed Central

2013-01-01

Background Deep sequencing of viruses isolated from infected hosts is an efficient way to measure population-genetic variation and can reveal patterns of dispersal and natural selection. In this study, we mined existing Illumina sequence reads to investigate single-nucleotide polymorphisms (SNPs) within two RNA viruses of the Western honey bee (Apis mellifera), deformed wing virus (DWV) and Israel acute paralysis virus (IAPV). All viral RNA was extracted from North American samples of honey bees or, in one case, the ectoparasitic mite Varroa destructor. Results Coverage depth was generally lower for IAPV than DWV, and marked gaps in coverage occurred in several narrow regions (< 50 bp) of IAPV. These coverage gaps occurred across sequencing runs and were virtually unchanged when reads were re-mapped with greater permissiveness (up to 8% divergence), suggesting a recurrent sequencing artifact rather than strain divergence. Consensus sequences of DWV for each sample showed little phylogenetic divergence, low nucleotide diversity, and strongly negative values of Fu and Li’s D statistic, suggesting a recent population bottleneck and/or purifying selection. The Kakugo strain of DWV fell outside of all other DWV sequences at 100% bootstrap support. IAPV consensus sequences supported the existence of multiple clades as had been previously reported, and Fu and Li’s D was closer to neutral expectation overall, although a sliding-window analysis identified a significantly positive D within the protease region, suggesting selection maintains diversity in that region. Within-sample mean diversity was comparable between the two viruses on average, although for both viruses there was substantial variation among samples in mean diversity at third codon positions and in the number of high-diversity sites. FST values were bimodal for DWV, likely reflecting neutral divergence in two low-diversity populations, whereas IAPV had several sites that were strong outliers with very low FST. Conclusions This initial survey of genetic variation within honey bee RNA viruses suggests future directions for studies examining the underlying causes of population-genetic structure in these economically important pathogens. PMID:23497218

Population-genomic variation within RNA viruses of the Western honey bee, Apis mellifera, inferred from deep sequencing.

PubMed

Cornman, Robert Scott; Boncristiani, Humberto; Dainat, Benjamin; Chen, Yanping; vanEngelsdorp, Dennis; Weaver, Daniel; Evans, Jay D

2013-03-07

Deep sequencing of viruses isolated from infected hosts is an efficient way to measure population-genetic variation and can reveal patterns of dispersal and natural selection. In this study, we mined existing Illumina sequence reads to investigate single-nucleotide polymorphisms (SNPs) within two RNA viruses of the Western honey bee (Apis mellifera), deformed wing virus (DWV) and Israel acute paralysis virus (IAPV). All viral RNA was extracted from North American samples of honey bees or, in one case, the ectoparasitic mite Varroa destructor. Coverage depth was generally lower for IAPV than DWV, and marked gaps in coverage occurred in several narrow regions (< 50 bp) of IAPV. These coverage gaps occurred across sequencing runs and were virtually unchanged when reads were re-mapped with greater permissiveness (up to 8% divergence), suggesting a recurrent sequencing artifact rather than strain divergence. Consensus sequences of DWV for each sample showed little phylogenetic divergence, low nucleotide diversity, and strongly negative values of Fu and Li's D statistic, suggesting a recent population bottleneck and/or purifying selection. The Kakugo strain of DWV fell outside of all other DWV sequences at 100% bootstrap support. IAPV consensus sequences supported the existence of multiple clades as had been previously reported, and Fu and Li's D was closer to neutral expectation overall, although a sliding-window analysis identified a significantly positive D within the protease region, suggesting selection maintains diversity in that region. Within-sample mean diversity was comparable between the two viruses on average, although for both viruses there was substantial variation among samples in mean diversity at third codon positions and in the number of high-diversity sites. FST values were bimodal for DWV, likely reflecting neutral divergence in two low-diversity populations, whereas IAPV had several sites that were strong outliers with very low FST. This initial survey of genetic variation within honey bee RNA viruses suggests future directions for studies examining the underlying causes of population-genetic structure in these economically important pathogens.

Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

PubMed

Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

2011-10-17

The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection

PubMed Central

2011-01-01

Background The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. Results The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. Conclusions These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection. PMID:22004418

ENGINES: exploring single nucleotide variation in entire human genomes.

PubMed

Amigo, Jorge; Salas, Antonio; Phillips, Christopher

2011-04-19

Next generation ultra-sequencing technologies are starting to produce extensive quantities of data from entire human genome or exome sequences, and therefore new software is needed to present and analyse this vast amount of information. The 1000 Genomes project has recently released raw data for 629 complete genomes representing several human populations through their Phase I interim analysis and, although there are certain public tools available that allow exploration of these genomes, to date there is no tool that permits comprehensive population analysis of the variation catalogued by such data. We have developed a genetic variant site explorer able to retrieve data for Single Nucleotide Variation (SNVs), population by population, from entire genomes without compromising future scalability and agility. ENGINES (ENtire Genome INterface for Exploring SNVs) uses data from the 1000 Genomes Phase I to demonstrate its capacity to handle large amounts of genetic variation (>7.3 billion genotypes and 28 million SNVs), as well as deriving summary statistics of interest for medical and population genetics applications. The whole dataset is pre-processed and summarized into a data mart accessible through a web interface. The query system allows the combination and comparison of each available population sample, while searching by rs-number list, chromosome region, or genes of interest. Frequency and FST filters are available to further refine queries, while results can be visually compared with other large-scale Single Nucleotide Polymorphism (SNP) repositories such as HapMap or Perlegen. ENGINES is capable of accessing large-scale variation data repositories in a fast and comprehensive manner. It allows quick browsing of whole genome variation, while providing statistical information for each variant site such as allele frequency, heterozygosity or FST values for genetic differentiation. Access to the data mart generating scripts and to the web interface is granted from http://spsmart.cesga.es/engines.php. © 2011 Amigo et al; licensee BioMed Central Ltd.

Genetic variation and virulence of nucleopolyhedroviruses isolated worldwide from the heliothine pests Helicoverpa armigera, Helicoverpa zea, and Heliothis virescens

USDA-ARS?s Scientific Manuscript database

A PCR-based method was used to classify 90 samples of nucleopolyhedrovirus (NPV; Baculoviridae: Alphabaculovirus) obtained worldwide from larvae of Heliothis virescens, Helicoverpa zea, and Helicoverpa armigera. Partial nucleotide sequencing and phylogenetic analysis of three highly conserved genes...

The nucleotides they are a-changin': function of RNA binding proteins in post-transcriptional messenger RNA editing and modification in Arabidopsis.

PubMed

Kramer, Marianne C; Anderson, Stephen J; Gregory, Brian D

2018-06-05

During and after transcription, the fate of an RNA molecule is almost entirely directed by the cohorts of interacting RNA-binding proteins (RBPs). RBPs regulate all stages of the life cycle of a messenger RNA (mRNA) molecule, including splicing, polyadenylation, transport out of the nucleus, RNA stability, and translation. In addition to these functions, RBPs can function to modify or edit the sequences encoded by the RNA. While the sequence for each transcript is determined in the genome, by the time an RNA reaches its final fate, the sequence may have been edited, where one nucleotide is converted to another, or modified, where a chemical group, or sometimes others moieties, are covalently linked to a nucleotide base. These changes to the RNA sequence have major consequences on the function of the RNA. Additionally, variation in the levels of the RBPs that perform the editing or modification can drastically affect the fitness of an organism. Here, we review RBPs that are known to edit or modify RNA ribonucleotides, focusing on the RNA editing ability of the pentatricopeptide repeat (PPR) proteins and the RBPs that modify adenosine to N 6 - methyladenosine. Copyright © 2018 Elsevier Ltd. All rights reserved.

Sequence differences in the diagnostic region of the cysteine protease 8 gene of Tritrichomonas foetus parasites of cats and cattle.

PubMed

Sun, Zichen; Stack, Colin; Šlapeta, Jan

2012-05-25

In order to investigate the genetic variation between Tritrichomonas foetus from bovine and feline origins, cysteine protease 8 (CP8) coding sequence was selected as the polymorphic DNA marker. Direct sequencing of CP8 coding sequence of T. foetus from four feline isolates and two bovine isolates with polymerase chain reaction successfully revealed conserved nucleotide polymorphisms between feline and bovine isolates. These results provide useful information for CP8-based molecular differentiation of T. foetus genotypes. Copyright © 2011 Elsevier B.V. All rights reserved.

Genetic variation and dynamics of infections of equid herpesvirus 5 in individual horses.

PubMed

Back, Helena; Ullman, Karin; Leijon, Mikael; Söderlund, Robert; Penell, Johanna; Ståhl, Karl; Pringle, John; Valarcher, Jean-François

2016-01-01

Equid herpesvirus 5 (EHV-5) is related to the human Epstein-Barr virus (human herpesvirus 4) and has frequently been observed in equine populations worldwide. EHV-5 was previously assumed to be low to non-pathogenic; however, studies have also related the virus to the severe lung disease equine multinodular pulmonary fibrosis (EMPF). Genetic information of EHV-5 is scanty: the whole genome was recently described and only limited nucleotide sequences are available. In this study, samples were taken twice 1 year apart from eight healthy horses at the same professional training yard and samples from a ninth horse that was diagnosed with EMPF with samples taken pre- and post-mortem to analyse partial glycoprotein B (gB) gene of EHV-5 by using next-generation sequencing. The analysis resulted in 27 partial gB gene sequences, 11 unique sequence types and five amino acid sequences. These sequences could be classified within four genotypes (I-IV) of the EHV-5 gB gene based on the degree of similarity of the nucleotide and amino acid sequences, and in this work horses were shown to be identified with up to three different genotypes simultaneously. The observations showed a range of interactions between EHV-5 and the host over time, where the same virus persists in some horses, whereas others have a more dynamic infection pattern including strains from different genotypes. This study provides insight into the genetic variation and dynamics of EHV-5, and highlights that further work is needed to understand the EHV-5 interaction with its host.

Whole genome sequencing discriminates hepatocellular carcinoma with intrahepatic metastasis from multi-centric tumors.

PubMed

Furuta, Mayuko; Ueno, Masaki; Fujimoto, Akihiro; Hayami, Shinya; Yasukawa, Satoru; Kojima, Fumiyoshi; Arihiro, Koji; Kawakami, Yoshiiku; Wardell, Christopher P; Shiraishi, Yuichi; Tanaka, Hiroko; Nakano, Kaoru; Maejima, Kazuhiro; Sasaki-Oku, Aya; Tokunaga, Naoki; Boroevich, Keith A; Abe, Tetsuo; Aikata, Hiroshi; Ohdan, Hideki; Gotoh, Kunihito; Kubo, Michiaki; Tsunoda, Tatsuhiko; Miyano, Satoru; Chayama, Kazuaki; Yamaue, Hiroki; Nakagawa, Hidewaki

2017-02-01

Patients with hepatocellular carcinoma (HCC) have a high-risk of multi-centric (MC) tumor occurrence due to a strong carcinogenic background in the liver. In addition, they have a high risk of intrahepatic metastasis (IM). Liver tumors withIM or MC are profoundly different in their development and clinical outcome. However, clinically or pathologically discriminating between IM and MC can be challenging. This study investigated whether IM or MC could be diagnosed at the molecular level. We performed whole genome and RNA sequencing analyses of 49 tumors including two extra-hepatic metastases, and one nodule-in-nodule tumor from 23 HCC patients. Sequencing-based molecular diagnosis using somatic single nucleotide variation information showed higher sensitivity compared to previous techniques due to the inclusion of a larger number of mutation events. This proved useful in cases, which showed inconsistent clinical diagnoses. In addition, whole genome sequencing offered advantages in profiling of other genetic alterations, such as structural variations, copy number alterations, and variant allele frequencies, and helped to confirm the IM/MCdiagnosis. Divergent alterations between IM tumors with sorafenib treatment, long time-intervals, or tumor-in-tumor nodules indicated high intra-tumor heterogeneity, evolution, and clonal switching of liver cancers. It is important to analyze the differences between IM tumors, in addition to IM/MC diagnosis, before selecting a therapeutic strategy for multiple tumors in the liver. Whole genome sequencing of multiple liver tumors enabled the accuratediagnosis ofmulti-centric occurrence and intrahepatic metastasis using somatic single nucleotide variation information. In addition, genetic discrepancies between tumors help us to understand the physical changes during recurrence and cancer spread. Copyright © 2016 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

DOEpatents

Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.

2007-12-04

The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

Complex multifractal nature in Mycobacterium tuberculosis genome

PubMed Central

Mandal, Saurav; Roychowdhury, Tanmoy; Chirom, Keilash; Bhattacharya, Alok; Brojen Singh, R. K.

2017-01-01

The mutifractal and long range correlation (C(r)) properties of strings, such as nucleotide sequence can be a useful parameter for identification of underlying patterns and variations. In this study C(r) and multifractal singularity function f(α) have been used to study variations in the genomes of a pathogenic bacteria Mycobacterium tuberculosis. Genomic sequences of M. tuberculosis isolates displayed significant variations in C(r) and f(α) reflecting inherent differences in sequences among isolates. M. tuberculosis isolates can be categorised into different subgroups based on sensitivity to drugs, these are DS (drug sensitive isolates), MDR (multi-drug resistant isolates) and XDR (extremely drug resistant isolates). C(r) follows significantly different scaling rules in different subgroups of isolates, but all the isolates follow one parameter scaling law. The richness in complexity of each subgroup can be quantified by the measures of multifractal parameters displaying a pattern in which XDR isolates have highest value and lowest for drug sensitive isolates. Therefore C(r) and multifractal functions can be useful parameters for analysis of genomic sequences. PMID:28440326

Complex multifractal nature in Mycobacterium tuberculosis genome

NASA Astrophysics Data System (ADS)

Mandal, Saurav; Roychowdhury, Tanmoy; Chirom, Keilash; Bhattacharya, Alok; Brojen Singh, R. K.

2017-04-01

The mutifractal and long range correlation (C(r)) properties of strings, such as nucleotide sequence can be a useful parameter for identification of underlying patterns and variations. In this study C(r) and multifractal singularity function f(α) have been used to study variations in the genomes of a pathogenic bacteria Mycobacterium tuberculosis. Genomic sequences of M. tuberculosis isolates displayed significant variations in C(r) and f(α) reflecting inherent differences in sequences among isolates. M. tuberculosis isolates can be categorised into different subgroups based on sensitivity to drugs, these are DS (drug sensitive isolates), MDR (multi-drug resistant isolates) and XDR (extremely drug resistant isolates). C(r) follows significantly different scaling rules in different subgroups of isolates, but all the isolates follow one parameter scaling law. The richness in complexity of each subgroup can be quantified by the measures of multifractal parameters displaying a pattern in which XDR isolates have highest value and lowest for drug sensitive isolates. Therefore C(r) and multifractal functions can be useful parameters for analysis of genomic sequences.

Complete mitochondrial genome sequences of Brassica rapa (Chinese cabbage and mizuna), and intraspecific differentiation of cytoplasm in B. rapa and Brassica juncea.

PubMed

Hatono, Saki; Nishimura, Kaori; Murakami, Yoko; Tsujimura, Mai; Yamagishi, Hiroshi

2017-09-01

The complete sequence of the mitochondrial genome was determined for two cultivars of Brassica rapa . After determining the sequence of a Chinese cabbage variety, 'Oushou hakusai', the sequence of a mizuna variety, 'Chusei shiroguki sensuji kyomizuna', was mapped against the sequence of Chinese cabbage. The precise sequences where the two varieties demonstrated variation were ascertained by direct sequencing. It was found that the mitochondrial genomes of the two varieties are identical over 219,775 bp, with a single nucleotide polymorphism (SNP) between the genomes. Because B. rapa is the maternal species of an amphidiploid crop species, Brassica juncea , the distribution of the SNP was observed both in B. rapa and B. juncea . While the mizuna type SNP was restricted mainly to cultivars of mizuna (japonica group) in B. rapa , the mizuna type was widely distributed in B. juncea . The finding that the two Brassica species have these SNP types in common suggests that the nucleotide substitution occurred in wild B. rapa before both mitotypes were domesticated. It was further inferred that the interspecific hybridization between B. rapa and B. nigra took place twice and resulted in the two mitotypes of cultivated B. juncea .

Sequence diversity of wheat mosaic virus isolates.

PubMed

Stewart, Lucy R

2016-02-02

Wheat mosaic virus (WMoV), transmitted by eriophyid wheat curl mites (Aceria tosichella) is the causal agent of High Plains disease in wheat and maize. WMoV and other members of the genus Emaravirus evaded thorough molecular characterization for many years due to the experimental challenges of mite transmission and manipulating multisegmented negative sense RNA genomes. Recently, the complete genome sequence of a Nebraska isolate of WMoV revealed eight segments, plus a variant sequence of the nucleocapsid protein-encoding segment. Here, near-complete and partial consensus sequences of five more WMoV isolates are reported and compared to the Nebraska isolate: an Ohio maize isolate (GG1), a Kansas barley isolate (KS7), and three Ohio wheat isolates (H1, K1, W1). Results show two distinct groups of WMoV isolates: Ohio wheat isolate RNA segments had 84% or lower nucleotide sequence identity to the NE isolate, whereas GG1 and KS7 had 98% or higher nucleotide sequence identity to the NE isolate. Knowledge of the sequence variability of WMoV isolates is a step toward understanding virus biology, and potentially explaining observed biological variation. Published by Elsevier B.V.

High levels of MHC class II allelic diversity in lake trout from Lake Superior

USGS Publications Warehouse

Dorschner, M.O.; Duris, T.; Bronte, C.R.; Burnham-Curtis, M. K.; Phillips, R.B.

2000-01-01

Sequence variation in a 216 bp portion of the major histocompatibility complex (MHC) II B1 domain was examined in 74 individual lake trout (Salvelinus namaycush) from different locations in Lake Superior. Forty-three alleles were obtained which encoded 71-72 amino acids of the mature protein. These sequences were compared with previous data obtained from five Pacific salmon species and Atlantic salmon using the same primers. Although all of the lake trout alleles clustered together in the neighbor-joining analysis of amino acid sequences, one amino acid allelic lineage was shared with Atlantic salmon (Salmo salar), a species in another genus which probably diverged from Salvelinus more than 10-20 million years ago. As shown previously in other salmonids, the level of nonsynonymous nucleotide substitution (d(N)) exceeded the level of synonymous substitution (d(S)). The level of nucleotide diversity at the MHC class II B1 locus was considerably higher in lake trout than in the Pacific salmon (genus Oncorhynchus). These results are consistent with the hypothesis that lake trout colonized Lake Superior from more than one refuge following the Wisconsin glaciation. Recent population bottlenecks may have reduced nucleotide diversity in Pacific salmon populations.

37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

Code of Federal Regulations, 2011 CFR

2011-07-01

... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

Strain variation in Mycobacterium marinum fish isolates.

PubMed

Ucko, M; Colorni, A; Kvitt, H; Diamant, A; Zlotkin, A; Knibb, W R

2002-11-01

A molecular characterization of two Mycobacterium marinum genes, 16S rRNA and hsp65, was carried out with a total of 21 isolates from various species of fish from both marine and freshwater environments of Israel, Europe, and the Far East. The nucleotide sequences of both genes revealed that all M. marinum isolates from fish in Israel belonged to two different strains, one infecting marine (cultured and wild) fish and the other infecting freshwater (cultured) fish. A restriction enzyme map based on the nucleotide sequences of both genes confirmed the divergence of the Israeli marine isolates from the freshwater isolates and differentiated the Israeli isolates from the foreign isolates, with the exception of one of three Greek isolates from marine fish which was identical to the Israeli marine isolates. The second isolate from Greece exhibited a single base alteration in the 16S rRNA sequence, whereas the third isolate was most likely a new Mycobacterium species. Isolates from Denmark and Thailand shared high sequence homology to complete identity with reference strain ATCC 927. Combined analysis of the two gene sequences increased the detection of intraspecific variations and was thus of importance in studying the taxonomy and epidemiology of this aquatic pathogen. Whether the Israeli M. marinum strain infecting marine fish is endemic to the Red Sea and found extremely susceptible hosts in the exotic species imported for aquaculture or rather was accidentally introduced with occasional imports of fingerlings from the Mediterranean Sea could not be determined.

Receptor-like genes in the major resistance locus of lettuce are subject to divergent selection.

PubMed Central

Meyers, B C; Shen, K A; Rohani, P; Gaut, B S; Michelmore, R W

1998-01-01

Disease resistance genes in plants are often found in complex multigene families. The largest known cluster of disease resistance specificities in lettuce contains the RGC2 family of genes. We compared the sequences of nine full-length genomic copies of RGC2 representing the diversity in the cluster to determine the structure of genes within this family and to examine the evolution of its members. The transcribed regions range from at least 7.0 to 13.1 kb, and the cDNAs contain deduced open reading frames of approximately 5. 5 kb. The predicted RGC2 proteins contain a nucleotide binding site and irregular leucine-rich repeats (LRRs) that are characteristic of resistance genes cloned from other species. Unique features of the RGC2 gene products include a bipartite LRR region with >40 repeats. At least eight members of this family are transcribed. The level of sequence diversity between family members varied in different regions of the gene. The ratio of nonsynonymous (Ka) to synonymous (Ks) nucleotide substitutions was lowest in the region encoding the nucleotide binding site, which is the presumed effector domain of the protein. The LRR-encoding region showed an alternating pattern of conservation and hypervariability. This alternating pattern of variation was also found in all comparisons within families of resistance genes cloned from other species. The Ka /Ks ratios indicate that diversifying selection has resulted in increased variation at these codons. The patterns of variation support the predicted structure of LRR regions with solvent-exposed hypervariable residues that are potentially involved in binding pathogen-derived ligands. PMID:9811792

A comparative genomics strategy for targeted discovery of single-nucleotide polymorphisms and conserved-noncoding sequences in orphan crops.

PubMed

Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H

2006-04-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species.

A Comparative Genomics Strategy for Targeted Discovery of Single-Nucleotide Polymorphisms and Conserved-Noncoding Sequences in Orphan Crops1[W

PubMed Central

Feltus, F.A.; Singh, H.P.; Lohithaswa, H.C.; Schulze, S.R.; Silva, T.D.; Paterson, A.H.

2006-01-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031

Complete mitochondrial genome of Yangtze River wild common carp (Cyprinus carpio haematopterus) and Russian scattered scale mirror carp (Cyprinus carpio carpio).

PubMed

Hu, Guang Fu; Liu, Xiang Jiang; Zou, Gui Wei; Li, Zhong; Liang, Hong-Wei; Hu, Shao-Na

2016-01-01

We sequenced the complete mitogenomes of (Cyprinus carpio haematopterus) and Russian scattered scale mirror carp (Cyprinus carpio carpio). Comparison of these two mitogenomes revealed that the mitogenomes of these two common carp strains were remarkably similar in genome length, gene order and content, and AT content. There were only 55 bp variations in 16,581 nucleotides. About 1 bp variation was located in rRNAs, 2 bp in tRNAs, 9 bp in the control region and 43 bp in protein-coding genes. Furthermore, forty-three variable nucleotides in the protein-coding genes of the two strains led to four variable amino acids, which were located in the ND2, ATPase 6, ND5 and ND6 genes, respectively.

ACTG: novel peptide mapping onto gene models.

PubMed

Choi, Seunghyuk; Kim, Hyunwoo; Paek, Eunok

2017-04-15

In many proteogenomic applications, mapping peptide sequences onto genome sequences can be very useful, because it allows us to understand origins of the gene products. Existing software tools either take the genomic position of a peptide start site as an input or assume that the peptide sequence exactly matches the coding sequence of a given gene model. In case of novel peptides resulting from genomic variations, especially structural variations such as alternative splicing, these existing tools cannot be directly applied unless users supply information about the variant, either its genomic position or its transcription model. Mapping potentially novel peptides to genome sequences, while allowing certain genomic variations, requires introducing novel gene models when aligning peptide sequences to gene structures. We have developed a new tool called ACTG (Amino aCids To Genome), which maps peptides to genome, assuming all possible single exon skipping, junction variation allowing three edit distances from the original splice sites, exon extension and frame shift. In addition, it can also consider SNVs (single nucleotide variations) during mapping phase if a user provides the VCF (variant call format) file as an input. Available at http://prix.hanyang.ac.kr/ACTG/search.jsp . eunokpaek@hanyang.ac.kr. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Ancient diversity and geographical sub-structuring in African buffalo Theileria parva populations revealed through metagenetic analysis of antigen-encoding loci.

PubMed

Hemmink, Johanneke D; Sitt, Tatjana; Pelle, Roger; de Klerk-Lorist, Lin-Mari; Shiels, Brian; Toye, Philip G; Morrison, W Ivan; Weir, William

2018-03-01

An infection and treatment protocol involving infection with a mixture of three parasite isolates and simultaneous treatment with oxytetracycline is currently used to vaccinate cattle against Theileria parva. While vaccination results in high levels of protection in some regions, little or no protection is observed in areas where animals are challenged predominantly by parasites of buffalo origin. A previous study involving sequencing of two antigen-encoding genes from a series of parasite isolates indicated that this is associated with greater antigenic diversity in buffalo-derived T. parva. The current study set out to extend these analyses by applying high-throughput sequencing to ex vivo samples from naturally infected buffalo to determine the extent of diversity in a set of antigen-encoding genes. Samples from two populations of buffalo, one in Kenya and the other in South Africa, were examined to investigate the effect of geographical distance on the nature of sequence diversity. The results revealed a number of significant findings. First, there was a variable degree of nucleotide sequence diversity in all gene segments examined, with the percentage of polymorphic nucleotides ranging from 10% to 69%. Second, large numbers of allelic variants of each gene were found in individual animals, indicating multiple infection events. Third, despite the observed diversity in nucleotide sequences, several of the gene products had highly conserved amino acid sequences, and thus represent potential candidates for vaccine development. Fourth, although compelling evidence for population differentiation between the Kenyan and South African T. parva parasites was identified, analysis of molecular variance for each gene revealed that the majority of the underlying nucleotide sequence polymorphism was common to both areas, indicating that much of this aspect of genetic variation in the parasite population arose prior to geographic separation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Classification, genetic variation, and biological activity of nucleopolyhedrovirus samples from larvae of the heliothine pests heliothis virescens, helicoverpa zea, and helicoverpa armigera

USDA-ARS?s Scientific Manuscript database

A PCR-based method was used to classify 109 isolates of nucleopolyhedrovirus (NPV; Baculoviridae: Alphabaculovirus) collected worldwide from larvae of Heliothis virescens, Helicoverpa zea, and Helicoverpa armigera. Partial nucleotide sequencing and phylogenetic analysis of three highly conserved ge...

Rate of de novo mutations and the importance of father's age to disease risk.

PubMed

Kong, Augustine; Frigge, Michael L; Masson, Gisli; Besenbacher, Soren; Sulem, Patrick; Magnusson, Gisli; Gudjonsson, Sigurjon A; Sigurdsson, Asgeir; Jonasdottir, Aslaug; Jonasdottir, Adalbjorg; Wong, Wendy S W; Sigurdsson, Gunnar; Walters, G Bragi; Steinberg, Stacy; Helgason, Hannes; Thorleifsson, Gudmar; Gudbjartsson, Daniel F; Helgason, Agnar; Magnusson, Olafur Th; Thorsteinsdottir, Unnur; Stefansson, Kari

2012-08-23

Mutations generate sequence diversity and provide a substrate for selection. The rate of de novo mutations is therefore of major importance to evolution. Here we conduct a study of genome-wide mutation rates by sequencing the entire genomes of 78 Icelandic parent-offspring trios at high coverage. We show that in our samples, with an average father's age of 29.7, the average de novo mutation rate is 1.20 × 10(-8) per nucleotide per generation. Most notably, the diversity in mutation rate of single nucleotide polymorphisms is dominated by the age of the father at conception of the child. The effect is an increase of about two mutations per year. An exponential model estimates paternal mutations doubling every 16.5 years. After accounting for random Poisson variation, father's age is estimated to explain nearly all of the remaining variation in the de novo mutation counts. These observations shed light on the importance of the father's age on the risk of diseases such as schizophrenia and autism.

Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

PubMed

Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

2013-06-01

Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and reliable genotyping tool to assist hybrid cotton breeding.

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

Complete sequence of two tick-borne flaviviruses isolated from Siberia and the UK: analysis and significance of the 5' and 3'-UTRs.

PubMed

Gritsun, T S; Venugopal, K; Zanotto, P M; Mikhailov, M V; Sall, A A; Holmes, E C; Polkinghorne, I; Frolova, T V; Pogodina, V V; Lashkevich, V A; Gould, E A

1997-05-01

The complete nucleotide sequence of two tick-transmitted flaviviruses, Vasilchenko (Vs) from Siberia and louping ill (LI) from the UK, have been determined. The genomes were respectively, 10928 and 10871 nucleotides (nt) in length. The coding strategy and functional protein sequence motifs of tick-borne flaviviruses are presented in both Vs and LI viruses. The phylogenies based on maximum likelihood, maximum parsimony and distance analysis of the polyproteins, identified Vs virus as a member of the tick-borne encephalitis virus subgroup within the tick-borne serocomplex, genus Flavivirus, family Flaviviridae. Comparative alignment of the 3'-untranslated regions revealed deletions of different lengths essentially at the same position downstream of the stop codon for all tick-borne viruses. Two direct 27 nucleotide repeats at the 3'-end were found only for Vs and LI virus. Immediately following the deletions a region of 332-334 nt with relatively conserved primary structure (67-94% identity) was observed at the 3'-non-coding end of the virus genome. Pairwise comparisons of the nucleotide sequence data revealed similar levels of variation between the coding region, and the 5' and 3'-termini of the genome, implying an equivalent strong selective control for translated and untranslated regions. Indeed the predicted folding of the 5' and 3'-untranslated regions revealed patterns of stem and loop structures conserved for all tick-borne flaviviruses suggesting a purifying selection for preservation of essential RNA secondary structures which could be involved in translational control and replication. The possible implications of these findings are discussed.

Natural variations in OsγTMT contribute to diversity of the α-tocopherol content in rice.

PubMed

Wang, Xiao-Qiang; Yoon, Min-Young; He, Qiang; Kim, Tae-Sung; Tong, Wei; Choi, Bu-Woong; Lee, Young-Sang; Park, Yong-Jin

2015-12-01

Tocopherols and tocotrienols, collectively known as tocochromanols, are lipid-soluble molecules that belong to the group of vitamin E compounds. Among them, α-tocopherol (αΤ) is one of the antioxidants with diverse functions and benefits for humans and animals. Thus, understanding the genetic basis of these traits would be valuable to improve nutritional quality by breeding in rice. Genome-wide association study (GWAS) has emerged as a powerful strategy for identifying genes or quantitative trait loci (QTL) underlying complex traits in plants. To discover the genes or QTLs underlying the naturally occurring variations of αΤ content in rice, we performed GWAS using 1.44 million high-quality single-nucleotide polymorphisms acquired from re-sequencing of 137 accessions from a diverse rice core collection. Thirteen candidate genes were found across 2-year phenotypic data, among which gamma-tocopherol methyltransferase (OsγTMT) was identified as the major factor responsible for the αΤ content among rice accessions. Nucleotide variations in the coding region of OsγTMT were significantly associated with the αΤ content variations, while nucleotide polymorphisms in the promoter region of OsγTMT also could partly demonstrate the correlation with αΤ content variations, according to our RNA expression analyses. This study provides useful information for genetic factors underlying αΤ content variations in rice, which will significantly contribute the research on αΤ biosynthesis mechanisms and αΤ improvement of rice.

Incidence of three Kudoa spp., K. neothunni, K. hexapunctata, and K. thunni (Myxosporea: Multivalvulida), in Thunnus tunas distributed in the western Pacific Ocean.

PubMed

Kasai, Akihiro; Tsuduki, Hideaki; Jimenez, Lea Angsinco; Li, Ying-Chun; Tanaka, Shuhei; Sato, Hiroshi

2017-04-01

A variety of tunas of the genus Thunnus are consumed daily in Japan as sliced raw fish (sashimi and sushi). The consumption of fresh sliced raw fish, i.e., unfrozen or uncooked, can sometimes cause food poisoning that is manifested by transient diarrhea and vomiting for a single day. One of the causes of this type of food poisoning has been identified as live Kudoa septempunctata (Myxosporea: Multivalvulida) in the olive flounder (Paralichthys olivaceus). Furthermore, raw slices of fresh tunas are highly suspected to be a possible causative fish of similar food poisoning in Japan. In the present study, we conducted a survey of kudoid infections in tunas (the yellowfin tuna Thunnus albacares, the Pacific bluefin tuna Thunnus orientalis, and the longtail tuna Thunnus tonggol) fished in the western Pacific Ocean off Japan and several East Asian countries and characterized morphologically and genetically the kudoid myxospores in pseudocysts or cysts dispersed in the trunk muscles. Pseudocysts of solely Kudoa hexapunctata were identified in the Pacific bluefin tuna (four isolates), whereas in the yellowfin tuna (21 isolates) pseudocysts of Kudoa neothunni and K. hexapunctata were detected at a ratio of 15:6, respectively, in addition to cyst-forming Kudoa thunni in five yellowfin tunas. In the trunk muscles of six longtail tunas examined, pseudocysts of K. neothunni (all six fish) and K. hexapunctata (two fish) were densely dispersed. The myxospores of K. neothunni found in these longtail tunas had seven shell valves and polar capsules (SV/PC) instead of the more common six SV/PC arranged symmetrically. Nucleotide sequences of the 18S and 28S ribosomal RNA gene (rDNA), some with the internal transcribed spacer regions as well, of K. hexapunctata and K. neothunni from the three Thunnus spp., including the seven-SV/PC morphotype, were very similar to previously characterized nucleotide sequences of each species, whereas the 18S and 28S rDNA of four isolates of K. thunni from yellowfin tunas showed a range of nucleotide variations of 99.0-99.9% identity over 1752-1763-bp long partial 18S rDNA and 97.4-99.9% identity over 797-802-bp long partial 28S rDNA. Therefore, this rather high variation of the rDNA nucleotide sequences of K. thunni proved to be contrary to the few variations of K. neothunni and K. hexapunctata rDNA nucleotide sequences. The present study provides a new host record of the longtail tuna for K. neothunni and K. hexapunctata and reveals a high prevalence of the seven-SV/PC myxospore morphotype of K. neothunni in this tuna host.

Molecular and morphological characterization of the tapeworm Taenia hydatigena (Pallas, 1766) in sheep from Iran.

PubMed

Rostami, S; Salavati, R; Beech, R N; Babaei, Z; Sharbatkhori, M; Baneshi, M R; Hajialilo, E; Shad, H; Harandi, M F

2015-03-01

Although Taenia hydatigena is one of the most prevalent taeniid species of livestock, very little molecular genetic information exists for this parasite. Up to 100 sheep isolates of T. hydatigena were collected from 19 abattoirs located in the provinces of Tehran, Alborz and Kerman. A calibrated microscope was used to measure the larval rostellar hook lengths. Following DNA extraction, fragments of cytochrome c oxidase 1 (CO1) and 12S rRNA genes were amplified by the polymerase chain reaction method and the amplicons were subjected to sequencing. The mean total length of large and small hooks was 203.4 μm and 135.9 μm, respectively. Forty CO1 and 39 12S rRNA sequence haplotypes were obtained in the study. The levels of pairwise nucleotide variation between individual haplotypes of CO1 and 12S rRNA genes were determined to be between 0.3-3.4% and 0.2-2.1%, respectively. The overall nucleotide variation among all the CO1 haplotypes was 9.7%, and for all the 12S rRNA haplotypes it was 10.1%. A significant difference was observed between rostellar hook morphometry and both CO1 and 12S rRNA sequence variability. A significantly high level of genetic variation was observed in the present study. The results showed that the 12S rRNA gene is more variable than CO1.

Occurrence and genetic diversity of the Plasmopara halstedii virus in sunflower downy mildew populations of the world.

PubMed

Grasse, Wolfgang; Spring, Otmar

2015-03-01

Plasmopara halstedii virus (PhV) is a ss(+)RNA virus that exclusively occurs in the sunflower downy mildew pathogen Plasmopara halstedii, a biotrophic oomycete of severe economic impact. The virus origin and its genomic variability are unknown. A PCR-based screening of 128 samples of P. halstedii from five continents and up to 40 y old was conducted. PhV RNA was found in over 90 % of the isolates with no correlation to geographic origin or pathotype of its host. Sequence analyses of the two open reading frames (ORFs) revealed only 18 single nucleotide polymorphisms (SNPs) in 3873 nucleotides. The SNPs had no recognizable effect on the two encoded virus proteins. In 398 nucleotides of the untranslated regions (UTRs) of the RNA 2 strand eight additional SNPs and one short deletion was found. Modelling experiments revealed no effects of these variations on the secondary structure of the RNA. The results showed the presence of PhV in P. halstedii isolates of global origin and the existence of the virus since more than 40 y. The virus genome revealed a surprisingly low variation in both coding and noncoding parts. No sequence differences were correlated with host pathotype or geographic populations of the oomycete. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Single nucleotide polymorphism (SNP) discovery in duplicated genomes: intron-primed exon-crossing (IPEC) as a strategy for avoiding amplification of duplicated loci in Atlantic salmon (Salmo salar) and other salmonid fishes

PubMed Central

Ryynänen, Heikki J; Primmer, Craig R

2006-01-01

Background Single nucleotide polymorphisms (SNPs) represent the most abundant type of DNA variation in the vertebrate genome, and their applications as genetic markers in numerous studies of molecular ecology and conservation of natural populations are emerging. Recent large-scale sequencing projects in several fish species have provided a vast amount of data in public databases, which can be utilized in novel SNP discovery in salmonids. However, the suggested duplicated nature of the salmonid genome may hamper SNP characterization if the primers designed in conserved gene regions amplify multiple loci. Results Here we introduce a new intron-primed exon-crossing (IPEC) method in an attempt to overcome this duplication problem, and also evaluate different priming methods for SNP discovery in Atlantic salmon (Salmo salar) and other salmonids. A total of 69 loci with differing priming strategies were screened in S. salar, and 27 of these produced ~13 kb of high-quality sequence data consisting of 19 SNPs or indels (one per 680 bp). The SNP frequency and the overall nucleotide diversity (3.99 × 10-4) in S. salar was lower than reported in a majority of other organisms, which may suggest a relative young population history for Atlantic salmon. A subset of primers used in cross-species analyses revealed considerable variation in the SNP frequencies and nucleotide diversities in other salmonids. Conclusion Sequencing success was significantly higher with the new IPEC primers; thus the total number of loci to screen in order to identify one potential polymorphic site was six times less with this new strategy. Given that duplication may hamper SNP discovery in some species, the IPEC method reported here is an alternative way of identifying novel polymorphisms in such cases. PMID:16872523

Sequence analysis of Jembrana disease virus strains reveals a genetically stable lentivirus.

PubMed

Desport, Moira; Stewart, Meredith E; Mikosza, Andrew S; Sheridan, Carol A; Peterson, Shane E; Chavand, Olivier; Hartaningsih, Nining; Wilcox, Graham E

2007-06-01

Jembrana disease virus (JDV) is a lentivirus associated with an acute disease syndrome with a 20% case fatality rate in Bos javanicus (Bali cattle) in Indonesia, occurring after a short incubation period and with no recurrence of the disease after recovery. Partial regions of gag and pol and the entire env were examined for sequence variation in DNA samples from cases of Jembrana disease obtained from Bali, Sumatra and South Kalimantan in Indonesian Borneo. A high level of nucleotide conservation (97-100%) was observed in gag sequences from samples taken in Bali and Sumatra, indicating that the source of JDV in Sumatra was most likely to have originated from Bali. The pol sequences and, unexpectedly, the env sequences from Bali samples were also well conserved with low nucleotide (96-99%) and amino acid substitutions (95-99%). However, the sample from South Kalimantan (JDV(KAL/01)) contained more divergent sequences, particularly in env (88% identity). Phylogenetic analysis revealed that the JDV(KAL/01)env sequences clustered with the sequence from the Pulukan sample (Bali) from 2001. JDV appears to be remarkably stable genetically and has undergone minor genetic changes over a period of nearly 20 years in Bali despite becoming endemic in the cattle population of the island.

Associations between single nucleotide polymorphisms in multiple candidate genes and body weight in rabbits

PubMed Central

El-Sabrout, Karim; Aggag, Sarah A.

2017-01-01

Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458

Denoising DNA deep sequencing data—high-throughput sequencing errors and their correction

PubMed Central

Laehnemann, David; Borkhardt, Arndt

2016-01-01

Characterizing the errors generated by common high-throughput sequencing platforms and telling true genetic variation from technical artefacts are two interdependent steps, essential to many analyses such as single nucleotide variant calling, haplotype inference, sequence assembly and evolutionary studies. Both random and systematic errors can show a specific occurrence profile for each of the six prominent sequencing platforms surveyed here: 454 pyrosequencing, Complete Genomics DNA nanoball sequencing, Illumina sequencing by synthesis, Ion Torrent semiconductor sequencing, Pacific Biosciences single-molecule real-time sequencing and Oxford Nanopore sequencing. There is a large variety of programs available for error removal in sequencing read data, which differ in the error models and statistical techniques they use, the features of the data they analyse, the parameters they determine from them and the data structures and algorithms they use. We highlight the assumptions they make and for which data types these hold, providing guidance which tools to consider for benchmarking with regard to the data properties. While no benchmarking results are included here, such specific benchmarks would greatly inform tool choices and future software development. The development of stand-alone error correctors, as well as single nucleotide variant and haplotype callers, could also benefit from using more of the knowledge about error profiles and from (re)combining ideas from the existing approaches presented here. PMID:26026159

The World Health Organization Global Programme on AIDS proposal for standardization of HIV sequence nomenclature. WHO Network for HIV Isolation and Characterization.

PubMed

Korber, B T; Osmanov, S; Esparza, J; Myers, G

1994-11-01

The World Health Organization Global Programme on AIDS (WHO/GPA) is conducting a large-scale collaborative study of human immunodeficiency virus type 1 (HIV-1) variation, based in four potential vaccine-trial site countries: Brazil, Rwanda, Thailand, and Uganda. Through the course of this study, it was crucial to keep track of certain attributes of the samples from which the viral nucleotide sequences were derived (e.g., country of origin and viral culture characterization), so that meaningful sequence comparisons could be made. Here we describe a system developed in the context of the WHO/GPA study that summarizes such critical attributes by representing them as standardized characters directly incorporated into sequence names. This nomenclature allows linkage of clinical, phenotypic, and geographic information with molecular data. We propose that other investigators involved in human immunodeficiency virus (HIV) nucleotide sequencing efforts adopt a similar standardized sequence nomenclature to facilitate cross-study sequence comparison. HIV sequence data are being generated at an ever-increasing rate; directly coupled to this increase is our deepening understanding of biological parameters that influence or result from sequence variability. A standardized sequence nomenclature that includes relevant biological information would enable researchers to better utilize the growing body of sequence data, and enhance their ability to interpret the biological implications of their own data through facilitating comparisons with previously published work.

Helicobacter pylori Heat Shock Protein A: Serologic Responses and Genetic Diversity

PubMed Central

Ng, Enders K. W.; Thompson, Stuart A.; Pérez-Pérez, Guillermo I.; Kansau, Imad; van der Ende, Arie; Labigne, Agnès; Sung, Joseph J. Y.; Chung, S. C. Sydney; Blaser, Martin J.

1999-01-01

Helicobacter pylori synthesizes an unusual GroES homolog, heat shock protein A (HspA). The present study was aimed at an assessment of the serological response to HspA in a group of Chinese patients with defined gastroduodenal pathologies and determination of whether diversity is present in the nucleotide sequences encoding HspA in isolates from these patients. Serum samples collected from 154 patients who had an upper gastrointestinal pathology and the presence of H. pylori defined by biopsy were tested for an immunoglobulin G (IgG) serologic response to H. pylori HspA by an enzyme linked immunosorbant assay. HspA-encoding nucleotide sequences in H. pylori isolates from 14 patients (7 seropositive and 7 seronegative for HspA) were analyzed by PCR and direct sequencing of the PCR products. The sequencing results were compared to those of 48 isolates from other parts of the world. Of the 154 known H. pylori-positive patients, 54 (35.1%) were seropositive for HspA. The A domain (GroES homology) of HspA was highly conserved in the 14 isolates tested. Although the B domain (metal-binding site unique to H. pylori) resembled that in the known major variant, particular amino acid substitutions allowed definition of an HspA variant associated with isolates from East Asia. There were no associations between patient characteristics and HspA seropositivity or amino acid sequences. We confirmed in this study that the clinical outcomes of H. pylori infection are not related to HspA antigenicity or to sequence variation. However, B-domain sequence variation may be a marker for the study of the genetic diversity of H. pylori strains of different geographic origins. PMID:10225839

Molecular Population Genetics of the Alcohol Dehydrogenase Gene Region of DROSOPHILA MELANOGASTER

PubMed Central

Aquadro, Charles F.; Desse, Susan F.; Bland, Molly M.; Langley, Charles H.; Laurie-Ahlberg, Cathy C.

1986-01-01

Variation in the DNA restriction map of a 13-kb region of chromosome II including the alcohol dehydrogenase structural gene (Adh) was examined in Drosophila melanogaster from natural populations. Detailed analysis of 48 D. melanogaster lines representing four eastern United States populations revealed extensive DNA sequence variation due to base substitutions, insertions and deletions. Cloning of this region from several lines allowed characterization of length variation as due to unique sequence insertions or deletions [nine sizes; 21–200 base pairs (bp)] or transposable element insertions (several sizes, 340 bp to 10.2 kb, representing four different elements). Despite this extensive variation in sequences flanking the Adh gene, only one length polymorphism is clearly associated with altered Adh expression (a copia element approximately 250 bp 5' to the distal transcript start site). Nonetheless, the frequency spectra of transposable elements within and between Drosophila species suggests they are slightly deleterious. Strong nonrandom associations are observed among Adh region sequence variants, ADH allozyme (Fast vs. Slow), ADH enzyme activity and the chromosome inversion ln(2L) t. Phylogenetic analysis of restriction map haplotypes suggest that the major twofold component of ADH activity variation (high vs. low, typical of Fast and Slow allozymes, respectively) is due to sequence variation tightly linked to and possibly distinct from that underlying the allozyme difference. The patterns of nucleotide and haplotype variation for Fast and Slow allozyme lines are consistent with the recent increase in frequency and spread of the Fast haplotype associated with high ADH activity. These data emphasize the important role of evolutionary history and strong nonrandom associations among tightly linked sequence variation as determinants of the patterns of variation observed in natural populations. PMID:3026893

Strain-specific and pooled genome sequences for populations of Drosophila melanogaster from three continents.

PubMed Central

Bergman, Casey M.; Haddrill, Penelope R.

2015-01-01

To contribute to our general understanding of the evolutionary forces that shape variation in genome sequences in nature, we have sequenced genomes from 50 isofemale lines and six pooled samples from populations of Drosophila melanogaster on three continents. Analysis of raw and reference-mapped reads indicates the quality of these genomic sequence data is very high. Comparison of the predicted and experimentally-determined Wolbachia infection status of these samples suggests that strain or sample swaps are unlikely to have occurred in the generation of these data. Genome sequences are freely available in the European Nucleotide Archive under accession ERP009059. Isofemale lines can be obtained from the Drosophila Species Stock Center. PMID:25717372

Strain-specific and pooled genome sequences for populations of Drosophila melanogaster from three continents.

PubMed

Bergman, Casey M; Haddrill, Penelope R

2015-01-01

To contribute to our general understanding of the evolutionary forces that shape variation in genome sequences in nature, we have sequenced genomes from 50 isofemale lines and six pooled samples from populations of Drosophila melanogaster on three continents. Analysis of raw and reference-mapped reads indicates the quality of these genomic sequence data is very high. Comparison of the predicted and experimentally-determined Wolbachia infection status of these samples suggests that strain or sample swaps are unlikely to have occurred in the generation of these data. Genome sequences are freely available in the European Nucleotide Archive under accession ERP009059. Isofemale lines can be obtained from the Drosophila Species Stock Center.

Estimating the Population Mutation Rate from a de novo Assembled Bactrian Camel Genome and Cross-Species Comparison with Dromedary ESTs

PubMed Central

2014-01-01

The Bactrian camel (Camelus bactrianus) and the dromedary (Camelus dromedarius) are among the last species that have been domesticated around 3000–6000 years ago. During domestication, strong artificial (anthropogenic) selection has shaped the livestock, creating a huge amount of phenotypes and breeds. Hence, domestic animals represent a unique resource to understand the genetic basis of phenotypic variation and adaptation. Similar to its late domestication history, the Bactrian camel is also among the last livestock animals to have its genome sequenced and deciphered. As no genomic data have been available until recently, we generated a de novo assembly by shotgun sequencing of a single male Bactrian camel. We obtained 1.6 Gb genomic sequences, which correspond to more than half of the Bactrian camel’s genome. The aim of this study was to identify heterozygous single-nucleotide polymorphisms (SNPs) and to estimate population parameters and nucleotide diversity based on an individual camel. With an average 6.6-fold coverage, we detected over 116 000 heterozygous SNPs and recorded a genome-wide nucleotide diversity similar to that of other domesticated ungulates. More than 20 000 (85%) dromedary expressed sequence tags successfully aligned to our genomic draft. Our results provide a template for future association studies targeting economically relevant traits and to identify changes underlying the process of camel domestication and environmental adaptation. PMID:23454912

PGen: large-scale genomic variations analysis workflow and browser in SoyKB.

PubMed

Liu, Yang; Khan, Saad M; Wang, Juexin; Rynge, Mats; Zhang, Yuanxun; Zeng, Shuai; Chen, Shiyuan; Maldonado Dos Santos, Joao V; Valliyodan, Babu; Calyam, Prasad P; Merchant, Nirav; Nguyen, Henry T; Xu, Dong; Joshi, Trupti

2016-10-06

With the advances in next-generation sequencing (NGS) technology and significant reductions in sequencing costs, it is now possible to sequence large collections of germplasm in crops for detecting genome-scale genetic variations and to apply the knowledge towards improvements in traits. To efficiently facilitate large-scale NGS resequencing data analysis of genomic variations, we have developed "PGen", an integrated and optimized workflow using the Extreme Science and Engineering Discovery Environment (XSEDE) high-performance computing (HPC) virtual system, iPlant cloud data storage resources and Pegasus workflow management system (Pegasus-WMS). The workflow allows users to identify single nucleotide polymorphisms (SNPs) and insertion-deletions (indels), perform SNP annotations and conduct copy number variation analyses on multiple resequencing datasets in a user-friendly and seamless way. We have developed both a Linux version in GitHub ( https://github.com/pegasus-isi/PGen-GenomicVariations-Workflow ) and a web-based implementation of the PGen workflow integrated within the Soybean Knowledge Base (SoyKB), ( http://soykb.org/Pegasus/index.php ). Using PGen, we identified 10,218,140 single-nucleotide polymorphisms (SNPs) and 1,398,982 indels from analysis of 106 soybean lines sequenced at 15X coverage. 297,245 non-synonymous SNPs and 3330 copy number variation (CNV) regions were identified from this analysis. SNPs identified using PGen from additional soybean resequencing projects adding to 500+ soybean germplasm lines in total have been integrated. These SNPs are being utilized for trait improvement using genotype to phenotype prediction approaches developed in-house. In order to browse and access NGS data easily, we have also developed an NGS resequencing data browser ( http://soykb.org/NGS_Resequence/NGS_index.php ) within SoyKB to provide easy access to SNP and downstream analysis results for soybean researchers. PGen workflow has been optimized for the most efficient analysis of soybean data using thorough testing and validation. This research serves as an example of best practices for development of genomics data analysis workflows by integrating remote HPC resources and efficient data management with ease of use for biological users. PGen workflow can also be easily customized for analysis of data in other species.

Mitochondrial control-region sequence variation in aboriginal Australians.

PubMed Central

van Holst Pellekaan, S; Frommer, M; Sved, J; Boettcher, B

1998-01-01

The mitochondrial D-loop hypervariable segment 1 (mt HVS1) between nucleotides 15997 and 16377 has been examined in aboriginal Australian people from the Darling River region of New South Wales (riverine) and from Yuendumu in central Australia (desert). Forty-seven unique HVS1 types were identified, varying at 49 nucleotide positions. Pairwise analysis by calculation of BEPPI (between population proportion index) reveals statistically significant structure in the populations, although some identical HVS1 types are seen in the two contrasting regions. mt HVS1 types may reflect more-ancient distributions than do linguistic diversity and other culturally distinguishing attributes. Comparison with sequences from five published global studies reveals that these Australians demonstrate greatest divergence from some Africans, least from Papua New Guinea highlanders, and only slightly more from some Pacific groups (Indonesian, Asian, Samoan, and coastal Papua New Guinea), although the HVS1 types vary at different nucleotide sites. Construction of a median network, displaying three main groups, suggests that several hypervariable nucleotide sites within the HVS1 are likely to have undergone mutation independently, making phylogenetic comparison with global samples by conventional methods difficult. Specific nucleotide-site variants are major separators in median networks constructed from Australian HVS1 types alone and for one global selection. The distribution of these, requiring extended study, suggests that they may be signatures of different groups of prehistoric colonizers into Australia, for which the time of colonization remains elusive. PMID:9463317

Organization of nif gene cluster in Frankia sp. EuIK1 strain, a symbiont of Elaeagnus umbellata.

PubMed

Oh, Chang Jae; Kim, Ho Bang; Kim, Jitae; Kim, Won Jin; Lee, Hyoungseok; An, Chung Sun

2012-01-01

The nucleotide sequence of a 20.5-kb genomic region harboring nif genes was determined and analyzed. The fragment was obtained from Frankia sp. EuIK1 strain, an indigenous symbiont of Elaeagnus umbellata. A total of 20 ORFs including 12 nif genes were identified and subjected to comparative analysis with the genome sequences of 3 Frankia strains representing diverse host plant specificities. The nucleotide and deduced amino acid sequences showed highest levels of identity with orthologous genes from an Elaeagnus-infecting strain. The gene organization patterns around the nif gene clusters were well conserved among all 4 Frankia strains. However, characteristic features appeared in the location of the nifV gene for each Frankia strain, depending on the type of host plant. Sequence analysis was performed to determine the transcription units and suggested that there could be an independent operon starting from the nifW gene in the EuIK strain. Considering the organization patterns and their total extensions on the genome, we propose that the nif gene clusters remained stable despite genetic variations occurring in the Frankia genomes.

Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70.

PubMed Central

Hunt, C; Morimoto, R I

1985-01-01

We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075

RNA sequencing to study gene expression and single nucleotide polymorphism variation associated with citrate content in cow milk.

PubMed

Cánovas, A; Rincón, G; Islas-Trejo, A; Jimenez-Flores, R; Laubscher, A; Medrano, J F

2013-04-01

The technological properties of milk have significant importance for the dairy industry. Citrate, a normal constituent of milk, forms one of the main buffer systems that regulate the equilibrium between Ca(2+) and H(+) ions. Higher-than-normal citrate content is associated with poor coagulation properties of milk. To identify the genes responsible for the variation of citrate content in milk in dairy cattle, the metabolic steps involved in citrate and fatty acid synthesis pathways in ruminant mammary tissue using RNA sequencing were studied. Genetic markers that could influence milk citrate content in Holstein cows were used in a marker-trait association study to establish the relationship between 74 single nucleotide polymorphisms (SNP) in 20 candidate genes and citrate content in 250 Holstein cows. This analysis revealed 6 SNP in key metabolic pathway genes [isocitrate dehydrogenase 1 (NADP+), soluble (IDH1); pyruvate dehydrogenase (lipoamide) β (PDHB); pyruvate kinase (PKM2); and solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 (SLC25A1)] significantly associated with increased milk citrate content. The amount of the phenotypic variation explained by the 6 SNP ranged from 10.1 to 13.7%. Also, genotype-combination analysis revealed the highest phenotypic variation was explained combining IDH1_23211, PDHB_5562, and SLC25A1_4446 genotypes. This specific genotype combination explained 21.3% of the phenotypic variation. The largest citrate associated effect was in the 3' untranslated region of the SLC25A1 gene, which is responsible for the transport of citrate across the mitochondrial inner membrane. This study provides an approach using RNA sequencing, metabolic pathway analysis, and association studies to identify genetic variation in functional target genes determining complex trait phenotypes. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-29

... DEPARTMENT OF COMMERCE Patent and Trademark Office Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request... Patent applications that contain nucleotide and/or amino acid sequence disclosures must include a copy of...

Landscape of Insertion Polymorphisms in the Human Genome

PubMed Central

Onozawa, Masahiro; Goldberg, Liat; Aplan, Peter D.

2015-01-01

Nucleotide substitutions, small (<50 bp) insertions or deletions (indels), and large (>50 bp) deletions are well-known causes of genetic variation within the human genome. We recently reported a previously unrecognized form of polymorphic insertions, termed templated sequence insertion polymorphism (TSIP), in which the inserted sequence was templated from a distant genomic region, and was inserted in the genome through reverse transcription of an RNA intermediate. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; class 1 TSIPs show target site duplication, polyadenylation, and preference for insertion at a 5′-TTTT/A-3′ sequence, suggesting a LINE-1 based insertion mechanism, whereas class 2 TSIPs show features consistent with repair of a DNA double strand break by nonhomologous end joining. To gain a more complete picture of TSIPs throughout the human population, we evaluated whole-genome sequence from 52 individuals, and identified 171 TSIPs. Most individuals had 25–30 TSIPs, and common (present in >20% of individuals) TSIPs were found in individuals throughout the world, whereas rare TSIPs tended to cluster in specific geographic regions. The number of rare TSIPs was greater than the number of common TSIPs, suggesting that TSIP generation is an ongoing process. Intriguingly, mitochondrial sequences were a frequent template for class 2 insertions, used more commonly than any nuclear chromosome. Similar to single nucleotide polymorphisms and indels, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases, and can be useful in tracking historical migration of populations. PMID:25745018

Quantification of the tissue-culture induced variation in barley (Hordeum vulgare L.)

PubMed Central

Bednarek, Piotr T; Orłowska, Renata; Koebner, Robert MD; Zimny, Janusz

2007-01-01

Background When plant tissue is passaged through in vitro culture, many regenerated plants appear to be no longer clonal copies of their donor genotype. Among the factors that affect this so-called tissue culture induced variation are explant genotype, explant tissue origin, medium composition, and the length of time in culture. Variation is understood to be generated via a combination of genetic and/or epigenetic changes. A lack of any phenotypic variation between regenerants does not necessarily imply a concomitant lack of genetic (or epigenetic) change, and it is therefore of interest to assay the outcomes of tissue culture at the genotypic level. Results A variant of methylation sensitive AFLP, based on the isoschizomeric combinations Acc65I/MseI and KpnI/MseI was applied to analyze, at both the sequence and methylation levels, the outcomes of regeneration from tissue culture in barley. Both sequence mutation and alteration in methylation pattern were detected. Two sets of regenerants from each of five DH donor lines were compared. One set was derived via androgenesis, and the other via somatic embryogenesis, developed from immature embryos. These comparisons delivered a quantitative assessment of the various types of somaclonal variation induced. The average level of variation was 6%, of which almost 1.7% could be accounted for by nucleotide mutation, and the remainder by changes in methylation state. The nucleotide mutation rates and the rate of epimutations were substantially similar between the andro- and embryo-derived sets of regenerants across all the donors. Conclusion We have developed an AFLP based approach that is capable of describing the qualitative and quantitative characteristics of the tissue culture-induced variation. We believe that this approach will find particular value in the study of patterns of inheritance of somaclonal variation, since non-heritable variation is of little interest for the improvement of plant species which are sexually propagated. Of significant biological interest is the conclusion that the mode of regeneration has no significant effect on the balance between sequence and methylation state change induced by the tissue culture process. PMID:17335560

Somatic Genetic Variation in Solid Pseudopapillary Tumor of the Pancreas by Whole Exome Sequencing

PubMed Central

Guo, Meng; Luo, Guopei; Jin, Kaizhou; Long, Jiang; Cheng, He; Lu, Yu; Wang, Zhengshi; Yang, Chao; Xu, Jin; Ni, Quanxing; Yu, Xianjun; Liu, Chen

2017-01-01

Solid pseudopapillary tumor of the pancreas (SPT) is a rare pancreatic disease with a unique clinical manifestation. Although CTNNB1 gene mutations had been universally reported, genetic variation profiles of SPT are largely unidentified. We conducted whole exome sequencing in nine SPT patients to probe the SPT-specific insertions and deletions (indels) and single nucleotide polymorphisms (SNPs). In total, 54 SNPs and 41 indels of prominent variations were demonstrated through parallel exome sequencing. We detected that CTNNB1 mutations presented throughout all patients studied (100%), and a higher count of SNPs was particularly detected in patients with older age, larger tumor, and metastatic disease. By aggregating 95 detected variation events and viewing the interconnections among each of the genes with variations, CTNNB1 was identified as the core portion in the network, which might collaborate with other events such as variations of USP9X, EP400, HTT, MED12, and PKD1 to regulate tumorigenesis. Pathway analysis showed that the events involved in other cancers had the potential to influence the progression of the SNPs count. Our study revealed an insight into the variation of the gene encoding region underlying solid-pseudopapillary neoplasm tumorigenesis. The detection of these variations might partly reflect the potential molecular mechanism. PMID:28054945

Precise detection of chromosomal translocation or inversion breakpoints by whole-genome sequencing.

PubMed

Suzuki, Toshifumi; Tsurusaki, Yoshinori; Nakashima, Mitsuko; Miyake, Noriko; Saitsu, Hirotomo; Takeda, Satoru; Matsumoto, Naomichi

2014-12-01

Structural variations (SVs), including translocations, inversions, deletions and duplications, are potentially associated with Mendelian diseases and contiguous gene syndromes. Determination of SV-related breakpoints at the nucleotide level is important to reveal the genetic causes for diseases. Whole-genome sequencing (WGS) by next-generation sequencers is expected to determine structural abnormalities more directly and efficiently than conventional methods. In this study, 14 SVs (9 balanced translocations, 1 inversion and 4 microdeletions) in 9 patients were analyzed by WGS with a shallow (5 × ) to moderate read coverage (20 × ). Among 28 breakpoints (as each SV has two breakpoints), 19 SV breakpoints had been determined previously at the nucleotide level by any other methods and 9 were uncharacterized. BreakDancer and Integrative Genomics Viewer determined 20 breakpoints (16 translocation, 2 inversion and 2 deletion breakpoints), but did not detect 8 breakpoints (2 translocation and 6 deletion breakpoints). These data indicate the efficacy of WGS for the precise determination of translocation and inversion breakpoints.

Phylogeny of North American Powassan virus.

PubMed

Ebel, G D; Spielman, A; Telford, S R

2001-07-01

To determine whether Powassan virus (POW) and deer tick virus (DTV) constitute distinct flaviviral populations transmitted by ixodid ticks in North America, we analysed diverse nucleotide sequences from 16 strains of these viruses. Two distinct genetic lineages are evident, which may be defined by geographical and host associations. The nucleotide and amino acid sequences of lineage one (comprising New York and Canadian POW isolates) are highly conserved across time and space, but those of lineage two (comprising isolates from deer ticks and a fox) are more variable. The divergence between lineages is much greater than the variation within either lineage, and lineage two appears to be more diverse genetically than is lineage one. Application of McDonald-Kreitman tests to the sequences of these strains indicates that adaptive evolution of the envelope protein separates lineage one from lineage two. The two POW lineages circulating in North America possess a pattern of genetic diversity suggesting that they comprise distinct subtypes that may perpetuate in separate enzootic cycles.

Mitochondrial DNA sequence variation and phylogeography of the scarlet kingsnake (Lampropeltis elapsoides).

PubMed

Friedman, Michael; Schaffer, Les

2011-02-01

BACKGROUND AND AIMS. With the goal of assessing population structure and geographic distribution of haplotype lineages among Lampropeltis elapsoides, we sequenced the ND4 mitochondrial DNA locus from 96 specimens of this snake across its area of distribution. MATERIALS AND METHODS. We relied heavily on formalin-fixed museum specimens to accomplish this analysis. RESULTS. The sequence alignment consisted of 491 bp of the selected gene, with 28% missing data. A simulation used to assess the effect of missing data on population genetic and phylogenetic resolution indicated increased character conflict, but with minimal loss of phylogenetic structure. CONCLUSION. This limited dataset suggests that L. elapsoides constitutes a largely unstructured population, with both widespread haplotypes and large number of private haplotypes, a moderate level of nucleotide diversity, and a low, but significant, degree of north-south population differentiation. Haplotype structure and frequency, nucleotide frequency, and values for Tajima's D and Fu's F(S) indicate a recent range or population expansion following a historic bottleneck.

Ricebase: a breeding and genetics platform for rice, integrating individual molecular markers, pedigrees, and whole-genome-based data

USDA-ARS?s Scientific Manuscript database

Ricebase (http://ricebase.org) is an integrative genomic database for rice (Oryza sativa) with an emphasis on combining data sets in a way that maintains the key links between past and current genetic studies. Ricebase includes DNA sequence data, gene annotations, nucleotide variation data, and mol...

Deep resequencing of Trichinella spiralis reveals previously un-described single nucleotide polymorphisms and intra-isolate variation within the mitochondrial genome.

USDA-ARS?s Scientific Manuscript database

Trichinella spiralis is a parasitic roundworm that infects domestic swine, rats and humans. Ingestion of infected pork by humans can lead to the potentially fatal disease trichinellosis. The phylogeny and historical dispersal of Trichinella spp. have been studied, in part, by sequencing portions of...

Museum genomics: low-cost and high-accuracy genetic data from historical specimens.

PubMed

Rowe, Kevin C; Singhal, Sonal; Macmanes, Matthew D; Ayroles, Julien F; Morelli, Toni Lyn; Rubidge, Emily M; Bi, Ke; Moritz, Craig C

2011-11-01

Natural history collections are unparalleled repositories of geographical and temporal variation in faunal conditions. Molecular studies offer an opportunity to uncover much of this variation; however, genetic studies of historical museum specimens typically rely on extracting highly degraded and chemically modified DNA samples from skins, skulls or other dried samples. Despite this limitation, obtaining short fragments of DNA sequences using traditional PCR amplification of DNA has been the primary method for genetic study of historical specimens. Few laboratories have succeeded in obtaining genome-scale sequences from historical specimens and then only with considerable effort and cost. Here, we describe a low-cost approach using high-throughput next-generation sequencing to obtain reliable genome-scale sequence data from a traditionally preserved mammal skin and skull using a simple extraction protocol. We show that single-nucleotide polymorphisms (SNPs) from the genome sequences obtained independently from the skin and from the skull are highly repeatable compared to a reference genome. © 2011 Blackwell Publishing Ltd.

Low incidence of DNA sequence variation in human induced pluripotent stem cells generated by non-integrating plasmid expression

PubMed Central

Cheng, Linzhao; Hansen, Nancy F.; Zhao, Ling; Du, Yutao; Zou, Chunlin; Donovan, Frank X.; Chou, Bin-Kuan; Zhou, Guangyu; Li, Shijie; Dowey, Sarah N.; Ye, Zhaohui; Chandrasekharappa, Settara C.; Yang, Huanming; Mullikin, James C.; Liu, P. Paul

2012-01-01

Summary The utility of induced pluripotent stem cells (iPSCs) as models to study diseases and as sources for cell therapy depends on the integrity of their genomes. Despite recent publications of DNA sequence variations in the iPSCs, the true scope of such changes for the entire genome is not clear. Here we report the whole-genome sequencing of three human iPSC lines derived from two cell types of an adult donor by episomal vectors. The vector sequence was undetectable in the deeply sequenced iPSC lines. We identified 1058–1808 heterozygous single nucleotide variants (SNVs), but no copy number variants, in each iPSC line. Six to twelve of these SNVs were within coding regions in each iPSC line, but ~50% of them are synonymous changes and the remaining are not selectively enriched for known genes associated with cancers. Our data thus suggest that episome-mediated reprogramming is not inherently mutagenic during integration-free iPSC induction. PMID:22385660

Expansion of inverted repeat does not decrease substitution rates in Pelargonium plastid genomes.

PubMed

Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

2017-04-01

For species with minor inverted repeat (IR) boundary changes in the plastid genome (plastome), nucleotide substitution rates were previously shown to be lower in the IR than the single copy regions (SC). However, the impact of large-scale IR expansion/contraction on plastid nucleotide substitution rates among closely related species remains unclear. We included plastomes from 22 Pelargonium species, including eight newly sequenced genomes, and used both pairwise and model-based comparisons to investigate the impact of the IR on sequence evolution in plastids. Ten types of plastome organization with different inversions or IR boundary changes were identified in Pelargonium. Inclusion in the IR was not sufficient to explain the variation of nucleotide substitution rates. Instead, the rate heterogeneity in Pelargonium plastomes was a mixture of locus-specific, lineage-specific and IR-dependent effects. Our study of Pelargonium plastomes that vary in IR length and gene content demonstrates that the evolutionary consequences of retaining these repeats are more complicated than previously suggested. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

The multivariate association between genomewide DNA methylation and climate across the range of Arabidopsis thaliana.

PubMed

Keller, Thomas E; Lasky, Jesse R; Yi, Soojin V

2016-04-01

Epigenetic changes can occur due to extracellular environmental conditions. Consequently, epigenetic mechanisms can play an intermediate role to translate environmental signals to intracellular changes. Such a role might be particularly important in plants, which often show strong local adaptation and have the potential for heritable epigenetic states. However, little is currently known about the role of epigenetic variation in the ecological mechanisms of adaptation. Here, we used multivariate redundancy analyses to examine genomewide associations between DNA methylation polymorphisms and climate variation in two independent panels of Arabidopsis accessions, including 122 Eurasian accessions as well as in a regional panel of 148 accessions in Sweden. At the single-nucleotide methylation level, climate and space (geographic spatial structure) explain small yet significant amount of variation in both panels. On the other hand, when viewed in a context of genomic clusters of methylated and unmethylated cytosines, climate and space variables explain much greater amounts of variation in DNA methylation than those explained by variation at the single-nucleotide level. We found that the single-nucleotide methylation polymorphisms with the strongest associations with climate were enriched in transposable elements and in potentially RNA-directed methylation contexts. When viewed in the context of genomic clusters, variation of DNA methylation at different sequence contexts exhibit distinctive segregation along different axes of variation in the redundancy analyses. Genomewide methylation showed much stronger associations with climate within the regional panel (Sweden) compared to the global (Eurasia). Together, these findings indicate that genetic and epigenetic variation across the genome may play a role in response to climate conditions and local adaptation. © 2016 John Wiley & Sons Ltd.

Overdispersion of the Molecular Clock: Temporal Variation of Gene-Specific Substitution Rates in Drosophila

PubMed Central

Hartl, Daniel L.

2008-01-01

Simple models of molecular evolution assume that sequences evolve by a Poisson process in which nucleotide or amino acid substitutions occur as rare independent events. In these models, the expected ratio of the variance to the mean of substitution counts equals 1, and substitution processes with a ratio greater than 1 are called overdispersed. Comparing the genomes of 10 closely related species of Drosophila, we extend earlier evidence for overdispersion in amino acid replacements as well as in four-fold synonymous substitutions. The observed deviation from the Poisson expectation can be described as a linear function of the rate at which substitutions occur on a phylogeny, which implies that deviations from the Poisson expectation arise from gene-specific temporal variation in substitution rates. Amino acid sequences show greater temporal variation in substitution rates than do four-fold synonymous sequences. Our findings provide a general phenomenological framework for understanding overdispersion in the molecular clock. Also, the presence of substantial variation in gene-specific substitution rates has broad implications for work in phylogeny reconstruction and evolutionary rate estimation. PMID:18480070

Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

PubMed

Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

2014-05-04

The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

Characterization and mapping of cDNA encoding aspartate aminotransferase in rice, Oryza sativa L.

PubMed

Song, J; Yamamoto, K; Shomura, A; Yano, M; Minobe, Y; Sasaki, T

1996-10-31

Fifteen cDNA clones, putatively identified as encoding aspartate aminotransferase (AST, EC 2.6.1.1.), were isolated and partially sequenced. Together with six previously isolated clones putatively identified to encode ASTs (Sasaki, et al. 1994, Plant Journal 6, 615-624), their sequences were characterized and classified into 4 cDNA species. Two of the isolated clones, C60213 and C2079, were full-length cDNAs, and their complete nucleotide sequences were determined. C60213 was 1612 bp long and its deduced amino acid sequence showed 88% homology with that of Panicum miliaceum L. mitochondrial AST. The C60213-encoded protein had an N-terminal amino acid sequence that was characteristic of a mitochondrial transit peptide. On the other hand, C2079 was 1546 bp long and had 91% amino acid sequence homology with P. miliaceum L. cytosolic AST but lacked in the transit peptide sequence. The homologies of nucleotide sequences and deduced amino acid sequences of C2079 and C60213 were 54% and 52%, respectively. C2079 and C60213 were mapped on chromosomes 1 and 6, respectively, by restriction fragment length polymorphism linkage analysis. Northern blot analysis using C2079 as a probe revealed much higher transcript levels in callus and root than in green and etiolated shoots, suggesting tissue-specific variations of AST gene expression.

BayesPI-BAR: a new biophysical model for characterization of regulatory sequence variations

PubMed Central

Wang, Junbai; Batmanov, Kirill

2015-01-01

Sequence variations in regulatory DNA regions are known to cause functionally important consequences for gene expression. DNA sequence variations may have an essential role in determining phenotypes and may be linked to disease; however, their identification through analysis of massive genome-wide sequencing data is a great challenge. In this work, a new computational pipeline, a Bayesian method for protein–DNA interaction with binding affinity ranking (BayesPI-BAR), is proposed for quantifying the effect of sequence variations on protein binding. BayesPI-BAR uses biophysical modeling of protein–DNA interactions to predict single nucleotide polymorphisms (SNPs) that cause significant changes in the binding affinity of a regulatory region for transcription factors (TFs). The method includes two new parameters (TF chemical potentials or protein concentrations and direct TF binding targets) that are neglected by previous methods. The new method is verified on 67 known human regulatory SNPs, of which 47 (70%) have predicted true TFs ranked in the top 10. Importantly, the performance of BayesPI-BAR, which uses principal component analysis to integrate multiple predictions from various TF chemical potentials, is found to be better than that of existing programs, such as sTRAP and is-rSNP, when evaluated on the same SNPs. BayesPI-BAR is a publicly available tool and is able to carry out parallelized computation, which helps to investigate a large number of TFs or SNPs and to detect disease-associated regulatory sequence variations in the sea of genome-wide noncoding regions. PMID:26202972

HPV16 E2 gene disruption and polymorphisms of E2 and LCR: some significant associations with cervical cancer in Indian women.

PubMed

Bhattacharjee, Bornali; Sengupta, Sharmila

2006-02-01

We evaluated the status of the HPV16 E2 gene (disrupted or intact), nucleotide sequence alterations within intact E2 genes and LCR of HPV16 isolates in a group of CaCx cases (invasive squamous cell carcinomas, n = 81) and population controls (normal cervical scrapes, n = 27) from Indian women. E2 disruption was detected by amplifying the entire E2 gene with single set of primers, while overlapping primers were used to determine if any particular region got selectively disrupted. Nucleotide variations in E2 and LCR were analyzed by PCR amplification followed by bi-directional sequencing. The associations between the viral factors and CaCx were analyzed using Fisher's Exact or Chi-squared test and interpreted as OR (95% CI) and P values. E2 disruption was significantly higher among the cases [3.38 (1.07-10.72); P = 0.02], which was maximum in the region between nucleotides 3650 and 3872 (DNA-binding region). The European (E) variant was found to be the prevalent subgroup (87.76% among cases and 96.30% among the controls), and the remaining samples were Asian-American variants. Among the E subgroup, variation at position 7450 (T > C) within the E2-binding site-IV was found to be significantly higher among the E2 undisrupted cases (21/37; 56.76%), compared to controls (5/18; 27.78%) [3.41 (1.01-11.55); P = 0.03]. Besides HPV16 E2 disruption, LCR 7450T > C variation within undisrupted E2 of E subgroup appears to be a major factor contributing to the risk of CaCx development in Indian women. Furthermore, polymorphisms in the E2 gene of HPV16 may not be significant for disease risk.

Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX

2009-02-24

Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Brucella and methods for the detection of Brucella

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L

Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Analysis of nucleotide diversity among alleles of the major bacterial blight resistance gene Xa27 in cultivars of rice (Oryza sativa) and its wild relatives.

PubMed

Bimolata, Waikhom; Kumar, Anirudh; Sundaram, Raman Meenakshi; Laha, Gouri Shankar; Qureshi, Insaf Ahmed; Reddy, Gajjala Ashok; Ghazi, Irfan Ahmad

2013-08-01

Xa27 is one of the important R-genes, effective against bacterial blight disease of rice caused by Xanthomonas oryzae pv. oryzae (Xoo). Using natural population of Oryza, we analyzed the sequence variation in the functionally important domains of Xa27 across the Oryza species. DNA sequences of Xa27 alleles from 27 rice accessions revealed higher nucleotide diversity among the reported R-genes of rice. Sequence polymorphism analysis revealed synonymous and non-synonymous mutations in addition to a number of InDels in non-coding regions of the gene. High sequence variation was observed in the promoter region including the 5'UTR with 'π' value 0.00916 and 'θ w ' = 0.01785. Comparative analysis of the identified Xa27 alleles with that of IRBB27 and IR24 indicated the operation of both positive selection (Ka/Ks > 1) and neutral selection (Ka/Ks ≈ 0). The genetic distances of alleles of the gene from Oryza nivara were nearer to IRBB27 as compared to IR24. We also found the presence of conserved and null UPT (upregulated by transcriptional activator) box in the isolated alleles. Considerable amino acid polymorphism was localized in the trans-membrane domain for which the functional significance is yet to be elucidated. However, the absence of functional UPT box in all the alleles except IRBB27 suggests the maintenance of single resistant allele throughout the natural population.

Geographically Distinct and Domain-Specific Sequence Variations in the Alleles of Rice Blast Resistance Gene Pib

PubMed Central

Vasudevan, Kumar; Vera Cruz, Casiana M.; Gruissem, Wilhelm; Bhullar, Navreet K.

2016-01-01

Rice blast is caused by Magnaporthe oryzae, which is the most destructive fungal pathogen affecting rice growing regions worldwide. The rice blast resistance gene Pib confers broad-spectrum resistance against Southeast Asian M. oryzae races. We investigated the allelic diversity of Pib in rice germplasm originating from 12 major rice growing countries. Twenty-five new Pib alleles were identified that have unique single nucleotide polymorphisms (SNPs), insertions and/or deletions, in addition to the polymorphic nucleotides that are shared between the different alleles. These partially or completely shared polymorphic nucleotides indicate frequent sequence exchange events between the Pib alleles. In some of the new Pib alleles, nucleotide diversity is high in the LRR domain, whereas, in others it is distributed among the NB-ARC and LRR domains. Most of the polymorphic amino acids in LRR and NB-ARC2 domains are predicted as solvent-exposed. Several of the alleles and the unique SNPs are country specific, suggesting a diversifying selection of alleles in various geographical locations in response to the locally prevalent M. oryzae population. Together, the new Pib alleles are an important genetic resource for rice blast resistance breeding programs and provide new information on rice-M. oryzae interactions at the molecular level. PMID:27446145

Genomic variation and DNA repair associated with soybean transgenesis: a comparison to cultivars and mutagenized plants.

PubMed

Anderson, Justin E; Michno, Jean-Michel; Kono, Thomas J Y; Stec, Adrian O; Campbell, Benjamin W; Curtin, Shaun J; Stupar, Robert M

2016-05-12

The safety of mutagenized and genetically transformed plants remains a subject of scrutiny. Data gathered and communicated on the phenotypic and molecular variation induced by gene transfer technologies will provide a scientific-based means to rationally address such concerns. In this study, genomic structural variation (e.g. large deletions and duplications) and single nucleotide polymorphism rates were assessed among a sample of soybean cultivars, fast neutron-derived mutants, and five genetically transformed plants developed through Agrobacterium based transformation methods. On average, the number of genes affected by structural variations in transgenic plants was one order of magnitude less than that of fast neutron mutants and two orders of magnitude less than the rates observed between cultivars. Structural variants in transgenic plants, while rare, occurred adjacent to the transgenes, and at unlinked loci on different chromosomes. DNA repair junctions at both transgenic and unlinked sites were consistent with sequence microhomology across breakpoints. The single nucleotide substitution rates were modest in both fast neutron and transformed plants, exhibiting fewer than 100 substitutions genome-wide, while inter-cultivar comparisons identified over one-million single nucleotide polymorphisms. Overall, these patterns provide a fresh perspective on the genomic variation associated with high-energy induced mutagenesis and genetically transformed plants. The genetic transformation process infrequently results in novel genetic variation and these rare events are analogous to genetic variants occurring spontaneously, already present in the existing germplasm, or induced through other types of mutagenesis. It remains unclear how broadly these results can be applied to other crops or transformation methods.

Characterization of genetic sequence variation of 58 STR loci in four major population groups.

PubMed

Novroski, Nicole M M; King, Jonathan L; Churchill, Jennifer D; Seah, Lay Hong; Budowle, Bruce

2016-11-01

Massively parallel sequencing (MPS) can identify sequence variation within short tandem repeat (STR) alleles as well as their nominal allele lengths that traditionally have been obtained by capillary electrophoresis. Using the MiSeq FGx Forensic Genomics System (Illumina), STRait Razor, and in-house excel workbooks, genetic variation was characterized within STR repeat and flanking regions of 27 autosomal, 7 X-chromosome and 24 Y-chromosome STR markers in 777 unrelated individuals from four population groups. Seven hundred and forty six autosomal, 227 X-chromosome, and 324 Y-chromosome STR alleles were identified by sequence compared with 357 autosomal, 107 X-chromosome, and 189 Y-chromosome STR alleles that were identified by length. Within the observed sequence variation, 227 autosomal, 156 X-chromosome, and 112 Y-chromosome novel alleles were identified and described. One hundred and seventy six autosomal, 123 X-chromosome, and 93 Y-chromosome sequence variants resided within STR repeat regions, and 86 autosomal, 39 X-chromosome, and 20 Y-chromosome variants were located in STR flanking regions. Three markers, D18S51, DXS10135, and DYS385a-b had 1, 4, and 1 alleles, respectively, which contained both a novel repeat region variant and a flanking sequence variant in the same nucleotide sequence. There were 50 markers that demonstrated a relative increase in diversity with the variant sequence alleles compared with those of traditional nominal length alleles. These population data illustrate the genetic variation that exists in the commonly used STR markers in the selected population samples and provide allele frequencies for statistical calculations related to STR profiling with MPS data. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Genetic characterization of the UCS and Kex1 loci of Pneumocystis jirovecii.

PubMed

Esteves, F; Tavares, A; Costa, M C; Gaspar, J; Antunes, F; Matos, O

2009-02-01

Nucleotide variation in the Pneumocystis jirovecii upstream conserved sequence (UCS) and kexin-like serine protease (Kex1) loci was studied in pulmonary specimens from Portuguese HIV-positive patients. DNA was extracted and used for specific molecular sequence analysis. The number of UCS tandem repeats detected in 13 successfully sequenced isolates ranged from three (9 isolates, 69%) to four (4 isolates, 31%). A novel tandem repeat pattern and two novel polymorphisms were detected in the UCS region. For the Kex1 gene, the wild-type (24 isolates, 86%) was the most frequent sequence detected among the 28 sequenced isolates. Nevertheless, a nonsynonymous (1 isolate, 3%) and three synonymous (3 isolates, 11%) polymorphisms were detected and are described here for the first time.

Application of a time-dependent coalescence process for inferring the history of population size changes from DNA sequence data.

PubMed

Polanski, A; Kimmel, M; Chakraborty, R

1998-05-12

Distribution of pairwise differences of nucleotides from data on a sample of DNA sequences from a given segment of the genome has been used in the past to draw inferences about the past history of population size changes. However, all earlier methods assume a given model of population size changes (such as sudden expansion), parameters of which (e.g., time and amplitude of expansion) are fitted to the observed distributions of nucleotide differences among pairwise comparisons of all DNA sequences in the sample. Our theory indicates that for any time-dependent population size, N(tau) (in which time tau is counted backward from present), a time-dependent coalescence process yields the distribution, p(tau), of the time of coalescence between two DNA sequences randomly drawn from the population. Prediction of p(tau) and N(tau) requires the use of a reverse Laplace transform known to be unstable. Nevertheless, simulated data obtained from three models of monotone population change (stepwise, exponential, and logistic) indicate that the pattern of a past population size change leaves its signature on the pattern of DNA polymorphism. Application of the theory to the published mtDNA sequences indicates that the current mtDNA sequence variation is not inconsistent with a logistic growth of the human population.

Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

PubMed

Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

2013-06-01

Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

ERIC Educational Resources Information Center

Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

2006-01-01

We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

Determination of ABO genotypes with DNA extracted from formalin-fixed, paraffin-embedded tissues.

PubMed

Yamada, M; Yamamoto, Y; Tanegashima, A; Kane, M; Ikehara, Y; Fukunaga, T; Nishi, K

1994-01-01

The gene encoding the specific glycosyltransferases which catalyze the conversion of the H antigen to A or B antigens shows a slight but distinct variation in its allelic nucleotide sequence and can be divided into 6 genotypes when digested with specific restriction enzymes. We extracted DNA from formalin-fixed, paraffin-embedded tissues using SDS/proteinase K treatment followed by phenol/chloroform extraction. The sequence of nucleotides for the A, B and O genes was amplified by the polymerase chain reaction (PCR). DNA fragments of 128 bp and 200 bp could be amplified in the second round of PCR, using an aliquot of the first round PCR product as template. Degraded DNA from paraffin blocks stored for up to 10.7 years could be successfully typed. The ABO genotype was deduced from the digestion patterns with an appropriate combination of restriction enzymes and was compatible with the phenotype obtained from the blood sample.

Selective sweep at the Drosophila melanogaster Suppressor of Hairless locus and its association with the In(2L)t inversion polymorphism.

PubMed Central

Depaulis, F; Brazier, L; Veuille, M

1999-01-01

The hitchhiking model of population genetics predicts that an allele favored by Darwinian selection can replace haplotypes from the same locus previously established at a neutral mutation-drift equilibrium. This process, known as "selective sweep," was studied by comparing molecular variation between the polymorphic In(2L)t inversion and the standard chromosome. Sequence variation was recorded at the Suppressor of Hairless (Su[H]) gene in an African population of Drosophila melanogaster. We found 47 nucleotide polymorphisms among 20 sequences of 1.2 kb. Neutrality tests were nonsignificant at the nucleotide level. However, these sites were strongly associated, because 290 out of 741 observed pairwise combinations between them were in significant linkage disequilibrium. We found only seven haplotypes, two occurring in the 9 In(2L)t chromosomes, and five in the 11 standard chromosomes, with no shared haplotype. Two haplotypes, one in each chromosome arrangement, made up two-thirds of the sample. This low haplotype diversity departed from neutrality in a haplotype test. This pattern supports a selective sweep hypothesis for the Su(H) chromosome region. PMID:10388820

RefSeq microbial genomes database: new representation and annotation strategy.

PubMed

Tatusova, Tatiana; Ciufo, Stacy; Fedorov, Boris; O'Neill, Kathleen; Tolstoy, Igor

2014-01-01

The source of the microbial genomic sequences in the RefSeq collection is the set of primary sequence records submitted to the International Nucleotide Sequence Database public archives. These can be accessed through the Entrez search and retrieval system at http://www.ncbi.nlm.nih.gov/genome. Next-generation sequencing has enabled researchers to perform genomic sequencing at rates that were unimaginable in the past. Microbial genomes can now be sequenced in a matter of hours, which has led to a significant increase in the number of assembled genomes deposited in the public archives. This huge increase in DNA sequence data presents new challenges for the annotation, analysis and visualization bioinformatics tools. New strategies have been developed for the annotation and representation of reference genomes and sequence variations derived from population studies and clinical outbreaks.

Poly A tail length analysis of in vitro transcribed mRNA by LC-MS.

PubMed

Beverly, Michael; Hagen, Caitlin; Slack, Olga

2018-02-01

The 3'-polyadenosine (poly A) tail of in vitro transcribed (IVT) mRNA was studied using liquid chromatography coupled to mass spectrometry (LC-MS). Poly A tails were cleaved from the mRNA using ribonuclease T1 followed by isolation with dT magnetic beads. Extracted tails were then analyzed by LC-MS which provided tail length information at single-nucleotide resolution. A 2100-nt mRNA with plasmid-encoded poly A tail lengths of either 27, 64, 100, or 117 nucleotides was used for these studies as enzymatically added poly A tails showed significant length heterogeneity. The number of As observed in the tails closely matched Sanger sequencing results of the DNA template, and even minor plasmid populations with sequence variations were detected. When the plasmid sequence contained a discreet number of poly As in the tail, analysis revealed a distribution that included tails longer than the encoded tail lengths. These observations were consistent with transcriptional slippage of T7 RNAP taking place within a poly A sequence. The type of RNAP did not alter the observed tail distribution, and comparison of T3, T7, and SP6 showed all three RNAPs produced equivalent tail length distributions. The addition of a sequence at the 3' end of the poly A tail did, however, produce narrower tail length distributions which supports a previously described model of slippage where the 3' end can be locked in place by having a G or C after the poly nucleotide region. Graphical abstract Determination of mRNA poly A tail length using magnetic beads and LC-MS.

Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

PubMed

Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

2012-01-01

We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, David B.; Lao, Guifang

1998-01-01

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

Genetic variability in E6, E7 and L1 genes of Human Papillomavirus 62 and its prevalence in Mexico.

PubMed

Artaza-Irigaray, Cristina; Flores-Miramontes, María Guadalupe; Olszewski, Dominik; Magaña-Torres, María Teresa; López-Cardona, María Guadalupe; Leal-Herrera, Yelda Aurora; Piña-Sánchez, Patricia; Jave-Suárez, Luis Felipe; Aguilar-Lemarroy, Adriana

2017-01-01

Human papillomavirus (HPV) is the main etiological agent of cervical cancer, the third most common cancer among women globally and the second most frequent in Mexico. Persistent infection with high-risk HPV genotypes is associated with premalignant lesions and cervical cancer development. HPVs considered as low risk or not yet classified, are often found in coinfection with different HPV genotypes. Indeed, HPV62 is one of the most prevalent HPV detected in some countries, but there is limited information about its prevalence in other regions and there are no HPV62 variants currently described. The aim of this study was to determine the prevalence of HPV62 in cervical samples from Mexican women and to identify mutations in the L1, E6 and E7 genes, which have never been reported in our population. HPV screening was performed by Cobas HPV Test in women who attended prevention health programs and dysplasia clinics. All HPV positive samples ( n  = 491) and 87 additional cervical cancer samples were then genotyped with Linear Array HPV Genotyping test. Some samples were selected to corroborate genotyping by Next-Generation sequencing. On the other hand, nucleotide changes in L1, E6 and E7 genes were determined using PCR, Sanger sequencing and analysis with the CLC-MainWorkbench 7.6.1 software. L1 protein structure was predicted with the I-TASSER server. Using Linear Array, HPV62 prevalence was 7.6% in general population, 8% in Cervical Intraepithelial Neoplasia grade 1 (CIN1) samples and 4.6% in cervical samples. The presence of HPV62 was confirmed with Next-Generation sequencing. Regarding L1 gene, novel sequence variations were detected, but they did not alter the tertiary structure of the protein. Moreover, several nucleotide substitutions were found in E6 and E7 genes compared to reference HPV62 genomic sequence. Specifically, three non-synonymous sequence variations were detected, two in E6 and one in E7. HPV62 is a frequent HPV genotype found mainly in general population and in women with CIN1, and in 90.5% of the cases it was found in coinfection with other HPVs. Novel nucleotide changes in its L1, E6 and E7 genes were detected, some of them lead to changes in the protein sequence.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2007-02-06

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2009-02-24

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Ultra-Deep Sequencing Analysis of the Hepatitis A Virus 5'-Untranslated Region among Cases of the Same Outbreak from a Single Source

PubMed Central

Wu, Shuang; Nakamoto, Shingo; Kanda, Tatsuo; Jiang, Xia; Nakamura, Masato; Miyamura, Tatsuo; Shirasawa, Hiroshi; Sugiura, Nobuyuki; Takahashi-Nakaguchi, Azusa; Gonoi, Tohru; Yokosuka, Osamu

2014-01-01

Hepatitis A virus (HAV) is a causative agent of acute viral hepatitis for which an effective vaccine has been developed. Here we describe ultra-deep pyrosequences (UDPSs) of HAV 5'-untranslated region (5'UTR) among cases of the same outbreak, which arose from a single source, associated with a revolving sushi bar. We determined the reference sequence from HAV-derived clone from an attendant by the Sanger method. Sixteen UDPSs from this outbreak and one from another sporadic case were compared with this reference. Nucleotide errors yielded a UDPS error rate of < 1%. This study confirmed that nucleotide substitutions of this region are transition mutations in outbreak cases, that insertion was observed only in non-severe cases, and that these nucleotide substitutions were different from those of the sporadic case. Analysis of UDPSs detected low-prevalence HAV variations in 5'UTR, but no specific mutations associated with severity in these outbreak cases. To our surprise, HAV strains in this outbreak conserved HAV IRES sequence even if we performed analysis of UDPSs. UDPS analysis of HAV 5'UTR gave us no association between the disease severity of hepatitis A and HAV 5'UTR substitutions. It might be more interesting to perform ultra-deep sequencing of full length HAV genome in order to reveal possible unknown genomic determinants associated with disease severity. Further studies will be needed. PMID:24396287

Extremely low nucleotide polymorphism in Pinus krempfii Lecomte, a unique flat needle pine endemic to Vietnam

PubMed Central

Wang, Baosheng; Khalili Mahani, Marjan; Ng, Wei Lun; Kusumi, Junko; Phi, Hai Hong; Inomata, Nobuyuki; Wang, Xiao-Ru; Szmidt, Alfred E

2014-01-01

Pinus krempfii Lecomte is a morphologically and ecologically unique pine, endemic to Vietnam. It is regarded as vulnerable species with distribution limited to just two provinces: Khanh Hoa and Lam Dong. Although a few phylogenetic studies have included this species, almost nothing is known about its genetic features. In particular, there are no studies addressing the levels and patterns of genetic variation in natural populations of P. krempfii. In this study, we sampled 57 individuals from six natural populations of P. krempfii and analyzed their sequence variation in ten nuclear gene regions (approximately 9 kb) and 14 mitochondrial (mt) DNA regions (approximately 10 kb). We also analyzed variation at seven chloroplast (cp) microsatellite (SSR) loci. We found very low haplotype and nucleotide diversity at nuclear loci compared with other pine species. Furthermore, all investigated populations were monomorphic across all mitochondrial DNA (mtDNA) regions included in our study, which are polymorphic in other pine species. Population differentiation at nuclear loci was low (5.2%) but significant. However, structure analysis of nuclear loci did not detect genetically differentiated groups of populations. Approximate Bayesian computation (ABC) using nuclear sequence data and mismatch distribution analysis for cpSSR loci suggested recent expansion of the species. The implications of these findings for the management and conservation of P. krempfii genetic resources were discussed. PMID:25360263

Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae.

PubMed

Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe

2015-05-30

Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.

Complete genomic sequence of a Tobacco rattle virus isolate from Michigan-grown potatoes.

PubMed

Crosslin, James M; Hamm, Philip B; Kirk, William W; Hammond, Rosemarie W

2010-04-01

Tobacco rattle virus (TRV) causes stem mottle on potato leaves and necrotic arcs and rings in potato tubers, known as corky ringspot disease. Recently, TRV was reported in Michigan potato tubers cv. FL1879 exhibiting corky ringspot disease. Sequence analysis of the RNA-1-encoded 16-kDa gene of the Michigan isolate, designated MI-1, revealed homology to TRV isolates from Florida and Washington. Here, we report the complete genomic sequence of RNA-1 (6,791 nt) and RNA-2 (3,685 nt) of TRV MI-1. RNA-1 is predicted to contain four open reading frames, and the genome structure and phylogenetic analyses of the RNA-1 nucleotide sequence revealed significant homologies to the known sequences of other TRV-1 isolates. The relationships based on the full-length nucleotide sequence were different from than those based on the 16-kDa gene encoded on genomic RNA-1 and reflect sequence variation within a 20-25-aa residue region of the 16-kDa protein. MI-1 RNA-2 is predicted to contain three ORFs, encoding the coat protein (CP), a 37.6-kDa protein (ORF 2b), and a 33.6-kDa protein (ORF 2c). In addition, it contains a region of similarity to the 3' terminus of RNA-1, including a truncated portion of the 16-kDa cistron. Phylogenetic analysis of RNA-2, based on a comparison of nucleotide sequences with other members of the genus Tobravirus, indicates that TRV MI-1 and other North American isolates cluster as a distinct group. TRV M1-1 is only the second North American isolate for which there is a complete sequence of the genome, and it is distinct from the North American isolate TRV ORY. The relationship of the TRV MI-1 isolate to other tobravirus isolates is discussed.

Complete Genomic Sequence and Comparative Analysis of the Genome Segments of Sweet Potato Chlorotic Stunt Virus in China

PubMed Central

Qin, Yanhong; Wang, Li; Zhang, Zhenchen; Qiao, Qi; Zhang, Desheng; Tian, Yuting; Wang, Shuang; Wang, Yongjiang; Yan, Zhaoling

2014-01-01

Background Sweet potato chlorotic stunt virus (family Closteroviridae, genus Crinivirus) features a large bipartite, single-stranded, positive-sense RNA genome. To date, only three complete genomic sequences of SPCSV can be accessed through GenBank. SPCSV was first detected from China in 2011, only partial genomic sequences have been determined in the country. No report on the complete genomic sequence and genome structure of Chinese SPCSV isolates or the genetic relation between isolates from China and other countries is available. Methodology/Principal Findings The complete genomic sequences of five isolates from different areas in China were characterized. This study is the first to report the complete genome sequences of SPCSV from whitefly vectors. Genome structure analysis showed that isolates of WA and EA strains from China have the same coding protein as isolates Can181-9 and m2-47, respectively. Twenty cp genes and four RNA1 partial segments were sequenced and analyzed, and the nucleotide identities of complete genomic, cp, and RNA1 partial sequences were determined. Results indicated high conservation among strains and significant differences between WA and EA strains. Genetic analysis demonstrated that, except for isolates from Guangdong Province, SPCSVs from other areas belong to the WA strain. Genome organization analysis showed that the isolates in this study lack the p22 gene. Conclusions/Significance We presented the complete genome sequences of SPCSV in China. Comparison of nucleotide identities and genome structures between these isolates and previously reported isolates showed slight differences. The nucleotide identities of different SPCSV isolates showed high conservation among strains and significant differences between strains. All nine isolates in this study lacked p22 gene. WA strains were more extensively distributed than EA strains in China. These data provide important insights into the molecular variation and genomic structure of SPCSV in China as well as genetic relationships among isolates from China and other countries. PMID:25170926

Organellar phylogenomics of an emerging model system: Sphagnum (peatmoss).

PubMed

Jonathan Shaw, A; Devos, Nicolas; Liu, Yang; Cox, Cymon J; Goffinet, Bernard; Flatberg, Kjell Ivar; Shaw, Blanka

2016-08-01

Sphagnum-dominated peatlands contain approx. 30 % of the terrestrial carbon pool in the form of partially decomposed plant material (peat), and, as a consequence, Sphagnum is currently a focus of studies on biogeochemistry and control of global climate. Sphagnum species differ in ecologically important traits that scale up to impact ecosystem function, and sequencing of the genome from selected Sphagnum species is currently underway. As an emerging model system, these resources for Sphagnum will facilitate linking nucleotide variation to plant functional traits, and through those traits to ecosystem processes. A solid phylogenetic framework for Sphagnum is crucial to comparative analyses of species-specific traits, but relationships among major clades within Sphagnum have been recalcitrant to resolution because the genus underwent a rapid radiation. Herein a well-supported hypothesis for phylogenetic relationships among major clades within Sphagnum based on organellar genome sequences (plastid, mitochondrial) is provided. We obtained nucleotide sequences (273 753 nucleotides in total) from the two organellar genomes from 38 species (including three outgroups). Phylogenetic analyses were conducted using a variety of methods applied to nucleotide and amino acid sequences. The Sphagnum phylogeny was rooted with sequences from the related Sphagnopsida genera, Eosphagnum and Flatbergium Phylogenetic analyses of the data converge on the following subgeneric relationships: (Rigida (((Subsecunda) (Cuspidata)) ((Sphagnum) (Acutifolia))). All relationships were strongly supported. Species in the two major clades (i.e. Subsecunda + Cuspidata and Sphagnum + Acutifolia), which include >90 % of all Sphagnum species, differ in ecological niches and these differences correlate with other functional traits that impact biogeochemical cycling. Mitochondrial intron presence/absence are variable among species and genera of the Sphagnopsida. Two new nomenclatural combinations are made, in the genera Eosphagnum and Flatbergium Newly resolved relationships now permit phylogenetic analyses of morphological, biochemical and ecological traits among Sphagnum species. The results clarify long-standing disagreements about subgeneric relationships and intrageneric classification. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Organellar phylogenomics of an emerging model system: Sphagnum (peatmoss)

PubMed Central

Jonathan Shaw, A.; Devos, Nicolas; Liu, Yang; Cox, Cymon J.; Goffinet, Bernard; Flatberg, Kjell Ivar; Shaw, Blanka

2016-01-01

Background and Aims Sphagnum-dominated peatlands contain approx. 30 % of the terrestrial carbon pool in the form of partially decomposed plant material (peat), and, as a consequence, Sphagnum is currently a focus of studies on biogeochemistry and control of global climate. Sphagnum species differ in ecologically important traits that scale up to impact ecosystem function, and sequencing of the genome from selected Sphagnum species is currently underway. As an emerging model system, these resources for Sphagnum will facilitate linking nucleotide variation to plant functional traits, and through those traits to ecosystem processes. A solid phylogenetic framework for Sphagnum is crucial to comparative analyses of species-specific traits, but relationships among major clades within Sphagnum have been recalcitrant to resolution because the genus underwent a rapid radiation. Herein a well-supported hypothesis for phylogenetic relationships among major clades within Sphagnum based on organellar genome sequences (plastid, mitochondrial) is provided. Methods We obtained nucleotide sequences (273 753 nucleotides in total) from the two organellar genomes from 38 species (including three outgroups). Phylogenetic analyses were conducted using a variety of methods applied to nucleotide and amino acid sequences. The Sphagnum phylogeny was rooted with sequences from the related Sphagnopsida genera, Eosphagnum and Flatbergium. Key Results Phylogenetic analyses of the data converge on the following subgeneric relationships: (Rigida (((Subsecunda) (Cuspidata)) ((Sphagnum) (Acutifolia))). All relationships were strongly supported. Species in the two major clades (i.e. Subsecunda + Cuspidata and Sphagnum + Acutifolia), which include >90 % of all Sphagnum species, differ in ecological niches and these differences correlate with other functional traits that impact biogeochemical cycling. Mitochondrial intron presence/absence are variable among species and genera of the Sphagnopsida. Two new nomenclatural combinations are made, in the genera Eosphagnum and Flatbergium. Conclusions Newly resolved relationships now permit phylogenetic analyses of morphological, biochemical and ecological traits among Sphagnum species. The results clarify long-standing disagreements about subgeneric relationships and intrageneric classification. PMID:27268484

DNAAlignEditor: DNA alignment editor tool

PubMed Central

Sanchez-Villeda, Hector; Schroeder, Steven; Flint-Garcia, Sherry; Guill, Katherine E; Yamasaki, Masanori; McMullen, Michael D

2008-01-01

Background With advances in DNA re-sequencing methods and Next-Generation parallel sequencing approaches, there has been a large increase in genomic efforts to define and analyze the sequence variability present among individuals within a species. For very polymorphic species such as maize, this has lead to a need for intuitive, user-friendly software that aids the biologist, often with naïve programming capability, in tracking, editing, displaying, and exporting multiple individual sequence alignments. To fill this need we have developed a novel DNA alignment editor. Results We have generated a nucleotide sequence alignment editor (DNAAlignEditor) that provides an intuitive, user-friendly interface for manual editing of multiple sequence alignments with functions for input, editing, and output of sequence alignments. The color-coding of nucleotide identity and the display of associated quality score aids in the manual alignment editing process. DNAAlignEditor works as a client/server tool having two main components: a relational database that collects the processed alignments and a user interface connected to database through universal data access connectivity drivers. DNAAlignEditor can be used either as a stand-alone application or as a network application with multiple users concurrently connected. Conclusion We anticipate that this software will be of general interest to biologists and population genetics in editing DNA sequence alignments and analyzing natural sequence variation regardless of species, and will be particularly useful for manual alignment editing of sequences in species with high levels of polymorphism. PMID:18366684

Genomic analysis reveals Nairobi sheep disease virus to be highly diverse and present in both Africa, and in India in the form of the Ganjam virus variant.

PubMed

Yadav, Pragya D; Vincent, Martin J; Khristova, Marina; Kale, Charuta; Nichol, Stuart T; Mishra, Akhilesh C; Mourya, Devendra T

2011-07-01

Nairobi sheep disease (NSD) virus, the prototype tick-borne virus of the genus Nairovirus, family Bunyaviridae is associated with acute hemorrhagic gastroenteritis in sheep and goats in East and Central Africa. The closely related Ganjam virus found in India is associated with febrile illness in humans and disease in livestock. The complete S, M and L segment sequences of Ganjam and NSD virus and partial sequence analysis of Ganjam viral RNA genome S, M and L segments encoding regions (396 bp, 701 bp and 425 bp) of the viral nucleocapsid (N), glycoprotein precursor (GPC) and L polymerase (L) proteins, respectively, was carried out for multiple Ganjam virus isolates obtained from 1954 to 2002 and from various regions of India. M segments of NSD and Ganjam virus encode a large ORF for the glycoprotein precursor (GPC), (1627 and 1624 amino acids in length, respectively) and their L segments encode a very large L polymerase (3991 amino acids). The complete S, M and L segments of NSD and Ganjam viruses were more closely related to one another than to other characterized nairoviruses, and no evidence of reassortment was found. However, the NSD and Ganjam virus complete M segment differed by 22.90% and 14.70%, for nucleotide and amino acid respectively, and the complete L segment nucleotide and protein differing by 9.90% and 2.70%, respectively among themselves. Ganjam and NSD virus, complete S segment differed by 9.40-10.40% and 3.2-4.10 for nucleotide and proteins while among Ganjam viruses 0.0-6.20% and 0.0-1.4%, variation was found for nucleotide and amino acids. Ganjam virus isolates differed by up to 17% and 11% at the nucleotide level for the partial S and L gene fragments, respectively, with less variation observed at the deduced amino acid level (10.5 and 2%, S and L, respectively). However, the virus partial M gene fragment (which encodes the hypervariable mucin-like domain) of these viruses differed by as much as 56% at the nucleotide level. Phylogenetic analysis of partial sequence differences suggests considerable mixing and movement of Ganjam virus strains within India, with no clear relationship between genetic lineages and virus geographic origin or year of isolation. Surprisingly, NSD virus does not represent a distinct lineage, but appears as a variant with other Ganjam virus among NSD virus group. Copyright © 2011 Elsevier B.V. All rights reserved.

Molecular spectrum of somaclonal variation in regenerated rice revealed by whole-genome sequencing.

PubMed

Miyao, Akio; Nakagome, Mariko; Ohnuma, Takako; Yamagata, Harumi; Kanamori, Hiroyuki; Katayose, Yuichi; Takahashi, Akira; Matsumoto, Takashi; Hirochika, Hirohiko

2012-01-01

Somaclonal variation is a phenomenon that results in the phenotypic variation of plants regenerated from cell culture. One of the causes of somaclonal variation in rice is the transposition of retrotransposons. However, many aspects of the mechanisms that result in somaclonal variation remain undefined. To detect genome-wide changes in regenerated rice, we analyzed the whole-genome sequences of three plants independently regenerated from cultured cells originating from a single seed stock. Many single-nucleotide polymorphisms (SNPs) and insertions and deletions (indels) were detected in the genomes of the regenerated plants. The transposition of only Tos17 among 43 transposons examined was detected in the regenerated plants. Therefore, the SNPs and indels contribute to the somaclonal variation in regenerated rice in addition to the transposition of Tos17. The observed molecular spectrum was similar to that of the spontaneous mutations in Arabidopsis thaliana. However, the base change ratio was estimated to be 1.74 × 10(-6) base substitutions per site per regeneration, which is 248-fold greater than the spontaneous mutation rate of A. thaliana.

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, D.B.; Lao, G.

1998-01-06

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping

PubMed Central

2011-01-01

Background Integration of genomic variation with phenotypic information is an effective approach for uncovering genotype-phenotype associations. This requires an accurate identification of the different types of variation in individual genomes. Results We report the integration of the whole genome sequence of a single Holstein Friesian bull with data from single nucleotide polymorphism (SNP) and comparative genomic hybridization (CGH) array technologies to determine a comprehensive spectrum of genomic variation. The performance of resequencing SNP detection was assessed by combining SNPs that were identified to be either in identity by descent (IBD) or in copy number variation (CNV) with results from SNP array genotyping. Coding insertions and deletions (indels) were found to be enriched for size in multiples of 3 and were located near the N- and C-termini of proteins. For larger indels, a combination of split-read and read-pair approaches proved to be complementary in finding different signatures. CNVs were identified on the basis of the depth of sequenced reads, and by using SNP and CGH arrays. Conclusions Our results provide high resolution mapping of diverse classes of genomic variation in an individual bovine genome and demonstrate that structural variation surpasses sequence variation as the main component of genomic variability. Better accuracy of SNP detection was achieved with little loss of sensitivity when algorithms that implemented mapping quality were used. IBD regions were found to be instrumental for calculating resequencing SNP accuracy, while SNP detection within CNVs tended to be less reliable. CNV discovery was affected dramatically by platform resolution and coverage biases. The combined data for this study showed that at a moderate level of sequencing coverage, an ensemble of platforms and tools can be applied together to maximize the accurate detection of sequence and structural variants. PMID:22082336

A Perfect Match Genomic Landscape Provides a Unified Framework for the Precise Detection of Variation in Natural and Synthetic Haploid Genomes

PubMed Central

Palacios-Flores, Kim; García-Sotelo, Jair; Castillo, Alejandra; Uribe, Carina; Aguilar, Luis; Morales, Lucía; Gómez-Romero, Laura; Reyes, José; Garciarubio, Alejandro; Boege, Margareta; Dávila, Guillermo

2018-01-01

We present a conceptually simple, sensitive, precise, and essentially nonstatistical solution for the analysis of genome variation in haploid organisms. The generation of a Perfect Match Genomic Landscape (PMGL), which computes intergenome identity with single nucleotide resolution, reveals signatures of variation wherever a query genome differs from a reference genome. Such signatures encode the precise location of different types of variants, including single nucleotide variants, deletions, insertions, and amplifications, effectively introducing the concept of a general signature of variation. The precise nature of variants is then resolved through the generation of targeted alignments between specific sets of sequence reads and known regions of the reference genome. Thus, the perfect match logic decouples the identification of the location of variants from the characterization of their nature, providing a unified framework for the detection of genome variation. We assessed the performance of the PMGL strategy via simulation experiments. We determined the variation profiles of natural genomes and of a synthetic chromosome, both in the context of haploid yeast strains. Our approach uncovered variants that have previously escaped detection. Moreover, our strategy is ideally suited for further refining high-quality reference genomes. The source codes for the automated PMGL pipeline have been deposited in a public repository. PMID:29367403

Whole Genome Sequencing of Greater Amberjack (Seriola dumerili) for SNP Identification on Aligned Scaffolds and Genome Structural Variation Analysis Using Parallel Resequencing

PubMed Central

Aokic, Jun-ya; Kawase, Junya; Hamada, Kazuhisa; Fujimoto, Hiroshi; Yamamoto, Ikki; Usuki, Hironori

2018-01-01

Greater amberjack (Seriola dumerili) is distributed in tropical and temperate waters worldwide and is an important aquaculture fish. We carried out de novo sequencing of the greater amberjack genome to construct a reference genome sequence to identify single nucleotide polymorphisms (SNPs) for breeding amberjack by marker-assisted or gene-assisted selection as well as to identify functional genes for biological traits. We obtained 200 times coverage and constructed a high-quality genome assembly using next generation sequencing technology. The assembled sequences were aligned onto a yellowtail (Seriola quinqueradiata) radiation hybrid (RH) physical map by sequence homology. A total of 215 of the longest amberjack sequences, with a total length of 622.8 Mbp (92% of the total length of the genome scaffolds), were lined up on the yellowtail RH map. We resequenced the whole genomes of 20 greater amberjacks and mapped the resulting sequences onto the reference genome sequence. About 186,000 nonredundant SNPs were successfully ordered on the reference genome. Further, we found differences in the genome structural variations between two greater amberjack populations using BreakDancer. We also analyzed the greater amberjack transcriptome and mapped the annotated sequences onto the reference genome sequence. PMID:29785397

Simple sequence repeats in Escherichia coli: abundance, distribution, composition, and polymorphism.

PubMed

Gur-Arie, R; Cohen, C J; Eitan, Y; Shelef, L; Hallerman, E M; Kashi, Y

2000-01-01

Computer-based genome-wide screening of the DNA sequence of Escherichia coli strain K12 revealed tens of thousands of tandem simple sequence repeat (SSR) tracts, with motifs ranging from 1 to 6 nucleotides. SSRs were well distributed throughout the genome. Mononucleotide SSRs were over-represented in noncoding regions and under-represented in open reading frames (ORFs). Nucleotide composition of mono- and dinucleotide SSRs, both in ORFs and in noncoding regions, differed from that of the genomic region in which they occurred, with 93% of all mononucleotide SSRs proving to be of A or T. Computer-based analysis of the fine position of every SSR locus in the noncoding portion of the genome relative to downstream ORFs showed SSRs located in areas that could affect gene regulation. DNA sequences at 14 arbitrarily chosen SSR tracts were compared among E. coli strains. Polymorphisms of SSR copy number were observed at four of seven mononucleotide SSR tracts screened, with all polymorphisms occurring in noncoding regions. SSR polymorphism could prove important as a genome-wide source of variation, both for practical applications (including rapid detection, strain identification, and detection of loci affecting key phenotypes) and for evolutionary adaptation of microbes.

Sequence-Based Prioritization of Nonsynonymous Single-Nucleotide Polymorphisms for the Study of Disease Mutations

PubMed Central

Jiang, Rui ; Yang, Hua ; Zhou, Linqi ; Kuo, C.-C. Jay ; Sun, Fengzhu ; Chen, Ting 

2007-01-01

The increasing demand for the identification of genetic variation responsible for common diseases has translated into a need for sophisticated methods for effectively prioritizing mutations occurring in disease-associated genetic regions. In this article, we prioritize candidate nonsynonymous single-nucleotide polymorphisms (nsSNPs) through a bioinformatics approach that takes advantages of a set of improved numeric features derived from protein-sequence information and a new statistical learning model called “multiple selection rule voting” (MSRV). The sequence-based features can maximize the scope of applications of our approach, and the MSRV model can capture subtle characteristics of individual mutations. Systematic validation of the approach demonstrates that this approach is capable of prioritizing causal mutations for both simple monogenic diseases and complex polygenic diseases. Further studies of familial Alzheimer diseases and diabetes show that the approach can enrich mutations underlying these polygenic diseases among the top of candidate mutations. Application of this approach to unclassified mutations suggests that there are 10 suspicious mutations likely to cause diseases, and there is strong support for this in the literature. PMID:17668383

Phylogenic analysis of human bocavirus detected in children with acute respiratory infection in Yaounde, Cameroon.

PubMed

Kenmoe, Sebastien; Vernet, Marie-Astrid; Njankouo-Ripa, Mohamadou; Penlap, Véronique Beng; Vabret, Astrid; Njouom, Richard

2017-07-17

Human Bocavirus (HBoV) was first identified in 2005 and has been shown to be a common cause of respiratory infections and gastroenteritis in children. In a recent study, we found that 10.7% of children with acute respiratory infections (ARI) were infected by HBoV. Genetic characterization of this virus remains unknown in Central Africa, particularly in Cameroon Leeding us to evaluate the molecular characteristics of HBoV strains in Cameroonian children with ARI. Phylogenetic analysis of partial HBoV VP1/2 sequences showed a low level of nucleotide variation and the circulation of HBoV genotype 1 (HBoV-1) only. Three clades were obtained, two clustering with each of the reference strains ST1 and ST2, and a third group consisting of only Cameroon strains. By comparing with the Swedish reference sequences, ST1 and ST2, Cameroon sequences showed nucleotide and amino acid similarities of respectively 97.36-100% and 98.35-100%. These results could help improve strategies for monitoring and control of respiratory infections in Cameroon.

Sequencing of a Patient with Balanced Chromosome Abnormalities and Neurodevelopmental Disease Identifies Disruption of Multiple High Risk Loci by Structural Variation

PubMed Central

Blake, Jonathon; Riddell, Andrew; Theiss, Susanne; Gonzalez, Alexis Perez; Haase, Bettina; Jauch, Anna; Janssen, Johannes W. G.; Ibberson, David; Pavlinic, Dinko; Moog, Ute; Benes, Vladimir; Runz, Heiko

2014-01-01

Balanced chromosome abnormalities (BCAs) occur at a high frequency in healthy and diseased individuals, but cost-efficient strategies to identify BCAs and evaluate whether they contribute to a phenotype have not yet become widespread. Here we apply genome-wide mate-pair library sequencing to characterize structural variation in a patient with unclear neurodevelopmental disease (NDD) and complex de novo BCAs at the karyotype level. Nucleotide-level characterization of the clinically described BCA breakpoints revealed disruption of at least three NDD candidate genes (LINC00299, NUP205, PSMD14) that gave rise to abnormal mRNAs and could be assumed as disease-causing. However, unbiased genome-wide analysis of the sequencing data for cryptic structural variation was key to reveal an additional submicroscopic inversion that truncates the schizophrenia- and bipolar disorder-associated brain transcription factor ZNF804A as an equally likely NDD-driving gene. Deep sequencing of fluorescent-sorted wild-type and derivative chromosomes confirmed the clinically undetected BCA. Moreover, deep sequencing further validated a high accuracy of mate-pair library sequencing to detect structural variants larger than 10 kB, proposing that this approach is powerful for clinical-grade genome-wide structural variant detection. Our study supports previous evidence for a role of ZNF804A in NDD and highlights the need for a more comprehensive assessment of structural variation in karyotypically abnormal individuals and patients with neurocognitive disease to avoid diagnostic deception. PMID:24625750

Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

PubMed

Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

2018-04-01

Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Universal digital high-resolution melt: a novel approach to broad-based profiling of heterogeneous biological samples.

PubMed

Fraley, Stephanie I; Hardick, Justin; Masek, Billie J; Jo Masek, Billie; Athamanolap, Pornpat; Rothman, Richard E; Gaydos, Charlotte A; Carroll, Karen C; Wakefield, Teresa; Wang, Tza-Huei; Yang, Samuel

2013-10-01

Comprehensive profiling of nucleic acids in genetically heterogeneous samples is important for clinical and basic research applications. Universal digital high-resolution melt (U-dHRM) is a new approach to broad-based PCR diagnostics and profiling technologies that can overcome issues of poor sensitivity due to contaminating nucleic acids and poor specificity due to primer or probe hybridization inaccuracies for single nucleotide variations. The U-dHRM approach uses broad-based primers or ligated adapter sequences to universally amplify all nucleic acid molecules in a heterogeneous sample, which have been partitioned, as in digital PCR. Extensive assay optimization enables direct sequence identification by algorithm-based matching of melt curve shape and Tm to a database of known sequence-specific melt curves. We show that single-molecule detection and single nucleotide sensitivity is possible. The feasibility and utility of U-dHRM is demonstrated through detection of bacteria associated with polymicrobial blood infection and microRNAs (miRNAs) associated with host response to infection. U-dHRM using broad-based 16S rRNA gene primers demonstrates universal single cell detection of bacterial pathogens, even in the presence of larger amounts of contaminating bacteria; U-dHRM using universally adapted Lethal-7 miRNAs in a heterogeneous mixture showcases the single copy sensitivity and single nucleotide specificity of this approach.

Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds.

PubMed

Stafuzza, Nedenia Bonvino; Zerlotini, Adhemar; Lobo, Francisco Pereira; Yamagishi, Michel Eduardo Beleza; Chud, Tatiane Cristina Seleguim; Caetano, Alexandre Rodrigues; Munari, Danísio Prado; Garrick, Dorian J; Machado, Marco Antonio; Martins, Marta Fonseca; Carvalho, Maria Raquel; Cole, John Bruce; Barbosa da Silva, Marcos Vinicius Gualberto

2017-01-01

Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose), Gyr, Girolando and Holstein (dairy production). A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs) and 3,828,041 insertions/deletions (InDels) were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.

Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds

PubMed Central

Lobo, Francisco Pereira; Yamagishi, Michel Eduardo Beleza; Chud, Tatiane Cristina Seleguim; Caetano, Alexandre Rodrigues; Munari, Danísio Prado; Garrick, Dorian J.; Machado, Marco Antonio; Martins, Marta Fonseca; Carvalho, Maria Raquel; Cole, John Bruce; Barbosa da Silva, Marcos Vinicius Gualberto

2017-01-01

Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose), Gyr, Girolando and Holstein (dairy production). A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs) and 3,828,041 insertions/deletions (InDels) were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs. PMID:28323836

Molecular characterization and expression profiling of BMP 3 gene in broiler and layer chicken.

PubMed

Divya, Devara; Bhattacharya, Tarun Kumar; Gnana Prakash, Manthani; Chatterjee, R N; Shukla, Renu; Guru Vishnu, Pothana Boyina; Vinoth, Amirthalingam; Dushyanth, Kotha

2018-04-10

A study was carried out to characterize and explore the expression profile of BMP 3 gene in control broiler and control layer chicken. The total open reading frame of BMP 3 (1389 bp) was cloned and sequenced. The control broiler and control layer chicken showed variation at nucleotide and amino acid level with reference gene (Gallus gallus, NCBI Acc. No. NM_001034819). When compared to reference gene, the control broiler showed four nucleotide differences (c.192A>G, c.519C>T, 903G>A and 960C>G), while, control layer showed variation at c.33G>C, 192A>G, 858G>A, 904G>A, 960C>G and 1257C>T making six differences in total. However, between control broiler and control layer lines, nucleotide differences was observed at c.33G>C, 519T>C, 858G>A, 903A>G, 904G>A and 1257C>T. The change at amino acid level between reference and control broiler was p.D320N and with control layer chicken, it was p.D302N and p.D320N. On the other hand, a single amino acid difference (p.D302N) was observed between the control broiler and control layer chicken lines. The phylogenetic study displayed a close relationship between broiler and layer lines and reference gene and also with other avian species resulting in a cluster formation. These cluster in turn displayed a distant link with the mammalian species. The expression profile of BMP 3 gene exhibited a variation at different stages of embryonic development and also at post embryonic period among the lines with control layer showing higher expression than that of broiler chicken. The protein was also detected in bone marrow tissue of broiler and layer lines by western blotting. It is concluded that the BMP 3 gene sequence differed at nucleotide and amino acid level among the lines and the gene expressed differentially at different periods of embryonic development and also at post hatch period.

Mitochondrial DNA sequence data reveals association of haplogroup U with psychosis in bipolar disorder.

PubMed

Frye, Mark A; Ryu, Euijung; Nassan, Malik; Jenkins, Gregory D; Andreazza, Ana C; Evans, Jared M; McElroy, Susan L; Oglesbee, Devin; Highsmith, W Edward; Biernacka, Joanna M

2017-01-01

Converging genetic, postmortem gene-expression, cellular, and neuroimaging data implicate mitochondrial dysfunction in bipolar disorder. This study was conducted to investigate whether mitochondrial DNA (mtDNA) haplogroups and single nucleotide variants (SNVs) are associated with sub-phenotypes of bipolar disorder. MtDNA from 224 patients with Bipolar I disorder (BPI) was sequenced, and association of sequence variations with 3 sub-phenotypes (psychosis, rapid cycling, and adolescent illness onset) was evaluated. Gene-level tests were performed to evaluate overall burden of minor alleles for each phenotype. The haplogroup U was associated with a higher risk of psychosis. Secondary analyses of SNVs provided nominal evidence for association of psychosis with variants in the tRNA, ND4 and ND5 genes. The association of psychosis with ND4 (gene that encodes NADH dehydrogenase 4) was further supported by gene-level analysis. Preliminary analysis of mtDNA sequence data suggests a higher risk of psychosis with the U haplogroup and variation in the ND4 gene implicated in electron transport chain energy regulation. Further investigation of the functional consequences of this mtDNA variation is encouraged. Copyright © 2016. Published by Elsevier Ltd.

Length and sequence variability in mitochondrial control region of the milkfish, Chanos chanos.

PubMed

Ravago, Rachel G; Monje, Virginia D; Juinio-Meñez, Marie Antonette

2002-01-01

Extensive length variability was observed in the mitochondrial control region of the milkfish, Chanos chanos. The nucleotide sequence of the control region and flanking regions was determined. Length variability and heteroplasmy was due to the presence of varying numbers of a 41-bp tandemly repeated sequence and a 48-bp insertion/deletion (indel). The structure and organization of the milkfish control region is similar to that of other teleost fish and vertebrates. However, extensive variation in the copy number of tandem repeats (4-20 copies) and the presence of a relatively large (48-bp) indel, are apparently uncommon in teleost fish control region sequences reported to date. High sequence variability of control region peripheral domains indicates the potential utility of selected regions as markers for population-level studies.

srRNA evolution and phylogenetic relationships of the genus Naegleria (Protista: Rhizopoda).

PubMed

Baverstock, P R; Illana, S; Christy, P E; Robinson, B S; Johnson, A M

1989-05-01

A rapid RNA sequencing technique was used to partially sequence the small-subunit ribosomal RNA (srRNA) of four species of the amoeboid genus Naegleria. The extent of nucleotide sequence divergence between the two most divergent species was roughly similar to that found between mammals and frogs. However, the pattern of variation among the Naegleria species was quite different from that found for those species of tetrapods characterized to date. A phylogenetic analysis of the consensus Naegleria sequence showed that Naegleria was not monophyletic with either Acanthamoeba castellanii or Dictyostelium discoideum, two other amoebas for which sequences were available. It was shown that the semiconserved regions of the srRNA molecule evolve in a clocklike fashion and that the clock is time dependent rather than generation dependent.

Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

NASA Technical Reports Server (NTRS)

Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

1976-01-01

Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

Reduced representation approaches to interrogate genome diversity in large repetitive plant genomes.

PubMed

Hirsch, Cory D; Evans, Joseph; Buell, C Robin; Hirsch, Candice N

2014-07-01

Technology and software improvements in the last decade now provide methodologies to access the genome sequence of not only a single accession, but also multiple accessions of plant species. This provides a means to interrogate species diversity at the genome level. Ample diversity among accessions in a collection of species can be found, including single-nucleotide polymorphisms, insertions and deletions, copy number variation and presence/absence variation. For species with small, non-repetitive rich genomes, re-sequencing of query accessions is robust, highly informative, and economically feasible. However, for species with moderate to large sized repetitive-rich genomes, technical and economic barriers prevent en masse genome re-sequencing of accessions. Multiple approaches to access a focused subset of loci in species with larger genomes have been developed, including reduced representation sequencing, exome capture and transcriptome sequencing. Collectively, these approaches have enabled interrogation of diversity on a genome scale for large plant genomes, including crop species important to worldwide food security. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Chloroplast DNA Structural Variation, Phylogeny, and Age of Divergence among Diploid Cotton Species.

PubMed

Chen, Zhiwen; Feng, Kun; Grover, Corrinne E; Li, Pengbo; Liu, Fang; Wang, Yumei; Xu, Qin; Shang, Mingzhao; Zhou, Zhongli; Cai, Xiaoyan; Wang, Xingxing; Wendel, Jonathan F; Wang, Kunbo; Hua, Jinping

2016-01-01

The cotton genus (Gossypium spp.) contains 8 monophyletic diploid genome groups (A, B, C, D, E, F, G, K) and a single allotetraploid clade (AD). To gain insight into the phylogeny of Gossypium and molecular evolution of the chloroplast genome in this group, we performed a comparative analysis of 19 Gossypium chloroplast genomes, six reported here for the first time. Nucleotide distance in non-coding regions was about three times that of coding regions. As expected, distances were smaller within than among genome groups. Phylogenetic topologies based on nucleotide and indel data support for the resolution of the 8 genome groups into 6 clades. Phylogenetic analysis of indel distribution among the 19 genomes demonstrates contrasting evolutionary dynamics in different clades, with a parallel genome downsizing in two genome groups and a biased accumulation of insertions in the clade containing the cultivated cottons leading to large (for Gossypium) chloroplast genomes. Divergence time estimates derived from the cpDNA sequence suggest that the major diploid clades had diverged approximately 10 to 11 million years ago. The complete nucleotide sequences of 6 cpDNA genomes are provided, offering a resource for cytonuclear studies in Gossypium.

Chloroplast DNA Structural Variation, Phylogeny, and Age of Divergence among Diploid Cotton Species

PubMed Central

Li, Pengbo; Liu, Fang; Wang, Yumei; Xu, Qin; Shang, Mingzhao; Zhou, Zhongli; Cai, Xiaoyan; Wang, Xingxing; Wendel, Jonathan F.; Wang, Kunbo

2016-01-01

The cotton genus (Gossypium spp.) contains 8 monophyletic diploid genome groups (A, B, C, D, E, F, G, K) and a single allotetraploid clade (AD). To gain insight into the phylogeny of Gossypium and molecular evolution of the chloroplast genome in this group, we performed a comparative analysis of 19 Gossypium chloroplast genomes, six reported here for the first time. Nucleotide distance in non-coding regions was about three times that of coding regions. As expected, distances were smaller within than among genome groups. Phylogenetic topologies based on nucleotide and indel data support for the resolution of the 8 genome groups into 6 clades. Phylogenetic analysis of indel distribution among the 19 genomes demonstrates contrasting evolutionary dynamics in different clades, with a parallel genome downsizing in two genome groups and a biased accumulation of insertions in the clade containing the cultivated cottons leading to large (for Gossypium) chloroplast genomes. Divergence time estimates derived from the cpDNA sequence suggest that the major diploid clades had diverged approximately 10 to 11 million years ago. The complete nucleotide sequences of 6 cpDNA genomes are provided, offering a resource for cytonuclear studies in Gossypium. PMID:27309527

Genetic structure and genealogy in the Sphagnum subsecundum complex (Sphagnaceae: Bryophyta).

PubMed

Shaw, A J; Pokorny, L; Shaw, B; Ricca, M; Boles, S; Szövényi, P

2008-10-01

Allopolyploidy is probably the most extensively studied mode of plant speciation and allopolyploid species appear to be common in the mosses (Bryophyta). The Sphagnum subsecundum complex includes species known to be gametophytically haploid or diploid, and it has been proposed that the diploids (i.e., with tetraploid sporophytes) are allopolyploids. Nucleotide sequence and microsatellite variation among haploids and diploids from Newfoundland and Scandinavia indicate that (1) the diploids exhibit fixed or nearly fixed heterozygosity at the majority of loci sampled, and are clearly allopolyploids, (2) diploids originated independently in North America and Europe, (3) the European diploids appear to have the haploid species, S. subsecundum, as the maternal parent based on shared chloroplast DNA haplotypes, (4) the North American diploids do not have the chloroplast DNA of any sampled haploid, (5) both North American and European diploids share nucleotide and microsatellite similarities with S. subsecundum, (6) the diploids harbor more nucleotide and microsatellite diversity than the haploids, and (7) diploids exhibit higher levels of linkage disequilibrium among microsatellite loci. An experiment demonstrates significant artifactual recombination between interspecific DNAs coamplified by PCR, which may be a complicating factor in the interpretation of sequence-based analyses of allopolyploids.

Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree.

PubMed

Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi

2017-04-01

Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

Sequence and Secondary Structure of the Mitochondrial Small-Subunit rRNA V4, V6, and V9 Domains Reveal Highly Species-Specific Variations within the Genus Agrocybe

PubMed Central

Gonzalez, Patrice; Labarère, Jacques

1998-01-01

A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota. PMID:9797259

Sequence and secondary structure of the mitochondrial small-subunit rRNA V4, V6, and V9 domains reveal highly species-specific variations within the genus Agrocybe.

PubMed

Gonzalez, P; Labarère, J

1998-11-01

A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota.

Genetic differentiation of Artyfechinostomum malayanum and A. sufrartyfex (Trematoda: Echinostomatidae) based on internal transcribed spacer sequences.

PubMed

Tantrawatpan, Chairat; Saijuntha, Weerachai; Sithithaworn, Paiboon; Andrews, Ross H; Petney, Trevor N

2013-01-01

Genetic differentiation between two synonymous echinostomes species, Artyfechinostomum malayanum and Artyfechinostomum sufrartyfex was determined by using the first and second internal transcribed spacers (ITS1 and ITS2), the non-coding region of rDNA as genetic makers. Of the 699 bp of combined ITS1 and ITS2 sequences examined, 18 variable nucleotide positions (2.58 %) were observed. Of these, 17 positions could be used as diagnostic position between these two sibling species, whereas the other one variation was intraspecific variation of A. malayanum. A clade of A. malayanum was closely aligned with A. sufrartyfex and clearly distance from the cluster of other echinostomes. Our results may sufficiently suggest that the current synonymy of these species is not valid.

Composition for nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-08-26

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-06-06

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-05-30

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Population genetic inference from personal genome data: impact of ancestry and admixture on human genomic variation.

PubMed

Kidd, Jeffrey M; Gravel, Simon; Byrnes, Jake; Moreno-Estrada, Andres; Musharoff, Shaila; Bryc, Katarzyna; Degenhardt, Jeremiah D; Brisbin, Abra; Sheth, Vrunda; Chen, Rong; McLaughlin, Stephen F; Peckham, Heather E; Omberg, Larsson; Bormann Chung, Christina A; Stanley, Sarah; Pearlstein, Kevin; Levandowsky, Elizabeth; Acevedo-Acevedo, Suehelay; Auton, Adam; Keinan, Alon; Acuña-Alonzo, Victor; Barquera-Lozano, Rodrigo; Canizales-Quinteros, Samuel; Eng, Celeste; Burchard, Esteban G; Russell, Archie; Reynolds, Andy; Clark, Andrew G; Reese, Martin G; Lincoln, Stephen E; Butte, Atul J; De La Vega, Francisco M; Bustamante, Carlos D

2012-10-05

Full sequencing of individual human genomes has greatly expanded our understanding of human genetic variation and population history. Here, we present a systematic analysis of 50 human genomes from 11 diverse global populations sequenced at high coverage. Our sample includes 12 individuals who have admixed ancestry and who have varying degrees of recent (within the last 500 years) African, Native American, and European ancestry. We found over 21 million single-nucleotide variants that contribute to a 1.75-fold range in nucleotide heterozygosity across diverse human genomes. This heterozygosity ranged from a high of one heterozygous site per kilobase in west African genomes to a low of 0.57 heterozygous sites per kilobase in segments inferred to have diploid Native American ancestry from the genomes of Mexican and Puerto Rican individuals. We show evidence of all three continental ancestries in the genomes of Mexican, Puerto Rican, and African American populations, and the genome-wide statistics are highly consistent across individuals from a population once ancestry proportions have been accounted for. Using a generalized linear model, we identified subtle variations across populations in the proportion of neutral versus deleterious variation and found that genome-wide statistics vary in admixed populations even once ancestry proportions have been factored in. We further infer that multiple periods of gene flow shaped the diversity of admixed populations in the Americas-70% of the European ancestry in today's African Americans dates back to European gene flow happening only 7-8 generations ago. Copyright © 2012 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Population Genetic Inference from Personal Genome Data: Impact of Ancestry and Admixture on Human Genomic Variation

PubMed Central

Kidd, Jeffrey M.; Gravel, Simon; Byrnes, Jake; Moreno-Estrada, Andres; Musharoff, Shaila; Bryc, Katarzyna; Degenhardt, Jeremiah D.; Brisbin, Abra; Sheth, Vrunda; Chen, Rong; McLaughlin, Stephen F.; Peckham, Heather E.; Omberg, Larsson; Bormann Chung, Christina A.; Stanley, Sarah; Pearlstein, Kevin; Levandowsky, Elizabeth; Acevedo-Acevedo, Suehelay; Auton, Adam; Keinan, Alon; Acuña-Alonzo, Victor; Barquera-Lozano, Rodrigo; Canizales-Quinteros, Samuel; Eng, Celeste; Burchard, Esteban G.; Russell, Archie; Reynolds, Andy; Clark, Andrew G.; Reese, Martin G.; Lincoln, Stephen E.; Butte, Atul J.; De La Vega, Francisco M.; Bustamante, Carlos D.

2012-01-01

Full sequencing of individual human genomes has greatly expanded our understanding of human genetic variation and population history. Here, we present a systematic analysis of 50 human genomes from 11 diverse global populations sequenced at high coverage. Our sample includes 12 individuals who have admixed ancestry and who have varying degrees of recent (within the last 500 years) African, Native American, and European ancestry. We found over 21 million single-nucleotide variants that contribute to a 1.75-fold range in nucleotide heterozygosity across diverse human genomes. This heterozygosity ranged from a high of one heterozygous site per kilobase in west African genomes to a low of 0.57 heterozygous sites per kilobase in segments inferred to have diploid Native American ancestry from the genomes of Mexican and Puerto Rican individuals. We show evidence of all three continental ancestries in the genomes of Mexican, Puerto Rican, and African American populations, and the genome-wide statistics are highly consistent across individuals from a population once ancestry proportions have been accounted for. Using a generalized linear model, we identified subtle variations across populations in the proportion of neutral versus deleterious variation and found that genome-wide statistics vary in admixed populations even once ancestry proportions have been factored in. We further infer that multiple periods of gene flow shaped the diversity of admixed populations in the Americas—70% of the European ancestry in today’s African Americans dates back to European gene flow happening only 7–8 generations ago. PMID:23040495

Translating natural genetic variation to gene expression in a computational model of the Drosophila gap gene regulatory network

PubMed Central

Kozlov, Konstantin N.; Kulakovskiy, Ivan V.; Zubair, Asif; Marjoram, Paul; Lawrie, David S.; Nuzhdin, Sergey V.; Samsonova, Maria G.

2017-01-01

Annotating the genotype-phenotype relationship, and developing a proper quantitative description of the relationship, requires understanding the impact of natural genomic variation on gene expression. We apply a sequence-level model of gap gene expression in the early development of Drosophila to analyze single nucleotide polymorphisms (SNPs) in a panel of natural sequenced D. melanogaster lines. Using a thermodynamic modeling framework, we provide both analytical and computational descriptions of how single-nucleotide variants affect gene expression. The analysis reveals that the sequence variants increase (decrease) gene expression if located within binding sites of repressors (activators). We show that the sign of SNP influence (activation or repression) may change in time and space and elucidate the origin of this change in specific examples. The thermodynamic modeling approach predicts non-local and non-linear effects arising from SNPs, and combinations of SNPs, in individual fly genotypes. Simulation of individual fly genotypes using our model reveals that this non-linearity reduces to almost additive inputs from multiple SNPs. Further, we see signatures of the action of purifying selection in the gap gene regulatory regions. To infer the specific targets of purifying selection, we analyze the patterns of polymorphism in the data at two phenotypic levels: the strengths of binding and expression. We find that combinations of SNPs show evidence of being under selective pressure, while individual SNPs do not. The model predicts that SNPs appear to accumulate in the genotypes of the natural population in a way biased towards small increases in activating action on the expression pattern. Taken together, these results provide a systems-level view of how genetic variation translates to the level of gene regulatory networks via combinatorial SNP effects. PMID:28898266

Population genetic structure and phylogeographical pattern of a relict tree fern, Alsophila spinulosa (Cyatheaceae), inferred from cpDNA atpB- rbcL intergenic spacers.

PubMed

Su, Yingjuan; Wang, Ting; Zheng, Bo; Jiang, Yu; Chen, Guopei; Gu, Hongya

2004-11-01

Sequences of chloroplast DNA (cpDNA) atpB- rbcL intergenic spacers of individuals of a tree fern species, Alsophila spinulosa, collected from ten relict populations distributed in the Hainan and Guangdong provinces, and the Guangxi Zhuang region in southern China, were determined. Sequence length varied from 724 bp to 731 bp, showing length polymorphism, and base composition was with high A+T content between 63.17% and 63.95%. Sequences were neutral in terms of evolution (Tajima's criterion D=-1.01899, P>0.10 and Fu and Li's test D*=-1.39008, P>0.10; F*=-1.49775, P>0.10). A total of 19 haplotypes were identified based on nucleotide variation. High levels of haplotype diversity (h=0.744) and nucleotide diversity (Dij=0.01130) were detected in A. spinulosa, probably associated with its long evolutionary history, which has allowed the accumulation of genetic variation within lineages. Both the minimum spanning network and neighbor-joining trees generated for haplotypes demonstrated that current populations of A. spinulosa existing in Hainan, Guangdong, and Guangxi were subdivided into two geographical groups. An analysis of molecular variance indicated that most of the genetic variation (93.49%, P<0.001) was partitioned among regions. Wright's isolation by distance model was not supported across extant populations. Reduced gene flow by the Qiongzhou Strait and inbreeding may result in the geographical subdivision between the Hainan and Guangdong + Guangxi populations (FST=0.95, Nm=0.03). Within each region, the star-like pattern of phylogeography of haplotypes implied a population expansion process during evolutionary history. Gene genealogies together with coalescent theory provided significant information for uncovering phylogeography of A. spinulosa.

Challenges in the association of human single nucleotide polymorphism mentions with unique database identifiers

PubMed Central

2011-01-01

Background Most information on genomic variations and their associations with phenotypes are covered exclusively in scientific publications rather than in structured databases. These texts commonly describe variations using natural language; database identifiers are seldom mentioned. This complicates the retrieval of variations, associated articles, as well as information extraction, e. g. the search for biological implications. To overcome these challenges, procedures to map textual mentions of variations to database identifiers need to be developed. Results This article describes a workflow for normalization of variation mentions, i.e. the association of them to unique database identifiers. Common pitfalls in the interpretation of single nucleotide polymorphism (SNP) mentions are highlighted and discussed. The developed normalization procedure achieves a precision of 98.1 % and a recall of 67.5% for unambiguous association of variation mentions with dbSNP identifiers on a text corpus based on 296 MEDLINE abstracts containing 527 mentions of SNPs. The annotated corpus is freely available at http://www.scai.fraunhofer.de/snp-normalization-corpus.html. Conclusions Comparable approaches usually focus on variations mentioned on the protein sequence and neglect problems for other SNP mentions. The results presented here indicate that normalizing SNPs described on DNA level is more difficult than the normalization of SNPs described on protein level. The challenges associated with normalization are exemplified with ambiguities and errors, which occur in this corpus. PMID:21992066

Population genomics reveals a candidate gene involved in bumble bee pigmentation.

PubMed

Pimsler, Meaghan L; Jackson, Jason M; Lozier, Jeffrey D

2017-05-01

Variation in bumble bee color patterns is well-documented within and between species. Identifying the genetic mechanisms underlying such variation may be useful in revealing evolutionary forces shaping rapid phenotypic diversification. The widespread North American species Bombus bifarius exhibits regional variation in abdominal color forms, ranging from red-banded to black-banded phenotypes and including geographically and phenotypically intermediate forms. Identifying genomic regions linked to this variation has been complicated by strong, near species level, genome-wide differentiation between red- and black-banded forms. Here, we instead focus on the closely related black-banded and intermediate forms that both belong to the subspecies B. bifarius nearcticus . We analyze an RNA sequencing (RNAseq) data set and identify a cluster of single nucleotide polymorphisms (SNPs) within one gene, Xanthine dehydrogenase/oxidase -like, that exhibit highly unusual differentiation compared to the rest of the sequenced genome. Homologs of this gene contribute to pigmentation in other insects, and results thus represent a strong candidate for investigating the genetic basis of pigment variation in B. bifarius and other bumble bee mimicry complexes.

Human germline and pan-cancer variomes and their distinct functional profiles

PubMed Central

Pan, Yang; Karagiannis, Konstantinos; Zhang, Haichen; Dingerdissen, Hayley; Shamsaddini, Amirhossein; Wan, Quan; Simonyan, Vahan; Mazumder, Raja

2014-01-01

Identification of non-synonymous single nucleotide variations (nsSNVs) has exponentially increased due to advances in Next-Generation Sequencing technologies. The functional impacts of these variations have been difficult to ascertain because the corresponding knowledge about sequence functional sites is quite fragmented. It is clear that mapping of variations to sequence functional features can help us better understand the pathophysiological role of variations. In this study, we investigated the effect of nsSNVs on more than 17 common types of post-translational modification (PTM) sites, active sites and binding sites. Out of 1 705 285 distinct nsSNVs on 259 216 functional sites we identified 38 549 variations that significantly affect 10 major functional sites. Furthermore, we found distinct patterns of site disruptions due to germline and somatic nsSNVs. Pan-cancer analysis across 12 different cancer types led to the identification of 51 genes with 106 nsSNV affected functional sites found in 3 or more cancer types. 13 of the 51 genes overlap with previously identified Significantly Mutated Genes (Nature. 2013 Oct 17;502(7471)). 62 mutations in these 13 genes affecting functional sites such as DNA, ATP binding and various PTM sites occur across several cancers and can be prioritized for additional validation and investigations. PMID:25232094

Labeled nucleotide phosphate (NP) probes

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2009-02-03

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

PubMed Central

Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

1982-01-01

The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

Phylogenetic and nucleotide sequence analysis of influenza A (H1N1) HA and NA genes of strains isolated from Saudi Arabia.

PubMed

Al-Qahtani, Ahmed Ali; Mubin, Muhammad; Dela Cruz, Damian M; Althawadi, Sahar Isa; Ul Rehman, Muhammad Shah Nawaz; Bohol, Marie Fe F; Al-Ahdal, Mohammed N

2017-01-30

In early 2009, a novel influenza A (H1N1) virus appeared in Mexico and rapidly disseminated worldwide. Little is known about the phylogeny and evolutionary dynamics of the H1N1 strain found in Saudi Arabia. Nucleotide sequencing and bioinformatics analyses were used to study molecular variation between the virus isolates. In this report, 72 hemagglutinin (HA) and 45 neuraminidase (NA) H1N1 virus gene sequences, isolated in 2009 from various regions of Saudi Arabia, were analyzed. Genetic characterization indicated that viruses from two different clades, 6 and 7, were circulating in the region, with clade 7, the most widely circulating H1N1 clade globally in 2009, being predominant. Sequence analysis of the HA and NA genes revealed a high degree of sequence identity with the corresponding genes from viruses circulating in the South East Asia region and with the A/California/7/2009 strain. New mutations in the HA gene of pandemic H1N1 (pH1N1) viruses, that could alter viral fitness, were identified. Relaxed-clock and Bayesian Skyline Plot analyses, based on the isolates used in this study and closely related globally representative strains, indicated marginally higher substitution rates than the type strain (5.14×10-3 and 4.18×10-3 substitutions/nucleotide/year in the HA and NA genes, respectively). The Saudi isolates were antigenically homogeneous and closely related to the prototype vaccine strain A/California/7/2009. The antigenic site of the HA gene had acquired novel mutations in some isolates, making continued monitoring of these viruses vital for the identification of potentially highly virulent and drug resistant variants.

37 CFR 5.31-5.33 - [Reserved

Code of Federal Regulations, 2011 CFR

2011-07-01

... from abandonment 1.135 Amino Acid Sequences. (See Nucleotide and/or Amino Acid Sequences) Appeal to... Appeals and Interference 41.47 Of rejection of an application 1.104(a) Nucleotide and/or Amino Acid...) Symbols for nucleotide and/or amino acid sequence data 1.822 T Tables in patent applications 1.58 Terminal...

[Nucleotidic variations of two captive groups of tepezcuintle, Agouti paca (Rodentia: Agoutidae), from two sites in Yucatan, Mexico].

PubMed

Montes-Pérez, Rubén C; García, Adán W Echeverría; Castro, Jorge Zavala; Gamboa, Militza G Alfaro

2006-09-01

The objective of this work was to estimate the nucleotidic variation between two groups of tepezcuintles (Agouti paca) from the states of Campeche and Quintana Roo, Mexico and within members of each group. Blood samples were collected from eleven A. paca kept in captivity. DNA from leukocytic cells was used for Ramdom Amplification of DNA Polimorphism (RAPD). The primers three 5'-d(GTAGACCCGT)- 3' and six 5'-d(CCCGTCAGCA)- 3' were selected from de Amersham kit (Ready.To.Go. RAPD Analysis Beads, Amersham Pharmacia Biotech), because they produced an adequate number of bands. The electrophoretic pattern of bands obtained was analyzed using software for phylogenetic analysis based on the UPGMA method, to estimate the units of nucleotidic variation. The phylogenetic tree obtained with primer three reveals a dicotomic grouping between the animals from both states in the Yucatan Peninsula showing a divergent value of 1.983 nucleotides per hundred. Animals from Quintana Roo show a grouping with primer six; an additional grouping was observed with animals from Campeche. Nucleotidic variation between both groups was 2.118 nucleotides per hundred. The nucleotidic variation for the two primers within the groups from both states, showed fluctuating values from 0.46 to 1.68 nucleotides per hundred, which indicates that nucleotidic variation between the two groups of animals is around two nucleotides per hundred and, within the groups, less than 1.7 nucleotides per hundred.

WEB-server for search of a periodicity in amino acid and nucleotide sequences

NASA Astrophysics Data System (ADS)

E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

2017-12-01

A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

PubMed

Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

1987-06-01

The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

Deep whole-genome sequencing of 90 Han Chinese genomes.

PubMed

Lan, Tianming; Lin, Haoxiang; Zhu, Wenjuan; Laurent, Tellier Christian Asker Melchior; Yang, Mengcheng; Liu, Xin; Wang, Jun; Wang, Jian; Yang, Huanming; Xu, Xun; Guo, Xiaosen

2017-09-01

Next-generation sequencing provides a high-resolution insight into human genetic information. However, the focus of previous studies has primarily been on low-coverage data due to the high cost of sequencing. Although the 1000 Genomes Project and the Haplotype Reference Consortium have both provided powerful reference panels for imputation, low-frequency and novel variants remain difficult to discover and call with accuracy on the basis of low-coverage data. Deep sequencing provides an optimal solution for the problem of these low-frequency and novel variants. Although whole-exome sequencing is also a viable choice for exome regions, it cannot account for noncoding regions, sometimes resulting in the absence of important, causal variants. For Han Chinese populations, the majority of variants have been discovered based upon low-coverage data from the 1000 Genomes Project. However, high-coverage, whole-genome sequencing data are limited for any population, and a large amount of low-frequency, population-specific variants remain uncharacterized. We have performed whole-genome sequencing at a high depth (∼×80) of 90 unrelated individuals of Chinese ancestry, collected from the 1000 Genomes Project samples, including 45 Northern Han Chinese and 45 Southern Han Chinese samples. Eighty-three of these 90 have been sequenced by the 1000 Genomes Project. We have identified 12 568 804 single nucleotide polymorphisms, 2 074 210 short InDels, and 26 142 structural variations from these 90 samples. Compared to the Han Chinese data from the 1000 Genomes Project, we have found 7 000 629 novel variants with low frequency (defined as minor allele frequency < 5%), including 5 813 503 single nucleotide polymorphisms, 1 169 199 InDels, and 17 927 structural variants. Using deep sequencing data, we have built a greatly expanded spectrum of genetic variation for the Han Chinese genome. Compared to the 1000 Genomes Project, these Han Chinese deep sequencing data enhance the characterization of a large number of low-frequency, novel variants. This will be a valuable resource for promoting Chinese genetics research and medical development. Additionally, it will provide a valuable supplement to the 1000 Genomes Project, as well as to other human genome projects. © The Authors 2017. Published by Oxford University Press.

Prospecting for pig single nucleotide polymorphisms in the human genome: have we struck gold?

PubMed

Grapes, L; Rudd, S; Fernando, R L; Megy, K; Rocha, D; Rothschild, M F

2006-06-01

Gene-to-gene variation in the frequency of single nucleotide polymorphisms (SNPs) has been observed in humans, mice, rats, primates and pigs, but a relationship across species in this variation has not been described. Here, the frequency of porcine coding SNPs (cSNPs) identified by in silico methods, and the frequency of murine cSNPs, were compared with the frequency of human cSNPs across homologous genes. From 150,000 porcine expressed sequence tag (EST) sequences, a total of 452 SNP-containing sequence clusters were found, totalling 1394 putative SNPs. All the clustered porcine EST annotations and SNP data have been made publicly available at http://sputnik.btk.fi/project?name=swine. Human and murine cSNPs were identified from dbSNP and were characterized as either validated or total number of cSNPs (validated plus non-validated) for comparison purposes. The correlation between in silico pig cSNP and validated human cSNP densities was found to be 0.77 (p < 0.00001) for a set of 25 homologous genes, while a correlation of 0.48 (p < 0.0005) was found for a primarily random sample of 50 homologous human and mouse genes. This is the first evidence of conserved gene-to-gene variability in cSNP frequency across species and indicates that site-directed screening of porcine genes that are homologous to cSNP-rich human genes may rapidly advance cSNP discovery in pigs.

Genomic analysis of the Chinese genotype 1F rubella virus that disappeared after 2002 in China.

PubMed

Zhu, Zhen; Chen, Min-Hsin; Abernathy, Emily; Zhou, Shujie; Wang, Changyin; Icenogle, Joseph; Xu, Wenbo

2014-12-01

Genotype 1F was likely localized geographically to China as it has not been reported elsewhere. In this study, whole genome sequences of two rubella 1F virus isolates were completed. Both viruses contained 9,761 nt with a single nucleotide deletion in the intergenic region, compared to the NCBI rubella reference sequence (NC 001545). No evidence of recombination was found between 1F and other rubella viruses. The genetic distance between 1F viruses and 10 other rubella virus genotypes (1a, 1B, 1C, 1D, 1E, 1G, 1J 2A, 2B, and 2C) ranged from 3.9% to 8.6% by pairwise comparison. A region known to be hypervariable in other rubella genotypes was also the most variable region in the 1F genomes. Comparisons to all available rubella virus sequences from GenBank identified 22 nucleotide variations exclusively in 1F viruses. Among these unique variations, C9306U is located within the recommended molecular window for rubella virus genotyping assignment, could be useful to confirm 1F viruses. Using the Bayesian Markov Chain Monte Carlo (MCMC) method, the time of the most recent common ancestor for the genotype 1F was estimated between 1976 and 1995. Recent rubella molecular surveillance suggests that this indigenous strain may have circulated for less than three decades, as it has not been detected since 2002. © 2014 Wiley Periodicals, Inc.

Measles virus genetic evolution throughout an imported epidemic outbreak in a highly vaccinated population.

PubMed

Muñoz-Alía, Miguel Ángel; Fernández-Muñoz, Rafael; Casasnovas, José María; Porras-Mansilla, Rebeca; Serrano-Pardo, Ángela; Pagán, Israel; Ordobás, María; Ramírez, Rosa; Celma, María Luisa

2015-01-22

Measles virus circulates endemically in African and Asian large urban populations, causing outbreaks worldwide in populations with up-to-95% immune protection. We studied the natural genetic variability of genotype B3.1 in a population with 95% vaccine coverage throughout an imported six month measles outbreak. From first pass viral isolates of 47 patients we performed direct sequencing of genomic cDNA. Whilst no variation from index case sequence occurred in the Nucleocapsid gene hyper-variable carboxy end, in the Hemagglutinin gene, main target for neutralizing antibodies, we observed gradual nucleotide divergence from index case along the outbreak (0% to 0.380%, average 0.138%) with the emergence of transient and persistent non-synonymous and synonymous mutations. Little or no variation was observed between the index and last outbreak cases in Phosphoprotein, Nucleocapsid, Matrix and Fusion genes. Most of the H non-synonymous mutations were mapped on the protein surface near antigenic and receptors binding sites. We estimated a MV-Hemagglutinin nucleotide substitution rate of 7.28 × 10-6 substitutions/site/day by a Bayesian phylogenetic analysis. The dN/dS analysis did not suggest significant immune or other selective pressures on the H gene during the outbreak. These results emphasize the usefulness of MV-H sequence analysis in measles epidemiological surveillance and elimination programs, and in detection of potentially emergence of measles virus neutralization-resistant mutants. Copyright © 2014 Elsevier B.V. All rights reserved.

Morphological and molecular evidence for a new species of the genus Cosmocercoides Wilkie, 1930 (Ascaridida: Cosmocercidae) from the Asiatic toad Bufo gargarizans Cantor (Amphibia: Anura).

PubMed

Chen, Hui-Xia; Zhang, Lu-Ping; Nakao, Minoru; Li, Liang

2018-06-01

A new cosmocercid species, Cosmocercoides qingtianensis sp. n., collected from the intestine of the Asiatic toad Bufo gargarizans Cantor (Amphibia: Anura) is described using integrated approaches, including light and scanning electron microscopy, and sequencing and analyzing the ribosomal [small ribosomal DNA (18S) and internal transcribed spacer (ITS)] and mitochondrial [cytochrome c oxidase subunit 1 (cox1)] target regions, respectively. The new species can be distinguished from its congeners by the combination of the following morphological characters, including the large body size, the presence of lateral alae and somatic papillae in both sexes, the length of spicules, the particular morphology and length of gubernaculum, the number, arrangement and morphology of caudal rosettes, the presence of large medioventral precloacal papilla and the long tail. Our molecular analysis revealed the level of intraspecific genetic variation of C. qingtianensis sp. n. distinctly lower than that of the interspecific genetic variation in the ITS and cox1 regions. However, there are some overlaps in the range of intra- and interspecific 18S sequence divergence between the new species and some closely related species. The results of molecular analysis supported the validity of the new species based on the morphological observations. The 18S, ITS, and cox1 regions of C. pulcher collected from Bufo japonicus formosus in Japan were also sequenced and analyzed. The results showed a low level of intraspecific genetic variation in 18S and ITS regions (0-0.12% and 0-0.23% nucleotide differences, respectively), but a relatively high level of intraspecific genetic variation in cox1 region (0.78-4.69% nucleotide differences). In addition, it seems more powerful and practical to use the cox1 region as a genetic marker for the accurate identification and differentiation of species of Cosmocercoides than the 18S and ITS regions, especially for the closely related species.

Human Papillomavirus Type 6 and 11 Genetic Variants Found in 71 Oral and Anogenital Epithelial Samples from Australia

PubMed Central

Danielewski, Jennifer A.; Garland, Suzanne M.; McCloskey, Jenny; Hillman, Richard J.; Tabrizi, Sepehr N.

2013-01-01

Genetic variation of 49 human papillomavirus (HPV) 6 and 22 HPV11 isolates from recurrent respiratory papillomatosis (RRP) (n = 17), genital warts (n = 43), anal cancer (n = 6) and cervical neoplasia cells (n = 5), was determined by sequencing the long control region (LCR) and the E6 and E7 genes. Comparative analysis of genetic variability was examined to determine whether different disease states resulting from HPV6 or HPV11 infection cluster into distinct variant groups. Sequence variation analysis of HPV6 revealed that isolates cluster into variants within previously described HPV6 lineages, with the majority (65%) clustering to HPV6 sublineage B1 across the three genomic regions examined. Overall 72 HPV6 and 25 HPV11 single nucleotide variations, insertions and deletions were observed within samples examined. In addition, missense alterations were observed in the E6/E7 genes for 6 HPV6 and 5 HPV11 variants. No nucleotide variations were identified in any isolates at the four E2 binding sites for HPV6 or HPV11, nor were any isolates found to be identical to the HPV6 lineage A or HPV11 sublineage A1 reference genomes. Overall, a high degree of sequence conservation was observed between isolates across each of the regions investigated for both HPV6 and HPV11. Genetic variants identified a slight association with HPV6 and anogenital lesions (p = 0.04). This study provides important information on the genetic diversity of circulating HPV 6 and HPV11 variants within the Australian population and supports the observation that the majority of HPV6 isolates cluster to the HPV6 sublineage B1 with anogenital lesions demonstrating an association with this sublineage (p = 0.02). Comparative analysis of Australian isolates for both HPV6 and HPV11 to those from other geographical regions based on the LCR revealed a high degree of sequence similarity throughout the world, confirming previous observations that there are no geographically specific variants for these HPV types. PMID:23691108

Major Breeding Plumage Color Differences of Male Ruffs (Philomachus pugnax) Are Not Associated With Coding Sequence Variation in the MC1R Gene

PubMed Central

Küpper, Clemens; Burke, Terry; Lank, David B.

2015-01-01

Sequence variation in the melanocortin-1 receptor (MC1R) gene explains color morph variation in several species of birds and mammals. Ruffs (Philomachus pugnax) exhibit major dark/light color differences in melanin-based male breeding plumage which is closely associated with alternative reproductive behavior. A previous study identified a microsatellite marker (Ppu020) near the MC1R locus associated with the presence/absence of ornamental plumage. We investigated whether coding sequence variation in the MC1R gene explains major dark/light plumage color variation and/or the presence/absence of ornamental plumage in ruffs. Among 821bp of the MC1R coding region from 44 male ruffs we found 3 single nucleotide polymorphisms, representing 1 nonsynonymous and 2 synonymous amino acid substitutions. None were associated with major dark/light color differences or the presence/absence of ornamental plumage. At all amino acid sites known to be functionally important in other avian species with dark/light plumage color variation, ruffs were either monomorphic or the shared polymorphism did not coincide with color morph. Neither ornamental plumage color differences nor the presence/absence of ornamental plumage in ruffs are likely to be caused entirely by amino acid variation within the coding regions of the MC1R locus. Regulatory elements and structural variation at other loci may be involved in melanin expression and contribute to the extreme plumage polymorphism observed in this species. PMID:25534935

Nucleotide cleaving agents and method

DOEpatents

Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.

2000-01-01

The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

In Silico Analysis of Gene Expression Network Components Underlying Pigmentation Phenotypes in the Python Identified Evolutionarily Conserved Clusters of Transcription Factor Binding Sites

PubMed Central

2016-01-01

Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1) that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus. Our results provide insight into pigment phenotypes in pythons. PMID:27698666

In Silico Analysis of Gene Expression Network Components Underlying Pigmentation Phenotypes in the Python Identified Evolutionarily Conserved Clusters of Transcription Factor Binding Sites.

PubMed

Irizarry, Kristopher J L; Bryden, Randall L

2016-01-01

Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1) that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus . Our results provide insight into pigment phenotypes in pythons.

Positive selection in the SLC11A1 gene in the family Equidae.

PubMed

Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr

2016-05-01

Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.

Genovar: a detection and visualization tool for genomic variants.

PubMed

Jung, Kwang Su; Moon, Sanghoon; Kim, Young Jin; Kim, Bong-Jo; Park, Kiejung

2012-05-08

Along with single nucleotide polymorphisms (SNPs), copy number variation (CNV) is considered an important source of genetic variation associated with disease susceptibility. Despite the importance of CNV, the tools currently available for its analysis often produce false positive results due to limitations such as low resolution of array platforms, platform specificity, and the type of CNV. To resolve this problem, spurious signals must be separated from true signals by visual inspection. None of the previously reported CNV analysis tools support this function and the simultaneous visualization of comparative genomic hybridization arrays (aCGH) and sequence alignment. The purpose of the present study was to develop a useful program for the efficient detection and visualization of CNV regions that enables the manual exclusion of erroneous signals. A JAVA-based stand-alone program called Genovar was developed. To ascertain whether a detected CNV region is a novel variant, Genovar compares the detected CNV regions with previously reported CNV regions using the Database of Genomic Variants (DGV, http://projects.tcag.ca/variation) and the Single Nucleotide Polymorphism Database (dbSNP). The current version of Genovar is capable of visualizing genomic data from sources such as the aCGH data file and sequence alignment format files. Genovar is freely accessible and provides a user-friendly graphic user interface (GUI) to facilitate the detection of CNV regions. The program also provides comprehensive information to help in the elimination of spurious signals by visual inspection, making Genovar a valuable tool for reducing false positive CNV results. http://genovar.sourceforge.net/.

CNV-RF Is a Random Forest-Based Copy Number Variation Detection Method Using Next-Generation Sequencing.

PubMed

Onsongo, Getiria; Baughn, Linda B; Bower, Matthew; Henzler, Christine; Schomaker, Matthew; Silverstein, Kevin A T; Thyagarajan, Bharat

2016-11-01

Simultaneous detection of small copy number variations (CNVs) (<0.5 kb) and single-nucleotide variants in clinically significant genes is of great interest for clinical laboratories. The analytical variability in next-generation sequencing (NGS) and artifacts in coverage data because of issues with mappability along with lack of robust bioinformatics tools for CNV detection have limited the utility of targeted NGS data to identify CNVs. We describe the development and implementation of a bioinformatics algorithm, copy number variation-random forest (CNV-RF), that incorporates a machine learning component to identify CNVs from targeted NGS data. Using CNV-RF, we identified 12 of 13 deletions in samples with known CNVs, two cases with duplications, and identified novel deletions in 22 additional cases. Furthermore, no CNVs were identified among 60 genes in 14 cases with normal copy number and no CNVs were identified in another 104 patients with clinical suspicion of CNVs. All positive deletions and duplications were confirmed using a quantitative PCR method. CNV-RF also detected heterozygous deletions and duplications with a specificity of 50% across 4813 genes. The ability of CNV-RF to detect clinically relevant CNVs with a high degree of sensitivity along with confirmation using a low-cost quantitative PCR method provides a framework for providing comprehensive NGS-based CNV/single-nucleotide variant detection in a clinical molecular diagnostics laboratory. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes

PubMed Central

2010-01-01

Background A genome-wide assessment of nucleotide diversity in a polyploid species must minimize the inclusion of homoeologous sequences into diversity estimates and reliably allocate individual haplotypes into their respective genomes. The same requirements complicate the development and deployment of single nucleotide polymorphism (SNP) markers in polyploid species. We report here a strategy that satisfies these requirements and deploy it in the sequencing of genes in cultivated hexaploid wheat (Triticum aestivum, genomes AABBDD) and wild tetraploid wheat (Triticum turgidum ssp. dicoccoides, genomes AABB) from the putative site of wheat domestication in Turkey. Data are used to assess the distribution of diversity among and within wheat genomes and to develop a panel of SNP markers for polyploid wheat. Results Nucleotide diversity was estimated in 2114 wheat genes and was similar between the A and B genomes and reduced in the D genome. Within a genome, diversity was diminished on some chromosomes. Low diversity was always accompanied by an excess of rare alleles. A total of 5,471 SNPs was discovered in 1791 wheat genes. Totals of 1,271, 1,218, and 2,203 SNPs were discovered in 488, 463, and 641 genes of wheat putative diploid ancestors, T. urartu, Aegilops speltoides, and Ae. tauschii, respectively. A public database containing genome-specific primers, SNPs, and other information was constructed. A total of 987 genes with nucleotide diversity estimated in one or more of the wheat genomes was placed on an Ae. tauschii genetic map, and the map was superimposed on wheat deletion-bin maps. The agreement between the maps was assessed. Conclusions In a young polyploid, exemplified by T. aestivum, ancestral species are the primary source of genetic diversity. Low effective recombination due to self-pollination and a genetic mechanism precluding homoeologous chromosome pairing during polyploid meiosis can lead to the loss of diversity from large chromosomal regions. The net effect of these factors in T. aestivum is large variation in diversity among genomes and chromosomes, which impacts the development of SNP markers and their practical utility. Accumulation of new mutations in older polyploid species, such as wild emmer, results in increased diversity and its more uniform distribution across the genome. PMID:21156062

Unique LCR variations among lineages of HPV16, 18 and 45 isolates from women with normal cervical cytology in Ghana.

PubMed

Awua, Adolf K; Adanu, Richard M K; Wiredu, Edwin K; Afari, Edwin A; Zubuch, Vanessa A; Asmah, Richard H; Severini, Alberto

2017-04-21

In addition to being useful for classification, sequence variations of human Papillomavirus (HPV) genotypes have been implicated in differential oncogenic potential and a differential association with the different histological forms of invasive cervical cancer. These associations have also been indicated for HPV genotype lineages and sub-lineages. In order to better understand the potential implications of lineage variation in the occurrence of cervical cancers in Ghana, we studied the lineages of the three most prevalent HPV genotypes among women with normal cytology as baseline to further studies. Of previously collected self- and health personnel-collected cervical specimen, 54, which were positive for HPV16, 18 and 45, were selected and the long control region (LCR) of each HPV genotype was separately amplified by a nested PCR. DNA sequences of 41 isolates obtained with the forward and reverse primers by Sanger sequencing were analysed. Nucleotide sequence variations of the HPV16 genotypes were observed at 30 positions within the LCR (7460 - 7840). Of these, 19 were the known variations for the lineages B and C (African lineages), while the other 11 positions had variations unique to the HPV16 isolates of this study. For the HPV18 isolates, the variations were at 35 positions, 22 of which were known variations of Africa lineages and the other 13 were unique variations observed for the isolates obtained in this study (at positions 7799 and 7813). HPV45 isolates had variations at 35 positions and 2 (positions 7114 and 97) were unique to the isolates of this study. This study provides the first data on the lineages of HPV 16, 18 and 45 isolates from Ghana. Although the study did not obtain full genome sequence data for a comprehensive comparison with known lineages, these genotypes were predominately of the Africa lineages and had some unique sequence variations at positions that suggest potential oncogenic implications. These data will be useful for comparison with lineages of these genotypes from women with cervical lesion and all the forms of invasive cervical cancers.

Modeling kinetic rate variation in third generation DNA sequencing data to detect putative modifications to DNA bases

PubMed Central

Schadt, Eric E.; Banerjee, Onureena; Fang, Gang; Feng, Zhixing; Wong, Wing H.; Zhang, Xuegong; Kislyuk, Andrey; Clark, Tyson A.; Luong, Khai; Keren-Paz, Alona; Chess, Andrew; Kumar, Vipin; Chen-Plotkin, Alice; Sondheimer, Neal; Korlach, Jonas; Kasarskis, Andrew

2013-01-01

Current generation DNA sequencing instruments are moving closer to seamlessly sequencing genomes of entire populations as a routine part of scientific investigation. However, while significant inroads have been made identifying small nucleotide variation and structural variations in DNA that impact phenotypes of interest, progress has not been as dramatic regarding epigenetic changes and base-level damage to DNA, largely due to technological limitations in assaying all known and unknown types of modifications at genome scale. Recently, single-molecule real time (SMRT) sequencing has been reported to identify kinetic variation (KV) events that have been demonstrated to reflect epigenetic changes of every known type, providing a path forward for detecting base modifications as a routine part of sequencing. However, to date no statistical framework has been proposed to enhance the power to detect these events while also controlling for false-positive events. By modeling enzyme kinetics in the neighborhood of an arbitrary location in a genomic region of interest as a conditional random field, we provide a statistical framework for incorporating kinetic information at a test position of interest as well as at neighboring sites that help enhance the power to detect KV events. The performance of this and related models is explored, with the best-performing model applied to plasmid DNA isolated from Escherichia coli and mitochondrial DNA isolated from human brain tissue. We highlight widespread kinetic variation events, some of which strongly associate with known modification events, while others represent putative chemically modified sites of unknown types. PMID:23093720

Modeling kinetic rate variation in third generation DNA sequencing data to detect putative modifications to DNA bases.

PubMed

Schadt, Eric E; Banerjee, Onureena; Fang, Gang; Feng, Zhixing; Wong, Wing H; Zhang, Xuegong; Kislyuk, Andrey; Clark, Tyson A; Luong, Khai; Keren-Paz, Alona; Chess, Andrew; Kumar, Vipin; Chen-Plotkin, Alice; Sondheimer, Neal; Korlach, Jonas; Kasarskis, Andrew

2013-01-01

Current generation DNA sequencing instruments are moving closer to seamlessly sequencing genomes of entire populations as a routine part of scientific investigation. However, while significant inroads have been made identifying small nucleotide variation and structural variations in DNA that impact phenotypes of interest, progress has not been as dramatic regarding epigenetic changes and base-level damage to DNA, largely due to technological limitations in assaying all known and unknown types of modifications at genome scale. Recently, single-molecule real time (SMRT) sequencing has been reported to identify kinetic variation (KV) events that have been demonstrated to reflect epigenetic changes of every known type, providing a path forward for detecting base modifications as a routine part of sequencing. However, to date no statistical framework has been proposed to enhance the power to detect these events while also controlling for false-positive events. By modeling enzyme kinetics in the neighborhood of an arbitrary location in a genomic region of interest as a conditional random field, we provide a statistical framework for incorporating kinetic information at a test position of interest as well as at neighboring sites that help enhance the power to detect KV events. The performance of this and related models is explored, with the best-performing model applied to plasmid DNA isolated from Escherichia coli and mitochondrial DNA isolated from human brain tissue. We highlight widespread kinetic variation events, some of which strongly associate with known modification events, while others represent putative chemically modified sites of unknown types.

Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

PubMed

Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

2004-01-01

Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

New chloroplast microsatellite markers suitable for assessing genetic diversity of Lolium perenne and other related grass species

PubMed Central

Diekmann, Kerstin; Hodkinson, Trevor R.; Barth, Susanne

2012-01-01

Background and Aims Lolium perenne (perennial ryegrass) is the most important forage grass species of temperate regions. We have previously released the chloroplast genome sequence of L. perenne ‘Cashel’. Here nine chloroplast microsatellite markers are published, which were designed based on knowledge about genetically variable regions within the L. perenne chloroplast genome. These markers were successfully used for characterizing the genetic diversity in Lolium and different grass species. Methods Chloroplast genomes of 14 Poaceae taxa were screened for mononucleotide microsatellite repeat regions and primers designed for their amplification from nine loci. The potential of these markers to assess genetic diversity was evaluated on a set of 16 Irish and 15 European L. perenne ecotypes, nine L. perenne cultivars, other Lolium taxa and other grass species. Key Results All analysed Poaceae chloroplast genomes contained more than 200 mononucleotide repeats (chloroplast simple sequence repeats, cpSSRs) of at least 7 bp in length, concentrated mainly in the large single copy region of the genome. Nucleotide composition varied considerably among subfamilies (with Pooideae biased towards poly A repeats). The nine new markers distinguish L. perenne from all non-Lolium taxa. TeaCpSSR28 was able to distinguish between all Lolium species and Lolium multiflorum due to an elongation of an A8 mononucleotide repeat in L. multiflorum. TeaCpSSR31 detected a considerable degree of microsatellite length variation and single nucleotide polymorphism. TeaCpSSR27 revealed variation within some L. perenne accessions due to a 44-bp indel and was hence readily detected by simple agarose gel electrophoresis. Smaller insertion/deletion events or single nucleotide polymorphisms detected by these new markers could be visualized by polyacrylamide gel electrophoresis or DNA sequencing, respectively. Conclusions The new markers are a valuable tool for plant breeding companies, seed testing agencies and the wider scientific community due to their ability to monitor genetic diversity within breeding pools, to trace maternal inheritance and to distinguish closely related species. PMID:22419761

New chloroplast microsatellite markers suitable for assessing genetic diversity of Lolium perenne and other related grass species.

PubMed

Diekmann, Kerstin; Hodkinson, Trevor R; Barth, Susanne

2012-11-01

Lolium perenne (perennial ryegrass) is the most important forage grass species of temperate regions. We have previously released the chloroplast genome sequence of L. perenne 'Cashel'. Here nine chloroplast microsatellite markers are published, which were designed based on knowledge about genetically variable regions within the L. perenne chloroplast genome. These markers were successfully used for characterizing the genetic diversity in Lolium and different grass species. Chloroplast genomes of 14 Poaceae taxa were screened for mononucleotide microsatellite repeat regions and primers designed for their amplification from nine loci. The potential of these markers to assess genetic diversity was evaluated on a set of 16 Irish and 15 European L. perenne ecotypes, nine L. perenne cultivars, other Lolium taxa and other grass species. All analysed Poaceae chloroplast genomes contained more than 200 mononucleotide repeats (chloroplast simple sequence repeats, cpSSRs) of at least 7 bp in length, concentrated mainly in the large single copy region of the genome. Nucleotide composition varied considerably among subfamilies (with Pooideae biased towards poly A repeats). The nine new markers distinguish L. perenne from all non-Lolium taxa. TeaCpSSR28 was able to distinguish between all Lolium species and Lolium multiflorum due to an elongation of an A(8) mononucleotide repeat in L. multiflorum. TeaCpSSR31 detected a considerable degree of microsatellite length variation and single nucleotide polymorphism. TeaCpSSR27 revealed variation within some L. perenne accessions due to a 44-bp indel and was hence readily detected by simple agarose gel electrophoresis. Smaller insertion/deletion events or single nucleotide polymorphisms detected by these new markers could be visualized by polyacrylamide gel electrophoresis or DNA sequencing, respectively. The new markers are a valuable tool for plant breeding companies, seed testing agencies and the wider scientific community due to their ability to monitor genetic diversity within breeding pools, to trace maternal inheritance and to distinguish closely related species.

Nucleic acid analysis using terminal-phosphate-labeled nucleotides

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-04-22

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Nucleotide sequence analysis of the L gene of Newcastle disease virus: homologies with Sendai and vesicular stomatitis viruses.

PubMed Central

Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T

1987-01-01

The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486

Seasonal changes of nucleotides in mussel (Mytilus galloprovincialis) mantle tissue.

PubMed

Blanco, S L; Suárez, M P; San Juan, F

2006-03-01

Seasonal variations of nucleotides in Mytilus galloprovincialis mantle tissue were analyzed. Separation and quantification was achieved by reversed-phase high-performance liquid chromatography. Total nucleotides show a pronounced seasonal variation with maximum and minimum values in autumn and spring, respectively. Adenine nucleotides accounted for the major part in spring and summer, guanosine and cytidine nucleotides in winter; uridine nucleotides were relatively constant throughout the year. Their inverse variation suggests inter-conversion among them and the maintenance of the potential cell energy in winter by other triphosphate nucleotides different from ATP. These results reflect environmental and nutritional conditions, and also the reserves and gametogenic cycles taking place in M. galloprovincialis mantle tissue.

A Perfect Match Genomic Landscape Provides a Unified Framework for the Precise Detection of Variation in Natural and Synthetic Haploid Genomes.

PubMed

Palacios-Flores, Kim; García-Sotelo, Jair; Castillo, Alejandra; Uribe, Carina; Aguilar, Luis; Morales, Lucía; Gómez-Romero, Laura; Reyes, José; Garciarubio, Alejandro; Boege, Margareta; Dávila, Guillermo

2018-04-01

We present a conceptually simple, sensitive, precise, and essentially nonstatistical solution for the analysis of genome variation in haploid organisms. The generation of a Perfect Match Genomic Landscape (PMGL), which computes intergenome identity with single nucleotide resolution, reveals signatures of variation wherever a query genome differs from a reference genome. Such signatures encode the precise location of different types of variants, including single nucleotide variants, deletions, insertions, and amplifications, effectively introducing the concept of a general signature of variation. The precise nature of variants is then resolved through the generation of targeted alignments between specific sets of sequence reads and known regions of the reference genome. Thus, the perfect match logic decouples the identification of the location of variants from the characterization of their nature, providing a unified framework for the detection of genome variation. We assessed the performance of the PMGL strategy via simulation experiments. We determined the variation profiles of natural genomes and of a synthetic chromosome, both in the context of haploid yeast strains. Our approach uncovered variants that have previously escaped detection. Moreover, our strategy is ideally suited for further refining high-quality reference genomes. The source codes for the automated PMGL pipeline have been deposited in a public repository. Copyright © 2018 by the Genetics Society of America.

Whole Genome Re-Sequencing and Characterization of Powdery Mildew Disease-Associated Allelic Variation in Melon.

PubMed

Natarajan, Sathishkumar; Kim, Hoy-Taek; Thamilarasan, Senthil Kumar; Veerappan, Karpagam; Park, Jong-In; Nou, Ill-Sup

2016-01-01

Powdery mildew is one of the most common fungal diseases in the world. This disease frequently affects melon (Cucumis melo L.) and other Cucurbitaceous family crops in both open field and greenhouse cultivation. One of the goals of genomics is to identify the polymorphic loci responsible for variation in phenotypic traits. In this study, powdery mildew disease assessment scores were calculated for four melon accessions, 'SCNU1154', 'Edisto47', 'MR-1', and 'PMR5'. To investigate the genetic variation of these accessions, whole genome re-sequencing using the Illumina HiSeq 2000 platform was performed. A total of 754,759,704 quality-filtered reads were generated, with an average of 82.64% coverage relative to the reference genome. Comparisons of the sequences for the melon accessions revealed around 7.4 million single nucleotide polymorphisms (SNPs), 1.9 million InDels, and 182,398 putative structural variations (SVs). Functional enrichment analysis of detected variations classified them into biological process, cellular component and molecular function categories. Further, a disease-associated QTL map was constructed for 390 SNPs and 45 InDels identified as related to defense-response genes. Among them 112 SNPs and 12 InDels were observed in powdery mildew responsive chromosomes. Accordingly, this whole genome re-sequencing study identified SNPs and InDels associated with defense genes that will serve as candidate polymorphisms in the search for sources of resistance against powdery mildew disease and could accelerate marker-assisted breeding in melon.

Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

PubMed

Wyszyńska-Koko, J; Kurył, J

2004-01-01

MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

Simultaneous Differentiation and Typing of Entamoeba histolytica and Entamoeba dispar

PubMed Central

Zaki, Mehreen; Meelu, Parool; Sun, Wei; Clark, C. Graham

2002-01-01

Sequences corresponding to some of the polymorphic loci previously reported from Entamoeba histolytica have been detected in Entamoeba dispar. Comparison of nucleotide sequences of two loci between E. dispar strain SAW760 and E. histolytica strain HM-1:IMSS revealed significant differences in both repeat and flanking regions. The tandem repeat units varied not only in sequence but also in number and arrangement between the two species at both the loci. Using the sequences obtained, primer pairs aimed at amplifying species-specific products were designed and tested on a variety of E. histolytica and E. dispar samples. Amplification results were in complete agreement with the original species classification in all cases, and the PCR products displayed discernible size and pattern variations among the isolates. PMID:11923344

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2014 CFR

2014-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2013 CFR

2013-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2012 CFR

2012-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

A map of human genome variation from population-scale sequencing.

PubMed

Abecasis, Gonçalo R; Altshuler, David; Auton, Adam; Brooks, Lisa D; Durbin, Richard M; Gibbs, Richard A; Hurles, Matt E; McVean, Gil A

2010-10-28

The 1000 Genomes Project aims to provide a deep characterization of human genome sequence variation as a foundation for investigating the relationship between genotype and phenotype. Here we present results of the pilot phase of the project, designed to develop and compare different strategies for genome-wide sequencing with high-throughput platforms. We undertook three projects: low-coverage whole-genome sequencing of 179 individuals from four populations; high-coverage sequencing of two mother-father-child trios; and exon-targeted sequencing of 697 individuals from seven populations. We describe the location, allele frequency and local haplotype structure of approximately 15 million single nucleotide polymorphisms, 1 million short insertions and deletions, and 20,000 structural variants, most of which were previously undescribed. We show that, because we have catalogued the vast majority of common variation, over 95% of the currently accessible variants found in any individual are present in this data set. On average, each person is found to carry approximately 250 to 300 loss-of-function variants in annotated genes and 50 to 100 variants previously implicated in inherited disorders. We demonstrate how these results can be used to inform association and functional studies. From the two trios, we directly estimate the rate of de novo germline base substitution mutations to be approximately 10(-8) per base pair per generation. We explore the data with regard to signatures of natural selection, and identify a marked reduction of genetic variation in the neighbourhood of genes, due to selection at linked sites. These methods and public data will support the next phase of human genetic research.

A reference human genome dataset of the BGISEQ-500 sequencer.

PubMed

Huang, Jie; Liang, Xinming; Xuan, Yuankai; Geng, Chunyu; Li, Yuxiang; Lu, Haorong; Qu, Shoufang; Mei, Xianglin; Chen, Hongbo; Yu, Ting; Sun, Nan; Rao, Junhua; Wang, Jiahao; Zhang, Wenwei; Chen, Ying; Liao, Sha; Jiang, Hui; Liu, Xin; Yang, Zhaopeng; Mu, Feng; Gao, Shangxian

2017-05-01

BGISEQ-500 is a new desktop sequencer developed by BGI. Using DNA nanoball and combinational probe anchor synthesis developed from Complete Genomics™ sequencing technologies, it generates short reads at a large scale. Here, we present the first human whole-genome sequencing dataset of BGISEQ-500. The dataset was generated by sequencing the widely used cell line HG001 (NA12878) in two sequencing runs of paired-end 50 bp (PE50) and two sequencing runs of paired-end 100 bp (PE100). We also include examples of the raw images from the sequencer for reference. Finally, we identified variations using this dataset, estimated the accuracy of the variations, and compared to that of the variations identified from similar amounts of publicly available HiSeq2500 data. We found similar single nucleotide polymorphism (SNP) detection accuracy for the BGISEQ-500 PE100 data (false positive rate [FPR] = 0.00020%, sensitivity = 96.20%) compared to the PE150 HiSeq2500 data (FPR = 0.00017%, sensitivity = 96.60%) better SNP detection accuracy than the PE50 data (FPR = 0.0006%, sensitivity = 94.15%). But for insertions and deletions (indels), we found lower accuracy for BGISEQ-500 data (FPR = 0.00069% and 0.00067% for PE100 and PE50 respectively, sensitivity = 88.52% and 70.93%) than the HiSeq2500 data (FPR = 0.00032%, sensitivity = 96.28%). Our dataset can serve as the reference dataset, providing basic information not just for future development, but also for all research and applications based on the new sequencing platform. © The Authors 2017. Published by Oxford University Press.

Modular probes for enriching and detecting complex nucleic acid sequences

NASA Astrophysics Data System (ADS)

Wang, Juexiao Sherry; Yan, Yan Helen; Zhang, David Yu

2017-12-01

Complex DNA sequences are difficult to detect and profile, but are important contributors to human health and disease. Existing hybridization probes lack the capability to selectively bind and enrich hypervariable, long or repetitive sequences. Here, we present a generalized strategy for constructing modular hybridization probes (M-Probes) that overcomes these challenges. We demonstrate that M-Probes can tolerate sequence variations of up to 7 nt at prescribed positions while maintaining single nucleotide sensitivity at other positions. M-Probes are also shown to be capable of sequence-selectively binding a continuous DNA sequence of more than 500 nt. Furthermore, we show that M-Probes can detect genes with triplet repeats exceeding a programmed threshold. As a demonstration of this technology, we have developed a hybrid capture method to determine the exact triplet repeat expansion number in the Huntington's gene of genomic DNA using quantitative PCR.

Using Single-Nucleotide Polymorphisms To Discriminate Disease-Associated from Carried Genomes of Neisseria meningitidis▿†

PubMed Central

Katz, Lee S.; Sharma, Nitya V.; Harcourt, Brian H.; Thomas, Jennifer Dolan; Wang, Xin; Mayer, Leonard W.; Jordan, I. King

2011-01-01

Neisseria meningitidis is one of the main agents of bacterial meningitis, causing substantial morbidity and mortality worldwide. However, most of the time N. meningitidis is carried as a commensal not associated with invasive disease. The genomic basis of the difference between disease-associated and carried isolates of N. meningitidis may provide critical insight into mechanisms of virulence, yet it has remained elusive. Here, we have taken a comparative genomics approach to interrogate the difference between disease-associated and carried isolates of N. meningitidis at the level of individual nucleotide variations (i.e., single nucleotide polymorphisms [SNPs]). We aligned complete genome sequences of 8 disease-associated and 4 carried isolates of N. meningitidis to search for SNPs that show mutually exclusive patterns of variation between the two groups. We found 63 SNPs that distinguish the 8 disease-associated genomes from the 4 carried genomes of N. meningitidis, which is far more than can be expected by chance alone given the level of nucleotide variation among the genomes. The putative list of SNPs that discriminate between disease-associated and carriage genomes may be expected to change with increased sampling or changes in the identities of the isolates being compared. Nevertheless, we show that these discriminating SNPs are more likely to reflect phenotypic differences than shared evolutionary history. Discriminating SNPs were mapped to genes, and the functions of the genes were evaluated for possible connections to virulence mechanisms. A number of overrepresented functional categories related to virulence were uncovered among SNP-associated genes, including genes related to the category “symbiosis, encompassing mutualism through parasitism.” PMID:21622743

Single-Cell Whole-Genome Amplification and Sequencing: Methodology and Applications.

PubMed

Huang, Lei; Ma, Fei; Chapman, Alec; Lu, Sijia; Xie, Xiaoliang Sunney

2015-01-01

We present a survey of single-cell whole-genome amplification (WGA) methods, including degenerate oligonucleotide-primed polymerase chain reaction (DOP-PCR), multiple displacement amplification (MDA), and multiple annealing and looping-based amplification cycles (MALBAC). The key parameters to characterize the performance of these methods are defined, including genome coverage, uniformity, reproducibility, unmappable rates, chimera rates, allele dropout rates, false positive rates for calling single-nucleotide variations, and ability to call copy-number variations. Using these parameters, we compare five commercial WGA kits by performing deep sequencing of multiple single cells. We also discuss several major applications of single-cell genomics, including studies of whole-genome de novo mutation rates, the early evolution of cancer genomes, circulating tumor cells (CTCs), meiotic recombination of germ cells, preimplantation genetic diagnosis (PGD), and preimplantation genomic screening (PGS) for in vitro-fertilized embryos.

Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

PubMed Central

Hall, L; Laird, J E; Craig, R K

1984-01-01

Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

In silico Derivation of HLA-Specific Alloreactivity Potential from Whole Exome Sequencing of Stem-Cell Transplant Donors and Recipients: Understanding the Quantitative Immunobiology of Allogeneic Transplantation

PubMed Central

Jameson-Lee, Max; Koparde, Vishal; Griffith, Phil; Scalora, Allison F.; Sampson, Juliana K.; Khalid, Haniya; Sheth, Nihar U.; Batalo, Michael; Serrano, Myrna G.; Roberts, Catherine H.; Hess, Michael L.; Buck, Gregory A.; Neale, Michael C.; Manjili, Masoud H.; Toor, Amir Ahmed

2014-01-01

Donor T-cell mediated graft versus host (GVH) effects may result from the aggregate alloreactivity to minor histocompatibility antigens (mHA) presented by the human leukocyte antigen (HLA) molecules in each donor–recipient pair undergoing stem-cell transplantation (SCT). Whole exome sequencing has previously demonstrated a large number of non-synonymous single nucleotide polymorphisms (SNP) present in HLA-matched recipients of SCT donors (GVH direction). The nucleotide sequence flanking each of these SNPs was obtained and the amino acid sequence determined. All the possible nonameric peptides incorporating the variant amino acid resulting from these SNPs were interrogated in silico for their likelihood to be presented by the HLA class I molecules using the Immune Epitope Database stabilized matrix method (SMM) and NetMHCpan algorithms. The SMM algorithm predicted that a median of 18,396 peptides weakly bound HLA class I molecules in individual SCT recipients, and 2,254 peptides displayed strong binding. A similar library of presented peptides was identified when the data were interrogated using the NetMHCpan algorithm. The bioinformatic algorithm presented here demonstrates that there may be a high level of mHA variation in HLA-matched individuals, constituting a HLA-specific alloreactivity potential. PMID:25414699

In silico Derivation of HLA-Specific Alloreactivity Potential from Whole Exome Sequencing of Stem-Cell Transplant Donors and Recipients: Understanding the Quantitative Immunobiology of Allogeneic Transplantation.

PubMed

Jameson-Lee, Max; Koparde, Vishal; Griffith, Phil; Scalora, Allison F; Sampson, Juliana K; Khalid, Haniya; Sheth, Nihar U; Batalo, Michael; Serrano, Myrna G; Roberts, Catherine H; Hess, Michael L; Buck, Gregory A; Neale, Michael C; Manjili, Masoud H; Toor, Amir Ahmed

2014-01-01

Donor T-cell mediated graft versus host (GVH) effects may result from the aggregate alloreactivity to minor histocompatibility antigens (mHA) presented by the human leukocyte antigen (HLA) molecules in each donor-recipient pair undergoing stem-cell transplantation (SCT). Whole exome sequencing has previously demonstrated a large number of non-synonymous single nucleotide polymorphisms (SNP) present in HLA-matched recipients of SCT donors (GVH direction). The nucleotide sequence flanking each of these SNPs was obtained and the amino acid sequence determined. All the possible nonameric peptides incorporating the variant amino acid resulting from these SNPs were interrogated in silico for their likelihood to be presented by the HLA class I molecules using the Immune Epitope Database stabilized matrix method (SMM) and NetMHCpan algorithms. The SMM algorithm predicted that a median of 18,396 peptides weakly bound HLA class I molecules in individual SCT recipients, and 2,254 peptides displayed strong binding. A similar library of presented peptides was identified when the data were interrogated using the NetMHCpan algorithm. The bioinformatic algorithm presented here demonstrates that there may be a high level of mHA variation in HLA-matched individuals, constituting a HLA-specific alloreactivity potential.

Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA.

PubMed

Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod

2016-02-01

Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili.

NEBNext Direct: A Novel, Rapid, Hybridization-Based Approach for the Capture and Library Conversion of Genomic Regions of Interest.

PubMed

Emerman, Amy B; Bowman, Sarah K; Barry, Andrew; Henig, Noa; Patel, Kruti M; Gardner, Andrew F; Hendrickson, Cynthia L

2017-07-05

Next-generation sequencing (NGS) is a powerful tool for genomic studies, translational research, and clinical diagnostics that enables the detection of single nucleotide polymorphisms, insertions and deletions, copy number variations, and other genetic variations. Target enrichment technologies improve the efficiency of NGS by only sequencing regions of interest, which reduces sequencing costs while increasing coverage of the selected targets. Here we present NEBNext Direct ® , a hybridization-based, target-enrichment approach that addresses many of the shortcomings of traditional target-enrichment methods. This approach features a simple, 7-hr workflow that uses enzymatic removal of off-target sequences to achieve a high specificity for regions of interest. Additionally, unique molecular identifiers are incorporated for the identification and filtering of PCR duplicates. The same protocol can be used across a wide range of input amounts, input types, and panel sizes, enabling NEBNext Direct to be broadly applicable across a wide variety of research and diagnostic needs. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

Whole-Genome Sequencing Reveals Genetic Variation in the Asian House Rat.

PubMed

Teng, Huajing; Zhang, Yaohua; Shi, Chengmin; Mao, Fengbiao; Hou, Lingling; Guo, Hongling; Sun, Zhongsheng; Zhang, Jianxu

2016-07-07

Whole-genome sequencing of wild-derived rat species can provide novel genomic resources, which may help decipher the genetics underlying complex phenotypes. As a notorious pest, reservoir of human pathogens, and colonizer, the Asian house rat, Rattus tanezumi, is successfully adapted to its habitat. However, little is known regarding genetic variation in this species. In this study, we identified over 41,000,000 single-nucleotide polymorphisms, plus insertions and deletions, through whole-genome sequencing and bioinformatics analyses. Moreover, we identified over 12,000 structural variants, including 143 chromosomal inversions. Further functional analyses revealed several fixed nonsense mutations associated with infection and immunity-related adaptations, and a number of fixed missense mutations that may be related to anticoagulant resistance. A genome-wide scan for loci under selection identified various genes related to neural activity. Our whole-genome sequencing data provide a genomic resource for future genetic studies of the Asian house rat species and have the potential to facilitate understanding of the molecular adaptations of rats to their ecological niches. Copyright © 2016 Teng et al.

Detection with synthetic oligonucleotide probes of nucleotide sequence variations in the genes encoding enterotoxins of Escherichia coli.

PubMed Central

Nishibuchi, M; Murakami, A; Arita, M; Jikuya, H; Takano, J; Honda, T; Miwatani, T

1989-01-01

We examined variations in the genes encoding heat-stable enterotoxin (ST) and heat-labile enterotoxin (LT) in 88 strains of Escherichia coli isolated from individuals with traveler's diarrhea to find suitable sequences for use as oligonucleotide probes. Four oligonucleotide probes of the gene encoding ST of human origin (STIb or STh), one oligonucleotide probe of the gene encoding ST of porcine origin (STIa or STp), and three oligonucleotide probes of the gene encoding LT of human origin (LTIh) were used in DNA colony hybridization tests. In 15 of 22 strains possessing the STh gene and 28 of 42 strains producing LT, the sequences of all regions tested were identical to the published sequences. One region in the STh gene examined with a 18-mer probe was relatively well conserved and was shown to be closely associated with the enterotoxicity of the E. coli strains in suckling mice. This oligonucleotide, however, hybridized with strains of Vibrio cholerae O1, V. parahaemolyticus, and Yersinia enterocolitica that gave negative results in the suckling mouse assay. PMID:2685027

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

PubMed Central

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

PubMed

Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

2014-06-01

The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

PubMed Central

Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

1982-01-01

The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

11,670 whole-genome sequences representative of the Han Chinese population from the CONVERGE project.

PubMed

Cai, Na; Bigdeli, Tim B; Kretzschmar, Warren W; Li, Yihan; Liang, Jieqin; Hu, Jingchu; Peterson, Roseann E; Bacanu, Silviu; Webb, Bradley Todd; Riley, Brien; Li, Qibin; Marchini, Jonathan; Mott, Richard; Kendler, Kenneth S; Flint, Jonathan

2017-02-14

The China, Oxford and Virginia Commonwealth University Experimental Research on Genetic Epidemiology (CONVERGE) project on Major Depressive Disorder (MDD) sequenced 11,670 female Han Chinese at low-coverage (1.7X), providing the first large-scale whole genome sequencing resource representative of the largest ethnic group in the world. Samples are collected from 58 hospitals from 23 provinces around China. We are able to call 22 million high quality single nucleotide polymorphisms (SNP) from the nuclear genome, representing the largest SNP call set from an East Asian population to date. We use these variants for imputation of genotypes across all samples, and this has allowed us to perform a successful genome wide association study (GWAS) on MDD. The utility of these data can be extended to studies of genetic ancestry in the Han Chinese and evolutionary genetics when integrated with data from other populations. Molecular phenotypes, such as copy number variations and structural variations can be detected, quantified and analysed in similar ways.

Haplotype block structure study of the CFTR gene. Most variants are associated with the M470 allele in several European populations.

PubMed

Pompei, Fiorenza; Ciminelli, Bianca Maria; Bombieri, Cristina; Ciccacci, Cinzia; Koudova, Monika; Giorgi, Silvia; Belpinati, Francesca; Begnini, Angela; Cerny, Milos; Des Georges, Marie; Claustres, Mireille; Ferec, Claude; Macek, Milan; Modiano, Guido; Pignatti, Pier Franco

2006-01-01

An average of about 1700 CFTR (cystic fibrosis transmembrane conductance regulator) alleles from normal individuals from different European populations were extensively screened for DNA sequence variation. A total of 80 variants were observed: 61 coding SNSs (results already published), 13 noncoding SNSs, three STRs, two short deletions, and one nucleotide insertion. Eight DNA variants were classified as non-CF causing due to their high frequency of occurrence. Through this survey the CFTR has become the most exhaustively studied gene for its coding sequence variability and, though to a lesser extent, for its noncoding sequence variability as well. Interestingly, most variation was associated with the M470 allele, while the V470 allele showed an 'extended haplotype homozygosity' (EHH). These findings make us suggest a role for selection acting either on the M470V itself or through an hitchhiking mechanism involving a second site. The possible ancient origin of the V allele in an 'out of Africa' time frame is discussed.

A gene variation of 14-3-3 zeta isoform in rat hippocampus.

PubMed

Murakami, K; Situ, S Y; Eshete, F

1996-11-14

A variant form of 14-3-3 zeta was isolated from the rat hippocampal cDNA library. The cloned cDNA is 1687 bp in length and it contains an entire ORF (nt = 63-797) with 245 amino acids that is characteristic to 14-3-3 zeta subtype. By comparing with reported sequences of 14-3-3 zeta, we found three nucleotide substitutions within the coding sequence in our clone; C<-->T transition at nt = 325 and G<-->C transversions at nt = 387 and 388. Both are missense mutations, leading ACG (Thr) to ATG (Met) and CGT (Arg) to GCT (Ala) conversions at residue 88 and 109, respectively. Our results show that at least three different genetic variants of 14-3-3 zeta are present in rat species which results in protein variations. Such mutation in the amino acid sequence is an important indication of the diverse functions of this protein and may also contribute to the recent contradictory observations regarding the role of the 14-3-3 zeta subtype.

Markov-modulated Markov chains and the covarion process of molecular evolution.

PubMed

Galtier, N; Jean-Marie, A

2004-01-01

The covarion (or site specific rate variation, SSRV) process of biological sequence evolution is a process by which the evolutionary rate of a nucleotide/amino acid/codon position can change in time. In this paper, we introduce time-continuous, space-discrete, Markov-modulated Markov chains as a model for representing SSRV processes, generalizing existing theory to any model of rate change. We propose a fast algorithm for diagonalizing the generator matrix of relevant Markov-modulated Markov processes. This algorithm makes phylogeny likelihood calculation tractable even for a large number of rate classes and a large number of states, so that SSRV models become applicable to amino acid or codon sequence datasets. Using this algorithm, we investigate the accuracy of the discrete approximation to the Gamma distribution of evolutionary rates, widely used in molecular phylogeny. We show that a relatively large number of classes is required to achieve accurate approximation of the exact likelihood when the number of analyzed sequences exceeds 20, both under the SSRV and among site rate variation (ASRV) models.

High-throughput multiplex HLA-typing by ligase detection reaction (LDR) and universal array (UA) approach.

PubMed

Consolandi, Clarissa

2009-01-01

One major goal of genetic research is to understand the role of genetic variation in living systems. In humans, by far the most common type of such variation involves differences in single DNA nucleotides, and is thus termed single nucleotide polymorphism (SNP). The need for improvement in throughput and reliability of traditional techniques makes it necessary to develop new technologies. Thus the past few years have witnessed an extraordinary surge of interest in DNA microarray technology. This new technology offers the first great hope for providing a systematic way to explore the genome. It permits a very rapid analysis of thousands genes for the purpose of gene discovery, sequencing, mapping, expression, and polymorphism detection. We generated a series of analytical tools to address the manufacturing, detection and data analysis components of a microarray experiment. In particular, we set up a universal array approach in combination with a PCR-LDR (polymerase chain reaction-ligation detection reaction) strategy for allele identification in the HLA gene.

Cross-host evolution of severe acute respiratory syndrome coronavirus in palm civet and human

PubMed Central

Song, Huai-Dong; Tu, Chang-Chun; Zhang, Guo-Wei; Wang, Sheng-Yue; Zheng, Kui; Lei, Lian-Cheng; Chen, Qiu-Xia; Gao, Yu-Wei; Zhou, Hui-Qiong; Xiang, Hua; Zheng, Hua-Jun; Chern, Shur-Wern Wang; Cheng, Feng; Pan, Chun-Ming; Xuan, Hua; Chen, Sai-Juan; Luo, Hui-Ming; Zhou, Duan-Hua; Liu, Yu-Fei; He, Jian-Feng; Qin, Peng-Zhe; Li, Ling-Hui; Ren, Yu-Qi; Liang, Wen-Jia; Yu, Ye-Dong; Anderson, Larry; Wang, Ming; Xu, Rui-Heng; Wu, Xin-Wei; Zheng, Huan-Ying; Chen, Jin-Ding; Liang, Guodong; Gao, Yang; Liao, Ming; Fang, Ling; Jiang, Li-Yun; Li, Hui; Chen, Fang; Di, Biao; He, Li-Juan; Lin, Jin-Yan; Tong, Suxiang; Kong, Xiangang; Du, Lin; Hao, Pei; Tang, Hua; Bernini, Andrea; Yu, Xiao-Jing; Spiga, Ottavia; Guo, Zong-Ming; Pan, Hai-Yan; He, Wei-Zhong; Manuguerra, Jean-Claude; Fontanet, Arnaud; Danchin, Antoine; Niccolai, Neri; Li, Yi-Xue; Wu, Chung-I; Zhao, Guo-Ping

2005-01-01

The genomic sequences of severe acute respiratory syndrome coronaviruses from human and palm civet of the 2003/2004 outbreak in the city of Guangzhou, China, were nearly identical. Phylogenetic analysis suggested an independent viral invasion from animal to human in this new episode. Combining all existing data but excluding singletons, we identified 202 single-nucleotide variations. Among them, 17 are polymorphic in palm civets only. The ratio of nonsynonymous/synonymous nucleotide substitution in palm civets collected 1 yr apart from different geographic locations is very high, suggesting a rapid evolving process of viral proteins in civet as well, much like their adaptation in the human host in the early 2002–2003 epidemic. Major genetic variations in some critical genes, particularly the Spike gene, seemed essential for the transition from animal-to-human transmission to human-to-human transmission, which eventually caused the first severe acute respiratory syndrome outbreak of 2002/2003. PMID:15695582

Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany.

PubMed

Hernández-Frederick, C J; Cereb, N; Giani, A S; Ruppel, J; Maraszek, A; Pingel, J; Sauter, J; Schmidt, A H; Yang, S Y

2016-01-01

We characterized 549 new human leukocyte antigen (HLA) class I and class II alleles found in newly registered stem cell donors as a result of high-throughput HLA typing. New alleles include 101 HLA-A, 132 HLA-B, 105 HLA-C, 2 HLA-DRB1, 89 HLA-DQB1 and 120 HLA-DPB1 alleles. Mainly, new alleles comprised single nucleotide variations when compared with homologous sequences. We identified nonsynonymous nucleotide mutations in 70.7% of all new alleles, synonymous variations in 26.4% and nonsense substitutions in 2.9% (null alleles). Some new alleles (55, 10.0%) were found multiple times, HLA-DPB1 alleles being the most frequent among these. Furthermore, as several new alleles were identified in individuals from ethnic minority groups, the relevance of recruiting donors belonging to such groups and the importance of ethnicity data collection in donor centers and registries is highlighted. © 2015 The Authors. HLA published by John Wiley & Sons Ltd.

Molecular variation and distribution of Anopheles fluviatilis (Diptera: Culicidae) complex in Iran.

PubMed

Naddaf, Saied Reza; Razavi, Mohammad Reza; Bahramali, Golnaz

2010-09-01

Anopheles fluviatilis James (Diptera: Culicidae) is one of the known malaria vectors in south and southeastern Iran. Earlier ITS2 sequences analysis of specimens from Iran demonstrated only a single genotype that was identical to species Y in India, which is also the same as species T. We identified 2 haplotypes in the An. fluviatilis populations of Iran based on differences in nucleotide sequences of D3 domain of the 28S locus of ribosomal DNA (rDNA). Comparison of sequence data from 44 Iranian specimens with those publicly available in the Genbank database showed that all of the 28S-D3 sequences from Kazeroun and Khesht regions in Fars Province were identical to the database entry representing species U in India. In other regions, all the individuals showed heterozygosity at the single nucleotide position, which identifies species U and T. It is argued that the 2 species may co-occur in some regions and hybridize; however, the heterozygosity in the 28S-D3 locus was not reflected in ITS2 sequences and this locus for all individuals was identical to species T. This study shows that in a newly diverged species, like members of An. fluviatilis complex, a single molecular marker may not be sufficiently discriminatory to identify all the taxa over a vast geographical area. In addition, other molecular markers may provide more reliable information for species discrimination.

Complete mitochondrial genome sequence of black mustard (Brassica nigra; BB) and comparison with Brassica oleracea (CC) and Brassica carinata (BBCC).

PubMed

Yamagishi, Hiroshi; Tanaka, Yoshiyuki; Terachi, Toru

2014-11-01

Crop species of Brassica (Brassicaceae) consist of three monogenomic species and three amphidiploid species resulting from interspecific hybridizations among them. Until now, mitochondrial genome sequences were available for only five of these species. We sequenced the mitochondrial genome of the sixth species, Brassica nigra (nuclear genome constitution BB), and compared it with those of Brassica oleracea (CC) and Brassica carinata (BBCC). The genome was assembled into a 232 145 bp circular sequence that is slightly larger than that of B. oleracea (219 952 bp). The genome of B. nigra contained 33 protein-coding genes, 3 rRNA genes, and 17 tRNA genes. The cox2-2 gene present in B. oleracea was absent in B. nigra. Although the nucleotide sequences of 52 genes were identical between B. nigra and B. carinata, the second exon of rps3 showed differences including an insertion/deletion (indel) and nucleotide substitutions. A PCR test to detect the indel revealed intraspecific variation in rps3, and in one line of B. nigra it amplified a DNA fragment of the size expected for B. carinata. In addition, the B. carinata lines tested here produced DNA fragments of the size expected for B. nigra. The results indicate that at least two mitotypes of B. nigra were present in the maternal parents of B. carinata.

Simple Sequence Repeats in Escherichia coli: Abundance, Distribution, Composition, and Polymorphism

PubMed Central

Gur-Arie, Riva; Cohen, Cyril J.; Eitan, Yuval; Shelef, Leora; Hallerman, Eric M.; Kashi, Yechezkel

2000-01-01

Computer-based genome-wide screening of the DNA sequence of Escherichia coli strain K12 revealed tens of thousands of tandem simple sequence repeat (SSR) tracts, with motifs ranging from 1 to 6 nucleotides. SSRs were well distributed throughout the genome. Mononucleotide SSRs were over-represented in noncoding regions and under-represented in open reading frames (ORFs). Nucleotide composition of mono- and dinucleotide SSRs, both in ORFs and in noncoding regions, differed from that of the genomic region in which they occurred, with 93% of all mononucleotide SSRs proving to be of A or T. Computer-based analysis of the fine position of every SSR locus in the noncoding portion of the genome relative to downstream ORFs showed SSRs located in areas that could affect gene regulation. DNA sequences at 14 arbitrarily chosen SSR tracts were compared among E. coli strains. Polymorphisms of SSR copy number were observed at four of seven mononucleotide SSR tracts screened, with all polymorphisms occurring in noncoding regions. SSR polymorphism could prove important as a genome-wide source of variation, both for practical applications (including rapid detection, strain identification, and detection of loci affecting key phenotypes) and for evolutionary adaptation of microbes.[The sequence data described in this paper have been submitted to the GenBank data library under accession numbers AF209020–209030 and AF209508–209518.] PMID:10645951

Multiple-strand displacement and identification of single nucleotide polymorphisms as markers of genotypic variation of Pasteuria penetrans biotypes infecting root-knot nematodes.

PubMed

Nong, Guang; Chow, Virginia; Schmidt, Liesbeth M; Dickson, Don W; Preston, James F

2007-08-01

Pasteuria species are endospore-forming obligate bacterial parasites of soil-inhabiting nematodes and water-inhabiting cladocerans, e.g. water fleas, and are closely related to Bacillus spp. by 16S rRNA gene sequence. As naturally occurring bacteria, biotypes of Pasteuria penetrans are attractive candidates for the biocontrol of various Meloidogyne spp. (root-knot nematodes). Failure to culture these bacteria outside their hosts has prevented isolation of genomic DNA in quantities sufficient for identification of genes associated with host recognition and virulence. We have applied multiple-strand displacement amplification (MDA) to generate DNA for comparative genomics of biotypes exhibiting different host preferences. Using the genome of Bacillus subtilis as a paradigm, MDA allowed quantitative detection and sequencing of 12 marker genes from 2000 cells. Meloidogyne spp. infected with P. penetrans P20 or B4 contained single nucleotide polymorphisms (SNPs) in the spoIIAB gene that did not change the amino acid sequence, or that substituted amino acids with similar chemical properties. Individual nematodes infected with P. penetrans P20 or B4 contained SNPs in the spoIIAB gene sequenced in MDA-generated products. Detection of SNPs in the spoIIAB gene in a nematode indicates infection by more than one genotype, supporting the need to sequence genomes of Pasteuria spp. derived from single spore isolates.

Determination of Trichuris skrjabini by sequencing of the ITS1-5.8S-ITS2 segment of the ribosomal DNA: comparative molecular study of different species of trichurids.

PubMed

Cutillas, C; Oliveros, R; de Rojas, M; Guevara, D C

2004-06-01

Adults of Trichuris skrjahini have been isolated from the cecum of caprine hosts (Capra hircus), Trichuris ovis and Trichuris globulosa from Ovis aries (sheep) and C. hircus (goats), and Trichuris leporis from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and the ITS1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced by polymerase chain reaction (PCR) techniques. The ITS1 of T. skrjabini, T. ovis, T. globulosa, and T. leporis was 495, 757, 757, and 536 nucleotides in length, respectively, and had G + C contents of 59.6, 58.7, 58.7, and 60.8%, respectively. Intraindividual variation was detected in the ITSI sequences of the 4 species. Furthermore, the 5.8S sequences of T. skrjabini, T. ovis, T. globulosa, and T. leporis were compared. A total of 157, 152, 153, and 157 nucleotides in length was observed in the 5.8S sequences of these 4 species, respectively. There were no sequence differences of ITS1 and 5.8S products between T. ovis and T. globulosa. Nevertheless, clear differences were detected between the ITS1 sequences of T. skrjabini, T. ovis, T. leporis, Trichuris muris, and T. arvicolae. The ITS2 fragment from the rDNA of T. skrjabini was sequenced. A comparative study of the ITS2 sequence of T. skrjabini with the previously published ITS2 sequence data of T. ovis, T. leporis, T. muris, and T. arvicolae suggested that the combined use of sequence data from both spacers would be useful in the molecular characterization of trichurid parasites.

NCBI Reference Sequence (RefSeq): a curated non-redundant sequence database of genomes, transcripts and proteins

PubMed Central

Pruitt, Kim D.; Tatusova, Tatiana; Maglott, Donna R.

2005-01-01

The National Center for Biotechnology Information (NCBI) Reference Sequence (RefSeq) database (http://www.ncbi.nlm.nih.gov/RefSeq/) provides a non-redundant collection of sequences representing genomic data, transcripts and proteins. Although the goal is to provide a comprehensive dataset representing the complete sequence information for any given species, the database pragmatically includes sequence data that are currently publicly available in the archival databases. The database incorporates data from over 2400 organisms and includes over one million proteins representing significant taxonomic diversity spanning prokaryotes, eukaryotes and viruses. Nucleotide and protein sequences are explicitly linked, and the sequences are linked to other resources including the NCBI Map Viewer and Gene. Sequences are annotated to include coding regions, conserved domains, variation, references, names, database cross-references, and other features using a combined approach of collaboration and other input from the scientific community, automated annotation, propagation from GenBank and curation by NCBI staff. PMID:15608248

[Progress in genetic research of human height].

PubMed

Chen, Kaixu; Wang, Weilan; Zhang, Fuchun; Zheng, Xiufen

2015-08-01

It is well known that both environmental and genetic factors contribute to adult height variation in general population. However, heritability studies have shown that the variation in height is more affected by genetic factors. Height is a typical polygenic trait which has been studied by traditional linkage analysis and association analysis to identify common DNA sequence variation associated with height, but progress has been slow. More recently, with the development of genotyping and DNA sequencing technologies, tremendous achievements have been made in genetic research of human height. Hundreds of single nucleotide polymorphisms (SNPs) associated with human height have been identified and validated with the application of genome-wide association studies (GWAS) methodology, which deepens our understanding of the genetics of human growth and development and also provides theoretic basis and reference for studying other complex human traits. In this review, we summarize recent progress in genetic research of human height and discuss problems and prospects in this research area which may provide some insights into future genetic studies of human height.

Next-generation genomic shotgun sequencing indicates greater genetic variability in the mitochondria of Hypophthalmichthys molitrix relative to H. nobilis from the Mississippi River, USA and provides tools for research and detection

USGS Publications Warehouse

Miller, John J; Eackles, Michael S.; Stauffer, Jay R; King, Timothy L.

2015-01-01

We characterized variation within the mitochondrial genomes of the invasive silver carp (Hypophthalmichthys molitrix) and bighead carp (H. nobilis) from the Mississippi River drainage by mapping our Next-Generation sequences to their publicly available genomes. Variant detection resulted in 338 single-nucleotide polymorphisms for H. molitrix and 39 for H. nobilis. The much greater genetic variation in H. molitrix mitochondria relative to H. nobilis may be indicative of a greater North American female effective population size of the former. When variation was quantified by gene, many tRNA loci appear to have little or no variability based on our results whereas protein-coding regions were more frequently polymorphic. These results provide biologists with additional regions of DNA to be used as markers to study the invasion dynamics of these species.

Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

PubMed

Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

2014-11-01

As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

DOEpatents

Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

1999-01-19

The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

The use of sequence-based SSR mining for the development of a vast collection of microsatellites in Aquilegia Formosa

Treesearch

Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet

2014-01-01

Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...

Identification of single-nucleotide polymorphisms of the prion protein gene in sika deer (Cervus nippon laiouanus)

PubMed Central

Jeong, Hyun-Jeong; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Kim, Bo-Sook; Rho, Jung-Rae; Yoo, Mi-Hyun; Jeong, Byung-Hoon; Kim, Yong-Sun

2007-01-01

Polymorphisms of the prion protein gene (PRNP) have been detected in several cervid species. In order to confirm the genetic variations, this study examined the DNA sequences of the PRNP obtained from 33 captive sika deer (Cervus nippon laiouanus) in Korea. A total of three single-nucleotide polymorphisms (SNPs) at codons 100, 136 and 226 in the PRNP of the sika deer were identified. The polymorphic site located at codon 100 has not been reported. The SNPs detected at codons 100 and 226 induced amino acid substitutions. The SNP at codon 136 was a silent mutation that does not induce any amino acid change. The genotype and allele frequencies were determined for each of the SNPs. PMID:17679779

Genetic structure of Plasmodium vivax using the merozoite surface protein 1 icb5-6 fragment reveals new hybrid haplotypes in southern Mexico

PubMed Central

2014-01-01

Background Plasmodium vivax is a protozoan parasite with an extensive worldwide distribution, being highly prevalent in Asia as well as in Mesoamerica and South America. In southern Mexico, P. vivax transmission has been endemic and recent studies suggest that these parasites have unique biological and genetic features. The msp1 gene has shown high rate of nucleotide substitutions, deletions, insertions, and its mosaic structure reveals frequent events of recombination, maybe between highly divergent parasite isolates. Methods The nucleotide sequence variation in the polymorphic icb5-6 fragment of the msp1 gene of Mexican and worldwide isolates was analysed. To understand how genotype diversity arises, disperses and persists in Mexico, the genetic structure and genealogical relationships of local isolates were examined. To identify new sequence hybrids and their evolutionary relationships with other P. vivax isolates circulating worldwide two haplotype networks were constructed questioning that two portions of the icb5-6 have different evolutionary history. Results Twelve new msp1 icb5-6 haplotypes of P. vivax from Mexico were identified. These nucleotide sequences show mosaic structure comprising three partially conserved and two variable subfragments and resulted into five different sequence types. The variable subfragment sV1 has undergone recombination events and resulted in hybrid sequences and the haplotype network allocated the Mexican haplotypes to three lineages, corresponding to the Sal I and Belem types, and other more divergent group. In contrast, the network from icb5-6 fragment but not sV1 revealed that the Mexican haplotypes belong to two separate lineages, none of which are closely related to Sal I or Belem sequences. Conclusions These results suggest that the new hybrid haplotypes from southern Mexico were the result of at least three different recombination events. These rearrangements likely resulted from the recombination between haplotypes of highly divergent lineages that are frequently distributed in South America and Asia and diversified rapidly. PMID:24472213

Quantitative genetic bases of anthocyanin variation in grape (Vitis vinifera L. ssp. sativa) berry: a quantitative trait locus to quantitative trait nucleotide integrated study.

PubMed

Fournier-Level, Alexandre; Le Cunff, Loïc; Gomez, Camila; Doligez, Agnès; Ageorges, Agnès; Roux, Catherine; Bertrand, Yves; Souquet, Jean-Marc; Cheynier, Véronique; This, Patrice

2009-11-01

The combination of QTL mapping studies of synthetic lines and association mapping studies of natural diversity represents an opportunity to throw light on the genetically based variation of quantitative traits. With the positional information provided through quantitative trait locus (QTL) mapping, which often leads to wide intervals encompassing numerous genes, it is now feasible to directly target candidate genes that are likely to be responsible for the observed variation in completely sequenced genomes and to test their effects through association genetics. This approach was performed in grape, a newly sequenced genome, to decipher the genetic architecture of anthocyanin content. Grapes may be either white or colored, ranging from the lightest pink to the darkest purple tones according to the amount of anthocyanin accumulated in the berry skin, which is a crucial trait for both wine quality and human nutrition. Although the determinism of the white phenotype has been fully identified, the genetic bases of the quantitative variation of anthocyanin content in berry skin remain unclear. A single QTL responsible for up to 62% of the variation in the anthocyanin content was mapped on a Syrah x Grenache F(1) pseudo-testcross. Among the 68 unigenes identified in the grape genome within the QTL interval, a cluster of four Myb-type genes was selected on the basis of physiological evidence (VvMybA1, VvMybA2, VvMybA3, and VvMybA4). From a core collection of natural resources (141 individuals), 32 polymorphisms revealed significant association, and extended linkage disequilibrium was observed. Using a multivariate regression method, we demonstrated that five polymorphisms in VvMybA genes except VvMybA4 (one retrotransposon, three single nucleotide polymorphisms and one 2-bp insertion/deletion) accounted for 84% of the observed variation. All these polymorphisms led to either structural changes in the MYB proteins or differences in the VvMybAs promoters. We concluded that the continuous variation in anthocyanin content in grape was explained mainly by a single gene cluster of three VvMybA genes. The use of natural diversity helped to reduce one QTL to a set of five quantitative trait nucleotides and gave a clear picture of how isogenes combined their effects to shape grape color. Such analysis also illustrates how isogenes combine their effect to shape a complex quantitative trait and enables the definition of markers directly targeted for upcoming breeding programs.

Switchgrass ubiquitin promoter (PVUBI2) and uses thereof

DOEpatents

Stewart, C. Neal; Mann, David George James

2013-12-10

The subject application provides polynucleotides, compositions thereof and methods for regulating gene expression in a plant. Polynucleotides disclosed herein comprise novel sequences for a promoter isolated from Panicum virgatum (switchgrass) that initiates transcription of an operably linked nucleotide sequence. Thus, various embodiments of the invention comprise the nucleotide sequence of SEQ ID NO: 2 or fragments thereof comprising nucleotides 1 to 692 of SEQ ID NO: 2 that are capable of driving the expression of an operably linked nucleic acid sequence.

A set of plastid loci for use in multiplex fragment length genotyping for intraspecific variation in Pinus (Pinaceae)1

PubMed Central

Wofford, Austin M.; Finch, Kristen; Bigott, Adam; Willyard, Ann

2014-01-01

• Premise of the study: Recently released Pinus plastome sequences support characterization of 15 plastid simple sequence repeat (cpSSR) loci originally published for P. contorta and P. thunbergii. This allows selection of loci for single-tube PCR multiplexed genotyping in any subsection of the genus. • Methods: Unique placement of primers and primer conservation across the genus were investigated, and a set of six loci were selected for single-tube multiplexing. We compared interspecific variation between cpSSRs and nucleotide sequences of ycf1 and tested intraspecific variation for cpSSRs using 911 samples in the P. ponderosa species complex. • Results: The cpSSR loci contain mononucleotide and complex repeats with additional length variation in flanking regions. They are not located in hypervariable regions, and most primers are conserved across the genus. A single PCR per sample multiplexed for six loci yielded 45 alleles in 911 samples. • Discussion: The protocol allows efficient genotyping of many samples. The cpSSR loci are too variable for Pinus phylogenies but are useful for the study of genetic structure within and among populations. The multiplex method could easily be extended to other plant groups by choosing primers for cpSSR loci in a plastome alignment for the target group. PMID:25202625

Genotyping of Chromobacterium violaceum isolates by recA PCR-RFLP analysis.

PubMed

Scholz, Holger Christian; Witte, Angela; Tomaso, Herbert; Al Dahouk, Sascha; Neubauer, Heinrich

2005-03-15

Intraspecies variation of Chromobacterium violaceum was examined by comparative sequence - and by restriction fragment length polymorphism analysis of the recombinase A gene (recA-PCR-RFLP). Primers deduced from the known recA gene sequence of the type strain C. violaceum ATCC 12472(T) allowed the specific amplification of a 1040bp recA fragment from each of the 13 C. violaceum strains investigated, whereas other closely related organisms tested negative. HindII-PstI-recA RFLP analysis generated from 13 representative C. violaceum strains enabled us to identify at least three different genospecies. In conclusion, analysis of the recA gene provides a rapid and robust nucleotide sequence-based approach to specifically identify and classify C. violaceum on genospecies level.

Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

USDA-ARS?s Scientific Manuscript database

Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

Extension of the COG and arCOG databases by amino acid and nucleotide sequences

PubMed Central

Meereis, Florian; Kaufmann, Michael

2008-01-01

Background The current versions of the COG and arCOG databases, both excellent frameworks for studies in comparative and functional genomics, do not contain the nucleotide sequences corresponding to their protein or protein domain entries. Results Using sequence information obtained from GenBank flat files covering the completely sequenced genomes of the COG and arCOG databases, we constructed NUCOCOG (nucleotide sequences containing COG databases) as an extended version including all nucleotide sequences and in addition the amino acid sequences originally utilized to construct the current COG and arCOG databases. We make available three comprehensive single XML files containing the complete databases including all sequence information. In addition, we provide a web interface as a utility suitable to browse the NUCOCOG database for sequence retrieval. The database is accessible at . Conclusion NUCOCOG offers the possibility to analyze any sequence related property in the context of the COG and arCOG framework simply by using script languages such as PERL applied to a large but single XML document. PMID:19014535

DNA Nucleotide Sequence Restricted by the RI Endonuclease

PubMed Central

Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

1972-01-01

The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

The genetic diversity and complete genome analysis of two novel porcine deltacoronavirus isolates in Thailand in 2015.

PubMed

Lorsirigool, Athip; Saeng-Chuto, Kepalee; Madapong, Adthakorn; Temeeyasen, Gun; Tripipat, Thitima; Kaewprommal, Pavita; Tantituvanont, Angkana; Piriyapongsa, Jittima; Nilubol, Dachrit

2017-04-01

Porcine deltacoronavirus (PDCoV) was identified in intestinal samples collected from piglets with diarrhea in Thailand in 2015. Two Thai PDCoV isolates, P23_15_TT_1115 and P24_15_NT1_1215, were isolated and identified. The full-length genome sequences of the P23_15_TT_1115 and P24_15_NT1_1215 isolates were 25,404 and 25,407 nucleotides in length, respectively, which were relatively shorter than that of US and China PDCoV. The phylogenetic analysis based on the full-length genome demonstrated that Thai PDCoV isolates form a new cluster separated from US and China PDCoV but relatively were more closely related to China PDCoV than US isolates. The genetic analyses demonstrated that Thai PDCoVs have 97.0-97.8 and 92.2-94.0% similarities with China PDCoV at nucleotide and amino acid levels, respectively, but share 97.1-97.3 and 92.5-93.0 similarity with US PDCoV at the nucleotide and amino acid levels, respectively. Thai PDCoV possesses two discontinuous deletions of five amino acids in ORF1a/b region. One additional deletion of one amino acid was identified in P23_15_TT_1115. The variation analyses demonstrated that six regions (nt 1317-1436, 2997-3096, 19,737-19,836, 20,277-20,376, 21,177-21,276, and 22,371-22,416) in ORF1a/b and spike genes exhibit high sequence variation between Thai and other PDCoV. The analyses of amino acid changes suggested that they could potentially be from different lineages.

Outbreak of poliomyelitis in Finland in 1984-85 - Re-analysis of viral sequences using the current standard approach.

PubMed

Simonen, Marja-Leena; Roivainen, Merja; Iber, Jane; Burns, Cara; Hovi, Tapani

2010-01-01

In 1984, a wild type 3 poliovirus (PV3/FIN84) spread all over Finland causing nine cases of paralytic poliomyelitis and one case of aseptic meningitis. The outbreak was ended in 1985 with an intensive vaccination campaign. By limited sequence comparison with previously isolated PV3 strains, closest relatives of PV3/FIN84 were found among strains circulating in the Mediterranean region. Now we wanted to reanalyse the relationships using approaches currently exploited in poliovirus surveillance. Cell lysates of 22 strains isolated during the outbreak and stored frozen were subjected to RT-PCR amplification in three genomic regions without prior subculture. Sequences of the entire VP1 coding region, 150 nucleotides in the VP1-2A junction, most of the 5' non-coding region, partial sequences of the 3D RNA polymerase coding region and partial 3' non-coding region were compared within the outbreak and with sequences available in data banks. In addition, complete nucleotide sequences were obtained for 2 strains isolated from two different cases of disease during the outbreak. The results confirmed the previously described wide intraepidemic variation of the strains, including amino acid substitutions in antigenic sites, as well as the likely Mediterranean region origin of the strains. Simplot and bootscanning analyses of the complete genomes indicated complicated evolutionary history of the non-capsid coding regions of the genome suggesting several recombinations with different HEV-C viruses in the past.

Modeling the Association of Space, Time, and Host Species with Variation of the HA, NA, and NS Genes of H5N1 Highly Pathogenic Avian Influenza Viruses Isolated from Birds in Romania in 2005–2007

PubMed Central

Alkhamis, Mohammad; Perez, Andres; Batey, Nicole; Howard, Wendy; Baillie, Greg; Watson, Simon; Franz, Stephanie; Focosi-Snyman, Raffaella; Onita, Iuliana; Cioranu, Raluca; Turcitu, Mihai; Kellam, Paul; Brown, Ian H.; Breed, Andrew C.

2014-01-01

SUMMARY Molecular characterization studies of a diverse collection of avian influenza viruses (AIVs) have demonstrated that AIVs’ greatest genetic variability lies in the HA, NA, and NS genes. The objective here was to quantify the association between geographical locations, periods of time, and host species and pairwise nucleotide variation in the HA, NA, and NS genes of 70 isolates of H5N1 highly pathogenic avian influenza virus (HPAIV) collected from October 2005 to December 2007 from birds in Romania. A mixed-binomial Bayesian regression model was used to quantify the probability of nucleotide variation between isolates and its association with space, time, and host species. As expected for the three target genes, a higher probability of nucleotide differences (odds ratios [ORs] > 1) was found between viruses sampled from places at greater geographical distances from each other, viruses sampled over greater periods of time, and viruses derived from different species. The modeling approach in the present study maybe useful in further understanding the molecular epidemiology of H5N1 HPAI virus in bird populations. The methodology presented here will be useful in predicting the most likely genetic distance for any of the three gene segments of viruses that have not yet been isolated or sequenced based on space, time, and host species during the course of an epidemic. PMID:24283126

Patterns of Nucleotide Diversity at the Regions Encompassing the Drosophila Insulin-Like Peptide (dilp) Genes: Demography vs. Positive Selection in Drosophila melanogaster

PubMed Central

Guirao-Rico, Sara; Aguadé, Montserrat

2013-01-01

In Drosophila, the insulin-signaling pathway controls some life history traits, such as fertility and lifespan, and it is considered to be the main metabolic pathway involved in establishing adult body size. Several observations concerning variation in body size in the Drosophila genus are suggestive of its adaptive character. Genes encoding proteins in this pathway are, therefore, good candidates to have experienced adaptive changes and to reveal the footprint of positive selection. The Drosophila insulin-like peptides (DILPs) are the ligands that trigger the insulin-signaling cascade. In Drosophila melanogaster, there are several peptides that are structurally similar to the single mammalian insulin peptide. The footprint of recent adaptive changes on nucleotide variation can be unveiled through the analysis of polymorphism and divergence. With this aim, we have surveyed nucleotide sequence variation at the dilp1-7 genes in a natural population of D. melanogaster. The comparison of polymorphism in D. melanogaster and divergence from D. simulans at different functional classes of the dilp genes provided no evidence of adaptive protein evolution after the split of the D. melanogaster and D. simulans lineages. However, our survey of polymorphism at the dilp gene regions of D. melanogaster has provided some evidence for the action of positive selection at or near these genes. The regions encompassing the dilp1-4 genes and the dilp6 gene stand out as likely affected by recent adaptive events. PMID:23308258

Modeling the association of space, time, and host species with variation of the HA, NA, and NS genes of H5N1 highly pathogenic avian influenza viruses isolated from birds in Romania in 2005-2007.

PubMed

Alkhamis, Mohammad; Perez, Andres; Batey, Nicole; Howard, Wendy; Baillie, Greg; Watson, Simon; Franz, Stephanie; Focosi-Snyman, Raffaella; Onita, Iuliana; Cioranu, Raluca; Turcitu, Mihai; Kellam, Paul; Brown, Ian H; Breed, Andrew C

2013-09-01

Molecular characterization studies of a diverse collection of avian influenza viruses (AIVs) have demonstrated that AIVs' greatest genetic variability lies in the HA, NA, and NS genes. The objective here was to quantify the association between geographical locations, periods of time, and host species and pairwise nucleotide variation in the HA, NA, and NS genes of 70 isolates of H5N1 highly pathogenic avian influenza virus (HPAIV) collected from October 2005 to December 2007 from birds in Romania. A mixed-binomial Bayesian regression model was used to quantify the probability of nucleotide variation between isolates and its association with space, time, and host species. As expected for the three target genes, a higher probability of nucleotide differences (odds ratios [ORs] > 1) was found between viruses sampled from places at greater geographical distances from each other, viruses sampled over greater periods of time, and viruses derived from different species. The modeling approach in the present study maybe useful in further understanding the molecular epidemiology of H5N1 HPAI virus in bird populations. The methodology presented here will be useful in predicting the most likely genetic distance for any of the three gene segments of viruses that have not yet been isolated or sequenced based on space, time, and host species during the course of an epidemic.

Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

PubMed Central

Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

1982-01-01

We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

The Impact of Mutation and Gene Conversion on the Local Diversification of Antigen Genes in African Trypanosomes

PubMed Central

Gjini, Erida; Haydon, Daniel T.; Barry, J. David; Cobbold, Christina A.

2012-01-01

Patterns of genetic diversity in parasite antigen gene families hold important information about their potential to generate antigenic variation within and between hosts. The evolution of such gene families is typically driven by gene duplication, followed by point mutation and gene conversion. There is great interest in estimating the rates of these processes from molecular sequences for understanding the evolution of the pathogen and its significance for infection processes. In this study, a series of models are constructed to investigate hypotheses about the nucleotide diversity patterns between closely related gene sequences from the antigen gene archive of the African trypanosome, the protozoan parasite causative of human sleeping sickness in Equatorial Africa. We use a hidden Markov model approach to identify two scales of diversification: clustering of sequence mismatches, a putative indicator of gene conversion events with other lower-identity donor genes in the archive, and at a sparser scale, isolated mismatches, likely arising from independent point mutations. In addition to quantifying the respective probabilities of occurrence of these two processes, our approach yields estimates for the gene conversion tract length distribution and the average diversity contributed locally by conversion events. Model fitting is conducted using a Bayesian framework. We find that diversifying gene conversion events with lower-identity partners occur at least five times less frequently than point mutations on variant surface glycoprotein (VSG) pairs, and the average imported conversion tract is between 14 and 25 nucleotides long. However, because of the high diversity introduced by gene conversion, the two processes have almost equal impact on the per-nucleotide rate of sequence diversification between VSG subfamily members. We are able to disentangle the most likely locations of point mutations and conversions on each aligned gene pair. PMID:22735079

Plant nitrogen regulatory P-PII genes

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2001-01-01

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the

Synthesis and evaluations of an acid-cleavable, fluorescently labeled nucleotide as a reversible terminator for DNA sequencing.

PubMed

Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng

2016-02-11

An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.

Mining sequence variations in representative polyploid sugarcane germplasm accessions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Xiping; Song, Jian; You, Qian

Sugarcane (Saccharum spp.) is one of the most important economic crops because of its high sugar production and biofuel potential. Due to the high polyploid level and complex genome of sugarcane, it has been a huge challenge to investigate genomic sequence variations, which are critical for identifying alleles contributing to important agronomic traits. In order to mine the genetic variations in sugarcane, genotyping by sequencing (GBS), was used to genotype 14 representative Saccharum complex accessions. GBS is a method to generate a large number of markers, enabled by next generation sequencing (NGS) and the genome complexity reduction using restriction enzymes.more » To use GBS for high throughput genotyping highly polyploid sugarcane, the GBS analysis pipelines in 14 Saccharum complex accessions were established by evaluating different alignment methods, sequence variants callers, and sequence depth for single nucleotide polymorphism (SNP) filtering. By using the established pipeline, a total of 76,251 non-redundant SNPs, 5642 InDels, 6380 presence/absence variants (PAVs), and 826 copy number variations (CNVs) were detected among the 14 accessions. In addition, non-reference based universal network enabled analysis kit and Stacks de novo called 34,353 and 109,043 SNPs, respectively. In the 14 accessions, the percentages of single dose SNPs ranged from 38.3% to 62.3% with an average of 49.6%, much more than the portions of multiple dosage SNPs. Concordantly called SNPs were used to evaluate the phylogenetic relationship among the 14 accessions. The results showed that the divergence time between the Erianthus genus and the Saccharum genus was more than 10 million years ago (MYA). The Saccharum species separated from their common ancestors ranging from 0.19 to 1.65 MYA. The GBS pipelines including the reference sequences, alignment methods, sequence variant callers, and sequence depth were recommended and discussed for the Saccharum complex and other related species. A large number of sequence variations were discovered in the Saccharum complex, including SNPs, InDels, PAVs, and CNVs. Genome-wide SNPs were further used to illustrate sequence features of polyploid species and demonstrated the divergence of different species in the Saccharum complex. The results of this study showed that GBS was an effective NGS-based method to discover genomic sequence variations in highly polyploid and heterozygous species.« less

Mining sequence variations in representative polyploid sugarcane germplasm accessions

DOE PAGES

Yang, Xiping; Song, Jian; You, Qian; ...

2017-08-09

Sugarcane (Saccharum spp.) is one of the most important economic crops because of its high sugar production and biofuel potential. Due to the high polyploid level and complex genome of sugarcane, it has been a huge challenge to investigate genomic sequence variations, which are critical for identifying alleles contributing to important agronomic traits. In order to mine the genetic variations in sugarcane, genotyping by sequencing (GBS), was used to genotype 14 representative Saccharum complex accessions. GBS is a method to generate a large number of markers, enabled by next generation sequencing (NGS) and the genome complexity reduction using restriction enzymes.more » To use GBS for high throughput genotyping highly polyploid sugarcane, the GBS analysis pipelines in 14 Saccharum complex accessions were established by evaluating different alignment methods, sequence variants callers, and sequence depth for single nucleotide polymorphism (SNP) filtering. By using the established pipeline, a total of 76,251 non-redundant SNPs, 5642 InDels, 6380 presence/absence variants (PAVs), and 826 copy number variations (CNVs) were detected among the 14 accessions. In addition, non-reference based universal network enabled analysis kit and Stacks de novo called 34,353 and 109,043 SNPs, respectively. In the 14 accessions, the percentages of single dose SNPs ranged from 38.3% to 62.3% with an average of 49.6%, much more than the portions of multiple dosage SNPs. Concordantly called SNPs were used to evaluate the phylogenetic relationship among the 14 accessions. The results showed that the divergence time between the Erianthus genus and the Saccharum genus was more than 10 million years ago (MYA). The Saccharum species separated from their common ancestors ranging from 0.19 to 1.65 MYA. The GBS pipelines including the reference sequences, alignment methods, sequence variant callers, and sequence depth were recommended and discussed for the Saccharum complex and other related species. A large number of sequence variations were discovered in the Saccharum complex, including SNPs, InDels, PAVs, and CNVs. Genome-wide SNPs were further used to illustrate sequence features of polyploid species and demonstrated the divergence of different species in the Saccharum complex. The results of this study showed that GBS was an effective NGS-based method to discover genomic sequence variations in highly polyploid and heterozygous species.« less

Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

PubMed Central

Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

2016-01-01

DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

Control of artefactual variation in reported inter-sample relatedness during clinical use of a Mycobacterium tuberculosis sequencing pipeline.

PubMed

Wyllie, David H; Sanderson, Nicholas; Myers, Richard; Peto, Tim; Robinson, Esther; Crook, Derrick W; Smith, E Grace; Walker, A Sarah

2018-06-06

Contact tracing requires reliable identification of closely related bacterial isolates. When we noticed the reporting of artefactual variation between M. tuberculosis isolates during routine next generation sequencing of Mycobacterium spp, we investigated its basis in 2,018 consecutive M. tuberculosis isolates. In the routine process used, clinical samples were decontaminated and inoculated into broth cultures; from positive broth cultures DNA was extracted, sequenced, reads mapped, and consensus sequences determined. We investigated the process of consensus sequence determination, which selects the most common nucleotide at each position. Having determined the high-quality read depth and depth of minor variants across 8,006 M. tuberculosis genomic regions, we quantified the relationship between the minor variant depth and the amount of non-Mycobacterial bacterial DNA, which originates from commensal microbes killed during sample decontamination. In the presence of non-Mycobacterial bacterial DNA, we found significant increases in minor variant frequencies of more than 1.5 fold in 242 regions covering 5.1% of the M. tuberculosis genome. Included within these were four high variation regions strongly influenced by the amount of non-Mycobacterial bacterial DNA. Excluding these four regions from pairwise distance comparisons reduced biologically implausible variation from 5.2% to 0% in an independent validation set derived from 226 individuals. Thus, we have demonstrated an approach identifying critical genomic regions contributing to clinically relevant artefactual variation in bacterial similarity searches. The approach described monitors the outputs of the complex multi-step laboratory and bioinformatics process, allows periodic process adjustments, and will have application to quality control of routine bacterial genomics. Copyright © 2018 Wyllie et al.

Significance of Pharmacogenetics and Pharmacogenomics Research in Current Medical Practice.

PubMed

Prakash, Swayam; Agrawal, Suraksha

2016-01-01

Human genome sequencing highlights the involvement of genetic variation towards differential risk of human diseases, presence of different phenotypes, and response to pharmacological elements. This brings the field of personalized medicine to forefront in the era of modern health care. Numerous recent approaches have shown that how variation in the genome at single nucleotide level can be used in pharmacological research. The two broad aspects that deal with pharmacological research are pharmacogenetics and pharmacogenomics. This review encompasses how these variations have created the basis of pharmacogenetics and pharmacogenomics research and important milestones accomplished in these two fields in different diseases. It further discusses at length their importance in disease diagnosis, response of drugs, and various treatment modalities on the basis of genetic determinants.

Molecular Population Genetics of Sex Determination Genes: The Transformer Gene of Drosophila Melanogaster

PubMed Central

Walthour, C. S.; Schaeffer, S. W.

1994-01-01

The transformer locus (tra) produces an RNA processing protein that alternatively splices the doublesex pre-mRNA in the sex determination hierarchy of Drosophila melanogaster. Comparisons of the tra coding region among Drosophila species have revealed an unusually high degree of divergence in synonymous and nonsynonymous sites. In this study, we tested the hypothesis that the tra gene will be polymorphic in synonymous and nonsynonymous sites within species by investigating nucleotide sequence variation in eleven tra alleles within D. melanogaster. Of the 1063 nucleotides examined, two synonymous sites were polymorphic and no amino acid variation was detected. Three statistical tests were used to detect departures from an equilibrium neutral model. Two tests failed to reject a neutral model of molecular evolution because of low statisitical power associated with low levels of genetic variation (Tajima/Fu and Li). The Hudson, Kreitman, and Aguade test rejected a neutral model when the tra region was compared to the 5'-flanking region of alcohol dehydrogenase (Adh). The lack of variability in the tra gene is consistent with a recent selective sweep of a beneficial allele in or near the tra locus. PMID:8013913

Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

USDA-ARS?s Scientific Manuscript database

: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

Novel methodologies for spectral classification of exon and intron sequences

NASA Astrophysics Data System (ADS)

Kwan, Hon Keung; Kwan, Benjamin Y. M.; Kwan, Jennifer Y. Y.

2012-12-01

Digital processing of a nucleotide sequence requires it to be mapped to a numerical sequence in which the choice of nucleotide to numeric mapping affects how well its biological properties can be preserved and reflected from nucleotide domain to numerical domain. Digital spectral analysis of nucleotide sequences unfolds a period-3 power spectral value which is more prominent in an exon sequence as compared to that of an intron sequence. The success of a period-3 based exon and intron classification depends on the choice of a threshold value. The main purposes of this article are to introduce novel codes for 1-sequence numerical representations for spectral analysis and compare them to existing codes to determine appropriate representation, and to introduce novel thresholding methods for more accurate period-3 based exon and intron classification of an unknown sequence. The main findings of this study are summarized as follows: Among sixteen 1-sequence numerical representations, the K-Quaternary Code I offers an attractive performance. A windowed 1-sequence numerical representation (with window length of 9, 15, and 24 bases) offers a possible speed gain over non-windowed 4-sequence Voss representation which increases as sequence length increases. A winner threshold value (chosen from the best among two defined threshold values and one other threshold value) offers a top precision for classifying an unknown sequence of specified fixed lengths. An interpolated winner threshold value applicable to an unknown and arbitrary length sequence can be estimated from the winner threshold values of fixed length sequences with a comparable performance. In general, precision increases as sequence length increases. The study contributes an effective spectral analysis of nucleotide sequences to better reveal embedded properties, and has potential applications in improved genome annotation.

Similar genomic proportions of copy number variation within gray wolves and modern dog breeds inferred from whole genome sequencing.

PubMed

Serres-Armero, Aitor; Povolotskaya, Inna S; Quilez, Javier; Ramirez, Oscar; Santpere, Gabriel; Kuderna, Lukas F K; Hernandez-Rodriguez, Jessica; Fernandez-Callejo, Marcos; Gomez-Sanchez, Daniel; Freedman, Adam H; Fan, Zhenxin; Novembre, John; Navarro, Arcadi; Boyko, Adam; Wayne, Robert; Vilà, Carles; Lorente-Galdos, Belen; Marques-Bonet, Tomas

2017-12-19

Whole genome re-sequencing data from dogs and wolves are now commonly used to study how natural and artificial selection have shaped the patterns of genetic diversity. Single nucleotide polymorphisms, microsatellites and variants in mitochondrial DNA have been interrogated for links to specific phenotypes or signals of domestication. However, copy number variation (CNV), despite its increasingly recognized importance as a contributor to phenotypic diversity, has not been extensively explored in canids. Here, we develop a new accurate probabilistic framework to create fine-scale genomic maps of segmental duplications (SDs), compare patterns of CNV across groups and investigate their role in the evolution of the domestic dog by using information from 34 canine genomes. Our analyses show that duplicated regions are enriched in genes and hence likely possess functional importance. We identify 86 loci with large CNV differences between dogs and wolves, enriched in genes responsible for sensory perception, immune response, metabolic processes, etc. In striking contrast to the observed loss of nucleotide diversity in domestic dogs following the population bottlenecks that occurred during domestication and breed creation, we find a similar proportion of CNV loci in dogs and wolves, suggesting that other dynamics are acting to particularly select for CNVs with potentially functional impacts. This work is the first comparison of genome wide CNV patterns in domestic and wild canids using whole-genome sequencing data and our findings contribute to study the impact of novel kinds of genetic changes on the evolution of the domestic dog.

Increased genomic prediction accuracy in wheat breeding through spatial adjustment of field trial data.

PubMed

Lado, Bettina; Matus, Ivan; Rodríguez, Alejandra; Inostroza, Luis; Poland, Jesse; Belzile, François; del Pozo, Alejandro; Quincke, Martín; Castro, Marina; von Zitzewitz, Jarislav

2013-12-09

In crop breeding, the interest of predicting the performance of candidate cultivars in the field has increased due to recent advances in molecular breeding technologies. However, the complexity of the wheat genome presents some challenges for applying new technologies in molecular marker identification with next-generation sequencing. We applied genotyping-by-sequencing, a recently developed method to identify single-nucleotide polymorphisms, in the genomes of 384 wheat (Triticum aestivum) genotypes that were field tested under three different water regimes in Mediterranean climatic conditions: rain-fed only, mild water stress, and fully irrigated. We identified 102,324 single-nucleotide polymorphisms in these genotypes, and the phenotypic data were used to train and test genomic selection models intended to predict yield, thousand-kernel weight, number of kernels per spike, and heading date. Phenotypic data showed marked spatial variation. Therefore, different models were tested to correct the trends observed in the field. A mixed-model using moving-means as a covariate was found to best fit the data. When we applied the genomic selection models, the accuracy of predicted traits increased with spatial adjustment. Multiple genomic selection models were tested, and a Gaussian kernel model was determined to give the highest accuracy. The best predictions between environments were obtained when data from different years were used to train the model. Our results confirm that genotyping-by-sequencing is an effective tool to obtain genome-wide information for crops with complex genomes, that these data are efficient for predicting traits, and that correction of spatial variation is a crucial ingredient to increase prediction accuracy in genomic selection models.

High-density single nucleotide polymorphism (SNP) array mapping in Brassica oleracea: identification of QTL associated with carotenoid variation in broccoli florets.

PubMed

Brown, Allan F; Yousef, Gad G; Chebrolu, Kranthi K; Byrd, Robert W; Everhart, Koyt W; Thomas, Aswathy; Reid, Robert W; Parkin, Isobel A P; Sharpe, Andrew G; Oliver, Rebekah; Guzman, Ivette; Jackson, Eric W

2014-09-01

A high-resolution genetic linkage map of B. oleracea was developed from a B. napus SNP array. The work will facilitate genetic and evolutionary studies in Brassicaceae. A broccoli population, VI-158 × BNC, consisting of 150 F2:3 families was used to create a saturated Brassica oleracea (diploid: CC) linkage map using a recently developed rapeseed (Brassica napus) (tetraploid: AACC) Illumina Infinium single nucleotide polymorphism (SNP) array. The map consisted of 547 non-redundant SNP markers spanning 948.1 cM across nine chromosomes with an average interval size of 1.7 cM. As the SNPs are anchored to the genomic reference sequence of the rapid cycling B. oleracea TO1000, we were able to estimate that the map provides 96 % coverage of the diploid genome. Carotenoid analysis of 2 years data identified 3 QTLs on two chromosomes that are associated with up to half of the phenotypic variation associated with the accumulation of total or individual compounds. By searching the genome sequences of the two related diploid species (B. oleracea and B. rapa), we further identified putative carotenoid candidate genes in the region of these QTLs. This is the first description of the use of a B. napus SNP array to rapidly construct high-density genetic linkage maps of one of the constituent diploid species. The unambiguous nature of these markers with regard to genomic sequences provides evidence to the nature of genes underlying the QTL, and demonstrates the value and impact this resource will have on Brassica research.

Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

USDA-ARS?s Scientific Manuscript database

The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

Native South American genetic structure and prehistory inferred from hierarchical modeling of mtDNA.

PubMed

Lewis, Cecil M; Long, Jeffrey C

2008-03-01

Genetic diversity in Native South Americans forms a complex pattern at both the continental and local levels. In comparing the West to the East, there is more variation within groups and smaller genetic distances between groups. From this pattern, researchers have proposed that there is more variation in the West and that a larger, more genetically diverse, founding population entered the West than the East. Here, we question this characterization of South American genetic variation and its interpretation. Our concern arises because others have inferred regional variation from the mean variation within local populations without taking into account the variation among local populations within the same region. This failure produces a biased view of the actual variation in the East. In this study, we analyze the mitochondrial DNA sequence between positions 16040 and 16322 of the Cambridge reference sequence. Our sample represents a total of 886 people from 27 indigenous populations from South (22), Central (3), and North America (2). The basic unit of our analyses is nucleotide identity by descent, which is easily modeled and proportional to nucleotide diversity. We use a forward modeling strategy to fit a series of nested models to identity by descent within and between all pairs of local populations. This method provides estimates of identity by descent at different levels of population hierarchy without assuming homogeneity within populations, regions, or continents. Our main discovery is that Eastern South America harbors more genetic variation than has been recognized. We find no evidence that there is increased identity by descent in the East relative to the total for South America. By contrast, we discovered that populations in the Western region, as a group, harbor more identity by descent than has been previously recognized, despite the fact that average identity by descent within groups is lower. In this light, there is no need to postulate separate founding populations for the East and the West because the variability in the East could serve as a source for the Western gene pools.

Statistical analysis of nucleotide sequences of the hemagglutinin gene of human influenza A viruses.

PubMed Central

Ina, Y; Gojobori, T

1994-01-01

To examine whether positive selection operates on the hemagglutinin 1 (HA1) gene of human influenza A viruses (H1 subtype), 21 nucleotide sequences of the HA1 gene were statistically analyzed. The nucleotide sequences were divided into antigenic and nonantigenic sites. The nucleotide diversities for antigenic and nonantigenic sites of the HA1 gene were computed at synonymous and nonsynonymous sites separately. For nonantigenic sites, the nucleotide diversities were larger at synonymous sites than at nonsynonymous sites. This is consistent with the neutral theory of molecular evolution. For antigenic sites, however, the nucleotide diversities at nonsynonymous sites were larger than those at synonymous sites. These results suggest that positive selection operates on antigenic sites of the HA1 gene of human influenza A viruses (H1 subtype). PMID:8078892

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus

PubMed Central

2013-01-01

Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered – 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had “no hits found”, 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. Conclusions High-quality EST-SNPs from different citrus genotypes were detected, and compared to estimate the heterozygosity of each genome. All the SNP oligo sequences were aligned with the Clementine citrus genome to determine their distribution and uniqueness and for in silico validation, in addition to SNaPshot and sequencing validation of selected SNPs. PMID:24175923

Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.

PubMed

Faragher, S G; Meek, A D; Rice, C M; Dalgarno, L

1988-04-01

The nucleotide sequence of the genomic RNA of a mouse-avirulent strain of Ross River virus, RRV NB5092 (isolated in 1969), has been determined and the corresponding sequence for the prototype mouse-virulent strain, RRV T48 (isolated in 1959), has been completed. The RRV NB5092 genome is approximately 11,674 nucleotides in length, compared with 11,853 nucleotides for RRV T48. RRV NB5092 and RRV T48 have the same genome organization. For both viruses an untranslated region of 80 nucleotides at the 5' end of the genome is followed by a 7440-nucleotide open reading frame which is interrupted after 5586 nucleotides by a single opal termination codon. By homology with other alphaviruses, the 5586-nucleotide open reading frame encodes the nonstructural proteins nsP1, nsP2, and nsP3; a fourth nonstructural protein, nsP4, is produced by read-through of the opal codon. The RRV nonstructural proteins show strong homology with the corresponding proteins of Sindbis virus and Semliki Forest virus in terms of size, net charge, and hydropathy characteristics. However, homology is not uniform between or within the proteins; nsP1, nsP2, and nsP4 contain extended domains which are highly conserved between alphaviruses, while the C-terminal region of nsP3 shows little conservation in sequence or length between alphaviruses. An untranslated "junction" region of 44 nucleotides (for RRV NB5092) or 47 nucleotides (for RRV T48) separates the nonstructural and structural protein coding regions. The structural proteins (capsid-E3-E2-6K-E1) are translated from an open reading frame of 3762 nucleotides which is followed by a 3'-untranslated region of approximately 348 nucleotides (for RRV NB5092) or 524 nucleotides (for RRV T48). Excluding deletions and insertions, the genomes of RRV NB5092 and RRV T48 differ at 284 nucleotides, representing a sequence divergence of 2.38%. Sequence deletions or insertions were found only in the noncoding regions and include a 173-nucleotide deletion in the 3'-untranslated region of RRV NB5092, compared with RRV T48. In the coding regions, most of the nucleotide differences are silent; there are 36 amino acid differences in the nonstructural proteins and 12 in the structural proteins. The distribution of amino acid differences between the two RRV strains correlates with the location of domains which are poorly conserved in sequence between alphaviruses. The possible role of amino acid differences in envelope glycoproteins E1 and E2 in determining the different antigenic and biological properties of RRV NB5092 and RRV T48 is discussed.

Genome Editing of Structural Variations: Modeling and Gene Correction.

PubMed

Park, Chul-Yong; Sung, Jin Jea; Kim, Dong-Wook

2016-07-01

The analysis of chromosomal structural variations (SVs), such as inversions and translocations, was made possible by the completion of the human genome project and the development of genome-wide sequencing technologies. SVs contribute to genetic diversity and evolution, although some SVs can cause diseases such as hemophilia A in humans. Genome engineering technology using programmable nucleases (e.g., ZFNs, TALENs, and CRISPR/Cas9) has been rapidly developed, enabling precise and efficient genome editing for SV research. Here, we review advances in modeling and gene correction of SVs, focusing on inversion, translocation, and nucleotide repeat expansion. Copyright © 2016 Elsevier Ltd. All rights reserved.

A novel LPL intronic variant: g.18704C>A identified by re-sequencing Kuwaiti Arab samples is associated with high-density lipoprotein, very low-density lipoprotein and triglyceride lipid levels.

PubMed

Al-Bustan, Suzanne A; Al-Serri, Ahmad; Annice, Babitha G; Alnaqeeb, Majed A; Al-Kandari, Wafa Y; Dashti, Mohammed

2018-01-01

The role interethnic genetic differences play in plasma lipid level variation across populations is a global health concern. Several genes involved in lipid metabolism and transport are strong candidates for the genetic association with lipid level variation especially lipoprotein lipase (LPL). The objective of this study was to re-sequence the full LPL gene in Kuwaiti Arabs, analyse the sequence variation and identify variants that could attribute to variation in plasma lipid levels for further genetic association. Samples (n = 100) of an Arab ethnic group from Kuwait were analysed for sequence variation by Sanger sequencing across the 30 Kb LPL gene and its flanking sequences. A total of 293 variants including 252 single nucleotide polymorphisms (SNPs) and 39 insertions/deletions (InDels) were identified among which 47 variants (32 SNPs and 15 InDels) were novel to Kuwaiti Arabs. This study is the first to report sequence data and analysis of frequencies of variants at the LPL gene locus in an Arab ethnic group with a novel "rare" variant (LPL:g.18704C>A) significantly associated to HDL (B = -0.181; 95% CI (-0.357, -0.006); p = 0.043), TG (B = 0.134; 95% CI (0.004-0.263); p = 0.044) and VLDL (B = 0.131; 95% CI (-0.001-0.263); p = 0.043) levels. Sequence variation in Kuwaiti Arabs was compared to other populations and was found to be similar with regards to the number of SNPs, InDels and distribution of the number of variants across the LPL gene locus and minor allele frequency (MAF). Moreover, comparison of the identified variants and their MAF with other reports provided a list of 46 potential variants across the LPL gene to be considered for future genetic association studies. The findings warrant further investigation into the association of g.18704C>A with lipid levels in other ethnic groups and with clinical manifestations of dyslipidemia.

A novel LPL intronic variant: g.18704C>A identified by re-sequencing Kuwaiti Arab samples is associated with high-density lipoprotein, very low-density lipoprotein and triglyceride lipid levels

PubMed Central

Al-Serri, Ahmad; Annice, Babitha G.; Alnaqeeb, Majed A.; Al-Kandari, Wafa Y.; Dashti, Mohammed

2018-01-01

The role interethnic genetic differences play in plasma lipid level variation across populations is a global health concern. Several genes involved in lipid metabolism and transport are strong candidates for the genetic association with lipid level variation especially lipoprotein lipase (LPL). The objective of this study was to re-sequence the full LPL gene in Kuwaiti Arabs, analyse the sequence variation and identify variants that could attribute to variation in plasma lipid levels for further genetic association. Samples (n = 100) of an Arab ethnic group from Kuwait were analysed for sequence variation by Sanger sequencing across the 30 Kb LPL gene and its flanking sequences. A total of 293 variants including 252 single nucleotide polymorphisms (SNPs) and 39 insertions/deletions (InDels) were identified among which 47 variants (32 SNPs and 15 InDels) were novel to Kuwaiti Arabs. This study is the first to report sequence data and analysis of frequencies of variants at the LPL gene locus in an Arab ethnic group with a novel “rare” variant (LPL:g.18704C>A) significantly associated to HDL (B = -0.181; 95% CI (-0.357, -0.006); p = 0.043), TG (B = 0.134; 95% CI (0.004–0.263); p = 0.044) and VLDL (B = 0.131; 95% CI (-0.001–0.263); p = 0.043) levels. Sequence variation in Kuwaiti Arabs was compared to other populations and was found to be similar with regards to the number of SNPs, InDels and distribution of the number of variants across the LPL gene locus and minor allele frequency (MAF). Moreover, comparison of the identified variants and their MAF with other reports provided a list of 46 potential variants across the LPL gene to be considered for future genetic association studies. The findings warrant further investigation into the association of g.18704C>A with lipid levels in other ethnic groups and with clinical manifestations of dyslipidemia. PMID:29438437

Sequence Polymorphisms and Structural Variations among Four Grapevine (Vitis vinifera L.) Cultivars Representing Sardinian Agriculture

PubMed Central

Mercenaro, Luca; Nieddu, Giovanni; Porceddu, Andrea; Pezzotti, Mario; Camiolo, Salvatore

2017-01-01

The genetic diversity among grapevine (Vitis vinifera L.) cultivars that underlies differences in agronomic performance and wine quality reflects the accumulation of single nucleotide polymorphisms (SNPs) and small indels as well as larger genomic variations. A combination of high throughput sequencing and mapping against the grapevine reference genome allows the creation of comprehensive sequence variation maps. We used next generation sequencing and bioinformatics to generate an inventory of SNPs and small indels in four widely cultivated Sardinian grape cultivars (Bovale sardo, Cannonau, Carignano and Vermentino). More than 3,200,000 SNPs were identified with high statistical confidence. Some of the SNPs caused the appearance of premature stop codons and thus identified putative pseudogenes. The analysis of SNP distribution along chromosomes led to the identification of large genomic regions with uninterrupted series of homozygous SNPs. We used a digital comparative genomic hybridization approach to identify 6526 genomic regions with significant differences in copy number among the four cultivars compared to the reference sequence, including 81 regions shared between all four cultivars and 4953 specific to single cultivars (representing 1.2 and 75.9% of total copy number variation, respectively). Reads mapping at a distance that was not compatible with the insert size were used to identify a dataset of putative large deletions with cultivar Cannonau revealing the highest number. The analysis of genes mapping to these regions provided a list of candidates that may explain some of the phenotypic differences among the Bovale sardo, Cannonau, Carignano and Vermentino cultivars. PMID:28775732

Sequence Variation of the tRNALeu Intron as a Marker for Genetic Diversity and Specificity of Symbiotic Cyanobacteria in Some Lichens

PubMed Central

Paulsrud, Per; Lindblad, Peter

1998-01-01

We examined the genetic diversity of Nostoc symbionts in some lichens by using the tRNALeu (UAA) intron as a genetic marker. The nucleotide sequence was analyzed in the context of the secondary structure of the transcribed intron. Cyanobacterial tRNALeu (UAA) introns were specifically amplified from freshly collected lichen samples without previous DNA extraction. The lichen species used in the present study were Nephroma arcticum, Peltigera aphthosa, P. membranacea, and P. canina. Introns with different sizes around 300 bp were consistently obtained. Multiple clones from single PCRs were screened by using their single-stranded conformational polymorphism pattern, and the nucleotide sequence was determined. No evidence for sample heterogenity was found. This implies that the symbiont in situ is not a diverse community of cyanobionts but, rather, one Nostoc strain. Furthermore, each lichen thallus contained only one intron type, indicating that each thallus is colonized only once or that there is a high degree of specificity. The same cyanobacterial intron sequence was also found in samples of one lichen species from different localities. In a phylogenetic analysis, the cyanobacterial lichen sequences grouped together with the sequences from two free-living Nostoc strains. The size differences in the intron were due to insertions and deletions in highly variable regions. The sequence data were used in discussions concerning specificity and biology of the lichen symbiosis. It is concluded that the tRNALeu (UAA) intron can be of great value when examining cyanobacterial diversity. PMID:9435083

Characterization of Trichuris trichiura from humans and T. suis from pigs in China using internal transcribed spacers of nuclear ribosomal DNA.

PubMed

Liu, G H; Zhou, W; Nisbet, A J; Xu, M J; Zhou, D H; Zhao, G H; Wang, S K; Song, H Q; Lin, R Q; Zhu, X Q

2014-03-01

Trichuris trichiura and Trichuris suis parasitize (at the adult stage) the caeca of humans and pigs, respectively, causing trichuriasis. Despite these parasites being of human and animal health significance, causing considerable socio-economic losses globally, little is known of the molecular characteristics of T. trichiura and T. suis from China. In the present study, the entire first and second internal transcribed spacer (ITS-1 and ITS-2) regions of nuclear ribosomal DNA (rDNA) of T. trichiura and T. suis from China were amplified by polymerase chain reaction (PCR), the representative amplicons were cloned and sequenced, and sequence variation in the ITS rDNA was examined. The ITS rDNA sequences for the T. trichiura and T. suis samples were 1222-1267 bp and 1339-1353 bp in length, respectively. Sequence analysis revealed that the ITS-1, 5.8S and ITS-2 rDNAs of both whipworms were 600-627 bp and 655-661 bp, 154 bp, and 468-486 bp and 530-538 bp in size, respectively. Sequence variation in ITS rDNA within and among T. trichiura and T. suis was examined. Excluding nucleotide variations in the simple sequence repeats, the intra-species sequence variation in the ITS-1 was 0.2-1.7% within T. trichiura, and 0-1.5% within T. suis. For ITS-2 rDNA, the intra-species sequence variation was 0-1.3% within T. trichiura and 0.2-1.7% within T. suis. The inter-species sequence differences between the two whipworms were 60.7-65.3% for ITS-1 and 59.3-61.5% for ITS-2. These results demonstrated that the ITS rDNA sequences provide additional genetic markers for the characterization and differentiation of the two whipworms. These data should be useful for studying the epidemiology and population genetics of T. trichiura and T. suis, as well as for the diagnosis of trichuriasis in humans and pigs.

The complete nucleotide sequence of the glnALG operon of Escherichia coli K12.

PubMed Central

Miranda-Ríos, J; Sánchez-Pescador, R; Urdea, M; Covarrubias, A A

1987-01-01

The nucleotide sequence of the E. coli glnALG operon has been determined. The glnL (ntrB) and glnG (ntrC) genes present a high homology, at the nucleotide and aminoacid levels, with the corresponding genes of Klebsiella pneumoniae. The predicted aminoacid sequence for glutamine synthetase allowed us to locate some of the enzyme domains. The structure of this operon is discussed. PMID:2882477

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-11-11

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

Asian affinities and continental radiation of the four founding Native American mtDNAs.

PubMed Central

Torroni, A; Schurr, T G; Cabell, M F; Brown, M D; Neel, J V; Larsen, M; Smith, D G; Vullo, C M; Wallace, D C

1993-01-01

The mtDNA variation of 321 individuals from 17 Native American populations was examined by high-resolution restriction endonuclease analysis. All mtDNAs were amplified from a variety of sources by using PCR. The mtDNA of a subset of 38 of these individuals was also analyzed by D-loop sequencing. The resulting data were combined with previous mtDNA data from five other Native American tribes, as well as with data from a variety of Asian populations, and were used to deduce the phylogenetic relationships between mtDNAs and to estimate sequence divergences. This analysis revealed the presence of four haplotype groups (haplogroups A, B, C, and D) in the Amerind, but only one haplogroup (A) in the Na-Dene, and confirmed the independent origins of the Amerinds and the Na-Dene. Further, each haplogroup appeared to have been founded by a single mtDNA haplotype, a result which is consistent with a hypothesized founder effect. Most of the variation within haplogroups was tribal specific, that is, it occurred as tribal private polymorphisms. These observations suggest that the process of tribalization began early in the history of the Amerinds, with relatively little intertribal genetic exchange occurring subsequently. The sequencing of 341 nucleotides in the mtDNA D-loop revealed that the D-loop sequence variation correlated strongly with the four haplogroups defined by restriction analysis, and it indicated that the D-loop variation, like the haplotype variation, arose predominantly after the migration of the ancestral Amerinds across the Bering land bridge. Images Figure 4 PMID:7688932

Exploiting sequence similarity to validate the sensitivity of SNP arrays in detecting fine-scaled copy number variations.

PubMed

Wong, Gerard; Leckie, Christopher; Gorringe, Kylie L; Haviv, Izhak; Campbell, Ian G; Kowalczyk, Adam

2010-04-15

High-density single nucleotide polymorphism (SNP) genotyping arrays are efficient and cost effective platforms for the detection of copy number variation (CNV). To ensure accuracy in probe synthesis and to minimize production costs, short oligonucleotide probe sequences are used. The use of short probe sequences limits the specificity of binding targets in the human genome. The specificity of these short probeset sequences has yet to be fully analysed against a normal reference human genome. Sequence similarity can artificially elevate or suppress copy number measurements, and hence reduce the reliability of affected probe readings. For the purpose of detecting narrow CNVs reliably down to the width of a single probeset, sequence similarity is an important issue that needs to be addressed. We surveyed the Affymetrix Human Mapping SNP arrays for probeset sequence similarity against the reference human genome. Utilizing sequence similarity results, we identified a collection of fine-scaled putative CNVs between gender from autosomal probesets whose sequence matches various loci on the sex chromosomes. To detect these variations, we utilized our statistical approach, Detecting REcurrent Copy number change using rank-order Statistics (DRECS), and showed that its performance was superior and more stable than the t-test in detecting CNVs. Through the application of DRECS on the HapMap population datasets with multi-matching probesets filtered, we identified biologically relevant SNPs in aberrant regions across populations with known association to physical traits, such as height, covered by the span of a single probe. This provided empirical confirmation of the existence of naturally occurring narrow CNVs as well as the sensitivity of the Affymetrix SNP array technology in detecting them. The MATLAB implementation of DRECS is available at http://ww2.cs.mu.oz.au/ approximately gwong/DRECS/index.html.

The polymorphisms of LCR, E6, and E7 of HPV-58 isolates in Yunnan, Southwest China.

PubMed

Xi, Juemin; Chen, Junying; Xu, Miaoling; Yang, Hongying; Wen, Songjiao; Pan, Yue; Wang, Xiaodan; Ye, Chao; Qiu, Lijuan; Sun, Qiangming

2018-04-25

Variations in HPV LCR/E6/E7 have been shown to be associated with the viral persistence and cervical cancer development. So far, there are few reports about the polymorphisms of the HPV-58 LCR/E6/E7 sequences in Southwest China. This study aims to characterize the gene polymorphisms of the HPV-58 LCR/E6/E7 sequences in women of Southwest China, and assess the effects of variations on the immune recognition of viral E6 and E7 antigens. Twelve LCR/E6/E7 of the HPV-58 isolates were amplified and sequenced. A neighbor-joining phylogenetic tree was constructed by MEGA 7.0, followed by the secondary structure prediction of the related proteins using PSIPRED v3.3. The selection pressure acting on the HPV-58 E6 and E7 coding regions was estimated by Bayes empirical Bayes analysis of PAML 4.8. Meanwhile, the MHC class-I and II binding peptides were predicted by the ProPred-I server and ProPred server. The transcription factor binding sites in the HPV-58 LCR were analyzed using the JASPAR database. Twenty nine SNPs (20 in the LCR, 3 in the E6, 6 in the E7) were identified at 27 nucleotide sites across the HPV-58 LCR/E6/E7. From the most variable to the least variable, the nucleotide variations were LCR > E7 > E6. The combinations of all the SNPs resulted in 11 unique sequences, which were clustered into the A lineage (7 belong to A1, 2 belong to A2, and 2 belong to A3). An insertion (TGTCAGTTTCCT) was found between the nucleotide sites 7280 and 7281 in 2 variants, and a deletion (TTTAT) was found between 7429 and 7433 in 1 variant. The most common non-synonymous substitution V77A in the E7 was observed in the sequences encoding the α-helix. 63G in the E7 was determined to be the only one positively selected site in the HPV-58 E6/E7 sequences. Six non-synonymous amino acid substitutions (including S71F and K93 N in the E6, and T20I, G41R, G63S/D, and V77A in the E7) were affecting multiple putative epitopes for both CD4 + and CD8 + T-cells. In the LCR, C7265G and C7266T were the most variable sites and were the potential binding sites for the transcription factor SOX10. These results provide an insight into the intrinsic geographical relatedness and biological differences of the HPV-58 variants, and contribute to further research on the HPV-58 epidemiology, carcinogenesis, and therapeutic vaccine development.

Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome

PubMed Central

Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki

2015-01-01

Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions. PMID:26544948

Hybridization properties of long nucleic acid probes for detection of variable target sequences, and development of a hybridization prediction algorithm

PubMed Central

Öhrmalm, Christina; Jobs, Magnus; Eriksson, Ronnie; Golbob, Sultan; Elfaitouri, Amal; Benachenhou, Farid; Strømme, Maria; Blomberg, Jonas

2010-01-01

One of the main problems in nucleic acid-based techniques for detection of infectious agents, such as influenza viruses, is that of nucleic acid sequence variation. DNA probes, 70-nt long, some including the nucleotide analog deoxyribose-Inosine (dInosine), were analyzed for hybridization tolerance to different amounts and distributions of mismatching bases, e.g. synonymous mutations, in target DNA. Microsphere-linked 70-mer probes were hybridized in 3M TMAC buffer to biotinylated single-stranded (ss) DNA for subsequent analysis in a Luminex® system. When mismatches interrupted contiguous matching stretches of 6 nt or longer, it had a strong impact on hybridization. Contiguous matching stretches are more important than the same number of matching nucleotides separated by mismatches into several regions. dInosine, but not 5-nitroindole, substitutions at mismatching positions stabilized hybridization remarkably well, comparable to N (4-fold) wobbles in the same positions. In contrast to shorter probes, 70-nt probes with judiciously placed dInosine substitutions and/or wobble positions were remarkably mismatch tolerant, with preserved specificity. An algorithm, NucZip, was constructed to model the nucleation and zipping phases of hybridization, integrating both local and distant binding contributions. It predicted hybridization more exactly than previous algorithms, and has the potential to guide the design of variation-tolerant yet specific probes. PMID:20864443

Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

PubMed

Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki

2015-01-01

Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

Single-cell mRNA sequencing identifies subclonal heterogeneity in anti-cancer drug responses of lung adenocarcinoma cells.

PubMed

Kim, Kyu-Tae; Lee, Hye Won; Lee, Hae-Ock; Kim, Sang Cheol; Seo, Yun Jee; Chung, Woosung; Eum, Hye Hyeon; Nam, Do-Hyun; Kim, Junhyong; Joo, Kyeung Min; Park, Woong-Yang

2015-06-19

Intra-tumoral genetic and functional heterogeneity correlates with cancer clinical prognoses. However, the mechanisms by which intra-tumoral heterogeneity impacts therapeutic outcome remain poorly understood. RNA sequencing (RNA-seq) of single tumor cells can provide comprehensive information about gene expression and single-nucleotide variations in individual tumor cells, which may allow for the translation of heterogeneous tumor cell functional responses into customized anti-cancer treatments. We isolated 34 patient-derived xenograft (PDX) tumor cells from a lung adenocarcinoma patient tumor xenograft. Individual tumor cells were subjected to single cell RNA-seq for gene expression profiling and expressed mutation profiling. Fifty tumor-specific single-nucleotide variations, including KRAS(G12D), were observed to be heterogeneous in individual PDX cells. Semi-supervised clustering, based on KRAS(G12D) mutant expression and a risk score representing expression of 69 lung adenocarcinoma-prognostic genes, classified PDX cells into four groups. PDX cells that survived in vitro anti-cancer drug treatment displayed transcriptome signatures consistent with the group characterized by KRAS(G12D) and low risk score. Single-cell RNA-seq on viable PDX cells identified a candidate tumor cell subgroup associated with anti-cancer drug resistance. Thus, single-cell RNA-seq is a powerful approach for identifying unique tumor cell-specific gene expression profiles which could facilitate the development of optimized clinical anti-cancer strategies.

The EMBL nucleotide sequence database

PubMed Central

Stoesser, Guenter; Baker, Wendy; van den Broek, Alexandra; Camon, Evelyn; Garcia-Pastor, Maria; Kanz, Carola; Kulikova, Tamara; Lombard, Vincent; Lopez, Rodrigo; Parkinson, Helen; Redaschi, Nicole; Sterk, Peter; Stoehr, Peter; Tuli, Mary Ann

2001-01-01

The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/) is maintained at the European Bioinformatics Institute (EBI) in an international collaboration with the DNA Data Bank of Japan (DDBJ) and GenBank at the NCBI (USA). Data is exchanged amongst the collaborating databases on a daily basis. The major contributors to the EMBL database are individual authors and genome project groups. Webin is the preferred web-based submission system for individual submitters, whilst automatic procedures allow incorporation of sequence data from large-scale genome sequencing centres and from the European Patent Office (EPO). Database releases are produced quarterly. Network services allow free access to the most up-to-date data collection via ftp, email and World Wide Web interfaces. EBI’s Sequence Retrieval System (SRS), a network browser for databanks in molecular biology, integrates and links the main nucleotide and protein databases plus many specialized databases. For sequence similarity searching a variety of tools (e.g. Blitz, Fasta, BLAST) are available which allow external users to compare their own sequences against the latest data in the EMBL Nucleotide Sequence Database and SWISS-PROT. PMID:11125039

Interactive computer programs for the graphic analysis of nucleotide sequence data.

PubMed Central

Luckow, V A; Littlewood, R K; Rownd, R H

1984-01-01

A group of interactive computer programs have been developed which aid in the collection and graphical analysis of nucleotide and protein sequence data. The programs perform the following basic functions: a) enter, edit, list, and rearrange sequence data; b) permit automatic entry of nucleotide sequence data directly from an autoradiograph into the computer; c) search for restriction sites or other specified patterns and plot a linear or circular restriction map, or print their locations; d) plot base composition; e) analyze homology between sequences by plotting a two-dimensional graphic matrix; and f) aid in plotting predicted secondary structures of RNA molecules. PMID:6546437

Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

PubMed Central

Khan, A S

1984-01-01

The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

Parallel or convergent evolution in human population genomic data revealed by genotype networks.

PubMed

R Vahdati, Ali; Wagner, Andreas

2016-08-02

Genotype networks are representations of genetic variation data that are complementary to phylogenetic trees. A genotype network is a graph whose nodes are genotypes (DNA sequences) with the same broadly defined phenotype. Two nodes are connected if they differ in some minimal way, e.g., in a single nucleotide. We analyze human genome variation data from the 1,000 genomes project, and construct haploid genotype (haplotype) networks for 12,235 protein coding genes. The structure of these networks varies widely among genes, indicating different patterns of variation despite a shared evolutionary history. We focus on those genes whose genotype networks show many cycles, which can indicate homoplasy, i.e., parallel or convergent evolution, on the sequence level. For 42 genes, the observed number of cycles is so large that it cannot be explained by either chance homoplasy or recombination. When analyzing possible explanations, we discovered evidence for positive selection in 21 of these genes and, in addition, a potential role for constrained variation and purifying selection. Balancing selection plays at most a small role. The 42 genes with excess cycles are enriched in functions related to immunity and response to pathogens. Genotype networks are representations of genetic variation data that can help understand unusual patterns of genomic variation.

Complete nucleotide sequence and genome organization of a novel allexivirus from alfalfa (Medicago sativa)

USDA-ARS?s Scientific Manuscript database

A new species of the family Alphaflexiviridae provisionally named Alfalfa virus S (AVS) was diagnosed in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by Illumina NGS technology ...

The primary structure of the thymidine kinase gene of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Handermann, M; Szépe, O; Darai, G

1991-06-01

The DNA nucleotide sequence of the thymidine kinase (TK) gene of fish lymphocystis disease virus (FLDV) which has been localized between the coordinates 0.678 to 0.688 of the viral genome was determined. The analysis of the DNA nucleotide sequence located between the recognition sites of HindIII (0.669 map unit; nucleotide position 1) and AccI (nucleotide position 2032) revealed the presence of an open reading frame of 954 bp on the lower strand of this region between nucleotide positions 1868 (ATG) and 915 (TAA). It encodes for a protein of 318 amino acid residues. The evolutionary relationships of the TK gene of FLDV to the other known TK genes was investigated using the method of progressive sequence alignment. These analyses revealed a high degree of diversity between the protein sequence of FLDV TK gene and the amino acid composition of other TKs tested. However, significant conservations were detected at several regions of amino acid residues of the FLDV TK protein when compared to the amino acid sequence of TKs of African swine fever virus, fowlpox virus, shope fibroma virus, and vaccinia virus and to the amino acid sequences of the cellular cytoplasmic TK of chicken, mouse, and man.

Sequence diversity within the reovirus S2 gene: reovirus genes reassort in nature, and their termini are predicted to form a panhandle motif.

PubMed Central

Chapell, J D; Goral, M I; Rodgers, S E; dePamphilis, C W; Dermody, T S

1994-01-01

To better understand genetic diversity within mammalian reoviruses, we determined S2 nucleotide and deduced sigma 2 amino acid sequences of nine reovirus strains and compared these sequences with those of prototype strains of the three reovirus serotypes. The S2 gene and sigma 2 protein are highly conserved among the four type 1, one type 2, and seven type 3 strains studied. Phylogenetic analyses based on S2 nucleotide sequences of the 12 reovirus strains indicate that diversity within the S2 gene is independent of viral serotype. Additionally, we found marked topological differences between phylogenetic trees generated from S1 and S2 gene nucleotide sequences of the seven type 3 strains. These results demonstrate that reovirus S1 and S2 genes have distinct evolutionary histories, thus providing phylogenetic evidence for lateral transfer of reovirus genes in nature. When variability among the 12 sigma 2-encoding S2 nucleotide sequences was analyzed at synonymous positions, we found that approximately 60 nucleotides at the 5' terminus and 30 nucleotides at the 3' terminus were markedly conserved in comparison with other sigma 2-encoding regions of S2. Predictions of RNA secondary structures indicate that the more conserved S2 sequences participate in the formation of an extended region of duplex RNA interrupted by a pair of stem-loops. Among the 12 deduced sigma 2 amino acid sequences examined, substitutions were observed at only 11% of amino acid positions. This finding suggests that constraints on the structure or function of sigma 2, perhaps in part because of its location in the virion core, have limited sequence diversity within this protein. PMID:8289378

DNA sequence analysis of simian virus 40 mutants with deletions mapping in the leader region of the late viral mRNA's: mutants with deletions similar in size and position exhibit varied phenotypes.

PubMed

Barkan, A; Mertz, J E

1981-02-01

The nucleotide sequences of 10 viable yet partially defective deletion mutants of simian virus 40 were determined. The deletions mapped within, and, in many cases, 5' to, the predominant leader sequence of the late viral mRNA's. They ranged from 74 to 187 nucleotide pairs in length. Six of the mutants had lost the sequence that corresponds to the "cap" site (5' terminus) of the most abundant class of 16S mRNA's. One of these mutants had a deletion that extended 103 nucleotide pairs into the region preceding this primary cap site and, therefore, was missing many secondary cap sites as well. A seventh mutant lacked the entire major 16S leader sequence except for the first six nucleotides at its 5' end and the last nine at its 3' end. Although these mutants differed in the size and position of their deletions, we were unable to discover any simple correlations between their growth characteristics and their DNA sequences. This finding indicates that the secondary structures of the RNA transcripts may play a more important role than the exact nucleotide sequence of the RNAs in determining how they function within the cell.

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Ellanskaya, legal representative, Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser; Ellanskaya, deceased, Irina

2007-12-11

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Elleskaya, Irina; Ellanskaya, legal representative; Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-08-10

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Waukee, IA; Dahlbacka, Glen [Oakland, CA; Elleskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, IA; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2011-04-12

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Granger, IA; Dahlbacka, Glen [Oakland, CA; Ellanskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, TX; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2012-04-03

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

PubMed Central

Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

2011-01-01

DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum

PubMed Central

Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

2017-01-01

Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1–3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry. PMID:28056060

Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum.

PubMed

Zhang, Xiuqing; Xu, Zhangyang; Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

2017-01-01

Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1-3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry.

Construction of a high-density genetic map by specific locus amplified fragment sequencing (SLAF-seq) and its application to Quantitative Trait Loci (QTL) analysis for boll weight in upland cotton (Gossypium hirsutum.).

PubMed

Zhang, Zhen; Shang, Haihong; Shi, Yuzhen; Huang, Long; Li, Junwen; Ge, Qun; Gong, Juwu; Liu, Aiying; Chen, Tingting; Wang, Dan; Wang, Yanling; Palanga, Koffi Kibalou; Muhammad, Jamshed; Li, Weijie; Lu, Quanwei; Deng, Xiaoying; Tan, Yunna; Song, Weiwu; Cai, Juan; Li, Pengtao; Rashid, Harun or; Gong, Wankui; Yuan, Youlu

2016-04-11

Upland Cotton (Gossypium hirsutum) is one of the most important worldwide crops it provides natural high-quality fiber for the industrial production and everyday use. Next-generation sequencing is a powerful method to identify single nucleotide polymorphism markers on a large scale for the construction of a high-density genetic map for quantitative trait loci mapping. In this research, a recombinant inbred lines population developed from two upland cotton cultivars 0-153 and sGK9708 was used to construct a high-density genetic map through the specific locus amplified fragment sequencing method. The high-density genetic map harbored 5521 single nucleotide polymorphism markers which covered a total distance of 3259.37 cM with an average marker interval of 0.78 cM without gaps larger than 10 cM. In total 18 quantitative trait loci of boll weight were identified as stable quantitative trait loci and were detected in at least three out of 11 environments and explained 4.15-16.70 % of the observed phenotypic variation. In total, 344 candidate genes were identified within the confidence intervals of these stable quantitative trait loci based on the cotton genome sequence. These genes were categorized based on their function through gene ontology analysis, Kyoto Encyclopedia of Genes and Genomes analysis and eukaryotic orthologous groups analysis. This research reported the first high-density genetic map for Upland Cotton (Gossypium hirsutum) with a recombinant inbred line population using single nucleotide polymorphism markers developed by specific locus amplified fragment sequencing. We also identified quantitative trait loci of boll weight across 11 environments and identified candidate genes within the quantitative trait loci confidence intervals. The results of this research would provide useful information for the next-step work including fine mapping, gene functional analysis, pyramiding breeding of functional genes as well as marker-assisted selection.

Nonsynonymous substitution in abalone sperm fertilization genes exceeds substitution in introns and mitochondrial DNA

PubMed Central

Metz, Edward C.; Robles-Sikisaka, Refugio; Vacquier, Victor D.

1998-01-01

Strong positive Darwinian selection acts on two sperm fertilization proteins, lysin and 18-kDa protein, from abalone (Haliotis). To understand the phylogenetic context for this dramatic molecular evolution, we obtained sequences of mitochondrial cytochrome c oxidase subunit I (mtCOI), and genomic sequences of lysin, 18-kDa, and a G protein subunit. Based on mtDNA differentiation, four north Pacific abalone species diverged within the past 2 million years (Myr), and remaining north Pacific species diverged over a period of 4–20 Myr. Between-species nonsynonymous differences in lysin and 18-kDa exons exceed nucleotide differences in introns by 3.5- to 24-fold. Remarkably, in some comparisons nonsynonymous substitutions in lysin and 18-kDa genes exceed synonymous substitutions in mtCOI. Lysin and 18-kDa intron/exon segments were sequenced from multiple red abalone individuals collected over a 1,200-km range. Only two nucleotide changes and two sites of slippage variation were detected in a total of >29,000 nucleotides surveyed. However, polymorphism in mtCOI and a G protein intron was found in this species. This finding suggests that positive selection swept one lysin allele and one 18-kDa allele to fixation. Similarities between mtCOI and lysin gene trees indicate that rapid adaptive evolution of lysin has occurred consistently through the history of the group. Comparisons with mtCOI molecular clock calibrations suggest that nonsynonymous substitutions accumulate 2–50 times faster in lysin and 18-kDa genes than in rapidly evolving mammalian genes. PMID:9724763

Precise detection of de novo single nucleotide variants in human genomes.

PubMed

Gómez-Romero, Laura; Palacios-Flores, Kim; Reyes, José; García, Delfino; Boege, Margareta; Dávila, Guillermo; Flores, Margarita; Schatz, Michael C; Palacios, Rafael

2018-05-22

The precise determination of de novo genetic variants has enormous implications across different fields of biology and medicine, particularly personalized medicine. Currently, de novo variations are identified by mapping sample reads from a parent-offspring trio to a reference genome, allowing for a certain degree of differences. While widely used, this approach often introduces false-positive (FP) results due to misaligned reads and mischaracterized sequencing errors. In a previous study, we developed an alternative approach to accurately identify single nucleotide variants (SNVs) using only perfect matches. However, this approach could be applied only to haploid regions of the genome and was computationally intensive. In this study, we present a unique approach, coverage-based single nucleotide variant identification (COBASI), which allows the exploration of the entire genome using second-generation short sequence reads without extensive computing requirements. COBASI identifies SNVs using changes in coverage of exactly matching unique substrings, and is particularly suited for pinpointing de novo SNVs. Unlike other approaches that require population frequencies across hundreds of samples to filter out any methodological biases, COBASI can be applied to detect de novo SNVs within isolated families. We demonstrate this capability through extensive simulation studies and by studying a parent-offspring trio we sequenced using short reads. Experimental validation of all 58 candidate de novo SNVs and a selection of non-de novo SNVs found in the trio confirmed zero FP calls. COBASI is available as open source at https://github.com/Laura-Gomez/COBASI for any researcher to use. Copyright © 2018 the Author(s). Published by PNAS.

Variation analysis of the severe acute respiratory syndrome coronavirus putative non-structural protein 2 gene and construction of three-dimensional model.

PubMed

Lu, Jia-hai; Zhang, Ding-mei; Wang, Guo-ling; Guo, Zhong-min; Zhang, Chuan-hai; Tan, Bing-yan; Ouyang, Li-ping; Lin, Li; Liu, Yi-min; Chen, Wei-qing; Ling, Wen-hua; Yu, Xin-bing; Zhong, Nan-shan

2005-05-05

The rapid transmission and high mortality rate made severe acute respiratory syndrome (SARS) a global threat for which no efficacious therapy is available now. Without sufficient knowledge about the SARS coronavirus (SARS-CoV), it is impossible to define the candidate for the anti-SARS targets. The putative non-structural protein 2 (nsp2) (3CL(pro), following the nomenclature by Gao et al, also known as nsp5 in Snidjer et al) of SARS-CoV plays an important role in viral transcription and replication, and is an attractive target for anti-SARS drug development, so we carried on this study to have an insight into putative polymerase nsp2 of SARS-CoV Guangdong (GD) strain. The SARS-CoV strain was isolated from a SARS patient in Guangdong, China, and cultured in Vero E6 cells. The nsp2 gene was amplified by reverse transcription-polymerase chain reaction (RT-PCR) and cloned into eukaryotic expression vector pCI-neo (pCI-neo/nsp2). Then the recombinant eukaryotic expression vector pCI-neo/nsp2 was transfected into COS-7 cells using lipofectin reagent to express the nsp2 protein. The expressive protein of SARS-CoV nsp2 was analyzed by 7% sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE). The nucleotide sequence and protein sequence of GD nsp2 were compared with that of other SARS-CoV strains by nucleotide-nucleotide basic local alignment search tool (BLASTN) and protein-protein basic local alignment search tool (BLASTP) to investigate its variance trend during the transmission. The secondary structure of GD strain and that of other strains were predicted by Garnier-Osguthorpe-Robson (GOR) Secondary Structure Prediction. Three-dimensional-PSSM Protein Fold Recognition (Threading) Server was employed to construct the three-dimensional model of the nsp2 protein. The putative polymerase nsp2 gene of GD strain was amplified by RT-PCR. The eukaryotic expression vector (pCI-neo/nsp2) was constructed and expressed the protein in COS-7 cells successfully. The result of sequencing and sequence comparison with other SARS-CoV strains showed that nsp2 gene was relatively conservative during the transmission and total five base sites mutated in about 100 strains investigated, three of which in the early and middle phases caused synonymous mutation, and another two base sites variation in the late phase resulted in the amino acid substitutions and secondary structure changes. The three-dimensional structure of the nsp2 protein was successfully constructed. The results suggest that polymerase nsp2 is relatively stable during the phase of epidemic. The amino acid and secondary structure change may be important for viral infection. The fact that majority of single nucleotide variations (SNVs) are predicted to cause synonymous, as well as the result of low mutation rate of nsp2 gene in the epidemic variations, indicates that the nsp2 is conservative and could be a target for anti-SARS drugs. The three-dimensional structure result indicates that the nsp2 protein of GD strain is high homologous with 3CL(pro) of SARS-CoV urbani strain, 3CL(pro) of transmissible gastroenteritis virus and 3CL(pro) of human coronavirus 229E strain, which further suggests that nsp2 protein of GD strain possesses the activity of 3CL(pro).

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

PubMed

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

Detection of a single nucleotide polymorphism in the human alpha-lactalbumin gene: implications for human milk proteins.

PubMed

Chowanadisai, Winyoo; Kelleher, Shannon L; Nemeth, Jennifer F; Yachetti, Stephen; Kuhlman, Charles F; Jackson, Joan G; Davis, Anne M; Lien, Eric L; Lönnerdal, Bo

2005-05-01

Variability in the protein composition of breast milk has been observed in many women and is believed to be due to natural variation of the human population. Single nucleotide polymorphisms (SNPs) are present throughout the entire human genome, but the impact of this variation on human milk composition and biological activity and infant nutrition and health is unclear. The goals of this study were to characterize a variant of human alpha-lactalbumin observed in milk from a Filipino population by determining the location of the polymorphism in the amino acid and genomic sequences of alpha-lactalbumin. Milk and blood samples were collected from 20 Filipino women, and milk samples were collected from an additional 450 women from nine different countries. alpha-Lactalbumin concentration was measured by high-performance liquid chromatography (HPLC), and milk samples containing the variant form of the protein were identified with both HPLC and mass spectrometry (MS). The molecular weight of the variant form was measured by MS, and the location of the polymorphism was narrowed down by protein reduction, alkylation and trypsin digestion. Genomic DNA was isolated from whole blood, and the polymorphism location and subject genotype were determined by amplifying the entire coding sequence of human alpha-lactalbumin by PCR, followed by DNA sequencing. A variant form of alpha-lactalbumin was observed in HPLC chromatograms, and the difference in molecular weight was determined by MS (wild type=14,070 Da, variant=14,056 Da). Protein reduction and digestion narrowed the polymorphism between the 33rd and 77th amino acid of the protein. The genetic polymorphism was identified as adenine to guanine, which translates to a substitution from isoleucine to valine at amino acid 46. The frequency of variation was higher in milk from China, Japan and Philippines, which suggests that this polymorphism is most prevalent in Asia. There are SNPs in the genome for human milk proteins and their implications for protein bioactivity and infant nutrition need to be considered.

Phylogenetic analyses indicate little variation among reticuloendotheliosis viruses infecting avian species, including the endangered Attwater's prairie chicken.

PubMed

Bohls, Ryan L; Linares, Jose A; Gross, Shannon L; Ferro, Pam J; Silvy, Nova J; Collisson, Ellen W

2006-08-01

Reticuloendotheliosis virus infection, which typically causes systemic lymphomas and high mortality in the endangered Attwater's prairie chicken, has been described as a major obstacle in repopulation efforts of captive breeding facilities in Texas. Although antigenic relationships among reticuloendotheliosis virus (REV) strains have been previously determined, phylogenetic relationships have not been reported. The pol and env of REV proviral DNA from prairie chickens (PC-R92 and PC-2404), from poxvirus lesions in domestic chickens, the prototype poultry derived REV-A and chick syncytial virus (CSV), and duck derived spleen necrosis virus (SNV) were PCR amplified and sequenced. The 5032bp, that included the pol and most of env genes, of the PC-R92 and REV-A were 98% identical, and nucleotide sequence identities of smaller regions within the pol and env from REV strains examined ranged from 95 to 99% and 93 to 99%, respectively. The putative amino acid sequences were 97-99% identical in the polymerase and 90-98% in the envelope. Phylogenetic analyses of the nucleotide and amino acid sequences indicated the closest relationship among the recent fowl pox-associated chicken isolates, the prairie chicken isolates and the prototype CSV while only the SNV appeared to be distinctly divergent. While the origin of the naturally occurring viruses is not known, the avian poxvirus may be a critical component of transmission of these ubiquitous oncogenic viruses.

Identification of New Single Nucleotide Polymorphism-Based Markers for Inter- and Intraspecies Discrimination of Obligate Bacterial Parasites (Pasteuria spp.) of Invertebrates ▿ †

PubMed Central

Mauchline, Tim H.; Knox, Rachel; Mohan, Sharad; Powers, Stephen J.; Kerry, Brian R.; Davies, Keith G.; Hirsch, Penny R.

2011-01-01

Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of “cryptic” SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms. PMID:21803895

Identification of new single nucleotide polymorphism-based markers for inter- and intraspecies discrimination of obligate bacterial parasites (Pasteuria spp.) of invertebrates.

PubMed

Mauchline, Tim H; Knox, Rachel; Mohan, Sharad; Powers, Stephen J; Kerry, Brian R; Davies, Keith G; Hirsch, Penny R

2011-09-01

Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of "cryptic" SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms.

Population genetic implications from sequence variation in four Y chromosome genes.

PubMed

Shen, P; Wang, F; Underhill, P A; Franco, C; Yang, W H; Roxas, A; Sung, R; Lin, A A; Hyman, R W; Vollrath, D; Davis, R W; Cavalli-Sforza, L L; Oefner, P J

2000-06-20

Some insight into human evolution has been gained from the sequencing of four Y chromosome genes. Primary genomic sequencing determined gene SMCY to be composed of 27 exons that comprise 4,620 bp of coding sequence. The unfinished sequencing of the 5' portion of gene UTY1 was completed by primer walking, and a total of 20 exons were found. By using denaturing HPLC, these two genes, as well as DBY and DFFRY, were screened for polymorphic sites in 53-72 representatives of the five continents. A total of 98 variants were found, yielding nucleotide diversity estimates of 2.45 x 10(-5), 5. 07 x 10(-5), and 8.54 x 10(-5) for the coding regions of SMCY, DFFRY, and UTY1, respectively, with no variant having been observed in DBY. In agreement with most autosomal genes, diversity estimates for the noncoding regions were about 2- to 3-fold higher and ranged from 9. 16 x 10(-5) to 14.2 x 10(-5) for the four genes. Analysis of the frequencies of derived alleles for all four genes showed that they more closely fit the expectation of a Luria-Delbrück distribution than a distribution expected under a constant population size model, providing evidence for exponential population growth. Pairwise nucleotide mismatch distributions date the occurrence of population expansion to approximately 28,000 years ago. This estimate is in accord with the spread of Aurignacian technology and the disappearance of the Neanderthals.

The complete nucleotide sequence of the domestic dog (Canis familiaris) mitochondrial genome.

PubMed

Kim, K S; Lee, S E; Jeong, H W; Ha, J H

1998-10-01

The complete nucleotide sequence of the mitochondrial genome of the domestic dog, Canis familiaris, was determined. The length of the sequence was 16,728 bp; however, the length was not absolute due to the variation (heteroplasmy) caused by differing numbers of the repetitive motif, 5'-GTACACGT(A/G)C-3', in the control region. The genome organization, gene contents, and codon usage conformed to those of other mammalian mitochondrial genomes. Although its features were unknown, the "CTAGA" duplication event which followed the translational stop codon of the COII gene was not observed in other mammalian mitochondrial genomes. In order to determine the possible differences between mtDNAs in carnivores, two rRNA and 13 protein-coding genes from the cat, dog, and seal were compared. The combined molecular differences, in two rRNA genes as well as in the inferred amino acid sequences of the mitochondrial 13 protein-coding genes, suggested that there is a closer relationship between the dog and the seal than there is between either of these species and the cat. Based on the molecular differences of the mtDNA, the evolutionary divergence between the cat, the dog, and the seal was dated to approximately 50 +/- 4 million years ago. The degree of difference between carnivore mtDNAs varied according to the individual protein-coding gene applied, showing that the evolutionary relationships of distantly related species should be presented in an extended study based on ample sequence data like complete mtDNA molecules. Copyright 1998 Academic Press.

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed Central

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-01-01

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%). PMID:6891053

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2011 CFR

2011-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2013 CFR

2013-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2012 CFR

2012-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2010 CFR

2010-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2014 CFR

2014-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

Evaluation of the reliability of maize reference assays for GMO quantification.

PubMed

Papazova, Nina; Zhang, David; Gruden, Kristina; Vojvoda, Jana; Yang, Litao; Buh Gasparic, Meti; Blejec, Andrej; Fouilloux, Stephane; De Loose, Marc; Taverniers, Isabel

2010-03-01

A reliable PCR reference assay for relative genetically modified organism (GMO) quantification must be specific for the target taxon and amplify uniformly along the commercialised varieties within the considered taxon. Different reference assays for maize (Zea mays L.) are used in official methods for GMO quantification. In this study, we evaluated the reliability of eight existing maize reference assays, four of which are used in combination with an event-specific polymerase chain reaction (PCR) assay validated and published by the Community Reference Laboratory (CRL). We analysed the nucleotide sequence variation in the target genomic regions in a broad range of transgenic and conventional varieties and lines: MON 810 varieties cultivated in Spain and conventional varieties from various geographical origins and breeding history. In addition, the reliability of the assays was evaluated based on their PCR amplification performance. A single base pair substitution, corresponding to a single nucleotide polymorphism (SNP) reported in an earlier study, was observed in the forward primer of one of the studied alcohol dehydrogenase 1 (Adh1) (70) assays in a large number of varieties. The SNP presence is consistent with a poor PCR performance observed for this assay along the tested varieties. The obtained data show that the Adh1 (70) assay used in the official CRL NK603 assay is unreliable. Based on our results from both the nucleotide stability study and the PCR performance test, we can conclude that the Adh1 (136) reference assay (T25 and Bt11 assays) as well as the tested high mobility group protein gene assay, which also form parts of CRL methods for quantification, are highly reliable. Despite the observed uniformity in the nucleotide sequence of the invertase gene assay, the PCR performance test reveals that this target sequence might occur in more than one copy. Finally, although currently not forming a part of official quantification methods, zein and SSIIb assays are found to be highly reliable in terms of nucleotide stability and PCR performance and are proposed as good alternative targets for a reference assay for maize.

Biological nanopore MspA for DNA sequencing

NASA Astrophysics Data System (ADS)

Manrao, Elizabeth A.

Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.

Analysis of the nucleoprotein gene identifies three distinct lineages of viral haemorrhagic septicemia virus (VHSV) within the European marine environment

USGS Publications Warehouse

Snow, M.; Cunningham, C.O.; Melvin, W.T.; Kurath, G.

1999-01-01

A ribonuclease (RNase) protection assay (RPA) has been used to detect nucleotide sequence variation within the nucleoprotein gene of 39 viral haemorrhagic septicaemia virus (VHSV) isolates of European marine origin. The classification of VHSV isolates based on RPA cleavage patterns permitted the identification of ten distinct groups of viruses based on differences at the molecular level. The nucleotide sequence of representatives of each of these groupings was determined and subjected to phylogenetic analysis. This revealed grouping of the European marine isolates of VHSV into three genotypes circulating within distinct geographic areas. A fourth genotype was identified comprising isolates originating from North America. Phylogenetic analyses indicated that VHSV isolates recovered from wild caught fish around the British Isles were genetically related to isolates responsible for losses in farmed turbot. Furthermore, a relationship between naturally occurring marine isolates and VHSV isolates causing mortality among rainbow trout in continental Europe was demonstrated. Analysis of the nucleoprotein gene identifies distinct lineages of viral haemorrhagic septicaemia virus within the European marine environment. Virus Res. 63, 35-44. Available from: 

A new genetic variant in the Sp1 binding cis-element of cholecystokinin gene promoter region and relationship to alcoholism.

PubMed

Harada, S; Okubo, T; Tsutsumi, M; Takase, S; Muramatsu, T

1998-05-01

Neuropeptide cholecystokinin (CCK) and the CCK receptors in the central nervous system mediate actions on increasing firings, anxiety, and nociceptions. Furthermore, CCK modulates the release of dopamine and dopamine-related behaviors in the mesolimbic pathway. In our study, genetic variation in the promoter and coding regions of the prepro-CCK gene were analyzed among 66 Japanese, 66 American Whites, 54 Chinese, and 41 Colombian natives. Two nucleotide sequence variants were found: a frequent mutation at nucleotide position -45 C to T involved in core sequence of Sp1 binding cis-element of the promoter region, and a C to T substitution at the 1662 position in intron 2. Analysis for the segregation study in 10 families of twins confirmed codominant heredity of two alleles. Distribution of genotypes and gene frequencies of 66 controls and 108 alcoholics in Japan presented that allelic variant T type in alcoholics was found in higher frequencies than that of controls, and distribution of these genotypes was significantly different between the both groups.

Sequence variations of the partially dominant DELLA gene Rht-B1c in wheat and their functional impacts

PubMed Central

Ma, Zhengqiang

2013-01-01

Rht-B1c, allelic to the DELLA protein-encoding gene Rht-B1a, is a natural mutation documented in common wheat (Triticum aestivum). It confers variation to a number of traits related to cell and plant morphology, seed dormancy, and photosynthesis. The present study was conducted to examine the sequence variations of Rht-B1c and their functional impacts. The results showed that Rht-B1c was partially dominant or co-dominant for plant height, and exhibited an increased dwarfing effect. At the sequence level, Rht-B1c differed from Rht-B1a by one 2kb Veju retrotransposon insertion, three coding region single nucleotide polymorphisms (SNPs), one 197bp insertion, and four SNPs in the 1kb upstream sequence. Haplotype investigations, association analyses, transient expression assays, and expression profiling showed that the Veju insertion was primarily responsible for the extreme dwarfing effect. It was found that the Veju insertion changed processing of the Rht-B1c transcripts and resulted in DELLA motif primary structure disruption. Expression assays showed that Rht-B1c caused reduction of total Rht-1 transcript levels, and up-regulation of GATA-like transcription factors and genes positively regulated by these factors, suggesting that one way in which Rht-1 proteins affect plant growth and development is through GATA-like transcription factor regulation. PMID:23918966

Theileria parva antigens recognized by CD8+ T cells show varying degrees of diversity in buffalo-derived infected cell lines.

PubMed

Sitt, Tatjana; Pelle, Roger; Chepkwony, Maurine; Morrison, W Ivan; Toye, Philip

2018-05-06

The extent of sequence diversity among the genes encoding 10 antigens (Tp1-10) known to be recognized by CD8+ T lymphocytes from cattle immune to Theileria parva was analysed. The sequences were derived from parasites in 23 buffalo-derived cell lines, three cattle-derived isolates and one cloned cell line obtained from a buffalo-derived stabilate. The results revealed substantial variation among the antigens through sequence diversity. The greatest nucleotide and amino acid diversity were observed in Tp1, Tp2 and Tp9. Tp5 and Tp7 showed the least amount of allelic diversity, and Tp5, Tp6 and Tp7 had the lowest levels of protein diversity. Tp6 was the most conserved protein; only a single non-synonymous substitution was found in all obtained sequences. The ratio of non-synonymous: synonymous substitutions varied from 0.84 (Tp1) to 0.04 (Tp6). Apart from Tp2 and Tp9, we observed no variation in the other defined CD8+ T cell epitopes (Tp4, 5, 7 and 8), indicating that epitope variation is not a universal feature of T. parva antigens. In addition to providing markers that can be used to examine the diversity in T. parva populations, the results highlight the potential for using conserved antigens to develop vaccines that provide broad protection against T. parva.

VCGDB: a dynamic genome database of the Chinese population

PubMed Central

2014-01-01

Background The data released by the 1000 Genomes Project contain an increasing number of genome sequences from different nations and populations with a large number of genetic variations. As a result, the focus of human genome studies is changing from single and static to complex and dynamic. The currently available human reference genome (GRCh37) is based on sequencing data from 13 anonymous Caucasian volunteers, which might limit the scope of genomics, transcriptomics, epigenetics, and genome wide association studies. Description We used the massive amount of sequencing data published by the 1000 Genomes Project Consortium to construct the Virtual Chinese Genome Database (VCGDB), a dynamic genome database of the Chinese population based on the whole genome sequencing data of 194 individuals. VCGDB provides dynamic genomic information, which contains 35 million single nucleotide variations (SNVs), 0.5 million insertions/deletions (indels), and 29 million rare variations, together with genomic annotation information. VCGDB also provides a highly interactive user-friendly virtual Chinese genome browser (VCGBrowser) with functions like seamless zooming and real-time searching. In addition, we have established three population-specific consensus Chinese reference genomes that are compatible with mainstream alignment software. Conclusions VCGDB offers a feasible strategy for processing big data to keep pace with the biological data explosion by providing a robust resource for genomics studies; in particular, studies aimed at finding regions of the genome associated with diseases. PMID:24708222

First report of Beet western yellows virus infecting Epiphyllum spp

USDA-ARS?s Scientific Manuscript database

Beet western yellow virus (BWYV) was identified from an orchid cactus (Epiphyllum spp.) hybrid without obvious symptoms by high-throughput sequencing. The nearly complete genomic sequence of 5,458 nucleotides of the virus was determined. The isolate has the highest nucleotide sequence identity (93%)...

A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Nucleotide diversity and linkage disequilibrium in wild avocado (Persea americana Mill.).

PubMed

Chen, Haofeng; Morrell, Peter L; de la Cruz, Marlene; Clegg, Michael T

2008-01-01

Resequencing studies provide the ultimate resolution of genetic diversity because they identify all mutations in a gene that are present within the sampled individuals. We report a resequencing study of Persea americana, a subtropical tree species native to Meso- and Central America and the progenitor of cultivated avocado. The sample includes 21 wild accessions from Mexico, Costa Rica, Ecuador, and the Dominican Republic. Estimated levels of nucleotide polymorphism and linkage disequilibrium (LD) are obtained from fully resolved haplotype data from 4 nuclear loci that span 5960 nucleotide sites. Results show that, although avocado is a subtropical tree crop and a predominantly outcrossing plant, the overall level of genetic variation is not exceptionally high (nucleotide diversity at silent sites, pi(sil) = 0.0102) compared with available estimates from temperate plant species. Intralocus LD decays rapidly to half the initial value within about 1 kb. Estimates of recombination rate (based on the sequence data) show that the rate is not exceptionally high when compared with annual plants such as wild barley or maize. Interlocus LD is significant owing to substantial population structure induced by mixing of the 3 botanical races of avocado.

Methodologic European external quality assurance for DNA sequencing: the EQUALseq program.

PubMed

Ahmad-Nejad, Parviz; Dorn-Beineke, Alexandra; Pfeiffer, Ulrike; Brade, Joachim; Geilenkeuser, Wolf-Jochen; Ramsden, Simon; Pazzagli, Mario; Neumaier, Michael

2006-04-01

DNA sequencing is a key technique in molecular diagnostics, but to date no comprehensive methodologic external quality assessment (EQA) programs have been instituted. Between 2003 and 2005, the European Union funded, as specific support actions, the EQUAL initiative to develop methodologic EQA schemes for genotyping (EQUALqual), quantitative PCR (EQUALquant), and sequencing (EQUALseq). Here we report on the results of the EQUALseq program. The participating laboratories received a 4-sample set comprising 2 DNA plasmids, a PCR product, and a finished sequencing reaction to be analyzed. Data and information from detailed questionnaires were uploaded online and evaluated by use of a scoring system for technical skills and proficiency of data interpretation. Sixty laboratories from 21 European countries registered, and 43 participants (72%) returned data and samples. Capillary electrophoresis was the predominant platform (n = 39; 91%). The median contiguous correct sequence stretch was 527 nucleotides with considerable variation in quality of both primary data and data evaluation. The association between laboratory performance and the number of sequencing assays/year was statistically significant (P <0.05). Interestingly, more than 30% of participants neither added comments to their data nor made efforts to identify the gene sequences or mutational positions. Considerable variations exist even in a highly standardized methodology such as DNA sequencing. Methodologic EQAs are appropriate tools to uncover strengths and weaknesses in both technique and proficiency, and our results emphasize the need for mandatory EQAs. The results of EQUALseq should help improve the overall quality of molecular genetics findings obtained by DNA sequencing.

Genome Analysis of the Domestic Dog (Korean Jindo) by Massively Parallel Sequencing

PubMed Central

Kim, Ryong Nam; Kim, Dae-Soo; Choi, Sang-Haeng; Yoon, Byoung-Ha; Kang, Aram; Nam, Seong-Hyeuk; Kim, Dong-Wook; Kim, Jong-Joo; Ha, Ji-Hong; Toyoda, Atsushi; Fujiyama, Asao; Kim, Aeri; Kim, Min-Young; Park, Kun-Hyang; Lee, Kang Seon; Park, Hong-Seog

2012-01-01

Although pioneering sequencing projects have shed light on the boxer and poodle genomes, a number of challenges need to be met before the sequencing and annotation of the dog genome can be considered complete. Here, we present the DNA sequence of the Jindo dog genome, sequenced to 45-fold average coverage using Illumina massively parallel sequencing technology. A comparison of the sequence to the reference boxer genome led to the identification of 4 675 437 single nucleotide polymorphisms (SNPs, including 3 346 058 novel SNPs), 71 642 indels and 8131 structural variations. Of these, 339 non-synonymous SNPs and 3 indels are located within coding sequences (CDS). In particular, 3 non-synonymous SNPs and a 26-bp deletion occur in the TCOF1 locus, implying that the difference observed in cranial facial morphology between Jindo and boxer dogs might be influenced by those variations. Through the annotation of the Jindo olfactory receptor gene family, we found 2 unique olfactory receptor genes and 236 olfactory receptor genes harbouring non-synonymous homozygous SNPs that are likely to affect smelling capability. In addition, we determined the DNA sequence of the Jindo dog mitochondrial genome and identified Jindo dog-specific mtDNA genotypes. This Jindo genome data upgrade our understanding of dog genomic architecture and will be a very valuable resource for investigating not only dog genetics and genomics but also human and dog disease genetics and comparative genomics. PMID:22474061

Enhanced Gene Expression Rather than Natural Polymorphism in Coding Sequence of the OsbZIP23 Determines Drought Tolerance and Yield Improvement in Rice Genotypes

PubMed Central

Dey, Avishek; Samanta, Milan Kumar; Gayen, Srimonta; Sen, Soumitra K.; Maiti, Mrinal K.

2016-01-01

Drought is one of the major limiting factors for productivity of crops including rice (Oryza sativa L.). Understanding the role of allelic variations of key regulatory genes involved in stress-tolerance is essential for developing an effective strategy to combat drought. The bZIP transcription factors play a crucial role in abiotic-stress adaptation in plants via abscisic acid (ABA) signaling pathway. The present study aimed to search for allelic polymorphism in the OsbZIP23 gene across selected drought-tolerant and drought-sensitive rice genotypes, and to characterize the new allele through overexpression (OE) and gene-silencing (RNAi). Analyses of the coding DNA sequence (CDS) of the cloned OsbZIP23 gene revealed single nucleotide polymorphism at four places and a 15-nucleotide deletion at one place. The single-copy OsbZIP23 gene is expressed at relatively higher level in leaf tissues of drought-tolerant genotypes, and its abundance is more in reproductive stage. Cloning and sequence analyses of the OsbZIP23-promoter from drought-tolerant O. rufipogon and drought-sensitive IR20 cultivar showed variation in the number of stress-responsive cis-elements and a 35-nucleotide deletion at 5’-UTR in IR20. Analysis of the GFP reporter gene function revealed that the promoter activity of O. rufipogon is comparatively higher than that of IR20. The overexpression of any of the two polymorphic forms (1083 bp and 1068 bp CDS) of OsbZIP23 improved drought tolerance and yield-related traits significantly by retaining higher content of cellular water, soluble sugar and proline; and exhibited decrease in membrane lipid peroxidation in comparison to RNAi lines and non-transgenic plants. The OE lines showed higher expression of target genes-OsRab16B, OsRab21 and OsLEA3-1 and increased ABA sensitivity; indicating that OsbZIP23 is a positive transcriptional-regulator of the ABA-signaling pathway. Taken together, the present study concludes that the enhanced gene expression rather than natural polymorphism in coding sequence of OsbZIP23 is accountable for improved drought tolerance and yield performance in rice genotypes. PMID:26959651

Climate change and oceanic barriers: genetic differentiation in Pomatomus saltatrix (Pisces: Pomatomidae) in the North Atlantic Ocean and the Mediterranean Sea.

PubMed

Pardiñas, A F; Campo, D; Pola, I G; Miralles, L; Juanes, F; Garcia-Vazquez, E

2010-11-01

Nucleotide variation of partial cytochrome b sequences was analysed in the bluefish Pomatomus saltatrix to investigate the population-structuring roles of climate change and oceanic barriers. Western and eastern North Atlantic Ocean populations appeared to be totally isolated, with the latter connected to the Mediterranean Sea within which further structuring occurred. © 2010 The Authors. Journal of Fish Biology © 2010 The Fisheries Society of the British Isles.

Equalizer reduces SNP bias in Affymetrix microarrays.

PubMed

Quigley, David

2015-07-30

Gene expression microarrays measure the levels of messenger ribonucleic acid (mRNA) in a sample using probe sequences that hybridize with transcribed regions. These probe sequences are designed using a reference genome for the relevant species. However, most model organisms and all humans have genomes that deviate from their reference. These variations, which include single nucleotide polymorphisms, insertions of additional nucleotides, and nucleotide deletions, can affect the microarray's performance. Genetic experiments comparing individuals bearing different population-associated single nucleotide polymorphisms that intersect microarray probes are therefore subject to systemic bias, as the reduction in binding efficiency due to a technical artifact is confounded with genetic differences between parental strains. This problem has been recognized for some time, and earlier methods of compensation have attempted to identify probes affected by genome variants using statistical models. These methods may require replicate microarray measurement of gene expression in the relevant tissue in inbred parental samples, which are not always available in model organisms and are never available in humans. By using sequence information for the genomes of organisms under investigation, potentially problematic probes can now be identified a priori. However, there is no published software tool that makes it easy to eliminate these probes from an annotation. I present equalizer, a software package that uses genome variant data to modify annotation files for the commonly used Affymetrix IVT and Gene/Exon platforms. These files can be used by any microarray normalization method for subsequent analysis. I demonstrate how use of equalizer on experiments mapping germline influence on gene expression in a genetic cross between two divergent mouse species and in human samples significantly reduces probe hybridization-induced bias, reducing false positive and false negative findings. The equalizer package reduces probe hybridization bias from experiments performed on the Affymetrix microarray platform, allowing accurate assessment of germline influence on gene expression.

Spontaneous Mutation Rate in the Smallest Photosynthetic Eukaryotes

PubMed Central

Krasovec, Marc; Eyre-Walker, Adam; Sanchez-Ferandin, Sophie

2017-01-01

Abstract Mutation is the ultimate source of genetic variation, and knowledge of mutation rates is fundamental for our understanding of all evolutionary processes. High throughput sequencing of mutation accumulation lines has provided genome wide spontaneous mutation rates in a dozen model species, but estimates from nonmodel organisms from much of the diversity of life are very limited. Here, we report mutation rates in four haploid marine bacterial-sized photosynthetic eukaryotic algae; Bathycoccus prasinos, Ostreococcus tauri, Ostreococcus mediterraneus, and Micromonas pusilla. The spontaneous mutation rate between species varies from μ = 4.4 × 10−10 to 9.8 × 10−10 mutations per nucleotide per generation. Within genomes, there is a two-fold increase of the mutation rate in intergenic regions, consistent with an optimization of mismatch and transcription-coupled DNA repair in coding sequences. Additionally, we show that deviation from the equilibrium GC content increases the mutation rate by ∼2% to ∼12% because of a GC bias in coding sequences. More generally, the difference between the observed and equilibrium GC content of genomes explains some of the inter-specific variation in mutation rates. PMID:28379581

RNA circularization reveals terminal sequence heterogeneity in a double-stranded RNA virus.

PubMed

Widmer, G

1993-03-01

Double-stranded RNA viruses (dsRNA), termed LRV1, have been found in several strains of the protozoan parasite Leishmania. With the aim of constructing a full-length cDNA copy of the viral genome, including its terminal sequences, a protocol based on PCR amplification across the 3'-5' junction of circularized RNA was developed. This method proved to be applicable to dsRNA. It provided a relatively simple alternative to one-sided PCR, without loss of specificity inherent in the use of generic primers. LRV1 terminal nucleotide sequences obtained by this method showed a considerable variation in length, particularly at the 5' end of the positive strand, as well as the potential for forming 3' overhangs. The opposite genomic end terminates in 0, 1, or 2 TCA trinucleotide repeats. These results are compared with terminal sequences derived from one-sided PCR experiments.

Two‐phase designs for joint quantitative‐trait‐dependent and genotype‐dependent sampling in post‐GWAS regional sequencing

PubMed Central

Espin‐Garcia, Osvaldo; Craiu, Radu V.

2017-01-01

ABSTRACT We evaluate two‐phase designs to follow‐up findings from genome‐wide association study (GWAS) when the cost of regional sequencing in the entire cohort is prohibitive. We develop novel expectation‐maximization‐based inference under a semiparametric maximum likelihood formulation tailored for post‐GWAS inference. A GWAS‐SNP (where SNP is single nucleotide polymorphism) serves as a surrogate covariate in inferring association between a sequence variant and a normally distributed quantitative trait (QT). We assess test validity and quantify efficiency and power of joint QT‐SNP‐dependent sampling and analysis under alternative sample allocations by simulations. Joint allocation balanced on SNP genotype and extreme‐QT strata yields significant power improvements compared to marginal QT‐ or SNP‐based allocations. We illustrate the proposed method and evaluate the sensitivity of sample allocation to sampling variation using data from a sequencing study of systolic blood pressure. PMID:29239496

Sequence of the tomato chloroplast DNA and evolutionary comparison of solanaceous plastid genomes.

PubMed

Kahlau, Sabine; Aspinall, Sue; Gray, John C; Bock, Ralph

2006-08-01

Tomato, Solanum lycopersicum (formerly Lycopersicon esculentum), has long been one of the classical model species of plant genetics. More recently, solanaceous species have become a model of evolutionary genomics, with several EST projects and a tomato genome project having been initiated. As a first contribution toward deciphering the genetic information of tomato, we present here the complete sequence of the tomato chloroplast genome (plastome). The size of this circular genome is 155,461 base pairs (bp), with an average AT content of 62.14%. It contains 114 genes and conserved open reading frames (ycfs). Comparison with the previously sequenced plastid DNAs of Nicotiana tabacum and Atropa belladonna reveals patterns of plastid genome evolution in the Solanaceae family and identifies varying degrees of conservation of individual plastid genes. In addition, we discovered several new sites of RNA editing by cytidine-to-uridine conversion. A detailed comparison of editing patterns in the three solanaceous species highlights the dynamics of RNA editing site evolution in chloroplasts. To assess the level of intraspecific plastome variation in tomato, the plastome of a second tomato cultivar was sequenced. Comparison of the two genotypes (IPA-6, bred in South America, and Ailsa Craig, bred in Europe) revealed no nucleotide differences, suggesting that the plastomes of modern tomato cultivars display very little, if any, sequence variation.

Alternative SNP detection platforms, HRM and biosensors, for varietal identification in Vitis vinifera L. using F3H and LDOX genes.

PubMed

Gomes, Sónia; Castro, Cláudia; Barrias, Sara; Pereira, Leonor; Jorge, Pedro; Fernandes, José R; Martins-Lopes, Paula

2018-04-11

The wine sector requires quick and reliable methods for Vitis vinifera L. varietal identification. The number of V. vinifera varieties is estimated in about 5,000 worldwide. Single Nucleotide Polymorphisms (SNPs) represent the most basic and abundant form of genetic sequence variation, being adequate for varietal discrimination. The aim of this work was to develop DNA-based assays suitable to detect SNP variation in V. vinifera, allowing varietal discrimination. Genotyping by sequencing allowed the detection of eleven SNPs on two genes of the anthocyanin pathway, the flavanone 3-hydroxylase (F3H, EC: 1.14.11.9), and the leucoanthocyanidin dioxygenase (LDOX, EC 1.14.11.19; synonym anthocyanidin synthase, ANS) in twenty V. vinifera varieties. Three High Resolution Melting (HRM) assays were designed based on the sequencing information, discriminating five of the 20 varieties: Alicante Bouschet, Donzelinho Tinto, Merlot, Moscatel Galego and Tinta Roriz. Sanger sequencing of the HRM assay products confirmed the HRM profiles. Three probes, with different lengths and sequences, were used as bio-recognition elements in an optical biosensor platform based on a long period grating (LPG) fiber optic sensor. The label free platform detected a difference of a single SNP using genomic DNA samples. The two different platforms were successfully applied for grapevine varietal identification.

Allele frequencies of variants in ultra conserved elements identify selective pressure on transcription factor binding.

PubMed

Silla, Toomas; Kepp, Katrin; Tai, E Shyong; Goh, Liang; Davila, Sonia; Catela Ivkovic, Tina; Calin, George A; Voorhoeve, P Mathijs

2014-01-01

Ultra-conserved genes or elements (UCGs/UCEs) in the human genome are extreme examples of conservation. We characterized natural variations in 2884 UCEs and UCGs in two distinct populations; Singaporean Chinese (n = 280) and Italian (n = 501) by using a pooled sample, targeted capture, sequencing approach. We identify, with high confidence, in these regions the abundance of rare SNVs (MAF<0.5%) of which 75% is not present in dbSNP137. UCEs association studies for complex human traits can use this information to model expected background variation and thus necessary power for association studies. By combining our data with 1000 Genome Project data, we show in three independent datasets that prevalent UCE variants (MAF>5%) are more often found in relatively less-conserved nucleotides within UCEs, compared to rare variants. Moreover, prevalent variants are less likely to overlap transcription factor binding site. Using SNPfold we found no significant influence of RNA secondary structure on UCE conservation. All together, these results suggest UCEs are not under selective pressure as a stretch of DNA but are under differential evolutionary pressure on the single nucleotide level.

Historical DNA reveals the demographic history of Atlantic cod (Gadus morhua) in medieval and early modern Iceland

PubMed Central

Ólafsdóttir, Guðbjörg Ásta; Westfall, Kristen M.; Edvardsson, Ragnar; Pálsson, Snæbjörn

2014-01-01

Atlantic cod (Gadus morhua) vertebrae from archaeological sites were used to study the history of the Icelandic Atlantic cod population in the time period of 1500–1990. Specifically, we used coalescence modelling to estimate population size and fluctuations from the sequence diversity at the cytochrome b (cytb) and Pantophysin I (PanI) loci. The models are consistent with an expanding population during the warm medieval period, large historical effective population size (NE), a marked bottleneck event at 1400–1500 and a decrease in NE in early modern times. The model results are corroborated by the reduction of haplotype and nucleotide variation over time and pairwise population distance as a significant portion of nucleotide variation partitioned across the 1550 time mark. The mean age of the historical fished stock is high in medieval times with a truncation in age in early modern times. The population size crash coincides with a period of known cooling in the North Atlantic, and we conclude that the collapse may be related to climate or climate-induced ecosystem change. PMID:24403343

Historical DNA reveals the demographic history of Atlantic cod (Gadus morhua) in medieval and early modern Iceland.

PubMed

Ólafsdóttir, Guðbjörg Ásta; Westfall, Kristen M; Edvardsson, Ragnar; Pálsson, Snæbjörn

2014-02-22

Atlantic cod (Gadus morhua) vertebrae from archaeological sites were used to study the history of the Icelandic Atlantic cod population in the time period of 1500-1990. Specifically, we used coalescence modelling to estimate population size and fluctuations from the sequence diversity at the cytochrome b (cytb) and Pantophysin I (PanI) loci. The models are consistent with an expanding population during the warm medieval period, large historical effective population size (NE), a marked bottleneck event at 1400-1500 and a decrease in NE in early modern times. The model results are corroborated by the reduction of haplotype and nucleotide variation over time and pairwise population distance as a significant portion of nucleotide variation partitioned across the 1550 time mark. The mean age of the historical fished stock is high in medieval times with a truncation in age in early modern times. The population size crash coincides with a period of known cooling in the North Atlantic, and we conclude that the collapse may be related to climate or climate-induced ecosystem change.

[Study on the genetic difference of SEO type Hantaviruses].

PubMed

Zhang, X; Zhou, S; Wang, H; Hu, J; Guan, Z; Liu, H

2000-10-01

To understand the genetic type of Hantaviruses and the difference between them caused by rodents in Beijing and to furhter explore the source of the infectious factors. Hantavirus RNA, isolated from lungs of rodents captured in Beijing and positive with Hantavirus antigens with frozen sectioning and Immunofluorescent assay, were reverse-transcribed and amplified with PCR with Hantavirus-specific primers. Five of the PCR amplifications were discovered and sequenced with 300 bp sequence data of M segments (from 2003 - 2302nt according cDNA of seoul 8039 strain). Nucleotide sequence homology showed that they were sequences of SEO-type Hantavirus. Compared with SEO type Hantavirus, the nucleotide sequence homology of these samples was more than 94% while the homology of amonia acid sequence was more than 98%. When compared with HNT type Hantavirus, the homology of nucleotide sequence became less than 72% with the homology of amonia acid sequence less than 81%. Similar to other Hantavirus of SEO type, their nucleotide sequences and deduced amino acid sequences were highly preserved. Phylogenetic tree analysis showed that the five viruses could be divided into at least 4 branches. It was quite likely that there were at least two sub-type SEO viruses with 4 branches that were circulating in Beijing.

Rumen Bacterial Diversity of 80 to 110-Day-Old Goats Using 16S rRNA Sequencing

PubMed Central

Han, Xufeng; Yang, Yuxin; Yan, Hailong; Wang, Xiaolong; Qu, Lei; Chen, Yulin

2015-01-01

The ability of rumen microorganisms to use fibrous plant matter plays an important role in ruminant animals; however, little information about rumen colonization by microbial populations after weaning has been reported. In this study, high-throughput sequencing was used to investigate the establishment of this microbial population in 80 to 110-day-old goats. Illumina sequencing of goat rumen samples yielded 101,356,610 nucleotides that were assembled into 256,868 reads with an average read length of 394 nucleotides. Taxonomic analysis of metagenomic reads indicated that the predominant phyla were distinct at different growth stages. The phyla Firmicutes and Synergistetes were predominant in samples taken from 80 to 100-day-old goats, but Bacteroidetes and Firmicutes became the most abundant phyla in samples from 110-day-old animals. There was a remarkable variation in the microbial populations with age; Firmicutes and Synergistetes decreased after weaning, but Bacteroidetes and Proteobacteria increased from 80 to 110 day of age. These findings suggested that colonization of the rumen by microorganisms is related to their function in the rumen digestive system. These results give a better understanding of the role of rumen microbes and the establishment of the microbial population, which help to maintain the host’s health and improve animal performance. PMID:25700157

Brief Overview of a Decade of Genome-Wide Association Studies on Primary Hypertension.

PubMed

Azam, Afifah Binti; Azizan, Elena Aisha Binti

2018-01-01

Primary hypertension is widely believed to be a complex polygenic disorder with the manifestation influenced by the interactions of genomic and environmental factors making identification of susceptibility genes a major challenge. With major advancement in high-throughput genotyping technology, genome-wide association study (GWAS) has become a powerful tool for researchers studying genetically complex diseases. GWASs work through revealing links between DNA sequence variation and a disease or trait with biomedical importance. The human genome is a very long DNA sequence which consists of billions of nucleotides arranged in a unique way. A single base-pair change in the DNA sequence is known as a single nucleotide polymorphism (SNP). With the help of modern genotyping techniques such as chip-based genotyping arrays, thousands of SNPs can be genotyped easily. Large-scale GWASs, in which more than half a million of common SNPs are genotyped and analyzed for disease association in hundreds of thousands of cases and controls, have been broadly successful in identifying SNPs associated with heart diseases, diabetes, autoimmune diseases, and psychiatric disorders. It is however still debatable whether GWAS is the best approach for hypertension. The following is a brief overview on the outcomes of a decade of GWASs on primary hypertension.

ESTs from Seeds to Assist the Selective Breeding of Jatropha curcas L. for Oil and Active Compounds

PubMed Central

Gomes, Kleber A; Almeida, Tiago C; Gesteira, Abelmon S; Lôbo, Ivon P; Guimarães, Ana Carolina R; de Miranda, Antonio B; Van Sluys, Marie-Anne; da Cruz, Rosenira S; Cascardo, Júlio CM; Carels, Nicolas

2010-01-01

We report here on the characterization of a cDNA library from seeds of Jatropha curcas L. at three stages of fruit maturation before yellowing. We sequenced a total of 2200 clones and obtained a set of 931 non-redundant sequences (unigenes) after trimming and quality control, ie, 140 contigs and 791 singlets with PHRED quality ≥10. We found low levels of sequence redundancy and extensive metabolic coverage by homology comparison to GO. After comparison of 5841 non-redundant ESTs from a total of 13193 reads from GenBank with KEGG, we identified tags with nucleotide variations among J. curcas accessions for genes of fatty acid, terpene, alkaloid, quinone and hormone pathways of biosynthesis. More specifically, the expression level of four genes (palmitoyl-acyl carrier protein thioesterase, 3-ketoacyl-CoA thiolase B, lysophosphatidic acid acyltransferase and geranyl pyrophosphate synthase) measured by real-time PCR proved to be significantly different between leaves and fruits. Since the nucleotide polymorphism of these tags is associated to higher level of gene expression in fruits compared to leaves, we propose this approach to speed up the search for quantitative traits in selective breeding of J. curcas. We also discuss its potential utility for the selective breeding of economically important traits in J. curcas. PMID:26217103

[Genetic characterization of different populations of Rhopilema esculentum based on the mitochondrial COI sequence.

PubMed

Li, Yu Long; Dong, Jing; Wang, Bin; Li, Yi Ping; Yu, Xu Guang; Fu, Jie; Wang, Wen Bo

2016-07-01

To investigate the genetic characterization and population genetic structure of Rhopilema esculentum, we sequenced the mtDNA COI gene (624 bp) in 56 individuals collected from Liaodong Bay and the Ganghwado Island in the estuarine waters of the Han River. In addition, the homologous sequences of other 15 individuals which were sampled from the Bohai and Yellow seas and Sea of Japan were analyzed. A total of 28 polymorphic nucleotide sites were detected among the 71 individuals, which defined 32 haplotypes. Haplotype diversity levels were high (0.91±0.06-0.94±0.01) in R. esculentum populations, whereas those of nucleotide diversity were moderate to low [(0.60±0.34)%-(0.68±0.40)%]. Compared with several other giant jellyfish species, the variation level of R. esculentum was high. Phylogeographic analysis of the COI region revealed two lineages. The pairwise F ST comparison and hierarchical molecular variance analysis (AMOVA) showed that significant population structure existed throughout the range of R. esculentum. The results of this study indicated that the life-cycle characteristics, together with possible anthropogenic introduction such as stock enhancement and the prevailing ocean currents in this region, were proposed as the main factors that determined the genetic patterns of R. esculentum.

Analysis of Nucleotide Variations in Genes of Iron Management in Patients of Parkinson's Disease and Other Movement Disorders

PubMed Central

Castiglioni, Emanuela; Finazzi, Dario; Goldwurm, Stefano; Pezzoli, Gianni; Forni, Gianluca; Girelli, Domenico; Maccarinelli, Federica; Poli, Maura; Ferrari, Maurizio; Cremonesi, Laura; Arosio, Paolo

2011-01-01

The capacity to act as an electron donor and acceptor makes iron an essential cofactor of many vital processes. Its balance in the body has to be tightly regulated since its excess can be harmful by favouring oxidative damage, while its deficiency can impair fundamental activities like erythropoiesis. In the brain, an accumulation of iron or an increase in its availability has been associated with the development and/or progression of different degenerative processes, including Parkinson's disease, while iron paucity seems to be associated with cognitive deficits, motor dysfunction, and restless legs syndrome. In the search of DNA sequence variations affecting the individual predisposition to develop movement disorders, we scanned by DHPLC the exons and intronic boundary regions of ceruloplasmin, iron regulatory protein 2, hemopexin, hepcidin and hemojuvelin genes in cohorts of subjects affected by Parkinson's disease and idiopathic neurodegeneration with brain iron accumulation (NBIA). Both novel and known sequence variations were identified in most of the genes, but none of them seemed to be significantly associated to the movement diseases of interest. PMID:20981230

Whole genome re-sequencing of date palms yields insights into diversification of a fruit tree crop.

PubMed

Hazzouri, Khaled M; Flowers, Jonathan M; Visser, Hendrik J; Khierallah, Hussam S M; Rosas, Ulises; Pham, Gina M; Meyer, Rachel S; Johansen, Caryn K; Fresquez, Zoë A; Masmoudi, Khaled; Haider, Nadia; El Kadri, Nabila; Idaghdour, Youssef; Malek, Joel A; Thirkhill, Deborah; Markhand, Ghulam S; Krueger, Robert R; Zaid, Abdelouahhab; Purugganan, Michael D

2015-11-09

Date palms (Phoenix dactylifera) are the most significant perennial crop in arid regions of the Middle East and North Africa. Here, we present a comprehensive catalogue of approximately seven million single nucleotide polymorphisms in date palms based on whole genome re-sequencing of a collection of 62 cultivars. Population structure analysis indicates a major genetic divide between North Africa and the Middle East/South Asian date palms, with evidence of admixture in cultivars from Egypt and Sudan. Genome-wide scans for selection suggest at least 56 genomic regions associated with selective sweeps that may underlie geographic adaptation. We report candidate mutations for trait variation, including nonsense polymorphisms and presence/absence variation in gene content in pathways for key agronomic traits. We also identify a copia-like retrotransposon insertion polymorphism in the R2R3 myb-like orthologue of the oil palm virescens gene associated with fruit colour variation. This analysis documents patterns of post-domestication diversification and provides a genomic resource for this economically important perennial tree crop.

Whole-genome analysis of a patient with early-stage small-cell lung cancer.

PubMed

Han, J-Y; Lee, Y-S; Kim, B C; Lee, G K; Lee, S; Kim, E-H; Kim, H-M; Bhak, J

2014-12-01

We performed whole-genome sequencing (WGS) of a case of early-stage small-cell lung cancer (SCLC) to analyze the genomic features. WGS revealed a lot of single-nucleotide variations (SNVs), small insertion/deletions and chromosomal abnormality. Chromosomes 4p, 5q, 13q, 15q, 17p and 22q contained many block deletions. Especially, copy loss was observed in tumor suppressor genes RB1 and TP53, and copy gain in oncogene hTERT. Somatic mutations were found in TP53 and CREBBP. Novel nonsynonymous (ns) SNVs in C6ORF103 and SLC5A4 genes were also found. Sanger sequencing of the SLC5A4 gene in 23 independent SCLC samples showed another nsSNV in the SLC5A4 gene, indicating that nsSNVs in the SLC5A4 gene are recurrent in SCLC. WGS of an early-stage SCLC identified novel recurrent mutations and validated known variations, including copy number variations. These findings provide insight into the genomic landscape contributing to SCLC development.

Whole genome re-sequencing of date palms yields insights into diversification of a fruit tree crop

PubMed Central

Hazzouri, Khaled M.; Flowers, Jonathan M.; Visser, Hendrik J.; Khierallah, Hussam S. M.; Rosas, Ulises; Pham, Gina M.; Meyer, Rachel S.; Johansen, Caryn K.; Fresquez, Zoë A.; Masmoudi, Khaled; Haider, Nadia; El Kadri, Nabila; Idaghdour, Youssef; Malek, Joel A.; Thirkhill, Deborah; Markhand, Ghulam S.; Krueger, Robert R.; Zaid, Abdelouahhab; Purugganan, Michael D.

2015-01-01

Date palms (Phoenix dactylifera) are the most significant perennial crop in arid regions of the Middle East and North Africa. Here, we present a comprehensive catalogue of approximately seven million single nucleotide polymorphisms in date palms based on whole genome re-sequencing of a collection of 62 cultivars. Population structure analysis indicates a major genetic divide between North Africa and the Middle East/South Asian date palms, with evidence of admixture in cultivars from Egypt and Sudan. Genome-wide scans for selection suggest at least 56 genomic regions associated with selective sweeps that may underlie geographic adaptation. We report candidate mutations for trait variation, including nonsense polymorphisms and presence/absence variation in gene content in pathways for key agronomic traits. We also identify a copia-like retrotransposon insertion polymorphism in the R2R3 myb-like orthologue of the oil palm virescens gene associated with fruit colour variation. This analysis documents patterns of post-domestication diversification and provides a genomic resource for this economically important perennial tree crop. PMID:26549859

[Genetic structure of Hemibarbus labeo and Hemibarbus medius in South China based on mtDNA COI and ND5 genes].

PubMed

Lan, Zhao Jun; Lin, Long Feng; Zhao, Jun

2017-04-18

Both Hemibarbus labeo and H. medius (Cypriniformes: Cyprinidae: Gobioninae) are primary freshwater fishes and are widely distributed. As such, they provide an ideal model for phylogeographical studies. However, the similarity in morphological characters between these two species made the description of their distributions and the validation of species quite challenging. Here we employed variations in the DNA sequences of mitochondrial COI and ND5 genes (2151 bp) to solve this challenge and to study the population genetics structure of these two species. Among the 130 specimens belonging to 8 populations of H. labeo and 9 populations of H. medius from 17 drainage systems in southern China,196 variable sites (9.1% in the full sequences) falling into 50 haplotypes were identified. The haplotype diversity (h) and the nucleotide diversity (π) were 0.964 and 0.019, respectively, indicating a high level of genetic diversity and an evolutionary potential in both species. The result of neighbor-joining tree based on composite nucleotide sequences of the mtDNA COI and ND5 genes showed that the H. labeo and H. medius fell into two major clades (clade1and clade2): clade1was composed of some specimens of Oujiang River, all the specimens of Hanjiang River and Jiulongjiang River, whereas all remaining populations fell in clade2. The genetic distance between clade I and clade II was 0.036, while that between H. labeo and H. medius was 0.027. The haplotype network analyses indicated that the populations of Hanjiang River and Jiulongjiang River had relatively high genetic variation with the rest rivers. The po-pulations of Hainan Island migrated northward to Moyangjaing River. Haplotypes of the rivers of Hainan Island and Moyangjang River had relatively higher genetic variation with the Yangtze River than Pearl River. The populations of Xiangjiang River had no genetic variation with the populations of Guijiang River and Liujiang River. Analysis of molecular variance (AMOVA) indicated that the genetic variance mainly presented in individuals between geographical regions. The genetic variation of populations among regions was 71.2%, the genetic variation among populations within regions was 16.6%, and that within populations within the regions was 12.2%, indicating that most of the genetic variations resided in the populations among regions. The results of mismatch distribution and tests of neutrality suggested that in all populations, H. labeo, H. medius, clade1and clade2 were relatively stable.

Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.

PubMed

Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng

2017-07-01

The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.

Complete nucleotide sequences of the coat protein messenger RNAs of brome mosaic virus and cowpea chlorotic mottle virus.

PubMed Central

Dasgupta, R; Kaesberg, P

1982-01-01

The nucleotide sequences of the subgenomic coat protein messengers (RNA4's) of two related bromoviruses, brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV), have been determined by direct RNA and CDNA sequencing without cloning. BMV RNA4 is 876 b long including a 5' noncoding region of nine nucleotides and a 3' noncoding region of 300 nucleotides. CCMV RNA 4 is 824 b long, including a 5' noncoding region of 10 nucleotides and a 3' noncoding region of 244 nucleotides. The encoded coat proteins are similar in length (188 amino acids for BMV and 189 amino acids for CCMV) and display about 70% homology in their amino acid sequences. Length difference between the two RNAs is due mostly to a single deletion, in CCMV with respect to BMV, of about 57 b immediately following the coding region. Allowing for this deletion the RNAs are indicate that mutations leading to divergence were constrained in the coding region primarily by the requirement of maintaining a favorable coat protein structure and in the 3' noncoding region primarily by the requirement of maintaining a favorable RNA spatial configuration. PMID:6895941

Nucleotide sequence analysis of the 3' terminal region of a wasabi strain of crucifer tobamovirus genomic RNA: subgrouping of crucifer tobamoviruses.

PubMed

Shimamoto, I; Sonoda, S; Vazquez, P; Minaka, N; Nishiguchi, M

1998-01-01

The 3' terminal 2378 nucleotides of a wasabi strain of crucifer tobamovirus (CTMV-W) infectious to crucifer plants was determined. This includes the 3' non-coding region of 235 nucleotides, coat protein (CP) gene (468 nucleotides), movement protein (MP) gene (798 nucleotides) and C-terminal partial readthrough portion of 180 K protein gene (940 nucleotides). Comparison of the sequence with homologous regions of thirteen other tobamovirus genomes showed that it had much higher identity to those of four other crucifer tobamoviruses, 85.2% to cr-TMV and turnip vein-clearing virus (TVCV), 87.4% to oilseed rape mosaic virus (ORMV) and 87.1% to TMV-Cg, than to those of other tobamoviruses. Thus CTMV-W was most similar to ORMV and TMV-Cg in sequence, but only marginally so, whereas the location and size of its MP gene was the same as cr-TMV amd TVCV. These results, together with other analyses, show that CTMV-W is a new crucifer tobamovirus, that the five crucifer tobamoviruses can be classified into two subgroups based on MP gene organization, and that the rate of sequence change is not the same in all lineages.

The Organelle Genomes of Hassawi Rice (Oryza sativa L.) and Its Hybrid in Saudi Arabia: Genome Variation, Rearrangement, and Origins

PubMed Central

Zhang, Tongwu; Hu, Songnian; Zhang, Guangyu; Pan, Linlin; Zhang, Xiaowei; Al-Mssallem, Ibrahim S.; Yu, Jun

2012-01-01

Hassawi rice (Oryza sativa L.) is a landrace adapted to the climate of Saudi Arabia, characterized by its strong resistance to soil salinity and drought. Using high quality sequencing reads extracted from raw data of a whole genome sequencing project, we assembled both chloroplast (cp) and mitochondrial (mt) genomes of the wild-type Hassawi rice (Hassawi-1) and its dwarf hybrid (Hassawi-2). We discovered 16 InDels (insertions and deletions) but no SNP (single nucleotide polymorphism) is present between the two Hassawi cp genomes. We identified 48 InDels and 26 SNPs in the two Hassawi mt genomes and a new type of sequence variation, termed reverse complementary variation (RCV) in the rice cp genomes. There are two and four RCVs identified in Hassawi-1 when compared to 93–11 (indica) and Nipponbare (japonica), respectively. Microsatellite sequence analysis showed there are more SSRs in the genic regions of both cp and mt genomes in the Hassawi rice than in the other rice varieties. There are also large repeats in the Hassawi mt genomes, with the longest length of 96,168 bp and 96,165 bp in Hassawi-1 and Hassawi-2, respectively. We believe that frequent DNA rearrangement in the Hassawi mt and cp genomes indicate ongoing dynamic processes to reach genetic stability under strong environmental pressures. Based on sequence variation analysis and the breeding history, we suggest that both Hassawi-1 and Hassawi-2 originated from the Indonesian variety Peta since genetic diversity between the two Hassawi cultivars is very low albeit an unknown historic origin of the wild-type Hassawi rice. PMID:22870184

Contribution of human growth hormone-releasing hormone receptor (GHRHR) gene sequence variation to isolated severe growth hormone deficiency (ISGHD) and normal adult height.

PubMed

Camats, Núria; Fernández-Cancio, Mónica; Carrascosa, Antonio; Andaluz, Pilar; Albisu, M Ángeles; Clemente, María; Gussinyé, Miquel; Yeste, Diego; Audí, Laura

2012-10-01

Molecular causes of isolated severe growth hormone deficiency (ISGHD) in several genes have been established. The aim of this study was to analyse the contribution of growth hormone-releasing hormone receptor (GHRHR) gene sequence variation to GH deficiency in a series of prepubertal ISGHD patients and to normal adult height. A systematic GHRHR gene sequence analysis was performed in 69 ISGHD patients and 60 normal adult height controls (NAHC). Four GHRHR single-nucleotide polymorphisms (SNPs) were genotyped in 248 additional NAHC. An analysis was performed on individual SNPs and combined genotype associations with diagnosis in ISGHD patients and with height-SDS in NAHC. Twenty-one SNPs were found. P3, P13, P15 and P20 had not been previously described. Patients and controls shared 12 SNPs (P1, P2, P4-P11, P16 and P21). Significantly different frequencies of the heterozygous genotype and alternate allele were detected in P9 (exon 4, rs4988498) and P12 (intron 6, rs35609199); P9 heterozygous genotype frequencies were similar in patients and the shortest control group (heights between -2 and -1 SDS) and significantly different in controls (heights between -1 and +2 SDS). GHRHR P9 together with 4 GH1 SNP genotypes contributed to 6·2% of height-SDS variation in the entire 308 NAHC. This study established the GHRHR gene sequence variation map in ISGHD patients and NAHC. No evidence of GHRHR mutation contribution to ISGHD was found in this population, although P9 and P12 SNP frequencies were significantly different between ISGHD and NAHC. Thus, the gene sequence may contribute to normal adult height, as demonstrated in NAHC. © 2012 Blackwell Publishing Ltd.

LPA and PLG sequence variation and kringle IV-2 copy number in two populations.

PubMed

Crawford, Dana C; Peng, Ze; Cheng, Jan-Fang; Boffelli, Dario; Ahearn, Magdalena; Nguyen, Dan; Shaffer, Tristan; Yi, Qian; Livingston, Robert J; Rieder, Mark J; Nickerson, Deborah A

2008-01-01

Lp(a) levels have long been recognized as a potential risk factor for coronary heart disease that is almost completely under genetic control. Much of the genetics impacting Lp(a) levels has been attributed to the highly polymorphic LPA kringle IV-2 copy number variant, and most of the variance in Lp(a) levels in populations of European-descent is inversely correlated with kringle IV copy number. However, less of the variance is explained in African-descent populations for the same structural variation. African-descent populations have, on average, higher levels of Lp(a), suggesting other genetic factors contribute to Lp(a) level variability across populations. To identify potential cis-acting factors, we re-sequenced the gene LPA for single nucleotide polymorphism (SNP) discovery in 23 European-Americans and 24 African-Americans. We also re- sequenced the neighboring gene plasminogen (PLG) and genotyped the kringle IV copy number variant in the same reference samples. These data are the most comprehensive description of sequence variation in LPA and its relationship with the kringle IV copy number variant. With these data, we demonstrate that only a fraction of LPA sequence diversity has been previously documented. Also, we identify several high frequency SNPs present in the African-American sample but absent in the European-American sample. Finally, we show that SNPs within PLG are not in linkage disequilibrium with SNPs in LPA, and we show that kringle IV copy number variation is not in linkage disequilibrium with either LPA or PLG SNPs. Together, these data suggest that LPA SNPs could independently contribute to Lp(a) levels in the general population. Copyright (c) 2008 S. Karger AG, Basel.

Copy Number Variation across European Populations

PubMed Central

Chen, Wanting; Hayward, Caroline; Wright, Alan F.; Hicks, Andrew A.; Vitart, Veronique; Knott, Sara; Wild, Sarah H.; Pramstaller, Peter P.; Wilson, James F.; Rudan, Igor; Porteous, David J.

2011-01-01

Genome analysis provides a powerful approach to test for evidence of genetic variation within and between geographical regions and local populations. Copy number variants which comprise insertions, deletions and duplications of genomic sequence provide one such convenient and informative source. Here, we investigate copy number variants from genome wide scans of single nucleotide polymorphisms in three European population isolates, the island of Vis in Croatia, the islands of Orkney in Scotland and the South Tyrol in Italy. We show that whereas the overall copy number variant frequencies are similar between populations, their distribution is highly specific to the population of origin, a finding which is supported by evidence for increased kinship correlation for specific copy number variants within populations. PMID:21829696

Increased Genomic Prediction Accuracy in Wheat Breeding Through Spatial Adjustment of Field Trial Data

PubMed Central

Lado, Bettina; Matus, Ivan; Rodríguez, Alejandra; Inostroza, Luis; Poland, Jesse; Belzile, François; del Pozo, Alejandro; Quincke, Martín; Castro, Marina; von Zitzewitz, Jarislav

2013-01-01

In crop breeding, the interest of predicting the performance of candidate cultivars in the field has increased due to recent advances in molecular breeding technologies. However, the complexity of the wheat genome presents some challenges for applying new technologies in molecular marker identification with next-generation sequencing. We applied genotyping-by-sequencing, a recently developed method to identify single-nucleotide polymorphisms, in the genomes of 384 wheat (Triticum aestivum) genotypes that were field tested under three different water regimes in Mediterranean climatic conditions: rain-fed only, mild water stress, and fully irrigated. We identified 102,324 single-nucleotide polymorphisms in these genotypes, and the phenotypic data were used to train and test genomic selection models intended to predict yield, thousand-kernel weight, number of kernels per spike, and heading date. Phenotypic data showed marked spatial variation. Therefore, different models were tested to correct the trends observed in the field. A mixed-model using moving-means as a covariate was found to best fit the data. When we applied the genomic selection models, the accuracy of predicted traits increased with spatial adjustment. Multiple genomic selection models were tested, and a Gaussian kernel model was determined to give the highest accuracy. The best predictions between environments were obtained when data from different years were used to train the model. Our results confirm that genotyping-by-sequencing is an effective tool to obtain genome-wide information for crops with complex genomes, that these data are efficient for predicting traits, and that correction of spatial variation is a crucial ingredient to increase prediction accuracy in genomic selection models. PMID:24082033

Evaluation of somatic copy number estimation tools for whole-exome sequencing data.

PubMed

Nam, Jae-Yong; Kim, Nayoung K D; Kim, Sang Cheol; Joung, Je-Gun; Xi, Ruibin; Lee, Semin; Park, Peter J; Park, Woong-Yang

2016-03-01

Whole-exome sequencing (WES) has become a standard method for detecting genetic variants in human diseases. Although the primary use of WES data has been the identification of single nucleotide variations and indels, these data also offer a possibility of detecting copy number variations (CNVs) at high resolution. However, WES data have uneven read coverage along the genome owing to the target capture step, and the development of a robust WES-based CNV tool is challenging. Here, we evaluate six WES somatic CNV detection tools: ADTEx, CONTRA, Control-FREEC, EXCAVATOR, ExomeCNV and Varscan2. Using WES data from 50 kidney chromophobe, 50 bladder urothelial carcinoma, and 50 stomach adenocarcinoma patients from The Cancer Genome Atlas, we compared the CNV calls from the six tools with a reference CNV set that was identified by both single nucleotide polymorphism array 6.0 and whole-genome sequencing data. We found that these algorithms gave highly variable results: visual inspection reveals significant differences between the WES-based segmentation profiles and the reference profile, as well as among the WES-based profiles. Using a 50% overlap criterion, 13-77% of WES CNV calls were covered by CNVs from the reference set, up to 21% of the copy gains were called as losses or vice versa, and dramatic differences in CNV sizes and CNV numbers were observed. Overall, ADTEx and EXCAVATOR had the best performance with relatively high precision and sensitivity. We suggest that the current algorithms for somatic CNV detection from WES data are limited in their performance and that more robust algorithms are needed. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

Genetic variation in Pythium myriotylum based on SNP typing and development of a PCR-RFLP detection of isolates recovered from Pythium soft rot ginger.

PubMed

Le, D P; Smith, M K; Aitken, E A B

2017-10-01

Pythium myriotylum is responsible for severe losses in both capsicum and ginger crops in Australia under different regimes. Intraspecific genomic variation within the pathogen might explain the differences in aggressiveness and pathogenicity on diverse hosts. In this study, whole genome data of four P. myriotylum isolates recovered from three hosts and one Pythium zingiberis isolate were derived and analysed for sequence diversity based on single nucleotide polymorphisms (SNPs). A higher number of true and unique SNPs occurred in P. myriotylum isolates obtained from ginger with symptoms of Pythium soft rot (PSR) in Australia compared to other P. myriotylum isolates. Overall, SNPs were discovered more in the mitochondrial genome than those in the nuclear genome. Among the SNPs, a single substitution from the cytosine (C) to the thymine (T) in the partially sequenced CoxII gene of 14 representatives of PSR P. myriotylum isolates was within a restriction site of HinP1I enzyme which was used in the PCR-RFLP for detection and identification of the isolates without sequencing. The PCR-RFLP was also sensitive to detect PSR P. myriotylum strains from artificially infected ginger without the need for isolation for pure cultures. This is the first study of intraspecific variants of Pythium myriotylum isolates recovered from different hosts and origins based on single nucleotide polymorphism (SNP) genotyping of multiple genes. The SNPs discovered provide valuable makers for detection and identification of P. myriotylum strains initially isolated from Pythium soft rot (PSR) ginger by using PCR-RFLP of the CoxII locus. The PCR-RFLP was also sensitive to detect P. myriotylum directly from PSR ginger sampled from pot trials without the need of isolation for pure cultures. © 2017 The Society for Applied Microbiology.

Validation and optimization of the Ion Torrent S5 XL sequencer and Oncomine workflow for BRCA1 and BRCA2 genetic testing.

PubMed

Shin, Saeam; Kim, Yoonjung; Chul Oh, Seoung; Yu, Nae; Lee, Seung-Tae; Rak Choi, Jong; Lee, Kyung-A

2017-05-23

In this study, we validated the analytical performance of BRCA1/2 sequencing using Ion Torrent's new bench-top sequencer with amplicon panel with optimized bioinformatics pipelines. Using 43 samples that were previously validated by Illumina's MiSeq platform and/or by Sanger sequencing/multiplex ligation-dependent probe amplification, we amplified the target with the Oncomine™ BRCA Research Assay and sequenced on Ion Torrent S5 XL (Thermo Fisher Scientific, Waltham, MA, USA). We compared two bioinformatics pipelines for optimal processing of S5 XL sequence data: the Torrent Suite with a plug-in Torrent Variant Caller (Thermo Fisher Scientific), and commercial NextGENe software (Softgenetics, State College, PA, USA). All expected 681 single nucleotide variants, 15 small indels, and three copy number variants were correctly called, except one common variant adjacent to a rare variant on the primer-binding site. The sensitivity, specificity, false positive rate, and accuracy for detection of single nucleotide variant and small indels of S5 XL sequencing were 99.85%, 100%, 0%, and 99.99% for the Torrent Variant Caller and 99.85%, 99.99%, 0.14%, and 99.99% for NextGENe, respectively. The reproducibility of variant calling was 100%, and the precision of variant frequency also showed good performance with coefficients of variation between 0.32 and 5.29%. We obtained highly accurate data through uniform and sufficient coverage depth over all target regions and through optimization of the bioinformatics pipeline. We confirmed that our platform is accurate and practical for diagnostic BRCA1/2 testing in a clinical laboratory.

Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp. NPVs.

PubMed

Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko

2009-10-01

A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.

Eco-geographical diversification of bitter taste receptor genes (TAS2Rs) among subspecies of chimpanzees (Pan troglodytes).

PubMed

Hayakawa, Takashi; Sugawara, Tohru; Go, Yasuhiro; Udono, Toshifumi; Hirai, Hirohisa; Imai, Hiroo

2012-01-01

Chimpanzees (Pan troglodytes) have region-specific difference in dietary repertoires from East to West across tropical Africa. Such differences may result from different genetic backgrounds in addition to cultural variations. We analyzed the sequences of all bitter taste receptor genes (cTAS2Rs) in a total of 59 chimpanzees, including 4 putative subspecies. We identified genetic variations including single-nucleotide variations (SNVs), insertions and deletions (indels), gene-conversion variations, and copy-number variations (CNVs) in cTAS2Rs. Approximately two-thirds of all cTAS2R haplotypes in the amino acid sequence were unique to each subspecies. We analyzed the evolutionary backgrounds of natural selection behind such diversification. Our previous study concluded that diversification of cTAS2Rs in western chimpanzees (P. t. verus) may have resulted from balancing selection. In contrast, the present study found that purifying selection dominates as the evolutionary form of diversification of the so-called human cluster of cTAS2Rs in eastern chimpanzees (P. t. schweinfurthii) and that the other cTAS2Rs were under no obvious selection as a whole. Such marked diversification of cTAS2Rs with different evolutionary backgrounds among subspecies of chimpanzees probably reflects their subspecies-specific dietary repertoires.

Eco-Geographical Diversification of Bitter Taste Receptor Genes (TAS2Rs) among Subspecies of Chimpanzees (Pan troglodytes)

PubMed Central

Hayakawa, Takashi; Sugawara, Tohru; Go, Yasuhiro; Udono, Toshifumi; Hirai, Hirohisa; Imai, Hiroo

2012-01-01

Chimpanzees (Pan troglodytes) have region-specific difference in dietary repertoires from East to West across tropical Africa. Such differences may result from different genetic backgrounds in addition to cultural variations. We analyzed the sequences of all bitter taste receptor genes (cTAS2Rs) in a total of 59 chimpanzees, including 4 putative subspecies. We identified genetic variations including single-nucleotide variations (SNVs), insertions and deletions (indels), gene-conversion variations, and copy-number variations (CNVs) in cTAS2Rs. Approximately two-thirds of all cTAS2R haplotypes in the amino acid sequence were unique to each subspecies. We analyzed the evolutionary backgrounds of natural selection behind such diversification. Our previous study concluded that diversification of cTAS2Rs in western chimpanzees (P. t. verus) may have resulted from balancing selection. In contrast, the present study found that purifying selection dominates as the evolutionary form of diversification of the so-called human cluster of cTAS2Rs in eastern chimpanzees (P. t. schweinfurthii) and that the other cTAS2Rs were under no obvious selection as a whole. Such marked diversification of cTAS2Rs with different evolutionary backgrounds among subspecies of chimpanzees probably reflects their subspecies-specific dietary repertoires. PMID:22916235

A High-Definition View of Functional Genetic Variation from Natural Yeast Genomes

PubMed Central

Bergström, Anders; Simpson, Jared T.; Salinas, Francisco; Barré, Benjamin; Parts, Leopold; Zia, Amin; Nguyen Ba, Alex N.; Moses, Alan M.; Louis, Edward J.; Mustonen, Ville; Warringer, Jonas; Durbin, Richard; Liti, Gianni

2014-01-01

The question of how genetic variation in a population influences phenotypic variation and evolution is of major importance in modern biology. Yet much is still unknown about the relative functional importance of different forms of genome variation and how they are shaped by evolutionary processes. Here we address these questions by population level sequencing of 42 strains from the budding yeast Saccharomyces cerevisiae and its closest relative S. paradoxus. We find that genome content variation, in the form of presence or absence as well as copy number of genetic material, is higher within S. cerevisiae than within S. paradoxus, despite genetic distances as measured in single-nucleotide polymorphisms being vastly smaller within the former species. This genome content variation, as well as loss-of-function variation in the form of premature stop codons and frameshifting indels, is heavily enriched in the subtelomeres, strongly reinforcing the relevance of these regions to functional evolution. Genes affected by these likely functional forms of variation are enriched for functions mediating interaction with the external environment (sugar transport and metabolism, flocculation, metal transport, and metabolism). Our results and analyses provide a comprehensive view of genomic diversity in budding yeast and expose surprising and pronounced differences between the variation within S. cerevisiae and that within S. paradoxus. We also believe that the sequence data and de novo assemblies will constitute a useful resource for further evolutionary and population genomics studies. PMID:24425782

Selection and sex-biased dispersal in a coastal shark: the influence of philopatry on adaptive variation.

PubMed

Portnoy, D S; Puritz, J B; Hollenbeck, C M; Gelsleichter, J; Chapman, D; Gold, J R

2015-12-01

Sex-biased dispersal is expected to homogenize nuclear genetic variation relative to variation in genetic material inherited through the philopatric sex. When site fidelity occurs across a heterogeneous environment, local selective regimes may alter this pattern. We assessed spatial patterns of variation in nuclear-encoded, single nucleotide polymorphisms (SNPs) and sequences of the mitochondrial control region in bonnethead sharks (Sphyrna tiburo), a species thought to exhibit female philopatry, collected from summer habitats used for gestation. Geographic patterns of mtDNA haplotypes and putatively neutral SNPs confirmed female philopatry and male-mediated gene flow along the northeastern coast of the Gulf of Mexico. A total of 30 outlier SNP loci were identified; alleles at over half of these loci exhibited signatures of latitude-associated selection. Our results indicate that in species with sex-biased dispersal, philopatry can facilitate sorting of locally adaptive variation, with the dispersing sex facilitating movement of potentially adaptive variation among locations and environments. © 2015 John Wiley & Sons Ltd.

The case for the continuing use of the revised Cambridge Reference Sequence (rCRS) and the standardization of notation in human mitochondrial DNA studies.

PubMed

Bandelt, Hans-Jürgen; Kloss-Brandstätter, Anita; Richards, Martin B; Yao, Yong-Gang; Logan, Ian

2014-02-01

Since the determination in 1981 of the sequence of the human mitochondrial DNA (mtDNA) genome, the Cambridge Reference Sequence (CRS), has been used as the reference sequence to annotate mtDNA in molecular anthropology, forensic science and medical genetics. The CRS was eventually upgraded to the revised version (rCRS) in 1999. This reference sequence is a convenient device for recording mtDNA variation, although it has often been misunderstood as a wild-type (WT) or consensus sequence by medical geneticists. Recently, there has been a proposal to replace the rCRS with the so-called Reconstructed Sapiens Reference Sequence (RSRS). Even if it had been estimated accurately, the RSRS would be a cumbersome substitute for the rCRS, as the new proposal fuses--and thus confuses--the two distinct concepts of ancestral lineage and reference point for human mtDNA. Instead, we prefer to maintain the rCRS and to report mtDNA profiles by employing the hitherto predominant circumfix style. Tree diagrams could display mutations by using either the profile notation (in conventional short forms where appropriate) or in a root-upwards way with two suffixes indicating ancestral and derived nucleotides. This would guard against misunderstandings about reporting mtDNA variation. It is therefore neither necessary nor sensible to change the present reference sequence, the rCRS, in any way. The proposed switch to RSRS would inevitably lead to notational chaos, mistakes and misinterpretations.

Interspecific variation in mitochondrial serine transfer RNA (UCN) in Euptychiina butterflies (Lepidoptera: Satyrinae): structure and alignment.

PubMed

Marín, Mario Alejandro; López, Andrés; Uribe, Sandra Inés

2012-06-01

The nucleotide variation and structural patterns of mitochondrial RNA molecule have been proposed as useful tools in molecular systematics; however, their usefulness is always subject to a proper assessment of homology in the sequence alignment. The present study describes the secondary structure of mitochondrial tRNA for the amino acid serine (UCN) on 13 Euptychiina species and the evaluation of its potential use for evolutionary studies in this group of butterflies. The secondary structure of tRNAs showed variation among the included species except between Hermeuptychia sp1 and sp2. Variation was concentrated in the ribotimidina-pseudouridine-cystosine (TψC), dihydrouridine (DHU) and variable loops and in the DHU and TψC arms. These results suggest this region as a potential marker useful for taxonomic differentiation of species in this group and also confirm the importance of including information from the secondary structure of tRNA to optimize the alignments.

Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

PubMed Central

Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

2016-01-01

Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

Complete Chloroplast Genome Sequence of Tartary Buckwheat (Fagopyrum tataricum) and Comparative Analysis with Common Buckwheat (F. esculentum)

PubMed Central

Cho, Kwang-Soo; Yun, Bong-Kyoung; Yoon, Young-Ho; Hong, Su-Young; Mekapogu, Manjulatha; Kim, Kyung-Hee; Yang, Tae-Jin

2015-01-01

We report the chloroplast (cp) genome sequence of tartary buckwheat (Fagopyrum tataricum) obtained by next-generation sequencing technology and compared this with the previously reported common buckwheat (F. esculentum ssp. ancestrale) cp genome. The cp genome of F. tataricum has a total sequence length of 159,272 bp, which is 327 bp shorter than the common buckwheat cp genome. The cp gene content, order, and orientation are similar to those of common buckwheat, but with some structural variation at tandem and palindromic repeat frequencies and junction areas. A total of seven InDels (around 100 bp) were found within the intergenic sequences and the ycf1 gene. Copy number variation of the 21-bp tandem repeat varied in F. tataricum (four repeats) and F. esculentum (one repeat), and the InDel of the ycf1 gene was 63 bp long. Nucleotide and amino acid have highly conserved coding sequence with about 98% homology and four genes—rpoC2, ycf3, accD, and clpP—have high synonymous (Ks) value. PCR based InDel markers were applied to diverse genetic resources of F. tataricum and F. esculentum, and the amplicon size was identical to that expected in silico. Therefore, these InDel markers are informative biomarkers to practically distinguish raw or processed buckwheat products derived from F. tataricum and F. esculentum. PMID:25966355

Analysis of Complete Nucleotide Sequences of 12 Gossypium Chloroplast Genomes: Origin and Evolution of Allotetraploids

PubMed Central

Xu, Qin; Xiong, Guanjun; Li, Pengbo; He, Fei; Huang, Yi; Wang, Kunbo; Li, Zhaohu; Hua, Jinping

2012-01-01

Background Cotton (Gossypium spp.) is a model system for the analysis of polyploidization. Although ascertaining the donor species of allotetraploid cotton has been intensively studied, sequence comparison of Gossypium chloroplast genomes is still of interest to understand the mechanisms underlining the evolution of Gossypium allotetraploids, while it is generally accepted that the parents were A- and D-genome containing species. Here we performed a comparative analysis of 13 Gossypium chloroplast genomes, twelve of which are presented here for the first time. Methodology/Principal Findings The size of 12 chloroplast genomes under study varied from 159,959 bp to 160,433 bp. The chromosomes were highly similar having >98% sequence identity. They encoded the same set of 112 unique genes which occurred in a uniform order with only slightly different boundary junctions. Divergence due to indels as well as substitutions was examined separately for genome, coding and noncoding sequences. The genome divergence was estimated as 0.374% to 0.583% between allotetraploid species and A-genome, and 0.159% to 0.454% within allotetraploids. Forty protein-coding genes were completely identical at the protein level, and 20 intergenic sequences were completely conserved. The 9 allotetraploids shared 5 insertions and 9 deletions in whole genome, and 7-bp substitutions in protein-coding genes. The phylogenetic tree confirmed a close relationship between allotetraploids and the ancestor of A-genome, and the allotetraploids were divided into four separate groups. Progenitor allotetraploid cotton originated 0.43–0.68 million years ago (MYA). Conclusion Despite high degree of conservation between the Gossypium chloroplast genomes, sequence variations among species could still be detected. Gossypium chloroplast genomes preferred for 5-bp indels and 1–3-bp indels are mainly attributed to the SSR polymorphisms. This study supports that the common ancestor of diploid A-genome species in Gossypium is the maternal source of extant allotetraploid species and allotetraploids have a monophyletic origin. G. hirsutum AD1 lineages have experienced more sequence variations than other allotetraploids in intergenic regions. The available complete nucleotide sequences of 12 Gossypium chloroplast genomes should facilitate studies to uncover the molecular mechanisms of compartmental co-evolution and speciation of Gossypium allotetraploids. PMID:22876273

Correlation approach to identify coding regions in DNA sequences

NASA Technical Reports Server (NTRS)

Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

1994-01-01

Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

Comparative genomics of the mimicry switch in Papilio dardanus.

PubMed

Timmermans, Martijn J T N; Baxter, Simon W; Clark, Rebecca; Heckel, David G; Vogel, Heiko; Collins, Steve; Papanicolaou, Alexie; Fukova, Iva; Joron, Mathieu; Thompson, Martin J; Jiggins, Chris D; ffrench-Constant, Richard H; Vogler, Alfried P

2014-07-22

The African Mocker Swallowtail, Papilio dardanus, is a textbook example in evolutionary genetics. Classical breeding experiments have shown that wing pattern variation in this polymorphic Batesian mimic is determined by the polyallelic H locus that controls a set of distinct mimetic phenotypes. Using bacterial artificial chromosome (BAC) sequencing, recombination analyses and comparative genomics, we show that H co-segregates with an interval of less than 500 kb that is collinear with two other Lepidoptera genomes and contains 24 genes, including the transcription factor genes engrailed (en) and invected (inv). H is located in a region of conserved gene order, which argues against any role for genomic translocations in the evolution of a hypothesized multi-gene mimicry locus. Natural populations of P. dardanus show significant associations of specific morphs with single nucleotide polymorphisms (SNPs), centred on en. In addition, SNP variation in the H region reveals evidence of non-neutral molecular evolution in the en gene alone. We find evidence for a duplication potentially driving physical constraints on recombination in the lamborni morph. Absence of perfect linkage disequilibrium between different genes in the other morphs suggests that H is limited to nucleotide positions in the regulatory and coding regions of en. Our results therefore support the hypothesis that a single gene underlies wing pattern variation in P. dardanus.

Nucleotide variation at the dopa decarboxylase (Ddc) gene in natural populations of Drosophila melanogaster.

PubMed

Tatarenkov, Andrey; Ayala, Francisco J

2007-08-01

We studied nucleotide sequence variation at the gene coding for dopa decarboxylase (Ddc) in seven populations of Drosophila melanogaster. Strength and pattern of linkage disequilibrium are somewhat distinct in the extensively sampled Spanish and Raleigh populations. In the Spanish population, a few sites are in strong positive association, whereas a large number of sites in the Raleigh population are associated nonrandomly but the association is not strong. Linkage disequilibrium analysis shows presence of two groups of haplotypes in the populations, each of which is fairly diverged, suggesting epistasis or inversion polymorphism. There is evidence of two forms of natural selection acting on Ddc. The McDonald-Kreitman test indicates a deficit of fixed amino acid differences between D. melanogaster and D. simulans, which may be due to negative selection. An excess of derived alleles at high frequency, significant according to the H-test, is consistent with the effect of hitchhiking. The hitchhiking may have been caused by directional selection downstream of the locus studied, as suggested by a gradual decrease of the polymorphism-to-divergence ratio. Altogether, the Ddc locus exhibits a complicated pattern of variation apparently due to several evolutionary forces. Such a complex pattern may be a result of an unusually high density of functionally important genes.

Nucleotide diversity, natural variation, and evolution of Flexible culm-1 and Strong culm-2 lodging resistance genes in rice.

PubMed

Rashid, Muhammad Abdul Rehman; Zhao, Yan; Zhang, Hongliang; Li, Jinjie; Li, Zichao

2016-07-01

Lodging resistance is one of the vital traits in yield improvement and sustainability. Culm wall thickness, diameter, and strength are different traits that can govern the lodging resistance in rice. The genes SCM2 and FC1 have been isolated for culm thickness, strength, and flexibility, but their functional nucleotide variations were still unknown. We used a 13× deep sequence of 795 diverse genotypes to present the functional variation and SNP diversity in SCM2 and FC1. The major functional variant for the SCM2 gene was at position 27480181 and for the FC1 gene at position 31072992. Haplotype analysis of both genes provided their various allelic differences among haplotypes. SCM2 alleles further presented the evolution of Oryza sativa L. subsp. indica and subsp. japonica genomes from common parent in different geographical zones, while the haplotypes of FC1 suggested their evolution from different strains of the common parent Oryza rufipogon. SCM2 showed purifying selection and functional associations with rare alleles, while FC1 displayed balanced selection favored by multiple heterozygous alleles. Genotypes with an allelic combination of SCM2-3 and FC1-2 in japonica background exhibited striking resistance against lodging, which can be used in further breeding programs.

Porcine insulin receptor substrate 4 (IRS4) gene: cloning, polymorphism and association study

USDA-ARS?s Scientific Manuscript database

Using PCR and IPCR techniques we obtained a 4498 bp nucleotide sequence FN424076 encompassing the complete coding sequence of the porcine IRS4 gene and its proximal promoter. The 1269-amino acid porcine protein deduced from the nucleotide sequence shares 92% identity with the human IRS4 and possesse...

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

A Bioinformatics Workflow for Variant Peptide Detection in Shotgun Proteomics*

PubMed Central

Li, Jing; Su, Zengliu; Ma, Ze-Qiang; Slebos, Robbert J. C.; Halvey, Patrick; Tabb, David L.; Liebler, Daniel C.; Pao, William; Zhang, Bing

2011-01-01

Shotgun proteomics data analysis usually relies on database search. However, commonly used protein sequence databases do not contain information on protein variants and thus prevent variant peptides and proteins from been identified. Including known coding variations into protein sequence databases could help alleviate this problem. Based on our recently published human Cancer Proteome Variation Database, we have created a protein sequence database that comprehensively annotates thousands of cancer-related coding variants collected in the Cancer Proteome Variation Database as well as noncancer-specific ones from the Single Nucleotide Polymorphism Database (dbSNP). Using this database, we then developed a data analysis workflow for variant peptide identification in shotgun proteomics. The high risk of false positive variant identifications was addressed by a modified false discovery rate estimation method. Analysis of colorectal cancer cell lines SW480, RKO, and HCT-116 revealed a total of 81 peptides that contain either noncancer-specific or cancer-related variations. Twenty-three out of 26 variants randomly selected from the 81 were confirmed by genomic sequencing. We further applied the workflow on data sets from three individual colorectal tumor specimens. A total of 204 distinct variant peptides were detected, and five carried known cancer-related mutations. Each individual showed a specific pattern of cancer-related mutations, suggesting potential use of this type of information for personalized medicine. Compatibility of the workflow has been tested with four popular database search engines including Sequest, Mascot, X!Tandem, and MyriMatch. In summary, we have developed a workflow that effectively uses existing genomic data to enable variant peptide detection in proteomics. PMID:21389108

Comparative sequencing in the genus Lycopersicon. Implications for the evolution of fruit size in the domestication of cultivated tomatoes.

PubMed Central

Nesbitt, T Clint; Tanksley, Steven D

2002-01-01

Sequence variation was sampled in cultivated and related wild forms of tomato at fw2.2--a fruit weight QTL key to the evolution of domesticated tomatoes. Variation at fw2.2 was contrasted with variation at four other loci not involved in fruit weight determination. Several conclusions could be reached: (1) Fruit weight variation attributable to fw2.2 is not caused by variation in the FW2.2 protein sequence; more likely, it is due to transcriptional variation associated with one or more of eight nucleotide changes unique to the promoter of large-fruit alleles; (2) fw2.2 and loci not involved in fruit weight have not evolved at distinguishably different rates in cultivated and wild tomatoes, despite the fact that fw2.2 was likely a target of selection during domestication; (3) molecular-clock-based estimates suggest that the large-fruit allele of fw2.2, now fixed in most cultivated tomatoes, arose in tomato germplasm long before domestication; (4) extant accessions of L. esculentum var. cerasiforme, the subspecies thought to be the most likely wild ancestor of domesticated tomatoes, appear to be an admixture of wild and cultivated tomatoes rather than a transitional step from wild to domesticated tomatoes; and (5) despite the fact that cerasiforme accessions are polymorphic for large- and small-fruit alleles at fw2.2, no significant association was detected between fruit size and fw2.2 genotypes in the subspecies--as tested by association genetic studies in the relatively small sample studied--suggesting the role of other fruit weight QTL in fruit weight variation in cerasiforme. PMID:12242247

Regions of conservation and divergence in the 3' untranslated sequences of genomic RNA from Ross River virus isolates.

PubMed

Faragher, S G; Dalgarno, L

1986-07-20

The 3' untranslated (UT) sequences of the genomic RNAs of five geographic variants of the alphavirus Ross River virus (RRV) were determined and compared with the 3' UT sequence of RRV T48, the prototype strain. Part of the 3' UT region of Getah virus, a close serological relative of RRV, was also sequenced. The RRV 3' UT region varies markedly in length between variants. Large deletions or insertions, sequence rearrangements and single nucleotide substitutions are observed. A sequence tract of 49 to 58 nucleotides, which is repeated as four blocks in the RRV T48 3' UT region, occurs only once in the 3' UT region of one RRV strain (NB5092), indicating that the existence of repeat sequence blocks is not essential for RRV replication. However, the precise sequence of the 3' proximal copy of the repeat block and its position relative to the poly(A) tail were identical in all RRV isolates examined, suggesting that it has an important role in RRV replication. Nucleotide substitutions between RRV variants are distributed non-randomly along the length of the 3' UT region. The sequence of 120 to 130 nucleotides adjacent to the poly(A) tail is strongly conserved. Getah virus RNA contains three repeat sequence blocks in the 3' UT region. These are similar in sequence to those in RRV RNA but differ in their arrangement. Homology between the RRV and Getah 3' UT sequences is greatest in the 3' proximal repeat sequence block that shows three differences in 49 nucleotides. The 3' proximal repeat in Getah RNA occurs at the same position, relative to the poly(A) tail, as in all RRV variants. The RRV and Getah virus 3' UT sequences show extensive homology in the region between the 3' proximal repeat and the poly(A) tail but, apart from the repeat blocks themselves, they show no significant homology elsewhere.

Phylogeny and polymorphism in the long control regions E6, E7, and L1 of HPV Type 56 in women from southwest China

PubMed Central

Jing, Yaling; Wang, Tao; Chen, Zuyi; Ding, Xianping; Xu, Jianju; Mu, Xuemei; Cao, Man; Chen, Honghan

2018-01-01

Globally, human papillomavirus (HPV)-56 accounts for a small proportion of all high-risk HPV types; however, HPV-56 is detected at a higher rate in Asia, particularly in southwest China. The present study analyzed polymorphisms, intratypic variants, and genetic variability in the long control regions (LCR), E6, E7, and L1 of HPV-56 (n=75). The LCRs, E6, E7 and L1 were sequenced using a polymerase chain reaction and the sequences were submitted to GenBank. Maximum-likelihood trees were constructed using Kimura's two-parameter model, followed by secondary structure analysis and protein damaging prediction. Additionally, in order to assess the effect of variations in the LCR on putative binding sites for cellular proteins, MATCH server was used. Finally, the selection pressures of the E6-E7 and L1 genes were estimated. A total of 18 point substitutions, a 42-bp deletion and a 19-bp deletion of LCR were identified. Some of those mutations are embedded in the putative binding sites for transcription factors. 18 single nucleotide changes occurred in the E6-E7 sequence, 11/18 were non-synonymous substitutions and 7/18 were synonymous mutations. A total 24 single nucleotide changes were identified in the L1 sequence, 6/24 being non-synonymous mutations and 18/24 synonymous mutations. Selective pressure analysis predicted that the majority of mutations of HPV-56 E6, E7 and L1 were of positive selection. The phylogenetic tree demonstrated that the isolates distributed in two lineages. Data on the prevalence and genetic variation of HPV-56 types in southwest China may aid future studies on viral molecular mechanisms and contribute to future investigations of diagnostic probes and therapeutic vaccines. PMID:29568922

A novel enterovirus species identified from severe diarrheal goats.

PubMed

Wang, Mingyue; He, Jia; Lu, Haibing; Liu, Yajing; Deng, Yingrui; Zhu, Lisai; Guo, Changming; Tu, Changchun; Wang, Xinping

2017-01-01

The Enterovirus genus of the family of Picornaviridae consists of 9 species of Enteroviruses and 3 species of Rhinoviruses based on the latest virus taxonomy. Those viruses contribute significantly to respiratory and digestive disorders in human and animals. Out of 9 Enterovirus species, Enterovirus E-G are closely related to diseases affecting on livestock industry. While enterovirus infection has been increasingly reported in cattle and swine, the enterovirus infections in small ruminants remain largely unknown. Virology, molecular and bioinformatics methods were employed to characterize a novel enterovirus CEV-JL14 from goats manifesting severe diarrhea with morbidity and mortality respectively up to 84% and 54% in China. CEV-JL14 was defined and proposed as a new Enterovirus species L within the genus of Enterovirus of the family Picornaviridae. CEV-JL14 had a complete genome sequence of 7461 nucleotides with an ORF encoding 2172 amino acids, and shared 77.1% of genomic sequence identity with TB4-OEV, an ovine enterovirus. Comparison of 5'-UTR and structural genes of CEV-JL14 with known Enterovirus species revealed highly genetic variations among CEV-JL14 with known Enterovirus species. VP1 nucleotide sequence identities of CEV-14 were 51.8%-53.5% with those of Enterovirus E and F, 30.9%-65.3% with Enterovirus G, and 43.8-51. 5% with Enterovirus A-D, respectively. CEV-JL14 was proposed as a novel species within the genus of Enterovirus according to the current ICTV demarcation criteria of enteroviruses. CEV-JL14 clustered phylogenetically to neither Enterovirus E and F, nor to Enterovirus G. It was defined and proposed as novel species L within the genus of Enterovirus. This is the first report of caprine enterovirus in China, the first complete genomic sequence of a caprine enterovirus revealed, and the unveiling of significant genetic variations between ovine enterovirus and caprine enterovirus, thus broadening the current understanding of enteroviruses.

A novel enterovirus species identified from severe diarrheal goats

PubMed Central

Liu, Yajing; Deng, Yingrui; Zhu, Lisai; Guo, Changming; Tu, Changchun; Wang, Xinping

2017-01-01

Backgrounds The Enterovirus genus of the family of Picornaviridae consists of 9 species of Enteroviruses and 3 species of Rhinoviruses based on the latest virus taxonomy. Those viruses contribute significantly to respiratory and digestive disorders in human and animals. Out of 9 Enterovirus species, Enterovirus E-G are closely related to diseases affecting on livestock industry. While enterovirus infection has been increasingly reported in cattle and swine, the enterovirus infections in small ruminants remain largely unknown. Methods Virology, molecular and bioinformatics methods were employed to characterize a novel enterovirus CEV-JL14 from goats manifesting severe diarrhea with morbidity and mortality respectively up to 84% and 54% in China. Results CEV-JL14 was defined and proposed as a new Enterovirus species L within the genus of Enterovirus of the family Picornaviridae. CEV-JL14 had a complete genome sequence of 7461 nucleotides with an ORF encoding 2172 amino acids, and shared 77.1% of genomic sequence identity with TB4-OEV, an ovine enterovirus. Comparison of 5’-UTR and structural genes of CEV-JL14 with known Enterovirus species revealed highly genetic variations among CEV-JL14 with known Enterovirus species. VP1 nucleotide sequence identities of CEV-14 were 51.8%-53.5% with those of Enterovirus E and F, 30.9%-65.3% with Enterovirus G, and 43.8–51. 5% with Enterovirus A-D, respectively. CEV-JL14 was proposed as a novel species within the genus of Enterovirus according to the current ICTV demarcation criteria of enteroviruses. Conclusions CEV-JL14 clustered phylogenetically to neither Enterovirus E and F, nor to Enterovirus G. It was defined and proposed as novel species L within the genus of Enterovirus. This is the first report of caprine enterovirus in China, the first complete genomic sequence of a caprine enterovirus revealed, and the unveiling of significant genetic variations between ovine enterovirus and caprine enterovirus, thus broadening the current understanding of enteroviruses. PMID:28376123

Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

PubMed

He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

2015-01-01

Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

Complete genomic sequence of Powassan virus: evaluation of genetic elements in tick-borne versus mosquito-borne flaviviruses.

PubMed

Mandl, C W; Holzmann, H; Kunz, C; Heinz, F X

1993-05-01

The complete nucleotide sequence of the positive-stranded RNA genome of the tick-borne flavivirus Powassan (10,839 nucleotides) was elucidated and the amino acid sequence of all viral proteins was derived. Based on this sequence as well as serological data, Powassan virus represents the most divergent member of the tick-borne serocomplex within the genus flaviviruses, family Flaviviridae. The primary nucleotide sequence and potential RNA secondary structures of the Powassan virus genome as well as the protein sequences and the reactivities of the virion with a panel of monoclonal antibodies were compared to other tick-borne and mosquito-borne flaviviruses. These analyses corroborated significant differences between tick-borne and mosquito-borne flaviviruses, but also emphasized structural elements that are conserved among both vector groups. The comparisons among tick-borne flaviviruses revealed conserved sequence elements that might represent important determinants of the tick-borne flavivirus phenotype.

Differences in a ribosomal DNA sequence of Strongylus species allows identification of single eggs.

PubMed

Campbell, A J; Gasser, R B; Chilton, N B

1995-03-01

In the current study, molecular techniques were evaluated for the species identification of individual strongyle eggs. Adult worms of Strongylus edentatus, S. equinus and S. vulgaris were collected at necropsy from horses from Australia and the U.S.A. Genomic DNA was isolated and a ribosomal transcribed spacer (ITS-2) amplified and sequenced using polymerase chain reaction (PCR) techniques. The length of the ITS-2 sequence of S. edentatus, S. equinus and S. vulgaris ranged between 217 and 235 nucleotides. Extensive sequence analysis demonstrated a low degree (0-0.9%) of intraspecific variation in the ITS-2 for the Strongylus species examined, whereas the levels of interspecific differences (13-29%) were significantly greater. Interspecific differences in the ITS-2 sequences allowed unequivocal species identification of single worms and eggs using PCR-linked restriction fragment length polymorphism. These results demonstrate the potential of the ribosomal spacers as genetic markers for species identification of single strongyle eggs from horse faeces.

Detection of a divergent variant of grapevine virus F by next-generation sequencing.

PubMed

Molenaar, Nicholas; Burger, Johan T; Maree, Hans J

2015-08-01

The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).

A framework for organizing cancer-related variations from existing databases, publications and NGS data using a High-performance Integrated Virtual Environment (HIVE).

PubMed

Wu, Tsung-Jung; Shamsaddini, Amirhossein; Pan, Yang; Smith, Krista; Crichton, Daniel J; Simonyan, Vahan; Mazumder, Raja

2014-01-01

Years of sequence feature curation by UniProtKB/Swiss-Prot, PIR-PSD, NCBI-CDD, RefSeq and other database biocurators has led to a rich repository of information on functional sites of genes and proteins. This information along with variation-related annotation can be used to scan human short sequence reads from next-generation sequencing (NGS) pipelines for presence of non-synonymous single-nucleotide variations (nsSNVs) that affect functional sites. This and similar workflows are becoming more important because thousands of NGS data sets are being made available through projects such as The Cancer Genome Atlas (TCGA), and researchers want to evaluate their biomarkers in genomic data. BioMuta, an integrated sequence feature database, provides a framework for automated and manual curation and integration of cancer-related sequence features so that they can be used in NGS analysis pipelines. Sequence feature information in BioMuta is collected from the Catalogue of Somatic Mutations in Cancer (COSMIC), ClinVar, UniProtKB and through biocuration of information available from publications. Additionally, nsSNVs identified through automated analysis of NGS data from TCGA are also included in the database. Because of the petabytes of data and information present in NGS primary repositories, a platform HIVE (High-performance Integrated Virtual Environment) for storing, analyzing, computing and curating NGS data and associated metadata has been developed. Using HIVE, 31 979 nsSNVs were identified in TCGA-derived NGS data from breast cancer patients. All variations identified through this process are stored in a Curated Short Read archive, and the nsSNVs from the tumor samples are included in BioMuta. Currently, BioMuta has 26 cancer types with 13 896 small-scale and 308 986 large-scale study-derived variations. Integration of variation data allows identifications of novel or common nsSNVs that can be prioritized in validation studies. Database URL: BioMuta: http://hive.biochemistry.gwu.edu/tools/biomuta/index.php; CSR: http://hive.biochemistry.gwu.edu/dna.cgi?cmd=csr; HIVE: http://hive.biochemistry.gwu.edu.

Association of candidate genes with drought tolerance traits in diverse perennial ryegrass accessions

PubMed Central

Jiang, Yiwei

2013-01-01

Drought is a major environmental stress limiting growth of perennial grasses in temperate regions. Plant drought tolerance is a complex trait that is controlled by multiple genes. Candidate gene association mapping provides a powerful tool for dissection of complex traits. Candidate gene association mapping of drought tolerance traits was conducted in 192 diverse perennial ryegrass (Lolium perenne L.) accessions from 43 countries. The panel showed significant variations in leaf wilting, leaf water content, canopy and air temperature difference, and chlorophyll fluorescence under well-watered and drought conditions across six environments. Analysis of 109 simple sequence repeat markers revealed five population structures in the mapping panel. A total of 2520 expression-based sequence readings were obtained for a set of candidate genes involved in antioxidant metabolism, dehydration, water movement across membranes, and signal transduction, from which 346 single nucleotide polymorphisms were identified. Significant associations were identified between a putative LpLEA3 encoding late embryogenesis abundant group 3 protein and a putative LpFeSOD encoding iron superoxide dismutase and leaf water content, as well as between a putative LpCyt Cu-ZnSOD encoding cytosolic copper-zinc superoxide dismutase and chlorophyll fluorescence under drought conditions. Four of these identified significantly associated single nucleotide polymorphisms from these three genes were also translated to amino acid substitutions in different genotypes. These results indicate that allelic variation in these genes may affect whole-plant response to drought stress in perennial ryegrass. PMID:23386684

Identification of Sequence Variation in the Apolipoprotein A2 Gene and Their Relationship with Serum High-Density Lipoprotein Cholesterol Levels.

PubMed

Bandarian, Fatemeh; Daneshpour, Maryam Sadat; Hedayati, Mehdi; Naseri, Mohsen; Azizi, Fereidoun

2016-01-01

Apolipoprotein A2 (APOA2) is the second major apolipoprotein of the high-density lipoprotein cholesterol (HDL-C). The study aim was to identify APOA2 gene variation in individuals within two extreme tails of HDL-C levels and its relationship with HDL-C level. This cross-sectional survey was conducted on participants from Tehran Glucose and Lipid Study (TLGS) at Research Institute for Endocrine Sciences, Tehran, Iran from April 2012 to February 2013. In total, 79 individuals with extreme low HDL-C levels (≤5th percentile for age and gender) and 63 individuals with extreme high HDL-C levels (≥95th percentile for age and gender) were selected. Variants were identified using DNA amplification and direct sequencing. Screen of all exons and the core promoter region of APOA2 gene identified nine single nucleotide substitutions and one microsatellite; five of which were known and four were new variants. Of these nine variants, two were common tag single nucleotide polymorphisms (SNPs) and seven were rare SNPs. Both exonic substitutions were missense mutations and caused an amino acid change. There was a significant association between the new missense mutation (variant Chr.1:16119226, Ala98Pro) and HDL-C level. None of two common tag SNPs of rs6413453 and rs5082 contributes to the HDL-C trait in Iranian population, but a new missense mutation in APOA2 in our population has a significant association with HDL-C.

High Variation in Pathogenicity of Genetically Closely Related Strains of Xanthomonas albilineans, the Sugarcane Leaf Scald Pathogen, in Guadeloupe.

PubMed

Champoiseau, P; Daugrois, J-H; Pieretti, I; Cociancich, S; Royer, M; Rott, P

2006-10-01

ABSTRACT Pathogenicity of 75 strains of Xanthomonas albilineans from Guadeloupe was assessed by inoculation of sugarcane cv. B69566, which is susceptible to leaf scald, and 19 of the strains were selected as representative of the variation in pathogenicity observed based on stalk colonization. In vitro production of albicidin varied among these 19 strains, but the restriction fragment length polymorphism pattern of their albicidin biosynthesis genes was identical. Similarly, no genomic variation was found among strains by pulsed-field gel electrophoresis. Some variation among strains was found by amplified fragment length polymorphism, but no relationship between this genetic variation and variation in pathogenicity was found. Only 3 (pilB, rpfA, and xpsE) of 40 genes involved in pathogenicity of bacterial species closely related to X. albilineans could be amplified by polymerase chain reaction from total genomic DNA of all nine strains tested of X. albilineans differing in pathogenicity in Guadeloupe. Nucleotide sequences of these genes were 100% identical among strains, and a phylogenetic study with these genes and housekeeping genes efp and ihfA suggested that X. albilineans is on an evolutionary road between the X. campestris group and Xylella fastidiosa, another vascular plant pathogen. Sequencing of the complete genome of Xanthomonas albilineans could be the next step in deciphering molecular mechanisms involved in pathogenicity of X. albilineans.

Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S.

1995-10-09

In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains amore » functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.« less

Inferring Multiple Refugia and Phylogeographical Patterns in Pinus massoniana Based on Nucleotide Sequence Variation and DNA Fingerprinting

PubMed Central

Lin, Chung-Jian; Huang, Chi-Chung; Huang, Chao-Ching; Chiang, Yu-Chung; Chiang, Tzen-Yuh

2012-01-01

Background Pinus massoniana, an ecologically and economically important conifer, is widespread across central and southern mainland China and Taiwan. In this study, we tested the central–marginal paradigm that predicts that the marginal populations tend to be less polymorphic than the central ones in their genetic composition, and examined a founders' effect in the island population. Methodology/Principal Findings We examined the phylogeography and population structuring of the P. massoniana based on nucleotide sequences of cpDNA atpB-rbcL intergenic spacer, intron regions of the AdhC2 locus, and microsatellite fingerprints. SAMOVA analysis of nucleotide sequences indicated that most genetic variants resided among geographical regions. High levels of genetic diversity in the marginal populations in the south region, a pattern seemingly contradicting the central–marginal paradigm, and the fixation of private haplotypes in most populations indicate that multiple refugia may have existed over the glacial maxima. STRUCTURE analyses on microsatellites revealed that genetic structure of mainland populations was mediated with recent genetic exchanges mostly via pollen flow, and that the genetic composition in east region was intermixed between south and west regions, a pattern likely shaped by gene introgression and maintenance of ancestral polymorphisms. As expected, the small island population in Taiwan was genetically differentiated from mainland populations. Conclusions/Significance The marginal populations in south region possessed divergent gene pools, suggesting that the past glaciations might have low impacts on these populations at low latitudes. Estimates of ancestral population sizes interestingly reflect a recent expansion in mainland from a rather smaller population, a pattern that seemingly agrees with the pollen record. PMID:22952747

Leishmania tropica isolates from non-healed and healed patients in Iran: A molecular typing and phylogenetic analysis.

PubMed

Bamorovat, Mehdi; Sharifi, Iraj; Mohammadi, Mohammad Ali; Eybpoosh, Sana; Nasibi, Saeid; Aflatoonian, Mohammad Reza; Khosravi, Ahmad

2018-03-01

The precise identification of the parasite species causing leishmaniasis is essential for selecting proper treatment modality. The present study aims to compare the nucleotide variations of the ITS1, 7SL RNA, and Hsp70 sequences between non-healed and healed anthroponotic cutaneous leishmaniasis (ACL) patients in major foci in Iran. A case-control study was carried out from September 2015 to October 2016 in the cities of Kerman and Bam, in the southeast of Iran. Randomly selected skin-scraping lesions of 40 patients (20 non-healed and 20 healed) were examined and the organisms were grown in a culture medium. Promastigotes were collected by centrifugation and kept for further molecular examinations. The extracted DNA was amplified and sequenced. After global sequence alignment with BioEdit software, maximum likelihood phylogenetic analysis was performed in PhyML for typing of Leishmania isolates. Nucleotide composition of each genetic region was also compared between non-healed and healed patients. Our results showed that all isolates belonged to the Leishmania tropica complex, with their genetic composition in the ITS1 region being different among non-healed and healed patients. 7SL RNA and Hsp70 regions were genetically identical between both groups. Variability in nucleotide patterns observed between both groups in the ITS1 region may serve to encourage future research on the function of these polymorphisms and may improve our understanding of the role of parasite genome properties on patients' response to Leishmania treatment. Our results also do not support future use of 7SL RNA and Hsp70 regions of the parasite for comparative genomic analyses. Copyright © 2018 Elsevier Ltd. All rights reserved.

The vestigial olfactory receptor subgenome of odontocete whales: phylogenetic congruence between gene-tree reconciliation and supermatrix methods.

PubMed

McGowen, Michael R; Clark, Clay; Gatesy, John

2008-08-01

The macroevolutionary transition of whales (cetaceans) from a terrestrial quadruped to an obligate aquatic form involved major changes in sensory abilities. Compared to terrestrial mammals, the olfactory system of baleen whales is dramatically reduced, and in toothed whales is completely absent. We sampled the olfactory receptor (OR) subgenomes of eight cetacean species from four families. A multigene tree of 115 newly characterized OR sequences from these eight species and published data for Bos taurus revealed a diverse array of class II OR paralogues in Cetacea. Evolution of the OR gene superfamily in toothed whales (Odontoceti) featured a multitude of independent pseudogenization events, supporting anatomical evidence that odontocetes have lost their olfactory sense. We explored the phylogenetic utility of OR pseudogenes in Cetacea, concentrating on delphinids (oceanic dolphins), the product of a rapid evolutionary radiation that has been difficult to resolve in previous studies of mitochondrial DNA sequences. Phylogenetic analyses of OR pseudogenes using both gene-tree reconciliation and supermatrix methods yielded fully resolved, consistently supported relationships among members of four delphinid subfamilies. Alternative minimizations of gene duplications, gene duplications plus gene losses, deep coalescence events, and nucleotide substitutions plus indels returned highly congruent phylogenetic hypotheses. Novel DNA sequence data for six single-copy nuclear loci and three mitochondrial genes (> 5000 aligned nucleotides) provided an independent test of the OR trees. Nucleotide substitutions and indels in OR pseudogenes showed a very low degree of homoplasy in comparison to mitochondrial DNA and, on average, provided more variation than single-copy nuclear DNA. Our results suggest that phylogenetic analysis of the large OR superfamily will be effective for resolving relationships within Cetacea whether supermatrix or gene-tree reconciliation procedures are used.

Genome wide re-sequencing of newly developed Rice Lines from common wild rice (Oryza rufipogon Griff.) for the identification of NBS-LRR genes.

PubMed

Liu, Wen; Ghouri, Fozia; Yu, Hang; Li, Xiang; Yu, Shuhong; Shahid, Muhammad Qasim; Liu, Xiangdong

2017-01-01

Common wild rice (Oryza rufipogon Griff.) is an important germplasm for rice breeding, which contains many resistance genes. Re-sequencing provides an unprecedented opportunity to explore the abundant useful genes at whole genome level. Here, we identified the nucleotide-binding site leucine-rich repeat (NBS-LRR) encoding genes by re-sequencing of two wild rice lines (i.e. Huaye 1 and Huaye 2) that were developed from common wild rice. We obtained 128 to 147 million reads with approximately 32.5-fold coverage depth, and uniquely covered more than 89.6% (> = 1 fold) of reference genomes. Two wild rice lines showed high SNP (single-nucleotide polymorphisms) variation rate in 12 chromosomes against the reference genomes of Nipponbare (japonica cultivar) and 93-11 (indica cultivar). InDels (insertion/deletion polymorphisms) count-length distribution exhibited normal distribution in the two lines, and most of the InDels were ranged from -5 to 5 bp. With reference to the Nipponbare genome sequence, we detected a total of 1,209,308 SNPs, 161,117 InDels and 4,192 SVs (structural variations) in Huaye 1, and 1,387,959 SNPs, 180,226 InDels and 5,305 SVs in Huaye 2. A total of 44.9% and 46.9% genes exhibited sequence variations in two wild rice lines compared to the Nipponbare and 93-11 reference genomes, respectively. Analysis of NBS-LRR mutant candidate genes showed that they were mainly distributed on chromosome 11, and NBS domain was more conserved than LRR domain in both wild rice lines. NBS genes depicted higher levels of genetic diversity in Huaye 1 than that found in Huaye 2. Furthermore, protein-protein interaction analysis showed that NBS genes mostly interacted with the cytochrome C protein (Os05g0420600, Os01g0885000 and BGIOSGA038922), while some NBS genes interacted with heat shock protein, DNA-binding activity, Phosphoinositide 3-kinase and a coiled coil region. We explored abundant NBS-LRR encoding genes in two common wild rice lines through genome wide re-sequencing, which proved to be a useful tool to exploit elite NBS-LRR genes in wild rice. The data here provide a foundation for future work aimed at dissecting the genetic basis of disease resistance in rice, and the two wild rice lines will be useful germplasm for the molecular improvement of cultivated rice.

Genome wide re-sequencing of newly developed Rice Lines from common wild rice (Oryza rufipogon Griff.) for the identification of NBS-LRR genes

PubMed Central

Yu, Hang; Li, Xiang; Yu, Shuhong; Shahid, Muhammad Qasim

2017-01-01

Common wild rice (Oryza rufipogon Griff.) is an important germplasm for rice breeding, which contains many resistance genes. Re-sequencing provides an unprecedented opportunity to explore the abundant useful genes at whole genome level. Here, we identified the nucleotide-binding site leucine-rich repeat (NBS-LRR) encoding genes by re-sequencing of two wild rice lines (i.e. Huaye 1 and Huaye 2) that were developed from common wild rice. We obtained 128 to 147 million reads with approximately 32.5-fold coverage depth, and uniquely covered more than 89.6% (> = 1 fold) of reference genomes. Two wild rice lines showed high SNP (single-nucleotide polymorphisms) variation rate in 12 chromosomes against the reference genomes of Nipponbare (japonica cultivar) and 93–11 (indica cultivar). InDels (insertion/deletion polymorphisms) count-length distribution exhibited normal distribution in the two lines, and most of the InDels were ranged from -5 to 5 bp. With reference to the Nipponbare genome sequence, we detected a total of 1,209,308 SNPs, 161,117 InDels and 4,192 SVs (structural variations) in Huaye 1, and 1,387,959 SNPs, 180,226 InDels and 5,305 SVs in Huaye 2. A total of 44.9% and 46.9% genes exhibited sequence variations in two wild rice lines compared to the Nipponbare and 93–11 reference genomes, respectively. Analysis of NBS-LRR mutant candidate genes showed that they were mainly distributed on chromosome 11, and NBS domain was more conserved than LRR domain in both wild rice lines. NBS genes depicted higher levels of genetic diversity in Huaye 1 than that found in Huaye 2. Furthermore, protein-protein interaction analysis showed that NBS genes mostly interacted with the cytochrome C protein (Os05g0420600, Os01g0885000 and BGIOSGA038922), while some NBS genes interacted with heat shock protein, DNA-binding activity, Phosphoinositide 3-kinase and a coiled coil region. We explored abundant NBS-LRR encoding genes in two common wild rice lines through genome wide re-sequencing, which proved to be a useful tool to exploit elite NBS-LRR genes in wild rice. The data here provide a foundation for future work aimed at dissecting the genetic basis of disease resistance in rice, and the two wild rice lines will be useful germplasm for the molecular improvement of cultivated rice. PMID:28700714

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lo, A.; Yang, H.L.

1990-02-13

This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

Ribosomal DNA sequence heterogeneity reflects intraspecies phylogenies and predicts genome structure in two contrasting yeast species.

PubMed

West, Claire; James, Stephen A; Davey, Robert P; Dicks, Jo; Roberts, Ian N

2014-07-01

The ribosomal RNA encapsulates a wealth of evolutionary information, including genetic variation that can be used to discriminate between organisms at a wide range of taxonomic levels. For example, the prokaryotic 16S rDNA sequence is very widely used both in phylogenetic studies and as a marker in metagenomic surveys and the internal transcribed spacer region, frequently used in plant phylogenetics, is now recognized as a fungal DNA barcode. However, this widespread use does not escape criticism, principally due to issues such as difficulties in classification of paralogous versus orthologous rDNA units and intragenomic variation, both of which may be significant barriers to accurate phylogenetic inference. We recently analyzed data sets from the Saccharomyces Genome Resequencing Project, characterizing rDNA sequence variation within multiple strains of the baker's yeast Saccharomyces cerevisiae and its nearest wild relative Saccharomyces paradoxus in unprecedented detail. Notably, both species possess single locus rDNA systems. Here, we use these new variation datasets to assess whether a more detailed characterization of the rDNA locus can alleviate the second of these phylogenetic issues, sequence heterogeneity, while controlling for the first. We demonstrate that a strong phylogenetic signal exists within both datasets and illustrate how they can be used, with existing methodology, to estimate intraspecies phylogenies of yeast strains consistent with those derived from whole-genome approaches. We also describe the use of partial Single Nucleotide Polymorphisms, a type of sequence variation found only in repetitive genomic regions, in identifying key evolutionary features such as genome hybridization events and show their consistency with whole-genome Structure analyses. We conclude that our approach can transform rDNA sequence heterogeneity from a problem to a useful source of evolutionary information, enabling the estimation of highly accurate phylogenies of closely related organisms, and discuss how it could be extended to future studies of multilocus rDNA systems. [concerted evolution; genome hydridisation; phylogenetic analysis; ribosomal DNA; whole genome sequencing; yeast]. © The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

The nucleotide sequences of 5S rRNAs from a fern Dryopteris acuminata and a horsetail Equisetum arvense.

PubMed Central

Hori, H; Osawa, S; Takaiwa, F; Sugiura, M

1984-01-01

The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the Bryophyta species (88% identity on average) than to those of seed plants (84% identity on average). PMID:6538332