Distribution Patterns of Three Sodium Channel Mutations Associated with Pyrethroid Resistance in Rhipicephalus (Boophilus) Microplus Populations from North and South America, South Africa and Australia

USDA-ARS?s Scientific Manuscript database

Resistance to synthetic pyrethroids (SP) in the cattle tick Rhipicephalus (Boophilus) microplus is widespread throughout its distribution area. Three single nucleotide substitutions identified in the Domains II and III of the sodium channel gene of R. (B.) microplus are known to be associated with t...

Molecular evolution of the leptin exon 3 in some species of the family Canidae

PubMed Central

Chmurzynska, Agata; Zajac, Magdalena; Switonski, Marek

2003-01-01

The structure of the leptin gene seems to be well conserved. The polymorphism of this gene in four species belonging to the Canidae family (the dog (Canis familiaris) – 16 different breeds, the Chinese racoon dog (Nyctereutes procyonoides procyonoides), the red fox (Vulpes vulpes) and the arctic fox (Alopex lagopus)) were studied with the use of single strand conformation polymorphism (SSCP), restriction fragment length polymorphism (RFLP) and DNA sequencing techniques. For exon 2, all species presented the same SSCP pattern, while in exon 3 some differences were found. DNA sequencing of exon 3 revealed the presence of six nucleotide substitutions, differentiating the studied species. Three of them cause amino acid substitutions as well. For all dog breeds studied, SSCP patterns were identical. PMID:12939206

Contrasting Patterns of Nucleotide Substitution Rates Provide Insight into Dynamic Evolution of Plastid and Mitochondrial Genomes of Geranium.

PubMed

Park, Seongjun; Ruhlman, Tracey A; Weng, Mao-Lun; Hajrah, Nahid H; Sabir, Jamal S M; Jansen, Robert K

2017-06-01

Geraniaceae have emerged as a model system for investigating the causes and consequences of variation in plastid and mitochondrial genomes. Incredible structural variation in plastid genomes (plastomes) and highly accelerated evolutionary rates have been reported in selected lineages and functional groups of genes in both plastomes and mitochondrial genomes (mitogenomes), and these phenomena have been implicated in cytonuclear incompatibility. Previous organelle genome studies have included limited sampling of Geranium, the largest genus in the family with over 400 species. This study reports on rates and patterns of nucleotide substitutions in plastomes and mitogenomes of 17 species of Geranium and representatives of other Geraniaceae. As detected across other angiosperms, substitution rates in the plastome are 3.5 times higher than the mitogenome in most Geranium. However, in the branch leading to Geranium brycei/Geranium incanum mitochondrial genes experienced significantly higher dN and dS than plastid genes, a pattern that has only been detected in one other angiosperm. Furthermore, rate accelerations differ in the two organelle genomes with plastomes having increased dN and mitogenomes with increased dS. In the Geranium phaeum/Geranium reflexum clade, duplicate copies of clpP and rpoA genes that experienced asymmetric rate divergence were detected in the single copy region of the plastome. In the case of rpoA, the branch leading to G. phaeum/G. reflexum experienced positive selection or relaxation of purifying selection. Finally, the evolution of acetyl-CoA carboxylase is unusual in Geraniaceae because it is only the second angiosperm family where both prokaryotic and eukaryotic ACCases functionally coexist in the plastid. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Contrasting Patterns of Nucleotide Substitution Rates Provide Insight into Dynamic Evolution of Plastid and Mitochondrial Genomes of Geranium

PubMed Central

Park, Seongjun; Ruhlman, Tracey A.; Weng, Mao-Lun; Hajrah, Nahid H.; Sabir, Jamal S.M.

2017-01-01

Abstract Geraniaceae have emerged as a model system for investigating the causes and consequences of variation in plastid and mitochondrial genomes. Incredible structural variation in plastid genomes (plastomes) and highly accelerated evolutionary rates have been reported in selected lineages and functional groups of genes in both plastomes and mitochondrial genomes (mitogenomes), and these phenomena have been implicated in cytonuclear incompatibility. Previous organelle genome studies have included limited sampling of Geranium, the largest genus in the family with over 400 species. This study reports on rates and patterns of nucleotide substitutions in plastomes and mitogenomes of 17 species of Geranium and representatives of other Geraniaceae. As detected across other angiosperms, substitution rates in the plastome are 3.5 times higher than the mitogenome in most Geranium. However, in the branch leading to Geranium brycei/Geranium incanum mitochondrial genes experienced significantly higher dN and dS than plastid genes, a pattern that has only been detected in one other angiosperm. Furthermore, rate accelerations differ in the two organelle genomes with plastomes having increased dN and mitogenomes with increased dS. In the Geranium phaeum/Geranium reflexum clade, duplicate copies of clpP and rpoA genes that experienced asymmetric rate divergence were detected in the single copy region of the plastome. In the case of rpoA, the branch leading to G. phaeum/G. reflexum experienced positive selection or relaxation of purifying selection. Finally, the evolution of acetyl-CoA carboxylase is unusual in Geraniaceae because it is only the second angiosperm family where both prokaryotic and eukaryotic ACCases functionally coexist in the plastid. PMID:28854633

Probing the mechanistic consequences of 5-fluorine substitution on cytidine nucleotide analogue incorporation by HIV-1 reverse transcriptase.

PubMed

Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S

2003-05-01

Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.

Modified nucleotides reveal the indirect role of the central base pairs in stabilizing the lac repressor-operator complex.

PubMed Central

Zhang, X; Gottlieb, P A

1995-01-01

Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate binding of the complex by altering the intrinsic properties of the DNA. Two specific attributes are required to achieve the lowest free energy of interaction. The DNA must have two interstrand hydrogen bonds to stabilize the duplex and it must have properties associated with directional bending or unwinding. This analysis does not rule out contributions by direct interactions between the protein and the central region of the operator but underscores how indirect effects play a major role in complex formation in this system. Images PMID:7784203

A ruler protein in a complex for antiviral defense determines the length of small interfering CRISPR RNAs.

PubMed

Hatoum-Aslan, Asma; Samai, Poulami; Maniv, Inbal; Jiang, Wenyan; Marraffini, Luciano A

2013-09-27

Small RNAs undergo maturation events that precisely determine the length and structure required for their function. CRISPRs (clustered regularly interspaced short palindromic repeats) encode small RNAs (crRNAs) that together with CRISPR-associated (cas) genes constitute a sequence-specific prokaryotic immune system for anti-viral and anti-plasmid defense. crRNAs are subject to multiple processing events during their biogenesis, and little is known about the mechanism of the final maturation step. We show that in the Staphylococcus epidermidis type III CRISPR-Cas system, mature crRNAs are measured in a Cas10·Csm ribonucleoprotein complex to yield discrete lengths that differ by 6-nucleotide increments. We looked for mutants that impact this crRNA size pattern and found that an alanine substitution of a conserved aspartate residue of Csm3 eliminates the 6-nucleotide increments in the length of crRNAs. In vitro, recombinant Csm3 binds RNA molecules at multiple sites, producing gel-shift patterns that suggest that each protein binds 6 nucleotides of substrate. In vivo, changes in the levels of Csm3 modulate the crRNA size distribution without disrupting the 6-nucleotide periodicity. Our data support a model in which multiple Csm3 molecules within the Cas10·Csm complex bind the crRNA with a 6-nucleotide periodicity to function as a ruler that measures the extent of crRNA maturation.

A new method for locating changes in a tree reveals distinct nucleotide polymorphism vs. divergence patterns in mouse mitochondrial control region.

PubMed

Galtier, N; Boursot, P

2000-03-01

A new, model-based method was devised to locate nucleotide changes in a given phylogenetic tree. For each site, the posterior probability of any possible change in each branch of the tree is computed. This probabilistic method is a valuable alternative to the maximum parsimony method when base composition is skewed (i.e., different from 25% A, 25% C, 25% G, 25% T): computer simulations showed that parsimony misses more rare --> common than common --> rare changes, resulting in biased inferred change matrices, whereas the new method appeared unbiased. The probabilistic method was applied to the analysis of the mutation and substitution processes in the mitochondrial control region of mouse. Distinct change patterns were found at the polymorphism (within species) and divergence (between species) levels, rejecting the hypothesis of a neutral evolution of base composition in mitochondrial DNA.

Evolutionary constraints and the neutral theory. [mutation-caused nucleotide substitutions in DNA

NASA Technical Reports Server (NTRS)

Jukes, T. H.; Kimura, M.

1984-01-01

The neutral theory of molecular evolution postulates that nucleotide substitutions inherently take place in DNA as a result of point mutations followed by random genetic drift. In the absence of selective constraints, the substitution rate reaches the maximum value set by the mutation rate. The rate in globin pseudogenes is about 5 x 10 to the -9th substitutions per site per year in mammals. Rates slower than this indicate the presence of constraints imposed by negative (natural) selection, which rejects and discards deleterious mutations.

A Ruler Protein in a Complex for Antiviral Defense Determines the Length of Small Interfering CRISPR RNAs

PubMed Central

Hatoum-Aslan, Asma; Samai, Poulami; Maniv, Inbal; Jiang, Wenyan; Marraffini, Luciano A.

2013-01-01

Small RNAs undergo maturation events that precisely determine the length and structure required for their function. CRISPRs (clustered regularly interspaced short palindromic repeats) encode small RNAs (crRNAs) that together with CRISPR-associated (cas) genes constitute a sequence-specific prokaryotic immune system for anti-viral and anti-plasmid defense. crRNAs are subject to multiple processing events during their biogenesis, and little is known about the mechanism of the final maturation step. We show that in the Staphylococcus epidermidis type III CRISPR-Cas system, mature crRNAs are measured in a Cas10·Csm ribonucleoprotein complex to yield discrete lengths that differ by 6-nucleotide increments. We looked for mutants that impact this crRNA size pattern and found that an alanine substitution of a conserved aspartate residue of Csm3 eliminates the 6-nucleotide increments in the length of crRNAs. In vitro, recombinant Csm3 binds RNA molecules at multiple sites, producing gel-shift patterns that suggest that each protein binds 6 nucleotides of substrate. In vivo, changes in the levels of Csm3 modulate the crRNA size distribution without disrupting the 6-nucleotide periodicity. Our data support a model in which multiple Csm3 molecules within the Cas10·Csm complex bind the crRNA with a 6-nucleotide periodicity to function as a ruler that measures the extent of crRNA maturation. PMID:23935102

The chlorophyll-deficient golden leaf mutation in cucumber is due to a single nucleotide substitution in CsChlI for magnesium chelatase I subunit.

PubMed

Gao, Meiling; Hu, Liangliang; Li, Yuhong; Weng, Yiqun

2016-10-01

The cucumber chlorophyll-deficient golden leaf mutation is due to a single nucleotide substitution in the CsChlI gene for magnesium chelatase I subunit which plays important roles in the chlorophyll biosynthesis pathway. The Mg-chelatase catalyzes the insertion of Mg(2+) into the protoporphyrin IX in the chlorophyll biosynthesis pathway, which is a protein complex encompassing three subunits CHLI, CHLD, and CHLH. Chlorophyll-deficient mutations in genes encoding the three subunits have played important roles in understanding the structure, function and regulation of this important enzyme. In an EMS mutagenesis population, we identified a chlorophyll-deficient mutant C528 with golden leaf color throughout its development which was viable and able to set fruits and seeds. Segregation analysis in multiple populations indicated that this leaf color mutation was recessively inherited and the green color showed complete dominance over golden color. Map-based cloning identified CsChlI as the candidate gene for this mutation which encoded the CHLI subunit of cucumber Mg-chelatase. The 1757-bp CsChlI gene had three exons and a single nucleotide change (G to A) in its third exon resulted in an amino acid substitution (G269R) and the golden leaf color in C528. This mutation occurred in the highly conserved nucleotide-binding domain of the CHLI protein in which chlorophyll-deficient mutations have been frequently identified. The mutant phenotype, CsChlI expression pattern and the mutated residue in the CHLI protein suggested the mutant allele in C528 is unique among mutations identified so far in different species. This golden leaf mutant not only has its potential in cucumber breeding, but also provides a useful tool in understanding the CHLI function and its regulation in the chlorophyll biosynthesis pathway as well as chloroplast development.

RNA structural constraints in the evolution of the influenza A virus genome NP segment

PubMed Central

Gultyaev, Alexander P; Tsyganov-Bodounov, Anton; Spronken, Monique IJ; van der Kooij, Sander; Fouchier, Ron AM; Olsthoorn, René CL

2014-01-01

Conserved RNA secondary structures were predicted in the nucleoprotein (NP) segment of the influenza A virus genome using comparative sequence and structure analysis. A number of structural elements exhibiting nucleotide covariations were identified over the whole segment length, including protein-coding regions. Calculations of mutual information values at the paired nucleotide positions demonstrate that these structures impose considerable constraints on the virus genome evolution. Functional importance of a pseudoknot structure, predicted in the NP packaging signal region, was confirmed by plaque assays of the mutant viruses with disrupted structure and those with restored folding using compensatory substitutions. Possible functions of the conserved RNA folding patterns in the influenza A virus genome are discussed. PMID:25180940

Runaway evolution of the male-specific exon of the doublesex gene in Diptera.

PubMed

Hughes, Austin L

2011-02-01

In Diptera (Insecta), alternatively spliced male-specific and female-specific products of the doublesex (dsx) gene play a key role in regulating development of the adult genital structures from the genital disc. Analysis of the pattern of nucleotide substitution of different domains of the dsx gene in 29 dipteran species showed that, over short evolutionary times, purifying selection predominated on the domain common to both sexes, the female-specific exons, and the and male-specific exon. However, over longer the evolutionary time frames represented by between-family comparisons, the male-specific exon accumulated nonsynonymous substitutions at a much more rapid rate than either the common domain or the female-specific exon. Overall, the accumulation of nonsynonymous substitutions in the male-specific exon occurred at a significantly greater than linear rate relative to the common domain, whereas the accumulation of nonsynonymous substitutions in the female-specific exon occurred at less than linear rate relative to the common domain. The evolution of the male-specific exon of dsx thus shows a pattern reminiscent of that seen in the "runaway" evolution of male secondary sexual characters at the morphological level, consistent with the hypothesis that female choice is an important factor in the morphological diversification of insect male genitalia. Copyright © 2010 Elsevier B.V. All rights reserved.

Exponential decay of GC content detected by strand-symmetric substitution rates influences the evolution of isochore structure.

PubMed

Karro, J E; Peifer, M; Hardison, R C; Kollmann, M; von Grünberg, H H

2008-02-01

The distribution of guanine and cytosine nucleotides throughout a genome, or the GC content, is associated with numerous features in mammals; understanding the pattern and evolutionary history of GC content is crucial to our efforts to annotate the genome. The local GC content is decaying toward an equilibrium point, but the causes and rates of this decay, as well as the value of the equilibrium point, remain topics of debate. By comparing the results of 2 methods for estimating local substitution rates, we identify 620 Mb of the human genome in which the rates of the various types of nucleotide substitutions are the same on both strands. These strand-symmetric regions show an exponential decay of local GC content at a pace determined by local substitution rates. DNA segments subjected to higher rates experience disproportionately accelerated decay and are AT rich, whereas segments subjected to lower rates decay more slowly and are GC rich. Although we are unable to draw any conclusions about causal factors, the results support the hypothesis proposed by Khelifi A, Meunier J, Duret L, and Mouchiroud D (2006. GC content evolution of the human and mouse genomes: insights from the study of processed pseudogenes in regions of different recombination rates. J Mol Evol. 62:745-752.) that the isochore structure has been reshaped over time. If rate variation were a determining factor, then the current isochore structure of mammalian genomes could result from the local differences in substitution rates. We predict that under current conditions strand-symmetric portions of the human genome will stabilize at an average GC content of 30% (considerably less than the current 42%), thus confirming that the human genome has not yet reached equilibrium.

Substitution scanning identifies a novel, catalytically active ibrutinib-resistant BTK cysteine 481 to threonine (C481T) variant

PubMed Central

Hamasy, A; Wang, Q; Blomberg, K E M; Mohammad, D K; Yu, L; Vihinen, M; Berglöf, A; Smith, C I E

2017-01-01

Irreversible Bruton tyrosine kinase (BTK) inhibitors, ibrutinib and acalabrutinib have demonstrated remarkable clinical responses in multiple B-cell malignancies. Acquired resistance has been identified in a sub-population of patients in which mutations affecting BTK predominantly substitute cysteine 481 in the kinase domain for catalytically active serine, thereby ablating covalent binding of inhibitors. Activating substitutions in the BTK substrate phospholipase Cγ2 (PLCγ2) instead confers resistance independent of BTK. Herein, we generated all six possible amino acid substitutions due to single nucleotide alterations for the cysteine 481 codon, in addition to threonine, requiring two nucleotide substitutions, and performed functional analysis. Replacement by arginine, phenylalanine, tryptophan or tyrosine completely inactivated the catalytic activity, whereas substitution with glycine caused severe impairment. BTK with threonine replacement was catalytically active, similar to substitution with serine. We identify three potential ibrutinib resistance scenarios for cysteine 481 replacement: (1) Serine, being catalytically active and therefore predominating among patients. (2) Threonine, also being catalytically active, but predicted to be scarce, because two nucleotide changes are needed. (3) As BTK variants replaced with other residues are catalytically inactive, they presumably need compensatory mutations, therefore being very scarce. Glycine and tryptophan variants were not yet reported but likely also provide resistance. PMID:27282255

Substitution rate and natural selection in parvovirus B19

PubMed Central

Stamenković, Gorana G.; Ćirković, Valentina S.; Šiljić, Marina M.; Blagojević, Jelena V.; Knežević, Aleksandra M.; Joksić, Ivana D.; Stanojević, Maja P.

2016-01-01

The aim of this study was to estimate substitution rate and imprints of natural selection on parvovirus B19 genotype 1. Studied datasets included 137 near complete coding B19 genomes (positions 665 to 4851) for phylogenetic and substitution rate analysis and 146 and 214 partial genomes for selection analyses in open reading frames ORF1 and ORF2, respectively, collected 1973–2012 and including 9 newly sequenced isolates from Serbia. Phylogenetic clustering assigned majority of studied isolates to G1A. Nucleotide substitution rate for total coding DNA was 1.03 (0.6–1.27) x 10−4 substitutions/site/year, with higher values for analyzed genome partitions. In spite of the highest evolutionary rate, VP2 codons were found to be under purifying selection with rare episodic positive selection, whereas codons under diversifying selection were found in the unique part of VP1, known to contain B19 immune epitopes important in persistent infection. Analyses of overlapping gene regions identified nucleotide positions under opposite selective pressure in different ORFs, suggesting complex evolutionary mechanisms of nucleotide changes in B19 viral genomes. PMID:27775080

Hannaella phyllophila sp. nov., a basidiomycetous yeast species associated with plants in Thailand and Taiwan.

PubMed

Surussawadee, Janjira; Jindamorakot, Sasitorn; Nakase, Takashi; Lee, Ching-Fu; Limtong, Savitree

2015-07-01

Five strains representing one novel anamorphic yeast species were isolated from plant leaves collected in Thailand (strains DMKU-SP186(T), ST-111 and ST-201) and Taiwan (strains FN20L02 and SM13L16). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics and sequence analysis of the D1/D2 region of the large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS) region, they were assigned to a single novel species of the genus Hannaella. The sequences of the D1/D2 regions of the LSU rRNA genes of four of the strains (DMKU-SP186(T), ST-111, FN20L02 and SM13L16) were identical, while differing from strain ST-201 by 2 substitutions and 2 gaps. The nucleotide sequence of the ITS regions of the five strains differed from each other by between 0 and 3 nucleotide substitutions. The novel species was most closely related to Hannaella luteola, but showed 1.0-1.3% nucleotide substitutions (between 6 substitutions out of 568-606 nt and 8 substitutions, and 2 gaps out of 597 nt) in the D1/D2 region of the LSU rRNA gene and 1.4-2.0% nucleotide substitutions (6-9 substitutions out of 435 nt) in the ITS region. Ballistospores were produced by three of the strains on cornmeal agar at 15 and 20 °C after 4 weeks, while H. luteola did not produce ballistospores. The name Hannaella phyllophila sp. nov. is proposed. The type strain is DMKU-SP186(T) ( = BCC 69500(T) = NBRC 110428(T) = CBS 13921(T)).

Genome-wide heterogeneity of nucleotide substitution model fit.

PubMed

Arbiza, Leonardo; Patricio, Mateus; Dopazo, Hernán; Posada, David

2011-01-01

At a genomic scale, the patterns that have shaped molecular evolution are believed to be largely heterogeneous. Consequently, comparative analyses should use appropriate probabilistic substitution models that capture the main features under which different genomic regions have evolved. While efforts have concentrated in the development and understanding of model selection techniques, no descriptions of overall relative substitution model fit at the genome level have been reported. Here, we provide a characterization of best-fit substitution models across three genomic data sets including coding regions from mammals, vertebrates, and Drosophila (24,000 alignments). According to the Akaike Information Criterion (AIC), 82 of 88 models considered were selected as best-fit models at least in one occasion, although with very different frequencies. Most parameter estimates also varied broadly among genes. Patterns found for vertebrates and Drosophila were quite similar and often more complex than those found in mammals. Phylogenetic trees derived from models in the 95% confidence interval set showed much less variance and were significantly closer to the tree estimated under the best-fit model than trees derived from models outside this interval. Although alternative criteria selected simpler models than the AIC, they suggested similar patterns. All together our results show that at a genomic scale, different gene alignments for the same set of taxa are best explained by a large variety of different substitution models and that model choice has implications on different parameter estimates including the inferred phylogenetic trees. After taking into account the differences related to sample size, our results suggest a noticeable diversity in the underlying evolutionary process. All together, we conclude that the use of model selection techniques is important to obtain consistent phylogenetic estimates from real data at a genomic scale.

Detecting Single-Nucleotide Substitutions Induced by Genome Editing.

PubMed

Miyaoka, Yuichiro; Chan, Amanda H; Conklin, Bruce R

2016-08-01

The detection of genome editing is critical in evaluating genome-editing tools or conditions, but it is not an easy task to detect genome-editing events-especially single-nucleotide substitutions-without a surrogate marker. Here we introduce a procedure that significantly contributes to the advancement of genome-editing technologies. It uses droplet digital polymerase chain reaction (ddPCR) and allele-specific hydrolysis probes to detect single-nucleotide substitutions generated by genome editing (via homology-directed repair, or HDR). HDR events that introduce substitutions using donor DNA are generally infrequent, even with genome-editing tools, and the outcome is only one base pair difference in 3 billion base pairs of the human genome. This task is particularly difficult in induced pluripotent stem (iPS) cells, in which editing events can be very rare. Therefore, the technological advances described here have implications for therapeutic genome editing and experimental approaches to disease modeling with iPS cells. © 2016 Cold Spring Harbor Laboratory Press.

DNA mismatch repair and oligonucleotide end-protection promote base-pair substitution distal from a CRISPR/Cas9-induced DNA break

PubMed Central

Harmsen, Tim; Klaasen, Sjoerd; van de Vrugt, Henri; te Riele, Hein

2018-01-01

Abstract Single-stranded oligodeoxyribonucleotide (ssODN)-mediated repair of CRISPR/Cas9-induced DNA double-strand breaks (DSB) can effectively be used to introduce small genomic alterations in a defined locus. Here, we reveal DNA mismatch repair (MMR) activity is crucial for efficient nucleotide substitution distal from the Cas9-induced DNA break when the substitution is instructed by the 3′ half of the ssODN. Furthermore, protecting the ssODN 3′ end with phosphorothioate linkages enhances MMR-dependent gene editing events. Our findings can be exploited to optimize efficiencies of nucleotide substitutions distal from the DSB and imply that oligonucleotide-mediated gene editing is effectuated by templated break repair. PMID:29447381

Three new HLA-C alleles (HLA-C*14:02:13, HLA-C*15:72 and HLA-C*15:74) in Saudi bone marrow donors.

PubMed

Fakhoury, H A; Jawdat, D; Alaskar, A S; Al Jumah, M; Cereb, N; Hajeer, A H

2015-10-01

Three new HLA-C alleles were identified by sequence-based typing method (SBT) in donors for the Saudi Bone Marrow Donor Registry (SBMDR). HLA-C*14:02:13 differs from HLA-C*14:02:01 by a silent G to A substitution at nucleotide position 400 in exon 2, where lysine at position 66 remains unchanged. HLA-C*15:72 differs from HLA-C*15:22 by a nonsynonymous C to A substitution at nucleotide position 796 in exon 3, resulting in an amino acid change from phenylalanine to leucine at position 116. HLA-C*15:74 differs from HLA-C*15:08 by a nonsynonymous C to T substitution at nucleotide position 914 in exon 3, resulting in an amino acid change from arginine to tryptophan at position 156. © 2015 John Wiley & Sons Ltd.

Expansion of inverted repeat does not decrease substitution rates in Pelargonium plastid genomes.

PubMed

Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

2017-04-01

For species with minor inverted repeat (IR) boundary changes in the plastid genome (plastome), nucleotide substitution rates were previously shown to be lower in the IR than the single copy regions (SC). However, the impact of large-scale IR expansion/contraction on plastid nucleotide substitution rates among closely related species remains unclear. We included plastomes from 22 Pelargonium species, including eight newly sequenced genomes, and used both pairwise and model-based comparisons to investigate the impact of the IR on sequence evolution in plastids. Ten types of plastome organization with different inversions or IR boundary changes were identified in Pelargonium. Inclusion in the IR was not sufficient to explain the variation of nucleotide substitution rates. Instead, the rate heterogeneity in Pelargonium plastomes was a mixture of locus-specific, lineage-specific and IR-dependent effects. Our study of Pelargonium plastomes that vary in IR length and gene content demonstrates that the evolutionary consequences of retaining these repeats are more complicated than previously suggested. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Structure and Temporal Dynamics of Populations within Wheat Streak Mosaic Virus Isolates

PubMed Central

Hall, Jeffrey S.; French, Roy; Morris, T. Jack; Stenger, Drake C.

2001-01-01

Variation within the Type and Sidney 81 strains of wheat streak mosaic virus was assessed by single-strand conformation polymorphism (SSCP) analysis and confirmed by nucleotide sequencing. Limiting-dilution subisolates (LDSIs) of each strain were evaluated for polymorphism in the P1, P3, NIa, and CP cistrons. Different SSCP patterns among LDSIs of a strain were associated with single-nucleotide substitutions. Sidney 81 LDSI-S10 was used as founding inoculum to establish three lineages each in wheat, corn, and barley. The P1, HC-Pro, P3, CI, NIa, NIb, and CP cistrons of LDSI-S10 and each lineage at passages 1, 3, 6, and 9 were evaluated for polymorphism. By passage 9, each lineage differed in consensus sequence from LDSI-S10. The majority of substitutions occurred within NIa and CP, although at least one change occurred in each cistron except HC-Pro and P3. Most consensus sequence changes among lineages were independent, with substitutions accumulating over time. However, LDSI-S10 bore a variant nucleotide (G6016) in NIa that was restored to A6016 in eight of nine lineages by passage 6. This near-global reversion is most easily explained by selection. Examination of nonconsensus variation revealed a pool of unique substitutions (singletons) that remained constant in frequency during passage, regardless of the host species examined. These results suggest that mutations arising by viral polymerase error are generated at a constant rate but that most newly generated mutants are sequestered in virions and do not serve as replication templates. Thus, a substantial fraction of variation generated is static and has yet to be tested for relative fitness. In contrast, nonsingleton variation increased upon passage, suggesting that some mutants do serve as replication templates and may become established in a population. Replicated mutants may or may not rise to prominence to become the consensus sequence in a lineage, with the fate of any particular mutant subject to selection and stochastic processes such as genetic drift and population growth factors. PMID:11581391

Recurrent DGCR8, DROSHA, and SIX homeodomain mutations in favorable histology Wilms tumors | Office of Cancer Genomics

Cancer.gov

We report the most common single-nucleotide substitution/deletion mutations in favorable histology Wilms tumors (FHWTs) to occur within SIX1/2 (7% of 534 tumors) and microRNA processing genes (miRNAPGs) DGCR8 and DROSHA (15% of 534 tumors). Comprehensive analysis of 77 FHWTs indicates that tumors with SIX1/2 and/or miRNAPG mutations show a pre-induction metanephric mesenchyme gene expression pattern and are significantly associated with both perilobar nephrogenic rests and 11p15 imprinting aberrations.

Single-Nucleotide Polymorphism and Copy Number Variation of the Multidrug Resistance-1 Locus of Plasmodium vivax: Local and Global Patterns

PubMed Central

Vargas-Rodríguez, Rosa del Carmen Miluska; da Silva Bastos, Melissa; Menezes, Maria José; Orjuela-Sánchez, Pamela; Ferreira, Marcelo U.

2012-01-01

Emerging resistance to chloroquine (CQ) poses a major challenge for Plasmodium vivax malaria control, and nucleotide substitutions and copy number variation in the P. vivax multidrug resistance 1 (pvmdr-1) locus, which encodes a digestive vacuole membrane transporter, may modulate this phenotype. We describe patterns of genetic variation in pvmdr-1 alleles from Acre and Amazonas in northwestern Brazil, and compare then with those reported in other malaria-endemic regions. The pvmdr-1 mutation Y976F, which is associated with CQ resistance in Southeast Asia and Oceania, remains rare in northwestern Brazil (1.8%) and its prevalence mirrors that of CQ resistance worldwide. Gene amplification of pvmdr-1, which is associated with mefloquine resistance but increased susceptibility to CQ, remains relatively rare in northwestern Brazil (0.9%) and globally (< 4%), but became common (> 10%) in Tak Province, Thailand, possibly because of drug-mediated selection. The global database we have assembled provides a baseline for further studies of genetic variation in pvmdr-1 and drug resistance in P. vivax malaria. PMID:22949516

Single-nucleotide polymorphism and copy number variation of the multidrug resistance-1 locus of Plasmodium vivax: local and global patterns.

PubMed

Vargas-Rodríguez, Rosa del Carmen Miluska; da Silva Bastos, Melissa; Menezes, Maria José; Orjuela-Sánchez, Pamela; Ferreira, Marcelo U

2012-11-01

Emerging resistance to chloroquine (CQ) poses a major challenge for Plasmodium vivax malaria control, and nucleotide substitutions and copy number variation in the P. vivax multidrug resistance 1 (pvmdr-1) locus, which encodes a digestive vacuole membrane transporter, may modulate this phenotype. We describe patterns of genetic variation in pvmdr-1 alleles from Acre and Amazonas in northwestern Brazil, and compare then with those reported in other malaria-endemic regions. The pvmdr-1 mutation Y976F, which is associated with CQ resistance in Southeast Asia and Oceania, remains rare in northwestern Brazil (1.8%) and its prevalence mirrors that of CQ resistance worldwide. Gene amplification of pvmdr-1, which is associated with mefloquine resistance but increased susceptibility to CQ, remains relatively rare in northwestern Brazil (0.9%) and globally (< 4%), but became common (> 10%) in Tak Province, Thailand, possibly because of drug-mediated selection. The global database we have assembled provides a baseline for further studies of genetic variation in pvmdr-1 and drug resistance in P. vivax malaria.

Determinants of Base-Pair Substitution Patterns Revealed by Whole-Genome Sequencing of DNA Mismatch Repair Defective Escherichia coli.

PubMed

Foster, Patricia L; Niccum, Brittany A; Popodi, Ellen; Townes, Jesse P; Lee, Heewook; MohammedIsmail, Wazim; Tang, Haixu

2018-06-15

Mismatch repair (MMR) is a major contributor to replication fidelity, but its impact varies with sequence context and the nature of the mismatch. Mutation accumulation experiments followed by whole-genome sequencing of MMR-defective E. coli strains yielded ≈30,000 base-pair substitutions, revealing mutational patterns across the entire chromosome. The base-pair substitution spectrum was dominated by A:T > G:C transitions, which occurred predominantly at the center base of 5'N A C3'+5'G T N3' triplets. Surprisingly, growth on minimal medium or at low temperature attenuated these mutations. Mononucleotide runs were also hotspots for base-pair substitutions, and the rate at which these occurred increased with run length. Comparison with ≈2000 base-pair substitutions accumulated in MMR-proficient strains revealed that both kinds of hotspots appeared in the wild-type spectrum and so are likely to be sites of frequent replication errors. In MMR-defective strains transitions were strand biased, occurring twice as often when A and C rather than T and G were on the lagging-strand template. Loss of nucleotide diphosphate kinase increases the cellular concentration of dCTP, which resulted in increased rates of mutations due to misinsertion of C opposite A and T. In an mmr ndk double mutant strain, these mutations were more frequent when the template A and T were on the leading strand, suggesting that lagging-strand synthesis was more error-prone or less well corrected by proofreading than was leading strand synthesis. Copyright © 2018, Genetics.

Differential sequence diversity at merozoite surface protein-1 locus of Plasmodium knowlesi from humans and macaques in Thailand.

PubMed

Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai

2013-08-01

To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

Discovery of Aminopiperidine Indoles That Activate the Guanine Nucleotide Exchange Factor SOS1 and Modulate RAS Signaling.

PubMed

Abbott, Jason R; Hodges, Timothy R; Daniels, R Nathan; Patel, Pratiq A; Kennedy, Jack Phillip; Howes, Jennifer E; Akan, Denis T; Burns, Michael C; Sai, Jiqing; Sobolik, Tammy; Beesetty, Yugandhar; Lee, Taekyu; Rossanese, Olivia W; Phan, Jason; Waterson, Alex G; Fesik, Stephen W

2018-06-01

Deregulated RAS activity, often the result of mutation, is implicated in approximately 30% of all human cancers. Despite this statistic, no clinically successful treatment for RAS-driven tumors has yet been developed. One approach for modulating RAS activity is to target and affect the activity of proteins that interact with RAS, such as the guanine nucleotide exchange factor (GEF) son of sevenless homologue 1 (SOS1). Here, we report on structure-activity relationships (SAR) in an indole series of compounds. Using structure-based design, we systematically explored substitution patterns on the indole nucleus, the pendant amino acid moiety, and the linker unit that connects these two fragments. Best-in-class compounds activate the nucleotide exchange process at sub-micromolar concentrations in vitro, increase levels of active RAS-GTP in HeLa cells, and elicit signaling changes in the mitogen-activated protein kinase/extracellular regulated kinase (MAPK/ERK) pathway, resulting in a decrease in pERK1/2 T202/Y204 protein levels at higher compound concentrations.

Origin of a function by tandem gene duplication limits the evolutionary capability of its sister copy.

PubMed

Hasselmann, Martin; Lechner, Sarah; Schulte, Christina; Beye, Martin

2010-07-27

The most remarkable outcome of a gene duplication event is the evolution of a novel function. Little information exists on how the rise of a novel function affects the evolution of its paralogous sister gene copy, however. We studied the evolution of the feminizer (fem) gene from which the gene complementary sex determiner (csd) recently derived by tandem duplication within the honey bee (Apis) lineage. Previous studies showed that fem retained its sex determination function, whereas the rise of csd established a new primary signal of sex determination. We observed a specific reduction of nonsynonymous to synonymous substitution ratios in Apis to non-Apis fem. We found a contrasting pattern at two other genetically linked genes, suggesting that hitchhiking effects to csd, the locus under balancing selection, is not the cause of this evolutionary pattern. We also excluded higher synonymous substitution rates by relative rate testing. These results imply that stronger purifying selection is operating at the fem gene in the presence of csd. We propose that csd's new function interferes with the function of Fem protein, resulting in molecular constraints and limited evolvability of fem in the Apis lineage. Elevated silent nucleotide polymorphism in fem relative to the genome-wide average suggests that genetic linkage to the csd gene maintained more nucleotide variation in today's population. Our findings provide evidence that csd functionally and genetically interferes with fem, suggesting that a newly evolved gene and its functions can limit the evolutionary capability of other genes in the genome.

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

PubMed

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

Yeast ribonuclease III uses a network of multiple hydrogen bonds for RNA binding and cleavage.

PubMed

Lavoie, Mathieu; Abou Elela, Sherif

2008-08-19

Members of the bacterial RNase III family recognize a variety of short structured RNAs with few common features. It is not clear how this group of enzymes supports high cleavage fidelity while maintaining a broad base of substrates. Here we show that the yeast orthologue of RNase III (Rnt1p) uses a network of 2'-OH-dependent interactions to recognize substrates with different structures. We designed a series of bipartite substrates permitting the distinction between binding and cleavage defects. Each substrate was engineered to carry a single or multiple 2'- O-methyl or 2'-fluoro ribonucleotide substitutions to prevent the formation of hydrogen bonds with a specific nucleotide or group of nucleotides. Interestingly, introduction of 2'- O-methyl ribonucleotides near the cleavage site increased the rate of catalysis, indicating that 2'-OH are not required for cleavage. Substitution of nucleotides in known Rnt1p binding site with 2'- O-methyl ribonucleotides inhibited cleavage while single 2'-fluoro ribonucleotide substitutions did not. This indicates that while no single 2'-OH is essential for Rnt1p cleavage, small changes in the substrate structure are not tolerated. Strikingly, several nucleotide substitutions greatly increased the substrate dissociation constant with little or no effect on the Michaelis-Menten constant or rate of catalysis. Together, the results indicate that Rnt1p uses a network of nucleotide interactions to identify its substrate and support two distinct modes of binding. One mode is primarily mediated by the dsRNA binding domain and leads to the formation of stable RNA/protein complex, while the other requires the presence of the nuclease and N-terminal domains and leads to RNA cleavage.

Mitochondrial DNA sequence analysis of four Alzheimer`s and Parkinson`s disease patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brown, M.D.; Shoffner, J.M.; Wallace, D.C.

1996-01-22

The mitochondrial DNA (mtDNA) sequence was determined on 3 patients with Alzheimer`s disease (AD) exhibiting AD plus Parkinson`s disease (PD) neuropathologic changes and one patient with PD. Patient mtDNA sequences were compared to the standard Cambridge sequence to identify base changes. In the first AD + PD patient, 2 of the 15 nucleotide substitutions may contribute to the neuropathology, a nucleotide pair (np) 4336 transition in the tRNA{sup Gln} gene found 7.4 times more frequently in patients than in controls, and a unique np 721 transition in the 12S rRNA gene which was not found in 70 other patients ormore » 905 controls. In the second AD + PD patient, 27 nucleotide substitutions were detected, including an np 3397 transition in the ND1 gene which converts a conserved methionine to a valine. In the third AD + PD patient, 2 polymorphic base substitutions frequently found at increased frequency in Leber`s hereditary optic neuropathy patients were observed, an np 4216 transition in ND1 and an np 13708 transition in the ND5 gene. For the PD patient, 2 novel variants were observed among 25 base substitutions, an np 1709 substitution in the 16S rRNA gene and an np 15851 missense mutation in the cytb gene. Further studies will be required to demonstrate a casual role for these base substitutions in neurodegenerative disease. 68 refs., 2 tabs.« less

Genomic variation and DNA repair associated with soybean transgenesis: a comparison to cultivars and mutagenized plants.

PubMed

Anderson, Justin E; Michno, Jean-Michel; Kono, Thomas J Y; Stec, Adrian O; Campbell, Benjamin W; Curtin, Shaun J; Stupar, Robert M

2016-05-12

The safety of mutagenized and genetically transformed plants remains a subject of scrutiny. Data gathered and communicated on the phenotypic and molecular variation induced by gene transfer technologies will provide a scientific-based means to rationally address such concerns. In this study, genomic structural variation (e.g. large deletions and duplications) and single nucleotide polymorphism rates were assessed among a sample of soybean cultivars, fast neutron-derived mutants, and five genetically transformed plants developed through Agrobacterium based transformation methods. On average, the number of genes affected by structural variations in transgenic plants was one order of magnitude less than that of fast neutron mutants and two orders of magnitude less than the rates observed between cultivars. Structural variants in transgenic plants, while rare, occurred adjacent to the transgenes, and at unlinked loci on different chromosomes. DNA repair junctions at both transgenic and unlinked sites were consistent with sequence microhomology across breakpoints. The single nucleotide substitution rates were modest in both fast neutron and transformed plants, exhibiting fewer than 100 substitutions genome-wide, while inter-cultivar comparisons identified over one-million single nucleotide polymorphisms. Overall, these patterns provide a fresh perspective on the genomic variation associated with high-energy induced mutagenesis and genetically transformed plants. The genetic transformation process infrequently results in novel genetic variation and these rare events are analogous to genetic variants occurring spontaneously, already present in the existing germplasm, or induced through other types of mutagenesis. It remains unclear how broadly these results can be applied to other crops or transformation methods.

Detection of Rickettsia helvetica and Candidatus R. tarasevichiae DNA in Ixodes persulcatus ticks collected in Northeastern European Russia (Komi Republic).

PubMed

Kartashov, Mikhail Yu; Glushkova, Ludmila I; Mikryukova, Tamara P; Korabelnikov, Igor V; Egorova, Yulia I; Tupota, Natalia L; Protopopova, Elena V; Konovalova, Svetlana N; Ternovoi, Vladimir A; Loktev, Valery B

2017-06-01

The number of tick-borne infections in the northern European regions of Russia has increased considerably in the last years. In the present study, 676 unfed adult Ixodes persulcatus ticks were collected in the Komi Republic from 2011 to 2013 to study tick-borne rickettsioses. Rickettsia spp. DNA was detected by PCR in 51 (7.6%) ticks. The nucleotide sequence analysis of gltA fragments (765bp) from 51 ticks indicated that 60.8% and 39.2% of the ticks were infected with Rickettsia helvetica and Candidatus R. tarasevichiae, respectively. The gltA fragments showed 100% identity with those of Candidatus R. tarasevichiae previously discovered in Siberia and China, whereas R. helvetica showed 99.9% sequence identity with European isolates. The ompB had 8 nucleotide substitutions, 6 of which resulted in amino acid substitutions. In the sca9 gene, 3 nucleotide substitutions were detected, and only one resulted in amino acid substitution. The smpA, ompW, and β-lactamase genes of R. helvetica also showed a high level of sequence identity. Copyright © 2017 Elsevier GmbH. All rights reserved.

Receptor-like genes in the major resistance locus of lettuce are subject to divergent selection.

PubMed Central

Meyers, B C; Shen, K A; Rohani, P; Gaut, B S; Michelmore, R W

1998-01-01

Disease resistance genes in plants are often found in complex multigene families. The largest known cluster of disease resistance specificities in lettuce contains the RGC2 family of genes. We compared the sequences of nine full-length genomic copies of RGC2 representing the diversity in the cluster to determine the structure of genes within this family and to examine the evolution of its members. The transcribed regions range from at least 7.0 to 13.1 kb, and the cDNAs contain deduced open reading frames of approximately 5. 5 kb. The predicted RGC2 proteins contain a nucleotide binding site and irregular leucine-rich repeats (LRRs) that are characteristic of resistance genes cloned from other species. Unique features of the RGC2 gene products include a bipartite LRR region with >40 repeats. At least eight members of this family are transcribed. The level of sequence diversity between family members varied in different regions of the gene. The ratio of nonsynonymous (Ka) to synonymous (Ks) nucleotide substitutions was lowest in the region encoding the nucleotide binding site, which is the presumed effector domain of the protein. The LRR-encoding region showed an alternating pattern of conservation and hypervariability. This alternating pattern of variation was also found in all comparisons within families of resistance genes cloned from other species. The Ka /Ks ratios indicate that diversifying selection has resulted in increased variation at these codons. The patterns of variation support the predicted structure of LRR regions with solvent-exposed hypervariable residues that are potentially involved in binding pathogen-derived ligands. PMID:9811792

A single splice site mutation in human-specific ARHGAP11B causes basal progenitor amplification

PubMed Central

Florio, Marta; Namba, Takashi; Pääbo, Svante; Hiller, Michael; Huttner, Wieland B.

2016-01-01

The gene ARHGAP11B promotes basal progenitor amplification and is implicated in neocortex expansion. It arose on the human evolutionary lineage by partial duplication of ARHGAP11A, which encodes a Rho guanosine triphosphatase–activating protein (RhoGAP). However, a lack of 55 nucleotides in ARHGAP11B mRNA leads to loss of RhoGAP activity by GAP domain truncation and addition of a human-specific carboxy-terminal amino acid sequence. We show that these 55 nucleotides are deleted by mRNA splicing due to a single C→G substitution that creates a novel splice donor site. We reconstructed an ancestral ARHGAP11B complementary DNA without this substitution. Ancestral ARHGAP11B exhibits RhoGAP activity but has no ability to increase basal progenitors during neocortex development. Hence, a single nucleotide substitution underlies the specific properties of ARHGAP11B that likely contributed to the evolutionary expansion of the human neocortex. PMID:27957544

Human fructose-1,6-bisphosphatase gene (FBP1): Exon-intron organization, localization to chromosome bands 9q22.2-q22.3, and mutation screening in subjects with fructose-1,6-bisphosphatase deficiency

DOE Office of Scientific and Technical Information (OSTI.GOV)

El-Maghrabi, M.R.; Jiang, W.

1995-06-10

Fructose-1,6-bisphosphatase (EC 3.1.3.11) is a key regulatory enzyme of gluconeogenesis that catalyzes the hydrolysis of fructose-1,6-bisphosphate to generate fructose-6-phosphate and inorganic phosphate. Deficiency of fructose-1,6-bisphosphatase is associated with fasting hypoglycemia and metabolic acidosis because of impaired gluconeogenesis. We have cloned and characterized the human liver fructose-1,6-bisphosphatase gene (FBP1). FBP1, localized to chromosome bands 9q22.2-q22.3 by fluorescence in situ hybridization, consists of seven exons that span > 31 kb, and the six introns are in the same position as in the rat gene. FBP1 was screened for mutations in two subjects with fructose-1,6-bisphosphatase deficiency. Four nucleotide substitutions were identified, two ofmore » which were silent mutations in the codons for Ala-216 (GCT {yields} GCC) and Gly-319 (GGG {yields} GGA). The other substitutions were in intron 3, a C {yields} T substitution 7 nucleotides downstream from the splice donor site, and in the promoter region, an A {yields} T substitution 188 nucleotides upstream from the start of transcription. These nucleotide substitutions were also found in normal unaffected subjects and thus are not the cause of fructose-1,6-bisphosphatase deficiency in the two subjects studied. The molecular basis of hepatic fructose-1,6-bisphosphatase deficiency in these subjects remains undetermined but could result from unidentified mutations in the promoter that decrease expression or from mutations in another gene that indirectly lead to decreased fructose-1,6-bisphosphatase activity. 18 refs., 3 figs., 3 tabs.« less

Maximum parsimony, substitution model, and probability phylogenetic trees.

PubMed

Weng, J F; Thomas, D A; Mareels, I

2011-01-01

The problem of inferring phylogenies (phylogenetic trees) is one of the main problems in computational biology. There are three main methods for inferring phylogenies-Maximum Parsimony (MP), Distance Matrix (DM) and Maximum Likelihood (ML), of which the MP method is the most well-studied and popular method. In the MP method the optimization criterion is the number of substitutions of the nucleotides computed by the differences in the investigated nucleotide sequences. However, the MP method is often criticized as it only counts the substitutions observable at the current time and all the unobservable substitutions that really occur in the evolutionary history are omitted. In order to take into account the unobservable substitutions, some substitution models have been established and they are now widely used in the DM and ML methods but these substitution models cannot be used within the classical MP method. Recently the authors proposed a probability representation model for phylogenetic trees and the reconstructed trees in this model are called probability phylogenetic trees. One of the advantages of the probability representation model is that it can include a substitution model to infer phylogenetic trees based on the MP principle. In this paper we explain how to use a substitution model in the reconstruction of probability phylogenetic trees and show the advantage of this approach with examples.

Candida kantuleensis sp. nov., a d-xylose-fermenting yeast species isolated from peat in a tropical peat swamp forest.

PubMed

Nitiyon, Sukanya; Khunnamwong, Pannida; Lertwattanasakul, Noppon; Limtong, Savitree

2018-05-24

Three strains (DMKU-XE11 T , DMKU-XE15 and DMKU-XE20) representing a single novel anamorphic and d-xylose-fermenting yeast species were obtained from three peat samples collected from Khan Thulee peat swamp forest in Surat Thani province, Thailand. The strains differed from each other by one to two nucleotide substitutions in the sequences of the D1/D2 region of the large subunit (LSU) rRNA gene and zero to one nucleotide substitution in the internal transcribed spacer (ITS) region. Phylogenetic analysis based on the combined sequences of the ITS and the D1/D2 regions showed that the three strains represented a single Candida species that was distinct from the other related species in the Lodderomyces/Candida albicans clade. The three strains form a subclade with the other Candida species including Candida sanyaensis, Candida tropicalis and Candida sojae. C. sanyaensis was the most closely related species, with 2.1-2.4 % nucleotide substitutions in the D1/D2 region of the LSU rRNA gene, and 3.8-4.0 % nucleotide substitutions in the ITS region. The three strains (DMKU-XE11 T , DMKU-XE15 and DMKU-XE20) were assigned as a single novel species, which was named Candida kantuleensis sp. nov. The type strain is DMKU-XE11 T (=CBS 15219 T =TBRC 7764 T ). The MycoBank number for C. kantuleensis sp. nov. is MB 824179.

Ancient tetraploidy and slow molecular evolution in Scaphiophryne: ecological correlates of speciation mode in Malagasy relict amphibians.

PubMed

Vences, Miguel; Aprea, Gennaro; Capriglione, Teresa; Andreone, Franco; Odierna, Gaetano

2002-01-01

Karyotypes of three microhylid frog species of the Malagasy relict genus Scaphiophryne were studied: Scaphiophryne gottlebei, S. madagascariensis and S. spinosa. The latter two showed a plesiomorphic ranoid karyotype of 2n = 26. In contrast, tetraploidy was demonstrated in S. gottlebei, which constitutes an exceptional state among Malagasy amphibians. A combination of different banding techniques and of rDNA-FISH provided evidence for allopolyploidy in the species and for a completed subsequent functional and structural diploidization. Phylogenetic analysis of mitochondrial 16S rDNA sequences revealed a significant deceleration of nucleotide substitution rates in Scaphiophryne. The tetraploidy of S. gottlebei probably occurred early in their radiation. Ecological and behavioural patterns of Scaphiophryne probably favoured intraspecific gene flow and hybridization events, thereby leading to slow molecular substitution rates and to allopolyploid chromosome speciation in S. gottlebei.

Nonenzymatic oligomerization reactions on templates containing inosinic acid or diaminopurine nucleotide residues

NASA Technical Reports Server (NTRS)

Kozlov, I. A.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

1999-01-01

The template-directed oligomerization of nucleoside-5'-phosphoro-2-methyl imidazolides on standard oligonucleotide templates has been studied extensively. Here, we describe experiments with templates in which inosinic acid (I) is substituted for guanylic acid, or 2,6-diaminopurine nucleotide (D) for adenylic acid. We find that the substitution of I for G in a template is strongly inhibitory and prevents any incorporation of C into internal positions in the oligomeric products of the reaction. The substitution of D for A, on the contrary, leads to increased incorporation of U into the products. We found no evidence for the template-directed facilitation of oligomerization of A or I through A-I base pairing. The significance of these results for prebiotic chemistry is discussed.

Does the choice of nucleotide substitution models matter topologically?

PubMed

Hoff, Michael; Orf, Stefan; Riehm, Benedikt; Darriba, Diego; Stamatakis, Alexandros

2016-03-24

In the context of a master level programming practical at the computer science department of the Karlsruhe Institute of Technology, we developed and make available an open-source code for testing all 203 possible nucleotide substitution models in the Maximum Likelihood (ML) setting under the common Akaike, corrected Akaike, and Bayesian information criteria. We address the question if model selection matters topologically, that is, if conducting ML inferences under the optimal, instead of a standard General Time Reversible model, yields different tree topologies. We also assess, to which degree models selected and trees inferred under the three standard criteria (AIC, AICc, BIC) differ. Finally, we assess if the definition of the sample size (#sites versus #sites × #taxa) yields different models and, as a consequence, different tree topologies. We find that, all three factors (by order of impact: nucleotide model selection, information criterion used, sample size definition) can yield topologically substantially different final tree topologies (topological difference exceeding 10 %) for approximately 5 % of the tree inferences conducted on the 39 empirical datasets used in our study. We find that, using the best-fit nucleotide substitution model may change the final ML tree topology compared to an inference under a default GTR model. The effect is less pronounced when comparing distinct information criteria. Nonetheless, in some cases we did obtain substantial topological differences.

Characteristic mutations found in the ML0411 gene of Mycobacterium leprae isolated in Northeast Asian countries.

PubMed

Kai, M; Nakata, N; Matsuoka, M; Sekizuka, T; Kuroda, M; Makino, M

2013-10-01

Genome analysis of Mycobacterium leprae strain Kyoto-2 in this study revealed characteristic nucleotide substitutions in gene ML0411, compared to the reference genome M. leprae strain TN. The ML0411 gene of Kyoto-2 had six SNPs compared to that of TN. All SNPs in ML0411 were non-synonymous mutations that result in amino acid replacements. In addition, a seventh SNP was found 41 bp upstream of the start codon in the regulatory region. The seven SNP sites in the ML0411 region were investigated by sequencing in 36 M. leprae isolates from the Leprosy Research Center in Japan. The SNP pattern in 14 of the 36 isolates showed similarity to that of Kyoto-2. Determination of the standard SNP types within the 36 stocked isolates revealed that almost all of the Japanese strains belonged to SNP type III, with nucleotide substitutions at position 14676, 164275, and 2935685 of the M. leprae TN genome. The geographical distribution pattern of east Asian M. leprae isolates by discrimination of ML0411 SNPs was investigated and interestingly turned out to be similar to that of tandem repeat numbers of GACATC in the rpoT gene (3 copies or 4 copies), which has been established as a tool for M. leprae genotyping. All seven Korean M. leprae isolates examined in this study, as well as those derived from Honshu Island of Japan, showed 4 copies of the 6-base tandem repeat plus the ML0411 SNPs observed in M. leprae Kyoto-2. They are termed Northeast Asian (NA) strain of M. leprae. On the other hand, many of isolates derived from the Okinawa Islands of Japan and from the Philippines showed 3 copies of the 6-base tandem repeat in addition to the M. leprae TN ML0411 type of SNPs. These results demonstrate the existence of M. leprae strains in Northeast Asian region having characteristic SNP patterns. Copyright © 2013 Elsevier B.V. All rights reserved.

Synthesis of Purine Nucleoside and Nucleotide Analogs as Antiparasitic Agents.

DTIC Science & Technology

1979-09-01

was to conduct studies on the synthesis of purine nucleoside and nucleotide analogs as anti- parasitic agents. The primary target compounds were 5...antiparasitic agents. - Jaffe has proposed that the susceptibility of pathogenic helminths and protozoa to fraudulent purine, in contrast to pyrimidine...8217-substituted derivatives are thus designed to inhibit nucleoside and nucleotide kinases as well as other parasitic enzymes. Mammalian cells, onthe

Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

PubMed

Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V

2016-01-01

Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.

Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals

PubMed Central

Popova, Olga V.; Mikhailov, Kirill V.; Nikitin, Mikhail A.; Logacheva, Maria D.; Penin, Aleksey A.; Muntyan, Maria S.; Kedrova, Olga S.; Petrov, Nikolai B.; Panchin, Yuri V.

2016-01-01

Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha—an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia. PMID:27755612

Natural History of Human Respiratory Syncytial Virus Inferred from Phylogenetic Analysis of the Attachment (G) Glycoprotein with a 60-Nucleotide Duplication

PubMed Central

Trento, Alfonsina; Viegas, Mariana; Galiano, Mónica; Videla, Cristina; Carballal, Guadalupe; Mistchenko, Alicia S.; Melero, José A.

2006-01-01

A total of 47 clinical samples were identified during an active surveillance program of respiratory infections in Buenos Aires (BA) (1999 to 2004) that contained sequences of human respiratory syncytial virus (HRSV) with a 60-nucleotide duplication in the attachment (G) protein gene. This duplication was analogous to that previously described for other three viruses also isolated in Buenos Aires in 1999 (A. Trento et al., J. Gen. Virol. 84:3115-3120, 2003). Phylogenetic analysis indicated that BA sequences with that duplication shared a common ancestor (dated about 1998) with other HRSV G sequences reported worldwide after 1999. The duplicated nucleotide sequence was an exact copy of the preceding 60 nucleotides in early viruses, but both copies of the duplicated segment accumulated nucleotide substitutions in more recent viruses at a rate apparently higher than in other regions of the G protein gene. The evolution of the viruses with the duplicated G segment apparently followed the overall evolutionary pattern previously described for HRSV, and this genotype has replaced other prevailing antigenic group B genotypes in Buenos Aires and other places. Thus, the duplicated segment represents a natural tag that can be used to track the dissemination and evolution of HRSV in an unprecedented setting. We have taken advantage of this situation to reexamine the molecular epidemiology of HRSV and to explore the natural history of this important human pathogen. PMID:16378999

Role of promoter DNA sequence variations on the binding of EGR1 transcription factor.

PubMed

Mikles, David C; Schuchardt, Brett J; Bhat, Vikas; McDonald, Caleb B; Farooq, Amjad

2014-05-01

In response to a wide variety of stimuli such as growth factors and hormones, EGR1 transcription factor is rapidly induced and immediately exerts downstream effects central to the maintenance of cellular homeostasis. Herein, our biophysical analysis reveals that DNA sequence variations within the target gene promoters tightly modulate the energetics of binding of EGR1 and that nucleotide substitutions at certain positions are much more detrimental to EGR1-DNA interaction than others. Importantly, the reduction in binding affinity poorly correlates with the loss of enthalpy and gain of entropy-a trend indicative of a complex interplay between underlying thermodynamic factors due to the differential role of water solvent upon nucleotide substitution. We also provide a rationale for the physical basis of the effect of nucleotide substitutions on the EGR1-DNA interaction at atomic level. Taken together, our study bears important implications on understanding the molecular determinants of a key protein-DNA interaction at the cross-roads of human health and disease. Copyright © 2014 Elsevier Inc. All rights reserved.

Inter- and intraspecific mitochondrial DNA variation in North American bears (Ursus)

USGS Publications Warehouse

Cronin, Matthew A.; Amstrup, Steven C.; Garner, Gerald W.; Vyse, Ernest R.

1991-01-01

We assessed mitochondrial DNA variation in North American black bears (Ursus americanus), brown bears (Ursus arctos), and polar bears (Ursus maritimus). Divergent mitochondrial DNA haplotypes (0.05 base substitutions per nucleotide) were identified in populations of black bears from Montana and Oregon. In contrast, very similar haplotypes occur in black bears across North America. This discordance of haplotype phylogeny and geographic distribution indicates that there has been maintenance of polymorphism and considerable gene flow throughout the history of the species. Intraspecific mitochondrial DNA sequence divergence in brown bears and polar bears is lower than in black bears. The two morphological forms of U. arctos, grizzly and coastal brown bears, are not in distinct mtDNA lineages. Interspecific comparisons indicate that brown bears and polar bears share similar mitochondrial DNA (0.023 base substitutions per nucleotide) which is quite divergent (0.078 base substitutions per nucleotide) from that of black bears. High mitochondrial DNA divergence within black bears and paraphyletic relationships of brown and polar bear mitochondrial DNA indicate that intraspecific variation across species' ranges should be considered in phylogenetic analyses of mitochondrial DNA.

Fast and accurate phylogeny reconstruction using filtered spaced-word matches

PubMed Central

Sohrabi-Jahromi, Salma; Morgenstern, Burkhard

2017-01-01

Abstract Motivation: Word-based or ‘alignment-free’ algorithms are increasingly used for phylogeny reconstruction and genome comparison, since they are much faster than traditional approaches that are based on full sequence alignments. Existing alignment-free programs, however, are less accurate than alignment-based methods. Results: We propose Filtered Spaced Word Matches (FSWM), a fast alignment-free approach to estimate phylogenetic distances between large genomic sequences. For a pre-defined binary pattern of match and don’t-care positions, FSWM rapidly identifies spaced word-matches between input sequences, i.e. gap-free local alignments with matching nucleotides at the match positions and with mismatches allowed at the don’t-care positions. We then estimate the number of nucleotide substitutions per site by considering the nucleotides aligned at the don’t-care positions of the identified spaced-word matches. To reduce the noise from spurious random matches, we use a filtering procedure where we discard all spaced-word matches for which the overall similarity between the aligned segments is below a threshold. We show that our approach can accurately estimate substitution frequencies even for distantly related sequences that cannot be analyzed with existing alignment-free methods; phylogenetic trees constructed with FSWM distances are of high quality. A program run on a pair of eukaryotic genomes of a few hundred Mb each takes a few minutes. Availability and Implementation: The program source code for FSWM including a documentation, as well as the software that we used to generate artificial genome sequences are freely available at http://fswm.gobics.de/ Contact: chris.leimeister@stud.uni-goettingen.de Supplementary information: Supplementary data are available at Bioinformatics online. PMID:28073754

Fast and accurate phylogeny reconstruction using filtered spaced-word matches.

PubMed

Leimeister, Chris-André; Sohrabi-Jahromi, Salma; Morgenstern, Burkhard

2017-04-01

Word-based or 'alignment-free' algorithms are increasingly used for phylogeny reconstruction and genome comparison, since they are much faster than traditional approaches that are based on full sequence alignments. Existing alignment-free programs, however, are less accurate than alignment-based methods. We propose Filtered Spaced Word Matches (FSWM) , a fast alignment-free approach to estimate phylogenetic distances between large genomic sequences. For a pre-defined binary pattern of match and don't-care positions, FSWM rapidly identifies spaced word-matches between input sequences, i.e. gap-free local alignments with matching nucleotides at the match positions and with mismatches allowed at the don't-care positions. We then estimate the number of nucleotide substitutions per site by considering the nucleotides aligned at the don't-care positions of the identified spaced-word matches. To reduce the noise from spurious random matches, we use a filtering procedure where we discard all spaced-word matches for which the overall similarity between the aligned segments is below a threshold. We show that our approach can accurately estimate substitution frequencies even for distantly related sequences that cannot be analyzed with existing alignment-free methods; phylogenetic trees constructed with FSWM distances are of high quality. A program run on a pair of eukaryotic genomes of a few hundred Mb each takes a few minutes. The program source code for FSWM including a documentation, as well as the software that we used to generate artificial genome sequences are freely available at http://fswm.gobics.de/. chris.leimeister@stud.uni-goettingen.de. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

Rapid evolution of avirulence genes in rice blast fungus Magnaporthe oryzae

PubMed Central

2014-01-01

Background Rice blast fungus Magnaporthe oryzae is one of the most devastating pathogens in rice. Avirulence genes in this fungus share a gene-for-gene relationship with the resistance genes in its host rice. Although numerous studies have shown that rice blast R-genes are extremely diverse and evolve rapidly in their host populations, little is known about the evolutionary patterns of the Avr-genes in the pathogens. Results Here, six well-characterized Avr-genes and seven randomly selected non-Avr control genes were used to investigate the genetic variations in 62 rice blast strains from different parts of China. Frequent presence/absence polymorphisms, high levels of nucleotide variation (~10-fold higher than non-Avr genes), high non-synonymous to synonymous substitution ratios, and frequent shared non-synonymous substitution were observed in the Avr-genes of these diversified blast strains. In addition, most Avr-genes are closely associated with diverse repeated sequences, which may partially explain the frequent presence/absence polymorphisms in Avr-genes. Conclusion The frequent deletion and gain of Avr-genes and rapid non-synonymous variations might be the primary mechanisms underlying rapid adaptive evolution of pathogens toward virulence to their host plants, and these features can be used as the indicators for identifying additional Avr-genes. The high number of nucleotide polymorphisms among Avr-gene alleles could also be used to distinguish genetic groups among different strains. PMID:24725999

Phylogeny, rate variation, and genome size evolution of Pelargonium (Geraniaceae).

PubMed

Weng, Mao-Lun; Ruhlman, Tracey A; Gibby, Mary; Jansen, Robert K

2012-09-01

The phylogeny of 58 Pelargonium species was estimated using five plastid markers (rbcL, matK, ndhF, rpoC1, trnL-F) and one mitochondrial gene (nad5). The results confirmed the monophyly of three major clades and four subclades within Pelargonium but also indicate the need to revise some sectional classifications. This phylogeny was used to examine karyotype evolution in the genus: plotting chromosome sizes, numbers and 2C-values indicates that genome size is significantly correlated with chromosome size but not number. Accelerated rates of nucleotide substitution have been previously detected in both plastid and mitochondrial genes in Pelargonium, but sparse taxon sampling did not enable identification of the phylogenetic distribution of these elevated rates. Using the multigene phylogeny as a constraint, we investigated lineage- and locus-specific heterogeneity of substitution rates in Pelargonium for an expanded number of taxa and demonstrated that both plastid and mitochondrial genes have had accelerated substitution rates but with markedly disparate patterns. In the plastid, the exons of rpoC1 have significantly accelerated substitution rates compared to its intron and the acceleration was mainly due to nonsynonymous substitutions. In contrast, the mitochondrial gene, nad5, experienced substantial acceleration of synonymous substitution rates in three internal branches of Pelargonium, but this acceleration ceased in all terminal branches. Several lineages also have dN/dS ratios significantly greater than one for rpoC1, indicating that positive selection is acting on this gene, whereas the accelerated synonymous substitutions in the mitochondrial gene are the result of elevated mutation rates. Published by Elsevier Inc.

Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

PubMed Central

Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

2010-01-01

DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

ModelTest Server: a web-based tool for the statistical selection of models of nucleotide substitution online

PubMed Central

Posada, David

2006-01-01

ModelTest server is a web-based application for the selection of models of nucleotide substitution using the program ModelTest. The server takes as input a text file with likelihood scores for the set of candidate models. Models can be selected with hierarchical likelihood ratio tests, or with the Akaike or Bayesian information criteria. The output includes several statistics for the assessment of model selection uncertainty, for model averaging or to estimate the relative importance of model parameters. The server can be accessed at . PMID:16845102

In What Ways Do Synthetic Nucleotides and Natural Base Lesions Alter the Structural Stability of G-Quadruplex Nucleic Acids?

PubMed Central

2017-01-01

Synthetic analogs of natural nucleotides have long been utilized for structural studies of canonical and noncanonical nucleic acids, including the extensively investigated polymorphic G-quadruplexes (GQs). Dependence on the sequence and nucleotide modifications of the folding landscape of GQs has been reviewed by several recent studies. Here, an overview is compiled on the thermodynamic stability of the modified GQ folds and on how the stereochemical preferences of more than 70 synthetic and natural derivatives of nucleotides substituting for natural ones determine the stability as well as the conformation. Groups of nucleotide analogs only stabilize or only destabilize the GQ, while the majority of analogs alter the GQ stability in both ways. This depends on the preferred syn or anti N-glycosidic linkage of the modified building blocks, the position of substitution, and the folding architecture of the native GQ. Natural base lesions and epigenetic modifications of GQs explored so far also stabilize or destabilize the GQ assemblies. Learning the effect of synthetic nucleotide analogs on the stability of GQs can assist in engineering a required stable GQ topology, and exploring the in vitro action of the single and clustered natural base damage on GQ architectures may provide indications for the cellular events. PMID:29181193

The Evolution of Vp1 Gene in Enterovirus C Species Sub-Group That Contains Types CVA-21, CVA-24, EV-C95, EV-C96 and EV-C99

PubMed Central

Smura, Teemu; Blomqvist, Soile; Vuorinen, Tytti; Ivanova, Olga; Samoilovich, Elena; Al-Hello, Haider; Savolainen-Kopra, Carita; Hovi, Tapani; Roivainen, Merja

2014-01-01

Genus Enterovirus (Family Picornaviridae,) consists of twelve species divided into genetically diverse types by their capsid protein VP1 coding sequences. Each enterovirus type can further be divided into intra-typic sub-clusters (genotypes). The aim of this study was to elucidate what leads to the emergence of novel enterovirus clades (types and genotypes). An evolutionary analysis was conducted for a sub-group of Enterovirus C species that contains types Coxsackievirus A21 (CVA-21), CVA-24, Enterovirus C95 (EV-C95), EV-C96 and EV-C99. VP1 gene datasets were collected and analysed to infer the phylogeny, rate of evolution, nucleotide and amino acid substitution patterns and signs of selection. In VP1 coding gene, high intra-typic sequence diversities and robust grouping into distinct genotypes within each type were detected. Within each type the majority of nucleotide substitutions were synonymous and the non-synonymous substitutions tended to cluster in distinct highly polymorphic sites. Signs of positive selection were detected in some of these highly polymorphic sites, while strong negative selection was indicated in most of the codons. Despite robust clustering to intra-typic genotypes, only few genotype-specific ‘signature’ amino acids were detected. In contrast, when different enterovirus types were compared, there was a clear tendency towards fixation of type-specific ‘signature’ amino acids. The results suggest that permanent fixation of type-specific amino acids is a hallmark associated with evolution of different enterovirus types, whereas neutral evolution and/or (frequency-dependent) positive selection in few highly polymorphic amino acid sites are the dominant forms of evolution when strains within an enterovirus type are compared. PMID:24695547

The evolution of Vp1 gene in enterovirus C species sub-group that contains types CVA-21, CVA-24, EV-C95, EV-C96 and EV-C99.

PubMed

Smura, Teemu; Blomqvist, Soile; Vuorinen, Tytti; Ivanova, Olga; Samoilovich, Elena; Al-Hello, Haider; Savolainen-Kopra, Carita; Hovi, Tapani; Roivainen, Merja

2014-01-01

Genus Enterovirus (Family Picornaviridae,) consists of twelve species divided into genetically diverse types by their capsid protein VP1 coding sequences. Each enterovirus type can further be divided into intra-typic sub-clusters (genotypes). The aim of this study was to elucidate what leads to the emergence of novel enterovirus clades (types and genotypes). An evolutionary analysis was conducted for a sub-group of Enterovirus C species that contains types Coxsackievirus A21 (CVA-21), CVA-24, Enterovirus C95 (EV-C95), EV-C96 and EV-C99. VP1 gene datasets were collected and analysed to infer the phylogeny, rate of evolution, nucleotide and amino acid substitution patterns and signs of selection. In VP1 coding gene, high intra-typic sequence diversities and robust grouping into distinct genotypes within each type were detected. Within each type the majority of nucleotide substitutions were synonymous and the non-synonymous substitutions tended to cluster in distinct highly polymorphic sites. Signs of positive selection were detected in some of these highly polymorphic sites, while strong negative selection was indicated in most of the codons. Despite robust clustering to intra-typic genotypes, only few genotype-specific 'signature' amino acids were detected. In contrast, when different enterovirus types were compared, there was a clear tendency towards fixation of type-specific 'signature' amino acids. The results suggest that permanent fixation of type-specific amino acids is a hallmark associated with evolution of different enterovirus types, whereas neutral evolution and/or (frequency-dependent) positive selection in few highly polymorphic amino acid sites are the dominant forms of evolution when strains within an enterovirus type are compared.

Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments.

PubMed

Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu

2014-10-01

Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

Nucleotide substitutions in dengue virus serotypes from Asian and American countries: insights into intracodon recombination and purifying selection

PubMed Central

2013-01-01

Background Dengue virus (DENV) infection represents a significant public health problem in many subtropical and tropical countries. Although genetically closely related, the four serotypes of DENV differ in antigenicity for which cross protection among serotypes is limited. It is also believed that both multi-serotype infection as well as the evolution of viral antigenicity may have confounding effects in increased dengue epidemics. Numerous studies have been performed that investigated genetic diversity of DENV, but the precise mechanism(s) of dengue virus evolution are not well understood. Results We investigated genome-wide genetic diversity and nucleotide substitution patterns in the four serotypes among samples collected from different countries in Asia and Central and South America and sequenced as part of the Genome Sequencing Center for Infectious Diseases at the Broad Institute. We applied bioinformatics, statistical and coalescent simulation methods to investigate diversity of codon sequences of DENV samples representing the four serotypes. We show that fixation of nucleotide substitutions is more prominent among the inter-continental isolates (Asian and American) of serotypes 1, 2 and 3 compared to serotype 4 isolates (South and Central America) and are distributed in a non-random manner among the genes encoded by the virus. Nearly one third of the negatively selected sites are associated with fixed mutation sites within serotypes. Our results further show that of all the sites showing evidence of recombination, the majority (~84%) correspond to sites under purifying selection in the four serotypes. The analysis further shows that genetic recombination occurs within specific codons, albeit with low frequency (< 5% of all recombination sites) throughout the DENV genome of the four serotypes and reveals significant enrichment (p < 0.05) among sites under purifying selection in the virus. Conclusion The study provides the first evidence for intracodon recombination in DENV and suggests that within codons, genetic recombination has a significant role in maintaining extensive purifying selection of DENV in natural populations. Our study also suggests that fixation of beneficial mutations may lead to virus evolution via translational selection of specific sites in the DENV genome. PMID:23410119

G to A substitution in 5{prime} donor splice site of introns 18 and 48 of COL1A1 gene of type I collagen results in different splicing alternatives in osteogenesis imperfecta type I cell strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willing, M.; Deschenes, S.

We have identified a G to A substitution in the 5{prime} donor splice site of intron 18 of one COL1A1 allele in two unrelated families with osteogenesis imperfecta (OI) type I. A third OI type I family has a G to A substitution at the identical position in intron 48 of one COL1A1 allele. Both mutations abolish normal splicing and lead to reduced steady-state levels of mRNA from the mutant COL1A1 allele. The intron 18 mutation leads to both exon 18 skipping in the mRNA and to utilization of a single alternative splice site near the 3{prime} end of exonmore » 18. The latter results in deletion of the last 8 nucleotides of exon 18 from the mRNA, a shift in the translational reading-frame, and the creation of a premature termination codon in exon 19. Of the potential alternative 5{prime} splice sites in exon 18 and intron 18, the one utilized has a surrounding nucleotide sequence which most closely resembles that of the natural splice site. Although a G to A mutation was detected at the identical position in intron 48 of one COL1A1 allele in another OI type I family, nine complex alternative splicing patterns were identified by sequence analysis of cDNA clones derived from fibroblast mRNA from this cell strain. All result in partial or complete skipping of exon 48, with in-frame deletions of portions of exons 47 and/or 49. The different patterns of RNA splicing were not explained by their sequence homology with naturally occuring 5{prime} splice sites, but rather by recombination between highly homologous exon sequences, suggesting that we may not have identified the major splicing alternative(s) in this cell strain. Both G to A mutations result in decreased production of type I collagen, the common biochemical correlate of OI type I.« less

Dynamic Nucleotide Mutation Gradients and Control Region Usage in Squamate Reptile Mitochondrial Genomes

PubMed Central

Castoe, T.A.; Gu, W.; de Koning, A.P.J.; Daza, J.M.; Jiang, Z.J.; Parkinson, C.L.; Pollock, D.D.

2010-01-01

Gradients of nucleotide bias and substitution rates occur in vertebrate mitochondrial genomes due to the asymmetric nature of the replication process. The evolution of these gradients has previously been studied in detail in primates, but not in other vertebrate groups. From the primate study, the strengths of these gradients are known to evolve in ways that can substantially alter the substitution process, but it is unclear how rapidly they evolve over evolutionary time or how different they may be in different lineages or groups of vertebrates. Given the importance of mitochondrial genomes in phylogenetics and molecular evolutionary research, a better understanding of how asymmetric mitochondrial substitution gradients evolve would contribute key insights into how this gradient evolution may mislead evolutionary inferences, and how it may also be incorporated into new evolutionary models. Most snake mitochondrial genomes have an additional interesting feature, 2 nearly identical control regions, which vary among different species in the extent that they are used as origins of replication. Given the expanded sampling of complete snake genomes currently available, together with 2 additional snakes sequenced in this study, we reexamined gradient strength and CR usage in alethinophidian snakes as well as several lizards that possess dual CRs. Our results suggest that nucleotide substitution gradients (and corresponding nucleotide bias) and CR usage is highly labile over the ∼200 m.y. of squamate evolution, and demonstrates greater overall variability than previously shown in primates. The evidence for the existence of such gradients, and their ability to evolve rapidly and converge among unrelated species suggests that gradient dynamics could easily mislead phylogenetic and molecular evolutionary inferences, and argues strongly that these dynamics should be incorporated into phylogenetic models. PMID:20215734

Slow but not low: genomic comparisons reveal slower evolutionary rate and higher dN/dS in conifers compared to angiosperms.

PubMed

Buschiazzo, Emmanuel; Ritland, Carol; Bohlmann, Jörg; Ritland, Kermit

2012-01-20

Comparative genomics can inform us about the processes of mutation and selection across diverse taxa. Among seed plants, gymnosperms have been lacking in genomic comparisons. Recent EST and full-length cDNA collections for two conifers, Sitka spruce (Picea sitchensis) and loblolly pine (Pinus taeda), together with full genome sequences for two angiosperms, Arabidopsis thaliana and poplar (Populus trichocarpa), offer an opportunity to infer the evolutionary processes underlying thousands of orthologous protein-coding genes in gymnosperms compared with an angiosperm orthologue set. Based upon pairwise comparisons of 3,723 spruce and pine orthologues, we found an average synonymous genetic distance (dS) of 0.191, and an average dN/dS ratio of 0.314. Using a fossil-established divergence time of 140 million years between spruce and pine, we extrapolated a nucleotide substitution rate of 0.68 × 10(-9) synonymous substitutions per site per year. When compared to angiosperms, this indicates a dramatically slower rate of nucleotide substitution rates in conifers: on average 15-fold. Coincidentally, we found a three-fold higher dN/dS for the spruce-pine lineage compared to the poplar-Arabidopsis lineage. This joint occurrence of a slower evolutionary rate in conifers with higher dN/dS, and possibly positive selection, showcases the uniqueness of conifer genome evolution. Our results are in line with documented reduced nucleotide diversity, conservative genome evolution and low rates of diversification in conifers on the one hand and numerous examples of local adaptation in conifers on the other hand. We propose that reduced levels of nucleotide mutation in large and long-lived conifer trees, coupled with large effective population size, were the main factors leading to slow substitution rates but retention of beneficial mutations.

Correlations of nucleotide substitution rates and base composition of mammalian coding sequences with protein structure.

PubMed

Chiusano, M L; D'Onofrio, G; Alvarez-Valin, F; Jabbari, K; Colonna, G; Bernardi, G

1999-09-30

We investigated the relationships between the nucleotide substitution rates and the predicted secondary structures in the three states representation (alpha-helix, beta-sheet, and coil). The analysis was carried out on 34 alignments, each of which comprised sequences belonging to at least four different mammalian orders. The rates of synonymous substitution were found to be significantly different in regions predicted to be alpha-helix, beta-sheet, or coil. Likewise, the nonsynonymous rates also differ, although expectedly at a lower extent, in the three types of secondary structure, suggesting that different selective constraints associated with the different structures are affecting in a similar way the synonymous and nonsynonymous rates. Moreover, the base composition of the third codon positions is different in coding sequence regions corresponding to different secondary structures of proteins.

Switch junction sequences in PMS2-deficient mice reveal a microhomology-mediated mechanism of Ig class switch recombination

PubMed Central

Ehrenstein, Michael R.; Rada, Cristina; Jones, Anne-Marie; Milstein, César; Neuberger, Michael S.

2001-01-01

Isotype switching involves a region-specific, nonhomologous recombinational deletion that has been suggested to occur by nonhomologous joining of broken DNA ends. Here, we find increased donor/acceptor homology at switch junctions from PMS2-deficient mice and propose that class switching can occur by microhomology-mediated end-joining. Interestingly, although isotype switching and somatic hypermutation show many parallels, we confirm that PMS2 deficiency has no major effect on the pattern of nucleotide substitutions generated during somatic hypermutation. This finding is in contrast to MSH2 deficiency. With MSH2, the altered pattern of switch recombination and hypermutation suggests parallels in the mechanics of the two processes, whereas the fact that PMS2 deficiency affects only switch recombination may reflect differences in the pathways of break resolution. PMID:11717399

Nonsynonymous substitution in abalone sperm fertilization genes exceeds substitution in introns and mitochondrial DNA

PubMed Central

Metz, Edward C.; Robles-Sikisaka, Refugio; Vacquier, Victor D.

1998-01-01

Strong positive Darwinian selection acts on two sperm fertilization proteins, lysin and 18-kDa protein, from abalone (Haliotis). To understand the phylogenetic context for this dramatic molecular evolution, we obtained sequences of mitochondrial cytochrome c oxidase subunit I (mtCOI), and genomic sequences of lysin, 18-kDa, and a G protein subunit. Based on mtDNA differentiation, four north Pacific abalone species diverged within the past 2 million years (Myr), and remaining north Pacific species diverged over a period of 4–20 Myr. Between-species nonsynonymous differences in lysin and 18-kDa exons exceed nucleotide differences in introns by 3.5- to 24-fold. Remarkably, in some comparisons nonsynonymous substitutions in lysin and 18-kDa genes exceed synonymous substitutions in mtCOI. Lysin and 18-kDa intron/exon segments were sequenced from multiple red abalone individuals collected over a 1,200-km range. Only two nucleotide changes and two sites of slippage variation were detected in a total of >29,000 nucleotides surveyed. However, polymorphism in mtCOI and a G protein intron was found in this species. This finding suggests that positive selection swept one lysin allele and one 18-kDa allele to fixation. Similarities between mtCOI and lysin gene trees indicate that rapid adaptive evolution of lysin has occurred consistently through the history of the group. Comparisons with mtCOI molecular clock calibrations suggest that nonsynonymous substitutions accumulate 2–50 times faster in lysin and 18-kDa genes than in rapidly evolving mammalian genes. PMID:9724763

SENCA: A Multilayered Codon Model to Study the Origins and Dynamics of Codon Usage

PubMed Central

Pouyet, Fanny; Bailly-Bechet, Marc; Mouchiroud, Dominique; Guéguen, Laurent

2016-01-01

Gene sequences are the target of evolution operating at different levels, including the nucleotide, codon, and amino acid levels. Disentangling the impact of those different levels on gene sequences requires developing a probabilistic model with three layers. Here we present SENCA (site evolution of nucleotides, codons, and amino acids), a codon substitution model that separately describes 1) nucleotide processes which apply on all sites of a sequence such as the mutational bias, 2) preferences between synonymous codons, and 3) preferences among amino acids. We argue that most synonymous substitutions are not neutral and that SENCA provides more accurate estimates of selection compared with more classical codon sequence models. We study the forces that drive the genomic content evolution, intraspecifically in the core genome of 21 prokaryotes and interspecifically for five Enterobacteria. We retrieve the existence of a universal mutational bias toward AT, and that taking into account selection on synonymous codon usage has consequences on the measurement of selection on nonsynonymous substitutions. We also confirm that codon usage bias is mostly driven by selection on preferred codons. We propose new summary statistics to measure the relative importance of the different evolutionary processes acting on sequences. PMID:27401173

Identical substitutions in magnesium chelatase paralogs result in chlorophyll deficient soybean mutants

USDA-ARS?s Scientific Manuscript database

The soybean (Glycine max (L.) Merr.) chlorophyll deficient line MinnGold is a spontaneous mutant characterized by yellow foliage. Map-based cloning and transgenic complementation revealed that the mutant phenotype is caused by a non-synonymous nucleotide substitution in the third exon of a Mg-chelat...

Screening for Novel Germline Rare Mutations Associated with Aggressive Prostate Cancer

DTIC Science & Technology

2015-12-01

amino acid substitution from Threonine (Thr) to Proline (Pro); while rs61756080 results to the amino acid substitution from Glycine (Gly) to Glutamic...Single nucleotide polymorphisms 20 in the gene encoding Krüppel-like factor 7 are associated with type 2 diabetes . Diabetologia. 2005 Jul;48(7

Structure-Function Model for Kissing Loop Interactions That Initiate Dimerization of Ty1 RNA

PubMed Central

Gamache, Eric R.; Doh, Jung H.; Ritz, Justin; Laederach, Alain; Bellaousov, Stanislav; Mathews, David H.; Curcio, M. Joan

2017-01-01

The genomic RNA of the retrotransposon Ty1 is packaged as a dimer into virus-like particles. The 5′ terminus of Ty1 RNA harbors cis-acting sequences required for translation initiation, packaging and initiation of reverse transcription (TIPIRT). To identify RNA motifs involved in dimerization and packaging, a structural model of the TIPIRT domain in vitro was developed from single-nucleotide resolution RNA structural data. In general agreement with previous models, the first 326 nucleotides of Ty1 RNA form a pseudoknot with a 7-bp stem (S1), a 1-nucleotide interhelical loop and an 8-bp stem (S2) that delineate two long, structured loops. Nucleotide substitutions that disrupt either pseudoknot stem greatly reduced helper-Ty1-mediated retrotransposition of a mini-Ty1, but only mutations in S2 destabilized mini-Ty1 RNA in cis and helper-Ty1 RNA in trans. Nested in different loops of the pseudoknot are two hairpins with complementary 7-nucleotide motifs at their apices. Nucleotide substitutions in either motif also reduced retrotransposition and destabilized mini- and helper-Ty1 RNA. Compensatory mutations that restore base-pairing in the S2 stem or between the hairpins rescued retrotransposition and RNA stability in cis and trans. These data inform a model whereby a Ty1 RNA kissing complex with two intermolecular kissing-loop interactions initiates dimerization and packaging. PMID:28445416

Somatic hypermutation in MutS homologue (MSH)3-, MSH6-, and MSH3/MSH6-deficient mice reveals a role for the MSH2-MSH6 heterodimer in modulating the base substitution pattern.

PubMed

Wiesendanger, M; Kneitz, B; Edelmann, W; Scharff, M D

2000-02-07

Although the primary function of the DNA mismatch repair (MMR) system is to identify and correct base mismatches that have been erroneously introduced during DNA replication, recent studies have further implicated several MMR components in somatic hypermutation of immunoglobulin (Ig) genes. We studied the immune response in mice deficient in MutS homologue (MSH)3 and MSH6, two mutually exclusive partners of MSH2 that have not been examined previously for their role in Ig hypermutation. In Msh6(-)/- and Msh3(-)/-/Msh6(-)/- mice, base substitutions are preferentially targeted to G and C nucleotides and to an RGYW hot spot, as has been shown previously in Msh2(-)/- mice. In contrast, Msh3(-)/- mice show no differences from their littermate controls. These findings indicate that the MSH2-MSH6 heterodimer, but not the MSH2-MSH3 complex, is responsible for modulating Ig hypermutation.

A contact photo-cross-linking investigation of the active site of the 8-17 deoxyribozyme.

PubMed

Liu, Yong; Sen, Dipankar

2008-09-12

The small RNA-cleaving 8-17 deoxyribozyme (DNAzyme) has been the subject of extensive mechanistic and structural investigation, including a number of recent single-molecule studies of its global folding. Little detailed insight exists, however, into this DNAzyme's active site; for instance, the identity of specific nucleotides that are proximal to or in contact with the scissile site in the substrate. Here, we report a systematic replacement of a number of bases within the magnesium-folded DNAzyme-substrate complex with thio- and halogen-substituted base analogues, which were then photochemically activated to generate contact cross-links within the complex. Mapping of the cross-links revealed a striking pattern of DNAzyme-substrate cross-links but an absence of significant intra-DNAzyme cross-links. Notably, the two nucleotides directly flanking the scissile phosphodiester cross-linked strongly with functionally important elements within the DNAzyme, the thymine of a G.T wobble base pair, a WCGR bulge loop, and a terminal AGC loop. Mutation of the wobble base pair to a G-C pair led to a significant folding instability of the DNAzyme-substrate complex. The cross-linking patterns obtained were used to generate a model for the DNAzyme's active site that had the substrate's scissile phosphodiester sandwiched between the DNAzyme's wobble thymine and its AGC and WCGR loops.

Mitochondrial DNA variation and genetic relationships of Populus species.

PubMed

Barrett, J W; Rajora, O P; Yeh, F C; Dancik, B P; Strobeck, C

1993-02-01

We examined variation in and around the region coding for the cytochrome c oxidase I (coxI) and ATPase 6 (atp6) genes in the mitochondrial genomes of four Populus species (P. nigra, P. deltoides, P. maximowiczii, and P. tremuloides) and the natural hybrid P. x canadensis (P. deltoides x P. nigra). Total cellular DNAs of these poplars were digested with 16 restriction endonucleases and probed with maize mtDNA-specific probes (CoxI and Atp6). The only variant observed for Atp6 was interspecific, with P. maximowiczii separated from the other species as revealed by EcoRI digestions. No intraspecific mtDNA variation was observed among individuals of P. nigra, P. maximowiczii, P. x canadensis, or P. tremuloides for the CoxI probe. However, two varieties of P. deltoides were distinct because of a single site change in the KpnI digestions, demonstrating that P. deltoides var. deltoides (eastern cottonwood) and var. occidentalis (plains cottonwood) have distinct mitochondrial genomes in the region of the coxI gene. Populus x canadensis shared the same restriction fragment patterns as its suspected maternal parent P. deltoides. Nucleotide substitutions per base in and around the coxI and atp6 genes among the Populus species and the hybrid ranged from 0.0017 to 0.0077. The interspecific estimates of nucleotide substitution per base suggested that P. tremuloides was furthest removed from P. deltoides and P. x canadensis and least diverged from P. nigra. Populus maximowiczii was placed between these two clusters.

Apolipoprotein gene polymorphisms as cause of cholesterol QTLs in mice.

PubMed

Suto, Jun-ichi

2005-06-01

Quantitative trait locus (QTL) analyses of plasma cholesterol levels were carried out in three sets of F(2) mice that were formed in a 'round-robin' manner from C57BL/6J, KK (-A(y)), and RR strains. Six QTLs were identified on chromosomes 1 (Cq1, Cq2, and Cq6), 3 (Cq3), and 9 (Cq4 and Cq5); of these, Cq2 colocalized with Cq6, and Cq4 colocalized with Cq5. The major candidate gene for Cq2 and Cq6 is Apoa2, and that for Cq4 and Cq5 is Apoa4. The adequacy of polymorphisms in candidate genes as cause of QTLs was investigated in this study. For Apoa2, three different alleles (Apoa2(a), Apoa2(b), and Apoa2(c)) are known. Since there was no significant physiologic difference between Apoa2(a) and Apoa2(c) alleles, previous hypothesis that Apoa2(b) was different from Apoa2(a) and Apoa2(c) in the ability to increase cholesterol levels was further supported. Presumably, G-to-A substitution at nucleotide 84 and/or C-to-T substitution at nucleotide 182 are crucial to make the Apoa2(b) unique. On the other hand, for Apoa4, the most striking polymorphism was the number of Glu-Gln-Ala/Val-Gln repeats in carboxyl end; however, this might not be responsible for QTLs. Instead, a silent mutation, C-to-T substitution at nucleotide 771, was shown to be completely correlated with the occurrence of QTLs in a total of six F(2) intercrosses. Provisionally, but reasonably, these base substitutions are qualified as primary causes that constitute QTL effect. The potential strategy for identifying genes and base substitutions underlying QTLs is discussed.

TALEN-mediated single-base-pair editing identification of an intergenic mutation upstream of BUB1B as causative of PCS (MVA) syndrome

PubMed Central

Ochiai, Hiroshi; Miyamoto, Tatsuo; Kanai, Akinori; Hosoba, Kosuke; Sakuma, Tetsushi; Kudo, Yoshiki; Asami, Keiko; Ogawa, Atsushi; Watanabe, Akihiro; Kajii, Tadashi; Yamamoto, Takashi; Matsuura, Shinya

2014-01-01

Cancer-prone syndrome of premature chromatid separation with mosaic variegated aneuploidy [PCS (MVA) syndrome] is a rare autosomal recessive disorder characterized by constitutional aneuploidy and a high risk of childhood cancer. We previously reported monoallelic mutations in the BUB1B gene (encoding BUBR1) in seven Japanese families with the syndrome. No second mutation was found in the opposite allele of any of the families studied, although a conserved BUB1B haplotype and a decreased transcript were identified. To clarify the molecular pathology of the second allele, we extended our mutational search to a candidate region surrounding BUB1B. A unique single nucleotide substitution, G > A at ss802470619, was identified in an intergenic region 44 kb upstream of a BUB1B transcription start site, which cosegregated with the disorder. To examine whether this is the causal mutation, we designed a transcription activator-like effector nuclease–mediated two-step single-base pair editing strategy and biallelically introduced this substitution into cultured human cells. The cell clones showed reduced BUB1B transcripts, increased PCS frequency, and MVA, which are the hallmarks of the syndrome. We also encountered a case of a Japanese infant with PCS (MVA) syndrome carrying a homozygous single nucleotide substitution at ss802470619. These results suggested that the nucleotide substitution identified was the causal mutation of PCS (MVA) syndrome. PMID:24344301

The Complete Nucleotide Sequence of the Mitochondrial Genome of Bactrocera minax (Diptera: Tephritidae)

PubMed Central

Zhang, Bin; Nardi, Francesco; Hull-Sanders, Helen; Wan, Xuanwu; Liu, Yinghong

2014-01-01

The complete 16,043 bp mitochondrial genome (mitogenome) of Bactrocera minax (Diptera: Tephritidae) has been sequenced. The genome encodes 37 genes usually found in insect mitogenomes. The mitogenome information for B. minax was compared to the homologous sequences of Bactrocera oleae, Bactrocera tryoni, Bactrocera philippinensis, Bactrocera carambolae, Bactrocera papayae, Bactrocera dorsalis, Bactrocera correcta, Bactrocera cucurbitae and Ceratitis capitata. The analysis indicated the structure and organization are typical of, and similar to, the nine closely related species mentioned above, although it contains the lowest genome-wide A+T content (67.3%). Four short intergenic spacers with a high degree of conservation among the nine tephritid species mentioned above and B. minax were observed, which also have clear counterparts in the control regions (CRs). Correlation analysis among these ten tephritid species revealed close positive correlation between the A+T content of zero-fold degenerate sites (P0FD), the ratio of nucleotide substitution frequency at P0FD sites to all degenerate sites (zero-fold degenerate sites, two-fold degenerate sites and four-fold degenerate sites) and amino acid sequence distance (ASD) were found. Further, significant positive correlation was observed between the A+T content of four-fold degenerate sites (P4FD) and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites; however, we found significant negative correlation between ASD and the A+T content of P4FD, and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites. A higher nucleotide substitution frequency at non-synonymous sites compared to synonymous sites was observed in nad4, the first time that has been observed in an insect mitogenome. A poly(T) stretch at the 5′ end of the CR followed by a [TA(A)]n-like stretch was also found. In addition, a highly conserved G+A-rich sequence block was observed in front of the poly(T) stretch among the ten tephritid species and two tandem repeats were present in the CR. PMID:24964138

Nucleotide and phylogenetic analyses of the Chlamydia trachomatis ompA gene indicates it is a hotspot for mutation

USDA-ARS?s Scientific Manuscript database

Background: Serovars of the human pathogen Chlamydia trachomatis occupy one of three specific tissue niches. Genomic analyses indicate that the serovars have a phylogeny congruent with their pathobiology and have an average substitution rate of less than one nucleotide per kilobase. The ompA gene, h...

The nucleotide sequence of HLA-B{sup *}2704 reveals a new amino acid substitution in exon 4 which is also present in HLA-B{sup *}2706

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rudwaleit, M.; Bowness, P.; Wordsworth, P.

1996-12-31

The HLA-B27 subtype HLA-B{sup *}2704 is virtually absent in Caucasians but common in Orientals, where it is associated with ankylosing spondylitis. The amino acid sequence of HLA-B{sup *}2704 has been established by peptide mapping and was shown to differ by two amino acids from HLA-B{sup *}2705, HLA-B{sup *}2704 is characterized by a serine for aspartic acid substitution at position 77 and glutamic acid for valine at position 152. To date, however, no nucleotide sequence confirming these changes at the DNA level has been published. 13 refs., 2 figs.

Nucleotide variability in the 5-enolpyruvylshikimate-3-phosphate synthase gene from Eleusine indica (L.) Gaertn.

PubMed

Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S

2008-02-01

This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.

Investigations with methanobacteria and with evolution of the genetic code

NASA Technical Reports Server (NTRS)

Jukes, T. H.

1986-01-01

Mycoplasma capricolum was found by Osawa et al. to use UGA as the code of tryptophan and to contain 75% A + T in its DNA. This change could have been from evolutionary pressure to replace C + G by A + T. Numerous studies have been reported of evolution of proteins as measured by amino acid replacements that are observed when homologus proteins, such as hemoglobins from various vertebrates, are compared. These replacements result from nucleotide substitutions in amino acid codons in the corresponding genes. Simultaneously, silent nucleotide substitutions take place that can be studied when sequences of the genes are compared. These silent evolutionary changes take place mostly in third positions of codons. Two types of nucleotide substitutions are recognized: pyrimidine-pyrimidine and purine-purine interchanges (transitions) and pyriidine-purine interchanges (transversions). Silent transitions are favored when a corresponding transversion would produce an amino acid replacement. Conversely, silent transversions are favored by probability when transitions and transversions will both be silent. Extensive examples of these situations have been found in protein genes, and it is evident that transversions in silent positions predominate in family boxes in most of the examples studied. In associated research a streptomycete from cow manure was found to produce an extracellular enzyme capable of lysing the pseudomurein-contining methanogen Methanobacterium formicicum.

Slow but not low: genomic comparisons reveal slower evolutionary rate and higher dN/dS in conifers compared to angiosperms

PubMed Central

2012-01-01

Background Comparative genomics can inform us about the processes of mutation and selection across diverse taxa. Among seed plants, gymnosperms have been lacking in genomic comparisons. Recent EST and full-length cDNA collections for two conifers, Sitka spruce (Picea sitchensis) and loblolly pine (Pinus taeda), together with full genome sequences for two angiosperms, Arabidopsis thaliana and poplar (Populus trichocarpa), offer an opportunity to infer the evolutionary processes underlying thousands of orthologous protein-coding genes in gymnosperms compared with an angiosperm orthologue set. Results Based upon pairwise comparisons of 3,723 spruce and pine orthologues, we found an average synonymous genetic distance (dS) of 0.191, and an average dN/dS ratio of 0.314. Using a fossil-established divergence time of 140 million years between spruce and pine, we extrapolated a nucleotide substitution rate of 0.68 × 10-9 synonymous substitutions per site per year. When compared to angiosperms, this indicates a dramatically slower rate of nucleotide substitution rates in conifers: on average 15-fold. Coincidentally, we found a three-fold higher dN/dS for the spruce-pine lineage compared to the poplar-Arabidopsis lineage. This joint occurrence of a slower evolutionary rate in conifers with higher dN/dS, and possibly positive selection, showcases the uniqueness of conifer genome evolution. Conclusions Our results are in line with documented reduced nucleotide diversity, conservative genome evolution and low rates of diversification in conifers on the one hand and numerous examples of local adaptation in conifers on the other hand. We propose that reduced levels of nucleotide mutation in large and long-lived conifer trees, coupled with large effective population size, were the main factors leading to slow substitution rates but retention of beneficial mutations. PMID:22264329

Switches in Genomic GC Content Drive Shifts of Optimal Codons under Sustained Selection on Synonymous Sites

PubMed Central

Sun, Yu; Tamarit, Daniel

2017-01-01

Abstract The major codon preference model suggests that codons read by tRNAs in high concentrations are preferentially utilized in highly expressed genes. However, the identity of the optimal codons differs between species although the forces driving such changes are poorly understood. We suggest that these questions can be tackled by placing codon usage studies in a phylogenetic framework and that bacterial genomes with extreme nucleotide composition biases provide informative model systems. Switches in the background substitution biases from GC to AT have occurred in Gardnerella vaginalis (GC = 32%), and from AT to GC in Lactobacillus delbrueckii (GC = 62%) and Lactobacillus fermentum (GC = 63%). We show that despite the large effects on codon usage patterns by these switches, all three species evolve under selection on synonymous sites. In G. vaginalis, the dramatic codon frequency changes coincide with shifts of optimal codons. In contrast, the optimal codons have not shifted in the two Lactobacillus genomes despite an increased fraction of GC-ending codons. We suggest that all three species are in different phases of an on-going shift of optimal codons, and attribute the difference to a stronger background substitution bias and/or longer time since the switch in G. vaginalis. We show that comparative and correlative methods for optimal codon identification yield conflicting results for genomes in flux and discuss possible reasons for the mispredictions. We conclude that switches in the direction of the background substitution biases can drive major shifts in codon preference patterns even under sustained selection on synonymous codon sites. PMID:27540085

Transcriptome sequencing reveals genome-wide variation in molecular evolutionary rate among ferns.

PubMed

Grusz, Amanda L; Rothfels, Carl J; Schuettpelz, Eric

2016-08-30

Transcriptomics in non-model plant systems has recently reached a point where the examination of nuclear genome-wide patterns in understudied groups is an achievable reality. This progress is especially notable in evolutionary studies of ferns, for which molecular resources to date have been derived primarily from the plastid genome. Here, we utilize transcriptome data in the first genome-wide comparative study of molecular evolutionary rate in ferns. We focus on the ecologically diverse family Pteridaceae, which comprises about 10 % of fern diversity and includes the enigmatic vittarioid ferns-an epiphytic, tropical lineage known for dramatically reduced morphologies and radically elongated phylogenetic branch lengths. Using expressed sequence data for 2091 loci, we perform pairwise comparisons of molecular evolutionary rate among 12 species spanning the three largest clades in the family and ask whether previously documented heterogeneity in plastid substitution rates is reflected in their nuclear genomes. We then inquire whether variation in evolutionary rate is being shaped by genes belonging to specific functional categories and test for differential patterns of selection. We find significant, genome-wide differences in evolutionary rate for vittarioid ferns relative to all other lineages within the Pteridaceae, but we recover few significant correlations between faster/slower vittarioid loci and known functional gene categories. We demonstrate that the faster rates characteristic of the vittarioid ferns are likely not driven by positive selection, nor are they unique to any particular type of nucleotide substitution. Our results reinforce recently reviewed mechanisms hypothesized to shape molecular evolutionary rates in vittarioid ferns and provide novel insight into substitution rate variation both within and among fern nuclear genomes.

Comparative Mitogenomic Analysis of Damsel Bugs Representing Three Tribes in the Family Nabidae (Insecta: Hemiptera)

PubMed Central

Song, Fan; Shi, Aimin; Zhou, Xuguo; Cai, Wanzhi

2012-01-01

Background Nabidae, a family of predatory heteropterans, includes two subfamilies and five tribes. We previously reported the complete mitogenome of Alloeorhynchus bakeri, a representative of the tribe Prostemmatini in the subfamily Prostemmatinae. To gain a better understanding of architecture and evolution of mitogenome in Nabidae, mitogenomes of five species representing two tribes (Gorpini and Nabini) in the subfamily Nabinae were sequenced, and a comparative mitogenomic analysis of three nabid tribes in two subfamilies was carried out. Methodology/Principal Findings Nabid mitogenomes share a similar nucleotide composition and base bias, except for the control region, where differences are observed at the subfamily level. In addition, the pattern of codon usage is influenced by the GC content and consistent with the standard invertebrate mitochondrial genetic code and the preference for A+T-rich codons. The comparison among orthologous protein-coding genes shows that different genes have been subject to different rates of molecular evolution correlated with the GC content. The stems and anticodon loops of tRNAs are extremely conserved, and the nucleotide substitutions are largely restricted to TψC and DHU loops and extra arms, with insertion-deletion polymorphisms. Comparative analysis shows similar rates of substitution between the two rRNAs. Long non-coding regions are observed in most Gorpini and Nabini mtDNAs in-between trnI-trnQ and/or trnS2-nad1. The lone exception, Nabis apicalis, however, has lost three tRNAs. Overall, phylogenetic analysis using mitogenomic data is consistent with phylogenies constructed mainly form morphological traits. Conclusions/Significance This comparative mitogenomic analysis sheds light on the architecture and evolution of mitogenomes in the family Nabidae. Nucleotide diversity and mitogenomic traits are phylogenetically informative at subfamily level. Furthermore, inclusion of a broader range of samples representing various taxonomic levels is critical for the understanding of mitogenomic evolution in damsel bugs. PMID:23029320

Distinctive features of single nucleotide alterations in induced pluripotent stem cells with different types of DNA repair deficiency disorders

PubMed Central

Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro

2016-01-01

Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874

Microenvironmental Effect of 2'-O-(1-Pyrenylmethyl)uridine Modified Fluorescent Oligonucleotide Probes on Sensitive and Selective Detection of Target RNA.

PubMed

Imincan, Gülnur; Pei, Fen; Yu, Lijia; Jin, Hongwei; Zhang, Liangren; Yang, Xiaoda; Zhang, Lihe; Tang, XinJing

2016-04-19

2'-O-(1-Pyrenylmethyl)uridine modified oligoribonucleotides provide highly sensitive pyrene fluorescent probes for detecting specific nucleotide mutation of RNA targets. To develop more stable and cost-effective oligonucleotide probes, we investigated the local microenvironmental effects of nearby nucleobases on pyrene fluorescence in duplexes of RNAs and 2'-O-(1-pyrenylmethyl)uridine modified oligonucleotides. By incorporation of deoxyribonucleotides, ribonucleotides, 2'-MeO-nucleotides and 2'-F-nucleotides at both sides of 2'-O-(1-pyrenylmethyl)uridine (U(p)) in oligodeoxynucleotide probes, we synthesized a series of pyrene modified oligonucleotide probes. Their pyrene fluorescence emission spectra indicated that only two proximal nucleotides have a substantial effect on the pyrene fluorescence properties of these oligonucleotide probes hybridized with target RNA with an order of fluorescence sensitivity of 2'-F-nucleotides > 2'-MeO-nucleotides > ribonucleotides ≫ deoxyribonucleotides. While based on circular dichroism spectra, overall helix conformations (either A- or B-form) of the duplexes have marginal effects on the sensitivity of the probes. Instead, the local substitution reflected the propensity of the nucleotide sugar ring to adopt North type conformation and, accordingly, shifted their helix geometry toward a more A-type like conformation in local microenvironments. Thus, higher enhancement of pyrene fluorescence emission favored local A-type helix structures and more polar and hydrophobic environments (F > MeO > OH at 2' substitution) of duplex minor grooves of probes with the target RNA. Further dynamic simulation revealed that local microenvironmental effect of 2'-F-nucleotides or ribonucleotides was enough for pyrene moiety to move out of nucleobases to the minor groove of duplexes; in addition, 2'-F-nucleotide had less effect on π-stack of pyrene-modified uridine with upstream and downstream nucleobases. The present oligonucleotide probes successfully distinguished target RNA from single-mutated RNA analyte during an in vitro assay of RNA synthesis.

Novel modes of RNA editing in mitochondria

PubMed Central

Moreira, Sandrine; Valach, Matus; Aoulad-Aissa, Mohamed; Otto, Christian; Burger, Gertraud

2016-01-01

Abstract Gene structure and expression in diplonemid mitochondria are unparalleled. Genes are fragmented in pieces (modules) that are separately transcribed, followed by the joining of module transcripts to contiguous RNAs. Some instances of unique uridine insertion RNA editing at module boundaries were noted, but the extent and potential occurrence of other editing types remained unknown. Comparative analysis of deep transcriptome and genome data from Diplonema papillatum mitochondria reveals ∼220 post-transcriptional insertions of uridines, but no insertions of other nucleotides nor deletions. In addition, we detect in total 114 substitutions of cytosine by uridine and adenosine by inosine, amassed into unusually compact clusters. Inosines in transcripts were confirmed experimentally. This is the first report of adenosine-to-inosine editing of mRNAs and ribosomal RNAs in mitochondria. In mRNAs, editing causes mostly amino-acid additions and non-synonymous substitutions; in ribosomal RNAs, it permits formation of canonical secondary structures. Two extensively edited transcripts were compared across four diplonemids. The pattern of uridine-insertion editing is strictly conserved, whereas substitution editing has diverged dramatically, but still rendering diplonemid proteins more similar to other eukaryotic orthologs. We posit that RNA editing not only compensates but also sustains, or even accelerates, ultra-rapid evolution of genome structure and sequence in diplonemid mitochondria. PMID:27001515

Comparative Analysis of the Mitochondrial Genomes of Callitettixini Spittlebugs (Hemiptera: Cercopidae) Confirms the Overall High Evolutionary Speed of the AT-Rich Region but Reveals the Presence of Short Conservative Elements at the Tribal Level

PubMed Central

Liu, Jie; Bu, Cuiping; Wipfler, Benjamin; Liang, Aiping

2014-01-01

The present study compares the mitochondrial genomes of five species of the spittlebug tribe Callitettixini (Hemiptera: Cercopoidea: Cercopidae) from eastern Asia. All genomes of the five species sequenced are circular double-stranded DNA molecules and range from 15,222 to 15,637 bp in length. They contain 22 tRNA genes, 13 protein coding genes (PCGs) and 2 rRNA genes and share the putative ancestral gene arrangement of insects. The PCGs show an extreme bias of nucleotide and amino acid composition. Significant differences of the substitution rates among the different genes as well as the different codon position of each PCG are revealed by the comparative evolutionary analyses. The substitution speeds of the first and second codon position of different PCGs are negatively correlated with their GC content. Among the five species, the AT-rich region features great differences in length and pattern and generally shows a 2–5 times higher substitution rate than the fastest PCG in the mitochondrial genome, atp8. Despite the significant variability in length, short conservative segments were identified in the AT-rich region within Callitettixini, although absent from the other groups of the spittlebug superfamily Cercopoidea. PMID:25285442

Identification of a His54Gln substitution in von Willebrand factor from a patient with defective binding of factor VIII.

PubMed

Rick, M E; Krizek, D M

1996-04-01

A patient with type 2N ("Normandy" variant) von Willebrand's disease is described. Her von Willebrand factor level was borderline low, while her factor VIII was markedly decreased to 7%. Her plasma von Willebrand factor demonstrated a decreased ability to complex with factor VIII in vitro, binding less than 10% when compared to normal plasma von Willebrand factor. The factor VIII released into the circulation after the patient received DDAVP had a shortened survival in vivo. Nucleotide sequence analysis revealed a T-to-A transition at nucleotide 2451 on both alleles. This transition results in a substitution of Gln for His at amino acid 54 in the mature subunit of von Willebrand factor.

Variants of glycoside hydrolases

DOEpatents

Teter, Sarah; Ward, Connie; Cherry, Joel; Jones, Aubrey; Harris, Paul; Yi, Jung

2013-02-26

The present invention relates to variants of a parent glycoside hydrolase, comprising a substitution at one or more positions corresponding to positions 21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455, 467, and 486 of amino acids 1 to 513 of SEQ ID NO: 2, and optionally further comprising a substitution at one or more positions corresponding to positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of SEQ ID NO: 2 a substitution at one or more positions corresponding to positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of SEQ ID NO: 2, wherein the variants have glycoside hydrolase activity. The present invention also relates to nucleotide sequences encoding the variant glycoside hydrolases and to nucleic acid constructs, vectors, and host cells comprising the nucleotide sequences.

Variants of glycoside hydrolases

DOEpatents

Teter, Sarah [Davis, CA; Ward, Connie [Hamilton, MT; Cherry, Joel [Davis, CA; Jones, Aubrey [Davis, CA; Harris, Paul [Carnation, WA; Yi, Jung [Sacramento, CA

2011-04-26

The present invention relates to variants of a parent glycoside hydrolase, comprising a substitution at one or more positions corresponding to positions 21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455, 467, and 486 of amino acids 1 to 513 of SEQ ID NO: 2, and optionally further comprising a substitution at one or more positions corresponding to positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of SEQ ID NO: 2 a substitution at one or more positions corresponding to positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of SEQ ID NO: 2, wherein the variants have glycoside hydrolase activity. The present invention also relates to nucleotide sequences encoding the variant glycoside hydrolases and to nucleic acid constructs, vectors, and host cells comprising the nucleotide sequences.

Expanding diversity at the HLA-B locus: 28 novel HLA-B alleles.

PubMed

Lazaro, A M; Xiao, Y; Cao, K; Masaberg, C; Nichol, L; Ng, J; Hurley, C K; Posch, P E

2008-05-01

Twenty-eight novel human leukocyte antigen-B alleles are described: one B*07 (*0745), two B*08 (*0826 and *0831), one B*27 (*2731), four B*35 (*350106, *350402, *3566, and *3568), two B*37 (*370102 and *3711), two B*38 (*380102 and *3813), two B*39 (*3935 and *3939), one B*41 (*4108), one B*42 (*4209), two B*44 (*4444 and *4448), two B*48 (*480302 and *4815), one B*51 (*5140), one B*55 (*5523), one B*56 (*5617), two B*57 (*570103 and *5710), and three B*15 (*9505, *9510, and *9519). Sixteen of the variants are single-nucleotide substitutions from their most homologous allele, of which 10 result in amino acid changes (B*0745, *0831, *3813, *3935, *3939, *4815, *9505, *9509, *9510, and *9519) and 6 are silent substitutions. The remaining alleles (B*0826, *2731, *3566, *3568, *3711, *4108, *4209, *4444, *4448, *5140, *5523, *5617, and *5710) differ from their most similar alleles by two to seven nucleotides substitutions, altering from one to five amino acids.

Variants of glycoside hydrolases

DOEpatents

Teter, Sarah; Ward, Connie; Cherry, Joel; Jones, Aubrey; Harris, Paul; Yi, Jung

2017-07-11

The present invention relates to variants of a parent glycoside hydrolase, comprising a substitution at one or more positions corresponding to positions 21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455, 467, and 486 of amino acids 1 to 513 of SEQ ID NO: 2, and optionally further comprising a substitution at one or more positions corresponding to positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of SEQ ID NO: 2 a substitution at one or more positions corresponding to positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of SEQ ID NO: 2, wherein the variants have glycoside hydrolase activity. The present invention also relates to nucleotide sequences encoding the variant glycoside hydrolases and to nucleic acid constructs, vectors, and host cells comprising the nucleotide sequences.

Digital gene expression analysis of the zebra finch genome

PubMed Central

2010-01-01

Background In order to understand patterns of adaptation and molecular evolution it is important to quantify both variation in gene expression and nucleotide sequence divergence. Gene expression profiling in non-model organisms has recently been facilitated by the advent of massively parallel sequencing technology. Here we investigate tissue specific gene expression patterns in the zebra finch (Taeniopygia guttata) with special emphasis on the genes of the major histocompatibility complex (MHC). Results Almost 2 million 454-sequencing reads from cDNA of six different tissues were assembled and analysed. A total of 11,793 zebra finch transcripts were represented in this EST data, indicating a transcriptome coverage of about 65%. There was a positive correlation between the tissue specificity of gene expression and non-synonymous to synonymous nucleotide substitution ratio of genes, suggesting that genes with a specialised function are evolving at a higher rate (or with less constraint) than genes with a more general function. In line with this, there was also a negative correlation between overall expression levels and expression specificity of contigs. We found evidence for expression of 10 different genes related to the MHC. MHC genes showed relatively tissue specific expression levels and were in general primarily expressed in spleen. Several MHC genes, including MHC class I also showed expression in brain. Furthermore, for all genes with highest levels of expression in spleen there was an overrepresentation of several gene ontology terms related to immune function. Conclusions Our study highlights the usefulness of next-generation sequence data for quantifying gene expression in the genome as a whole as well as in specific candidate genes. Overall, the data show predicted patterns of gene expression profiles and molecular evolution in the zebra finch genome. Expression of MHC genes in particular, corresponds well with expression patterns in other vertebrates. PMID:20359325

Multilocus sequence analysis of Thermoanaerobacter isolates reveals recombining, but differentiated, populations from geothermal springs of the Uzon Caldera, Kamchatka, Russia

PubMed Central

Wagner, Isaac D.; Varghese, Litty B.; Hemme, Christopher L.; Wiegel, Juergen

2013-01-01

Thermal environments have island-like characteristics and provide a unique opportunity to study population structure and diversity patterns of microbial taxa inhabiting these sites. Strains having ≥98% 16S rRNA gene sequence similarity to the obligately anaerobic Firmicutes Thermoanaerobacter uzonensis were isolated from seven geothermal springs, separated by up to 1600 m, within the Uzon Caldera (Kamchatka, Russian Far East). The intraspecies variation and spatial patterns of diversity for this taxon were assessed by multilocus sequence analysis (MLSA) of 106 strains. Analysis of eight protein-coding loci (gyrB, lepA, leuS, pyrG, recA, recG, rplB, and rpoB) revealed that all loci were polymorphic and that nucleotide substitutions were mostly synonymous. There were 148 variable nucleotide sites across 8003 bp concatenates of the protein-coding loci. While pairwise FST values indicated a small but significant level of genetic differentiation between most subpopulations, there was a negligible relationship between genetic divergence and spatial separation. Strains with the same allelic profile were only isolated from the same hot spring, occasionally from consecutive years, and single locus variant (SLV) sequence types were usually derived from the same spring. While recombination occurred, there was an “epidemic” population structure in which a particular T. uzonensis sequence type rose in frequency relative to the rest of the population. These results demonstrate spatial diversity patterns for an anaerobic bacterial species in a relative small geographic location and reinforce the view that terrestrial geothermal springs are excellent places to look for biogeographic diversity patterns regardless of the involved distances. PMID:23801987

Higher-level phylogeny of paraneopteran insects inferred from mitochondrial genome sequences

PubMed Central

Li, Hu; Shao, Renfu; Song, Nan; Song, Fan; Jiang, Pei; Li, Zhihong; Cai, Wanzhi

2015-01-01

Mitochondrial (mt) genome data have been proven to be informative for animal phylogenetic studies but may also suffer from systematic errors, due to the effects of accelerated substitution rate and compositional heterogeneity. We analyzed the mt genomes of 25 insect species from the four paraneopteran orders, aiming to better understand how accelerated substitution rate and compositional heterogeneity affect the inferences of the higher-level phylogeny of this diverse group of hemimetabolous insects. We found substantial heterogeneity in base composition and contrasting rates in nucleotide substitution among these paraneopteran insects, which complicate the inference of higher-level phylogeny. The phylogenies inferred with concatenated sequences of mt genes using maximum likelihood and Bayesian methods and homogeneous models failed to recover Psocodea and Hemiptera as monophyletic groups but grouped, instead, the taxa that had accelerated substitution rates together, including Sternorrhyncha (a suborder of Hemiptera), Thysanoptera, Phthiraptera and Liposcelididae (a family of Psocoptera). Bayesian inference with nucleotide sequences and heterogeneous models (CAT and CAT + GTR), however, recovered Psocodea, Thysanoptera and Hemiptera each as a monophyletic group. Within Psocodea, Liposcelididae is more closely related to Phthiraptera than to other species of Psocoptera. Furthermore, Thysanoptera was recovered as the sister group to Hemiptera. PMID:25704094

Long-range dispersal moved Francisella tularensis into Western Europe from the East.

PubMed

Dwibedi, Chinmay; Birdsell, Dawn; Lärkeryd, Adrian; Myrtennäs, Kerstin; Öhrman, Caroline; Nilsson, Elin; Karlsson, Edvin; Hochhalter, Christian; Rivera, Andrew; Maltinsky, Sara; Bayer, Brittany; Keim, Paul; Scholz, Holger C; Tomaso, Herbert; Wittwer, Matthias; Beuret, Christian; Schuerch, Nadia; Pilo, Paola; Hernández Pérez, Marta; Rodriguez-Lazaro, David; Escudero, Raquel; Anda, Pedro; Forsman, Mats; Wagner, David M; Larsson, Pär; Johansson, Anders

2016-12-01

For many infections transmitting to humans from reservoirs in nature, disease dispersal patterns over space and time are largely unknown. Here, a reversed genomics approach helped us understand disease dispersal and yielded insight into evolution and biological properties of Francisella tularensis , the bacterium causing tularemia. We whole-genome sequenced 67 strains and characterized by single-nucleotide polymorphism assays 138 strains, collected from individuals infected 1947-2012 across Western Europe. We used the data for phylogenetic, population genetic and geographical network analyses. All strains ( n =205) belonged to a monophyletic population of recent ancestry not found outside Western Europe. Most strains ( n =195) throughout the study area were assigned to a star-like phylogenetic pattern indicating that colonization of Western Europe occurred via clonal expansion. In the East of the study area, strains were more diverse, consistent with a founder population spreading from east to west. The relationship of genetic and geographic distance within the F. tularensis population was complex and indicated multiple long-distance dispersal events. Mutation rate estimates based on year of isolation indicated null rates; in outbreak hotspots only, there was a rate of 0.4 mutations/genome/year. Patterns of nucleotide substitution showed marked AT mutational bias suggestive of genetic drift. These results demonstrate that tularemia has moved from east to west in Europe and that F. tularensis has a biology characterized by long-range geographical dispersal events and mostly slow, but variable, replication rates. The results indicate that mutation-driven evolution, a resting survival phase, genetic drift and long-distance geographical dispersal events have interacted to generate genetic diversity within this species.

Identification of Four Novel Synonymous Substitutions in the X-Linked Genes Neuroligin 3 and Neuroligin 4X in Japanese Patients with Autistic Spectrum Disorder.

PubMed

Yanagi, Kumiko; Kaname, Tadashi; Wakui, Keiko; Hashimoto, Ohiko; Fukushima, Yoshimitsu; Naritomi, Kenji

2012-01-01

Mutations in the X-linked genes neuroligin 3 (NLGN3) and neuroligin 4X (NLGN4X) were first implicated in the pathogenesis of X-linked autism in Swedish families. However, reports of mutations in these genes in autism spectrum disorder (ASD) patients from various ethnic backgrounds present conflicting results regarding the etiology of ASD, possibly because of genetic heterogeneity and/or differences in their ethnic background. Additional mutation screening study on another ethnic background could help to clarify the relevance of the genes to ASD. We scanned the entire coding regions of NLGN3 and NLGN4X in 62 Japanese patients with ASD by polymerase chain reaction-high-resolution melting curve and direct sequencing analyses. Four synonymous substitutions, one in NLGN3 and three in NLGN4X, were identified in four of the 62 patients. These substitutions were not present in 278 control X-chromosomes from unrelated Japanese individuals and were not registered in the database of Single Nucleotide Polymorphisms build 132 or in the Japanese Single Nucleotide Polymorphisms database, indicating that they were novel and specific to ASD. Though further analysis is necessary to determine the physiological and clinical importance of such substitutions, the possibility of the relevance of both synonymous and nonsynonymous substitutions with the etiology of ASD should be considered.

Identification of Four Novel Synonymous Substitutions in the X-Linked Genes Neuroligin 3 and Neuroligin 4X in Japanese Patients with Autistic Spectrum Disorder

PubMed Central

Yanagi, Kumiko; Kaname, Tadashi; Wakui, Keiko; Hashimoto, Ohiko; Fukushima, Yoshimitsu; Naritomi, Kenji

2012-01-01

Mutations in the X-linked genes neuroligin 3 (NLGN3) and neuroligin 4X (NLGN4X) were first implicated in the pathogenesis of X-linked autism in Swedish families. However, reports of mutations in these genes in autism spectrum disorder (ASD) patients from various ethnic backgrounds present conflicting results regarding the etiology of ASD, possibly because of genetic heterogeneity and/or differences in their ethnic background. Additional mutation screening study on another ethnic background could help to clarify the relevance of the genes to ASD. We scanned the entire coding regions of NLGN3 and NLGN4X in 62 Japanese patients with ASD by polymerase chain reaction-high-resolution melting curve and direct sequencing analyses. Four synonymous substitutions, one in NLGN3 and three in NLGN4X, were identified in four of the 62 patients. These substitutions were not present in 278 control X-chromosomes from unrelated Japanese individuals and were not registered in the database of Single Nucleotide Polymorphisms build 132 or in the Japanese Single Nucleotide Polymorphisms database, indicating that they were novel and specific to ASD. Though further analysis is necessary to determine the physiological and clinical importance of such substitutions, the possibility of the relevance of both synonymous and nonsynonymous substitutions with the etiology of ASD should be considered. PMID:22934180

Cytosine substituted calix[4]pyrroles: Neutral receptors for 5′-guanosine monophosphate

PubMed Central

Sessler, Jonathan L.; Král, Vladimír; Shishkanova, Tatiana V.; Gale, Philip A.

2002-01-01

The synthesis and characterization of two cytosine-substituted calix[4]pyrrole conjugates, bearing the appended cytosine attached at either a β- or meso-pyrrolic position, is described. These systems were tested as nucleotide-selective carriers and as active components of nucleotide-sensing ion-selective electrodes at pH 6.6. Studies of carrier selectivity were made using a Pressman-type model membrane system consisting of an initial pH 6.0 aqueous phase, an intervening dichloromethane barrier containing the calix[4]pyrrole conjugate, and a receiving basic aqueous phase. Good selectivity for the Watson–Crick complementary nucleotide, 5′-guanosine monophosphate (5′-GMP), was seen in the case of the meso-linked conjugate with the relative rates of through-membrane transport being 7.7:4.1:1 for 5′-GMP, 5′-AMP, and 5′-CMP, respectively. By contrast, the β-substituted conjugate, while showing a selectivity for 5′-GMP that was enhanced relative to unsubstituted calix[4]pyrrole, was found to transport 5′-CMP roughly 4.5 times more quickly than 5′-GMP. Higher selectivities were also found for 5′-CMP when both the β- and meso-substituted conjugates were incorporated into polyvinyl chloride membranes and tested as ion selective electrodes at pH 6.6, whereas near-equal selectivities were observed for 5′-CMP and 5′-GMP in the case of unsubstituted calix[4]pyrroles. These seemingly disparate results are consistent with a picture wherein the meso-substituted cytosine calix[4]pyrrole conjugate, but not its β-linked congener, is capable of acting as a ditopic receptor, binding concurrently both the phosphate anion and nucleobase portions of 5′-GMP to the calixpyrrole core and cytosine “tails” of the molecule, respectively, with the effect of this binding being most apparent under the conditions of the transport experiments. PMID:11929967

Nuclear-Cytoplasmic Conflict in Pea (Pisum sativum L.) Is Associated with Nuclear and Plastidic Candidate Genes Encoding Acetyl-CoA Carboxylase Subunits

PubMed Central

Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.

2015-01-01

In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472

Influence of mandatory generic substitution on pharmaceutical sales patterns: a national study over five years.

PubMed

Andersson, Karolina A; Petzold, Max G; Allebeck, Peter; Carlsten, Anders

2008-02-29

Mandatory generic substitution was introduced in Sweden in October 2002 in order to try to curb escalating pharmaceutical expenditure. The aim of this study was to investigate how sales patterns for substitutable and non-substitutable pharmaceuticals have developed since the introduction of mandatory generic substitution; furthermore, to compare sales patterns in different groups of the population, based on patients' age and gender. Five therapeutic groups comprising both substitutable and non-substitutable pharmaceuticals were included. The study period was from January 2000 to June 2005. National sales data were used, covering volumes of dispensed prescription medicines (expressed in defined daily doses per 1000 inhabitants and day) of each pharmacological substance in the therapeutic groups for each age and gender group. Sales patterns for substitutable and non-substitutable pharmaceuticals were compared using a descriptive approach. In most therapeutic groups there has been an increase in the volumes of substitutable pharmaceuticals sold since the introduction of the reform, ranging from one third to three times the initial volume; whereas the volumes of non-substitutable pharmaceuticals have levelled out or declined. There were few gender differences in sales patterns of substitutable and non-substitutable drugs. In three therapeutic groups, sales patterns differed across different age groups, and there was a tendency for volumes of recently introduced non-substitutable pharmaceuticals to be proportionally higher in the youngest age groups. Since the introduction of the reform, there has been a proportionally larger increase in sales of substitutable pharmaceuticals compared with sales of non-substitutable pharmaceuticals. This indicates that the reform might have contributed to larger sales of less expensive pharmaceuticals.

WEB-server for search of a periodicity in amino acid and nucleotide sequences

NASA Astrophysics Data System (ADS)

E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

2017-12-01

A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

Single genome retrieval of context-dependent variability in mutation rates for human germline.

PubMed

Sahakyan, Aleksandr B; Balasubramanian, Shankar

2017-01-13

Accurate knowledge of the core components of substitution rates is of vital importance to understand genome evolution and dynamics. By performing a single-genome and direct analysis of 39,894 retrotransposon remnants, we reveal sequence context-dependent germline nucleotide substitution rates for the human genome. The rates are characterised through rate constants in a time-domain, and are made available through a dedicated program (Trek) and a stand-alone database. Due to the nature of the method design and the imposed stringency criteria, we expect our rate constants to be good estimates for the rates of spontaneous mutations. Benefiting from such data, we study the short-range nucleotide (up to 7-mer) organisation and the germline basal substitution propensity (BSP) profile of the human genome; characterise novel, CpG-independent, substitution prone and resistant motifs; confirm a decreased tendency of moieties with low BSP to undergo somatic mutations in a number of cancer types; and, produce a Trek-based estimate of the overall mutation rate in human. The extended set of rate constants we report may enrich our resources and help advance our understanding of genome dynamics and evolution, with possible implications for the role of spontaneous mutations in the emergence of pathological genotypes and neutral evolution of proteomes.

Sequence of a new DR12 allele with two silent mutations that affect PCR-SSP typing.

PubMed

Zanone, R; Bettens, F; Tiercy, J-M

2002-02-01

A new HLA-DR12 allele has been identified in a European Caucasoid bone marrow donor. The DRB1*12012 allele differs from DRB1*12011 by two silent substitutions at codons 72 and 78, two polymorphic positions used for DNA subtyping of the DR12 serotype. The co-occurence of the two nucleotide changes is unique to the DR12 group and results in a new PCR-SSP typing pattern. The complete HLA type of the donor is A24, A68; B55, B61; Cw*01, Cw*0304; DRB1*12012, DRB1*1402; DRB3*0101, DRB3*0202; DQB1*0301. HLA-DRB1*12012 is a rare allele as it occurs in < 0.2% of DR12 donors.

Ultra-Deep Sequencing Analysis of the Hepatitis A Virus 5'-Untranslated Region among Cases of the Same Outbreak from a Single Source

PubMed Central

Wu, Shuang; Nakamoto, Shingo; Kanda, Tatsuo; Jiang, Xia; Nakamura, Masato; Miyamura, Tatsuo; Shirasawa, Hiroshi; Sugiura, Nobuyuki; Takahashi-Nakaguchi, Azusa; Gonoi, Tohru; Yokosuka, Osamu

2014-01-01

Hepatitis A virus (HAV) is a causative agent of acute viral hepatitis for which an effective vaccine has been developed. Here we describe ultra-deep pyrosequences (UDPSs) of HAV 5'-untranslated region (5'UTR) among cases of the same outbreak, which arose from a single source, associated with a revolving sushi bar. We determined the reference sequence from HAV-derived clone from an attendant by the Sanger method. Sixteen UDPSs from this outbreak and one from another sporadic case were compared with this reference. Nucleotide errors yielded a UDPS error rate of < 1%. This study confirmed that nucleotide substitutions of this region are transition mutations in outbreak cases, that insertion was observed only in non-severe cases, and that these nucleotide substitutions were different from those of the sporadic case. Analysis of UDPSs detected low-prevalence HAV variations in 5'UTR, but no specific mutations associated with severity in these outbreak cases. To our surprise, HAV strains in this outbreak conserved HAV IRES sequence even if we performed analysis of UDPSs. UDPS analysis of HAV 5'UTR gave us no association between the disease severity of hepatitis A and HAV 5'UTR substitutions. It might be more interesting to perform ultra-deep sequencing of full length HAV genome in order to reveal possible unknown genomic determinants associated with disease severity. Further studies will be needed. PMID:24396287

Positive Selection Driving Cytoplasmic Genome Evolution of the Medicinally Important Ginseng Plant Genus Panax

PubMed Central

Jiang, Peng; Shi, Feng-Xue; Li, Ming-Rui; Liu, Bao; Wen, Jun; Xiao, Hong-Xing; Li, Lin-Feng

2018-01-01

Panax L. (the ginseng genus) is a shade-demanding group within the family Araliaceae and all of its species are of crucial significance in traditional Chinese medicine. Phylogenetic and biogeographic analyses demonstrated that two rounds of whole genome duplications accompanying with geographic and ecological isolations promoted the diversification of Panax species. However, contributions of the cytoplasmic genomes to the adaptive evolution of Panax species remained largely uninvestigated. In this study, we sequenced the chloroplast and mitochondrial genomes of 11 accessions belonging to seven Panax species. Our results show that heterogeneity in nucleotide substitution rate is abundant in both of the two cytoplasmic genomes, with the mitochondrial genome possessing more variants at the total level but the chloroplast showing higher sequence polymorphisms at the genic regions. Genome-wide scanning of positive selection identified five and 12 genes from the chloroplast and mitochondrial genomes, respectively. Functional analyses further revealed that these selected genes play important roles in plant development, cellular metabolism and adaptation. We therefore conclude that positive selection might be one of the potential evolutionary forces that shaped nucleotide variation pattern of these Panax species. In particular, the mitochondrial genes evolved under stronger selective pressure compared to the chloroplast genes. PMID:29670636

Positive Selection Driving Cytoplasmic Genome Evolution of the Medicinally Important Ginseng Plant Genus Panax.

PubMed

Jiang, Peng; Shi, Feng-Xue; Li, Ming-Rui; Liu, Bao; Wen, Jun; Xiao, Hong-Xing; Li, Lin-Feng

2018-01-01

Panax L. (the ginseng genus) is a shade-demanding group within the family Araliaceae and all of its species are of crucial significance in traditional Chinese medicine. Phylogenetic and biogeographic analyses demonstrated that two rounds of whole genome duplications accompanying with geographic and ecological isolations promoted the diversification of Panax species. However, contributions of the cytoplasmic genomes to the adaptive evolution of Panax species remained largely uninvestigated. In this study, we sequenced the chloroplast and mitochondrial genomes of 11 accessions belonging to seven Panax species. Our results show that heterogeneity in nucleotide substitution rate is abundant in both of the two cytoplasmic genomes, with the mitochondrial genome possessing more variants at the total level but the chloroplast showing higher sequence polymorphisms at the genic regions. Genome-wide scanning of positive selection identified five and 12 genes from the chloroplast and mitochondrial genomes, respectively. Functional analyses further revealed that these selected genes play important roles in plant development, cellular metabolism and adaptation. We therefore conclude that positive selection might be one of the potential evolutionary forces that shaped nucleotide variation pattern of these Panax species. In particular, the mitochondrial genes evolved under stronger selective pressure compared to the chloroplast genes.

Multifunctionality of a picornavirus polymerase domain: nuclear localization signal and nucleotide recognition.

PubMed

Ferrer-Orta, Cristina; de la Higuera, Ignacio; Caridi, Flavia; Sánchez-Aparicio, María Teresa; Moreno, Elena; Perales, Celia; Singh, Kamalendra; Sarafianos, Stefan G; Sobrino, Francisco; Domingo, Esteban; Verdaguer, Nuria

2015-07-01

The N-terminal region of the foot-and-mouth disease virus (FMDV) 3D polymerase contains the sequence MRKTKLAPT (residues 16 to 24) that acts as a nuclear localization signal. A previous study showed that substitutions K18E and K20E diminished the transport to the nucleus of 3D and 3CD and severely impaired virus infectivity. These residues have also been implicated in template binding, as seen in the crystal structures of different 3D-RNA elongation complexes. Here, we report the biochemical and structural characterization of different mutant polymerases harboring substitutions at residues 18 and 20, in particular, K18E, K18A, K20E, K20A, and the double mutant K18A K20A (KAKA). All mutant enzymes exhibit low RNA binding activity, low processivity, and alterations in nucleotide recognition, including increased incorporation of ribavirin monophosphate (RMP) relative to the incorporation of cognate nucleotides compared with the wild-type enzyme. The structural analysis shows an unprecedented flexibility of the 3D mutant polymerases, including both global rearrangements of the closed-hand architecture and local conformational changes at loop β9-α11 (within the polymerase motif B) and at the template-binding channel. Specifically, in 3D bound to RNA, both K18E and K20E induced the opening of new pockets in the template channel where the downstream templating nucleotide at position +2 binds. The comparisons of free and RNA-bound enzymes suggest that the structural rearrangements may occur in a concerted mode to regulate RNA replication, processivity, and fidelity. Thus, the N-terminal region of FMDV 3D that acts as a nuclear localization signal (NLS) and in template binding is also involved in nucleotide recognition and can affect the incorporation of nucleotide analogues. The study documents multifunctionality of a nuclear localization signal (NLS) located at the N-terminal region of the foot-and-mouth disease viral polymerase (3D). Amino acid substitutions at this polymerase region can impair the transport of 3D to the nucleus, reduce 3D binding to RNA, and alter the relative incorporation of standard nucleoside monophosphate versus ribavirin monophosphate. Structural data reveal that the conformational changes in this region, forming part of the template channel entry, would be involved in nucleotide discrimination. The results have implications for the understanding of viral polymerase function and for lethal mutagenesis mechanisms. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Multifunctionality of a Picornavirus Polymerase Domain: Nuclear Localization Signal and Nucleotide Recognition

PubMed Central

Ferrer-Orta, Cristina; de la Higuera, Ignacio; Caridi, Flavia; Sánchez-Aparicio, María Teresa; Moreno, Elena; Perales, Celia; Singh, Kamalendra; Sarafianos, Stefan G.; Sobrino, Francisco; Domingo, Esteban

2015-01-01

ABSTRACT The N-terminal region of the foot-and-mouth disease virus (FMDV) 3D polymerase contains the sequence MRKTKLAPT (residues 16 to 24) that acts as a nuclear localization signal. A previous study showed that substitutions K18E and K20E diminished the transport to the nucleus of 3D and 3CD and severely impaired virus infectivity. These residues have also been implicated in template binding, as seen in the crystal structures of different 3D-RNA elongation complexes. Here, we report the biochemical and structural characterization of different mutant polymerases harboring substitutions at residues 18 and 20, in particular, K18E, K18A, K20E, K20A, and the double mutant K18A K20A (KAKA). All mutant enzymes exhibit low RNA binding activity, low processivity, and alterations in nucleotide recognition, including increased incorporation of ribavirin monophosphate (RMP) relative to the incorporation of cognate nucleotides compared with the wild-type enzyme. The structural analysis shows an unprecedented flexibility of the 3D mutant polymerases, including both global rearrangements of the closed-hand architecture and local conformational changes at loop β9-α11 (within the polymerase motif B) and at the template-binding channel. Specifically, in 3D bound to RNA, both K18E and K20E induced the opening of new pockets in the template channel where the downstream templating nucleotide at position +2 binds. The comparisons of free and RNA-bound enzymes suggest that the structural rearrangements may occur in a concerted mode to regulate RNA replication, processivity, and fidelity. Thus, the N-terminal region of FMDV 3D that acts as a nuclear localization signal (NLS) and in template binding is also involved in nucleotide recognition and can affect the incorporation of nucleotide analogues. IMPORTANCE The study documents multifunctionality of a nuclear localization signal (NLS) located at the N-terminal region of the foot-and-mouth disease viral polymerase (3D). Amino acid substitutions at this polymerase region can impair the transport of 3D to the nucleus, reduce 3D binding to RNA, and alter the relative incorporation of standard nucleoside monophosphate versus ribavirin monophosphate. Structural data reveal that the conformational changes in this region, forming part of the template channel entry, would be involved in nucleotide discrimination. The results have implications for the understanding of viral polymerase function and for lethal mutagenesis mechanisms. PMID:25903341

The augmentation algorithm and molecular phylogenetic trees

NASA Technical Reports Server (NTRS)

Holmquist, R.

1978-01-01

Moore's (1977) augmentation procedure is discussed, and it is concluded that the procedure is valid for obtaining estimates of the total number of fixed nucleotide substitutions both theoretically and in practice, for both simulated and real data, and in agreement, for experimentally dense data sets, with stochastic estimates of the divergence, provided the restrictions on codon mutability resulting from natural selection are explicitly allowed for. Tateno and Nei's (1978) critique that the augmentation procedure has a systematic bias toward overestimation of the total number of nucleotide replacements is disputed, and a data analysis suggests that ancestral sequences inferred by the method of parsimony contain a large number of incorrectly assigned nucleotides.

Evolutionary Stasis in Cycad Plastomes and the First Case of Plastome GC-Biased Gene Conversion

PubMed Central

Wu, Chung-Shien; Chaw, Shu-Miaw

2015-01-01

In angiosperms, gene conversion has been known to reduce the mutational load of plastid genomes (the plastomes). Particularly, more frequent gene conversions in inverted repeat (IR) than in single copy (SC) regions result in contrasting substitution rates between these two regions. However, little has been known about the effect of gene conversion in the evolution of gymnosperm plastomes. Cycads (Cycadophyta) are the second largest gymnosperm group. Evolutionary study of their plastomes is limited to the basal cycad genus, Cycas. In this study, we addressed three questions. 1) Do the plastomes of other cycad genera evolve slowly as previously observed in the plastome of Cycas taitungensis? 2) Do substitution rates differ between their SC and IR regions? And 3) Does gene conversion occur in the cycad plastomes? If yes, is it AT-biased or GC-biased? Plastomes of eight species from other eight genera of cycads were sequenced. These plastomes are highly conserved in genome organization. Excluding ginkgo, cycad plastomes have significantly lower synonymous and nonsynonymous substitution rates than other gymnosperms, reflecting their evolutionary stasis in nucleotide mutations. In the IRs of cycad plastomes, the reduced substitution rates and GC-biased mutations are associated with a GC-biased gene conversion (gBGC) mechanism. Further investigations suggest that in cycads, gBGC is able to rectify plastome-wide mutations. Therefore, this study is the first to uncover the plastomic gBGC in seed plants. We also propose a gBGC model to interpret the dissimilar evolutionary patterns as well as the compositionally biased mutations in the SC and IR regions of cycad plastomes. PMID:26116919

Evidence in Gabon for an intrafamilial clustering with mother-to-child and sexual transmission of a new molecular variant of human T-lymphotropic virus type-II subtype B.

PubMed

Tuppin, P; Gessain, A; Kazanji, M; Mahieux, R; Cosnefroy, J Y; Tekaia, F; Georges-Courbot, M C; Georges, A; de Thé, G

1996-01-01

Following the observation of an HTLV-II seropositive 60-year-old woman living in Gabon (Central Africa), a serologic and molecular study of her family members was conducted in an attempt to determine the duration of the HTLV-II infection and the modes of transmission of the virus. Among 41 family members, five were HTLV-I seropositive and 7 exhibited specific HTLV-II antibodies in their sera as demonstrated by high immunofluorescence titers on C19 cells and/or specific Western-blot pattern. The second husband of the index case and two of his sisters were infected by the virus, suggesting the presence of HTLV-II in this family over two generations. Sequence analysis of an amplified fragment of 172 nucleotides within the gp21 of the env region (6469-6640) of four HTLV-II infected individuals revealed a new HTLV-II molecular variant of the subtype b diverging from the prototypes NRA and G12 by seven (4.1%) and five (2.9%) bases substitutions, respectively. Molecular analysis of the total env gene (1462 bp) and fragments of the pol and pX regions confirmed that this new African variant was the most divergent HTLV-II subtype b yet described, exhibiting 2.3% of nucleotide substitutions in the env gene (33 bases) as compared to the two HTLV-II b prototypes. These data demonstrate, for the first time in Africa, intrafamilial both mother-to-child transmission and sexual transmission between spouses of an HTLV-II b molecular variant, and also suggest that this virus has been present in Gabon for a long period of time.

A genome sequence resource for the aye-aye (Daubentonia madagascariensis), a nocturnal lemur from Madagascar.

PubMed

Perry, George H; Reeves, Darryl; Melsted, Páll; Ratan, Aakrosh; Miller, Webb; Michelini, Katelyn; Louis, Edward E; Pritchard, Jonathan K; Mason, Christopher E; Gilad, Yoav

2012-01-01

We present a high-coverage draft genome assembly of the aye-aye (Daubentonia madagascariensis), a highly unusual nocturnal primate from Madagascar. Our assembly totals ~3.0 billion bp (3.0 Gb), roughly the size of the human genome, comprised of ~2.6 million scaffolds (N50 scaffold size = 13,597 bp) based on short paired-end sequencing reads. We compared the aye-aye genome sequence data with four other published primate genomes (human, chimpanzee, orangutan, and rhesus macaque) as well as with the mouse and dog genomes as nonprimate outgroups. Unexpectedly, we observed strong evidence for a relatively slow substitution rate in the aye-aye lineage compared with these and other primates. In fact, the aye-aye branch length is estimated to be ~10% shorter than that of the human lineage, which is known for its low substitution rate. This finding may be explained, in part, by the protracted aye-aye life-history pattern, including late weaning and age of first reproduction relative to other lemurs. Additionally, the availability of this draft lemur genome sequence allowed us to polarize nucleotide and protein sequence changes to the ancestral primate lineage-a critical period in primate evolution, for which the relevant fossil record is sparse. Finally, we identified 293,800 high-confidence single nucleotide polymorphisms in the donor individual for our aye-aye genome sequence, a captive-born individual from two wild-born parents. The resulting heterozygosity estimate of 0.051% is the lowest of any primate studied to date, which is understandable considering the aye-aye's extensive home-range size and relatively low population densities. Yet this level of genetic diversity also suggests that conservation efforts benefiting this unusual species should be prioritized, especially in the face of the accelerating degradation and fragmentation of Madagascar's forests.

Double-strand break repair processes drive evolution of the mitochondrial genome in Arabidopsis.

PubMed

Davila, Jaime I; Arrieta-Montiel, Maria P; Wamboldt, Yashitola; Cao, Jun; Hagmann, Joerg; Shedge, Vikas; Xu, Ying-Zhi; Weigel, Detlef; Mackenzie, Sally A

2011-09-27

The mitochondrial genome of higher plants is unusually dynamic, with recombination and nonhomologous end-joining (NHEJ) activities producing variability in size and organization. Plant mitochondrial DNA also generally displays much lower nucleotide substitution rates than mammalian or yeast systems. Arabidopsis displays these features and expedites characterization of the mitochondrial recombination surveillance gene MSH1 (MutS 1 homolog), lending itself to detailed study of de novo mitochondrial genome activity. In the present study, we investigated the underlying basis for unusual plant features as they contribute to rapid mitochondrial genome evolution. We obtained evidence of double-strand break (DSB) repair, including NHEJ, sequence deletions and mitochondrial asymmetric recombination activity in Arabidopsis wild-type and msh1 mutants on the basis of data generated by Illumina deep sequencing and confirmed by DNA gel blot analysis. On a larger scale, with mitochondrial comparisons across 72 Arabidopsis ecotypes, similar evidence of DSB repair activity differentiated ecotypes. Forty-seven repeat pairs were active in DNA exchange in the msh1 mutant. Recombination sites showed asymmetrical DNA exchange within lengths of 50- to 556-bp sharing sequence identity as low as 85%. De novo asymmetrical recombination involved heteroduplex formation, gene conversion and mismatch repair activities. Substoichiometric shifting by asymmetrical exchange created the appearance of rapid sequence gain and loss in association with particular repeat classes. Extensive mitochondrial genomic variation within a single plant species derives largely from DSB activity and its repair. Observed gene conversion and mismatch repair activity contribute to the low nucleotide substitution rates seen in these genomes. On a phenotypic level, these patterns of rearrangement likely contribute to the reproductive versatility of higher plants.

Long-range dispersal moved Francisella tularensis into Western Europe from the East

PubMed Central

Dwibedi, Chinmay; Birdsell, Dawn; Lärkeryd, Adrian; Myrtennäs, Kerstin; Öhrman, Caroline; Nilsson, Elin; Karlsson, Edvin; Hochhalter, Christian; Rivera, Andrew; Maltinsky, Sara; Bayer, Brittany; Keim, Paul; Scholz, Holger C.; Tomaso, Herbert; Wittwer, Matthias; Beuret, Christian; Schuerch, Nadia; Pilo, Paola; Hernández Pérez, Marta; Rodriguez-Lazaro, David; Escudero, Raquel; Anda, Pedro; Forsman, Mats; Wagner, David M.; Larsson, Pär

2016-01-01

For many infections transmitting to humans from reservoirs in nature, disease dispersal patterns over space and time are largely unknown. Here, a reversed genomics approach helped us understand disease dispersal and yielded insight into evolution and biological properties of Francisella tularensis, the bacterium causing tularemia. We whole-genome sequenced 67 strains and characterized by single-nucleotide polymorphism assays 138 strains, collected from individuals infected 1947-2012 across Western Europe. We used the data for phylogenetic, population genetic and geographical network analyses. All strains (n=205) belonged to a monophyletic population of recent ancestry not found outside Western Europe. Most strains (n=195) throughout the study area were assigned to a star-like phylogenetic pattern indicating that colonization of Western Europe occurred via clonal expansion. In the East of the study area, strains were more diverse, consistent with a founder population spreading from east to west. The relationship of genetic and geographic distance within the F. tularensis population was complex and indicated multiple long-distance dispersal events. Mutation rate estimates based on year of isolation indicated null rates; in outbreak hotspots only, there was a rate of 0.4 mutations/genome/year. Patterns of nucleotide substitution showed marked AT mutational bias suggestive of genetic drift. These results demonstrate that tularemia has moved from east to west in Europe and that F. tularensis has a biology characterized by long-range geographical dispersal events and mostly slow, but variable, replication rates. The results indicate that mutation-driven evolution, a resting survival phase, genetic drift and long-distance geographical dispersal events have interacted to generate genetic diversity within this species. PMID:28348839

Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

PubMed

Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

2014-10-01

Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

Complete genome analysis of dengue virus type 3 isolated from the 2013 dengue outbreak in Yunnan, China.

PubMed

Wang, Xiaodan; Ma, Dehong; Huang, Xinwei; Li, Lihua; Li, Duo; Zhao, Yujiao; Qiu, Lijuan; Pan, Yue; Chen, Junying; Xi, Juemin; Shan, Xiyun; Sun, Qiangming

2017-06-15

In the past few decades, dengue has spread rapidly and is an emerging disease in China. An unexpected dengue outbreak occurred in Xishuangbanna, Yunnan, China, resulting in 1331 patients in 2013. In order to obtain the complete genome information and perform mutation and evolutionary analysis of causative agent related to this largest outbreak of dengue fever. The viruses were isolated by cell culture and evaluated by genome sequence analysis. Phylogenetic trees were then constructed by Neighbor-Joining methods (MEGA6.0), followed by analysis of nucleotide mutation and amino acid substitution. The analysis of the diversity of secondary structure for E and NS1 protein were also performed. Then selection pressures acting on the coding sequences were estimated by PAML software. The complete genome sequences of two isolated strains (YNSW1, YNSW2) were 10,710 and 10,702 nucleotides in length, respectively. Phylogenetic analysis revealed both strain were classified as genotype II of DENV-3. The results indicated that both isolated strains of Xishuangbanna in 2013 and Laos 2013 stains (KF816161.1, KF816158.1, LC147061.1, LC147059.1, KF816162.1) were most similar to Bangladesh (AY496873.2) in 2002. After comparing with the DENV-3SS (H87) 62 amino acid substitutions were identified in translated regions, and 38 amino acid substitutions were identified in translated regions compared with DENV-3 genotype II stains Bangladesh (AY496873.2). 27(YNSW1) or 28(YNSW2) single nucleotide changes were observed in structural protein sequences with 7(YNSW1) or 8(YNSW2) non-synonymous mutations compared with AY496873.2. Of them, 4 non-synonymous mutations were identified in E protein sequences with (2 in the β-sheet, 2 in the coil). Meanwhile, 117(YNSW1) or 115 (YNSW2) single nucleotide changes were observed in non-structural protein sequences with 31(YNSW1) or 30 (YNSW2) non-synonymous mutations. Particularly, 14 single nucleotide changes were observed in NS1 sequences with 4/14 non-synonymous substitutions (4 in the coil). Selection pressure analysis revealed no positive selection in the amino acid sites of the genes encoding for structural and non-structural proteins. This study may help understand the intrinsic geographical relatedness of dengue virus 3 and contributes further to research on their infectivity, pathogenicity and vaccine development. Copyright © 2017 Elsevier B.V. All rights reserved.

Apolipoprotein A-I mutant proteins having cysteine substitutions and polynucleotides encoding same

DOEpatents

Oda, Michael N [Benicia, CA; Forte, Trudy M [Berkeley, CA

2007-05-29

Functional Apolipoprotein A-I mutant proteins, having one or more cysteine substitutions and polynucleotides encoding same, can be used to modulate paraoxonase's arylesterase activity. These ApoA-I mutant proteins can be used as therapeutic agents to combat cardiovascular disease, atherosclerosis, acute phase response and other inflammatory related diseases. The invention also includes modifications and optimizations of the ApoA-I nucleotide sequence for purposes of increasing protein expression and optimization.

Convergent evolution of marine mammals is associated with distinct substitutions in common genes

PubMed Central

Zhou, Xuming; Seim, Inge; Gladyshev, Vadim N.

2015-01-01

Phenotypic convergence is thought to be driven by parallel substitutions coupled with natural selection at the sequence level. Multiple independent evolutionary transitions of mammals to an aquatic environment offer an opportunity to test this thesis. Here, whole genome alignment of coding sequences identified widespread parallel amino acid substitutions in marine mammals; however, the majority of these changes were not unique to these animals. Conversely, we report that candidate aquatic adaptation genes, identified by signatures of likelihood convergence and/or elevated ratio of nonsynonymous to synonymous nucleotide substitution rate, are characterized by very few parallel substitutions and exhibit distinct sequence changes in each group. Moreover, no significant positive correlation was found between likelihood convergence and positive selection in all three marine lineages. These results suggest that convergence in protein coding genes associated with aquatic lifestyle is mainly characterized by independent substitutions and relaxed negative selection. PMID:26549748

Sequence polymorphisms at the growth hormone GH1/GH2-N and GH2-Z gene copies and their relationship with dairy traits in domestic sheep (Ovis aries).

PubMed

Vacca, G M; Dettori, M L; Balia, F; Luridiana, S; Mura, M C; Carcangiu, V; Pazzola, M

2013-09-01

The purpose was to analyze the growth hormone GH1/GH2-N and GH2-Z gene copies and to assess their possible association with milk traits in Sarda sheep. Two hundred multiparous lactating ewes were monitored. The two gene copies were amplified separately and each was used as template for a nested PCR, to investigate single strand conformation polymorphism (SSCP) of the 5'UTR, exon-1, exon-5 and 3'UTR DNA regions. SSCP analysis revealed marked differences in the number of polymorphic patterns between the two genes. Sequencing revealed five nucleotide changes at the GH1/GH2-N gene. Five nucleotide changes occurred at the GH2-Z gene: one was located in exon-5 (c.556G > A) and resulted in a putative amino acid substitution G186S. All the nucleotide changes were copy-specific, except c.*30delT, which was common to both GH1/GH2-N and GH2-Z. Variability in the promoter regions of each gene might have consequences on the expression level, due to the involvement in potential transcription factor binding sites. Both gene copies influenced milk yield. A correlation with milk protein and casein content was also evidenced. These results may have implications that make them useful for future breeding strategies in dairy sheep breeding.

[Genetic evidence for recombination and mutation in the emergence of human enterovirus 71].

PubMed

Liu, Ai-Ping; Tan, Hui; Xie, Qun; Chen, Bai-Tang; Liu, Xiao-Feng; Zhang, Yong

2014-09-01

We wished to understand the genetic recombination and phylogenetic characteristics of human en- terovirus A71 (EV-A71) and to explore its potential virulence-related sites. Full-length genomes of three EV-A71 strains isolated from patients in Chenzhou City (China) were sequenced and analyzed. Possible re- combination events and crossover sites were analyzed with Recombination Detection Program v4. 1. 6 by comparison with the complete genome sequences of 231 strains of EV-A71. Similarly, plot and bootscanning analyses were undertaken with SimPlot v3. 5. 1. Phylogenetic trees based on the sequences of VP1 regions were constructed with MEGA v5. 2 using the Kimura two-parameter model and neighbor-joining method. Results suggested that recombination events were detected among the three EV-A71 isolates from Chenzhou City. The common main parent sequence was from JF799986 isolated from samples in Guang- zhou City (China) in 2009, and the minor parent sequence was TW/70516/08. Intertypic recombination e- vents were found in the C4b strain (strain SHZH98 isolated in 1998) and C4a strain (Fuyang strain isola- ted in 2008) with the prototype strains of CVA4 and CVA14 in the 3D region. The chi-square test was used to screen-out potential virulence-related sites with nucleotide substitutions of different types of hand, foot, and mouth disease (HFMD) cases using SPSS v19.0. Results suggested that there were no significant nucleotide substitutions between death cases and severe-HFMD cases. Eighteen significant nucleotide substitutions were found between death/severe-HFMD cases and mild-HFMD cases, and all these 18 substitutions were distributed only in P2 and P3 regions. Intertypic recombination among the predominant circulating EV-A71 strains in the Chinese mainland and other EV-A strains probably dates before 1998, and intratypic recombination might have occurred frequently in the HFMD outbreak from 2008 to 2012. Substitutions in the non-capsid region may be correlated with the changes in virulence of EV-A71. These data suggest that researchers should pay more attention to the relationships between substitutions in the noncapsid region and the virulence of the virus.

Overdispersion of the Molecular Clock: Temporal Variation of Gene-Specific Substitution Rates in Drosophila

PubMed Central

Hartl, Daniel L.

2008-01-01

Simple models of molecular evolution assume that sequences evolve by a Poisson process in which nucleotide or amino acid substitutions occur as rare independent events. In these models, the expected ratio of the variance to the mean of substitution counts equals 1, and substitution processes with a ratio greater than 1 are called overdispersed. Comparing the genomes of 10 closely related species of Drosophila, we extend earlier evidence for overdispersion in amino acid replacements as well as in four-fold synonymous substitutions. The observed deviation from the Poisson expectation can be described as a linear function of the rate at which substitutions occur on a phylogeny, which implies that deviations from the Poisson expectation arise from gene-specific temporal variation in substitution rates. Amino acid sequences show greater temporal variation in substitution rates than do four-fold synonymous sequences. Our findings provide a general phenomenological framework for understanding overdispersion in the molecular clock. Also, the presence of substantial variation in gene-specific substitution rates has broad implications for work in phylogeny reconstruction and evolutionary rate estimation. PMID:18480070

Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakoyama, Y.; Hong, K.J.; Byun, S.M.

To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: themore » mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.« less

High levels of MHC class II allelic diversity in lake trout from Lake Superior

USGS Publications Warehouse

Dorschner, M.O.; Duris, T.; Bronte, C.R.; Burnham-Curtis, M. K.; Phillips, R.B.

2000-01-01

Sequence variation in a 216 bp portion of the major histocompatibility complex (MHC) II B1 domain was examined in 74 individual lake trout (Salvelinus namaycush) from different locations in Lake Superior. Forty-three alleles were obtained which encoded 71-72 amino acids of the mature protein. These sequences were compared with previous data obtained from five Pacific salmon species and Atlantic salmon using the same primers. Although all of the lake trout alleles clustered together in the neighbor-joining analysis of amino acid sequences, one amino acid allelic lineage was shared with Atlantic salmon (Salmo salar), a species in another genus which probably diverged from Salvelinus more than 10-20 million years ago. As shown previously in other salmonids, the level of nonsynonymous nucleotide substitution (d(N)) exceeded the level of synonymous substitution (d(S)). The level of nucleotide diversity at the MHC class II B1 locus was considerably higher in lake trout than in the Pacific salmon (genus Oncorhynchus). These results are consistent with the hypothesis that lake trout colonized Lake Superior from more than one refuge following the Wisconsin glaciation. Recent population bottlenecks may have reduced nucleotide diversity in Pacific salmon populations.

Siberian population of the New Stone Age: mtDNA haplotype diversity in the ancient population from the Ust'-Ida I burial ground, dated 4020-3210 BC by 14C.

PubMed

Naumova O, Y u; Rychkov S, Y u

1998-03-01

On the basis of analysis of mtDNA from skeletal remains, dated by 14C 4020-3210 BC, from the Ust'-Ida I Neolithic burial ground in Cis-Baikal area of Siberia, we obtained genetic characteristics of the ancient Mongoloid population. Using the 7 restriction enzymes for the analysis of site's polymorphism in 16,106-16,545 region of mtDNA, we studied the structure of the most frequent DNA haplotypes, and estimated the intrapopulational nucleotide diversity of the Neolithic population. Comparison of the Neolithic and modern indigeneous populations from Siberia, Mongolia and Ural showed, that the ancient Siberian population is one of the ancestors of the modern population of Siberia. From genetic distance, in the assumption of constant nucleotide substitution rate, we estimated the divergence time between the Neolithic and the modern Siberian population. This divergence time (5572 years ago) is conformed to the age of skeletal remains (5542-5652 years). With use of the 14C dates of the skeletal remains, nucleotide substitution rate in mtDNA was estimated as 1% sequence divergence for 8938-9115 years.

Variants of beta-glucosidase

DOEpatents

Fidantsef, Ana; Lamsa, Michael; Gorre-Clancy, Brian

2015-07-14

The present invention relates to variants of a parent beta-glucosidase, comprising a substitution at one or more positions corresponding to positions 142, 183, 266, and 703 of amino acids 1 to 842 of SEQ ID NO: 2 or corresponding to positions 142, 183, 266, and 705 of amino acids 1 to 844 of SEQ ID NO: 70, wherein the variant has beta-glucosidase activity. The present invention also relates to nucleotide sequences encoding the variant beta-glucosidases and to nucleic acid constructs, vectors, and host cells comprising the nucleotide sequences.

Variants of beta-glucosidases

DOEpatents

Fidantsef, Ana; Lamsa, Michael; Gorre-Clancy, Brian

2014-10-07

The present invention relates to variants of a parent beta-glucosidase, comprising a substitution at one or more positions corresponding to positions 142, 183, 266, and 703 of amino acids 1 to 842 of SEQ ID NO: 2 or corresponding to positions 142, 183, 266, and 705 of amino acids 1 to 844 of SEQ ID NO: 70, wherein the variant has beta-glucosidase activity. The present invention also relates to nucleotide sequences encoding the variant beta-glucosidases and to nucleic acid constructs, vectors, and host cells comprising the nucleotide sequences.

Variants of beta-glucosidase

DOEpatents

Fidantsef, Ana [Davis, CA; Lamsa, Michael [Davis, CA; Gorre-Clancy, Brian [Elk Grove, CA

2009-12-29

The present invention relates to variants of a parent beta-glucosidase, comprising a substitution at one or more positions corresponding to positions 142, 183, 266, and 703 of amino acids 1 to 842 of SEQ ID NO: 2 or corresponding to positions 142, 183, 266, and 705 of amino acids 1 to 844 of SEQ ID NO: 70, wherein the variant has beta-glucosidase activity. The present invention also relates to nucleotide sequences encoding the variant beta-glucosidases and to nucleic acid constructs, vectors, and host cells comprising the nucleotide sequences.

A non-synonymous nucleotide substitution can account for one evolutionary route to sesquiterpene synthase activity in the TPS-b subgroup.

PubMed

Green, Sol; Baker, Edward N; Laing, William

2011-06-23

Plant sesquiterpene and hemiterpene synthases in the monoterpene synthase dominated TPS-b subgroup are thought to have evolved independently from a monoterpene synthase ancestor. A TPS-b sesquiterpene synthase from apple (MdAFS1), which predominantly produces α-farnesene, can also synthesize the monoterpene (E)-β-ocimene. The dual activity offered a functional link to an ancestral MdAFS1 enzyme and a rational basis for investigation of the evolution of TPS-b sesquiterpene enzymes. Protein modelling and mutagenesis analysis of the MdAFS1 active site identified a non-synonymous nucleotide substitution that could account for the requisite shift in substrate specificity necessary for the emergence of its sesquiterpene activity during the evolution of the TPS-b enzymes. Copyright © 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

[Cloning of new acylamidase gene from Rhodococcus erythropolis and its expression in Escherichia coli].

PubMed

Lavrov, K V; Ianenko, A S

2013-10-01

The gene for new Rhodococcus erythropolis TA37 acylamidase, which possesses unique substrate specificity, has been cloned and expressed in E. coli. Substrates for this enzyme are not only simple amides, such as acetamide and propionamide, but also N-substituted amides, such as 4'-nitroacetanilide. The 1431-bp gene was expressed in E. coli BL21 (DE3) cells on pET16b plasmid under the control of a promoter of the φ 10 gene from the T7 phage. The molecular mass of recombinant acylamidase in E. coli was 55 kDa, which corresponded to that of native acylamidase from Rhodococcus erythropolis TA37. Recombinant acylamidase was able to hydrolize N-substituted amides. A search of a nucleotide database and multiple alignment revealed that acylamidase belonged to the Amidase protein family PF01425, but its nucleotide and amino acid sequences differed significantly from those of the described amidases.

Molecular phylogenetic trees - On the validity of the Goodman-Moore augmentation algorithm

NASA Technical Reports Server (NTRS)

Holmquist, R.

1979-01-01

A response is made to the reply of Nei and Tateno (1979) to the letter of Holmquist (1978) supporting the validity of the augmentation algorithm of Moore (1977) in reconstructions of nucleotide substitutions by means of the maximum parsimony principle. It is argued that the overestimation of the augmented numbers of nucleotide substitutions (augmented distances) found by Tateno and Nei (1978) is due to an unrepresentative data sample and that it is only necessary that evolution be stochastically uniform in different regions of the phylogenetic network for the augmentation method to be useful. The importance of the average value of the true distance over all links is explained, and the relative variances of the true and augmented distances are calculated to be almost identical. The effects of topological changes in the phylogenetic tree on the augmented distance and the question of the correctness of ancestral sequences inferred by the method of parsimony are also clarified.

Determining orientation and direction of DNA sequences

DOEpatents

Goodwin, Edwin H.; Meyne, Julianne

2000-01-01

Determining orientation and direction of DNA sequences. A method by which fluorescence in situ hybridization can be made strand specific is described. Cell cultures are grown in a medium containing a halogenated nucleotide. The analog is partially incorporated in one DNA strand of each chromatid. This substitution takes place in opposite strands of the two sister chromatids. After staining with the fluorescent DNA-binding dye Hoechst 33258, cells are exposed to long-wavelength ultraviolet light which results in numerous strand nicks. These nicks enable the substituted strand to be denatured and solubilized by heat, treatment with high or low pH aqueous solutions, or by immersing the strands in 2.times.SSC (0.3M NaCl+0.03M sodium citrate), to name three procedures. It is unnecessary to enzymatically digest the strands using Exo III or another exonuclease in order to excise and solubilize nucleotides starting at the sites of the nicks. The denaturing/solubilizing process removes most of the substituted strand while leaving the prereplication strand largely intact. Hybridization of a single-stranded probe of a tandem repeat arranged in a head-to-tail orientation will result in hybridization only to the chromatid with the complementary strand present.

[Molecular evolution of the tick-borne encephalitis and Powassan viruses].

PubMed

Subbotina, E L; Loktev, V B

2012-01-01

The problem of emerging viruses, their genetic diversity and viral evolution in nature are attracting more attention. The phylogenetic analysis and evaluationary rate estimation were made for pathogenic flaviviruses such as tick-borne encephalitis virus (TBEV) and Powassan (PV) circulated in natural foci in Russia. 47 nucleotide sequences of encoded protein E of the TBEV and 17 sequences of NS5 genome region of the PV have been used. It was found that the rate of accumulation of nucleotide substitutions for E genome region of TBEV was approximately 1.4 x 10(-4) and 5.4 x 10(-5) substitutions per site per year for NS5 genome region of PV. The ratio of non-synonymous nucleotide substitutions to synonymous substitution (dN/dS) for viral sequences were estimated of 0.049 for TBEV and 0.098 for PV. Maximum value dN/dS was 0.201-0.220 for sub-cluster of Russian and Canadian strains of PV and the minimum - 0.024 for cluster of Russian and Chinese strains of Far Eastern genotype TBEV. Evaluation of time intervals of evolutionary events associated with these viruses showed that European subtype TBEV are diverged from all-TBEV ancestor within approximately 2750 years and the Siberian and Far Eastern subtypes are emerged about 2250 years ago. The PV was introduced into natural foci of the Primorsky Krai of Russia only about 70 years ago and PV is a very close to Canadian strains of PV. Evolutionary picture for PV in North America is similar to evolution of Siberian and Far Eastern subtypes TBEV in Asia. The divergence time for main genetic groups of TBEV and PV are correlated with historical periods of warming and cooling. These allow to propose a hypothesis that climate changes were essential to the evolution of the flaviviruses in the past millenniums.

Isolation and characterization of atypical Listeria monocytogenes associated with a canine urinary tract infection.

PubMed

Palerme, Jean-Sébastien; Pan, Po Ching; Parsons, Cameron T; Kathariou, Sophia; Ward, Todd J; Jacob, Megan E

2016-09-01

Listeria monocytogenes, a well-described cause of encephalitis and abortion in ruminants and of food-borne illness in humans, is rarely associated with disease in companion animals. A case of urinary tract infection associated with an atypical, weakly hemolytic L. monocytogenes strain is described in a diabetic dog. The serotype of the L. monocytogenes isolate was determined to be 1/2a (3a), with the multilocus genotyping pattern 2.72_1/2a. A nucleotide substitution (Gly145Asp) was detected at residue 145 in the promoter prfA region. This residue is within the critical helix-turn-helix motif of PrfA. The source of the L. monocytogenes strain remains unknown, and the dog recovered after a 4-week course of cephalexin (30 mg/kg orally twice daily). © 2016 The Author(s).

Greater numbers of nucleotide substitutions are introduced into the genomic RNA of bovine viral diarrhea virus during acute infections of pregnant cattle than of non-pregnant cattle.

PubMed

Neill, John D; Newcomer, Benjamin W; Marley, Shonda D; Ridpath, Julia F; Givens, M Daniel

2012-08-06

Bovine viral diarrhea virus (BVDV) strains circulating in livestock herds show significant sequence variation. Conventional wisdom states that most sequence variation arises during acute infections in response to immune or other environmental pressures. A recent study showed that more nucleotide changes were introduced into the BVDV genomic RNA during the establishment of a single fetal persistent infection than following a series of acute infections of naïve cattle. However, it was not known if nucleotide changes were introduce when the virus crossed the placenta and infected the fetus or during the acute infection of the dam. The sequence of the open reading frame (ORF) from viruses isolated from four acutely infected pregnant heifers following exposure to persistently infected (PI) calves was compared to the sequences of the virus from the progenitor PI calf and the virus from the resulting progeny PI calf to determine when genetic change was introduced. This was compared to genetic change found in viruses isolated from a pregnant PI cow and its PI calf, and in three viruses isolated from acutely infected, non-pregnant cattle exposed to PI calves. Most genetic changes previously identified between the progenitor and progeny PI viruses were in place in the acute phase viruses isolated from the dams six days post-exposure to the progenitor PI calf. Additionally, each progeny PI virus had two to three unique nucleotide substitutions that were introduced in crossing the placenta and infection of the fetus. The nucleotide sequence of two acute phase viruses isolated from steers exposed to PI calves revealed that six and seven nucleotide changes were introduced during the acute infection. The sequence of the BVDV-2 virus isolated from an acute infection of a PI calf (BVDV-1a) co-housed with a BVDV-2 PI calf had ten nucleotides that were different from the progenitor PI virus. Finally, twenty nucleotide changes were identified in the PI virus of a calf born to a PI dam. These results demonstrate that nucleotide changes are introduced into the BVDV infecting pregnant cattle at rates of 2.3 to 8 fold higher then during the acute infection of non-pregnant animals.

Genetic variation in potential Giardia vaccine candidates cyst wall protein 2 and α1-giardin.

PubMed

Radunovic, Matej; Klotz, Christian; Saghaug, Christina Skår; Brattbakk, Hans-Richard; Aebischer, Toni; Langeland, Nina; Hanevik, Kurt

2017-08-01

Giardia is a prevalent intestinal parasitic infection. The trophozoite structural protein a1-giardin (a1-g) and the cyst protein cyst wall protein 2 (CWP2) have shown promise as Giardia vaccine antigen candidates in murine models. The present study assesses the genetic diversity of a1-g and CWP2 between and within assemblages A and B in human clinical isolates. a1-g and CWP2 sequences were acquired from 15 Norwegian isolates by PCR amplification and 20 sequences from German cultured isolates by whole genome sequencing. Sequences were aligned to reference genomes from assemblage A2 and B to identify genetic variance. Genetic diversity was found between assemblage A and B reference sequences for both a1-g (90.8% nucleotide identity) and CWP2 (82.5% nucleotide identity). However, for a1-g, this translated into only 3 amino acid (aa) substitutions, while for CWP2 there were 41 aa substitutions, and also one aa deletion. Genetic diversity within assemblage B was larger; nucleotide identity 92.0% for a1-g and 94.3% for CWP2, than within assemblage A (nucleotide identity 99.0% for a1-g and 99.7% for CWP2). For CWP2, the diversity on both nucleotide and protein level was higher in the C-terminal end. Predicted antigenic epitopes were not affected for a1-g, but partially for CWP2. Despite genetic diversity in a1-g, we found aa sequence, characteristics, and antigenicity to be well preserved. CWP2 showed more aa variance and potential antigenic differences. Several CWP2 antigens might be necessary in a future Giardia vaccine to provide cross protection against both Giardia assemblages infecting humans.

DNA Sequence Polymorphism of the Lactate Dehydrogenase Genefrom Iranian Plasmodium vivax and Plasmodium falciparum Isolates.

PubMed

Getacher Feleke, Daniel; Nateghpour, Mehdi; Motevalli Haghi, Afsaneh; Hajjaran, Homa; Farivar, Leila; Mohebali, Mehdi; Raoofian, Reza

2015-01-01

Parasite lactate dehydrogenase (pLDH) is extensively employed as malaria rapid diagnostic tests (RDTs). Moreover, it is a well-known drug target candidate. However, the genetic diversity of this gene might influence performance of RDT kits and its drug target candidacy. This study aimed to determine polymorphism of pLDH gene from Iranian isolates of P. vivax and P. falciparum. Genomic DNA was extracted from whole blood of microscopically confirmed P. vivax and P. falciparum infected patients. pLDH gene of P. falciparum and P. vivax was amplified using conventional PCR from 43 symptomatic malaria patients from Sistan and Baluchistan Province, Southeast Iran from 2012 to 2013. Sequence analysis of 15 P. vivax LDH showed fourteen had 100% identity with P. vivax Sal-1 and Belem strains. Two nucleotide substitutions were detected with only one resulted in amino acid change. Analysis of P. falciparum LDH sequences showed six of the seven sequences had 100% homology with P. falciparum 3D7 and Mzr-1. Moreover, PfLDH displayed three nucleotide changes that resulted in changing only one amino acid. PvLDH and PfLDH showed 75%-76% nucleotide and 90.4%-90.76% amino acid homology. pLDH gene from Iranian P. falciparum and P. vivax isolates displayed 98.8-100% homology with 1-3 nucleotide substitutions. This indicated this gene was relatively conserved. Additional studies can be done weather this genetic variation can influence the performance of pLDH based RDTs or not.

Function of specific 2'-hydroxyl groups of guanosines in a hammerhead ribozyme probed by 2' modifications.

PubMed Central

Williams, D M; Pieken, W A; Eckstein, F

1992-01-01

The importance of the 2'-hydroxyl group of several guanosine residues for the catalytic efficiency of a hammerhead ribozyme has been investigated. Five ribozymes in which single guanosine residues were substituted with 2'-amino-, 2'-fluoro-, or 2'-deoxyguanosine were chemically synthesized. The comparison of the catalytic activity of the three 2' modifications at a specific position allows conclusions about the functional role of the parent 2'-hydroxyl group. Substitutions of nonconserved nucleotides within the ribozyme caused little alteration in the catalytic activity relative to that obtained with the unmodified ribozyme. In contrast, when either of the guanosines within the single-stranded loop between stem I and stem II of the ribozyme was replaced by 2'-deoxyguanosine or 2'-fluoro-2'-deoxyguanosine, the catalytic activities of the resulting ribozymes were reduced by factors of at least 150. The catalytic activities of the corresponding ribozymes containing 2'-amino-2'-deoxyguanosine substitutions at these positions, however, were both reduced by factors of 15. These effects resulted from decreases in the respective kcat values, whereas variations in the Km values were comparatively small. A different pattern of reactivity of the three 2' modifications was observed at the guanosine immediately 3' to stem II of the ribozyme. Whereas both 2'-deoxyguanosine and 2'-amino-2'-deoxyguanosine at this position showed catalytic activity similar to that of the unmodified ribozyme, the activity of the corresponding 2'-fluoro-2'-deoxyguanosine-containing ribozyme was reduced by a factor of 15. The implications of these substitution-specific reactivities on the functional role of the native 2'-hydroxyl groups are discussed. Images PMID:1736306

Evolutionary Stasis in Cycad Plastomes and the First Case of Plastome GC-Biased Gene Conversion.

PubMed

Wu, Chung-Shien; Chaw, Shu-Miaw

2015-06-27

In angiosperms, gene conversion has been known to reduce the mutational load of plastid genomes (the plastomes). Particularly, more frequent gene conversions in inverted repeat (IR) than in single copy (SC) regions result in contrasting substitution rates between these two regions. However, little has been known about the effect of gene conversion in the evolution of gymnosperm plastomes. Cycads (Cycadophyta) are the second largest gymnosperm group. Evolutionary study of their plastomes is limited to the basal cycad genus, Cycas. In this study, we addressed three questions. 1) Do the plastomes of other cycad genera evolve slowly as previously observed in the plastome of Cycas taitungensis? 2) Do substitution rates differ between their SC and IR regions? And 3) Does gene conversion occur in the cycad plastomes? If yes, is it AT-biased or GC-biased? Plastomes of eight species from other eight genera of cycads were sequenced. These plastomes are highly conserved in genome organization. Excluding ginkgo, cycad plastomes have significantly lower synonymous and nonsynonymous substitution rates than other gymnosperms, reflecting their evolutionary stasis in nucleotide mutations. In the IRs of cycad plastomes, the reduced substitution rates and GC-biased mutations are associated with a GC-biased gene conversion (gBGC) mechanism. Further investigations suggest that in cycads, gBGC is able to rectify plastome-wide mutations. Therefore, this study is the first to uncover the plastomic gBGC in seed plants. We also propose a gBGC model to interpret the dissimilar evolutionary patterns as well as the compositionally biased mutations in the SC and IR regions of cycad plastomes. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Ancient mitochondrial haplotypes and evidence for intragenic recombination in a gynodioecious plant.

PubMed

Städler, Thomas; Delph, Lynda F

2002-09-03

Because of their extremely low nucleotide mutation rates, plant mitochondrial genes are generally not expected to show variation within species. Remarkably, we found nine distinct cytochrome b sequence haplotypes in the gynodioecious alpine plant Silene acaulis, with two or more haplotypes coexisting locally in each of three sampled regions. Moreover, there is evidence for intragenic recombination in the history of the haplotype sample, implying at least transient heteroplasmy of mitochondrial DNA (mtDNA). Heteroplasmy might be achieved by one of two potential mechanisms, either continuous coexistence of subgenomic fragments in low stoichiometry, or occasional paternal leakage of mtDNA. On the basis of levels of synonymous nucleotide substitutions, the average divergence time between haplotypes is estimated to be at least 15 million years. Ancient coalescence of extant haplotypes is further indicated by the paucity of fixed differences in haplotypes obtained from related species, a pattern expected under trans-specific evolution. Our data are consistent with models of frequency-dependent selection on linked cytoplasmic male-sterility factors, the putative molecular basis of females in gynodioecious populations. However, associations between marker loci and the inferred male-sterility genes can be maintained only with very low rates of recombination. Heteroplasmy and recombination between divergent haplotypes imply unexplored consequences for the evolutionary dynamics of gynodioecy, a widespread plant breeding system.

Targeted mutagenesis in cotton (Gossypium hirsutum L.) using the CRISPR/Cas9 system

PubMed Central

Chen, Xiugui; Lu, Xuke; Shu, Na; Wang, Shuai; Wang, Junjuan; Wang, Delong; Guo, Lixue; Ye, Wuwei

2017-01-01

The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 system has been widely used for genome editing in various plants because of its simplicity, high efficiency and design flexibility. However, to our knowledge, there is no report on the application of CRISPR/Cas9-mediated targeted mutagenesis in cotton. Here, we report the genome editing and targeted mutagenesis in upland cotton (Gossypium hirsutum L., hereafter cotton) using the CRISPR/Cas9 system. We designed two guide RNAs to target distinct sites of the cotton Cloroplastos alterados 1 (GhCLA1) and vacuolar H+-pyrophosphatase (GhVP) genes. Mutations in these two genes were detected in cotton protoplasts. Most of the mutations were nucleotide substitutions, with one nucleotide insertion and one substitution found in GhCLA1 and one deletion found in GhVP in cotton protoplasts. Subsequently, the two vectors were transformed into cotton shoot apexes through Agrobacterium-mediated transformation, resulting in efficient target gene editing. Most of the mutations were nucleotide deletions, and the mutation efficiencies were 47.6–81.8% in transgenic cotton plants. Evaluation using restriction-enzyme-PCR assay and sequence analysis detected no off-target mutations. Our results indicated that the CRISPR/Cas9 system was an efficient and specific tool for targeted mutagenesis of the cotton genome. PMID:28287154

Targeted mutagenesis in cotton (Gossypium hirsutum L.) using the CRISPR/Cas9 system.

PubMed

Chen, Xiugui; Lu, Xuke; Shu, Na; Wang, Shuai; Wang, Junjuan; Wang, Delong; Guo, Lixue; Ye, Wuwei

2017-03-13

The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 system has been widely used for genome editing in various plants because of its simplicity, high efficiency and design flexibility. However, to our knowledge, there is no report on the application of CRISPR/Cas9-mediated targeted mutagenesis in cotton. Here, we report the genome editing and targeted mutagenesis in upland cotton (Gossypium hirsutum L., hereafter cotton) using the CRISPR/Cas9 system. We designed two guide RNAs to target distinct sites of the cotton Cloroplastos alterados 1 (GhCLA1) and vacuolar H + -pyrophosphatase (GhVP) genes. Mutations in these two genes were detected in cotton protoplasts. Most of the mutations were nucleotide substitutions, with one nucleotide insertion and one substitution found in GhCLA1 and one deletion found in GhVP in cotton protoplasts. Subsequently, the two vectors were transformed into cotton shoot apexes through Agrobacterium-mediated transformation, resulting in efficient target gene editing. Most of the mutations were nucleotide deletions, and the mutation efficiencies were 47.6-81.8% in transgenic cotton plants. Evaluation using restriction-enzyme-PCR assay and sequence analysis detected no off-target mutations. Our results indicated that the CRISPR/Cas9 system was an efficient and specific tool for targeted mutagenesis of the cotton genome.

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

PubMed

Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

2017-07-19

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

Shifts in the evolutionary rate and intensity of purifying selection between two Brassica genomes revealed by analyses of orthologous transposons and relics of a whole genome triplication.

PubMed

Zhao, Meixia; Du, Jianchang; Lin, Feng; Tong, Chaobo; Yu, Jingyin; Huang, Shunmou; Wang, Xiaowu; Liu, Shengyi; Ma, Jianxin

2013-10-01

Recent sequencing of the Brassica rapa and Brassica oleracea genomes revealed extremely contrasting genomic features such as the abundance and distribution of transposable elements between the two genomes. However, whether and how these structural differentiations may have influenced the evolutionary rates of the two genomes since their split from a common ancestor are unknown. Here, we investigated and compared the rates of nucleotide substitution between two long terminal repeats (LTRs) of individual orthologous LTR-retrotransposons, the rates of synonymous and non-synonymous substitution among triplicated genes retained in both genomes from a shared whole genome triplication event, and the rates of genetic recombination estimated/deduced by the comparison of physical and genetic distances along chromosomes and ratios of solo LTRs to intact elements. Overall, LTR sequences and genic sequences showed more rapid nucleotide substitution in B. rapa than in B. oleracea. Synonymous substitution of triplicated genes retained from a shared whole genome triplication was detected at higher rates in B. rapa than in B. oleracea. Interestingly, non-synonymous substitution was observed at lower rates in the former than in the latter, indicating shifted densities of purifying selection between the two genomes. In addition to evolutionary asymmetry, orthologous genes differentially regulated and/or disrupted by transposable elements between the two genomes were also characterized. Our analyses suggest that local genomic and epigenomic features, such as recombination rates and chromatin dynamics reshaped by independent proliferation of transposable elements and elimination between the two genomes, are perhaps partially the causes and partially the outcomes of the observed inter-specific asymmetric evolution. © 2013 Purdue University The Plant Journal © 2013 John Wiley & Sons Ltd.

Replication-associated mutational asymmetry in the human genome.

PubMed

Chen, Chun-Long; Duquenne, Lauranne; Audit, Benjamin; Guilbaud, Guillaume; Rappailles, Aurélien; Baker, Antoine; Huvet, Maxime; d'Aubenton-Carafa, Yves; Hyrien, Olivier; Arneodo, Alain; Thermes, Claude

2011-08-01

During evolution, mutations occur at rates that can differ between the two DNA strands. In the human genome, nucleotide substitutions occur at different rates on the transcribed and non-transcribed strands that may result from transcription-coupled repair. These mutational asymmetries generate transcription-associated compositional skews. To date, the existence of such asymmetries associated with replication has not yet been established. Here, we compute the nucleotide substitution matrices around replication initiation zones identified as sharp peaks in replication timing profiles and associated with abrupt jumps in the compositional skew profile. We show that the substitution matrices computed in these regions fully explain the jumps in the compositional skew profile when crossing initiation zones. In intergenic regions, we observe mutational asymmetries measured as differences between complementary substitution rates; their sign changes when crossing initiation zones. These mutational asymmetries are unlikely to result from cryptic transcription but can be explained by a model based on replication errors and strand-biased repair. In transcribed regions, mutational asymmetries associated with replication superimpose on the previously described mutational asymmetries associated with transcription. We separate the substitution asymmetries associated with both mechanisms, which allows us to determine for the first time in eukaryotes, the mutational asymmetries associated with replication and to reevaluate those associated with transcription. Replication-associated mutational asymmetry may result from unequal rates of complementary base misincorporation by the DNA polymerases coupled with DNA mismatch repair (MMR) acting with different efficiencies on the leading and lagging strands. Replication, acting in germ line cells during long evolutionary times, contributed equally with transcription to produce the present abrupt jumps in the compositional skew. These results demonstrate that DNA replication is one of the major processes that shape human genome composition.

Functional effect of grapevine 1-deoxy-D-xylulose 5-phosphate synthase substitution K284N on Muscat flavour formation

PubMed Central

Battilana, Juri; Emanuelli, Francesco; Gambino, Giorgio; Gribaudo, Ivana; Gasperi, Flavia; Boss, Paul K.; Grando, Maria Stella

2011-01-01

Grape berries of Muscat cultivars (Vitis vinifera L.) contain high levels of monoterpenols and exhibit a distinct aroma related to this composition of volatiles. A structural gene of the plastidial methyl-erythritol-phosphate (MEP) pathway, 1-deoxy-D-xylulose 5-phosphate synthase (VvDXS), was recently suggested as a candidate gene for this trait, having been co-localized with a major quantitative trait locus for linalool, nerol, and geraniol concentrations in berries. In addition, a structured association study discovered a putative causal single nucleotide polymorphism (SNP) responsible for the substitution of a lysine with an asparagine at position 284 of the VvDXS protein, and this SNP was significantly associated with Muscat-flavoured varieties. The significance of this nucleotide difference was investigated by comparing the monoterpene profiles with the expression of VvDXS alleles throughout berry development in Moscato Bianco, a cultivar heterozygous for the SNP mutation. Although correlation was detected between the VvDXS transcript profile and the accumulation of free monoterpenol odorants, the modulation of VvDXS expression during berry development appears to be independent of nucleotide variation in the coding sequence. In order to assess how the non-synonymous mutation may enhance Muscat flavour, an in vitro characterization of enzyme isoforms was performed followed by in vivo overexpression of each VvDXS allele in tobacco. The results showed that the amino acid non-neutral substitution influences the enzyme kinetics by increasing the catalytic efficiency and also dramatically affects monoterpene levels in transgenic lines. These findings confirm a functional effect of the VvDXS gene polymorphism and may pave the way for metabolic engineering of terpenoid contents in grapevine. PMID:21868399

Differentiation of highly virulent strains of Streptococcus suis serotype 2 according to glutamate dehydrogenase electrophoretic and sequence type.

PubMed

Kutz, Russell; Okwumabua, Ogi

2008-10-01

The glutamate dehydrogenase (GDH) enzymes of 19 Streptococcus suis serotype 2 strains, consisting of 18 swine isolates and 1 human clinical isolate from a geographically varied collection, were analyzed by activity staining on a nondenaturing gel. All seven (100%) of the highly virulent strains tested produced an electrophoretic type (ET) distinct from those of moderately virulent and nonvirulent strains. By PCR and nucleotide sequence determination, the gdh genes of the 19 strains and of 2 highly virulent strains involved in recent Chinese outbreaks yielded a 1,820-bp fragment containing an open reading frame of 1,344 nucleotides, which encodes a protein of 448 amino acid residues with a calculated molecular mass of approximately 49 kDa. The nucleotide sequences contained base pair differences, but most were silent. Cluster analysis of the deduced amino acid sequences separated the isolates into three groups. Group I (ETI) consisted of the seven highly virulent isolates and the two Chinese outbreak strains, containing Ala(299)-to-Ser, Glu(305)-to-Lys, and Glu(330)-to-Lys amino acid substitutions compared with groups II and III (ETII). Groups II and III consisted of moderately virulent and nonvirulent strains, which are separated from each other by Tyr(72)-to-Asp and Thr(296)-to-Ala substitutions. Gene exchange studies resulted in the change of ETI to ETII and vice versa. A spectrophotometric activity assay for GDH did not show significant differences between the groups. These results suggest that the GDH ETs and sequence types may serve as useful markers in predicting the pathogenic behavior of strains of this serotype and that the molecular basis for the observed differences in the ETs was amino acid substitutions and not deletion, insertion, or processing uniqueness.

Dynamically correlated mutations drive human Influenza A evolution.

PubMed

Tria, F; Pompei, S; Loreto, V

2013-01-01

Human Influenza A virus undergoes recurrent changes in the hemagglutinin (HA) surface protein, primarily involved in the human antibody recognition. Relevant antigenic changes, enabling the virus to evade host immune response, have been recognized to occur in parallel to multiple mutations at antigenic sites in HA. Yet, the role of correlated mutations (epistasis) in driving the molecular evolution of the virus still represents a challenging puzzle. Further, though circulation at a global geographic level is key for the survival of Influenza A, its role in shaping the viral phylodynamics remains largely unexplored. Here we show, through a sequence based epidemiological model, that epistatic effects between amino acids substitutions, coupled with a reservoir that mimics worldwide circulating viruses, are key determinants that drive human Influenza A evolution. Our approach explains all the up-to-date observations characterizing the evolution of H3N2 subtype, including phylogenetic properties, nucleotide fixation patterns, and composition of antigenic clusters.

Nucleotide Substitution in 3' Arm of Bovine MIR-2467 in Five Cattle Breeds.

PubMed

Łukaszewicz, Aneta; Basiak, Szymon; Proskura, Witold Stanisław; Dybus, Andrzej

2015-01-01

The T > C single nucleotide polymorphism (SNP) in the MIR2467 gene was investigated in order to confirm its presence in cattle genome and to check for possible differences in its genotype distribution among different breeds. Additional purpose of the study was to investigate in silico potential effect of that substitution on the structure and stability of precursor mir-2467. The study involved 634 individuals of five cattle breeds: Angus, Hereford, Holstein-Friesian, Jersey, and Limousin, which were genotyped using PCR-RFLP assay. In this study, the presence of T > C polymorphism at position 24 was observed in all the cattle breeds excepting Hereford. In addition, the differences in the genotype distribution among analyzed breeds were indicated. On the basis of minimum free energy structure prediction, the C allele was indicated to have possible impact on decreasing the stability of the pre-mir-2467, thus altering its ability to regulate target genes expression.

High frequency of a single nucleotide substitution (c.-6-180T>G) of the canine MDR1/ABCB1 gene associated with phenobarbital-resistant idiopathic epilepsy in Border Collie dogs.

PubMed

Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

2013-01-01

A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

High Frequency of a Single Nucleotide Substitution (c.-6-180T>G) of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs

PubMed Central

Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko

2013-01-01

A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies. PMID:24302812

Val66Met Polymorphism of BDNF Alters Prodomain Structure to Induce Neuronal Growth Cone Retraction

PubMed Central

Anastasia, Agustin; Deinhardt, Katrin; Chao, Moses V.; Will, Nathan E.; Irmady, Krithi; Lee, Francis S.; Hempstead, Barbara L.; Bracken, Clay

2013-01-01

A common single-nucleotide polymorphism in the human brain-derived neurotrophic factor (BDNF) gene results in a Val66Met substitution in the BDNF prodomain region. This single-nucleotide polymorphism is associated with alterations in memory and with enhanced risk to develop depression and anxiety disorders in humans. Here we show that the isolated BDNF prodomain is detected in the hippocampus and that it can be secreted from neurons in an activity-dependent manner. Using nuclear magnetic resonance spectroscopy and circular dichroism we find that the prodomain is intrinsically disordered, and the Val66Met substitution induces structural changes. Surprisingly, application of Met66 (but not Val66) BDNF prodomain induces acute growth cone retraction and a decrease in Rac activity in hippocampal neurons. Expression of p75NTR and differential engagement of the Met66 prodomain to the SorCS2 receptor are required for this effect. These results identify the Met66 prodomain as a new active ligand which modulates neuronal morphology. PMID:24048383

Effective oligonucleotide-mediated gene disruption in ES cells lacking the mismatch repair protein MSH3.

PubMed

Dekker, M; Brouwers, C; Aarts, M; van der Torre, J; de Vries, S; van de Vrugt, H; te Riele, H

2006-04-01

We have previously demonstrated that site-specific insertion, deletion or substitution of one or two nucleotides in mouse embryonic stem cells (ES cells) by single-stranded deoxyribo-oligonucleotides is several hundred-fold suppressed by DNA mismatch repair (MMR) activity. Here, we have investigated whether compound mismatches and larger insertions escape detection by the MMR machinery and can be effectively introduced in MMR-proficient cells. We identified several compound mismatches that escaped detection by the MMR machinery to some extent, but could not define general rules predicting the efficacy of complex base-pair substitutions. In contrast, we found that four-nucleotide insertions were largely subject to suppression by the MSH2/MSH3 branch of MMR and could be effectively introduced in Msh3-deficient cells. As these cells have no overt mutator phenotype and Msh3-deficient mice do not develop cancer, Msh3-deficient ES cells can be used for oligonucleotide-mediated gene disruption. As an example, we present disruption of the Fanconi anemia gene Fancf.

Identification of IBV QX vaccine markers : Should vaccine acceptance by authorities require similar identifications for all live IBV vaccines?

PubMed

Listorti, Valeria; Laconi, Andrea; Catelli, Elena; Cecchinato, Mattia; Lupini, Caterina; Naylor, Clive J

2017-10-09

IBV genotype QX causes sufficient disease in Europe for several commercial companies to have started developing live attenuated vaccines. Here, one of those vaccines (L1148) was fully consensus sequenced alongside its progenitor field strain (1148-A) to determine vaccine markers, thereby enabling detection on farms. Twenty-eight single nucleotide substitutions were associated with the 1148-A attenuation, of which any combination can identify vaccine L1148 in the field. Sixteen substitutions resulted in amino acid coding changes of which half were in spike. One change in the 1b gene altered the normally highly conserved final 5 nucleotides of the transcription regulatory sequence of the S gene, common to all IBV QX genes. No mutations can currently be associated with the attenuation process. Field vaccination strategies would greatly benefit by such comparative sequence data being mandatorily submitted to regulators prior to vaccine release following a successful registration process. Copyright © 2017. Published by Elsevier Ltd.

Analysis of evolutionary rate of HIV-1 subtype B using blood donor samples in Japan.

PubMed

Shinohara, Naoya; Matsumoto, Chieko; Matsubayashi, Keiji; Nagai, Tadashi; Satake, Masahiro

2018-06-01

There are few reports on HIV-1 intra-host evolutionary rate in asymptomatic treatment-naïve patients. Here, the HIV-1 intra-host evolutionary rate was estimated based on HIV-1 RNA sequences from plasma samples of blood donors in Japan. Blood donors were assumed to have received no treatment for and have no symptoms of HIV-1 infection because they were healthy, and declared no risky behaviors of HIV-1 infection on a self-reported questionnaire or interview followed by donation. HIV-1 RNA was obtained from 85 plasma samples from 36 blood donors who donated blood multiple times and were HIV-1-positive. The C2V3C3 region which encodes for a part of the envelope protein, and the V3 loop in the C2V3C3 region were analyzed by RT-PCR and direct sequencing, and the sequences were compared. The nucleotide substitution rate was calculated by linear regression. All HIV-1 samples analyzed were classified as subtype B. The mean nucleotide substitution rate in C2V3C3 was calculated to be 6.2 × 10 -3 -1.8 × 10 -2 /site/year (V3: 4.5 × 10 -3 -2.3 × 10 -2 /site/year). The mean non-synonymous substitution rate in C2V3C3 was calculated to be 5.2 × 10 -3 -1.7 × 10 -2 /site/year (V3: 4.5 × 10 -3 -2.1 × 10 -2 /site/year). The mean synonymous substitution rate in C2V3C3 was calculated to be 1.1 × 10 -4 -2.3 × 10 -3 /site/year (V3: 2.9 × 10 -3 /site/year). Among HIV-1 subtype B RNA-positive blood donors in Japan, the nucleotide substitution rate in C2V3C3 was estimated to be higher than that of reported cases using HIV-1 samples mainly obtained from AIDS patients. Compared to AIDS patients, immune responses against HIV-1 are probably more effective in HIV-1 RNA-positive blood donors. Consequently, immune pressure presumably promotes mutation of the virus genome.

Multilocus patterns of nucleotide polymorphism and demographic change in Taxodium distichum (Cupressaceae) in the lower Mississippi River alluvial valley

USGS Publications Warehouse

Kusumi, Junko; Zidong, Li; Kado, Tomoyuki; Tsumura, Yoshihiko; Middleton, Beth A.; Tachida, Hidenori

2010-01-01

Conclusions: Taxodium distichum had significantly higher nucleotide variation than C. japonica, and its patterns of polymorphism contrasted strikingly with those of the latter, which previously has been inferred to have experienced a reduction in population size.

Nucleotide exchange and excision technology DNA shuffling and directed evolution.

PubMed

Speck, Janina; Stebel, Sabine C; Arndt, Katja M; Müller, Kristian M

2011-01-01

Remarkable success in optimizing complex properties within DNA and proteins has been achieved by directed evolution. In contrast to various random mutagenesis methods and high-throughput selection methods, the number of available DNA shuffling procedures is limited, and protocols are often difficult to adjust. The strength of the nucleotide exchange and excision technology (NExT) DNA shuffling described here is the robust, efficient, and easily controllable DNA fragmentation step based on random incorporation of the so-called 'exchange nucleotides' by PCR. The exchange nucleotides are removed enzymatically, followed by chemical cleavage of the DNA backbone. The oligonucleotide pool is reassembled into full-length genes by internal primer extension, and the recombined gene library is amplified by standard PCR. The technique has been demonstrated by shuffling a defined gene library of chloramphenicol acetyltransferase variants using uridine as fragmentation defining exchange nucleotide. Substituting 33% of the dTTP with dUTP in the incorporation PCR resulted in shuffled clones with an average parental fragment size of 86 bases and revealed a mutation rate of only 0.1%. Additionally, a computer program (NExTProg) has been developed that predicts the fragment size distribution depending on the relative amount of the exchange nucleotide.

Parsimony and Model-Based Analyses of Indels in Avian Nuclear Genes Reveal Congruent and Incongruent Phylogenetic Signals

PubMed Central

Yuri, Tamaki; Kimball, Rebecca T.; Harshman, John; Bowie, Rauri C. K.; Braun, Michael J.; Chojnowski, Jena L.; Han, Kin-Lan; Hackett, Shannon J.; Huddleston, Christopher J.; Moore, William S.; Reddy, Sushma; Sheldon, Frederick H.; Steadman, David W.; Witt, Christopher C.; Braun, Edward L.

2013-01-01

Insertion/deletion (indel) mutations, which are represented by gaps in multiple sequence alignments, have been used to examine phylogenetic hypotheses for some time. However, most analyses combine gap data with the nucleotide sequences in which they are embedded, probably because most phylogenetic datasets include few gap characters. Here, we report analyses of 12,030 gap characters from an alignment of avian nuclear genes using maximum parsimony (MP) and a simple maximum likelihood (ML) framework. Both trees were similar, and they exhibited almost all of the strongly supported relationships in the nucleotide tree, although neither gap tree supported many relationships that have proven difficult to recover in previous studies. Moreover, independent lines of evidence typically corroborated the nucleotide topology instead of the gap topology when they disagreed, although the number of conflicting nodes with high bootstrap support was limited. Filtering to remove short indels did not substantially reduce homoplasy or reduce conflict. Combined analyses of nucleotides and gaps resulted in the nucleotide topology, but with increased support, suggesting that gap data may prove most useful when analyzed in combination with nucleotide substitutions. PMID:24832669

Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout

USGS Publications Warehouse

Rasmussen, C.; Purcell, M.K.; Gregg, J.L.; LaPatra, S.E.; Winton, J.R.; Hershberger, P.K.

2010-01-01

The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of ~740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

Evolution of the Male-Determining Gene SRY Within the Cat Family Felidae

PubMed Central

King, V.; Goodfellow, P. N.; Wilkerson, A. J. Pearks; Johnson, W. E.; O'Brien, S. J.; Pecon-Slattery, J.

2007-01-01

In most placental mammals, SRY is a single-copy gene located on the Y chromosome and is the trigger for male sex determination during embryonic development. Here, we present comparative genomic analyses of SRY (705 bp) along with the adjacent noncoding 5′ flank (997 bp) and 3′ flank (948 bp) in 36 species of the cat family Felidae. Phylogenetic analyses indicate that the noncoding genomic flanks and SRY closely track species divergence. However, several inconsistencies are observed in SRY. Overall, the gene exhibits purifying selection to maintain function (ω = 0.815) yet SRY is under positive selection in two of the eight felid lineages. SRY has low numbers of nucleotide substitutions, yet most encode amino acid changes between species, and four different species have significantly altered SRY due to insertion/deletions. Moreover, fixation of nonsynonymous substitutions between sister taxa is not consistent and may occur rapidly, as in the case of domestic cat, or not at all over long periods of time, as observed within the Panthera lineage. The former resembles positive selection during speciation, and the latter purifying selection to maintain function. Thus, SRY evolution in cats likely reflects the different phylogeographic histories, selection pressures, and patterns of speciation in modern felids. PMID:17277366

Characterization of the dog agouti gene and a nonagouti mutation in german shepherd dogs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kerns, Julie A.; Newton, J.; Berryere, Tom G.

The interaction between two genes, Agouti and Melanocortin-1 receptor (Mc1r), produces diverse pigment patterns in mammals by regulating the type, amount, and distribution pattern of the two pigment types found in mammalian hair: eumelanin (brown/black) and pheomelanin (yellow/red). In domestic dogs (Canis familiaris), there is a tremendous variation in coat color patterns between and within breeds; however, previous studies suggest that the molecular genetics of pigment-type switching in dogs may differ from that of other mammals. Here we report the identification and characterization of the Agouti gene from domestic dogs, predicted to encode a 131-amino-acid secreted protein 98 percent identicalmore » to the fox homolog, and which maps to chromosome CFA24 in a region of conserved linkage. Comparative analysis of the Doberman Pinscher Agouti cDNA, the fox cDNA, and 180 kb of Doberman Pinscher genomic DNA suggests that, as with laboratory mice, different pigment-type-switching patterns in the canine family are controlled by alternative usage of different promoters and untranslated first exons. A small survey of Labrador Retrievers, Greyhounds, Australian Shepherds, and German Shepherd Dogs did not uncover any polymorphisms, but we identified a single nucleotide variant in black German Shepherd Dogs predicted to cause an Arg-to-Cys substitution at codon 96, which is likely to account for recessive inheritance of a uniform black coat.« less

Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

PubMed

Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

2015-03-04

Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

The Brassicaceae Family Displays Divergent, Shoot-Skewed NLR Resistance Gene Expression.

PubMed

Munch, David; Gupta, Vikas; Bachmann, Asger; Busch, Wolfgang; Kelly, Simon; Mun, Terry; Andersen, Stig Uggerhøj

2018-02-01

Nucleotide-binding site leucine-rich repeat resistance genes (NLRs) allow plants to detect microbial effectors. We hypothesized that NLR expression patterns could reflect organ-specific differences in effector challenge and tested this by carrying out a meta-analysis of expression data for 1,235 NLRs from nine plant species. We found stable NLR root/shoot expression ratios within species, suggesting organ-specific hardwiring of NLR expression patterns in anticipation of distinct challenges. Most monocot and dicot plant species preferentially expressed NLRs in roots. In contrast, Brassicaceae species, including oilseed rape ( Brassica napus ) and the model plant Arabidopsis ( Arabidopsis thaliana ), were unique in showing NLR expression skewed toward the shoot across multiple phylogenetically distinct groups of NLRs. The Brassicaceae are also outliers in the sense that they have lost the common symbiosis signaling pathway, which enables intracellular infection by root symbionts. While it is unclear if these two events are related, the NLR expression shift identified here suggests that the Brassicaceae may have evolved unique pattern-recognition receptors and antimicrobial root metabolites to substitute for NLR protection. Such innovations in root protection could potentially be exploited in crop rotation schemes or for enhancing root defense systems of non-Brassicaceae crops. © 2018 American Society of Plant Biologists. All Rights Reserved.

The Teaching of Protein Synthesis--A Microcomputer Based Method.

ERIC Educational Resources Information Center

Goodridge, Frank

1983-01-01

Describes two computer programs (BASIC for 32K Commodore PET) for teaching protein synthesis. The first is an interactive test of base-pairing knowledge, and the second generates random DNA nucleotide sequences, with instructions for substitution, insertion, and deletion printed out for each student. (JN)

Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70.

PubMed Central

Hunt, C; Morimoto, R I

1985-01-01

We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075

Origin of the polymorphism of the involucrin gene in Asians.

PubMed Central

Djian, P; Delhomme, B; Green, H

1995-01-01

The involucrin gene, encoding a protein of the terminally differentiated keratinocyte, is polymorphic in the human. There is polymorphism of marker nucleotides a two positions in the coding region, and there are over eight polymorphic forms based on the number and kind of 10-codon tandem repeats in that part of the coding region most recently added in the human lineage. The involucrin alleles of Caucasians and Africans differ in both nucleotides and repeat patterns. We show that the involucrin alleles of East Asians (Chinese and Japanese) can be divided into two populations according to whether they possess the two marker nucleotides typical of Africans or Caucasians. The Asian population bearing Caucasian-type marker nucleotides has repeat patterns similar to those of Caucasians, whereas Asians bearing African-type marker nucleotides have repeat patterns that resemble those of Africans more than those of Caucasians. The existence of two populations of East Asian involucrin alleles gives support for the existence of a Eurasian stem lineage from which Caucasians and a part of the Asian population originated. PMID:7762559

Adaptive Molecular Evolution for 13,000 Phage Generations

PubMed Central

Wichman, Holly A.; Millstein, Jack; Bull, J. J.

2005-01-01

Bacteriophage φX174 was evolved on a continuous supply of sensitive hosts for 180 days (∼13,000 phage generations). The average rate of nucleotide substitution was nearly 0.2% (11 substitutions)/20 days, and, surprisingly, substitutions accumulated in a clock-like manner throughout the study, except for a low rate during the first 20 days. Rates of silent and missense substitutions varied over time and among genes. Approximately 40% of the 71 missense changes and 25% of the 58 silent changes have been observed in previous adaptations; the rate of parallel substitution was highest in the early phase of the evolution, but 7% of the later changes had evolved in previous studies of much shorter duration. Several lines of evidence suggest that most of the changes were adaptive, even many of the silent substitutions. The sustained, high rate of adaptive evolution for 180 days defies a model of adaptation to a constant environment. We instead suggest that continuing molecular evolution reflects a potentially indefinite arms race, stemming from high levels of co-infection and the resulting conflict among genomes competing within the same cell. PMID:15687276

A novel HLA-B allele, B*5214, detected in a Taiwanese volunteer bone marrow donor using a sequence-based typing method.

PubMed

Chen, M J; Chu, C C; Shyr, M H; Lin, C L; Lin, P Y; Yang, K L

2010-02-01

HLA-B*5214, a novel rare allele of HLA-B*52 variant, was found in a Taiwanese volunteer bone marrow donor by sequence-based typing method. The sequence of B*5214 is identical to that of B*520101 in exon 2 but differs from B*520101 in exon 3 at nucleotide positions 419 A-->T and 435 A-->G. Alteration of these two nucleotides resulted an amino acid substitution at amino acid residue 116 Y-->F ( TAC-->TTC) and a silent exchange at residue 121 K-->K (AAA-->AAG).

Economic aspects of drug substitution

PubMed Central

Salehi, Hossein; Schweitzer, Stuart O.

1985-01-01

One of the major directions of health policy is the attempt to contain expenditures on pharmaceuticals by encouraging substitution of generic for brand name drug products. Yet, a major marketing survey of prescribing and dispensing patterns in California in 1977 found relatively little drug substitution occurring, and in fact substitution of more expensive products occurred more frequently than did substitution of less expensive products. This article tests alternative models of pharmacy dispensing behavior to better explain substitution patterns and it estimates price functions to measure the extent to which cost savings on generic products are passed on to consumers. PMID:10311162

HTLV-1 subgroups associated with the risk of HAM/TSP are related to viral and host gene expression in peripheral blood mononuclear cells, independent of the transactivation functions of the viral factors.

PubMed

Yasuma, Keiko; Matsuzaki, Toshio; Yamano, Yoshihisa; Takashima, Hiroshi; Matsuoka, Masao; Saito, Mineki

2016-08-01

Among human T cell leukemia virus type 1 (HTLV-1)-infected individuals, the risk of developing HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) across lifetime differs between ethnic groups. There is an association between HTLV-1 tax gene subgroups (subgroup-A or subgroup-B) and the risk of HAM/TSP in the Japanese population. In this study, we investigated the full-length proviral genome sequences of various HTLV-1-infected cell lines and patient samples. The functional differences in the viral transcriptional regulators Tax and HTLV-1 bZIP factor (HBZ) between each subgroup and the relationships between subgroups and the clinical and laboratory characteristics of HAM/TSP patients were evaluated. The results of these analyses indicated the following: (1) distinct nucleotide substitutions corresponding to each subgroup were associated with nucleotide substitutions in viral structural, regulatory, and accessory genes; (2) the HBZ messenger RNA (mRNA) expression in HTLV-1-infected cells was significantly higher in HAM/TSP patients with subgroup-B than in those with subgroup-A; (3) a positive correlation was observed between the expression of HBZ mRNA and its target Foxp3 mRNA in HAM/TSP patients with subgroup-B, but not in patients with subgroup-A; (4) no clear differences were noted in clinical and laboratory characteristics between HAM/TSP patients with subgroup-A and subgroup-B; and (5) no functional differences were observed in Tax and HBZ between each subgroup based on reporter gene assays. Our results indicate that although different HTLV-1 subgroups are characterized by different patterns of viral and host gene expression in HAM/TSP patients via independent mechanisms of direct transcriptional regulation, these differences do not significantly affect the clinical and laboratory characteristics of HAM/TSP patients.

A Genome Sequence Resource for the Aye-Aye (Daubentonia madagascariensis), a Nocturnal Lemur from Madagascar

PubMed Central

Perry, George H.; Reeves, Darryl; Melsted, Páll; Ratan, Aakrosh; Miller, Webb; Michelini, Katelyn; Louis, Edward E.; Pritchard, Jonathan K.; Mason, Christopher E.; Gilad, Yoav

2012-01-01

We present a high-coverage draft genome assembly of the aye-aye (Daubentonia madagascariensis), a highly unusual nocturnal primate from Madagascar. Our assembly totals ∼3.0 billion bp (3.0 Gb), roughly the size of the human genome, comprised of ∼2.6 million scaffolds (N50 scaffold size = 13,597 bp) based on short paired-end sequencing reads. We compared the aye-aye genome sequence data with four other published primate genomes (human, chimpanzee, orangutan, and rhesus macaque) as well as with the mouse and dog genomes as nonprimate outgroups. Unexpectedly, we observed strong evidence for a relatively slow substitution rate in the aye-aye lineage compared with these and other primates. In fact, the aye-aye branch length is estimated to be ∼10% shorter than that of the human lineage, which is known for its low substitution rate. This finding may be explained, in part, by the protracted aye-aye life-history pattern, including late weaning and age of first reproduction relative to other lemurs. Additionally, the availability of this draft lemur genome sequence allowed us to polarize nucleotide and protein sequence changes to the ancestral primate lineage—a critical period in primate evolution, for which the relevant fossil record is sparse. Finally, we identified 293,800 high-confidence single nucleotide polymorphisms in the donor individual for our aye-aye genome sequence, a captive-born individual from two wild-born parents. The resulting heterozygosity estimate of 0.051% is the lowest of any primate studied to date, which is understandable considering the aye-aye's extensive home-range size and relatively low population densities. Yet this level of genetic diversity also suggests that conservation efforts benefiting this unusual species should be prioritized, especially in the face of the accelerating degradation and fragmentation of Madagascar's forests. PMID:22155688

Temporal distribution of genetically homogenous ‘free-living’ Hematodinium sp. in a Delmarva coastal ecosystem

PubMed Central

2012-01-01

Background Significant damage to crustacean fisheries worldwide has been associated with Hematodinium sp. It has been postulated that Hematodinium sp. requires passage through the water column and/or intermediate hosts to complete its life cycle. Thus, an understanding of the prevalence and seasonality of Hematodinium sp. within environmentally-derived samples should yield insight into potential modes of disease transmission, and how these relate to infection cycles in hosts. Results We conducted a two year survey, from 2010–2011, in which 48 of 546 (8.8%) of environmental samples from the Maryland and Virginia coastal bays were positive for Hematodinium sp. between April and November, as based upon endpoint PCR analysis specific to blue crab isolates. Detection in both water and sediment was roughly equivalent, and there were no obvious seasonal patterns. However, there was a high detection in April water samples, which was unanticipated owing to the fact that crabs infected with Hematodinium sp. have not been observed in this early month of the seasonal disease cycle. Focusing on three sites of high prevalence (Sinnickson, VA; Tom’s Cove, VA; and Newport Bay, MD) Hematodinium sp. population diversity was analyzed using standard cloning methods. Of 131 clones, 109 (83.2%) were identical, 19 displayed a single nucleotide substitution, and 4 contain two nucleotide substitutions. Conclusions Our data suggests a continuous presence of Hematodinium sp. in both water and sediment of a combined Maryland and Virginia coastal bay ecosystem. The detection of Hematodinium sp. in the water column in April is an earlier manifestation of the parasite than predicted, pointing to an as yet unknown stage in its development prior to infection. That the population is relatively homogenous ranging from April to November, at three distinct sites, supports a hypothesis that one species of Hematodinium is responsible for infections within the ecosystem. PMID:22828185

Systematic asymmetric nucleotide exchanges produce human mitochondrial RNAs cryptically encoding for overlapping protein coding genes.

PubMed

Seligmann, Hervé

2013-05-07

GenBank's EST database includes RNAs matching exactly human mitochondrial sequences assuming systematic asymmetric nucleotide exchange-transcription along exchange rules: A→G→C→U/T→A (12 ESTs), A→U/T→C→G→A (4 ESTs), C→G→U/T→C (3 ESTs), and A→C→G→U/T→A (1 EST), no RNAs correspond to other potential asymmetric exchange rules. Hypothetical polypeptides translated from nucleotide-exchanged human mitochondrial protein coding genes align with numerous GenBank proteins, predicted secondary structures resemble their putative GenBank homologue's. Two independent methods designed to detect overlapping genes (one based on nucleotide contents analyses in relation to replicative deamination gradients at third codon positions, and circular code analyses of codon contents based on frame redundancy), confirm nucleotide-exchange-encrypted overlapping genes. Methods converge on which genes are most probably active, and which not, and this for the various exchange rules. Mean EST lengths produced by different nucleotide exchanges are proportional to (a) extents that various bioinformatics analyses confirm the protein coding status of putative overlapping genes; (b) known kinetic chemistry parameters of the corresponding nucleotide substitutions by the human mitochondrial DNA polymerase gamma (nucleotide DNA misinsertion rates); (c) stop codon densities in predicted overlapping genes (stop codon readthrough and exchanging polymerization regulate gene expression by counterbalancing each other). Numerous rarely expressed proteins seem encoded within regular mitochondrial genes through asymmetric nucleotide exchange, avoiding lengthening genomes. Intersecting evidence between several independent approaches confirms the working hypothesis status of gene encryption by systematic nucleotide exchanges. Copyright © 2013 Elsevier Ltd. All rights reserved.

Detecting and Removing Ascertainment Bias in Microsatellites from the HGDP-CEPH Panel

PubMed Central

Eriksson, Anders; Manica, Andrea

2011-01-01

Although ascertainment bias in single nucleotide polymorphisms is a well-known problem, it is generally accepted that microsatellites have mutation rates too high for bias to be a concern. Here, we analyze in detail the large set of microsatellites typed for the Human Genetic Diversity Panel (HGDP)-CEPH panel. We develop a novel framework based on rarefaction to compare heterozygosity across markers with different mutation rates. We find that, whereas di- and tri-nucleotides show similar patterns of within- and between-population heterozygosity, tetra-nucleotides are inconsistent with the other two motifs. In addition, di- and tri-nucleotides are consistent with 16 unbiased tetra-nucleotide markers, whereas the HPGP-CEPH tetra-nucleotides are significantly different. This discrepancy is due to the HGDP-CEPH tetra-nucleotides being too homogeneous across Eurasia, even after their slower mutation rate is taken into account by rarefying the other markers. The most likely explanation for this pattern is ascertainment bias. We strongly advocate the exclusion of tetra-nucleotides from future population genetics analysis of this dataset, and we argue that other microsatellite datasets should be investigated for the presence of bias using the approach outlined in this article. PMID:22384358

Regions of conservation and divergence in the 3' untranslated sequences of genomic RNA from Ross River virus isolates.

PubMed

Faragher, S G; Dalgarno, L

1986-07-20

The 3' untranslated (UT) sequences of the genomic RNAs of five geographic variants of the alphavirus Ross River virus (RRV) were determined and compared with the 3' UT sequence of RRV T48, the prototype strain. Part of the 3' UT region of Getah virus, a close serological relative of RRV, was also sequenced. The RRV 3' UT region varies markedly in length between variants. Large deletions or insertions, sequence rearrangements and single nucleotide substitutions are observed. A sequence tract of 49 to 58 nucleotides, which is repeated as four blocks in the RRV T48 3' UT region, occurs only once in the 3' UT region of one RRV strain (NB5092), indicating that the existence of repeat sequence blocks is not essential for RRV replication. However, the precise sequence of the 3' proximal copy of the repeat block and its position relative to the poly(A) tail were identical in all RRV isolates examined, suggesting that it has an important role in RRV replication. Nucleotide substitutions between RRV variants are distributed non-randomly along the length of the 3' UT region. The sequence of 120 to 130 nucleotides adjacent to the poly(A) tail is strongly conserved. Getah virus RNA contains three repeat sequence blocks in the 3' UT region. These are similar in sequence to those in RRV RNA but differ in their arrangement. Homology between the RRV and Getah 3' UT sequences is greatest in the 3' proximal repeat sequence block that shows three differences in 49 nucleotides. The 3' proximal repeat in Getah RNA occurs at the same position, relative to the poly(A) tail, as in all RRV variants. The RRV and Getah virus 3' UT sequences show extensive homology in the region between the 3' proximal repeat and the poly(A) tail but, apart from the repeat blocks themselves, they show no significant homology elsewhere.

Three closely related herpesviruses are associated with fibropapillomatosis in marine turtles

USGS Publications Warehouse

Quackenbush, S.L.; Work, Thierry M.; Balazs, George H.; Casey, Rufina N.; Rovnak, J.; Chaves, A.; duToit, L.; Baines, J.D.; Parrish, C.R.; Bowser, Paul R.; Casey, James W.

1998-01-01

Green turtle fibropapillomatosis is a neoplastic disease of increasingly significant threat to the survivability of this species. Degenerate PCR primers that target highly conserved regions of genes encoding herpesvirus DNA polymerases were used to amplify a DNA sequence from fibropapillomas and fibromas from Hawaiian and Florida green turtles. All of the tumors tested (n= 23) were found to harbor viral DNA, whereas no viral DNA was detected in skin biopsies from tumor-negative turtles. The tissue distribution of the green turtle herpesvirus appears to be generally limited to tumors where viral DNA was found to accumulate at approximately two to five copies per cell and is occasionally detected, only by PCR, in some tissues normally associated with tumor development. In addition, herpesviral DNA was detected in fibropapillomas from two loggerhead and four olive ridley turtles. Nucleotide sequencing of a 483-bp fragment of the turtle herpesvirus DNA polymerase gene determined that the Florida green turtle and loggerhead turtle sequences are identical and differ from the Hawaiian green turtle sequence by five nucleotide changes, which results in two amino acid substitutions. The olive ridley sequence differs from the Florida and Hawaiian green turtle sequences by 15 and 16 nucleotide changes, respectively, resulting in four amino acid substitutions, three of which are unique to the olive ridley sequence. Our data suggest that these closely related turtle herpesviruses are intimately involved in the genesis of fibropapillomatosis.

Detection and characterization of hepatitis A virus circulating in Egypt.

PubMed

Hamza, Hazem; Abd-Elshafy, Dina Nadeem; Fayed, Sayed A; Bahgat, Mahmoud Mohamed; El-Esnawy, Nagwa Abass; Abdel-Mobdy, Emam

2017-07-01

Hepatitis A virus (HAV) still poses a considerable problem worldwide. In the current study, hepatitis A virus was recovered from wastewater samples collected from three wastewater treatment plants over one year. Using RT-PCR, HAV was detected in 43 out of 68 samples (63.2%) representing both inlet and outlet. Eleven positive samples were subjected to sequencing targeting the VP1-2A junction region. Phylogenetic analysis revealed that all samples belonged to subgenotype IB with few substitutions at the amino acid level. The complete sequence of one isolate (HAV/Egy/BI-11/2015) showed that the similarity at the amino acid level was not reflected at the nucleotide level. However, the deduced amino acid sequence derived from the complete nucleotide sequence showed distinct substitutions in the 2B, 2C, and 3A regions. Recombination analysis revealed a recombination event between X75215 (subgenotype IA) and AF268396 (subgenotype IB) involving a portion of the 2B nonstructural protein coding region (nucleotides 3757-3868) assuming the herein characterized sequence an actual recombinant. Despite the role of recombination in picornaviruses evolution, its involvement in HAV evolution has rarely been reported, and this may be due to the limited available complete HAV sequences. To our knowledge, this represents the first characterized complete sequence of an Egyptian isolate and the described recombination event provides an important update on the circulating HAV strains in Egypt.

Control of total GFP expression by alterations to the 3′ region nucleotide sequence

PubMed Central

2013-01-01

Background Previously, we distinguished the Escherichia coli type II cytoplasmic membrane translocation pathways of Tat, Yid, and Sec for unfolded and folded soluble target proteins. The translocation of folded protein to the periplasm for soluble expression via the Tat pathway was controlled by an N-terminal hydrophilic leader sequence. In this study, we investigated the effect of the hydrophilic C-terminal end and its nucleotide sequence on total and soluble protein expression. Results The native hydrophilic C-terminal end of GFP was obtained by deleting the C-terminal peptide LeuGlu-6×His, derived from pET22b(+). The corresponding clones induced total and soluble GFP expression that was either slightly increased or dramatically reduced, apparently through reconstruction of the nucleotide sequence around the stop codon in the 3′ region. In the expression-induced clones, the hydrophilic C-terminus showed increased Tat pathway specificity for soluble expression. However, in the expression-reduced clone, after analyzing the role of the 5′ poly(A) coding sequence with a substituted synonymous codon, we proved that the longer 5′ poly(A) coding sequence interacted with the reconstructed 3′ region nucleotide sequence to create a new mRNA tertiary structure between the 5′ and 3′ regions, which resulted in reduced total GFP expression. Further, to recover the reduced expression by changing the 3′ nucleotide sequence, after replacing selected C-terminal 5′ codons and the stop codon in the ORF with synonymous codons, total GFP expression in most of the clones was recovered to the undeleted control level. The insertion of trinucleotides after the stop codon in the 3′-UTR recovered or reduced total GFP expression. RT-PCR revealed that the level of total protein expression was controlled by changes in translational or transcriptional regulation, which were induced or reduced by the substitution or insertion of 3′ region nucleotides. Conclusions We found that the hydrophilic C-terminal end of GFP increased Tat pathway specificity and that the 3′ nucleotide sequence played an important role in total protein expression through translational and transcriptional regulation. These findings may be useful for efficiently producing recombinant proteins as well as for potentially controlling the expression level of specific genes in the body for therapeutic purposes. PMID:23834827

[Genetic Characteristics of Type 2 Vaccine-derived Poliovirus in Shanxi Province (China) in 2014].

PubMed

Yan, Dongrei; Li, Xiaolei; Zhang, Yong; Yang, Jianfang; Zhu, Shuangli; Wang, Dongyan; Zhang, Chuangye; Zhu, Hui; Xu, Wenbo

2015-03-01

The World Health Organization redefined the type 2 vaccine-derived poliovirus (VDPV) in 2010. To study the genetic characteristics and evolution of type 2 VDPV under this new definition, we conducted genome sequencing and analyses of type 2 VDPVs isolated from one patient with acute flaccid paralysis in Shanxi province (China) in 2014. Nucleotide sequencing revealed that the full-length of type 2 VDPV is 7439 bases encoding 2207 amino acids with no insertion or deletion of nucleotides compared with Sabin2. One nucleotide substitution identified as a key determinant of the attenuated phenotype of the Sabin 2 strain (A-G reversion at nucleotide nt 481 in the 5-end of the untranslated region) had reverted in the Shanxi type 2 VDPV. The other known key determinant of the attenuated phenotype of the Sabin 2 strain (U-->C reversion at nt2909 in the VP1 coding region that caused a Ile143Thr substitution in VP1) had not reverted in the Shanxi VDPV. The Shanxi type 2 VDPV was S2/S1 recombinant, the crossover site of which mapped to the 3-end of the 3D region (between nt 6247 and nt 6281). A phylogentic tree based on the VP1 coding region showed that evolution of the Shanxi type 2 VDPV was independent of other type 2 VDPVs detected worldwide. We estimated that the strain circulated for approximately = 11 months in the population according to the known evolution rate. The present study confirmed that the Chinese Polio Laboratory Network could discover the VDPV promptly and that it played an important part in maintenance of a polio-free China.

Effects of caffeine and adenine nucleotides on Ca2+ release by the sarcoplasmic reticulum in saponin-permeabilized frog skeletal muscle fibres

PubMed Central

Duke, Adrian M; Steele, Derek S

1998-01-01

The effect of caffeine and adenine nucleotides on the sarcoplasmic reticulum (SR) Ca2+ release mechanism was investigated in permeabilized frog skeletal muscle fibres. Caffeine was rapidly applied and the resulting release of Ca2+ from the SR detected using fura-2 fluorescence. Decreasing the [ATP] from 5 to 0.1 mm reduced the caffeine-induced Ca2+ transient by 89 ± 1.4 % (mean ± s.e.m., n = 16), while SR Ca2+ uptake was unaffected.The dependence of caffeine-induced Ca2+ release on cytosolic [ATP] was used to study the relative ability of other structurally related compounds to substitute for, or compete with, ATP at the adenine nucleotide binding site. It was found that AMP, ADP and the non-hydrolysable analogue adenylyl imidodiphosphate (AMP-PNP) partially substituted for ATP, although none was as potent in facilitating the Ca2+-releasing action of caffeine.Adenosine reversibly inhibited caffeine-induced Ca2+ release, without affecting SR Ca2+ uptake. Five millimolar adenosine markedly reduced the amplitude of the caffeine-induced Ca2+ transient by 64 ± 4 % (mean ± s.e.m., n = 11). The degree of inhibition was dependent upon the cytosolic [ATP], suggesting that adenosine may act as a competitive antagonist at the adenine nucleotide binding site.These data show that (i) the sensitivity of the in situ SR Ca2+ channel to caffeine activation is strongly dependent upon the cytosolic [ATP], (ii) the number of phosphates attached to the 5′ carbon of the ribose ring influences the efficacy of the ligand, and (iii) removal of a single phosphate group transforms AMP from a partial agonist, to adenosine, which acts as a competitive antagonist under these conditions. PMID:9782158

Effects of caffeine and adenine nucleotides on Ca2+ release by the sarcoplasmic reticulum in saponin-permeabilized frog skeletal muscle fibres.

PubMed

Duke, A M; Steele, D S

1998-11-15

1. The effect of caffeine and adenine nucleotides on the sarcoplasmic reticulum (SR) Ca2+ release mechanism was investigated in permeabilized frog skeletal muscle fibres. Caffeine was rapidly applied and the resulting release of Ca2+ from the SR detected using fura-2 fluorescence. Decreasing the [ATP] from 5 to 0.1 mM reduced the caffeine-induced Ca2+ transient by 89 +/- 1.4% (mean +/- s.e.m., n = 16), while SR Ca2+ uptake was unaffected. 2. The dependence of caffeine-induced Ca2+ release on cytosolic [ATP] was used to study the relative ability of other structurally related compounds to substitute for, or compete with, ATP at the adenine nucleotide binding site. It was found that AMP, ADP and the non-hydrolysable analogue adenylyl imidodiphosphate (AMP-PNP) partially substituted for ATP, although none was as potent in facilitating the Ca2+-releasing action of caffeine. 3. Adenosine reversibly inhibited caffeine-induced Ca2+ release, without affecting SR Ca2+ uptake. Five millimolar adenosine markedly reduced the amplitude of the caffeine-induced Ca2+ transient by 64 +/- 4% (mean +/- s.e.m., n = 11). The degree of inhibition was dependent upon the cytosolic [ATP], suggesting that adenosine may act as a competitive antagonist at the adenine nucleotide binding site. 4. These data show that (i) the sensitivity of the in situ SR Ca2+ channel to caffeine activation is strongly dependent upon the cytosolic [ATP], (ii) the number of phosphates attached to the 5' carbon of the ribose ring influences the efficacy of the ligand, and (iii) removal of a single phosphate group transforms AMP from a partial agonist, to adenosine, which acts as a competitive antagonist under these conditions.

A novel representation of the conformational structure of transfer RNAs. Correlation of the folding patterns of the polynucleotide chain with the base sequence and the nucleotide backbone torsions.

PubMed Central

Srinivasan, A R; Yathindra, N

1977-01-01

A novel description of the conformational characteristics of all the individual nucleotides and the phosphodiesters in tRNAs is presented in the form of a circular plot. This representation furnishes information of the base sequence with the folding patterns of the polynucleotide chain as one traverses along the circumference and with the individual nucleotide and phosphodiester linkage torsions along the radii. The circular plot obtained for yeast tRNAPhe strikingly distinguishes the helical and the loop regions. The variation of the different nucleotide torsions along the entire chain length and their effect on the secondary helical and tertiary loop regions become readily apparent. PMID:339206

A critical analysis of disease-associated DNA polymorphisms in the genes of cattle, goat, sheep, and pig

PubMed Central

Ibeagha-Awemu, Eveline M.; Kgwatalala, Patrick; Ibeagha, Aloysius E.

2008-01-01

Genetic variations through their effects on gene expression and protein function underlie disease susceptibility in farm animal species. The variations are in the form of single nucleotide polymorphisms, deletions/insertions of nucleotides or whole genes, gene or whole chromosomal rearrangements, gene duplications, and copy number polymorphisms or variants. They exert varying degrees of effects on gene action, such as substitution of an amino acid for another, shift in reading frame and premature termination of translation, and complete deletion of entire exon(s) or gene(s) in diseased individuals. These factors influence gene function by affecting mRNA splicing pattern or by altering/eliminating protein function. Elucidating the genetic bases of diseases under the control of many genes is very challenging, and it is compounded by several factors, including host × pathogen × environment interactions. In this review, the genetic variations that underlie several diseases of livestock (under monogenic and polygenic control) are analyzed. Also, factors hampering research efforts toward identification of genetic influences on animal disease identification and control are highlighted. A better understanding of the factors analyzed could be better harnessed to effectively identify and control, genetically, livestock diseases. Finally, genetic control of animal diseases can reduce the costs associated with diseases, improve animal welfare, and provide healthy animal products to consumers, and should be given more attention. PMID:18350334

Tyrosine phosphorylation switching of a G protein.

PubMed

Li, Bo; Tunc-Ozdemir, Meral; Urano, Daisuke; Jia, Haiyan; Werth, Emily G; Mowrey, David D; Hicks, Leslie M; Dokholyan, Nikolay V; Torres, Matthew P; Jones, Alan M

2018-03-30

Heterotrimeric G protein complexes are molecular switches relaying extracellular signals sensed by G protein-coupled receptors (GPCRs) to downstream targets in the cytoplasm, which effect cellular responses. In the plant heterotrimeric GTPase cycle, GTP hydrolysis, rather than nucleotide exchange, is the rate-limiting reaction and is accelerated by a receptor-like regulator of G signaling (RGS) protein. We hypothesized that posttranslational modification of the Gα subunit in the G protein complex regulates the RGS-dependent GTPase cycle. Our structural analyses identified an invariant phosphorylated tyrosine residue (Tyr 166 in the Arabidopsis Gα subunit AtGPA1) located in the intramolecular domain interface where nucleotide binding and hydrolysis occur. We also identified a receptor-like kinase that phosphorylates AtGPA1 in a Tyr 166 -dependent manner. Discrete molecular dynamics simulations predicted that phosphorylated Tyr 166 forms a salt bridge in this interface and potentially affects the RGS protein-accelerated GTPase cycle. Using a Tyr 166 phosphomimetic substitution, we found that the cognate RGS protein binds more tightly to the GDP-bound Gα substrate, consequently reducing its ability to accelerate GTPase activity. In conclusion, we propose that phosphorylation of Tyr 166 in AtGPA1 changes the binding pattern with AtRGS1 and thereby attenuates the steady-state rate of the GTPase cycle. We coin this newly identified mechanism "substrate phosphoswitching." © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Mutational Dynamics of Aroid Chloroplast Genomes

PubMed Central

Ahmed, Ibrar; Biggs, Patrick J.; Matthews, Peter J.; Collins, Lesley J.; Hendy, Michael D.; Lockhart, Peter J.

2012-01-01

A characteristic feature of eukaryote and prokaryote genomes is the co-occurrence of nucleotide substitution and insertion/deletion (indel) mutations. Although similar observations have also been made for chloroplast DNA, genome-wide associations have not been reported. We determined the chloroplast genome sequences for two morphotypes of taro (Colocasia esculenta; family Araceae) and compared these with four publicly available aroid chloroplast genomes. Here, we report the extent of genome-wide association between direct and inverted repeats, indels, and substitutions in these aroid chloroplast genomes. We suggest that alternative but not mutually exclusive hypotheses explain the mutational dynamics of chloroplast genome evolution. PMID:23204304

Beta-hydroxyphosphonate ribonucleoside analogues derived from 4-substituted-1,2,3-triazoles as IMP/GMP mimics: synthesis and biological evaluation

PubMed Central

Nguyen Van, Tai; Hospital, Audrey; Lionne, Corinne; Jordheim, Lars P; Dumontet, Charles; Périgaud, Christian; Chaloin, Laurent

2016-01-01

Summary A series of seventeen β-hydroxyphosphonate ribonucleoside analogues containing 4-substituted-1,2,3-triazoles was synthesized and fully characterized. Such compounds were designed as potential inhibitors of the cytosolic 5’-nucleotidase II (cN-II), an enzyme involved in the regulation of purine nucleotide pools. NMR and molecular modelling studies showed that a few derivatives adopted similar structural features to IMP or GMP. Five derivatives were identified as modest inhibitors with 53 to 64% of cN-II inhibition at 1 mM. PMID:27559400

Amino acid substitutions in the VanS sensor of the VanA-type vancomycin-resistant Enterococcus strains result in high-level vancomycin resistance and low-level teicoplanin resistance.

PubMed

Hashimoto, Y; Tanimoto, K; Ozawa, Y; Murata, T; Ike, Y

2000-04-15

The vancomycin-resistant enterococci GV1, GV2 and GV3, which were isolated from droppings from broiler farms in Japan have been characterized as VanA-type VRE, which express high-level vancomycin resistance (256 or 512 microg ml(-1), MIC) and low-level teicoplanin resistance (1 or 2 microg ml(-1), MIC). The vancomycin resistances were encoded on plasmids. The vancomycin resistance conjugative plasmid pMG2 was isolated from the GV2 strain. The VanA determinant of pMG2 showed the same genetic organization as that of the VanA genes encoded on the representative transposon Tn1546, which comprises vanRSHAXYZ. The nucleotide sequences of all the genes, except the gene related to the vanS gene on Tn1546, were completely identical to the genes encoded on Tn1546. Three amino acid substitutions in the N-terminal region of the deduced VanS were detected in the nucleotide sequence of vanS encoded on pMG2. There were also three amino acid substitutions in the vanS gene of the GV1 and GV3 strains in the same positions as in the vanS gene of pMG2. Vancomycin induced the increased teicoplanin resistance in these strains.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alexandrov, L. B.

All cancers originate from a single cell that starts to behave abnormally, to divide uncontrollably, and, eventually, to invade adjacent tissues (1). The aberrant behavior of this single cell is due to somatic mutations—changes in the genomic DNA produced by the activity of different mutational processes (1). These various mutational processes include exposure to exogenous or endogenous mutagens, abnormal DNA editing, the incomplete fidelity of DNA polymerases, and failure of DNA repair mechanisms (2). Early studies that sequenced TP53, the most commonly mutated gene in human cancer, provided evidence that mutational processes leave distinct imprints of somatic mutations on themore » genome of a cancer cell (3). For example, C:G>A:T transversions predominate in smoking-associated lung cancer, whereas C:G>T:A transitions occurring mainly at dipyrimidines and CC:GG>TT:AA double-nucleotide substitutions are common in ultraviolet light–associated skin cancers. Moreover, these patterns of mutations matched the ones induced experimentally by tobacco mutagens and ultraviolet light, respectively, the major, known, exogenous carcinogenic influences in these cancer types, and demonstrated that examining patterns of mutations in cancer genomes can yield information about the mutational processes that cause human cancer (4).« less

The western red cedar (Thuja plicata) 8-8' DIRIGENT family displays diverse expression patterns and conserved monolignol coupling specificity

NASA Technical Reports Server (NTRS)

Kim, Myoung K.; Jeon, Jae-Heung; Fujita, Masayuki; Davin, Laurence B.; Lewis, Norman G.

2002-01-01

The isolation and characterization of a multigene family of the first class of dirigent proteins (namely that mainly involved in 8-8' coupling leading to (+)-pinoresinol in this case) is reported, this comprising of nine western red cedar (Thuja plicata) DIRIGENT genes (DIR1-9) of 72-99.5% identity to each other. Their corresponding cDNA clones had coding regions for 180-183 amino acids with each having a predicted molecular mass of ca. 20 kDa including the signal peptide. Real time-PCR established that the DIRIGENT isovariants were differentially expressed during growth and development of T. plicata (P < 0.05). The phylogenetic relationships and the rates and patterns of nucleotide substitution suggest that the DIRIGENT gene may have evolved via paralogous expansion at an early stage of vascular plant diversification. Thereafter, western red cedar paralogues have maintained an high homogeneity presumably via a concerted evolutionary mode. This, in turn, is assumed to be the driving force for the differential formation of 8-8'-linked pinoresinol derived (poly)lignans in the needles, stems, bark and branches, as well as for massive accumulation of 8-8'-linked plicatic acid-derived (poly)lignans in heartwood.

Understanding the origins of human cancer

DOE PAGES

Alexandrov, L. B.

2015-12-04

All cancers originate from a single cell that starts to behave abnormally, to divide uncontrollably, and, eventually, to invade adjacent tissues (1). The aberrant behavior of this single cell is due to somatic mutations—changes in the genomic DNA produced by the activity of different mutational processes (1). These various mutational processes include exposure to exogenous or endogenous mutagens, abnormal DNA editing, the incomplete fidelity of DNA polymerases, and failure of DNA repair mechanisms (2). Early studies that sequenced TP53, the most commonly mutated gene in human cancer, provided evidence that mutational processes leave distinct imprints of somatic mutations on themore » genome of a cancer cell (3). For example, C:G>A:T transversions predominate in smoking-associated lung cancer, whereas C:G>T:A transitions occurring mainly at dipyrimidines and CC:GG>TT:AA double-nucleotide substitutions are common in ultraviolet light–associated skin cancers. Moreover, these patterns of mutations matched the ones induced experimentally by tobacco mutagens and ultraviolet light, respectively, the major, known, exogenous carcinogenic influences in these cancer types, and demonstrated that examining patterns of mutations in cancer genomes can yield information about the mutational processes that cause human cancer (4).« less

Probing the nucleotide binding domain of the osmoregulator EnvZ using fluorescent nucleotide derivatives.

PubMed

Plesniak, Leigh; Horiuchi, Yuki; Sem, Daniel; Meinenger, David; Stiles, Linda; Shaffer, Jennifer; Jennings, Patricia A; Adams, Joseph A

2002-11-26

EnvZ is a histidine protein kinase important for osmoregulation in bacteria. While structural data are available for this enzyme, the nucleotide binding pocket is not well characterized. The ATP binding domain (EnvZB) was expressed, and its ability to bind nucleotide derivatives was assessed using equilbrium and stopped-flow fluorescence spectroscopy. The fluorescence emission of the trinitrophenyl derivatives, TNP-ATP and TNP-ADP, increase upon binding to EnvZB. The fluorescence enhancements were quantitatively abolished in the presence of excess ADP, indicating that the fluorescent probes occupy the nucleotide binding pocket. Both TNP-ATP and TNP-ADP bind to EnvZB with high affinity (K(d) = 2-3 microM). The TNP moiety attached to the ribose ring does not impede access of the fluorescent nucleotide into the binding pocket. The association rate constant for TNP-ADP is 7 microM(-1) s(-1), a value consistent with those for natural nucleotides and the eucaryotic protein kinases. Using competition experiments, it was found that ATP and ADP bind 30- and 150-fold more poorly, respectively, than the corresponding TNP-derivatized forms. Surprisingly, the physiological metal Mg(2+) is not required for ADP binding and only enhances ATP affinity by 3-fold. Although portions of the nucleotide pocket are disordered, the recombinant enzyme is highly stable, unfolding only at temperatures in excess of 70 degrees C. The unusually high affinity of the TNP derivatives compared to the natural nucleotides suggests that hydrophobic substitutions on the ribose ring enforce an altered binding mode that may be exploited for drug design strategies.

Variation in the pattern of omissions and substitutions of grammatical morphemes in the spontaneous speech of so-called agrammatic patients.

PubMed

Miceli, G; Silveri, M C; Romani, C; Caramazza, A

1989-04-01

We describe the patterns of omissions (and substitutions) of freestanding grammatical morphemes and the patterns of substitutions of bound grammatical morphemes in 20 so-called agrammatic patients. Extreme variation was observed in the patterns of omissions and substitutions of grammatical morphemes, both in terms of the distribution of errors for different grammatical morphemes as well as in terms of the distribution of omissions versus substitutions. Results are discussed in the context of current debates concerning the possibility of a theoretically motivated distinction between the clinical categories of agrammatism and paragrammatism and, more generally, concerning the theoretical usefulness of any clinical category. The conclusion is reached that the observed heterogeneity in the production of grammatical morphemes among putatively agrammatic patients renders the clinical category of agrammatism, and by extension all other clinical categories from the classical classification scheme (e.g., Broca's aphasia, Wernicke's aphasia, and so forth) to more recent classificatory attempts (e.g., surface dyslexia, deep dysgraphia, and so forth), theoretically useless.

Identification of an HLA-B*27 variant, B*27:120, by sequence-based typing in a Taiwanese bone marrow stem cell donor.

PubMed

Yang, K L; Lin, P Y

2018-05-20

One nucleotide substitution at residue 577 of HLA-B*27:04:01 results in a novel allele, HLA-B*27:120. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Identification of a novel HLA-A*02 allele, HLA-A*02:01:01:32, in a deceased Caucasoid donor.

PubMed

Sherrill, J B; Turner, T R; Abraham, J P; Ho, C S

2018-06-19

HLA-A*02:01:01:32 differs from HLA-A*02:01:01:01 by a single nucleotide substitution (G➔A) at position 2456. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Greenberg, C.R.; Taylor, C.D.; Haworth, J.C.

The authors have discovered a single homoallelic nucleotide substitution as the putative cause of the perinatal (lethal) form of hypophosphatasia in Canadian Mennonites. Previous linkage and haplotype analysis in this population suggested that a single mutational event was responsible for this autosomal recessive form of hypophosphatasia. The mutation is a guanosine-to-adenosine substitution at nucleotide position 1177 in exon 10 of the tissue nonspecific (liver/bone/kidney) alkaline phosphatase gene. This Gly[sup 317] [yields] Asp mutation segregates exclusively with the heterozygote phenotype previously assigned by biochemical testing (maximum combined lod score of 18.24 at [theta] = 0.00). This putative disease-causing mutation has notmore » been described in controls nor in other non-Mennonite probands with both lethal and nonlethal forms of hypophosphatasia studied to date. This Gly[sup 317] [yields] Asp mutation changes a polar glycine to an acidic aspartate at amino acid position 317 within the highly conserved active site region of the 507-amino-acid polypeptide. Carrier screening for this lethal mutation in a high-risk population is now feasible. 15 refs., 2 figs.« less

Genomic changes in an attenuated genotype I Japanese encephalitis virus and comparison with virulent parental strain.

PubMed

Zhou, Yuyong; Wu, Rui; Feng, Yao; Zhao, Qin; Wen, Xintian; Huang, Xiaobo; Wen, Yiping; Yan, Qigui; Huang, Yong; Ma, Xiaoping; Han, Xinfeng; Cao, Sanjie

2018-06-01

Genotype I Japanese encephalitis virus (JEV) strain SCYA201201 was previously isolated from brain tissues of aborted piglets. In this study, we obtained an attenuated SCYA201201-0901 strain by serial passage of strain SCYA201201-1 in Syrian baby hamster kidney cells, combined with multiple plaque purifications and selection for virulence in mice. We investigated the genetic changes associated with attenuation by comparing the entire genomes of SCYA201201-0901 and SCYA201201-1. Sequence comparisons identified 14 common amino acid substitutions in the coding region, with two nucleotide point mutations in the 5'-untranslated region (UTR) and another three in the 3'-UTR, which differed between the attenuated and virulent strains. In addition, a total of 13 silent nucleotide mutations were found after attenuation. These substitutions, alone or in combination, may be responsible for the attenuated phenotype of the SCYA201201-0901 strain in mice. This information will contribute to our understanding of attenuation and of the molecular basis of virulence in genotype I strains such as SCYA201201-0901, as well as aiding the development of safer JEV vaccines.

Rare natural type 3/type 2 intertypic capsid recombinant vaccine-related poliovirus isolated from a case of acute flaccid paralysis in Brazil, 2015.

PubMed

Cassemiro, Klécia M S M; Burlandy, Fernanda M; da Silva, Edson E

2016-07-01

A natural type 3/type 2 intertypic capsid recombinant vaccine-related poliovirus was isolated from an acute flaccid paralytic case in Brazil. Genome sequencing revealed the uncommon location of the crossover site in the VP1 coding region (nucleotides 3251-3258 of Sabin 3 genome). The Sabin 2 donor sequence replaced the last 118 nt of VP1, resulting in the substitution of the complete antigenic site IIIa by PV2-specific amino acids. The low overall number of nucleotide substitutions in P1 region indicated that the predicted replication time of the isolate was about 8-9 weeks. Two of the principal determinants of attenuation in Sabin 3 genomes were mutated (U472C and C2493U), but the temperature-sensitive phenotype of the isolate was preserved. Our results support the theory that there exists a PV3/PV2 recombination hotspot site in the tail region of the VP1 capsid protein and that the recombination may occur soon after oral poliovirus vaccine administration.

Genetic and biochemical impairment of mitochondrial complex I activity in a family with Leber hereditary optic neuropathy and hereditary spastic dystonia

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Vries, D.D.; Oost, B.A. van; Went, L.N.

1996-04-01

A rare form of Leber hereditary optic neuropathy (LHON) that is associated with hereditary spastic dystonia has been studied in a large Dutch family. Neuropathy and ophthalmological lesions were present together in some family members, whereas only one type of abnormality was found in others. mtDNA mutations previously reported in LHON were not present. Sequence analysis of the protein-coding mitochondrial genes revealed two previously unreported mtDNA mutations. A heteroplasmic A{yields}G transition at nucleotide position 11696 in the ND4 gene resulted in the substitution of an isoleucine for valine at amino acid position 312. A second mutation, a homoplasmic T{yields}A transitionmore » at nucleotide position 14596 in the ND6 gene, resulted in the substitution of a methionine for the isoleucine at amino acid residue 26. Biochemical analysis of a muscle biopsy revealed a severe complex I deficiency, providing a link between these unique mtDNA mutations and this rare, complex phenotype including Leber optic neuropathy. 80 refs., 2 figs., 3 tabs.« less

Phylogenomic analyses support the position of turtles as the sister group of birds and crocodiles (Archosauria)

PubMed Central

2012-01-01

Background The morphological peculiarities of turtles have, for a long time, impeded their accurate placement in the phylogeny of amniotes. Molecular data used to address this major evolutionary question have so far been limited to a handful of markers and/or taxa. These studies have supported conflicting topologies, positioning turtles as either the sister group to all other reptiles, to lepidosaurs (tuatara, lizards and snakes), to archosaurs (birds and crocodiles), or to crocodilians. Genome-scale data have been shown to be useful in resolving other debated phylogenies, but no such adequate dataset is yet available for amniotes. Results In this study, we used next-generation sequencing to obtain seven new transcriptomes from the blood, liver, or jaws of four turtles, a caiman, a lizard, and a lungfish. We used a phylogenomic dataset based on 248 nuclear genes (187,026 nucleotide sites) for 16 vertebrate taxa to resolve the origins of turtles. Maximum likelihood and Bayesian concatenation analyses and species tree approaches performed under the most realistic models of the nucleotide and amino acid substitution processes unambiguously support turtles as a sister group to birds and crocodiles. The use of more simplistic models of nucleotide substitution for both concatenation and species tree reconstruction methods leads to the artefactual grouping of turtles and crocodiles, most likely because of substitution saturation at third codon positions. Relaxed molecular clock methods estimate the divergence between turtles and archosaurs around 255 million years ago. The most recent common ancestor of living turtles, corresponding to the split between Pleurodira and Cryptodira, is estimated to have occurred around 157 million years ago, in the Upper Jurassic period. This is a more recent estimate than previously reported, and questions the interpretation of controversial Lower Jurassic fossils as being part of the extant turtles radiation. Conclusions These results provide a phylogenetic framework and timescale with which to interpret the evolution of the peculiar morphological, developmental, and molecular features of turtles within the amniotes. PMID:22839781

Structural analysis of HLA-B40 epitopes.

PubMed

Kawaguchi, G; Kato, N; Kashiwase, K; Karaki, S; Kohsaka, T; Akaza, T; Kano, K; Takiguchi, M

1993-03-01

Two genes encoding HLA-B60 or HLA-B61 were cloned from Japanese and the exons of their genes were sequenced. One silent mutation was observed at the exon 1 between HLA-B60 (B*40012) and B*40011. Seven nucleotide substitutions were seen at the exon 3 between HLA-B61 (B*4006) and B*4002. Three substitutions at codon 95, CTC in B*4002 to TGG in B*4006, changed Leu in B*4002 to Trp in B*4006, while two substitutions at codon 97, AGC in B*4002 and ACG in B*4006, changed Ser in B*4002 to Thr in B*4006. Since B*4002 shares the epitope of alloantibodies specific for HLA-B61, two HLA-B61 subtypes are discriminated by two amino acid substitutions at residues 95 and 97. B*40012 and B*4006 differ by four amino acid substitutions on the beta sheet and five amino acid substitutions on the alpha 2 helix. Since the residues at the beta sheet seem hardly to affect the binding of alloantibody, it is suspected that the residues on the alpha 2 helix provide epitopes for alloantibodies that discriminate allospecificity between HLA-B60 and HLA-B61.

Nucleotide variation in genes invloved in wood formation in two pine species

Treesearch

David Pot; Lisa McMillan; Craig Echt; Gregoire Le Provost; Pauline Garnier-Gere; Sheree Cato; Christophe Plomion

2005-01-01

Nucleotide diversity in eight genes related to wood formation was investigated in two pine species, Pinus pinaster and P. radiata. The nucleotide diversity patterns observed and their properties were compared between the two species according to the specific characteristics of the samples analysed. A lower diversity was observed in P. radiata...

Characterization of a splicing mutation in group A xeroderma pigmentosum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Satokata, Ichiro; Tanaka, Kiyoji; Miura, Naoyuki

1990-12-01

The molecular basis of group A xeroderma pigmentosum (WP) was investigated by comparison of the nucleotide sequences of multiple clones of the XP group A complementing gene (XPAC) from a patient with group A XP with that of a normal gene. The clones showed a G {r arrow} C substitution at the 3{prime} splice acceptor site of intron 3, which altered the obligatory AG acceptor dinucleotide to AC. Nucleotide sequencing of cDNAs amplified by the polymerase chain reaction revealed that this single base substitution abolishes the canonical 3{prime} splice site, thus creating two abnormally spliced mRNA forms. The larger formmore » is identical with normal mRNA except for a dinucleotide deletion at the 5{prime} end of exon 4. This deletion results in a frameshift with premature translation termination in exon 4. The smaller form has a deletion of the entire exon 3 and the dinucleotide at the 5{prime} end of exon 4. The result of a transfection study provided additional evidence that this single base substitution is the disease-causing mutation. This single base substitution creates a new cleavage site for the restriction nuclease AlwNI. Analysis of AlwNI restriction fragment length polymorphism showed a high frequency of this mutation in Japanese patients with group A XP: 16 of 21 unrelated Japanese patients were homozygous and 4 were heterozygous for this mutation. However, 11 Caucasians and 2 Blacks with group A XP did not have this mutant allele. The polymorphic AlwNI restriction fragments are concluded to be useful for diagnosis of group A XP in Japanese subjects, including prenatal cases and carriers.« less

On the Overdispersed Molecular Clock

PubMed Central

Takahata, Naoyuki

1987-01-01

Rates of molecular evolution at some loci are more irregular than described by simple Poisson processes. Three situations under which molecular evolution would not follow simple Poisson processes are reevaluated from the viewpoint of the neutrality hypothesis: (i) concomitant or multiple substitutions in a gene, (ii) fluctuating substitution rates in time caused by coupled effects of deleterious mutations and bottlenecks, and (iii) changes in the degree of selective constraints against a gene (neutral space) caused by successive substitutions. The common underlying assumption that these causes are lineage nonspecific excludes the case where mutation rates themselves change systematically among lineages or taxonomic groups, and severely limits the extent of variation in the number of substitutions among lineages. Even under this stringent condition, however, the third hypothesis, the fluctuating neutral space model, can generate fairly large variation. This is described by a time-dependent renewal process, which does not exhibit any episodic nature of molecular evolution. It is argued that the observed elevated variances in the number of nucleotide or amino acid substitutions do not immediately call for positive Darwinian selection in molecular evolution. PMID:3596230

Host Genetic Variation Does Not Determine Spatio-Temporal Patterns of European Bat 1 Lyssavirus

PubMed Central

Picard-Meyer, Evelyne; Dellicour, Simon; Casademont, Isabelle; Kergoat, Lauriane; Lepelletier, Anthony; Dacheux, Laurent; Baele, Guy; Monchâtre-Leroy, Elodie; Cliquet, Florence; Lemey, Philippe

2017-01-01

Abstract The majority of bat rabies cases in Europe are attributed to European bat 1 lyssavirus (EBLV-1), circulating mainly in serotine bats (Eptesicus serotinus). Two subtypes have been defined (EBLV-1a and EBLV-1b), each associated with a different geographical distribution. In this study, we undertake a comprehensive sequence analysis based on 80 newly obtained EBLV-1 nearly complete genome sequences from nine European countries over a 45-year period to infer selection pressures, rates of nucleotide substitution, and evolutionary time scale of these two subtypes in Europe. Our results suggest that the current lineage of EBLV-1 arose in Europe ∼600 years ago and the virus has evolved at an estimated average substitution rate of ∼4.19×10−5 subs/site/year, which is among the lowest recorded for RNA viruses. In parallel, we investigate the genetic structure of French serotine bats at both the nuclear and mitochondrial level and find that they constitute a single genetic cluster. Furthermore, Mantel tests based on interindividual distances reveal the absence of correlation between genetic distances estimated between viruses and between host individuals. Taken together, this indicates that the genetic diversity observed in our E. serotinus samples does not account for EBLV-1a and -1b segregation and dispersal in Europe. PMID:29165566

Identification of largemouth bass virus in the introduced Northern Snakehead inhabiting the Chesapeake Bay watershed.

PubMed

Iwanowicz, L; Densmore, C; Hahn, C; McAllister, P; Odenkirk, J

2013-09-01

The Northern Snakehead Channa argus is an introduced species that now inhabits the Chesapeake Bay. During a preliminary survey for introduced pathogens possibly harbored by these fish in Virginia waters, a filterable agent was isolated from five specimens that produced cytopathic effects in BF-2 cells. Based on PCR amplification and partial sequencing of the major capsid protein (MCP), DNA polymerase (DNApol), and DNA methyltransferase (Mtase) genes, the isolates were identified as Largemouth Bass virus (LMBV). Nucleotide sequences of the MCP (492 bp) and DNApol (419 pb) genes were 100% identical to those of LMBV. The nucleotide sequence of the Mtase (206 bp) gene was 99.5% identical to that of LMBV, and the single nucleotide substitution did not lead to a predicted amino acid coding change. This is the first report of LMBV from the Northern Snakehead, and provides evidence that noncentrarchid fishes may be susceptible to this virus.

Identification of largemouth bass virus in the introduced Northern snakehead inhabiting the Cheasapeake Bay watershed

USGS Publications Warehouse

Iwanowicz, Luke R.; Densmore, Christine L.; Hahn, Cassidy M.; McAllister, Phillip; Odenkirk, John

2013-01-01

The Northern Snakehead Channa argus is an introduced species that now inhabits the Chesapeake Bay. During a preliminary survey for introduced pathogens possibly harbored by these fish in Virginia waters, a filterable agent was isolated from five specimens that produced cytopathic effects in BF-2 cells. Based on PCR amplification and partial sequencing of the major capsid protein (MCP), DNA polymerase (DNApol), and DNA methyltransferase (Mtase) genes, the isolates were identified as Largemouth Bass virus (LMBV). Nucleotide sequences of the MCP (492 bp) and DNApol (419 pb) genes were 100% identical to those of LMBV. The nucleotide sequence of the Mtase (206 bp) gene was 99.5% identical to that of LMBV, and the single nucleotide substitution did not lead to a predicted amino acid coding change. This is the first report of LMBV from the Northern Snakehead, and provides evidence that noncentrarchid fishes may be susceptible to this virus.

Exonuclease mutations in DNA polymerase epsilon reveal replication strand specific mutation patterns and human origins of replication

PubMed Central

Shinbrot, Eve; Henninger, Erin E.; Weinhold, Nils; Covington, Kyle R.; Göksenin, A. Yasemin; Schultz, Nikolaus; Chao, Hsu; Doddapaneni, HarshaVardhan; Muzny, Donna M.; Gibbs, Richard A.; Sander, Chris; Pursell, Zachary F.

2014-01-01

Tumors with somatic mutations in the proofreading exonuclease domain of DNA polymerase epsilon (POLE-exo*) exhibit a novel mutator phenotype, with markedly elevated TCT→TAT and TCG→TTG mutations and overall mutation frequencies often exceeding 100 mutations/Mb. Here, we identify POLE-exo* tumors in numerous cancers and classify them into two groups, A and B, according to their mutational properties. Group A mutants are found only in POLE, whereas Group B mutants are found in POLE and POLD1 and appear to be nonfunctional. In Group A, cell-free polymerase assays confirm that mutations in the exonuclease domain result in high mutation frequencies with a preference for C→A mutation. We describe the patterns of amino acid substitutions caused by POLE-exo* and compare them to other tumor types. The nucleotide preference of POLE-exo* leads to increased frequencies of recurrent nonsense mutations in key tumor suppressors such as TP53, ATM, and PIK3R1. We further demonstrate that strand-specific mutation patterns arise from some of these POLE-exo* mutants during genome duplication. This is the first direct proof of leading strand-specific replication by human POLE, which has only been demonstrated in yeast so far. Taken together, the extremely high mutation frequency and strand specificity of mutations provide a unique identifier of eukaryotic origins of replication. PMID:25228659

Ciliate telomerase RNA loop IV nucleotides promote hierarchical RNP assembly and holoenzyme stability.

PubMed

Robart, Aaron R; O'Connor, Catherine M; Collins, Kathleen

2010-03-01

Telomerase adds simple-sequence repeats to chromosome 3' ends to compensate for the loss of repeats with each round of genome replication. To accomplish this de novo DNA synthesis, telomerase uses a template within its integral RNA component. In addition to providing the template, the telomerase RNA subunit (TER) also harbors nontemplate motifs that contribute to the specialized telomerase catalytic cycle of reiterative repeat synthesis. Most nontemplate TER motifs function through linkage with the template, but in ciliate and vertebrate telomerases, a stem-loop motif binds telomerase reverse transcriptase (TERT) and reconstitutes full activity of the minimal recombinant TERT+TER RNP, even when physically separated from the template. Here, we resolve the functional requirements for this motif of ciliate TER in physiological RNP context using the Tetrahymena thermophila p65-TER-TERT core RNP reconstituted in vitro and the holoenzyme reconstituted in vivo. Contrary to expectation based on assays of the minimal recombinant RNP, we find that none of a panel of individual loop IV nucleotide substitutions impacts the profile of telomerase product synthesis when reconstituted as physiological core RNP or holoenzyme RNP. However, loop IV nucleotide substitutions do variably reduce assembly of TERT with the p65-TER complex in vitro and reduce the accumulation and stability of telomerase RNP in endogenous holoenzyme context. Our results point to a unifying model of a conformational activation role for this TER motif in the telomerase RNP enzyme.

A molecular study of a family with Greek hereditary persistence of fetal hemoglobin and beta-thalassemia.

PubMed Central

Giglioni, B; Casini, C; Mantovani, R; Merli, S; Comi, P; Ottolenghi, S; Saglio, G; Camaschella, C; Mazza, U

1984-01-01

A family was studied in which two inherited defects of the non-alpha-globin cluster segregate: Greek hereditary persistence of fetal hemoglobin (HPFH) and beta-thalassemia. Fragments of the non-alpha-globin cluster from two patients were cloned in cosmid and phage lambda vectors, and assigned to either the HPFH or beta-thalassemic chromosome on the basis of the demonstration of a polymorphic BglII site in the HPFH gamma-globin cluster. The thalassemic beta-globin gene carries a mutation at nucleotide 1 of the intervening sequence I, known to cause beta zero-thalassemia; the beta-globin gene from the HPFH chromosome is entirely normal, both in the intron-exon sequence and in 5' flanking regions required for transcription. As the compound HPFH/beta-thalassemia heterozygote synthesizes HbA, these data prove that the HPFH beta-globin gene is functional, although at a decreased rate; its lower activity is likely to be due to a distant mutation. The HPFH A gamma-globin gene shows only two mutations: a T----C substitution in the large intervening sequence (responsible for the BglII polymorphic site) and a C----T substitution 196 nucleotides 5' to the cap site; the 5' flanking sequence is normal up to -1350 nucleotides upstream from the gene. Circumstantial evidence suggests that the mutation at -196 may be responsible for the abnormally high expression of the A gamma-globin gene. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. PMID:6210198

Insecticide-driven patterns of genetic variation in the dengue vector Aedes aegypti in Martinique Island.

PubMed

Marcombe, Sébastien; Paris, Margot; Paupy, Christophe; Bringuier, Charline; Yebakima, André; Chandre, Fabrice; David, Jean-Philippe; Corbel, Vincent; Despres, Laurence

2013-01-01

Effective vector control is currently challenged worldwide by the evolution of resistance to all classes of chemical insecticides in mosquitoes. In Martinique, populations of the dengue vector Aedes aegypti have been intensively treated with temephos and deltamethrin insecticides over the last fifty years, resulting in heterogeneous levels of resistance across the island. Resistance spreading depends on standing genetic variation, selection intensity and gene flow among populations. To determine gene flow intensity, we first investigated neutral patterns of genetic variability in sixteen populations representative of the many environments found in Martinique and experiencing various levels of insecticide pressure, using 6 microsatellites. Allelic richness was lower in populations resistant to deltamethrin, and consanguinity was higher in populations resistant to temephos, consistent with a negative effect of insecticide pressure on neutral genetic diversity. The global genetic differentiation was low, suggesting high gene flow among populations, but significant structure was found, with a pattern of isolation-by-distance at the global scale. Then, we investigated adaptive patterns of divergence in six out of the 16 populations using 319 single nucleotide polymorphisms (SNPs). Five SNP outliers displaying levels of genetic differentiation out of neutral expectations were detected, including the kdr-V1016I mutation in the voltage-gated sodium channel gene. Association tests revealed a total of seven SNPs associated with deltamethrin resistance. Six other SNPs were associated with temephos resistance, including two non-synonymous substitutions in an alkaline phosphatase and in a sulfotransferase respectively. Altogether, both neutral and adaptive patterns of genetic variation in mosquito populations appear to be largely driven by insecticide pressure in Martinique.

Using of methods of speckle optics for Chlamydia trachomatis typing

NASA Astrophysics Data System (ADS)

Ulyanov, Sergey S.; Zaytsev, Sergey S.; Ulianova, Onega V.; Saltykov, Yury V.; Feodorova, Valentina A.

2017-03-01

Specific method of transformation of nucleotide of gene into speckle pattern is suggested. Reference speckle pattern of omp1 gene of typical wild strains of Chlamydia trachomatis of genovars D, E, F, G, J and K and Chlamydia psittaci as well is generated. Perspectives of proposed technique in the gene identification and detection of natural genetic mutations as single nucleotide polymorphism (SNP) are demonstrated.

[Polymorphisms of inhibin α gene exon 1 in buffalo (Bubalus bubalis), gayal (Bos frontalis) and yak (Bos grunniens)].

PubMed

Miao, Yong-Wang; Ha, Fu; Gao, Hua-Shan; Yuan, Feng; Li, Da-Lin; Yuan, Yue-Yun

2012-08-01

To elucidate the genetic characteristics of the bovine Inhibin α subunit (INHA) gene, the polymorphisms in exon 1 of INHA and its bilateral sequences were assayed using PCR with direct sequencing in buffalo, gayal and yak. A comparative analysis was conducted by pooled the results in this study with the published data of INHA on some mammals including some bovine species together. A synonymous substitution c.73C>A was identified in exon 1 of INHA for buffalo, which results in identical encoding product in river and swamp buffalo. In gayal, two non-synonymous but same property substitutions in exon 1 of INHA, viz. c.62 C>T and c.187 G>A, were detected, which lead to p. P21L, p. V63M changes in INHA, respectively. In yak, nucleotide substitution c.62C> T, c.129A>G were found in exon 1 of INHA, the former still causes p. P21L substitution and the latter is synonymous. For the sequence of the 5'-flanking region of INHA examined, no SNPs were found within the species, but a substitution, c. -6T>G, was found. The nucleotide in this site in gayal, yak and cattle was c. -6G, whereas in buffalo it was c. -6T. Meanwhile, a 6-bp deletion, namely c. 262+31_262+36delTCTGAC, was found in the intron of buffalo INHA gene. For this deletion, wild types (+/+) account for main part in river buffalo while mutant types (-/-) are predominant in swamp buffalo. This deletion was not found in gayal, yak and cattle, though these all have another deletion in the intron of INHA, c. 262+78_262+79delTG. The results of sequence alignment showed that the substitutions c. 43A and c. 67G in exon 1 of INHA are specific to buffalo, whereas the substitutions c. 173A and c. 255G are exclusive to gayal, yak and cattle, and c. 24C, c. 47G, c. 174T and c. 206T are specific to goat. Furthermore, there are few differences among gayal, yak and cattle, but there relatively great differences between buffalo, goat and other bovine species regarding the sequences of INHA exon 1.

Pre-steady-state Kinetic Analysis of a Family D DNA Polymerase from Thermococcus sp. 9°N Reveals Mechanisms for Archaeal Genomic Replication and Maintenance*

PubMed Central

Schermerhorn, Kelly M.; Gardner, Andrew F.

2015-01-01

Family D DNA polymerases (polDs) have been implicated as the major replicative polymerase in archaea, excluding the Crenarchaeota branch, and bear little sequence homology to other DNA polymerase families. Here we report a detailed kinetic analysis of nucleotide incorporation and exonuclease activity for a Family D DNA polymerase from Thermococcus sp. 9°N. Pre-steady-state single-turnover nucleotide incorporation assays were performed to obtain the kinetic parameters, kpol and Kd, for correct nucleotide incorporation, incorrect nucleotide incorporation, and ribonucleotide incorporation by exonuclease-deficient polD. Correct nucleotide incorporation kinetics revealed a relatively slow maximal rate of polymerization (kpol ∼2.5 s−1) and especially tight nucleotide binding (Kd(dNTP) ∼1.7 μm), compared with DNA polymerases from Families A, B, C, X, and Y. Furthermore, pre-steady-state nucleotide incorporation assays revealed that polD prevents the incorporation of incorrect nucleotides and ribonucleotides primarily through reduced nucleotide binding affinity. Pre-steady-state single-turnover assays on wild-type 9°N polD were used to examine 3′-5′ exonuclease hydrolysis activity in the presence of Mg2+ and Mn2+. Interestingly, substituting Mn2+ for Mg2+ accelerated hydrolysis rates >40-fold (kexo ≥110 s−1 versus ≥2.5 s−1). Preference for Mn2+ over Mg2+ in exonuclease hydrolysis activity is a property unique to the polD family. The kinetic assays performed in this work provide critical insight into the mechanisms that polD employs to accurately and efficiently replicate the archaeal genome. Furthermore, despite the unique properties of polD, this work suggests that a conserved polymerase kinetic pathway is present in all known DNA polymerase families. PMID:26160179

Nucleobase but not Sugar Fidelity is Maintained in the Sabin I RNA-Dependent RNA Polymerase.

PubMed

Liu, Xinran; Musser, Derek M; Lee, Cheri A; Yang, Xiaorong; Arnold, Jamie J; Cameron, Craig E; Boehr, David D

2015-10-26

The Sabin I poliovirus live, attenuated vaccine strain encodes for four amino acid changes (i.e., D53N, Y73H, K250E, and T362I) in the RNA-dependent RNA polymerase (RdRp). We have previously shown that the T362I substitution leads to a lower fidelity RdRp, and viruses encoding this variant are attenuated in a mouse model of poliovirus. Given these results, it was surprising that the nucleotide incorporation rate and nucleobase fidelity of the Sabin I RdRp is similar to that of wild-type enzyme, although the Sabin I RdRp is less selective against nucleotides with modified sugar groups. We suggest that the other Sabin amino acid changes (i.e., D53N, Y73H, K250E) help to re-establish nucleotide incorporation rates and nucleotide discrimination near wild-type levels, which may be a requirement for the propagation of the virus and its efficacy as a vaccine strain. These results also suggest that the nucleobase fidelity of the Sabin I RdRp likely does not contribute to viral attenuation.

Inhibition of Glucuronokinase by Substrate Analogs 1

PubMed Central

Gillard, Douglas F.; Dickinson, David B.

1978-01-01

Glucuronokinase from Lilium longiflorum pollen was purified 30- to 40- fold on a blue dextran-Sepharose column. Substrate analogs were tested for inhibitory effects, and nucleotide substrate specificity of the enzyme was determined. Nine nucleotides were tested, and all were inhibitory when the substrate was ATP. ADP was competitive with ATP and had a Ki value of 0.23 mm. None of the other nucleotide triphosphates could effectively substitute for ATP as a nucleotide substrate. Ten mm dATP and ITP reacted only 3% as rapidly as 10 mm ATP, while the rates for 10 mm GTP, CTP, UTP, and TTP were less than 1%. The glucuronic acid analogs, methyl α-glucuronoside, methyl β-glucuronoside, β-glucuronic acid-1-phosphate, and 4-O-methylglucuronic acid were tested as possible enzyme inhibitors. The three methyl derivatives showed little or no inhibition. The β-glucuronic acid-1-phosphate was inhibitory, with 50% inhibition obtained at 1 to 3 mm depending on the concentration of the glucuronic acid. It is concluded that the glucuronic acid-binding site on the enzyme is highly selective. PMID:16660589

Conserved intergenic sequences revealed by CTAG-profiling in Salmonella: thermodynamic modeling for function prediction

NASA Astrophysics Data System (ADS)

Tang, Le; Zhu, Songling; Mastriani, Emilio; Fang, Xin; Zhou, Yu-Jie; Li, Yong-Guo; Johnston, Randal N.; Guo, Zheng; Liu, Gui-Rong; Liu, Shu-Lin

2017-03-01

Highly conserved short sequences help identify functional genomic regions and facilitate genomic annotation. We used Salmonella as the model to search the genome for evolutionarily conserved regions and focused on the tetranucleotide sequence CTAG for its potentially important functions. In Salmonella, CTAG is highly conserved across the lineages and large numbers of CTAG-containing short sequences fall in intergenic regions, strongly indicating their biological importance. Computer modeling demonstrated stable stem-loop structures in some of the CTAG-containing intergenic regions, and substitution of a nucleotide of the CTAG sequence would radically rearrange the free energy and disrupt the structure. The postulated degeneration of CTAG takes distinct patterns among Salmonella lineages and provides novel information about genomic divergence and evolution of these bacterial pathogens. Comparison of the vertically and horizontally transmitted genomic segments showed different CTAG distribution landscapes, with the genome amelioration process to remove CTAG taking place inward from both terminals of the horizontally acquired segment.

Identification of a synonymous polymorphism within the cytochrome P4502C9 gene that interferes with identification of the CYP2C9*2 allele.

PubMed

Womack, Edward P; Reynolds, Kristen K; Valdes, Roland; Linder, Mark W

2007-10-01

Cytochrome P450 2C9 (CYP4502C9) genotyping is useful in dosage adjustments for several critical drug therapies, including warfarin. Potential interference compromising these genotyping results could lead to inappropriate dose adjustments that may result in adverse drug reactions. During routine clinical CYP4502C9 genotyping using multiplex allele-specific primer extension, an ambiguous result was obtained for determination of the CYP2C9 430C>T substitution, which defines the CYP2C9*2 allele. In this one patient sample submitted for CYP2C9 genotyping, the ratio for the variant 430T allele signal to the total signal (C+T alleles) was 0.29. This is above the expected ratio to be classified as wild-type (<0.15) and below the minimum expected ratio (>0.3) when the genotype is heterozygous at the 430 position. The mean fluorescence intensity for the 430C allele was consistent with that observed in subjects who are heterozygous at this nucleotide position. However, the corresponding signal for the 430T allele indicated the absence of the CYP2C9*2 allele. This suggests the assay was not able to determine the correct nucleotide at position 430 for one of the two alleles in this patient. Subsequent sequencing to investigate the allele-specific primer extension failure revealed the presence of a rare C>T nucleotide substitution at position 429. We tested this subject's CYP2C9 genotype using AvaII restriction endonuclease digestion and found that this rare substitution causes false-positive identification of the CYP2C9*2 allele when using this method. We developed a DpnII endonuclease digestion assay to specifically detect the CYP2C9 429C>T substitution and tested 100 randomly selected samples obtained from unrelated individuals. The 429C>T polymorphism was not identified in this sample set, which indicates an allele frequency of less than 2.0% (95% confidence interval, 0.0-1.8%) in the general population. Despite the rarity of this polymorphism, it has important implications for the accuracy of assays using allele-specific primers and the Ava II restriction endonuclease, when it occurs, which are two common methods currently applied for detecting the presence of the CYP2C9*2 allele.

Two missense mutations, E123Q and K151E, identified in the ERG11 allele of an azole-resistant isolate of Candida kefyr recovered from a stem cell transplant patient for acute myeloid leukemia

PubMed Central

Couzigou, Célia; Gabriel, Frédéric; Biteau, Nicolas; Fitton-Ouhabi, Valérie; Noël, Thierry; Accoceberry, Isabelle

2014-01-01

We report on the first cloning and nucleotide sequencing of an ERG11 allele from a clinical isolate of Candida kefyr cross-resistant to azole antifungals. It was recovered from a stem cell transplant patient, in an oncohematology unit exhibiting unexpected high prevalence of C. kefyr. Two amino acid substitutions were identified: K151E, whose role in fluconazole resistance was already demonstrated in Candida albicans, and E123Q, a new substitution never described so far in azole-resistant Candida yeast. PMID:24936404

Two missense mutations, E123Q and K151E, identified in the ERG11 allele of an azole-resistant isolate of Candida kefyr recovered from a stem cell transplant patient for acute myeloid leukemia.

PubMed

Couzigou, Célia; Gabriel, Frédéric; Biteau, Nicolas; Fitton-Ouhabi, Valérie; Noël, Thierry; Accoceberry, Isabelle

2014-07-01

We report on the first cloning and nucleotide sequencing of an ERG11 allele from a clinical isolate of Candida kefyr cross-resistant to azole antifungals. It was recovered from a stem cell transplant patient, in an oncohematology unit exhibiting unexpected high prevalence of C. kefyr. Two amino acid substitutions were identified: K151E, whose role in fluconazole resistance was already demonstrated in Candida albicans, and E123Q, a new substitution never described so far in azole-resistant Candida yeast.

The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

NASA Astrophysics Data System (ADS)

Štambuk, Nikola

The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

A stochastic evolution model for residue Insertion-Deletion Independent from Substitution.

PubMed

Lèbre, Sophie; Michel, Christian J

2010-12-01

We develop here a new class of stochastic models of gene evolution based on residue Insertion-Deletion Independent from Substitution (IDIS). Indeed, in contrast to all existing evolution models, insertions and deletions are modeled here by a concept in population dynamics. Therefore, they are not only independent from each other, but also independent from the substitution process. After a separate stochastic analysis of the substitution and the insertion-deletion processes, we obtain a matrix differential equation combining these two processes defining the IDIS model. By deriving a general solution, we give an analytical expression of the residue occurrence probability at evolution time t as a function of a substitution rate matrix, an insertion rate vector, a deletion rate and an initial residue probability vector. Various mathematical properties of the IDIS model in relation with time t are derived: time scale, time step, time inversion and sequence length. Particular expressions of the nucleotide occurrence probability at time t are given for classical substitution rate matrices in various biological contexts: equal insertion rate, insertion-deletion only and substitution only. All these expressions can be directly used for biological evolutionary applications. The IDIS model shows a strongly different stochastic behavior from the classical substitution only model when compared on a gene dataset. Indeed, by considering three processes of residue insertion, deletion and substitution independently from each other, it allows a more realistic representation of gene evolution and opens new directions and applications in this research field. Copyright © 2010 Elsevier Ltd. All rights reserved.

Optimization of algorithm of coding of genetic information of Chlamydia

NASA Astrophysics Data System (ADS)

Feodorova, Valentina A.; Ulyanov, Sergey S.; Zaytsev, Sergey S.; Saltykov, Yury V.; Ulianova, Onega V.

2018-04-01

New method of coding of genetic information using coherent optical fields is developed. Universal technique of transformation of nucleotide sequences of bacterial gene into laser speckle pattern is suggested. Reference speckle patterns of the nucleotide sequences of omp1 gene of typical wild strains of Chlamydia trachomatis of genovars D, E, F, G, J and K and Chlamydia psittaci serovar I as well are generated. Algorithm of coding of gene information into speckle pattern is optimized. Fully developed speckles with Gaussian statistics for gene-based speckles have been used as criterion of optimization.

Identification of four novel mutations in the COL4A5 gene of patients with Alport syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lemmink, H.H.; Schroeder, C.H.; Brunner, H.G.

1993-08-01

The type IV collagen [alpha]5 chain (COL4A5) genes of patients with Alport syndrome were tested for major gene rearrangements by Southern blot analysis, using COL4A5 cDNA clones as probes. In addition, individual exons were screened for small mutations by single-strand conformation polymorphism (SSCP) analysis. Four new COL4A5 mutations were detected. A duplication of the nine most 3[prime] located nucleotides of exon 49 and the first nucleotide of intron 49 was identified in the COL4A5 gene of one patient. Two patients displayed single base substitutions leading to, respectively, a proline to threonine and an arginine to glutamine substitution in the C-terminalmore » end. Both substitutions involve amino acids conserved through evolution. In COL4A5 intron 41 a mutation changing the splice acceptor site from AG to AA was identified. All mutations cosegregate with the clinical phenotype of Alport syndrome in affected family members. In a control population of 50 individuals tested by PCR-SSCP these mutations were never identified. Together with two mutations reported previously, a total of six mutations were found in 26 patients with Alport syndrome (23%) after systematic screening of about 30% of the COL4A5 coding region. The clinical features of these six patients are described in detail. 21 refs., 2 figs., 3 tabs.« less

Influence of genome-scale RNA structure disruption on the replication of murine norovirus—similar replication kinetics in cell culture but attenuation of viral fitness in vivo

PubMed Central

McFadden, Nora; Arias, Armando; Dry, Inga; Bailey, Dalan; Witteveldt, Jeroen; Evans, David J.; Goodfellow, Ian; Simmonds, Peter

2013-01-01

Mechanisms by which certain RNA viruses, such as hepatitis C virus, establish persistent infections and cause chronic disease are of fundamental importance in viral pathogenesis. Mammalian positive-stranded RNA viruses establishing persistence typically possess genome-scale ordered RNA secondary structure (GORS) in their genomes. Murine norovirus (MNV) persists in immunocompetent mice and provides an experimental model to functionally characterize GORS. Substitution mutants were constructed with coding sequences in NS3/4- and NS6/7-coding regions replaced with sequences with identical coding and (di-)nucleotide composition but disrupted RNA secondary structure (F1, F2, F1/F2 mutants). Mutants replicated with similar kinetics to wild-type (WT) MNV3 in RAW264.7 cells and primary macrophages, exhibited similar (highly restricted) induction and susceptibility to interferon-coupled cellular responses and equal replication fitness by serial passaging of co-cultures. In vivo, both WT and F1/F2 mutant viruses persistently infected mice, although F1, F2 and F1/F2 mutant viruses were rapidly eliminated 1–7 days post-inoculation in competition experiments with WT. F1/F2 mutants recovered from tissues at 9 months showed higher synonymous substitution rates than WT and nucleotide substitutions that potentially restored of RNA secondary structure. GORS plays no role in basic replication of MNV but potentially contributes to viral fitness and persistence in vivo. PMID:23630317

Diversity of genetic events associated with MLH1 promoter methylation in Lynch syndrome families with heritable constitutional epimutation.

PubMed

Leclerc, Julie; Flament, Cathy; Lovecchio, Tonio; Delattre, Lucie; Ait Yahya, Emilie; Baert-Desurmont, Stéphanie; Burnichon, Nelly; Bronner, Myriam; Cabaret, Odile; Lejeune, Sophie; Guimbaud, Rosine; Morin, Gilles; Mauillon, Jacques; Jonveaux, Philippe; Laurent-Puig, Pierre; Frébourg, Thierry; Porchet, Nicole; Buisine, Marie-Pierre

2018-04-12

PurposeConstitutional epimutations are an alternative to genetic mutations in the etiology of genetic diseases. Some of these epimutations, termed secondary, correspond to the epigenetic effects of cis-acting genetic defects transmitted to the offspring following a Mendelian inheritance pattern. In Lynch syndrome, a few families with such apparently heritable MLH1 epimutations have been reported so far.MethodsWe designed a long-range polymerase chain reaction next-generation sequencing strategy to screen MLH1 entire gene and applied it to 4 French families with heritable epimutations and 10 additional patients with no proven transmission of their epimutations.ResultsThis strategy successfully detected the insertion of an Alu element in MLH1 coding sequence in one family. Two previously unreported MLH1 variants were also identified in other epimutation carriers: a nucleotide substitution within intron 1 and a single-nucleotide deletion in the 5'-UTR. Detection of a partial MLH1 duplication in another family required multiplex ligation-dependent probe amplification technology. We demonstrated the segregation of these variants with MLH1 methylation and studied the functional consequences of these defects on transcription.ConclusionThis is the largest cohort of patients with MLH1 secondary epimutations associated with a broad spectrum of genetic defects. This study provides further insight into the complexity of molecular mechanisms leading to secondary epimutations.GENETICS in MEDICINE advance online publication, 12 April 2018; doi:10.1038/gim.2018.47.

Genetic and immunological comparison of the cladoceran parasite Pasteuria ramosa with the nematode parasite Pasteuria penetrans.

PubMed

Schmidt, Liesbeth M; Mouton, Laurence; Nong, Guang; Ebert, Dieter; Preston, James F

2008-01-01

Pasteuria penetrans, an obligate endospore-forming parasite of Meloidogyne spp. (root knot nematodes), has been identified as a promising agent for biocontrol of these destructive agricultural crop pests. Pasteuria ramosa, an obligate parasite of water fleas (Daphnia spp.), has been shown to modulate cladoceran populations in natural ecosystems. Selected sporulation genes and an epitope associated with the spore envelope of these related species were compared. The sigE and spoIIAA/spoIIAB genes differentiate the two species to a greater extent than 16S rRNA and may serve as probes to differentiate the species. Single-nucleotide variations were observed in several conserved genes of five distinct populations of P. ramosa, and while most of these variations are silent single-nucleotide polymorphisms, a few result in conservative amino acid substitutions. A monoclonal antibody directed against an adhesin epitope present on P. penetrans P20 endospores, previously determined to be specific for Pasteuria spp. associated with several phytopathogenic nematodes, also detects an epitope associated with P. ramosa endospores. Immunoblotting provided patterns that differentiate P. ramosa from other Pasteuria spp. This monoclonal antibody thus provides a probe with which to detect and discriminate endospores of different Pasteuria spp. The presence of a shared adhesin epitope in two species with such ecologically distant hosts suggests that there is an ancient and ecologically significant recognition process in these endospore-forming bacilli that contributes to the virulence of both species in their respective hosts.

Genetic and Immunological Comparison of the Cladoceran Parasite Pasteuria ramosa with the Nematode Parasite Pasteuria penetrans▿

PubMed Central

Schmidt, Liesbeth M.; Mouton, Laurence; Nong, Guang; Ebert, Dieter; Preston, James F.

2008-01-01

Pasteuria penetrans, an obligate endospore-forming parasite of Meloidogyne spp. (root knot nematodes), has been identified as a promising agent for biocontrol of these destructive agricultural crop pests. Pasteuria ramosa, an obligate parasite of water fleas (Daphnia spp.), has been shown to modulate cladoceran populations in natural ecosystems. Selected sporulation genes and an epitope associated with the spore envelope of these related species were compared. The sigE and spoIIAA/spoIIAB genes differentiate the two species to a greater extent than 16S rRNA and may serve as probes to differentiate the species. Single-nucleotide variations were observed in several conserved genes of five distinct populations of P. ramosa, and while most of these variations are silent single-nucleotide polymorphisms, a few result in conservative amino acid substitutions. A monoclonal antibody directed against an adhesin epitope present on P. penetrans P20 endospores, previously determined to be specific for Pasteuria spp. associated with several phytopathogenic nematodes, also detects an epitope associated with P. ramosa endospores. Immunoblotting provided patterns that differentiate P. ramosa from other Pasteuria spp. This monoclonal antibody thus provides a probe with which to detect and discriminate endospores of different Pasteuria spp. The presence of a shared adhesin epitope in two species with such ecologically distant hosts suggests that there is an ancient and ecologically significant recognition process in these endospore-forming bacilli that contributes to the virulence of both species in their respective hosts. PMID:17933927

Determination of multiple-clone infection at allelic dimorphism site of Plasmodium vivax merozoite surface protein-1 in the Republic of Korea by pyrosequencing assay.

PubMed

Dinzouna-Boutamba, Sylvatrie-Danne; Lee, Sanghyun; Son, Ui-Han; Yun, Hae Soo; Joo, So-Young; Jeong, Sookwan; Rhee, Man Hee; Kwak, Dongmi; Xuan, Xuenan; Hong, Yeonchul; Chung, Dong-Il; Goo, Youn-Kyoung

2017-12-01

Allelic diversity leading to multiple gene polymorphisms of vivax malaria parasites has been shown to greatly contribute to antigenic variation and drug resistance, increasing the potential for multiple-clone infections within the host. Therefore, to identify multiple-clone infections and the predominant haplotype of Plasmodium vivax in a South Korean population, P. vivax merozoite surface protein-1 (PvMSP-1) was analyzed by pyrosequencing. Pyrosequencing of 156 vivax malaria-infected samples yielded 97 (62.18%) output pyrograms showing two main types of peak patterns of the dimorphic allele for threonine and alanine (T1476A). Most of the samples evaluated (88.66%) carried multiple-clone infections (wild- and mutant-types), whereas 11.34% of the same population carried only the mutant-type (1476A). In addition, each allele showed a high frequency of guanine (G) base substitution at both the first and third positions (86.07% and 81.13%, respectively) of the nucleotide combinations. Pyrosequencing of the PvMSP-1 42-kDa fragment revealed a heterogeneous parasite population, with the mutant-type dominant compared to the wild-type. Understanding the genetic diversity and multiple-clone infection rates may lead to improvements in vivax malaria prevention and strategic control plans. Further studies are needed to improve the efficacy of the pyrosequencing assay with large sample sizes and additional nucleotide positions. Copyright © 2017 Elsevier B.V. All rights reserved.

Resurrection of Indian Ocean humbug damselfish, Dascyllus abudafur (Forsskål) from synonymy with its Pacific Ocean sibling, Dascyllus aruanus (L.).

PubMed

Borsa, Philippe; Sembiring, Andrianus; Fauvelot, Cécile; Chen, Wei-Jen

2014-12-01

Previous phylogeographic studies of the humbug damselfish, a widespread Indo-West Pacific coral reef fish, have revealed a split of two main mitochondrial lineages distributed on either side of the Indo-Pacific barrier. This has been interpreted as the result of vicariance. It has been hypothesized that reproductive barriers might currently limit gene flow between humbug damselfish populations from the Indian Ocean and the Pacific Ocean. In this study, we review the published phylogeographic information to update the distribution of the two main mitochondrial lineages of humbug damselfish. The Indian lineage was distributed from the Red Sea to the eastern extremity of the Sunda Shelf while the Pacific lineage, which diverged from the former by 0.6% net nucleotide divergence and diagnostic substitutions at three nucleotide sites at the cytochrome b locus, was distributed east and north of the Sunda Shelf. The two forms, which are also genetically distinct at nuclear loci, were also characterized by distinct pigmentation patterns. We argue that the two forms represent geminate species. Epithet aruanus Linnaeus is maintained for the Pacific Ocean humbug damselfish while epithet abudafur (Forsskål) is here resurrected for the Indian Ocean humbug damselfish. Future studies should focus on the population genetic structure of the transition zone between Dascyllus abudafur and D. aruanus. Copyright © 2014 Académie des sciences. Published by Elsevier SAS. All rights reserved.

A large-scale study of the random variability of a coding sequence: a study on the CFTR gene.

PubMed

Modiano, Guido; Bombieri, Cristina; Ciminelli, Bianca Maria; Belpinati, Francesca; Giorgi, Silvia; Georges, Marie des; Scotet, Virginie; Pompei, Fiorenza; Ciccacci, Cinzia; Guittard, Caroline; Audrézet, Marie Pierre; Begnini, Angela; Toepfer, Michael; Macek, Milan; Ferec, Claude; Claustres, Mireille; Pignatti, Pier Franco

2005-02-01

Coding single nucleotide substitutions (cSNSs) have been studied on hundreds of genes using small samples (n(g) approximately 100-150 genes). In the present investigation, a large random European population sample (average n(g) approximately 1500) was studied for a single gene, the CFTR (Cystic Fibrosis Transmembrane conductance Regulator). The nonsynonymous (NS) substitutions exhibited, in accordance with previous reports, a mean probability of being polymorphic (q > 0.005), much lower than that of the synonymous (S) substitutions, but they showed a similar rate of subpolymorphic (q < 0.005) variability. This indicates that, in autosomal genes that may have harmful recessive alleles (nonduplicated genes with important functions), genetic drift overwhelms selection in the subpolymorphic range of variability, making disadvantageous alleles behave as neutral. These results imply that the majority of the subpolymorphic nonsynonymous alleles of these genes are selectively negative or even pathogenic.

Patterns of homoeologous gene expression shown by RNA sequencing in hexaploid bread wheat

PubMed Central

2014-01-01

Background Bread wheat (Triticum aestivum) has a large, complex and hexaploid genome consisting of A, B and D homoeologous chromosome sets. Therefore each wheat gene potentially exists as a trio of A, B and D homoeoloci, each of which may contribute differentially to wheat phenotypes. We describe a novel approach combining wheat cytogenetic resources (chromosome substitution ‘nullisomic-tetrasomic’ lines) with next generation deep sequencing of gene transcripts (RNA-Seq), to directly and accurately identify homoeologue-specific single nucleotide variants and quantify the relative contribution of individual homoeoloci to gene expression. Results We discover, based on a sample comprising ~5-10% of the total wheat gene content, that at least 45% of wheat genes are expressed from all three distinct homoeoloci. Most of these genes show strikingly biased expression patterns in which expression is dominated by a single homoeolocus. The remaining ~55% of wheat genes are expressed from either one or two homoeoloci only, through a combination of extensive transcriptional silencing and homoeolocus loss. Conclusions We conclude that wheat is tending towards functional diploidy, through a variety of mechanisms causing single homoeoloci to become the predominant source of gene transcripts. This discovery has profound consequences for wheat breeding and our understanding of wheat evolution. PMID:24726045

Selective role for DNMT3a in learning and memory.

PubMed

Morris, Michael J; Adachi, Megumi; Na, Elisa S; Monteggia, Lisa M

2014-11-01

Methylation of cytosine nucleotides is governed by DNA methyltransferases (DNMTs) that establish de novo DNA methylation patterns in early embryonic development (e.g., DNMT3a and DNMT3b) or maintain those patterns on hemimethylated DNA in dividing cells (e.g., DNMT1). DNMTs continue to be expressed at high levels in mature neurons, however their impact on neuronal function and behavior are unclear. To address this issue we examined DNMT1 and DNMT3a expression following associative learning. We also generated forebrain specific conditional Dnmt1 or Dnmt3a knockout mice and characterized them in learning and memory paradigms as well as for alterations in long-term potentiation (LTP) and synaptic plasticity. Here, we report that experience in an associative learning task impacts expression of Dnmt3a, but not Dnmt1, in brain areas that mediate learning of this task. We also found that Dnmt3a knockout mice, and not Dnmt1 knockouts have synaptic alterations as well as learning deficits on several associative and episodic memory tasks. These findings indicate that the de novo DNA methylating enzyme DNMT3a in postmitotic neurons is necessary for normal memory formation and its function cannot be substituted by the maintenance DNA methylating enzyme DNMT1. Copyright © 2014 Elsevier Inc. All rights reserved.

Switching Cyclic Nucleotide-Selective Activation of Cyclic Adenosine Monophosphate-Dependent Protein Kinase Holoenzyme Reveals Distinct Roles of Tandem Cyclic Nucleotide-Binding Domains.

PubMed

He, Daniel; Lorenz, Robin; Kim, Choel; Herberg, Friedrich W; Lim, Chinten James

2017-12-15

The cyclic adenosine monophosphate (cAMP)- and cyclic guanosine monophosphate (cGMP)-dependent protein kinases (PKA and PKG) are key effectors of cyclic nucleotide signaling. Both share structural features that include tandem cyclic nucleotide-binding (CNB) domains, CNB-A and CNB-B, yet their functions are separated through preferential activation by either cAMP or cGMP. Based on structural studies and modeling, key CNB contact residues have been identified for both kinases. In this study, we explored the requirements for conversion of PKA activation from cAMP-dependent to cGMP-dependent. The consequences of the residue substitutions T192R/A212T within CNB-A or G316R/A336T within CNB-B of PKA-RIα on cyclic nucleotide binding and holoenzyme activation were assessed in vitro using purified recombinant proteins, and ex vivo using RIα-deficient mouse embryonic fibroblasts genetically reconstituted with wild-type or mutant PKA-RIα. In vitro, a loss of binding and activation selectivity was observed when residues in either one of the CNB domains were mutated, while mutations in both CNB domains resulted in a complete switch of selectivity from cAMP to cGMP. The switch in selectivity was also recapitulated ex vivo, confirming their functional roles in cells. Our results highlight the importance of key cyclic nucleotide contacts within each CNB domain and suggest that these domains may have evolved from an ancestral gene product to yield two distinct cyclic nucleotide-dependent protein kinases.

Atypical radiological findings in achondroplasia with uncommon mutation of the fibroblast growth factor receptor-3 (FGFR-3) gene (Gly to Cys transition at codon 375)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishimuri, Gen; Fukushima, Yoshimitsu; Ohashi, Hirofumi

1995-11-20

The recent discovery of mutations in the FGFR-3 (fibroblast growth factor receptor-3) gene (FGFR3) as the cause of achondroplasia has provided new insight into understanding genetic diseases. It was surprising from the viewpoint of molecular genetics that most patients with achondroplasia showed the same mutation at nucleotide 1138, leading to a single amino acid substitution from glycine to arginine at codon 380 (Gly380Arg). All 39 patients examined by two groups had the Gly380Arg; 38 patients and the other demonstrated a G to A and a G to C transition at nucleotide 1138, respectively. Subsequently another group disclosed a G tomore » A transition at the same nucleotide 1138 in 21/23 patients of diverse ethnic origin, although mutations were not identified in two patients. To date, a total of 193 patients with the mutation of the G380Arg have been reported; a single patient with another mutation resulting in a substitution from glycine to cysteine at codon 375 (Gly375Cys) has been described. The presence of this common mutation is consistent with the clinical fact that achondroplastic individuals show less phenotypic variability than is unusual for autosomal dominant diseases. We encountered a Japanese boy with the Gly375Cys. His mother with achondroplasia has the same mutation. The molecular investigation of these patients was reported elsewhere. Here we report the clinical and radiological findings in this boy who demonstrated some atypical manifestations from those of typical achondroplasia. 8 refs., 1 fig.« less

Identification of nucleotides in the 5'UTR and amino acids substitutions that are essential for the infectivity of 5'UTR-NS5A recombinant of hepatitis C virus genotype 1b (strain Con1).

PubMed

Li, Jinqian; Feng, Shengjun; Liu, Xi; Guo, Mingzhe; Chen, Mingxiao; Chen, Yiyi; Rong, Liang; Xia, Jinyu; Zhou, Yuanping; Zhong, Jin; Li, Yi-Ping

2018-05-01

Genotype 1b strain Con1 represents an important reference in the study of hepatitis C virus (HCV). Here, we aimed to develop an advanced infectious Con1 recombinant. We found that previously identified mutations A1226G/F1464L/A1672S/Q1773H permitted culture adaption of Con1 Core-NS5A (C-5A) recombinant containing 5'UTR and NS5B-3'UTR from JFH1 (genotype 2a), thus acquired additional mutations L725H/F886L/D2415G. C-5A containing all seven mutations (C-5A_7m) replicated efficiently in Huh7.5 and Huh7.5.1 cells and had an increased infectivity in SEC14L2-expressing Huh7.5.1 cells. Incorporation of Con1 NS5B was deleterious to C-5A_7m, however Con1 5'UTR was permissive but attenuated the virus. Nucleotides G1, A4, and G35 primarily accounted for the viral attenuation without affecting RNA translation. C-5A_7m was inhibited dose-dependently by simeprevir and daclatasvir, and substitutions at A4, A29, A34, and G35 conferred resistance to miR-122 antagonism. The novel Con1 5'UTR-NS5A recombinant, adaptive mutations, and critical nucleotides described here will facilitate future studies of HCV culture systems and virus-host interaction. Copyright © 2018 Elsevier Inc. All rights reserved.

Two Novel HOGA1 Splicing Mutations Identified in a Chinese Patient with Primary Hyperoxaluria Type 3.

PubMed

Wang, Xinsheng; Zhao, Xiangzhong; Wang, Xiaoling; Yao, Jian; Zhang, Feifei; Lang, Yanhua; Tuffery-Giraud, Sylvie; Bottillo, Irene; Shao, Leping

2015-01-01

Twenty-six HOGA1 mutations have been reported in primary hyperoxaluria (PH) type 3 (PH3) patients with c.700 + 5G>T accounting for about 50% of the total alleles. However, PH3 has never been described in Asians. A Chinese child with early-onset nephrolithiasis was suspected of having PH. We searched for AGXT, GRHPR and HOGA1 gene mutations in this patient and his parents. All coding regions, including intron-exon boundaries, were analyzed using PCR followed by direct sequence analysis. Two heterozygous mutations not previously described in the literature about HOGA1 were identified (compound heterozygous). One mutation was a successive 2 bp substitution at the last nucleotide of exon 6 and at the first nucleotide of intron 6, respectively (c.834_834 + 1GG>TT), while the other one was a guanine to adenine substitution of the last nucleotide of exon 6 (c.834G>A). Direct sequencing analysis failed to find these mutations in 100 unrelated healthy subjects and the functional role on splicing of both variants found in this study was confirmed by a minigene assay based on the pSPL3 exon trapping vector. In addition, we found a SNP in this family (c.715G>A, p.V239I). There were no mutations detected in AGXT and GRHPR. Two novel HOGA1 mutations were identified in association with PH3. This is the first description and investigation on mutant gene analysis of PH3 in an Asian. © 2015 S. Karger AG, Basel

Comparative sequence analysis of domain I of Plasmodium falciparum apical membrane antigen 1 from Saudi Arabia and worldwide isolates.

PubMed

Al-Qahtani, Ahmed A; Abdel-Muhsin, Abdel-Muhsin A; Dajem, Saad M Bin; AlSheikh, Adel Ali H; Bohol, Marie Fe F; Al-Ahdal, Mohammed N; Putaporntip, Chaturong; Jongwutiwes, Somchai

2016-04-01

The apical membrane antigen 1 of Plasmodium falciparum (PfAMA1) plays a crucial role in erythrocyte invasion and is a target of protective antibodies. Although domain I of PfAMA1 has been considered a promising vaccine component, extensive sequence diversity in this domain could compromise an effective vaccine design. To explore the extent of sequence diversity in domain I of PfAMA1, P. falciparum-infected blood samples from Saudi Arabia collected between 2007 and 2009 were analyzed and compared with those from worldwide parasite populations. Forty-six haplotypes and a novel codon change (M190V) were found among Saudi Arabian isolates. The haplotype diversity (0.948±0.004) and nucleotide diversity (0.0191±0.0008) were comparable to those from African hyperendemic countries. Positive selection in domain I of PfAMA1 among Saudi Arabian parasite population was observed because nonsynonymous nucleotide substitutions per nonsynonymous site (dN) significantly exceeded synonymous nucleotide substitutions per synonymous site (dS) and Tajima's D and its related statistics significantly deviated from neutrality in the positive direction. Despite a relatively low prevalence of malaria in Saudi Arabia, a minimum of 17 recombination events occurred in domain I. Genetic differentiation was significant between P. falciparum in Saudi Arabia and parasites from other geographic origins. Several shared or closely related haplotypes were found among parasites from different geographic areas, suggesting that vaccine derived from multiple shared epitopes could be effective across endemic countries. Copyright © 2016 Elsevier B.V. All rights reserved.

A cell-free stock of simian-human immunodeficiency virus that causes AIDS in pig-tailed macaques has a limited number of amino acid substitutions in both SIVmac and HIV-1 regions of the genome and has offered cytotropism.

PubMed

Stephens, E B; Mukherjee, S; Sahni, M; Zhuge, W; Raghavan, R; Singh, D K; Leung, K; Atkinson, B; Li, Z; Joag, S V; Liu, Z Q; Narayan, O

1997-05-12

We have examined both the sequence changes in the LTR, gag, vif, vpr, vpx, tat, rev, vpu, env, and nef genes and the cell tropism of a cell-free stock of chimeric simian-human immunodeficiency virus (SHIV) isolated from the cerebrospinal fluid of a pig-tailed macaque (PNb) that developed AIDS. This virus (SHIVKU-1) is highly pathogenic when inoculated into other macaques. DNA sequence analysis of PCR-amplified products revealed a total of 5 nucleotide changes in the LTR while vif had 2 consensus amino acid changes. The gag, vif, and vpx had no consensus amino acid substitutions, whereas vpr had 1 consensus substitution. The tat and rev genes of the HXB2 region of SHIVKU-1 had 2 and 1 consensus amino acid changes, respectively. The vpu gene of the HXB2 region of SHIV, which originally had an ACG at the beginning of the gene, reverted to an initiation ATG codon and in addition contained a consensus amino acid substitution at position 69 of this protein. As expected, the majority of the nucleotide substitutions were found in the env and nef genes. Thirteen and 5 amino acid changes were predicted for the corresponding Env and Nef proteins, respectively. In addition, one-third of the env gene clones isolated from the SHIVKU-1 stock had a 5-amino-acid deletion in the V4 region. Using three independent assays, we determined that the changes in the SHIVKU-1 were associated with an increase in the efficiency of replication in macrophages. The strikingly few consensus changes in the virus suggest that conversion of this virus to one capable of causing AIDS in pig-tailed macaques was associated with relatively few changes in the viral envelope and/or accessory genes. These results will provide the basis for the development of a pathogenic, molecular clone of SHIV capable of causing AIDS in pig-tailed macaques.

Transcriptome sequencing of Eucalyptus camaldulensis seedlings subjected to water stress reveals functional single nucleotide polymorphisms and genes under selection

PubMed Central

2012-01-01

Background Water stress limits plant survival and production in many parts of the world. Identification of genes and alleles responding to water stress conditions is important in breeding plants better adapted to drought. Currently there are no studies examining the transcriptome wide gene and allelic expression patterns under water stress conditions. We used RNA sequencing (RNA-seq) to identify the candidate genes and alleles and to explore the evolutionary signatures of selection. Results We studied the effect of water stress on gene expression in Eucalyptus camaldulensis seedlings derived from three natural populations. We used reference-guided transcriptome mapping to study gene expression. Several genes showed differential expression between control and stress conditions. Gene ontology (GO) enrichment tests revealed up-regulation of 140 stress-related gene categories and down-regulation of 35 metabolic and cell wall organisation gene categories. More than 190,000 single nucleotide polymorphisms (SNPs) were detected and 2737 of these showed differential allelic expression. Allelic expression of 52% of these variants was correlated with differential gene expression. Signatures of selection patterns were studied by estimating the proportion of nonsynonymous to synonymous substitution rates (Ka/Ks). The average Ka/Ks ratio among the 13,719 genes was 0.39 indicating that most of the genes are under purifying selection. Among the positively selected genes (Ka/Ks > 1.5) apoptosis and cell death categories were enriched. Of the 287 positively selected genes, ninety genes showed differential expression and 27 SNPs from 17 positively selected genes showed differential allelic expression between treatments. Conclusions Correlation of allelic expression of several SNPs with total gene expression indicates that these variants may be the cis-acting variants or in linkage disequilibrium with such variants. Enrichment of apoptosis and cell death gene categories among the positively selected genes reveals the past selection pressures experienced by the populations used in this study. PMID:22853646

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

PubMed Central

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

Molecular characterization of beta-tubulin from Phakopsora pachyrhizi, the causal agent of Asian soybean rust

PubMed Central

2010-01-01

β-tubulins are structural components of microtubules and the targets of benzimidazole fungicides used to control many diseases of agricultural importance. Intron polymorphisms in the intron-rich genes of these proteins have been used in phylogeographic investigations of phytopathogenic fungi. In this work, we sequenced 2764 nucleotides of the β-tubulin gene (Pp tubB) in samples of Phakopsora pachyrhizi collected from seven soybean fields in Brazil. Pp tubB contained an open reading frame of 1341 nucleotides, including nine exons and eight introns. Exon length varied from 14 to 880 nucleotides, whereas intron length varied from 76 to 102 nucleotides. The presence of only four polymorphic sites limited the usefulness of Pp tubB for phylogeographic studies in P. pachyrhizi. The gene structures of Pp tubB and orthologous β-tubulin genes of Melampsora lini and Uromyces viciae-fabae were highly conserved. The amino acid substitutions in β-tubulin proteins associated with the onset of benzimidazole resistance in model organisms, especially at His 6 , Glu 198 and Phe 200 , were absent from the predicted sequence of the P. pachyrhizi β-tubulin protein. PMID:21637494

Nucleobase but not Sugar Fidelity is Maintained in the Sabin I RNA-Dependent RNA Polymerase

PubMed Central

Liu, Xinran; Musser, Derek M.; Lee, Cheri A.; Yang, Xiaorong; Arnold, Jamie J.; Cameron, Craig E.; Boehr, David D.

2015-01-01

The Sabin I poliovirus live, attenuated vaccine strain encodes for four amino acid changes (i.e., D53N, Y73H, K250E, and T362I) in the RNA-dependent RNA polymerase (RdRp). We have previously shown that the T362I substitution leads to a lower fidelity RdRp, and viruses encoding this variant are attenuated in a mouse model of poliovirus. Given these results, it was surprising that the nucleotide incorporation rate and nucleobase fidelity of the Sabin I RdRp is similar to that of wild-type enzyme, although the Sabin I RdRp is less selective against nucleotides with modified sugar groups. We suggest that the other Sabin amino acid changes (i.e., D53N, Y73H, K250E) help to re-establish nucleotide incorporation rates and nucleotide discrimination near wild-type levels, which may be a requirement for the propagation of the virus and its efficacy as a vaccine strain. These results also suggest that the nucleobase fidelity of the Sabin I RdRp likely does not contribute to viral attenuation. PMID:26516899

Calcium diacylglycerol guanine nucleotide exchange factor I (CalDAG-GEFI) gene mutations in a thrombopathic Simmental calf.

PubMed

Boudreaux, M K; Schmutz, S M; French, P S

2007-11-01

Simmental thrombopathia is an inherited platelet disorder that closely resembles the platelet disorders described in Basset Hounds and Eskimo Spitz dogs. Recently, two different mutations in the gene encoding calcium diacylglycerol guanine nucleotide exchange factor I (CalDAG-GEFI) were described to be associated with the Basset Hound and Spitz thrombopathia disorders, and a third distinct mutation was identified in CalDAG-GEFI in thrombopathic Landseers of European Continental Type. The gene encoding CalDAG-GEFI was sequenced using DNA obtained from normal cattle and from a thrombopathic calf studied in Canada. The affected calf was found to have a nucleotide change (c.701 T>C), which would result in the substitution of a proline for a leucine within structurally conserved region two (SCR2) of the catalytic domain of the protein. This change is likely responsible for the thrombopathic phenotype observed in Simmental cattle and underscores the critical nature of this signal transduction protein in platelets.

pH profile of the adsorption of nucleotides onto montmorillonite. I - Selected homoionic clays

NASA Technical Reports Server (NTRS)

Lawless, J. G.; Church, F. M.; Mazzurco, J.; Banin, A.; Huff, R.; Kao, J.; Cook, A.; Lowe, T.; Orenberg, J. B.; Edelson, E.

1985-01-01

The effect of pH and adsorbed ions on the adsorption of purine and pyrimidine nucleotides on montmorillonite clay was studied experimentally. The specific nucleotides examined were: 5 prime-AMP; 3-prime AMP; and 5 prime-CMP. The pH of the clay samples was adjusted to various levels in the 2-12 pH range using microliter volumes of concentrated acid (1N HCl) and base (1NHNaOH). It was found that preferential adsorption among nulceotides was dependent on the pH level and on the characteristics of the substituted metal cation and anion exchange mechanisms. Below pH 4, adsorption was attributed to cation and anion exchange mechanisms. Above pH 4, however, adsorption was attributed to the complexation mechanisms occurring between the metal cations in the clay exchange site and in the biomolecule. The possible role of homoionic clays in the concentration mechanisms of biomonomers in the prebiotic environment is discussed.

Abasic pivot substitution harnesses target specificity of RNA interference

PubMed Central

Lee, Hye-Sook; Seok, Heeyoung; Lee, Dong Ha; Ham, Juyoung; Lee, Wooje; Youm, Emilia Moonkyung; Yoo, Jin Seon; Lee, Yong-Seung; Jang, Eun-Sook; Chi, Sung Wook

2015-01-01

Gene silencing via RNA interference inadvertently represses hundreds of off-target transcripts. Because small interfering RNAs (siRNAs) can function as microRNAs, avoiding miRNA-like off-target repression is a major challenge. Functional miRNA–target interactions are known to pre-require transitional nucleation, base pairs from position 2 to the pivot (position 6). Here, by substituting nucleotide in pivot with abasic spacers, which prevent base pairing and alleviate steric hindrance, we eliminate miRNA-like off-target repression while preserving on-target activity at ∼80–100%. Specifically, miR-124 containing dSpacer pivot substitution (6pi) loses seed-mediated transcriptome-wide target interactions, repression activity and biological function, whereas other conventional modifications are ineffective. Application of 6pi allows PCSK9 siRNA to efficiently lower plasma cholesterol concentration in vivo, and abolish potentially deleterious off-target phenotypes. The smallest spacer, C3, also shows the same improvement in target specificity. Abasic pivot substitution serves as a general means to harness the specificity of siRNA experiments and therapeutic applications. PMID:26679372

The current status of REH theory. [Random Evolutionary Hits in biological molecular evolution

NASA Technical Reports Server (NTRS)

Holmquist, R.; Jukes, T. H.

1981-01-01

A response is made to the evaluation of Fitch (1980) of REH (random evolutionary hits) theory for the evolutionary divergence of proteins and nucleic acids. Correct calculations for the beta hemoglobin mRNAs of the human, mouse and rabbit in the absence and presence of selective constraints are summarized, and it is shown that the alternative evolutionary analysis of Fitch underestimates the total fixed mutations. It is further shown that the model used by Fitch to test for the completeness of the count of total base substitutions is in fact a variant of REH theory. Considerations of the variance inherent in evolutionary estimations are also presented which show the REH model to produce no more variance than other evolutionary models. In the reply, it is argued that, despite the objections raised, REH theory applied to proteins gives inaccurate estimates of total gene substitutions. It is further contended that REH theory developed for nucleic sequences suffers from problems relating to the frequency of nucleotide substitutions, the identity of the codons accepting silent and amino acid-changing substitutions, and estimate uncertainties.

[The primary structure of a vaccine strain of tobacco mosaic virus V-69].

PubMed

Shiian, A N; Mil'shina, N V; Snegireva, P B; Pukhal'skiĭ, V A

1994-12-01

A random set of cDNA fragments were synthesized on genomic RNA of TMV vaccine strain V-69, using random primers and reverse transcriptase. Following synthesis of double-stranded cDNA, they were cloned into the pUC-19 plasmid; and 28 clones were sequenced (insert size 100-500 bp). High nucleotide sequence homology of V-69 (more than 95%) was shown only with tomato strain TMV-L [1]. Sequenced clones represent 54% of the genome (50% of the replicase gene, 98% of the transport protein gene, and 60% of the coat protein gene). In this genome region, 24 base substitutions were revealed, as compared to the wild-type TMV-L sequence. Six base substitutions resulted in changes in corresponding amino acid codons. No substitutions coincided with those discovered in the related TMV vaccine strain L11A [2], while two substitutions in the replicase gene were identical to those found in TMV strain Lta1 [3], which is capable of overcoming protection in tomatoes with the resistance gene Tm-1.

Ancient hepatitis B viruses from the Bronze Age to the Medieval period.

PubMed

Mühlemann, Barbara; Jones, Terry C; Damgaard, Peter de Barros; Allentoft, Morten E; Shevnina, Irina; Logvin, Andrey; Usmanova, Emma; Panyushkina, Irina P; Boldgiv, Bazartseren; Bazartseren, Tsevel; Tashbaeva, Kadicha; Merz, Victor; Lau, Nina; Smrčka, Václav; Voyakin, Dmitry; Kitov, Egor; Epimakhov, Andrey; Pokutta, Dalia; Vicze, Magdolna; Price, T Douglas; Moiseyev, Vyacheslav; Hansen, Anders J; Orlando, Ludovic; Rasmussen, Simon; Sikora, Martin; Vinner, Lasse; Osterhaus, Albert D M E; Smith, Derek J; Glebe, Dieter; Fouchier, Ron A M; Drosten, Christian; Sjögren, Karl-Göran; Kristiansen, Kristian; Willerslev, Eske

2018-05-09

Hepatitis B virus (HBV) is a major cause of human hepatitis. There is considerable uncertainty about the timescale of its evolution and its association with humans. Here we present 12 full or partial ancient HBV genomes that are between approximately 0.8 and 4.5 thousand years old. The ancient sequences group either within or in a sister relationship with extant human or other ape HBV clades. Generally, the genome properties follow those of modern HBV. The root of the HBV tree is projected to between 8.6 and 20.9 thousand years ago, and we estimate a substitution rate of 8.04 × 10 -6 -1.51 × 10 -5 nucleotide substitutions per site per year. In several cases, the geographical locations of the ancient genotypes do not match present-day distributions. Genotypes that today are typical of Africa and Asia, and a subgenotype from India, are shown to have an early Eurasian presence. The geographical and temporal patterns that we observe in ancient and modern HBV genotypes are compatible with well-documented human migrations during the Bronze and Iron Ages 1,2 . We provide evidence for the creation of HBV genotype A via recombination, and for a long-term association of modern HBV genotypes with humans, including the discovery of a human genotype that is now extinct. These data expose a complexity of HBV evolution that is not evident when considering modern sequences alone.

DOE Office of Scientific and Technical Information (OSTI.GOV)

K Kucera; A Koblansky; L Saunders

Profilins promote actin polymerization by exchanging ADP for ATP on monomeric actin and delivering ATP-actin to growing filament barbed ends. Apicomplexan protozoa such as Toxoplasma gondii invade host cells using an actin-dependent gliding motility. Toll-like receptor (TLR) 11 generates an innate immune response upon sensing T. gondii profilin (TgPRF). The crystal structure of TgPRF reveals a parasite-specific surface motif consisting of an acidic loop, followed by a long {beta}-hairpin. A series of structure-based profilin mutants show that TLR11 recognition of the acidic loop is responsible for most of the interleukin (IL)-12 secretion response to TgPRF in peritoneal macrophages. Deletion ofmore » both the acidic loop and the {beta}-hairpin completely abrogates IL-12 secretion. Insertion of the T. gondii acidic loop and {beta}-hairpin into yeast profilin is sufficient to generate TLR11-dependent signaling. Substitution of the acidic loop in TgPRF with the homologous loop from the apicomplexan parasite Cryptosporidium parvum does not affect TLR11-dependent IL-12 secretion, while substitution with the acidic loop from Plasmodium falciparum results in reduced but significant IL-12 secretion. We conclude that the parasite-specific motif in TgPRF is the key molecular pattern recognized by TLR11. Unlike other profilins, TgPRF slows nucleotide exchange on monomeric rabbit actin and binds rabbit actin weakly. The putative TgPRF actin-binding surface includes the {beta}-hairpin and diverges widely from the actin-binding surfaces of vertebrate profilins.« less

Host Genetic Variation Does Not Determine Spatio-Temporal Patterns of European Bat 1 Lyssavirus.

PubMed

Troupin, Cécile; Picard-Meyer, Evelyne; Dellicour, Simon; Casademont, Isabelle; Kergoat, Lauriane; Lepelletier, Anthony; Dacheux, Laurent; Baele, Guy; Monchâtre-Leroy, Elodie; Cliquet, Florence; Lemey, Philippe; Bourhy, Hervé

2017-11-01

The majority of bat rabies cases in Europe are attributed to European bat 1 lyssavirus (EBLV-1), circulating mainly in serotine bats (Eptesicus serotinus). Two subtypes have been defined (EBLV-1a and EBLV-1b), each associated with a different geographical distribution. In this study, we undertake a comprehensive sequence analysis based on 80 newly obtained EBLV-1 nearly complete genome sequences from nine European countries over a 45-year period to infer selection pressures, rates of nucleotide substitution, and evolutionary time scale of these two subtypes in Europe. Our results suggest that the current lineage of EBLV-1 arose in Europe ∼600 years ago and the virus has evolved at an estimated average substitution rate of ∼4.19×10-5 subs/site/year, which is among the lowest recorded for RNA viruses. In parallel, we investigate the genetic structure of French serotine bats at both the nuclear and mitochondrial level and find that they constitute a single genetic cluster. Furthermore, Mantel tests based on interindividual distances reveal the absence of correlation between genetic distances estimated between viruses and between host individuals. Taken together, this indicates that the genetic diversity observed in our E. serotinus samples does not account for EBLV-1a and -1b segregation and dispersal in Europe. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Diversifying Selection Underlies the Origin of Allozyme Polymorphism at the Phosphoglucose Isomerase Locus in Tigriopus californicus

PubMed Central

Schoville, Sean D.; Flowers, Jonathan M.; Burton, Ronald S.

2012-01-01

The marine copepod Tigriopus californicus lives in intertidal rock pools along the Pacific coast, where it exhibits strong, temporally stable population genetic structure. Previous allozyme surveys have found high frequency private alleles among neighboring subpopulations, indicating that there is limited genetic exchange between populations. Here we evaluate the factors responsible for the diversification and maintenance of alleles at the phosphoglucose isomerase (Pgi) locus by evaluating patterns of nucleotide variation underlying previously identified allozyme polymorphism. Copepods were sampled from eleven sites throughout California and Baja California, revealing deep genetic structure among populations as well as genetic variability within populations. Evidence of recombination is limited to the sample from Pescadero and there is no support for linkage disequilibrium across the Pgi locus. Neutrality tests and codon-based models of substitution suggest the action of natural selection due to elevated non-synonymous substitutions at a small number of sites in Pgi. Two sites are identified as the charge-changing residues underlying allozyme polymorphisms in T. californicus. A reanalysis of allozyme variation at several focal populations, spanning a period of 26 years and over 200 generations, shows that Pgi alleles are maintained without notable frequency changes. Our data suggest that diversifying selection accounted for the origin of Pgi allozymes, while McDonald-Kreitman tests and the temporal stability of private allozyme alleles suggests that balancing selection may be involved in the maintenance of amino acid polymorphisms within populations. PMID:22768211

Routine HLA-B genotyping with PCR-sequence-specific oligonucleotides detects a B*52 variant (B*5206).

PubMed

Hoelsch, K; Lenggeler, I; Pfannes, W; Knabe, H; Klein, H-G; Woelpl, A

2005-05-01

A new human leukocyte antigen (HLA)-B allele was found during routine typing of samples for a German unrelated bone marrow donor registry, the "Aktion Knochenmarkspende Bayern". After first interpretation of data of two independent low-resolution sequence-specific oligonucleotide typing tests, a B*51 variant was suggested. Further analysis via sequence-based typing identified the sequence as new B*52 allele. This new allele officially assigned as B*5206 differs from HLA-B*520102 by one nucleotide exchange in exon 2. The mutation is located at nucleotide position 274, at which a cytosine is substituted by a thymine leading to an amino acid change at protein position 67 from serine (TCC) to phenylalanine (TTC).

Identification of single-nucleotide polymorphisms of the prion protein gene in sika deer (Cervus nippon laiouanus)

PubMed Central

Jeong, Hyun-Jeong; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Kim, Bo-Sook; Rho, Jung-Rae; Yoo, Mi-Hyun; Jeong, Byung-Hoon; Kim, Yong-Sun

2007-01-01

Polymorphisms of the prion protein gene (PRNP) have been detected in several cervid species. In order to confirm the genetic variations, this study examined the DNA sequences of the PRNP obtained from 33 captive sika deer (Cervus nippon laiouanus) in Korea. A total of three single-nucleotide polymorphisms (SNPs) at codons 100, 136 and 226 in the PRNP of the sika deer were identified. The polymorphic site located at codon 100 has not been reported. The SNPs detected at codons 100 and 226 induced amino acid substitutions. The SNP at codon 136 was a silent mutation that does not induce any amino acid change. The genotype and allele frequencies were determined for each of the SNPs. PMID:17679779

Ultrasensitive Genotypic Detection of Antiviral Resistance in Hepatitis B Virus Clinical Isolates▿ †

PubMed Central

Fang, Jie; Wichroski, Michael J.; Levine, Steven M.; Baldick, Carl J.; Mazzucco, Charles E.; Walsh, Ann W.; Kienzle, Bernadette K.; Rose, Ronald E.; Pokornowski, Kevin A.; Colonno, Richard J.; Tenney, Daniel J.

2009-01-01

Amino acid substitutions that confer reduced susceptibility to antivirals arise spontaneously through error-prone viral polymerases and are selected as a result of antiviral therapy. Resistance substitutions first emerge in a fraction of the circulating virus population, below the limit of detection by nucleotide sequencing of either the population or limited sets of cloned isolates. These variants can expand under drug pressure to dominate the circulating virus population. To enhance detection of these viruses in clinical samples, we established a highly sensitive quantitative, real-time allele-specific PCR assay for hepatitis B virus (HBV) DNA. Sensitivity was accomplished using a high-fidelity DNA polymerase and oligonucleotide primers containing locked nucleic acid bases. Quantitative measurement of resistant and wild-type variants was accomplished using sequence-matched standards. Detection methodology that was not reliant on hybridization probes, and assay modifications, minimized the effect of patient-specific sequence polymorphisms. The method was validated using samples from patients chronically infected with HBV through parallel sequencing of large numbers of cloned isolates. Viruses with resistance to lamivudine and other l-nucleoside analogs and entecavir, involving 17 different nucleotide substitutions, were reliably detected at levels at or below 0.1% of the total population. The method worked across HBV genotypes. Longitudinal analysis of patient samples showed earlier emergence of resistance on therapy than was seen with sequencing methodologies, including some cases of resistance that existed prior to treatment. In summary, we established and validated an ultrasensitive method for measuring resistant HBV variants in clinical specimens, which enabled earlier, quantitative measurement of resistance to therapy. PMID:19433559

Sequence diversity and molecular evolutionary rates between buffalo and cattle.

PubMed

Moaeen-ud-Din, M; Bilal, G

2015-02-01

Identification of genes of importance regarding production traits in buffalo is impaired by a paucity of genomic resources. Choice to fill this gap is to exploit data available for cow. The cross-species application of comparative genomics tools is potential gear to investigate the buffalo genome. However, this is dependent on nucleotide sequences similarity. In this study, gene diversity between buffalo and cattle was determined using 86 gene orthologues. There was approximately 3% difference in all genes in terms of nucleotide diversity and 0.267 ± 0.134 in amino acids, indicating the possibility for successfully using cross-species strategies for genomic studies. There were significantly higher non-synonymous substitutions both in cattle and buffalo; however, there was similar difference in terms of dN- dS (4.414 versus 4.745) in buffalo and cattle, respectively. Higher rate of non-synonymous substitutions at similar level in buffalo and cattle indicated a similar positive selection pressure. Results for relative rate test were assessed with the chi-squared test. There was no significance difference on unique mutations between cattle and buffalo lineages at synonymous sites. However, there was a significance difference on unique mutations for non-synonymous sites, indicating ongoing mutagenic process that generates substitutional mutation at approximately the same rate at silent sites. Moreover, despite of common ancestry, our results indicate a different divergent time among genes of cattle and buffalo. This is the first demonstration that variable rates of molecular evolution may be present within the family Bovidae. © 2014 Blackwell Verlag GmbH.

Functional characterization of naturally occurring melittin peptide isoforms in two honey bee species, Apis mellifera and Apis cerana.

PubMed

Park, Doori; Jung, Je Won; Lee, Mi Ok; Lee, Si Young; Kim, Boyun; Jin, Hye Jun; Kim, Jiyoung; Ahn, Young-Joon; Lee, Ki Won; Song, Yong Sang; Hong, Seunghun; Womack, James E; Kwon, Hyung Wook

2014-03-01

Insect-derived antimicrobial peptides (AMPs) have diverse effects on antimicrobial properties and pharmacological activities such as anti-inflammation and anticancer properties. Naturally occurring genetic polymorphism have a direct and/or indirect influence on pharmacological effect of AMPs, therefore information on single nucleotide polymorphism (SNP) occurring in natural AMPs provides an important clue to therapeutic applications. Here we identified nucleotide polymorphisms in melittin gene of honey bee populations, which is one of the potent AMP in bee venoms. We found that the novel SNP of melittin gene exists in these two honey bee species, Apis mellifera and Apis cerana. Nine polymorphisms were identified within the coding region of the melittin gene, of which one polymorphism that resulted in serine (Ser) to asparagine (Asp) substitution that can potentially effect on biological activities of melittin peptide. Serine-substituted melittin (Mel-S) showed more cytotoxic effect than asparagine-substituted melittin (Mel-N) against E. coli. Also, Mel-N and Mel-S had different inhibitory effects on the production of inflammatory factors such as IL-6 and TNF-α in BV-2 cells. Moreover, Mel-S showed stronger cytotoxic activities than Mel-N peptide against two human ovarian cancer cell lines. Using carbon nanotube-based transistor, we here characterized that Mel-S interacted with small unilamellar liposomes more strongly than Mel-N. Taken together, our present study demonstrates that there exist different characteristics of the gene frequency and the biological activities of the melittin peptide in two honey bee species, Apis mellifera and A. cerana. Copyright © 2014 Elsevier Inc. All rights reserved.

Effect of point substitutions within the minimal DNA-binding domain of xeroderma pigmentosum group A protein on interaction with DNA intermediates of nucleotide excision repair.

PubMed

Maltseva, E A; Krasikova, Y S; Naegeli, H; Lavrik, O I; Rechkunova, N I

2014-06-01

Xeroderma pigmentosum factor A (XPA) is one of the key proteins in the nucleotide excision repair (NER) process. The effects of point substitutions in the DNA-binding domain of XPA (positively charged lysine residues replaced by negatively charged glutamate residues: XPA K204E, K179E, K141E, and tandem mutant K141E/K179E) on the interaction of the protein with DNA structures modeling intermediates of the damage recognition and pre-incision stages in NER were analyzed. All these mutations decreased the affinity of the protein to DNA, the effect depending on the substitution and the DNA structure. The mutant as well as wild-type proteins bind with highest efficiency partly open damaged DNA duplex, and the affinity of the mutants to this DNA is reduced in the order: K204E > K179E > K141E = K141/179E. For all the mutants, decrease in DNA binding efficiency was more pronounced in the case of full duplex and single-stranded DNA than with bubble-DNA structure, the difference between protein affinities to different DNA structures increasing as DNA binding activity of the mutant decreased. No effect of the studied XPA mutations on the location of the protein on the partially open DNA duplex was observed using photoinduced crosslinking with 5-I-dUMP in different positions of the damaged DNA strand. These results combined with earlier published data suggest no direct correlation between DNA binding and activity in NER for these XPA mutants.

The chlorophyll-deficient golden leaf mutation in cucumber is due to a single nucleotide substitution in CsChlI for magnesium chelatase I subunit

USDA-ARS?s Scientific Manuscript database

The chlorophyll gives the green color in plants. Any mutations in chloroplhyll biosynthesis or regulation may result in colr changes. Leaf color mutants are common in higher plants, which can be used as markers in crop breeding or as a tool in understanding regulatory mechanisms in chlorophyll biosy...

Development and evaluation of 200 novel SNP assays for population genetic studies of westslope cutthroat trout and genetic identification of related taxa

Treesearch

N. R. Campbell; S. J. Amish; V. L. Prichard; K. M. McKelvey; M. K. Young; M. K. Schwartz; J. C. Garza; G. Luikart; S. R. Narum

2012-01-01

DNA sequence data were collected and screened for single nucleotide polymorphisms (SNPs) in westslope cutthroat trout (Oncorhynchus clarki lewisi) and also for substitutions that could be used to genetically discriminate rainbow trout (O. mykiss) and cutthroat trout, as well as several cutthroat trout subspecies. In total, 260 expressed sequence tag-derived loci were...

High-resolution melting (HRM) analysis as a feasible method for detecting spinal muscular atrophy via dried blood spots.

PubMed

Er, Tze-Kiong; Kan, Tzu-Min; Su, Yu-Fa; Liu, Ta-Chih; Chang, Jan-Gowth; Hung, Shih-Ya; Jong, Yuh-Jyh

2012-11-12

Spinal muscular atrophy (SMA) is a neurodegenerative disease with the leading genetic cause of infant mortality. More than 95% of patients with SMA have a homozygous disruption in the survival motor neuron1 (SMN1) gene, caused by mutation, deletion, or rearrangement. Recently, treatment in humans in the immediate postnatal period, prior to the development of weakness or very early in the course of the disease, may be effective. Therefore, our objective was to establish a feasible method for SMA screening. High-resolution melting (HRM) analysis is rapidly becoming the most important mutation-scanning methodology that allows mutation scanning and genotyping without the need for costly labeled oligonucleotides. In the current study, we aim to develop a method for identifying the substitution of single nucleotide in SMN1 exon 7 (c.840C>T) by HRM analysis. Genomic DNA was extracted from peripheral blood samples and dried blood spots obtained from 30 patients with SMA and 30 normal individuals. All results were previously confirmed by denaturing high-performance liquid chromatography (DHPLC). In order to identify the substitution of single nucleotide in SMN1 exon 7 (c.840C>T) by HRM analysis, a primer set was used in HRM analysis. At first, we failed to identify the substitution of single nucleotide in SMN1 exon 7 (c.840C>T) by HRM analysis because the homozygous CC and homozygous TT cannot be distinguished by HRM analysis. Therefore, all samples were mixed with a known SMN1/SMN2 copy number (SMN1/SMN2=0:3), which we may call driver. This strategy is used to differentiate between homozygous CC and homozygous TT. After mixing with driver, the melting profile of homozygous CC becomes heteroduplex; however, the homozygous TT remains the same in the normalized and temperature-shifted difference plots. HRM analysis can be successfully applied to screen SMA via DNA obtained from whole blood and dried blood spots. We strongly believe that HRM analysis, a high-throughput method, could be used for identifying affected infants prior to the presentation of clinical symptoms in future. Copyright © 2012 Elsevier B.V. All rights reserved.

Reconstructing the Phylogenetic History of Long-Term Effective Population Size and Life-History Traits Using Patterns of Amino Acid Replacement in Mitochondrial Genomes of Mammals and Birds

PubMed Central

Nabholz, Benoit; Lartillot, Nicolas

2013-01-01

The nearly neutral theory, which proposes that most mutations are deleterious or close to neutral, predicts that the ratio of nonsynonymous over synonymous substitution rates (dN/dS), and potentially also the ratio of radical over conservative amino acid replacement rates (Kr/Kc), are negatively correlated with effective population size. Previous empirical tests, using life-history traits (LHT) such as body-size or generation-time as proxies for population size, have been consistent with these predictions. This suggests that large-scale phylogenetic reconstructions of dN/dS or Kr/Kc might reveal interesting macroevolutionary patterns in the variation in effective population size among lineages. In this work, we further develop an integrative probabilistic framework for phylogenetic covariance analysis introduced previously, so as to estimate the correlation patterns between dN/dS, Kr/Kc, and three LHT, in mitochondrial genomes of birds and mammals. Kr/Kc displays stronger and more stable correlations with LHT than does dN/dS, which we interpret as a greater robustness of Kr/Kc, compared with dN/dS, the latter being confounded by the high saturation of the synonymous substitution rate in mitochondrial genomes. The correlation of Kr/Kc with LHT was robust when controlling for the potentially confounding effects of nucleotide compositional variation between taxa. The positive correlation of the mitochondrial Kr/Kc with LHT is compatible with previous reports, and with a nearly neutral interpretation, although alternative explanations are also possible. The Kr/Kc model was finally used for reconstructing life-history evolution in birds and mammals. This analysis suggests a fairly large-bodied ancestor in both groups. In birds, life-history evolution seems to have occurred mainly through size reduction in Neoavian birds, whereas in placental mammals, body mass evolution shows disparate trends across subclades. Altogether, our work represents a further step toward a more comprehensive phylogenetic reconstruction of the evolution of life-history and of the population-genetics environment. PMID:23711670

Comparison of Detection Rate and Mutational Pattern of Drug-Resistant Mutations Between a Large Cohort of Genotype B and Genotype C Hepatitis B Virus-Infected Patients in North China.

PubMed

Li, Xiaodong; Liu, Yan; Xin, Shaojie; Ji, Dong; You, Shaoli; Hu, Jinhua; Zhao, Jun; Wu, Jingjing; Liao, Hao; Zhang, Xin-Xin; Xu, Dongping

2017-06-01

The study aimed to investigate the association of prevalent genotypes in China (HBV/C and HBV/B) with HBV drug-resistant mutations. A total of 13,847 nucleos(t)ide analogue (NA)-treated patients with chronic HBV infection from North China were enrolled. HBV genotypes and resistant mutations were determined by direct sequencing and confirmed by clonal sequencing if necessary. HBV/B, HBV/C, and HBV/D occupied 14.3%, 84.9%, and 0.8% across the study population, respectively. NA usage had no significant difference between HBV/B- and HBV/C-infected patients. Lamivudine-resistant mutations were more frequently detected in HBV/C-infected patients, compared with HBV/B-infected patients (31.67% vs. 25.26%, p < 0.01). Adefovir- and entecavir-resistant mutation detection rates were similar, but the mutational pattern was different between the two genotypes. For adefovir-resistant mutations, HBV/C-infected patients had a higher detection rate of rtA181 V (HBV/C 5.29% vs. HBV/B 1.36%, p < 0.01) and a lower detection rate of rtN236T (2.70% vs. 6.54%, p < 0.01). For entecavir-resistant mutations, HBV/C-infected patients had a higher detection rate of rtM204 V/I+T184 substitution or S202G/C (3.66% vs. 2.16%, p < 0.01) and a lower detection rate of rtM204 V/I+M250 V/I/L substitution (0.67% vs. 1.46%, p < 0.01). Multidrug-resistant mutations (defined as coexistence of mutation to nucleoside and nucleotide analogues) were detected in 104 patients. HBV/C-infected patients had a higher detection rate of multidrug-resistant mutation than HBV/B-infected patients (0.83% vs. 0.35%, p < 0.05). The study for the first time clarified that HBV/C-infected patients had a higher risk to develop multidrug-resistant mutations, compared with HBV/B-infected patients; and HBV/C- and HBV/B-infected patients had different inclinations in the ETV-resistant mutational pattern.

Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis

PubMed Central

Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai

2010-01-01

The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817

Alternative transcription of sodium/bicarbonate transporter SLC4A7 gene enhanced by single nucleotide polymorphisms.

PubMed

Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong

2017-03-01

Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.

Molecular recognition of modified adenine nucleotides by the P2Y(1)-receptor. 1. A synthetic, biochemical, and NMR approach.

PubMed

Halbfinger, E; Major, D T; Ritzmann, M; Ubl, J; Reiser, G; Boyer, J L; Harden, K T; Fischer, B

1999-12-30

The remarkably high potencies of 2-thioether-adenine nucleotides regarding the activation of the P2Y(1)-receptor (P2Y(1)-R) in turkey erythrocyte membranes represent some of the largest substitution-promoted increases in potencies over that of a natural receptor ligand. This paper describes the investigation regarding the origin of the high potency of these P2Y(1)-R ligands over that of ATP. For this study, an integrated approach was employed combining the synthesis of new ATP analogues, their biochemical evaluation, and their SAR analysis involving NMR experiments and theoretical calculations. These experiments and calculations were performed to elucidate the conformation and to evaluate the electronic nature of the investigated P2Y(1)-R ligands. ATP analogues synthesized included derivatives where C2 or C8 positions were substituted with electron-donating groups such as ethers, thioethers, or amines. The compounds were tested for their potency to induce P2Y(1)-R-mediated activation of phospholipase C in turkey erythrocytes and Ca(2+) response in rat astrocytes. 8-Substituted ATP and AMP derivatives had little or no effect on phospholipase C or on calcium levels, whereas the corresponding 2-substituted ATP analogues potently increased the levels of inositol phosphates and ¿Ca(2+)(i). AMP analogues were ineffective except for 2-butylthio-AMP which induced a small Ca(2+) response. P2Y(1)-R activity of these compounds was demonstrated by testing these ligands also on NG108-15 neuroblastoma x glioma hybrid cells. NMR data together with theoretical calculations imply that steric, rather than electronic, effects play a major role in ligand binding to the P2Y(1)-R. Hydrophobic interactions and H-bonds of the C2 substituent appear to be important determinants of a P2Y(1)-R ligand affinity.

Molecular evolutionary rates predict both extinction and speciation in temperate angiosperm lineages

PubMed Central

2010-01-01

Background A positive relationship between diversification (i.e., speciation) and nucleotide substitution rates is commonly reported for angiosperm clades. However, the underlying cause of this relationship is often unknown because multiple intrinsic and extrinsic factors can affect the relationship, and these have confounded previous attempts infer causation. Determining which factor drives this oft-reported correlation can lend insight into the macroevolutionary process. Results Using a new database of 13 time-calibrated angiosperm phylogenies based on internal transcribed spacer (ITS) sequences, and controlling for extrinsic variables of life history and habitat, I evaluated several potential intrinsic causes of this correlation. Speciation rates (λ) and relative extinction rates (ε) were positively correlated with mean substitution rates, but were uncorrelated with substitution rate heterogeneity. It is unlikely that the positive diversification-substitution correlation is due to accelerated molecular evolution during speciation (e.g., via enhanced selection or drift), because punctuated increases in ITS rate (i.e., greater mean and variation in ITS rate for rapidly speciating clades) were not observed. Instead, fast molecular evolution likely increases speciation rate (via increased mutational variation as a substrate for selection and reproductive isolation) but also increases extinction (via mutational genetic load). Conclusions In general, these results predict that clades with higher background substitution rates may undergo successful diversification under new conditions while clades with lower substitution rates may experience decreased extinction during environmental stasis. PMID:20515493

Genetic and codon usage bias analyses of polymerase genes of equine influenza virus and its relation to evolution.

PubMed

Bera, Bidhan Ch; Virmani, Nitin; Kumar, Naveen; Anand, Taruna; Pavulraj, S; Rash, Adam; Elton, Debra; Rash, Nicola; Bhatia, Sandeep; Sood, Richa; Singh, Raj Kumar; Tripathi, Bhupendra Nath

2017-08-23

Equine influenza is a major health problem of equines worldwide. The polymerase genes of influenza virus have key roles in virus replication, transcription, transmission between hosts and pathogenesis. Hence, the comprehensive genetic and codon usage bias of polymerase genes of equine influenza virus (EIV) were analyzed to elucidate the genetic and evolutionary relationships in a novel perspective. The group - specific consensus amino acid substitutions were identified in all polymerase genes of EIVs that led to divergence of EIVs into various clades. The consistent amino acid changes were also detected in the Florida clade 2 EIVs circulating in Europe and Asia since 2007. To study the codon usage patterns, a total of 281,324 codons of polymerase genes of EIV H3N8 isolates from 1963 to 2015 were systemically analyzed. The polymerase genes of EIVs exhibit a weak codon usage bias. The ENc-GC3s and Neutrality plots indicated that natural selection is the major influencing factor of codon usage bias, and that the impact of mutation pressure is comparatively minor. The methods for estimating host imposed translation pressure suggested that the polymerase acidic (PA) gene seems to be under less translational pressure compared to polymerase basic 1 (PB1) and polymerase basic 2 (PB2) genes. The multivariate statistical analysis of polymerase genes divided EIVs into four evolutionary diverged clusters - Pre-divergent, Eurasian, Florida sub-lineage 1 and 2. Various lineage specific amino acid substitutions observed in all polymerase genes of EIVs and especially, clade 2 EIVs underwent major variations which led to the emergence of a phylogenetically distinct group of EIVs originating from Richmond/1/07. The codon usage bias was low in all the polymerase genes of EIVs that was influenced by the multiple factors such as the nucleotide compositions, mutation pressure, aromaticity and hydropathicity. However, natural selection was the major influencing factor in defining the codon usage patterns and evolution of polymerase genes of EIVs.

Direct bisulfite sequencing for examination of DNA methylation with gene and nucleotide resolution from brain tissues.

PubMed

Parrish, R Ryley; Day, Jeremy J; Lubin, Farah D

2012-07-01

DNA methylation is an epigenetic modification that is essential for the development and mature function of the central nervous system. Due to the relevance of this modification to the transcriptional control of gene expression, it is often necessary to examine changes in DNA methylation patterns with both gene and single-nucleotide resolution. Here, we describe an in-depth basic protocol for direct bisulfite sequencing of DNA isolated from brain tissue, which will permit direct assessment of methylation status at individual genes as well as individual cytosine molecules/nucleotides within a genomic region. This method yields analysis of DNA methylation patterns that is robust, accurate, and reproducible, thereby allowing insights into the role of alterations in DNA methylation in brain tissue.

Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

USDA-ARS?s Scientific Manuscript database

High-density single nucleotide polymorphism (SNP) genotyping chips are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships among individuals in populations and studying marker-trait associations in mapping experiments. We developed a genotyping array includ...

Using information content and base frequencies to distinguish mutations from genetic polymorphisms in splice junction recognition sites.

PubMed

Rogan, P K; Schneider, T D

1995-01-01

Predicting the effects of nucleotide substitutions in human splice sites has been based on analysis of consensus sequences. We used a graphic representation of sequence conservation and base frequency, the sequence logo, to demonstrate that a change in a splice acceptor of hMSH2 (a gene associated with familial nonpolyposis colon cancer) probably does not reduce splicing efficiency. This confirms a population genetic study that suggested that this substitution is a genetic polymorphism. The information theory-based sequence logo is quantitative and more sensitive than the corresponding splice acceptor consensus sequence for detection of true mutations. Information analysis may potentially be used to distinguish polymorphisms from mutations in other types of transcriptional, translational, or protein-coding motifs.

Mutation in gelsolin gene in Finnish hereditary amyloidosis

PubMed Central

1990-01-01

Familial amyloidosis, Finnish type (FAF), is an autosomal dominant form of familial amyloid polyneuropathy. The novel amyloid fibril protein found in these patients is a degradation fragment of gelsolin, an actin- binding protein. We found a mutation (adenine for guanine) at nucleotide 654 of the gelsolin gene in genomic DNA isolated from five FAF patients. This site is polymorphic since the normal allele was also present in all the patients tested. This mutation was not found in two unaffected family members and 11 normal controls. The A for G transition causes an amino acid substitution (asparagine for aspartic acid) that was found at position 15 of the amyloid protein. The mutation and consequent amino acid substitution may lead to the development of FAF. PMID:2175344

Phylogenetic and nucleotide sequence analysis of influenza A (H1N1) HA and NA genes of strains isolated from Saudi Arabia.

PubMed

Al-Qahtani, Ahmed Ali; Mubin, Muhammad; Dela Cruz, Damian M; Althawadi, Sahar Isa; Ul Rehman, Muhammad Shah Nawaz; Bohol, Marie Fe F; Al-Ahdal, Mohammed N

2017-01-30

In early 2009, a novel influenza A (H1N1) virus appeared in Mexico and rapidly disseminated worldwide. Little is known about the phylogeny and evolutionary dynamics of the H1N1 strain found in Saudi Arabia. Nucleotide sequencing and bioinformatics analyses were used to study molecular variation between the virus isolates. In this report, 72 hemagglutinin (HA) and 45 neuraminidase (NA) H1N1 virus gene sequences, isolated in 2009 from various regions of Saudi Arabia, were analyzed. Genetic characterization indicated that viruses from two different clades, 6 and 7, were circulating in the region, with clade 7, the most widely circulating H1N1 clade globally in 2009, being predominant. Sequence analysis of the HA and NA genes revealed a high degree of sequence identity with the corresponding genes from viruses circulating in the South East Asia region and with the A/California/7/2009 strain. New mutations in the HA gene of pandemic H1N1 (pH1N1) viruses, that could alter viral fitness, were identified. Relaxed-clock and Bayesian Skyline Plot analyses, based on the isolates used in this study and closely related globally representative strains, indicated marginally higher substitution rates than the type strain (5.14×10-3 and 4.18×10-3 substitutions/nucleotide/year in the HA and NA genes, respectively). The Saudi isolates were antigenically homogeneous and closely related to the prototype vaccine strain A/California/7/2009. The antigenic site of the HA gene had acquired novel mutations in some isolates, making continued monitoring of these viruses vital for the identification of potentially highly virulent and drug resistant variants.

The vestigial olfactory receptor subgenome of odontocete whales: phylogenetic congruence between gene-tree reconciliation and supermatrix methods.

PubMed

McGowen, Michael R; Clark, Clay; Gatesy, John

2008-08-01

The macroevolutionary transition of whales (cetaceans) from a terrestrial quadruped to an obligate aquatic form involved major changes in sensory abilities. Compared to terrestrial mammals, the olfactory system of baleen whales is dramatically reduced, and in toothed whales is completely absent. We sampled the olfactory receptor (OR) subgenomes of eight cetacean species from four families. A multigene tree of 115 newly characterized OR sequences from these eight species and published data for Bos taurus revealed a diverse array of class II OR paralogues in Cetacea. Evolution of the OR gene superfamily in toothed whales (Odontoceti) featured a multitude of independent pseudogenization events, supporting anatomical evidence that odontocetes have lost their olfactory sense. We explored the phylogenetic utility of OR pseudogenes in Cetacea, concentrating on delphinids (oceanic dolphins), the product of a rapid evolutionary radiation that has been difficult to resolve in previous studies of mitochondrial DNA sequences. Phylogenetic analyses of OR pseudogenes using both gene-tree reconciliation and supermatrix methods yielded fully resolved, consistently supported relationships among members of four delphinid subfamilies. Alternative minimizations of gene duplications, gene duplications plus gene losses, deep coalescence events, and nucleotide substitutions plus indels returned highly congruent phylogenetic hypotheses. Novel DNA sequence data for six single-copy nuclear loci and three mitochondrial genes (> 5000 aligned nucleotides) provided an independent test of the OR trees. Nucleotide substitutions and indels in OR pseudogenes showed a very low degree of homoplasy in comparison to mitochondrial DNA and, on average, provided more variation than single-copy nuclear DNA. Our results suggest that phylogenetic analysis of the large OR superfamily will be effective for resolving relationships within Cetacea whether supermatrix or gene-tree reconciliation procedures are used.

Interaction of influenza virus polymerase with viral RNA in the 'corkscrew' conformation.

PubMed

Flick, R; Hobom, G

1999-10-01

The influenza virus RNA (vRNA) promoter structure is known to consist of the 5'- and 3'-terminal sequences of the RNA, within very narrow boundaries of 16 and 15 nucleotides, respectively. A complete set of single nucleotide substitutions led to the previously proposed model of a binary hooked or 'corkscrew' conformation for the vRNA promoter when it interacts with the viral polymerase. This functional structure is confirmed here with a complete set of complementary double substitutions, of both the regular A:U and G:C type and also the G:U type of base-pair exchanges. The proposed structure consists of a six base-pair RNA rod in the distal element in conjunction with two stem-loop structures of two short-range base-pairs (positions 2-9; 3-8). These support an exposed tetranucleotide loop within each branch of the proximal element, in an overall oblique organization due to a central unpaired A residue at position 10 in the 5' sequence. Long-range base-pairing between the entire 5' and 3' branches, as required for an unmodified 'panhandle' model, has been excluded for the proximal element, while it is known to represent the mode of interaction within the distal element. A large number of short-range base-pair exchanges in the proximal element constitute promoter-up mutations, which show activities several times above that of the wild-type in reporter gene assays. The unique overall conformation and rather few invariant nucleotides appear to be the core elements in vRNA recognition by polymerase and also in viral ribonucleoprotein packaging, to allow discrimination against the background of other RNA molecules in the cell.

Candida potacharoeniae sp. nov. and Candida spenceri sp. nov., two novel galactose-containing ascomycetous anamorphic yeast species isolated in Thailand.

PubMed

Nakase, Takashi; Jindamorakot, Sasitorn; Imanishi, Yumi; Am-In, Somjit; Ninomiya, Shinya; Kawasaki, Hiroko; Limtong, Savitree

2010-08-01

Fifteen strains of anamorphic yeasts isolated from various natural substrates collected in various places in Thailand were found to represent two novel species of anamorphic yeast genus Candida based on the sequence analysis of the D1/D2 domain of the large subunit rRNA genes, chemotaxonomic and conventional properties used for the classification of yeasts. These strains are located in the clade including Candida etchellsii and Candida magnoliae. Fourteen strains represented by ST-490(T) (BCC 15176(T)=NBRC 106439(T)= CBS 11674(T)) are closely related to Candida sorbosivorans in the D1/D2 sequences but 11 nucleotides (2.4%) were substituted. The remaining strain, ST-594(T) (=BCC 15278(T)=NBRC 106446(T)=CBS 11673(T)) showed a close relationship to Candida geochares but 21 nucleotides (4.7%) were substituted. Apparently, these strains represent two novel Candida species of the Starmerella clade. The two species are described as Candida potacharoeniae sp. nov. and Candida spenceri sp. nov. in the present paper. Like the most species of this clade, the two species contain galactose in the cells in addition to glucose and mannose and have high mol% G + C of 54.4-55.9 and 54.9, respectively.

The comparative chloroplast genomic analysis of photosynthetic orchids and developing DNA markers to distinguish Phalaenopsis orchids.

PubMed

Jheng, Cheng-Fong; Chen, Tien-Chih; Lin, Jhong-Yi; Chen, Ting-Chieh; Wu, Wen-Luan; Chang, Ching-Chun

2012-07-01

The chloroplast genome of Phalaenopsis equestris was determined and compared to those of Phalaenopsis aphrodite and Oncidium Gower Ramsey in Orchidaceae. The chloroplast genome of P. equestris is 148,959 bp, and a pair of inverted repeats (25,846 bp) separates the genome into large single-copy (85,967 bp) and small single-copy (11,300 bp) regions. The genome encodes 109 genes, including 4 rRNA, 30 tRNA and 75 protein-coding genes, but loses four ndh genes (ndhA, E, F and H) and seven other ndh genes are pseudogenes. The rate of inter-species variation between the two moth orchids was 0.74% (1107 sites) for single nucleotide substitution and 0.24% for insertions (161 sites; 1388 bp) and deletions (189 sites; 1393 bp). The IR regions have a lower rate of nucleotide substitution (3.5-5.8-fold) and indels (4.3-7.1-fold) than single-copy regions. The intergenic spacers are the most divergent, and based on the length variation of the three intergenic spacers, 11 native Phalaenopsis orchids could be successfully distinguished. The coding genes, IR junction and RNA editing sites are relatively more conserved between the two moth orchids than between those of Phalaenopsis and Oncidium spp. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Plastome Evolution in the Sole Hemiparasitic Genus Laurel Dodder (Cassytha) and Insights into the Plastid Phylogenomics of Lauraceae

PubMed Central

Wu, Chung-Shien; Wang, Ting-Jen; Wu, Chia-Wen; Wang, Ya-Nan

2017-01-01

Abstract To date, little is known about the evolution of plastid genomes (plastomes) in Lauraceae. As one of the top five largest families in tropical forests, the Lauraceae contain many species that are important ecologically and economically. Lauraceous species also provide wonderful materials to study the evolutionary trajectory in response to parasitism because they contain both nonparasitic and parasitic species. This study compared the plastomes of nine Lauraceous species, including the sole hemiparasitic and herbaceous genus Cassytha (laurel dodder; here represented by Cassytha filiformis). We found differential contractions of the canonical inverted repeat (IR), resulting in two IR types present in Lauraceae. These two IR types reinforce Cryptocaryeae and Neocinnamomum—Perseeae–Laureae as two separate clades. Our data reveal several traits unique to Cas. filiformis, including loss of IRs, loss or pseudogenization of 11 ndh and rpl23 genes, richness of repeats, and accelerated rates of nucleotide substitutions in protein-coding genes. Although Cas. filiformis is low in chlorophyll content, our analysis based on dN/dS ratios suggests that both its plastid house-keeping and photosynthetic genes are under strong selective constraints. Hence, we propose that short generation time and herbaceous lifestyle rather than reduced photosynthetic ability drive the accelerated rates of nucleotide substitutions in Cas. filiformis. PMID:28985306

A trans-acting leader RNA from a Salmonella virulence gene

PubMed Central

Choi, Eunna; Han, Yoontak; Cho, Yong-Joon; Nam, Daesil; Lee, Eun-Jin

2017-01-01

Bacteria use flagella to move toward nutrients, find its host, or retract from toxic substances. Because bacterial flagellum is one of the ligands that activate the host innate immune system, its synthesis should be tightly regulated during host infection, which is largely unknown. Here, we report that a bacterial leader mRNA from the mgtCBR virulence operon in the intracellular pathogen Salmonella enterica serovar Typhimurium binds to the fljB coding region of mRNAs in the fljBA operon encoding the FljB phase 2 flagellin, a main component of bacterial flagella and the FljA repressor for the FliC phase 1 flagellin, and degrades fljBA mRNAs in an RNase E-dependent fashion during infection. A nucleotide substitution of the fljB flagellin gene that prevents the mgtC leader RNA-mediated down-regulation increases the fljB-encoded flagellin synthesis, leading to a hypermotile phenotype inside macrophages. Moreover, the fljB nucleotide substitution renders Salmonella hypervirulent, indicating that FljB-based motility must be compromised in the phagosomal compartment where Salmonella resides. This suggests that this pathogen promotes pathogenicity by producing a virulence protein and limits locomotion by a trans-acting leader RNA from the same virulence gene during infection. PMID:28874555

HIP1 propagates in cyanobacterial DNA via nucleotide substitutions but promotes excision at similar frequencies in Escherichia coli and Synechococcus PCC 7942.

PubMed

Robinson, P J; Cranenburgh, R M; Head, I M; Robinson, N J

1997-04-01

The sequence 5'-GCGATCGC-3', designated HIP1, for highly iterated palindrome, was first identified at the borders of a gene-deletion event and subsequently shown to constitute up to 2.5% of the DNA in some cyanobacteria. It is now reported that HIP1 is polyphyletic, occurring in several distinct cyanobacterial lineages and not defining a clade. HIP1 does not introduce gaps into sequence alignments. It aligns with partial HIP1 sites in related sequences showing that it propagates by nucleotide substitutions rather than insertion. Constructs have been created to determine the frequencies at which deletion events occur between palindromes located within the selectable marker neo. Deletion between HIP1 sites was more frequent in Synechococcus PCC 7942 than deletion between control palindromes, 5'-CCGATCGG-3', designated PAL0. However, this is not due to a recombinase that recognises HIP1 and is peculiar to cyanobacteria because similar deletion frequencies were detected in Escherichia coli. Furthermore, the frequency of deletion of DNA flanked asymmetrically by one HIP1 site and one PAL0 site was less than the frequency of deletion of DNA flanked asymmetrically by identical copies of either palindrome. This is consistent with deletion by copy-choice.

Genomic diversity of Mycobacterium tuberculosis Beijing strains isolated in Tuscany, Italy, based on large sequence deletions, SNPs in putative DNA repair genes and MIRU-VNTR polymorphisms.

PubMed

Garzelli, Carlo; Lari, Nicoletta; Rindi, Laura

2016-03-01

The Beijing genotype of Mycobacterium tuberculosis is cause of global concern as it is rapidly spreading worldwide, is considered hypervirulent, and is most often associated to massive spread of MDR/XDR TB, although these epidemiological or pathological properties have not been confirmed for all strains and in all geographic settings. In this paper, to gain new insights into the biogeographical heterogeneity of the Beijing family, we investigated a global sample of Beijing strains (22% from Italian-born, 78% from foreign-born patients) by determining large sequence polymorphism of regions RD105, RD181, RD150 and RD142, single nucleotide polymorphism of putative DNA repair genes mutT4 and mutT2 and MIRU-VNTR profiles based on 11 discriminative loci. We found that, although our sample of Beijing strains showed a considerable genomic heterogeneity, yielding both ancient and recent phylogenetic strains, the prevalent successful Beijing subsets were characterized by deletions of RD105 and RD181 and by one nucleotide substitution in one or both mutT genes. MIRU-VNTR analysis revealed 47 unique patterns and 9 clusters including a total of 33 isolates (41% of total isolates); the relatively high proportion of Italian-born Beijing TB patients, often occurring in mixed clusters, supports the possibility of an ongoing cross-transmission of the Beijing genotype to autochthonous population. High rates of extra-pulmonary localization and drug-resistance, particularly MDR, frequently reported for Beijing strains in other settings, were not observed in our survey. Copyright © 2015 Elsevier Ltd. All rights reserved.

Molecular phylogeography and cryptic speciation in the mosses, Mielichhoferia elongata and M. mielichhoferiana (Bryaceae).

PubMed

Shaw, A J

2000-05-01

Nucleotide sequence variation in the ITS1-5.8S-ITS2 region of nuclear ribosomal DNA (nrDNA) from 70 populations of Mielichhoferia elongata and M. mielichhoferiana, plus two outgroup species, was analysed using maximum parsimony and maximum likelihood methods. High levels of nucleotide substitution and numerous insertion-deletion events were detected within and between the two species. M. elongata is monophyletic with regard to nrDNA variation, but M. mielichhoferiana is paraphyletic. (M. elongata is nested within it.) A clade within M. mielichhoferiana provides evidence of vicariance, with North American and Scandinavian sister groups of populations. Two major clades are resolved in M. elongata by sequence data that are completely congruent with previous isozyme work. One clade includes populations from both North America and Europe whereas the other is strictly North American. These two clades, resolved by multiple independent loci, clearly represent cryptic species within the morphologically uniform M. elongata. Certain geographical areas, most notably southwestern Colorado in Ouray and San Juan Counties, harbour diverse populations of M. elongata with distinct phylogenetic and phylogeographical histories. Morphologically indistinguishable but phylogenetically distant populations were detected a few metres apart at one site. In contrast, all populations collected over hundreds of kilometres in California belong to a single clade. Arctic North American populations belong to a clade that includes disjunct populations in Alaska, northern Ellesmere Island, and the northeastern USA, but not subarctic Swedish populations, which are more closely related to plants from the Rocky Mountains. Morphological uniformity belies complex infraspecific phylogenetic patterns within M. elongata and M. mielichhoferiana.

Isolation and molecular characterization of partial FSH and LH receptor genes in Arabian camels (Camelus dromedarius)

PubMed Central

Jelokhani-Niaraki, Saber; Tahmoorespur, Mojtaba; Bitaraf-Sani, Morteza

2015-01-01

Very little is known about LHR and FSHR genes of domestic dromedary camels. The main objective of this study was to determine and analyze partial genomic regions of FSHR and LHR genes in dromedary camels for the first time. To this end, a total of50 DNA samples belonging to dromedary camels raised in Iran were sent for sequencing (25 samples of each gene). We compared the nucleotide sequences of Camelus dromedarius with corresponding sequences of previously published FSHR and LHR genes in bactrian camels and other species. According to the data, the same nucleotide variation was identified in both regions of the two camel species. The alignment of deduced protein sequences of the two different species revealed an amino acid variation at the FSHR region. No evidence of amino acid variation was observed, however, in LHR sequences. Phylogenetic analysis indicated that both camel species had a close relationship and clustered together in a separate branch. This was further confirmed by genetic distance values illustrating significant sequence identity between Camelus dromedarius and Camelus bactrianus. Interestingly, sequence comparisons revealed heterozygote patterns in FSHR sequences isolated from dromedary camels of Iran. In comparison to other species, this camel contains three amino acid substitutions at 5, 67, and 105 positions in the FSHR coding region. These positions are found exclusively in camels and can be considered as species specific. The results of our study can be used for hormone functionality research (FSHR and LHR) as well as reproduction-linked polymorphisms and breeding programs. PMID:27844002

Isolation and molecular characterization of partial FSH and LH receptor genes in Arabian camels (Camelus dromedarius).

PubMed

Jelokhani-Niaraki, Saber; Tahmoorespur, Mojtaba; Bitaraf-Sani, Morteza

2015-06-01

Very little is known about LHR and FSHR genes of domestic dromedary camels. The main objective of this study was to determine and analyze partial genomic regions of FSHR and LHR genes in dromedary camels for the first time. To this end, a total of50 DNA samples belonging to dromedary camels raised in Iran were sent for sequencing (25 samples of each gene). We compared the nucleotide sequences of Camelus dromedarius with corresponding sequences of previously published FSHR and LHR genes in bactrian camels and other species. According to the data, the same nucleotide variation was identified in both regions of the two camel species. The alignment of deduced protein sequences of the two different species revealed an amino acid variation at the FSHR region. No evidence of amino acid variation was observed, however, in LHR sequences. Phylogenetic analysis indicated that both camel species had a close relationship and clustered together in a separate branch. This was further confirmed by genetic distance values illustrating significant sequence identity between Camelus dromedarius and Camelus bactrianus . Interestingly, sequence comparisons revealed heterozygote patterns in FSHR sequences isolated from dromedary camels of Iran. In comparison to other species, this camel contains three amino acid substitutions at 5, 67, and 105 positions in the FSHR coding region. These positions are found exclusively in camels and can be considered as species specific. The results of our study can be used for hormone functionality research ( FSHR and LHR ) as well as reproduction-linked polymorphisms and breeding programs.

Three crocodilian genomes reveal ancestral patterns of evolution among archosaurs.

PubMed

Green, Richard E; Braun, Edward L; Armstrong, Joel; Earl, Dent; Nguyen, Ngan; Hickey, Glenn; Vandewege, Michael W; St John, John A; Capella-Gutiérrez, Salvador; Castoe, Todd A; Kern, Colin; Fujita, Matthew K; Opazo, Juan C; Jurka, Jerzy; Kojima, Kenji K; Caballero, Juan; Hubley, Robert M; Smit, Arian F; Platt, Roy N; Lavoie, Christine A; Ramakodi, Meganathan P; Finger, John W; Suh, Alexander; Isberg, Sally R; Miles, Lee; Chong, Amanda Y; Jaratlerdsiri, Weerachai; Gongora, Jaime; Moran, Christopher; Iriarte, Andrés; McCormack, John; Burgess, Shane C; Edwards, Scott V; Lyons, Eric; Williams, Christina; Breen, Matthew; Howard, Jason T; Gresham, Cathy R; Peterson, Daniel G; Schmitz, Jürgen; Pollock, David D; Haussler, David; Triplett, Eric W; Zhang, Guojie; Irie, Naoki; Jarvis, Erich D; Brochu, Christopher A; Schmidt, Carl J; McCarthy, Fiona M; Faircloth, Brant C; Hoffmann, Federico G; Glenn, Travis C; Gabaldón, Toni; Paten, Benedict; Ray, David A

2014-12-12

To provide context for the diversification of archosaurs--the group that includes crocodilians, dinosaurs, and birds--we generated draft genomes of three crocodilians: Alligator mississippiensis (the American alligator), Crocodylus porosus (the saltwater crocodile), and Gavialis gangeticus (the Indian gharial). We observed an exceptionally slow rate of genome evolution within crocodilians at all levels, including nucleotide substitutions, indels, transposable element content and movement, gene family evolution, and chromosomal synteny. When placed within the context of related taxa including birds and turtles, this suggests that the common ancestor of all of these taxa also exhibited slow genome evolution and that the comparatively rapid evolution is derived in birds. The data also provided the opportunity to analyze heterozygosity in crocodilians, which indicates a likely reduction in population size for all three taxa through the Pleistocene. Finally, these data combined with newly published bird genomes allowed us to reconstruct the partial genome of the common ancestor of archosaurs, thereby providing a tool to investigate the genetic starting material of crocodilians, birds, and dinosaurs. Copyright © 2014, American Association for the Advancement of Science.

RNAcode: Robust discrimination of coding and noncoding regions in comparative sequence data

PubMed Central

Washietl, Stefan; Findeiß, Sven; Müller, Stephan A.; Kalkhof, Stefan; von Bergen, Martin; Hofacker, Ivo L.; Stadler, Peter F.; Goldman, Nick

2011-01-01

With the availability of genome-wide transcription data and massive comparative sequencing, the discrimination of coding from noncoding RNAs and the assessment of coding potential in evolutionarily conserved regions arose as a core analysis task. Here we present RNAcode, a program to detect coding regions in multiple sequence alignments that is optimized for emerging applications not covered by current protein gene-finding software. Our algorithm combines information from nucleotide substitution and gap patterns in a unified framework and also deals with real-life issues such as alignment and sequencing errors. It uses an explicit statistical model with no machine learning component and can therefore be applied “out of the box,” without any training, to data from all domains of life. We describe the RNAcode method and apply it in combination with mass spectrometry experiments to predict and confirm seven novel short peptides in Escherichia coli and to analyze the coding potential of RNAs previously annotated as “noncoding.” RNAcode is open source software and available for all major platforms at http://wash.github.com/rnacode. PMID:21357752

RNAcode: robust discrimination of coding and noncoding regions in comparative sequence data.

PubMed

Washietl, Stefan; Findeiss, Sven; Müller, Stephan A; Kalkhof, Stefan; von Bergen, Martin; Hofacker, Ivo L; Stadler, Peter F; Goldman, Nick

2011-04-01

With the availability of genome-wide transcription data and massive comparative sequencing, the discrimination of coding from noncoding RNAs and the assessment of coding potential in evolutionarily conserved regions arose as a core analysis task. Here we present RNAcode, a program to detect coding regions in multiple sequence alignments that is optimized for emerging applications not covered by current protein gene-finding software. Our algorithm combines information from nucleotide substitution and gap patterns in a unified framework and also deals with real-life issues such as alignment and sequencing errors. It uses an explicit statistical model with no machine learning component and can therefore be applied "out of the box," without any training, to data from all domains of life. We describe the RNAcode method and apply it in combination with mass spectrometry experiments to predict and confirm seven novel short peptides in Escherichia coli and to analyze the coding potential of RNAs previously annotated as "noncoding." RNAcode is open source software and available for all major platforms at http://wash.github.com/rnacode.

Three crocodilian genomes reveal ancestral patterns of evolution among archosaurs

PubMed Central

Green, Richard E; Braun, Edward L; Armstrong, Joel; Earl, Dent; Nguyen, Ngan; Hickey, Glenn; Vandewege, Michael W; St John, John A; Capella-Gutiérrez, Salvador; Castoe, Todd A; Kern, Colin; Fujita, Matthew K; Opazo, Juan C; Jurka, Jerzy; Kojima, Kenji K; Caballero, Juan; Hubley, Robert M; Smit, Arian F; Platt, Roy N; Lavoie, Christine A; Ramakodi, Meganathan P; Finger, John W; Suh, Alexander; Isberg, Sally R; Miles, Lee; Chong, Amanda Y; Jaratlerdsiri, Weerachai; Gongora, Jaime; Moran, Christopher; Iriarte, Andrés; McCormack, John; Burgess, Shane C; Edwards, Scott V; Lyons, Eric; Williams, Christina; Breen, Matthew; Howard, Jason T; Gresham, Cathy R; Peterson, Daniel G; Schmitz, Jürgen; Pollock, David D; Haussler, David; Triplett, Eric W; Zhang, Guojie; Irie, Naoki; Jarvis, Erich D; Brochu, Christopher A; Schmidt, Carl J; McCarthy, Fiona M; Faircloth, Brant C; Hoffmann, Federico G; Glenn, Travis C; Gabaldón, Toni; Paten, Benedict; Ray, David A

2015-01-01

To provide context for the diversifications of archosaurs, the group that includes crocodilians, dinosaurs and birds, we generated draft genomes of three crocodilians, Alligator mississippiensis (the American alligator), Crocodylus porosus (the saltwater crocodile), and Gavialis gangeticus (the Indian gharial). We observed an exceptionally slow rate of genome evolution within crocodilians at all levels, including nucleotide substitutions, indels, transposable element content and movement, gene family evolution, and chromosomal synteny. When placed within the context of related taxa including birds and turtles, this suggests that the common ancestor of all of these taxa also exhibited slow genome evolution and that the relatively rapid evolution of bird genomes represents an autapomorphy within that clade. The data also provided the opportunity to analyze heterozygosity in crocodilians, which indicates a likely reduction in population size for all three taxa through the Pleistocene. Finally, these new data combined with newly published bird genomes allowed us to reconstruct the partial genome of the common ancestor of archosaurs providing a tool to investigate the genetic starting material of crocodilians, birds, and dinosaurs. PMID:25504731

Asymmetry in Object Substitution Masking Occurs Relative to the Direction of Spatial Attention Shift

ERIC Educational Resources Information Center

Hirose, Nobuyuki; Osaka, Naoyuki

2010-01-01

A sparse mask that persists beyond the duration of a target can reduce its visibility, a phenomenon called "object substitution masking". Y. Jiang and M. M. Chun (2001a) found an asymmetric pattern of substitution masking such that a mask on the peripheral side of the target caused stronger substitution masking than on the central side.…

Genotypic relationships between Taenia saginata, Taenia asiatica and their hybrids.

PubMed

Yamane, Kanako; Yanagida, Tetsuya; Li, Tiaoying; Chen, Xingwang; Dekumyoy, Paron; Waikagul, Jitra; Nkouawa, Agathe; Nakao, Minoru; Sako, Yasuhito; Ito, Akira; Sato, Hiroshi; Okamoto, Munehiro

2013-11-01

Partial sequences of the DNA polymerase delta (pold) gene from Taenia saginata-like adult worms were sequenced. Phylogenetic analysis revealed that pold gene sequences were clearly divided into two clades, differing from each other in five to seven nucleotides. There is little doubt that T. saginata and Taenia asiatica were once separated into two distinct taxa as has been concluded in previous studies. On the other hand, most of the adult worms, which were identified as T. asiatica using mitochondrial DNA, were homozygous for an allele that originated from the allele of T. saginata via single nucleotide substitution. These results indicate that most of the adult worms, which had been called T. asiatica, are not actually 'pure T. asiatica' but instead originated from the hybridization of 'pure T. saginata' and 'pure T. asiatica'.

Mutation analysis of GLDC, AMT and GCSH in cataract captive-bred vervet monkeys (Chlorocebus aethiops).

PubMed

Chauke, Chesa G; Magwebu, Zandisiwe E; Sharma, Jyoti R; Arieff, Zainunisha; Seier, Jürgen V

2016-08-01

Non-ketotic hyperglycinaemia (NKH) is an autosomal recessive inborn error of glycine metabolism characterized by accumulation of glycine in body fluids and various neurological symptoms. This study describes the first screening of NKH in cataract captive-bred vervet monkeys (Chlorocebus aethiops). Glycine dehydrogenase (GLDC), aminomethyltransferase (AMT) and glycine cleavage system H protein (GCSH) were prioritized. Mutation analysis of the complete coding sequence of GLDC and AMT revealed six novel single-base substitutions, of which three were non-synonymous missense and three were silent nucleotide changes. Although deleterious effects of the three amino acid substitutions were not evaluated, one substitution of GLDC gene (S44R) could be disease-causing because of its drastic amino acid change, affecting amino acids conserved in different primate species. This study confirms the diagnosis of NKH for the first time in vervet monkeys with cataracts. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

SV40 host-substituted variants: a new look at the monkey DNA inserts and recombinant junctions.

PubMed

Singer, Maxine; Winocour, Ernest

2011-04-10

The available monkey genomic data banks were examined in order to determine the chromosomal locations of the host DNA inserts in 8 host-substituted SV40 variant DNAs. Five of the 8 variants contained more than one linked monkey DNA insert per tandem repeat unit and in all cases but one, the 19 monkey DNA inserts in the 8 variants mapped to different locations in the monkey genome. The 50 parental DNAs (32 monkey and 18 SV40 DNA segments) which spanned the crossover and flanking regions that participated in monkey/monkey and monkey/SV40 recombinations were characterized by substantial levels of microhomology of up to 8 nucleotides in length; the parental DNAs also exhibited direct and inverted repeats at or adjacent to the crossover sequences. We discuss how the host-substituted SV40 variants arose and the nature of the recombination mechanisms involved. Copyright © 2011 Elsevier Inc. All rights reserved.

Mutation and polymorphism analysis of the human homogentisate 1, 2-dioxygenase gene in alkaptonuria patients.

PubMed Central

Beltrán-Valero de Bernabé, D; Granadino, B; Chiarelli, I; Porfirio, B; Mayatepek, E; Aquaron, R; Moore, M M; Festen, J J; Sanmartí, R; Peñalva, M A; de Córdoba, S R

1998-01-01

Alkaptonuria (AKU), a rare hereditary disorder of phenylalanine and tyrosine catabolism, was the first disease to be interpreted as an inborn error of metabolism. AKU patients are deficient for homogentisate 1,2 dioxygenase (HGO); this deficiency causes homogentisic aciduria, ochronosis, and arthritis. We cloned the human HGO gene and characterized two loss-of-function mutations, P230S and V300G, in the HGO gene in AKU patients. Here we report haplotype and mutational analysis of the HGO gene in 29 novel AKU chromosomes. We identified 12 novel mutations: 8 (E42A, W97G, D153G, S189I, I216T, R225H, F227S, and M368V) missense mutations that result in amino acid substitutions at positions conserved in HGO in different species, 1 (F10fs) frameshift mutation, 2 intronic mutations (IVS9-56G-->A, IVS9-17G-->A), and 1 splice-site mutation (IVS5+1G-->T). We also report characterization of five polymorphic sites in HGO and describe the haplotypic associations of alleles at these sites in normal and AKU chromosomes. One of these sites, HGO-3, is a variable dinucleotide repeat; IVS2+35T/A, IVS5+25T/C, and IVS6+46C/A are intronic sites at which single nucleotide substitutions (dimorphisms) have been detected; and c407T/A is a relatively frequent nucleotide substitution in the coding sequence, exon 4, resulting in an amino acid change (H80Q). These data provide insight into the origin and evolution of the various AKU alleles. PMID:9529363

Adaptation of the TdT assay for semi-quantitative flow cytometric detection of DNA strand breaks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bromidge, T.J.; Howe, D.J.; Johnson, S.A.

The enzyme Terminal Deoxynucleotidyl Transferase (TdT) is a DNA polymerase which can be used to label DNA strand breaks by the incorporation of a labelled nucleotide followed by a fluorescent detection step. The amount of label incorporated can then be assessed by flow cytometry. The mechanism of action of TdT, however, will allow the addition of varying numbers of nucleotides to the free 3{prime} termini produced by DNA strand breaks. The substitution of Digoxigenin (DIG){trademark} labelled dideoxynucleotides for labelled deoxy-nucleotides in the TdT assay will limit the addition of label to a DNA break to a single nucleotide, thus ensuringmore » a direct relationship between an increase in DNA strand breaks and an increase in fluorescence. We have used this adaptation of the TdT assay to evaluate DNA damage incurred in lymphocytes, from patients with Chronic Lymphocytic Leukemia (CLL), on exposure to UV irradiation and apoptosis-inducing drugs, fludarabine and 2-Chloro-2{prime}-deoxyadenosine (2-CdA). This technique may give a good indication of the susceptibility of CLL patients to apoptosis inducing drugs, and hence an indication of the likely response to these therapies. 7 refs., 2 figs., 2 tabs.« less

Infant formulas. Recent developments and new issues.

PubMed

Agostoni, C; Haschke, F

2003-06-01

Infant formulas on the market today should be aimed at providing the best alternative to breast milk for infants of those women who are unable to continue breastfeeding until 6 months of age and substituting ideally for human milk after 6 months of age approaching the structural and functional effects observed in breastfed infants. The aim is to mimic the functional outcome of the breastfed infant (e.g. growth and development), and not to copy the composition of human milk. For this purpose, the following compounds have been added to formulas and are reviewed: long-chain polyunsaturated fatty acids (LCPUFA) for brain composition and neurodevelopment, probiotics and prebiotics for the fecal flora and the local intestinal defense, and nucleotides for promoting the immune response. Changes in protein quantity and quality allow to balance the blood amino acid pattern (possibly relevant to the early stages of brain development for the neurotransmitter function) and reducing the protein intake could be important for the prevention of later overweight. Hydrolysed proteins are important in the prevention of atopic disorders. Many trials have been published so far with short-term assessments, most of them with positive findings. However, we need more data on the long-term follow-up of infants who were fed the new formulas. Such data will allow to look at neural performance, prevention of overweight and obesity, and effects on the immune-allergic pattern.

Genetic characterization of the dihydrofolate reductase gene of Pneumocystis jirovecii isolates from Portugal.

PubMed

Costa, Marina C; Esteves, Francisco; Antunes, Francisco; Matos, Olga

2006-12-01

The aim of the present study was to evaluate the genetic variation of Pneumocystis jirovecii dihydrofolate reductase (DHFR) gene in an immunocompromised Portuguese population and to investigate the possible association between DHFR genotypes and P. jirovecii pneumonia (PcP) prophylaxis with co-trimoxazole. One hundred and thirty-eight P. jirovecii isolates were submitted to DHFR genetic characterization by PCR and sequencing. In the studied population, 72.7% of the patients presented sequences identical to the wild-type sequence of the P. jirovecii DHFR gene and 27.3% presented point substitutions. A total of nine substitution sites were identified; four synonymous substitutions at nucleotide positions 201, 272, 312 and 381 were detected in 31 patients. Five non-synonymous substitutions were observed, leading to the DHFR mutations Leu-13-->Ser, Asn-23-->Ser, Ser-31-->Phe, Met-52-->Leu and Ala-67-->Val. With the exception of the polymorphism at position 312 and the mutation at codon 52, all polymorphisms were reported in this study for the first time. Our results suggest that DHFR gene polymorphisms are frequent in the Portuguese immunocompromised population but do not seem to be associated with PcP prophylaxis failure (P = 0.748 and P = 0.730).

Sugar-modified G-quadruplexes: effects of LNA-, 2′F-RNA– and 2′F-ANA-guanosine chemistries on G-quadruplex structure and stability

PubMed Central

Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân

2014-01-01

G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274

Functional interactions between A' helices in the C-linker of open CNG channels.

PubMed

Hua, Li; Gordon, Sharona E

2005-03-01

Cyclic nucleotide-gated (CNG) channels are nonselective cation channels that are activated by the direct binding of the cyclic nucleotides cAMP and cGMP. The region linking the last membrane-spanning region (S6) to the cyclic nucleotide binding domain in the COOH terminus, termed the C-linker, has been shown to play an important role in coupling cyclic nucleotide binding to opening of the pore. In this study, we explored the intersubunit proximity between the A' helices of the C-linker regions of CNGA1 in functional channels using site-specific cysteine substitution. We found that intersubunit disulfide bonds can be formed between the A' helices in open channels, and that inducing disulfide bonds in most of the studied constructs resulted in potentiation of channel activation. This suggests that the A' helices of the C-linker regions are in close proximity when the channel is in the open state. Our finding is not compatible with a homology model of the CNGA1 C-linker made from the recently published X-ray crystallographic structure of the hyperpolarization-activated, cyclic nucleotide-modulated (HCN) channel COOH terminus, and leads us to suggest that the C-linker region depicted in the crystal structure may represent the structure of the closed state. The opening conformational change would then involve a movement of the A' helices from a position parallel to the axis of the membrane to one perpendicular to the axis of the membrane.

Hepatitis C Virus Nucleotide Inhibitors PSI-352938 and PSI-353661 Exhibit a Novel Mechanism of Resistance Requiring Multiple Mutations within Replicon RNA▿†

PubMed Central

Lam, Angela M.; Espiritu, Christine; Bansal, Shalini; Micolochick Steuer, Holly M.; Zennou, Veronique; Otto, Michael J.; Furman, Phillip A.

2011-01-01

PSI-352938, a cyclic phosphate nucleotide, and PSI-353661, a phosphoramidate nucleotide, are prodrugs of β-d-2′-deoxy-2′-α-fluoro-2′-β-C-methylguanosine-5′-monophosphate. Both compounds are metabolized to the same active 5′-triphosphate, PSI-352666, which serves as an alternative substrate inhibitor of the NS5B RNA-dependent RNA polymerase during HCV replication. PSI-352938 and PSI-353661 retained full activity against replicons containing the S282T substitution, which confers resistance to certain 2′-substituted nucleoside/nucleotide analogs. PSI-352666 was also similarly active against both wild-type and S282T NS5B polymerases. In order to identify mutations that confer resistance to these compounds, in vitro selection studies were performed using HCV replicon cells. While no resistant genotype 1a or 1b replicons could be selected, cells containing genotype 2a JFH-1 replicons cultured in the presence of PSI-352938 or PSI-353661 developed resistance to both compounds. Sequencing of the NS5B region identified a number of amino acid changes, including S15G, R222Q, C223Y/H, L320I, and V321I. Phenotypic evaluation of these mutations indicated that single amino acid changes were not sufficient to significantly reduce the activity of PSI-352938 and PSI-353661. Instead, a combination of three amino acid changes, S15G/C223H/V321I, was required to confer a high level of resistance. No cross-resistance exists between the 2′-F-2′-C-methylguanosine prodrugs and other classes of HCV inhibitors, including 2′-modified nucleoside/-tide analogs such as PSI-6130, PSI-7977, INX-08189, and IDX-184. Finally, we determined that in genotype 1b replicons, the C223Y/H mutation failed to support replication, and although the A15G/C223H/V321I triple mutation did confer resistance to PSI-352938 and PSI-353661, this mutant replicated at only about 10% efficiency compared to the wild type. PMID:21957306

Pre-Steady-State Kinetic Analysis of Truncated and Full-Length Saccharomyces cerevisiae DNA Polymerase Eta

PubMed Central

Brown, Jessica A.; Zhang, Likui; Sherrer, Shanen M.; Taylor, John-Stephen; Burgers, Peter M. J.; Suo, Zucai

2010-01-01

Understanding polymerase fidelity is an important objective towards ascertaining the overall stability of an organism's genome. Saccharomyces cerevisiae DNA polymerase η (yPolη), a Y-family DNA polymerase, is known to efficiently bypass DNA lesions (e.g., pyrimidine dimers) in vivo. Using pre-steady-state kinetic methods, we examined both full-length and a truncated version of yPolη which contains only the polymerase domain. In the absence of yPolη's C-terminal residues 514–632, the DNA binding affinity was weakened by 2-fold and the base substitution fidelity dropped by 3-fold. Thus, the C-terminus of yPolη may interact with DNA and slightly alter the conformation of the polymerase domain during catalysis. In general, yPolη discriminated between a correct and incorrect nucleotide more during the incorporation step (50-fold on average) than the ground-state binding step (18-fold on average). Blunt-end additions of dATP or pyrene nucleotide 5′-triphosphate revealed the importance of base stacking during the binding of incorrect incoming nucleotides. PMID:20798853

Unlinking the methylome pattern from nucleotide sequence, revealed by large-scale in vivo genome engineering and methylome editing in medaka fish

PubMed Central

Nakamura, Ryohei; Uno, Ayako; Kumagai, Masahiko; Fukushima, Hiroto S.; Morishita, Shinichi; Takeda, Hiroyuki

2017-01-01

The heavily methylated vertebrate genomes are punctuated by stretches of poorly methylated DNA sequences that usually mark gene regulatory regions. It is known that the methylation state of these regions confers transcriptional control over their associated genes. Given its governance on the transcriptome, cellular functions and identity, genome-wide DNA methylation pattern is tightly regulated and evidently predefined. However, how is the methylation pattern determined in vivo remains enigmatic. Based on in silico and in vitro evidence, recent studies proposed that the regional hypomethylated state is primarily determined by local DNA sequence, e.g., high CpG density and presence of specific transcription factor binding sites. Nonetheless, the dependency of DNA methylation on nucleotide sequence has not been carefully validated in vertebrates in vivo. Herein, with the use of medaka (Oryzias latipes) as a model, the sequence dependency of DNA methylation was intensively tested in vivo. Our statistical modeling confirmed the strong statistical association between nucleotide sequence pattern and methylation state in the medaka genome. However, by manipulating the methylation state of a number of genomic sequences and reintegrating them into medaka embryos, we demonstrated that artificially conferred DNA methylation states were predominantly and robustly maintained in vivo, regardless of their sequences and endogenous states. This feature was also observed in the medaka transgene that had passed across generations. Thus, despite the observed statistical association, nucleotide sequence was unable to autonomously determine its own methylation state in medaka in vivo. Our results apparently argue against the notion of the governance on the DNA methylation by nucleotide sequence, but instead suggest the involvement of other epigenetic factors in defining and maintaining the DNA methylation landscape. Further investigation in other vertebrate models in vivo will be needed for the generalization of our observations made in medaka. PMID:29267279

Nucleotide sequence variation at two genes of the phenylpropanoid pathway, the FAH1 and F3H genes, in Arabidopsis thaliana.

PubMed

Aguadé, M

2001-01-01

The FAH1 and F3H genes encode ferulate-5-hydroxylase and flavanone-3-hydroxylase, which are enzymes in the pathways leading to the synthesis of sinapic acid esters and flavonoids, respectively. Nucleotide variation at these genes was surveyed by sequencing a sample of 20 worldwide Arabidopsis thaliana ecotypes and one Arabidopsis lyrata spp. petraea stock. In contrast with most previously studied genes, the percentage of singletons was rather low in both the FAH1 and the F3H gene regions. There was, therefore, no footprint of a recent species expansion in the pattern of nucleotide variation in these regions. In both FAH1 and F3H, nucleotide variation was structured into two major highly differentiated haplotypes. In both genes, there was a peak of silent polymorphism in the 5' part of the coding region without a parallel increase in silent divergence. In FAH1, the peak was centered at the beginning of the second exon. In F3H, nucleotide diversity was highest at the beginning of the gene. The observed pattern of variation in both FAH1 and F3H, although suggestive of balancing selection, was compatible with a neutral model with no recombination.

Rapid rate of control-region evolution in Pacific butterflyfishes (Chaetodontidae).

PubMed

McMillan, W O; Palumbi, S R

1997-11-01

Sequence differences in the tRNA-proline (tRNApro) end of the mitochondrial control-region of three species of Pacific butterflyfishes accumulated 33-43 times more rapidly than did changes within the mitochondrial cytochrome b gene (cytb). Rapid evolution in this region was accompanied by strong transition/transversion bias and large variation in the probability of a DNA substitution among sites. These substitution constraints placed an absolute ceiling on the magnitude of sequence divergence that could be detected between individuals. This divergence "ceiling" was reached rapidly and led to a decay in the relative rate of control-region/cytb b evolution. A high rate of evolution in this section of the control-region of butterflyfishes stands in marked contrast to the patterns reported in some other fish lineages. Although the mechanism underlying rate variation remains unclear, all taxa with rapid evolution in the 5'-end of the control-region showed extreme transition biases. By contrast, in taxa with slower control-region evolution, transitions accumulated at nearly the same rate as transversions. More information is needed to understand the relationship between nucleotide bias and the rate of evolution in the 5'-end of the control-region. Despite strong constraints on sequence change, phylogenetic information was preserved in the group of recently differentiated species and supported the clustering of sequences into three major mtDNA groupings. Within these groups, very similar control-region sequences were widely distributed across the Pacific Ocean and were shared between recognized species, indicating a lack of mitochondrial sequence monophyly among species.

Phylogenetic Conflict in Bears Identified by Automated Discovery of Transposable Element Insertions in Low-Coverage Genomes

PubMed Central

Gallus, Susanne; Janke, Axel

2017-01-01

Abstract Phylogenetic reconstruction from transposable elements (TEs) offers an additional perspective to study evolutionary processes. However, detecting phylogenetically informative TE insertions requires tedious experimental work, limiting the power of phylogenetic inference. Here, we analyzed the genomes of seven bear species using high-throughput sequencing data to detect thousands of TE insertions. The newly developed pipeline for TE detection called TeddyPi (TE detection and discovery for Phylogenetic Inference) identified 150,513 high-quality TE insertions in the genomes of ursine and tremarctine bears. By integrating different TE insertion callers and using a stringent filtering approach, the TeddyPi pipeline produced highly reliable TE insertion calls, which were confirmed by extensive in vitro validation experiments. Analysis of single nucleotide substitutions in the flanking regions of the TEs shows that these substitutions correlate with the phylogenetic signal from the TE insertions. Our phylogenomic analyses show that TEs are a major driver of genomic variation in bears and enabled phylogenetic reconstruction of a well-resolved species tree, despite strong signals for incomplete lineage sorting and introgression. The analyses show that the Asiatic black, sun, and sloth bear form a monophyletic clade, in which phylogenetic incongruence originates from incomplete lineage sorting. TeddyPi is open source and can be adapted to various TE and structural variation callers. The pipeline makes it possible to confidently extract thousands of TE insertions even from low-coverage genomes (∼10×) of nonmodel organisms. This opens new possibilities for biologists to study phylogenies and evolutionary processes as well as rates and patterns of (retro-)transposition and structural variation. PMID:28985298

Curiously modern DNA for a "250 million-year-old" bacterium.

PubMed

Nickle, David C; Learn, Gerald H; Rain, Matthew W; Mullins, James I; Mittler, John E

2002-01-01

Studies of ancient DNA have attracted considerable attention in scientific journals and the popular press. Several of the more extreme claims for ancient DNA have been questioned on biochemical grounds (i.e., DNA surviving longer than expected) and evolutionary grounds (i.e., nucleotide substitution patterns not matching theoretical expectations for ancient DNA). A recent letter to Nature from Vreeland et al. (2000), however, tops all others with respect to age and condition of the specimen. These researchers extracted and cultured a bacterium from an inclusion body from what they claim is a 250 million-year (Myr)-old salt crystal. If substantiated, this observation could fundamentally alter views about bacterial physiology, ecology and evolution. Here we report on molecular evolutionary analyses of the 16S rDNA from this specimen. We find that 2-9-3 differs from a modern halophile, Salibacillus marismortui, by just 3 unambiguous bp in 16S rDNA, versus the approximately 59 bp that would be expected if these bacteria evolved at the same rate as other bacteria. We show, using a Poisson distribution, that unless it can be shown that S. marismortui evolves 5 to 10 times more slowly than other bacteria for which 16S rDNA substitution rates have been established, Vreeland et al.'s claim would be rejected at the 0.05 level. Also, a molecular clock test and a relative rates test fail to substantiate Vreeland et al.'s claim that strain 2-9-3 is a 250-Myr-old bacterium. The report of Vreeland et al. thus falls into a long series of suspect ancient DNA studies.

Multilocus patterns of nucleotide polymorphism and demographic change in Taxodium distichum (Cupressaceae) in the lower Mississippi River alluvial valley

USGS Publications Warehouse

Kusumi, J.; Zidong, L.; Kado, T.; Tsumura, Y.; Middleton, B.A.; Tachida, H.

2010-01-01

Premise of the Study: Studies of the geographic patterns of genetic variation can give important insights into the past population structure of species. Our study species, Taxodium distichum L. (bald-cypress), prefers riparian and wetland habitats and is widely distributed in southeastern North America and Mexico. We compared the genetic variation of T. distichum with that of its close relative, Cryptomeria japonica, which is endemic to Japan. Methods: Nucleotide polymorphisms of T. distichum in the lower Mississippi River alluvial valley, USA, were examined at 10 nuclear loci. Key Results: The average nucleotide diversity at silent sites, 7sil, across the 10 loci in T. distichum was higher than that of C. japonica (7sil = 0.00732 and 0.00322, respectively). In T. distichum, Tajima's D values were each negative at 9 out of 10 loci, which suggests a recent population expansion. Maximum-likelihood and Bayesian estimations of the exponential population growth rate (g) of T. distichum populations indicated that this species had expanded approximately at the rate of 1.7 - 1.0 10 -6 per year in the past. Conclusions: Taxodium distichum had signifi cantly higher nucleotide variation than C. japonica, and its patterns of polymorphism contrasted strikingly with those of the latter, which previously has been inferred to have experienced a reduction in population size.

Effects of Xylan Side-Chain Substitutions on Xylan-Cellulose Interactions and Implications for Thermal Pretreatment of Cellulosic Biomass.

PubMed

Pereira, Caroline S; Silveira, Rodrigo L; Dupree, Paul; Skaf, Munir S

2017-04-10

Lignocellulosic biomass is mainly constituted by cellulose, hemicellulose, and lignin and represents an important resource for the sustainable production of biofuels and green chemistry materials. Xylans, a common hemicellulose, interact with cellulose and often exhibit various side chain substitutions including acetate, (4-O-methyl) glucuronic acid, and arabinose. Recent studies have shown that the distribution of xylan substitutions is not random, but follows patterns that are dependent on the plant taxonomic family and cell wall type. Here, we use molecular dynamics simulations to investigate the role of substitutions on xylan interactions with the hydrophilic cellulose face, using the recently discovered xylan decoration pattern of the conifer gymnosperms as a model. The results show that α-1,2-linked substitutions stabilize the binding of single xylan chains independently of the nature of the substitution and that Ca 2+ ions can mediate cross-links between glucuronic acid substitutions of two neighboring xylan chains, thus stabilizing binding. At high temperature, xylans move from the hydrophilic to the hydrophobic cellulose surface and are also stabilized by Ca 2+ cross-links. Our results help to explain the role of substitutions on xylan-cellulose interactions, and improve our understanding of the plant cell wall architecture and the fundamentals of biomass pretreatments.

Hepatitis C Virus Genotype 1 to 6 Protease Inhibitor Escape Variants: In Vitro Selection, Fitness, and Resistance Patterns in the Context of the Infectious Viral Life Cycle

PubMed Central

Serre, Stéphanie B. N.; Jensen, Sanne B.; Ghanem, Lubna; Humes, Daryl G.; Ramirez, Santseharay; Li, Yi-Ping; Krarup, Henrik; Bukh, Jens

2016-01-01

Hepatitis C virus (HCV) NS3 protease inhibitors (PIs) are important components of novel HCV therapy regimens. Studies of PI resistance initially focused on genotype 1. Therefore, knowledge about the determinants of PI resistance for the highly prevalent genotypes 2 to 6 remains limited. Using Huh7.5 cell culture-infectious HCV recombinants with genotype 1 to 6 NS3 protease, we identified protease positions 54, 155, and 156 as hot spots for the selection of resistance substitutions under treatment with the first licensed PIs, telaprevir and boceprevir. Treatment of a genotype 2 isolate with the newer PIs vaniprevir, faldaprevir, simeprevir, grazoprevir, paritaprevir, and deldeprevir identified positions 156 and 168 as hot spots for resistance; the Y56H substitution emerged for three newer PIs. Substitution selection also depended on the specific recombinant. The substitutions identified conferred cross-resistance to several PIs; however, most substitutions selected under telaprevir or boceprevir treatment conferred less resistance to certain newer PIs. In a single-cycle production assay, across genotypes, PI treatment primarily decreased viral replication, which was rescued by PI resistance substitutions. The substitutions identified resulted in differential effects on viral fitness, depending on the original recombinant and the substitution. Across genotypes, fitness impairment induced by resistance substitutions was due primarily to decreased replication. Most combinations of substitutions that were identified increased resistance or fitness. Combinations of resistance substitutions with fitness-compensating substitutions either rescued replication or compensated for decreased replication by increasing assembly. This comprehensive study provides insight into the selection patterns and effects of PI resistance substitutions for HCV genotypes 1 to 6 in the context of the infectious viral life cycle, which is of interest for clinical and virological HCV research. PMID:27021330

Evolution of Xylan Substitution Patterns in Gymnosperms and Angiosperms: Implications for Xylan Interaction with Cellulose1[CC-BY

PubMed Central

Li, An; Gomes, Thiago C.F.

2016-01-01

The interaction between cellulose and xylan is important for the load-bearing secondary cell wall of flowering plants. Based on the precise, evenly spaced pattern of acetyl and glucuronosyl (MeGlcA) xylan substitutions in eudicots, we recently proposed that an unsubstituted face of xylan in a 2-fold helical screw can hydrogen bond to the hydrophilic surfaces of cellulose microfibrils. In gymnosperm cell walls, any role for xylan is unclear, and glucomannan is thought to be the important cellulose-binding polysaccharide. Here, we analyzed xylan from the secondary cell walls of the four gymnosperm lineages (Conifer, Gingko, Cycad, and Gnetophyta). Conifer, Gingko, and Cycad xylan lacks acetylation but is modified by arabinose and MeGlcA. Interestingly, the arabinosyl substitutions are located two xylosyl residues from MeGlcA, which is itself placed precisely on every sixth xylosyl residue. Notably, the Gnetophyta xylan is more akin to early-branching angiosperms and eudicot xylan, lacking arabinose but possessing acetylation on alternate xylosyl residues. All these precise substitution patterns are compatible with gymnosperm xylan binding to hydrophilic surfaces of cellulose. Molecular dynamics simulations support the stable binding of 2-fold screw conifer xylan to the hydrophilic face of cellulose microfibrils. Moreover, the binding of multiple xylan chains to adjacent planes of the cellulose fibril stabilizes the interaction further. Our results show that the type of xylan substitution varies, but an even pattern of xylan substitution is maintained among vascular plants. This suggests that 2-fold screw xylan binds hydrophilic faces of cellulose in eudicots, early-branching angiosperm, and gymnosperm cell walls. PMID:27325663

Structural basis for allosteric cross-talk between the asymmetric nucleotide binding sites of a heterodimeric ABC exporter.

PubMed

Hohl, Michael; Hürlimann, Lea M; Böhm, Simon; Schöppe, Jendrik; Grütter, Markus G; Bordignon, Enrica; Seeger, Markus A

2014-07-29

ATP binding cassette (ABC) transporters mediate vital transport processes in every living cell. ATP hydrolysis, which fuels transport, displays positive cooperativity in numerous ABC transporters. In particular, heterodimeric ABC exporters exhibit pronounced allosteric coupling between a catalytically impaired degenerate site, where nucleotides bind tightly, and a consensus site, at which ATP is hydrolyzed in every transport cycle. Whereas the functional phenomenon of cooperativity is well described, its structural basis remains poorly understood. Here, we present the apo structure of the heterodimeric ABC exporter TM287/288 and compare it to the previously solved structure with adenosine 5'-(β,γ-imido)triphosphate (AMP-PNP) bound at the degenerate site. In contrast to other ABC exporter structures, the nucleotide binding domains (NBDs) of TM287/288 remain in molecular contact even in the absence of nucleotides, and the arrangement of the transmembrane domains (TMDs) is not influenced by AMP-PNP binding, a notion confirmed by double electron-electron resonance (DEER) measurements. Nucleotide binding at the degenerate site results in structural rearrangements, which are transmitted to the consensus site via two D-loops located at the NBD interface. These loops owe their name from a highly conserved aspartate and are directly connected to the catalytically important Walker B motif. The D-loop at the degenerate site ties the NBDs together even in the absence of nucleotides and substitution of its aspartate by alanine is well-tolerated. By contrast, the D-loop of the consensus site is flexible and the aspartate to alanine mutation and conformational restriction by cross-linking strongly reduces ATP hydrolysis and substrate transport.

[Complete nucleotide sequences and genome structure of two Chinese tobacco mosaic virus isolates deduced from full-length infectious cDNA clones].

PubMed

Yang, G; Liu, X G; Qiu, B S

2000-07-01

The complete nucleotides of two Chinese tobacco mosaic virus (TMV) isolates, TMV-Cv (vulgare strain) and TMV-N14 (an attenuated virus originated from a tomato strain), were determined from their respective full-length infectious cDNA clones and compared with published TMV sequences. The genome structure of TMV-Cv contained 6395 nucleotides, in which four functional open reading frames (ORF), coding for replicase (126 kD/183 kD), movement protein (MP, 30 kD) and coat protein (CP, 17.6 kD) respectively, could be recognized. TMV-N14 contained 6384 nucleotides in its genome. In contrast to TMV-Cv, five functional ORFs encoding the replicase 98.5 kD/126 kD/183 kD, MP(27 kD) and CP(17.6 kD), respectively, were detected in the TMV-N14 genome. TMV-Cv is 99% homologous to a Korean TMV isolate belonging to the vulgare strain at the nucleotide level. TMV-N14 is 99% homologous to a highly virulent Japanese isolate TMV-L (tomato strain) at the nucleotide level. In TMV-N14, one opal nulation (UGA) occurred in the replicase gene and one ochre nutation (UAA) in the MP gene. The former mutation created a potential, additional ORF within the replicase gene, the latter reduced the size of the MP to 27 kD. In addition, there were also 13 amino acid substitutions in the replicase gene of TMV-N14 when compared to that of TMV-L. Collectively, these changes may have significant implications in the attenuation of the virulence of TMV-N14.

Sequence diversity within the reovirus S2 gene: reovirus genes reassort in nature, and their termini are predicted to form a panhandle motif.

PubMed Central

Chapell, J D; Goral, M I; Rodgers, S E; dePamphilis, C W; Dermody, T S

1994-01-01

To better understand genetic diversity within mammalian reoviruses, we determined S2 nucleotide and deduced sigma 2 amino acid sequences of nine reovirus strains and compared these sequences with those of prototype strains of the three reovirus serotypes. The S2 gene and sigma 2 protein are highly conserved among the four type 1, one type 2, and seven type 3 strains studied. Phylogenetic analyses based on S2 nucleotide sequences of the 12 reovirus strains indicate that diversity within the S2 gene is independent of viral serotype. Additionally, we found marked topological differences between phylogenetic trees generated from S1 and S2 gene nucleotide sequences of the seven type 3 strains. These results demonstrate that reovirus S1 and S2 genes have distinct evolutionary histories, thus providing phylogenetic evidence for lateral transfer of reovirus genes in nature. When variability among the 12 sigma 2-encoding S2 nucleotide sequences was analyzed at synonymous positions, we found that approximately 60 nucleotides at the 5' terminus and 30 nucleotides at the 3' terminus were markedly conserved in comparison with other sigma 2-encoding regions of S2. Predictions of RNA secondary structures indicate that the more conserved S2 sequences participate in the formation of an extended region of duplex RNA interrupted by a pair of stem-loops. Among the 12 deduced sigma 2 amino acid sequences examined, substitutions were observed at only 11% of amino acid positions. This finding suggests that constraints on the structure or function of sigma 2, perhaps in part because of its location in the virion core, have limited sequence diversity within this protein. PMID:8289378

Modular Organization of Residue-Level Contacts Shapes the Selection Pressure on Individual Amino Acid Sites of Ribosomal Proteins.

PubMed

Mallik, Saurav; Kundu, Sudip

2017-04-01

Understanding the molecular evolution of macromolecular complexes in the light of their structure, assembly, and stability is of central importance. Here, we address how the modular organization of native molecular contacts shapes the selection pressure on individual residue sites of ribosomal complexes. The bacterial ribosomal complex is represented as a residue contact network where nodes represent amino acid/nucleotide residues and edges represent their van der Waals interactions. We find statistically overrepresented native amino acid-nucleotide contacts (OaantC, one amino acid contacts one or multiple nucleotides, internucleotide contacts are disregarded). Contact number is defined as the number of nucleotides contacted. Involvement of individual amino acids in OaantCs with smaller contact numbers is more random, whereas only a few amino acids significantly contribute to OaantCs with higher contact numbers. An investigation of structure, stability, and assembly of bacterial ribosome depicts the involvement of these OaantCs in diverse biophysical interactions stabilizing the complex, including high-affinity protein-RNA contacts, interprotein cooperativity, intersubunit bridge, packing of multiple ribosomal RNA domains, etc. Amino acid-nucleotide constituents of OaantCs with higher contact numbers are generally associated with significantly slower substitution rates compared with that of OaantCs with smaller contact numbers. This evolutionary rate heterogeneity emerges from the strong purifying selection pressure that conserves the respective amino acid physicochemical properties relevant to the stabilizing interaction with OaantC nucleotides. An analysis of relative molecular orientations of OaantC residues and their interaction energetics provides the biophysical ground of purifying selection conserving OaantC amino acid physicochemical properties. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Acid-soluble nucleotides of pinto bean leaves at different stages of development.

PubMed

Weinstein, L H; McCune, D C; Mancini, J F; van Leuken, P

1969-11-01

Acid-soluble nucleotides of unifoliate leaves of Pinto bean plants (Phaseolus vulgaris L.) were determined at young, mature, and senescent stages of development. At least 25 components could be distinguished on the basis of inorganic phosphorus determinations and 37 or more fractions on the basis of (32)P labeling, with adenosine di- and triphosphates accounting for 60% of the total moles of nucleotide. The total nucleotide P and inorganic P, on a fresh weight basis, decreased about 44% between each stage of leaf development, but decrements in the levels of individual nucleotides varied from this over-all pattern.Minor changes in the relative abundance of the individual nucleotides accompanied aging although the percentage of purine-containing nucleotides decreased with age. Total (32)P activity per leaf in the nucleotide pool increased about 3-fold between the young and mature leaves and decreased slightly as leaves became senescent. In general, the specific activities of the nucleotides increased with increased age and adenosine-, guanosine-, uridine-, and cytidine triphosphates and adenosine diphosphate accounted for approximately 90% of the total activity. The changes in the relative sizes and energy status of the nucleotide pools were not so obvious as the changes in other metabolites that have been reported to accompany aging in leaf tissue.

Genomewide analysis of reassortment and evolution of human influenza A(H3N2) viruses circulating between 1968 and 2011.

PubMed

Westgeest, Kim B; Russell, Colin A; Lin, Xudong; Spronken, Monique I J; Bestebroer, Theo M; Bahl, Justin; van Beek, Ruud; Skepner, Eugene; Halpin, Rebecca A; de Jong, Jan C; Rimmelzwaan, Guus F; Osterhaus, Albert D M E; Smith, Derek J; Wentworth, David E; Fouchier, Ron A M; de Graaf, Miranda

2014-03-01

Influenza A(H3N2) viruses became widespread in humans during the 1968 H3N2 virus pandemic and have been a major cause of influenza epidemics ever since. These viruses evolve continuously by reassortment and genomic evolution. Antigenic drift is the cause for the need to update influenza vaccines frequently. Using two data sets that span the entire period of circulation of human influenza A(H3N2) viruses, it was shown that influenza A(H3N2) virus evolution can be mapped to 13 antigenic clusters. Here we analyzed the full genomes of 286 influenza A(H3N2) viruses from these two data sets to investigate the genomic evolution and reassortment patterns. Numerous reassortment events were found, scattered over the entire period of virus circulation, but most prominently in viruses circulating between 1991 and 1998. Some of these reassortment events persisted over time, and one of these coincided with an antigenic cluster transition. Furthermore, selection pressures and nucleotide and amino acid substitution rates of all proteins were studied, including those of the recently discovered PB1-N40, PA-X, PA-N155, and PA-N182 proteins. Rates of nucleotide and amino acid substitutions were most pronounced for the hemagglutinin, neuraminidase, and PB1-F2 proteins. Selection pressures were highest in hemagglutinin, neuraminidase, matrix 1, and nonstructural protein 1. This study of genotype in relation to antigenic phenotype throughout the period of circulation of human influenza A(H3N2) viruses leads to a better understanding of the evolution of these viruses. Each winter, influenza virus infects approximately 5 to 15% of the world's population, resulting in significant morbidity and mortality. Influenza A(H3N2) viruses evolve continuously by reassortment and genomic evolution. This leads to changes in antigenic recognition (antigenic drift) which make it necessary to update vaccines against influenza A(H3N2) viruses frequently. In this study, the relationship of genetic evolution to antigenic change spanning the entire period of A(H3N2) virus circulation was studied for the first time. The results presented in this study contribute to a better understanding of genetic evolution in correlation with antigenic evolution of influenza A(H3N2) viruses.

Hybridization properties of long nucleic acid probes for detection of variable target sequences, and development of a hybridization prediction algorithm

PubMed Central

Öhrmalm, Christina; Jobs, Magnus; Eriksson, Ronnie; Golbob, Sultan; Elfaitouri, Amal; Benachenhou, Farid; Strømme, Maria; Blomberg, Jonas

2010-01-01

One of the main problems in nucleic acid-based techniques for detection of infectious agents, such as influenza viruses, is that of nucleic acid sequence variation. DNA probes, 70-nt long, some including the nucleotide analog deoxyribose-Inosine (dInosine), were analyzed for hybridization tolerance to different amounts and distributions of mismatching bases, e.g. synonymous mutations, in target DNA. Microsphere-linked 70-mer probes were hybridized in 3M TMAC buffer to biotinylated single-stranded (ss) DNA for subsequent analysis in a Luminex® system. When mismatches interrupted contiguous matching stretches of 6 nt or longer, it had a strong impact on hybridization. Contiguous matching stretches are more important than the same number of matching nucleotides separated by mismatches into several regions. dInosine, but not 5-nitroindole, substitutions at mismatching positions stabilized hybridization remarkably well, comparable to N (4-fold) wobbles in the same positions. In contrast to shorter probes, 70-nt probes with judiciously placed dInosine substitutions and/or wobble positions were remarkably mismatch tolerant, with preserved specificity. An algorithm, NucZip, was constructed to model the nucleation and zipping phases of hybridization, integrating both local and distant binding contributions. It predicted hybridization more exactly than previous algorithms, and has the potential to guide the design of variation-tolerant yet specific probes. PMID:20864443

Can mutational GC-pressure create new linear B-cell epitopes in herpes simplex virus type 1 glycoprotein B?

PubMed

Khrustalev, Vladislav Victorovich

2009-01-01

We showed that GC-content of nucleotide sequences coding for linear B-cell epitopes of herpes simplex virus type 1 (HSV1) glycoprotein B (gB) is higher than GC-content of sequences coding for epitope-free regions of this glycoprotein (G + C = 73 and 64%, respectively). Linear B-cell epitopes have been predicted in HSV1 gB by BepiPred algorithm ( www.cbs.dtu.dk/services/BepiPred ). Proline is an acrophilic amino acid residue (it is usually situated on the surface of protein globules, and so included in linear B-cell epitopes). Indeed, the level of proline is much higher in predicted epitopes of gB than in epitope-free regions (17.8% versus 1.8%). This amino acid is coded by GC-rich codons (CCX) that can be produced due to nucleotide substitutions caused by mutational GC-pressure. GC-pressure will also lead to disappearance of acrophobic phenylalanine, isoleucine, methionine and tyrosine coded by GC-poor codons. Results of our "in-silico directed mutagenesis" showed that single nonsynonymous substitutions in AT to GC direction in two long epitope-free regions of gB will cause formation of new linear epitopes or elongation of previously existing epitopes flanking these regions in 25% of 539 possible cases. The calculations of GC-content and amino acid content have been performed by CodonChanges algorithm ( www.barkovsky.hotmail.ru ).

RY-Coding and Non-Homogeneous Models Can Ameliorate the Maximum-Likelihood Inferences From Nucleotide Sequence Data with Parallel Compositional Heterogeneity.

PubMed

Ishikawa, Sohta A; Inagaki, Yuji; Hashimoto, Tetsuo

2012-01-01

In phylogenetic analyses of nucleotide sequences, 'homogeneous' substitution models, which assume the stationarity of base composition across a tree, are widely used, albeit individual sequences may bear distinctive base frequencies. In the worst-case scenario, a homogeneous model-based analysis can yield an artifactual union of two distantly related sequences that achieved similar base frequencies in parallel. Such potential difficulty can be countered by two approaches, 'RY-coding' and 'non-homogeneous' models. The former approach converts four bases into purine and pyrimidine to normalize base frequencies across a tree, while the heterogeneity in base frequency is explicitly incorporated in the latter approach. The two approaches have been applied to real-world sequence data; however, their basic properties have not been fully examined by pioneering simulation studies. Here, we assessed the performances of the maximum-likelihood analyses incorporating RY-coding and a non-homogeneous model (RY-coding and non-homogeneous analyses) on simulated data with parallel convergence to similar base composition. Both RY-coding and non-homogeneous analyses showed superior performances compared with homogeneous model-based analyses. Curiously, the performance of RY-coding analysis appeared to be significantly affected by a setting of the substitution process for sequence simulation relative to that of non-homogeneous analysis. The performance of a non-homogeneous analysis was also validated by analyzing a real-world sequence data set with significant base heterogeneity.

Structural and functional effects of nucleotide variation on the human TB drug metabolizing enzyme arylamine N-acetyltransferase 1.

PubMed

Cloete, Ruben; Akurugu, Wisdom A; Werely, Cedric J; van Helden, Paul D; Christoffels, Alan

2017-08-01

The human arylamine N-acetyltransferase 1 (NAT1) enzyme plays a vital role in determining the duration of action of amine-containing drugs such as para-aminobenzoic acid (PABA) by influencing the balance between detoxification and metabolic activation of these drugs. Recently, four novel single nucleotide polymorphisms (SNPs) were identified within a South African mixed ancestry population. Modeling the effects of these SNPs within the structural protein was done to assess possible structure and function changes in the enzyme. The use of molecular dynamics simulations and stability predictions indicated less thermodynamically stable protein structures containing E264K and V231G, while the N245I change showed a stabilizing effect. Coincidently the N245I change displayed a similar free energy landscape profile to the known R64W amino acid substitution (slow acetylator), while the R242M displayed a similar profile to the published variant, I263V (proposed fast acetylator), and the wild type protein structure. Similarly, principal component analysis indicated that two amino acid substitutions (E264K and V231G) occupied less conformational clusters of folded states as compared to the WT and were found to be destabilizing (may affect protein function). However, two of the four novel SNPs that result in amino acid changes: (V231G and N245I) were predicted by both SIFT and POLYPHEN-2 algorithms to affect NAT1 protein function, while two other SNPs that result in R242M and E264K substitutions showed contradictory results based on SIFT and POLYPHEN-2 analysis. In conclusion, the structural methods were able to verify that two non-synonymous substitutions (E264K and V231G) can destabilize the protein structure, and are in agreement with mCSM predictions, and should therefore be experimentally tested for NAT1 activity. These findings could inform a strategy of incorporating genotypic data (i.e., functional SNP alleles) with phenotypic information (slow or fast acetylator) to better prescribe effective treatment using drugs metabolized by NAT1. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Genetic and evolutionary characterization of RABVs from China using the phosphoprotein gene.

PubMed

Wang, Lihua; Wu, Hui; Tao, Xiaoyan; Li, Hao; Rayner, Simon; Liang, Guodong; Tang, Qing

2013-01-07

While the function of the phosphoprotein (P) gene of the rabies virus (RABV) has been well studied in laboratory adapted RABVs, the genetic diversity and evolution characteristics of the P gene of street RABVs remain unclear. The objective of the present study was to investigate the mutation and evolution of P genes in Chinese street RABVs. The P gene of 77 RABVs from brain samples of dogs and wild animals collected in eight Chinese provinces through 2003 to 2008 were sequenced. The open reading frame (ORF) of the P genes was 894 nucleotides (nt) in length, with 85-99% (80-89%) amino acid (nucleotide) identity compared with the laboratory RABVs and vaccine strains. Phylogenetic analysis based on the P gene revealed that Chinese RABVs strains could be divided into two distinct clades, and several RABV variants were found to co circulating in the same province. Two conserved (CD1, 2) and two variable (VD1, 2) domains were identified by comparing the deduced primary sequences of the encoded P proteins. Two sequence motifs, one believed to confer binding to the cytoplasmic dynein light chain LC8 and a lysine-rich sequence were conserved throughout the Chinese RABVs. In contrast, the isolates exhibited lower conservation of one phosphate acceptor and one internal translation initiation site identified in the P protein of the rabies challenge virus standard (CVS) strain. Bayesian coalescent analysis showed that the P gene in Chinese RABVs have a substitution rate (3.305x10(-4) substitutions per site per year) and evolution history (592 years ago) similar to values for the glycoprotein (G) and nucleoprotein (N) reported previously. Several substitutions were found in the P gene of Chinese RABVs strains compared to the laboratory adapted and vaccine strains, whether these variations could affect the biological characteristics of Chinese RABVs need to be further investigated. The substitution rate and evolution history of P gene is similar to G and N gene, combine the topology of phylogenetic tree based on the P gene is similar to the G and N gene trees, indicate that the P, G and N genes are equally valid for examining the phylogenetics of RABVs.

Subtype specific internalization of P2Y1 and P2Y2 receptors induced by novel adenosine 5′-O-(1-boranotriphosphate) derivatives

PubMed Central

Tulapurkar, M E; Laubinger, W; Nahum, V; Fischer, B; Reiser, G

2004-01-01

P2Y-nucleotide receptors represent important targets for drug development. The lack of stable and receptor specific agonists, however, has prevented successful therapeutic applications. A novel series of P-boronated ATP derivatives (ATP-α-B) were synthesized by substitution of a nonbridging O at Pα with a BH3 group. This introduces a chiral center, thus resulting in diastereoisomers. In addition, at C2 of the adenine ring a further substitution was made (Cl- or methylthio-). The pairs of diastereoisomers were denoted here as A and B isomers. Here, we tested the receptor subtype specificity of these analogs on HEK 293 cells stably expressing rat P2Y1 and rat P2Y2 receptors, respectively, both attached to the fluorescent marker protein GFP (rP2Y1-GFP, rP2Y2-GFP). We investigated agonist-induced receptor endocytosis, [Ca2+]i rise and arachidonic acid (AA) release. Agonist-induced endocytosis of rP2Y1-GFP was more pronounced for the A isomers than the corresponding B counterparts for all ATP-α-B analogs. Both 2-MeS-substituted diastereoisomers induced a greater degree of agonist-induced receptor endocytosis as compared to the 2-Cl-substituted derivatives. Endocytosis results are in accordance with the potency to induce Ca2+ release by these compounds in HEK 293 cells stably transfected with rP2Y1. In case of rP2Y2-GFP, the borano-nucleotides were very weak agonists in comparison to UTP and ATP in terms of Ca2+ release, AA release and in inducing receptor endocytosis. The different ATP-α-B derivatives and also the diastereoisomers were equally ineffective. Thus, the new agonists may be considered as potent and highly specific agonist drug candidates for P2Y1 receptors. The difference in activity of the ATP analogs at P2Y receptors could be used as a tool to investigate structural differences between P2Y receptor subtypes. PMID:15197109

Influence of adequate pelvic floor muscle contraction on the movement of the coccyx during pelvic floor muscle training.

PubMed

Fujisaki, Akiko; Shigeta, Miwa; Shimoinaba, Misa; Yoshimura, Yasukuni

2018-04-01

[Purpose] Pelvic floor muscle training is a first-line therapy for female stress urinary incontinence. Previous studies have suggested that the coccyx tip moves ventrally and cranially during pelvic floor muscle contraction. The study aimed to elucidate the influence of adequate pelvic floor muscle contraction on coccyx movement. [Subjects and Methods] Sixty-three females (57 patients with stress urinary incontinence and additional 6 healthy volunteers) were enrolled. Using magnetic resonance imaging, coccyx movement was evaluated during pelvic floor muscle contraction and strain. An adequate contraction was defined as a contraction with good Oxford grading scale [≥3] and without inadequate muscle substitution patterns. [Results] Inadequate muscle substitution patterns were observed in 33 participants (52.4%). No significant difference was observed in the movement of the coccyx tip in the ventrodorsal direction between females with and without inadequate muscle substitution patterns. However, a significant increase in the movement of the coccyx tip in the cranial direction was detected in the group without inadequate muscle substitution patterns. Compared to participants with inadequate pelvic floor muscle contraction, those who had adequate pelvic floor muscle contraction exhibited significantly increased cranial movement of the coccyx. [Conclusion] Adequate pelvic floor muscle contraction can produce cranial movement of the coccyx tip.

No variation and low synonymous substitution rates in coral mtDNA despite high nuclear variation

PubMed Central

Hellberg, Michael E

2006-01-01

Background The mitochondrial DNA (mtDNA) of most animals evolves more rapidly than nuclear DNA, and often shows higher levels of intraspecific polymorphism and population subdivision. The mtDNA of anthozoans (corals, sea fans, and their kin), by contrast, appears to evolve slowly. Slow mtDNA evolution has been reported for several anthozoans, however this slow pace has been difficult to put in phylogenetic context without parallel surveys of nuclear variation or calibrated rates of synonymous substitution that could permit quantitative rate comparisons across taxa. Here, I survey variation in the coding region of a mitochondrial gene from a coral species (Balanophyllia elegans) known to possess high levels of nuclear gene variation, and estimate synonymous rates of mtDNA substitution by comparison to another coral (Tubastrea coccinea). Results The mtDNA surveyed (630 bp of cytochrome oxidase subunit I) was invariant among individuals sampled from 18 populations spanning 3000 km of the range of B. elegans, despite high levels of variation and population subdivision for allozymes over these same populations. The synonymous substitution rate between B. elegans and T. coccinea (0.05%/site/106 years) is similar to that in most plants, but 50–100 times lower than rates typical for most animals. In addition, while substitutions to mtDNA in most animals exhibit a strong bias toward transitions, mtDNA from these corals does not. Conclusion Slow rates of mitochondrial nucleotide substitution result in low levels of intraspecific mtDNA variation in corals, even when nuclear loci vary. Slow mtDNA evolution appears to be the basal condition among eukaryotes. mtDNA substitution rates switch from slow to fast abruptly and unidirectionally. This switch may stem from the loss of just one or a few mitochondrion-specific DNA repair or replication genes. PMID:16542456

Design of character-based DNA barcode motif for species identification: A computational approach and its validation in fishes.

PubMed

Chakraborty, Mohua; Dhar, Bishal; Ghosh, Sankar Kumar

2017-11-01

The DNA barcodes are generally interpreted using distance-based and character-based methods. The former uses clustering of comparable groups, based on the relative genetic distance, while the latter is based on the presence or absence of discrete nucleotide substitutions. The distance-based approach has a limitation in defining a universal species boundary across the taxa as the rate of mtDNA evolution is not constant throughout the taxa. However, character-based approach more accurately defines this using a unique set of nucleotide characters. The character-based analysis of full-length barcode has some inherent limitations, like sequencing of the full-length barcode, use of a sparse-data matrix and lack of a uniform diagnostic position for each group. A short continuous stretch of a fragment can be used to resolve the limitations. Here, we observe that a 154-bp fragment, from the transversion-rich domain of 1367 COI barcode sequences can successfully delimit species in the three most diverse orders of freshwater fishes. This fragment is used to design species-specific barcode motifs for 109 species by the character-based method, which successfully identifies the correct species using a pattern-matching program. The motifs also correctly identify geographically isolated population of the Cypriniformes species. Further, this region is validated as a species-specific mini-barcode for freshwater fishes by successful PCR amplification and sequencing of the motif (154 bp) using the designed primers. We anticipate that use of such motifs will enhance the diagnostic power of DNA barcode, and the mini-barcode approach will greatly benefit the field-based system of rapid species identification. © 2017 John Wiley & Sons Ltd.

Regulatory single nucleotide polymorphisms (rSNPs) at the promoters 1A and 1B of the human APC gene.

PubMed

Matveeva, Marina Yu; Kashina, Elena V; Reshetnikov, Vasily V; Bryzgalov, Leonid O; Antontseva, Elena V; Bondar, Natalia P; Merkulova, Tatiana I

2016-12-22

Germline mutations in the coding sequence of the tumour suppressor APC gene give rise to familial adenomatous polyposis (which leads to colorectal cancer) and are associated with many other oncopathologies. The loss of APC function because of deletion of putative promoter 1A or 1B also results in the development of colorectal cancer. Since the regions of promoters 1A and 1B contain many single nucleotide polymorphisms (SNPs), the aim of this study was to perform functional analysis of some of these SNPs by means of an electrophoretic mobility shift assay (EMSA) and a luciferase reporter assay. First, it was shown that both putative promoters of APC (1A and 1B) drive transcription in an in vitro reporter experiment. From eleven randomly selected SNPs of promoter 1A and four SNPs of promoter 1B, nine and two respectively showed differential patterns of binding of nuclear proteins to oligonucleotide probes corresponding to alternative alleles. The luciferase reporter assay showed that among the six SNPs tested, the rs75612255 C allele and rs113017087 C allele in promoter 1A as well as the rs138386816 T allele and rs115658307 T allele in promoter 1B significantly increased luciferase activity in the human erythromyeloblastoid leukaemia cell line K562. In human colorectal cancer HCT-116 cells, none of the substitutions under study had any effect, with the exception of minor allele G of rs79896135 in promoter 1B. This allele significantly decreased the luciferase reporter's activity CONCLUSION: Our results indicate that many SNPs in APC promoters 1A and 1B are functionally relevant and that allele G of rs79896135 may be associated with the predisposition to colorectal cancer.

Genome-Wide Biases in the Rate and Molecular Spectrum of Spontaneous Mutations in Vibrio cholerae and Vibrio fischeri.

PubMed

Dillon, Marcus M; Sung, Way; Sebra, Robert; Lynch, Michael; Cooper, Vaughn S

2017-01-01

The vast diversity in nucleotide composition and architecture among bacterial genomes may be partly explained by inherent biases in the rates and spectra of spontaneous mutations. Bacterial genomes with multiple chromosomes are relatively unusual but some are relevant to human health, none more so than the causative agent of cholera, Vibrio cholerae Here, we present the genome-wide mutation spectra in wild-type and mismatch repair (MMR) defective backgrounds of two Vibrio species, the low-%GC squid symbiont V. fischeri and the pathogen V. cholerae, collected under conditions that greatly minimize the efficiency of natural selection. In apparent contrast to their high diversity in nature, both wild-type V. fischeri and V. cholerae have among the lowest rates for base-substitution mutations (bpsms) and insertion-deletion mutations (indels) that have been measured, below 10 - 3 /genome/generation. Vibrio fischeri and V. cholerae have distinct mutation spectra, but both are AT-biased and produce a surprising number of multi-nucleotide indels. Furthermore, the loss of a functional MMR system caused the mutation spectra of these species to converge, implying that the MMR system itself contributes to species-specific mutation patterns. Bpsm and indel rates varied among genome regions, but do not explain the more rapid evolutionary rates of genes on chromosome 2, which likely result from weaker purifying selection. More generally, the very low mutation rates of Vibrio species correlate inversely with their immense population sizes and suggest that selection may not only have maximized replication fidelity but also optimized other polygenic traits relative to the constraints of genetic drift. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

A genome-wide scan study identifies a single nucleotide substitution in ASIP associated with white versus non-white coat-colour variation in sheep (Ovis aries)

PubMed Central

Li, M-H; Tiirikka, T; Kantanen, J

2014-01-01

In sheep, coat colour (and pattern) is one of the important traits of great biological, economic and social importance. However, the genetics of sheep coat colour has not yet been fully clarified. We conducted a genome-wide association study of sheep coat colours by genotyping 47 303 single-nucleotide polymorphisms (SNPs) in the Finnsheep population in Finland. We identified 35 SNPs associated with all the coat colours studied, which cover genomic regions encompassing three known pigmentation genes (TYRP1, ASIP and MITF) in sheep. Eighteen of these associations were confirmed in further tests between white versus non-white individuals, but none of the 35 associations were significant in the analysis of only non-white colours. Across the tests, the s66432.1 in ASIP showed significant association (P=4.2 × 10−11 for all the colours; P=2.3 × 10−11 for white versus non-white colours) with the variation in coat colours and strong linkage disequilibrium with other significant variants surrounding the ASIP gene. The signals detected around the ASIP gene were explained by differences in white versus non-white alleles. Further, a genome scan for selection for white coat pigmentation identified a strong and striking selection signal spanning ASIP. Our study identified the main candidate gene for the coat colour variation between white and non-white as ASIP, an autosomal gene that has been directly implicated in the pathway regulating melanogenesis. Together with ASIP, the two other newly identified genes (TYRP1 and MITF) in the Finnsheep, bordering associated SNPs, represent a new resource for enriching sheep coat-colour genetics and breeding. PMID:24022497

Masking as an effective quality control method for next-generation sequencing data analysis.

PubMed

Yun, Sajung; Yun, Sijung

2014-12-13

Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

Nucleotide diversity at two phytochrome loci along a latitudinal cline in Pinus sylvestris.

PubMed

García-Gil, M R; Mikkonen, M; Savolainen, O

2003-05-01

Forest tree species provide many examples of well-studied adaptive differentiation, where the search for the underlying genes might be possible. In earlier studies and in our common conditions in a greenhouse, northern populations set bud earlier than southern ones. A difference in latitude of origin of one degree corresponded to a change of 1.4 days in number of days to terminal bud set of seedlings. Earlier physiological and ecological genetics work in conifers and other plants have suggested that such variation could be governed by phytochromes. Nucleotide variation was examined at two phytochrome loci (PHYP and PHYO, homologues of the Arabidopsis thaliana PHYB and PHYA, respectively) in three populations: northern Finland, southern Finland and northern Spain. In our samples of 12-15 sequences (2980 and 1156 base pairs at the two loci) we found very low nonsynonymous variation; pi was 0.0003 and 0.0002 at PHYP and PHYO loci, respectively. There was no functional differentiation between populations at the photosensory domains of either locus. The overall silent variation was also low, only 0.0024 for the PHYP locus. The low estimates of silent variation are consistent with the estimated low synonymous substitution rates between Pinus sylvestris and Picea abies at the PHYO locus. Despite the low level of nucleotide variation, haplotypic diversity was relatively high (0.42 and 0.41 for fragments of 1156 nucleotides) at the two loci.

Molecular population genetics of inversion breakpoint regions in Drosophila pseudoobscura.

PubMed

Wallace, Andre G; Detweiler, Don; Schaeffer, Stephen W

2013-07-08

Paracentric inversions in populations can have a profound effect on the pattern and organization of nucleotide variability along a chromosome. Regions near inversion breakpoints are expected to have greater levels of differentiation because of reduced genetic exchange between different gene arrangements whereas central regions in the inverted segments are predicted to have lower levels of nucleotide differentiation due to greater levels of genetic flux among different karyotypes. We used the inversion polymorphism on the third chromosome of Drosophila pseudoobscura to test these predictions with an analysis of nucleotide diversity of 18 genetic markers near and away from inversion breakpoints. We tested hypotheses about how the presence of different chromosomal arrangements affects the pattern and organization of nucleotide variation. Overall, markers in the distal segment of the chromosome had greater levels of nucleotide heterozygosity than markers within the proximal segment of the chromosome. In addition, our results rejected the hypothesis that the breakpoints of derived inversions will have lower levels of nucleotide variability than breakpoints of ancestral inversions, even when strains with gene conversion events were removed. High levels of linkage disequilibrium were observed within all 11 breakpoint regions as well as between the ends of most proximal and distal breakpoints. The central region of the chromosome had the greatest levels of linkage disequilibrium compared with the proximal and distal regions because this is the region that experiences the highest level of recombination suppression. These data do not fully support the idea that genetic exchange is the sole force that influences genetic variation on inverted chromosomes.

Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.

Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donormore » ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.« less

Analysis of the breast milk of giant pandas (Ailuropoda melanoleuca) and the preparation of substitutes

PubMed Central

ZHANG, Zhihe; HOU, Rong; LAN, Jingchao; WANG, Hairui; KUROKAWA, Hiroyuki; TAKATSU, Zenta; KOBAYASHI, Toyokazu; KOIE, Hiroshi; KAMATA, Hiroshi; KANAYAMA, Kiichi; WATANABE, Toshi

2016-01-01

The first milk substitute for giant panda cubs was developed in 1988 based on limited data about giant panda breast milk and that of certain types of bear. Mixtures of other formulas have also been fed to cubs at some facilities. However, they are not of sufficient nutritional quality for promoting growth in panda cubs. Here, we report analysis of giant panda breast milk and propose new milk substitutes for cubs, which were developed based on the results of our analysis. The Chengdu Research Base of Giant Panda Breeding obtained breast milk samples from three giant pandas. Up to 30 ml of breast milk were collected from each mother by hand. Then, the milk samples were frozen and sent to Nihon University. The levels of protein, fat, carbohydrates, ash, moisture, vitamins, minerals, total amino acids, fatty acids, lactose and other carbohydrates in the milk were analyzed. The breast milk samples exhibited the following nutritional values: protein: 6.6–8.5%, fat: 6.9–16.4%, carbohydrates: 2.5–9.1%, ash: 0.9–1.0% and moisture: 67–83%. We designed two kinds of milk substitutes based on the data obtained and the nutritional requirements of dogs, cats and rodents. The nutritional composition of the milk substitutes for the first and second stages was as follows: protein: 38 and 26%, fat: 40 and 40%, carbohydrates: 13 and 25%, ash: 6 and 6% and moisture: 3 and 3%, respectively. In addition, the substitutes contained vitamins, minerals, taurine, docosahexaenoic acid, lactoferrin, nucleotides and other nutrients. PMID:26781707

Characteristics of a group of nonnucleoside reverse transcriptase inhibitors with structural diversity and potent anti-human immunodeficiency virus activity.

PubMed

Yang, S S; Fliakas-Boltz, V; Bader, J P; Buckheit, R W

1995-10-01

Current thrust in controlling the Acquired Immune Deficiency Syndrome (AIDS) focuses on antiviral drug development targeting the infection and replication of the human immunodeficiency virus (HIV), the causative agent of AIDS. To date, treatment of AIDS has relied on nucleoside reverse transcriptase inhibitors such as AZT, ddI, and ddC, which eventually become ineffective upon the emergence of resistant mutants bearing specific nucleotide substitutions. The Anti-AIDS Drug Screening Program of the NCI conducts and coordinates a high-capacity semi-robotic in vitro screening of synthetic or natural compounds submitted by academic, research and pharmaceutical institutions world-wide. About 10,000 synthetic compounds are screened annually for anti-HIV activity. Confirmed active agents are subjected to in-depth studies on range and mechanism of action. Emerging from this intense screening activity were a number of potentially promising categories of nonnucleoside reverse transcriptase inhibitors (NNRTI) with structural diversity but strong and reproducible anti-HIV activity. Over 2500 active compounds were evaluated for their inhibitory activity against a panel of both laboratory and clinical virus isolates in the appropriate established cell line or fresh human peripheral blood leukocyte and macrophage preparations. Out of these, 40 agents could be placed structurally in nine categories with an additional 16 unique compounds that share the characteristics of NNRTI. These NNRTIs were shown to inhibit reverse transcriptase enzymatically using homopolymeric or ribosomal RNA as templates. NNRTIs demonstrated similarity in their inhibitory pattern against the HIV-1 laboratory strains IIIB and RF, and an AZT-resistant strain; all were inactive against HIV-2. These compounds were further tested against NNRTI-resistant HIV-1 isolates. NNRTI-resistant HIV-1 isolates were selected and characterized with respect to the change(s) in the viral reverse transcriptase nucleotide sequence. Also, differential cross-resistance or sensitivity patterns to NNRTIs were studied in detail among NNRTI-resistant mutants. When tested in combination with AZT, all of the NNRTI's uniformly exhibited synergistic inhibition of HIV-1, suggesting that combination antiviral therapy of NNRTIs with AZT may be therapeutically promising for AIDS treatment.

[Studying of molecular mechanisms of rubella virus attenuation evidence from Russian strain C-77].

PubMed

Dmitriev, G V; Borisova, T K; Faĭzuloev, E B; Zabiiaka, Iu I; Desiatskova, R G; Zverev, V V

2012-01-01

Live attenuated rubella vaccine is used for vaccination. Temperature-sensitive (ts) phenotype was proved for almost all rubella vaccine strains, and the acquisition of the ts phenotype during cold adaptation was strongly correlated with the attenuation of the wild-type viruses. Nevertheless, the molecular mechanisms of the attenuation have been insufficiently understood for rubella virus. Study ofthese mechanisms, identifying genotypic markers of attenuation, which together with the sequence analyses could be used for genetic stability control of vaccine strains, is still of current interest. In this work, we determined nearly complete genome sequences of attenuated (ca) and the wildtype progenitor (wt) of the rubella virus strain C-77 isolated in Russia. Possible genetic determinants of attenuation were detected. Thus, 13 nucleotide differences leading to 6 amino acid substitutions were found. Four amino acid substitutions were found to be almost unique. Special consideration should be given to Tyr1042Cys substitution in the protease domain of C-77 strain, because it most probably plays the crucial role in acquisition of ts-phenotype.

Synthesis and biological evaluation of a series of tangeretin-derived chalcones.

PubMed

Quintin, Jérôme; Desrivot, Julie; Thoret, Sylviane; Le Menez, Patrick; Cresteil, Thierry; Lewin, Guy

2009-01-01

A series of chalcones polyoxygenated on the ring A (with pentamethoxy or 2'-hydroxy-3',4',5',6'-tetramethoxy substitution patterns) was synthesized from tangeretin, a natural Citrus flavonoid. These chalcones were evaluated for their antiproliferative, activation of apoptosis, inhibition of tubulin assembly and antileishmanial activities. Comparison with the reference analogous 3',4',5'-trimethoxylated chalcones showed that such peroxygenated substitution patterns on the ring A were less beneficial to these activities.

E2FM: an encrypted and compressed full-text index for collections of genomic sequences.

PubMed

Montecuollo, Ferdinando; Schmid, Giovannni; Tagliaferri, Roberto

2017-09-15

Next Generation Sequencing (NGS) platforms and, more generally, high-throughput technologies are giving rise to an exponential growth in the size of nucleotide sequence databases. Moreover, many emerging applications of nucleotide datasets-as those related to personalized medicine-require the compliance with regulations about the storage and processing of sensitive data. We have designed and carefully engineered E 2 FM -index, a new full-text index in minute space which was optimized for compressing and encrypting nucleotide sequence collections in FASTA format and for performing fast pattern-search queries. E 2 FM -index allows to build self-indexes which occupy till to 1/20 of the storage required by the input FASTA file, thus permitting to save about 95% of storage when indexing collections of highly similar sequences; moreover, it can exactly search the built indexes for patterns in times ranging from few milliseconds to a few hundreds milliseconds, depending on pattern length. Source code is available at https://github.com/montecuollo/E2FM . ferdinando.montecuollo@unicampania.it. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Computing sparse derivatives and consecutive zeros problem

NASA Astrophysics Data System (ADS)

Chandra, B. V. Ravi; Hossain, Shahadat

2013-02-01

We describe a substitution based sparse Jacobian matrix determination method using algorithmic differentiation. Utilizing the a priori known sparsity pattern, a compression scheme is determined using graph coloring. The "compressed pattern" of the Jacobian matrix is then reordered into a form suitable for computation by substitution. We show that the column reordering of the compressed pattern matrix (so as to align the zero entries into consecutive locations in each row) can be viewed as a variant of traveling salesman problem. Preliminary computational results show that on the test problems the performance of nearest-neighbor type heuristic algorithms is highly encouraging.

Distinct molecular structures and hydrogen bond patterns of α,α-diethyl-substituted cyclic imide, lactam, and acetamide derivatives in the crystalline phase

NASA Astrophysics Data System (ADS)

Krivoshein, Arcadius V.; Ordonez, Carlos; Khrustalev, Victor N.; Timofeeva, Tatiana V.

2016-10-01

α,α-Dialkyl- and α-alkyl-α-aryl-substituted cyclic imides, lactams, and acetamides show promising anticonvulsant, anxiolytic, and anesthetic activities. While a number of crystal structures of various α-substituted cyclic imides, lactams, and acetamides were reported, no in-depth comparison of crystal structures and solid-state properties of structurally matched compounds have been carried out so far. In this paper, we report molecular structure and intermolecular interactions of three α,α-diethyl-substituted compounds - 3,3-diethylpyrrolidine-2,5-dione, 3,3-diethylpyrrolidin-2-one, and 2,2-diethylacetamide - in the crystalline phase, as studied using single-crystal X-ray diffraction and IR spectroscopy. We found considerable differences in the patterns of H-bonding and packing of the molecules in crystals. These differences correlate with the compounds' melting points and are of significance to physical pharmacy and formulation development of neuroactive drugs.

[Nucleotidic variations of two captive groups of tepezcuintle, Agouti paca (Rodentia: Agoutidae), from two sites in Yucatan, Mexico].

PubMed

Montes-Pérez, Rubén C; García, Adán W Echeverría; Castro, Jorge Zavala; Gamboa, Militza G Alfaro

2006-09-01

The objective of this work was to estimate the nucleotidic variation between two groups of tepezcuintles (Agouti paca) from the states of Campeche and Quintana Roo, Mexico and within members of each group. Blood samples were collected from eleven A. paca kept in captivity. DNA from leukocytic cells was used for Ramdom Amplification of DNA Polimorphism (RAPD). The primers three 5'-d(GTAGACCCGT)- 3' and six 5'-d(CCCGTCAGCA)- 3' were selected from de Amersham kit (Ready.To.Go. RAPD Analysis Beads, Amersham Pharmacia Biotech), because they produced an adequate number of bands. The electrophoretic pattern of bands obtained was analyzed using software for phylogenetic analysis based on the UPGMA method, to estimate the units of nucleotidic variation. The phylogenetic tree obtained with primer three reveals a dicotomic grouping between the animals from both states in the Yucatan Peninsula showing a divergent value of 1.983 nucleotides per hundred. Animals from Quintana Roo show a grouping with primer six; an additional grouping was observed with animals from Campeche. Nucleotidic variation between both groups was 2.118 nucleotides per hundred. The nucleotidic variation for the two primers within the groups from both states, showed fluctuating values from 0.46 to 1.68 nucleotides per hundred, which indicates that nucleotidic variation between the two groups of animals is around two nucleotides per hundred and, within the groups, less than 1.7 nucleotides per hundred.

Localization, structure and polymorphism of two paralogous Xenopus laevis mitochondrial malate dehydrogenase genes.

PubMed

Tlapakova, Tereza; Krylov, Vladimir; Macha, Jaroslav

2005-01-01

Two paralogous mitochondrial malate dehydrogenase 2 (Mdh2) genes of Xenopus laevis have been cloned and sequenced, revealing 95% identity. Fluorescence in-situ hybridization (FISH) combined with tyramide amplification discriminates both genes; Mdh2a was localized into chromosome q3 and Mdh2b into chromosome q8. One kb cDNA probes detect both genes with 85% accuracy. The remaining signals were on the paralogous counterpart. Introns interrupt coding sequences at the same nucleotide as defined for mouse. Restriction polymorphism has been detected in the first intron of Mdh2a, while the individual variability in intron 6 of Mdh2b gene is represented by an insertion of incomplete retrotransposon L1Xl. Rates of nucleotide substitutions indicate that both genes are under similar evolutionary constraints. X. laevis Mdh2 genes can be used as markers for physical mapping and linkage analysis.

The SNP g.1311T>C associated with the absence of β-casein in goat milk influences CSN2 promoter activity.

PubMed

Cosenza, G; Iannaccone, M; Pico, B A; Ramunno, L; Capparelli, R

2016-10-01

Quantitative individual differences in the amount of β-casein in goat milk are determined by at least nine alleles. In particular, two alleles (CSN2(0) and CSN2(01) ) are associated with an undetectable amount of this protein in milk. The CSN2(01) allele is characterized by a single nucleotide substitution at position 373 of the seventh exon (AJ011018:g.8915C>T), responsible for the formation of a premature stop codon at the 182 position. Herein, we report the contribution of the SNP g.1311T>C, which demonstrates a linkage with the SNP AJ011018:g.8915C>T, to the promoter transcriptional activity. Particularly, we indicate that the nucleotide C at position 1311 negatively affects the promoter activity of the CSN2 gene. © 2016 Stichting International Foundation for Animal Genetics.

Amino acid sequence of the Amur tiger prion protein.

PubMed

Wu, Changde; Pang, Wanyong; Zhao, Deming

2006-10-01

Prion diseases are fatal neurodegenerative disorders in human and animal associated with conformational conversion of a cellular prion protein (PrP(C)) into the pathologic isoform (PrP(Sc)). Various data indicate that the polymorphisms within the open reading frame (ORF) of PrP are associated with the susceptibility and control the species barrier in prion diseases. In the present study, partial Prnp from 25 Amur tigers (tPrnp) were cloned and screened for polymorphisms. Four single nucleotide polymorphisms (T423C, A501G, C511A, A610G) were found; the C511A and A610G nucleotide substitutions resulted in the amino acid changes Lysine171Glutamine and Alanine204Threoine, respectively. The tPrnp amino acid sequence is similar to house cat (Felis catus ) and sheep, but differs significantly from other two cat Prnp sequences that were previously deposited in GenBank.

Brief Note Low diversity of the major histocompatibility complex class II DRA gene in domestic goats (Capra hircus) in Southern China.

PubMed

Chen, L P; E, G X; Zhao, Y J; Na, R S; Zhao, Z Q; Zhang, J H; Ma, Y H; Sun, Y W; Zhong, T; Zhang, H P; Huang, Y F

2015-06-18

DRA encodes the alpha chain of the DR heterodimer, is closely linked to DRB and is considered almost monomorphic in major histocompatibility complex region. In this study, we identified the exon 2 of DRA to evaluate the immunogenetic diversity of Chinese south indigenous goat. Two single nucleotide polymorphisms in an untranslated region and one synonymous substitution in coding region were identified. These data suggest that high immunodiversity in native Chinese population.

Eco-Virological Approach for Assessing the Role of Wild Birds in the Spread of Avian Influenza H5N1 along the Central Asian Flyway

DTIC Science & Technology

2012-02-07

nucleotide substitution [41]. The tree was rooted to A/goose/Guangdong/1/96 and included sequences from January 1959 (A/ chicken /Scotland/1959) to June...a ‘hotspot’ for outbreaks because of the prevalence of backyard farms that keep mixed flocks of indigenous chickens and ducks, coupled with lack of...practices or environmental conditions promoting transmission between migratory birds and poultry. In this region, the intensification of chicken and

Revised Mechanism and Improved Efficiency of the QuikChange Site-Directed Mutagenesis Method.

PubMed

Xia, Yongzhen; Xun, Luying

2017-01-01

Site-directed mutagenesis has been widely used for the substitution, addition or deletion of nucleotide residues in a defined DNA sequence. QuikChange™ site-directed mutagenesis and its related protocols have been widely used for this purpose because of convenience and efficiency. We have recently demonstrated that the mechanism of the QuikChange™ site-directed mutagenesis process is different from that being proposed. The new mechanism promotes the use of partially overlapping primers and commercial PCR enzymes for efficient PCR and mutagenesis.

Hepatitis C Virus Genotype 1 to 6 Protease Inhibitor Escape Variants: In Vitro Selection, Fitness, and Resistance Patterns in the Context of the Infectious Viral Life Cycle.

PubMed

Serre, Stéphanie B N; Jensen, Sanne B; Ghanem, Lubna; Humes, Daryl G; Ramirez, Santseharay; Li, Yi-Ping; Krarup, Henrik; Bukh, Jens; Gottwein, Judith M

2016-06-01

Hepatitis C virus (HCV) NS3 protease inhibitors (PIs) are important components of novel HCV therapy regimens. Studies of PI resistance initially focused on genotype 1. Therefore, knowledge about the determinants of PI resistance for the highly prevalent genotypes 2 to 6 remains limited. Using Huh7.5 cell culture-infectious HCV recombinants with genotype 1 to 6 NS3 protease, we identified protease positions 54, 155, and 156 as hot spots for the selection of resistance substitutions under treatment with the first licensed PIs, telaprevir and boceprevir. Treatment of a genotype 2 isolate with the newer PIs vaniprevir, faldaprevir, simeprevir, grazoprevir, paritaprevir, and deldeprevir identified positions 156 and 168 as hot spots for resistance; the Y56H substitution emerged for three newer PIs. Substitution selection also depended on the specific recombinant. The substitutions identified conferred cross-resistance to several PIs; however, most substitutions selected under telaprevir or boceprevir treatment conferred less resistance to certain newer PIs. In a single-cycle production assay, across genotypes, PI treatment primarily decreased viral replication, which was rescued by PI resistance substitutions. The substitutions identified resulted in differential effects on viral fitness, depending on the original recombinant and the substitution. Across genotypes, fitness impairment induced by resistance substitutions was due primarily to decreased replication. Most combinations of substitutions that were identified increased resistance or fitness. Combinations of resistance substitutions with fitness-compensating substitutions either rescued replication or compensated for decreased replication by increasing assembly. This comprehensive study provides insight into the selection patterns and effects of PI resistance substitutions for HCV genotypes 1 to 6 in the context of the infectious viral life cycle, which is of interest for clinical and virological HCV research. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Mutations in the nucleotide binding pocket of MreB can alter cell curvature and polar morphology in Caulobacter.

PubMed

Dye, Natalie A; Pincus, Zachary; Fisher, Isabelle C; Shapiro, Lucy; Theriot, Julie A

2011-07-01

The maintenance of cell shape in Caulobacter crescentus requires the essential gene mreB, which encodes a member of the actin superfamily and the target of the antibiotic, A22. We isolated 35 unique A22-resistant Caulobacter strains with single amino acid substitutions near the nucleotide binding site of MreB. Mutations that alter cell curvature and mislocalize the intermediate filament crescentin cluster on the back surface of MreB's structure. Another subset have variable cell widths, with wide cell bodies and actively growing thin extensions of the cell poles that concentrate fluorescent MreB. We found that the extent to which MreB localization is perturbed is linearly correlated with the development of pointed cell poles and variable cell widths. Further, we find that a mutation to glycine of two conserved aspartic acid residues that are important for nucleotide hydrolysis in other members of the actin superfamily abolishes robust midcell recruitment of MreB but supports a normal rate of growth. These mutant strains provide novel insight into how MreB's protein structure, subcellular localization, and activity contribute to its function in bacterial cell shape. © 2011 Blackwell Publishing Ltd.

Mutations in the nucleotide binding pocket of MreB can alter cell curvature and polar morphology in Caulobacter

PubMed Central

Dye, Natalie A; Pincus, Zachary; Fisher, Isabelle C; Shapiro, Lucy; Theriot, Julie A

2011-01-01

Summary The maintenance of cell shape in Caulobacter crescentus requires the essential gene mreB, which encodes a member of the actin superfamily and the target of the antibiotic, A22. We isolated 35 unique A22-resistant Caulobacter strains with single amino acid substitutions near the nucleotide binding site of MreB. Mutations that alter cell curvature and mislocalize the intermediate filament crescentin cluster on the back surface of MreB's structure. Another subset have variable cell widths, with wide cell bodies and actively growing thin extensions of the cell poles that concentrate fluorescent MreB. We found that the extent to which MreB localization is perturbed is linearly correlated with the development of pointed cell poles and variable cell widths. Further, we find that a mutation to glycine of two conserved aspartic acid residues that are important for nucleotide hydrolysis in other members of the actin superfamily abolishes robust midcell recruitment of MreB but supports a normal rate of growth. These mutant strains provide novel insight into how MreB's protein structure, subcellular localization, and activity contribute to its function in bacterial cell shape. PMID:21564339

Carrier-mediated translocation of uridine diphosphate glucose into the lumen of endoplasmic reticulum-derived vesicles from rat liver.

PubMed Central

Vanstapel, F; Blanckaert, N

1988-01-01

Radiolabeled UDPGlc incubated with rough endoplasmic reticulum (RER)-derived microsomes from rat liver became associated with the vesicles. This microsomal uptake of nucleotide sugar was time and temperature dependent. Analysis of the molecular species containing radiolabel revealed that initial uptake represented entry of predominantly intact UDPGlc in the microsomes. Conclusive evidence for proper translocation of UDPGlc across the microsomal membrane into the intravesicular space was obtained by demonstrating that UDPGlc was transported into an osmotically sensitive compartment. Microsomal uptake of UDPGlc exhibited features characteristic of carrier-mediated transport including saturation, specificity, and countertransport. Inhibition and trans-stimulation studies showed that other uridine-containing nucleotide sugars and 5'-UMP were substrates of the postulated microsomal carrier system for UDPGlc, while cytosine- or guanosine-containing nucleotides and non-5'-uridine monophosphates were, at best, very poor substrates. UDPGlc translocation activities were lower in smooth microsomal fractions than in the RER-derived vesicles, indicating that contamination with Golgi membranes could not be responsible for microsomal transport of UDPGlc. Our findings suggest that rat liver endoplasmic reticulum possesses a carrier system mediating proper translocation of UDPGlc and 5'-uridine-substituted structural analogues across the membrane. PMID:3417868

Kinetic Basis of Nucleotide Selection Employed by a Protein Template-Dependent DNA Polymerase†

PubMed Central

Brown, Jessica A.; Fowler, Jason D.; Suo, Zucai

2010-01-01

Rev1, a Y-family DNA polymerase, contributes to spontaneous and DNA damage-induced mutagenic events. In this paper, we have employed pre-steady state kinetic methodology to establish a kinetic basis for nucleotide selection by human Rev1, a unique nucleotidyl transferase that uses a protein template-directed mechanism to preferentially instruct dCTP incorporation. This work demonstrated that the high incorporation efficiency of dCTP is dependent on both substrates: an incoming dCTP and a templating base dG. The extremely low base substitution fidelity of human Rev1 (100 to 10-5) was due to the preferred misincorporation of dCTP with templating bases dA, dT, and dC over correct dNTPs. Using non-natural nucleotide analogs, we showed that hydrogen bonding interactions between residue R357 of human Rev1 and an incoming dNTP are not essential for DNA synthesis. Lastly, human Rev1 discriminates between ribonucleotides and deoxyribonucleotides mainly by reducing the rate of incorporation, and the sugar selectivity of human Rev1 is sensitive to both the size and orientation of the 2′-substituent of a ribonucleotide. PMID:20518555

Exploring the correlation between the sequence composition of the nucleotide binding G5 loop of the FeoB GTPase domain (NFeoB) and intrinsic rate of GDP release.

PubMed

Guilfoyle, Amy P; Deshpande, Chandrika N; Schenk, Gerhard; Maher, Megan J; Jormakka, Mika

2014-12-12

GDP release from GTPases is usually extremely slow and is in general assisted by external factors, such as association with guanine exchange factors or membrane-embedded GPCRs (G protein-coupled receptors), which accelerate the release of GDP by several orders of magnitude. Intrinsic factors can also play a significant role; a single amino acid substitution in one of the guanine nucleotide recognition motifs, G5, results in a drastically altered GDP release rate, indicating that the sequence composition of this motif plays an important role in spontaneous GDP release. In the present study, we used the GTPase domain from EcNFeoB (Escherichia coli FeoB) as a model and applied biochemical and structural approaches to evaluate the role of all the individual residues in the G5 loop. Our study confirms that several of the residues in the G5 motif have an important role in the intrinsic affinity and release of GDP. In particular, a T151A mutant (third residue of the G5 loop) leads to a reduced nucleotide affinity and provokes a drastically accelerated dissociation of GDP.

Thermodynamics of RNA duplexes modified with unlocked nucleic acid nucleotides

PubMed Central

Pasternak, Anna; Wengel, Jesper

2010-01-01

Thermodynamics provides insights into the influence of modified nucleotide residues on stability of nucleic acids and is crucial for designing duplexes with given properties. In this article, we introduce detailed thermodynamic analysis of RNA duplexes modified with unlocked nucleic acid (UNA) nucleotide residues. We investigate UNA single substitutions as well as model mismatch and dangling end effects. UNA residues placed in a central position makes RNA duplex structure less favourable by 4.0–6.6 kcal/mol. Slight destabilization, by ∼0.5–1.5 kcal/mol, is observed for 5′- or 3′-terminal UNA residues. Furthermore, thermodynamic effects caused by UNA residues are extremely additive with ΔG°37 conformity up to 98%. Direct mismatches involving UNA residues decrease the thermodynamic stability less than unmodified mismatches in RNA duplexes. Additionally, the presence of UNA residues adjacent to unpaired RNA residues reduces mismatch discrimination. Thermodynamic analysis of UNA 5′- and 3′-dangling ends revealed that stacking interactions of UNA residues are always less favourable than that of RNA residues. Finally, circular dichroism spectra imply no changes in overall A-form structure of UNA–RNA/RNA duplexes relative to the unmodified RNA duplexes. PMID:20562222

A novel CDKL5 mutation in a Japanese patient with atypical Rett syndrome.

PubMed

Christianto, Antonius; Katayama, Syouichi; Kameshita, Isamu; Inazu, Tetsuya

2016-08-01

Rett syndrome (RTT) is a severe X-linked dominant inheritance disorder with a wide spectrum of clinical manifestations. Mutations in Methyl CpG binding protein 2 (MECP2), Cyclin dependent kinase-like 5 (CDKL5) and Forkhead box G1 (FOXG1) have been associated with classic and/or variant RTT. This study was conducted to identify the responsible gene(s) in atypical RTT patient, and to examine the effect of the mutation on protein function. DNA sequence analysis showed a novel heterozygous mutation in CDKL5 identified as c.530A>G which resulted in an amino acid substitution at position 177, from tyrosine to cysteine. Genotyping analysis indicated that the mutation was not merely a single nucleotide polymorphism (SNP). We also revealed that patient's blood lymphocytes had random X-chromosome inactivation (XCI) pattern. Further examination by bioinformatics analysis demonstrated the mutation caused damage or deleterious in its protein. In addition, we demonstrated in vitro kinase assay of mutant protein showed impairment of its activity. Taken together, the results suggested the mutant CDKL5 was responsible for the disease. Copyright © 2016 Elsevier B.V. All rights reserved.

Aldehyde Dehydrogenase 2 in Aplastic Anemia, Fanconi Anemia and Hematopoietic Stem Cells

PubMed Central

Van Wassenhove, Lauren D.; Mochly-Rosen, Daria; Weinberg, Kenneth I.

2016-01-01

Maintenance of the hematopoietic stem cell (HSC) compartment depends on the ability to metabolize exogenously and endogenously generated toxins, and to repair cellular damage caused by such toxins. Reactive aldehydes have been demonstrated to cause specific genotoxic injury, namely DNA interstrand cross-links. Aldehyde dehydrogenase 2 (ALDH2) is a member of a 19 isoenzyme ALDH family with different substrate specificities, subcellular localization, and patterns of expression. ALDH2 is localized in mitochondria and is essential for the metabolism of acetaldehyde, thereby placing it directly downstream of ethanol metabolism. Deficiency in ALDH2 expression and function are caused by a single nucleotide substitution and resulting amino acid change, called ALDH2*2. This genetic polymorphism affects 35–45% of East Asians (about ~560 million people), and causes the well-known Asian flushing syndrome, which results in disulfiram-like reactions after ethanol consumption. Recently, the ALDH2*2 genotype has been found to be associated with marrow failure, with both an increased risk of sporadic aplastic anemia and more rapid progression of Fanconi Anemia. This review discusses the unexpected interrelationship between aldehydes, ALDH2 and hematopoietic stem cell biology, and in particular its relationship to Fanconi anemia. PMID:27650066

Phylogenetic analysis of human influenza A/H3N2 viruses isolated in 2015 in Germany indicates significant genetic divergence from vaccine strains.

PubMed

Mostafa, Ahmed; Abdelwhab, El-Sayed M; Slanina, Heiko; Hussein, Mohamed A; Kuznetsova, Irina; Schüttler, Christian G; Ziebuhr, John; Pleschka, Stephan

2016-06-01

Infections by H3N2-type influenza A viruses (IAV) resulted in significant numbers of hospitalization in several countries in 2014-2015, causing disease also in vaccinated individuals and, in some cases, fatal outcomes. In this study, sequence analysis of H3N2 viruses isolated in Germany from 1998 to 2015, including eleven H3N2 isolates collected early in 2015, was performed. Compared to the vaccine strain A/Texas/50/2012 (H3N2), the 2015 strains from Germany showed up to 4.5 % sequence diversity in their HA1 protein, indicating substantial genetic drift. The data further suggest that two distinct phylogroups, 3C.2 and 3C.3, with 1.6-2.3 % and 0.3-2.4 % HA1 nucleotide and amino acid sequence diversity, respectively, co-circulated in Germany in the 2014/2015 season. Distinct glycosylation patterns and amino acid substitutions in the hemagglutinin and neuraminidase proteins were identified, possibly contributing to the unusually high number of H3N2 infections in this season and providing important information for developing vaccines that are effective against both genotypes.

Yellow Fever Virus Exhibits Slower Evolutionary Dynamics than Dengue Virus ▿ †

PubMed Central

Sall, Amadou A.; Faye, Ousmane; Diallo, Mawlouth; Firth, Cadhla; Kitchen, Andrew; Holmes, Edward C.

2010-01-01

Although yellow fever has historically been one of the most important viral infections of humans, relatively little is known about the evolutionary processes that shape its genetic diversity. Similarly, there is limited information on the molecular epidemiology of yellow fever virus (YFV) in Africa even though it most likely first emerged on this continent. Through an analysis of complete E gene sequences, including a newly acquired viral collection from Central and West Africa (Senegal, Cameroon, Central African Republic, Côte d'Ivoire, Mali, and Mauritania), we show that YFV exhibits markedly lower rates of evolutionary change than dengue virus, despite numerous biological similarities between these two viruses. From this observation, along with a lack of clock-like evolutionary behavior in YFV, we suggest that vertical transmission, itself characterized by lower replication rates, may play an important role in the evolution of YFV in its enzootic setting. Despite a reduced rate of nucleotide substitution, phylogenetic patterns and estimates of times to common ancestry in YFV still accord well with the dual histories of colonialism and the slave trade, with areas of sylvatic transmission (such as Kedougou, Senegal) acting as enzootic/epidemic foci. PMID:19889759

The organization and expression of the mdm2 gene.

PubMed

de Oca Luna, R M; Tabor, A D; Eberspaecher, H; Hulboy, D L; Worth, L L; Colman, M S; Finlay, C A; Lozano, G

1996-05-01

The mdm2 gene encodes a zinc finger protein that negatively regulates p53 function by binding and masking the p53 transcriptional activation domain. Two different promoters control expression of mdm2, one of which is also transactivated by p53. We cloned and characterized the mdm2 gene from a murine 129 library. It contained at least 12 exons and spanned approximately 25 kb of DNA. Sequencing of the mdm2 gene revealed three nucleotide differences that resulted in amino acid substitutions in the previously published mdm2 sequence. Sequencing of normal BalbC/J DNA and the original cosmid clone isolated from the 3T3DM cell line revealed that they are identical, suggesting that the published sequence is in error at these three positions. In addition, we analyzed the expression pattern of mdm2 and found ubiquitous low-level expression throughout embryo development and in adult tissues. Analysis of mRNA from numerous tissues for several mdm2 spliced variants that had been identified in the transformed 3T3DM cell line revealed that these variants could not be detected in the developing embryo or in adult tissues.

Effect of lattice strain on structural and magnetic properties of Ca substituted barium hexaferrite

NASA Astrophysics Data System (ADS)

Kumar, Sunil; Supriya, Sweety; Pandey, Rabichandra; Pradhan, Lagen Kumar; Singh, Rakesh Kumar; Kar, Manoranjan

2018-07-01

The calcium (Ca2+) substituted M-type barium hexaferrite (Ba1-xCaxFe12O19) for Ca2+ (x = 0.00, 0.025, 0.050, 0.075, 0.100, 0.150, and 0.200) have been synthesized by the citrate sol-gel method. The X-ray diffraction (XRD) patterns with Rietveld refinement reveal the formation of hexagonal crystal structure with P63/mmc space group. The lattice parameters a = b and c decrease, whereas lattice strain found to increase with the increase in Ca concentration in the samples. The analysis of Raman spectra well supports the XRD patterns analysis. The average particle size is obtained from the FE-SEM (Field Emission Scanning Electron Microscopy) micrographs and these are similar to that of crystallite size obtained from the XRD pattern analysis. The saturation magnetization and magnetocrystalline anisotropy have been obtained by employing the "Law of Approach (LA) to Saturation magnetization" technique at room temperature. The saturation magnetization and magnetocrystalline anisotropy constant are maximum for 5% Ca substitution in barium hexaferrite. It could be due to lattice strain mediated magnetism. However, these magnetic properties decrease for more than the 5% Ca substitution in barium hexaferrite. It could be due to decrease of magnetic exchange interaction (Fe-O-Fe) in the sample. A correlation between magnetic interaction and lattice strain has been observed in Ca2+ substituted M-type barium hexaferrite.

Pattern of mathematic representation ability in magnetic electricity problem

NASA Astrophysics Data System (ADS)

Hau, R. R. H.; Marwoto, P.; Putra, N. M. D.

2018-03-01

The mathematic representation ability in solving magnetic electricity problem gives information about the way students understand magnetic electricity. Students have varied mathematic representation pattern ability in solving magnetic electricity problem. This study aims to determine the pattern of students' mathematic representation ability in solving magnet electrical problems.The research method used is qualitative. The subject of this study is the fourth semester students of UNNES Physics Education Study Program. The data collection is done by giving a description test that refers to the test of mathematical representation ability and interview about field line topic and Gauss law. The result of data analysis of student's mathematical representation ability in solving magnet electric problem is categorized into high, medium and low category. The ability of mathematical representations in the high category tends to use a pattern of making known and asked symbols, writing equations, using quantities of physics, substituting quantities into equations, performing calculations and final answers. The ability of mathematical representation in the medium category tends to use several patterns of writing the known symbols, writing equations, using quantities of physics, substituting quantities into equations, performing calculations and final answers. The ability of mathematical representations in the low category tends to use several patterns of making known symbols, writing equations, substituting quantities into equations, performing calculations and final answer.

Interaction between amiodarone and hepatitis-C virus nucleotide inhibitors in human induced pluripotent stem cell-derived cardiomyocytes and HEK-293 Cav1.2 over-expressing cells.

PubMed

Lagrutta, Armando; Zeng, Haoyu; Imredy, John; Balasubramanian, Bharathi; Dech, Spencer; Lis, Edward; Wang, Jixin; Zhai, Jin; DeGeorge, Joseph; Sannajust, Frederick

2016-10-01

Several clinical cases of severe bradyarrhythmias have been reported upon co-administration of the Hepatitis-C NS5B Nucleotide Polymerase Inhibitor (HCV-NI) direct-acting antiviral agent, sofosbuvir (SOF), and the Class-III anti-arrhythmic amiodarone (AMIO). We model the cardiac drug-drug interaction (DDI) between AMIO and SOF, and between AMIO and a closely-related SOF analog, MNI-1 (Merck Nucleotide Inhibitor #1), in functional assays of human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs), to provide mechanistic insights into recently reported clinical cases. AMIO co-applied with SOF or MNI-1 increased beating rate or field potential (FP) rate and decreased impedance (IMP) and Ca(2+) transient amplitudes in hiPSC-CM syncytia. This action resembled that of Ca(2+) channel blockers (CCBs) in the model, but CCBs did not substitute for AMIO in the DDI. AMIO analog dronedarone (DRON) did not substitute for, but competed with AMIO in the DDI. Ryanodine and thapsigargin, decreasing intracellular Ca(2+) stores, and SEA-0400, a Na(+)/Ca(2+) exchanger-1 (NCX1) inhibitor, partially antagonized or suppressed DDI effects. Other agents affecting FP rate only exerted additive or subtractive effects, commensurate with their individual effects. We also describe an interaction between AMIO and MNI-1 on Cav1.2 ion channels in an over-expressing HEK-293 cell line. MNI-1 enhanced Cav1.2 channel inhibition by AMIO, but did not affect inhibition of Cav1.2 by DRON, verapamil, nifedipine, or diltiazem. Our data in hiPSC-CMs indicate that HCV-NI agents such as SOF and MNI-1 interact with key intracellular Ca(2+)-handling mechanisms. Additional study in a Cav1.2 HEK-293 cell-line suggests that HCV-NIs potentiate the inhibitory action of AMIO on L-type Ca(2+) channels. Copyright © 2016 Elsevier Inc. All rights reserved.

Virulence Gene Sequencing Highlights Similarities and Differences in Sequences in Listeria monocytogenes Serotype 1/2a and 4b Strains of Clinical and Food Origin From 3 Different Geographic Locations.

PubMed

Poimenidou, Sofia V; Dalmasso, Marion; Papadimitriou, Konstantinos; Fox, Edward M; Skandamis, Panagiotis N; Jordan, Kieran

2018-01-01

The prfA -virulence gene cluster ( p VGC) is the main pathogenicity island in Listeria monocytogenes , comprising the prfA, plcA, hly, mpl, actA , and plcB genes. In this study, the p VGC of 36 L. monocytogenes isolates with respect to different serotypes (1/2a or 4b), geographical origin (Australia, Greece or Ireland) and isolation source (food-associated or clinical) was characterized. The most conserved genes were prfA and hly , with the lowest nucleotide diversity (π) among all genes ( P < 0.05), and the lowest number of alleles, substitutions and non-synonymous substitutions for prfA . Conversely, the most diverse gene was actA , which presented the highest number of alleles ( n = 20) and showed the highest nucleotide diversity. Grouping by serotype had a significantly lower π value ( P < 0.0001) compared to isolation source or geographical origin, suggesting a distinct and well-defined unit compared to other groupings. Among all tested genes, only hly and mpl were those with lower nucleotide diversity in 1/2a serotype than 4b serotype, reflecting a high within-1/2a serotype divergence compared to 4b serotype. Geographical divergence was noted with respect to the hly gene, where serotype 4b Irish strains were distinct from Greek and Australian strains. Australian strains showed less diversity in plcB and mpl relative to Irish or Greek strains. Notable differences regarding sequence mutations were identified between food-associated and clinical isolates in prfA, actA , and plcB sequences. Overall, these results indicate that virulence genes follow different evolutionary pathways, which are affected by a strain's origin and serotype and may influence virulence and/or epidemiological dominance of certain subgroups.

Characteristics of an Environmentally Monitored Prolonged Type 2 Vaccine Derived Poliovirus Shedding Episode that Stopped without Intervention

PubMed Central

Hovi, Tapani; Paananen, Anja; Blomqvist, Soile; Savolainen-Kopra, Carita; Al-Hello, Haider; Smura, Teemu; Shimizu, Hiroyuki; Nadova, Katarina; Sobotova, Zdenka; Gavrilin, Eugene; Roivainen, Merja

2013-01-01

Vaccine derived poliovirus (VDPV) type 2 strains strongly divergent from the corresponding vaccine strain, Sabin 2, were repeatedly isolated from sewage in Slovakia over a period of 22 months in 2003–2005. Cell cultures of stool specimens from known immune deficient patients and from an identified putative source population of 500 people failed to identify the potential excretor(s) of the virus. The occurrence of VDPV in sewage stopped without any intervention. No paralytic cases were reported in Slovakia during the episode. According to a GenBank search and similarity plotting-analysis, the closest known relative of the first isolate PV2/03/SVK/E783 through all main sections of the genome was the type 2 poliovirus Sabin strain, with nucleotide identities in 5′UTR, P1, P2, P3, and 3′UTR parts of the genome of 88.6, 85.9, 87.3, 88.5, and 94.0 percent, respectively. Phenotypic properties of selected Slovakian aVDPV strains resembled those of VDPV strains isolated from immune deficient individuals with prolonged PV infection (iVDPV), including antigenic changes and moderate neurovirulence in the transgenic mouse model. One hundred and two unique VP1 coding sequences were determined from VDPV strains isolated from 34 sewage specimens. Nucleotide differences from Sabin 2 in the VP1 coding region ranged from 12.5 to 15.6 percent, and reached a maximum of 9.6 percent between the VDPV strains under study. Most of the nucleotide substitutions were synonymous but as many as 93 amino acid positions out of 301 in VP1 showed substitutions. We conclude that (1) individuals with prolonged poliovirus infection are not as rare as suggested by the studies on immune deficient patients known to the health care systems and (2) genetic divergence of VDPV strains may remain extensive during years long replication in humans. PMID:23935826

An A−71C substitution in a green gene at the second position in the red/green visual-pigment gene array is associated with deutan color-vision deficiency

PubMed Central

Ueyama, Hisao; Li, Yao-Hua; Fu, Gui-Lian; Lertrit, Patcharee; Atchaneeyasakul, La-ongsri; Oda, Sanae; Tanabe, Shoko; Nishida, Yasuhiro; Yamade, Shinichi; Ohkubo, Iwao

2003-01-01

We studied 247 Japanese males with congenital deutan color-vision deficiency and found that 37 subjects (15.0%) had a normal genotype of a single red gene followed by a green gene(s). Two of them had missense mutations in the green gene(s), but the other 35 subjects had no mutations in either the exons or their flanking introns. However, 32 of the 35 subjects, including all 8 subjects with pigment-color defect, a special category of deuteranomaly, had a nucleotide substitution, A−71C, in the promoter of a green gene at the second position in the red/green visual-pigment gene array. Although the −71C substitution was also present in color-normal Japanese males at a frequency of 24.3%, it was never at the second position but always found further downstream. The substitution was found in 19.4% of Chinese males and 7.7% of Thai males but rarely in Caucasians or African Americans. These results suggest that the A−71C substitution in the green gene at the second position is closely associated with deutan color-vision deficiency. In Japanese and presumably other Asian populations further downstream genes with −71C comprise a reservoir of the visual-pigment genes that cause deutan color-vision deficiency by unequal crossing over between the intergenic regions. PMID:12626747

Gene sequence variations and expression patterns of mitochondrial genes are associated with the adaptive evolution of two Gynaephora species (Lepidoptera: Lymantriinae) living in different high-elevation environments.

PubMed

Zhang, Qi-Lin; Zhang, Li; Zhao, Tian-Xuan; Wang, Juan; Zhu, Qian-Hua; Chen, Jun-Yuan; Yuan, Ming-Long

2017-04-30

The adaptive evolution of animals to high-elevation environments has been extensively studied in vertebrates, while few studies have focused on insects. Gynaephora species (Lepidoptera: Lymantriinae) are endemic to the Qinghai-Tibetan Plateau (QTP) and represent an important insect pest of alpine meadows. Here, we present a detailed comparative analysis of the mitochondrial genomes (mitogenomes) of two Gynaephora species inhabiting different high-elevation environments: G. alpherakii and G. menyuanensis. The results indicated that the general mitogenomic features (genome size, nucleotide composition, codon usage and secondary structures of tRNAs) were well conserved between the two species. All of mitochondrial protein-coding genes were evolving under purifying selection, suggesting that selection constraints may play a role in ensuring adequate energy production. However, a number of substitutions and indels were identified that altered the protein conformations of ATP8 and NAD1, which may be the result of adaptive evolution of the two Gynaephora species to different high-elevation environments. Levels of gene expression for nine mitochondrial genes in nine different developmental stages were significantly suppressed in G. alpherakii, which lives at the higher elevation (~4800m above sea level), suggesting that gene expression patterns could be modulated by atmospheric oxygen content and environmental temperature. These results enhance our understanding of the genetic bases for the adaptive evolution of insects endemic to the QTP. Copyright © 2017 Elsevier B.V. All rights reserved.

Multiple cis-acting sequence elements are required for efficient splicing of simian virus 40 small-t antigen pre-mRNA.

PubMed Central

Fu, X Y; Colgan, J D; Manley, J L

1988-01-01

We have determined the effects of a number of mutations in the small-t antigen mRNA intron on the alternative splicing pattern of the simian virus 40 early transcript. Expansion of the distance separating the small-t pre-mRNA lariat branch point and the shared large T-small t 3' splice site from 18 to 29 nucleotides (nt) resulted in a relative enhancement of small-t splicing in vivo. This finding, coupled with the observation that large-T pre-RNA splicing in vitro was not affected by this expansion, suggests that small-t splicing is specifically constrained by a short branch point-3' splice site distance. Similarly, the distance separating the 5' splice site and branch point (48 nt) was found to be at or near a minimum for small-t splicing, because deletions in this region as small as 2 nt dramatically reduced the ratio of small-t to large-T mRNA that accumulated in transfected cells. Finally, a specific sequence within the small-t intron, encompassing the upstream branch sites used in large-T splicing, was found to be an important element in the cell-specific pattern of early alternative splicing. Substitutions within this region reduced the ratio of small-t to large-T mRNA produced in HeLa cells but had only minor effects in human 293 cells. Images PMID:2851720

Identification and expression analysis of cDNA encoding insulin-like growth factor 2 in horses

PubMed Central

KIKUCHI, Kohta; SASAKI, Keisuke; AKIZAWA, Hiroki; TSUKAHARA, Hayato; BAI, Hanako; TAKAHASHI, Masashi; NAMBO, Yasuo; HATA, Hiroshi; KAWAHARA, Manabu

2017-01-01

Insulin-like growth factor 2 (IGF2) is responsible for a broad range of physiological processes during fetal development and adulthood, but genomic analyses of IGF2 containing the 5ʹ- and 3ʹ-untranslated regions (UTRs) in equines have been limited. In this study, we characterized the IGF2 mRNA containing the UTRs, and determined its expression pattern in the fetal tissues of horses. The complete equine IGF2 mRNA sequence harboring another exon approximately 2.8 kb upstream from the canonical transcription start site was identified as a new transcript variant. As this upstream exon did not contain the start codon, the amino acid sequence was identical to the canonical variant. Analysis of the deduced amino acid sequence revealed that the protein possessed two major domains, IlGF and IGF2_C, and analysis of IGF2 sequence polymorphism in fetal tissues of Hokkaido native horse and Thoroughbreds revealed a single nucleotide polymorphism (T to C transition) at position 398 in Thoroughbreds, which caused an amino acid substitution at position 133 in the IGF2 sequence. Furthermore, the expression pattern of the IGF2 mRNA in the fetal tissues of horses was determined for the first time, and was found to be consistent with those of other species. Taken together, these results suggested that the transcriptional and translational products of the IGF2 gene have conserved functions in the fetal development of mammals, including horses. PMID:29151450

Phylogenetic analysis of symbionts in feather-feeding lice of the genus Columbicola: evidence for repeated symbiont replacements

PubMed Central

2013-01-01

Background Many groups of insects have obligate bacterial symbionts that are vertically transmitted. Such associations are typically characterized by the presence of a monophyletic group of bacteria living in a well-defined host clade. In addition the phylogeny of the symbiotic bacteria is typically congruent with that of the host, signifying co-speciation. Here we show that bacteria living in a single genus of feather lice, Columbicola (Insecta: Phthiraptera), present an exception to this typical pattern. Results The phylogeny of Columbicola spp. symbionts revealed the presence of three candidate clades, with the most species-rich clade having a comb-like topology with very short internodes and long terminal branches. Evolutionary simulations indicate that this topology is characteristic of a process of repeated symbiont replacement over a brief time period. The two remaining candidate clades in our study exhibit high levels of nucleotide substitution, suggesting accelerated molecular evolution due to relaxed purifying selection or smaller effective population size, which is typical of many vertically transmitted insect symbionts. Representatives of the fast-evolving and slow-evolving symbiont lineages exhibit the same localization, migration, and transmission patterns in their hosts, implying direct replacement. Conclusions Our findings suggest that repeated, independent symbiont replacements have taken place over the course of the relatively recent radiation of Columbicola spp. These results are compatible with the notion that lice and other insects have the capability to acquire novel symbionts through the domestication of progenitor strains residing in their local environment. PMID:23725492

An in silico approach to investigate the source of the controversial interpretations about the phenotypic results of the human AhR-gene G1661A polymorphism.

PubMed

Aftabi, Younes; Colagar, Abasalt Hosseinzadeh; Mehrnejad, Faramarz

2016-03-21

Aryl hydrocarbon receptor (AhR) acts as an enhancer binding ligand-activated intracellular receptor. Chromatin remodeling components and general transcription factors such as TATA-binding protein (TBP) are evoked on AhR-target genes by interaction with its flexible transactivation domain (TAD). AhR-G1661A single nucleotide polymorphism (SNP: rs2066853) causes an arginine to lysine substitution in the acidic sub-domain of TAD at position 554 (R554K). Although, numerous studies associate the SNP with some abnormalities such as cancer, other reliable investigations refuse the associations. Consequently, the interpretation of the phenotypic results of G1661A-transition has been controversial. In this study, an in silico analysis were performed to investigate the possible effects of the transition on AhR-mRNA, protein structure, interaction properties and modifications. The analysis revealed that the R554K substitution affects secondary structure and solvent accessibility of adjacent residues. Also, it causes to decreasing of the AhR stability; altering the hydropathy features of the local sequence and changing the pattern of the residues at the binding site of the TAD-acidic sub-domain. Generating of new sites for ubiquitination and acetylation for AhR-K554 variant respectively at positions 544 and 560 was predicted. Our findings intensify the idea that the AhR-G1661A transition may affects AhR-TAD interactions, especially with the TBP, which influence AhR-target genes expression. However, the previously reported flexibility of the modular TAD could act as an intervening factor, moderate the SNP effects and causes distinct outcomes in different individuals and tissues. Copyright © 2016 Elsevier Ltd. All rights reserved.

Genetic stability of foot-and-mouth disease virus during long-term infections in natural hosts

PubMed Central

Ramirez-Carvajal, Lisbeth; Pauszek, Steven J.; Ahmed, Zaheer; Farooq, Umer; Naeem, Khalid; Shabman, Reed S.; Stockwell, Timothy B.; Rodriguez, Luis L.

2018-01-01

Foot-and-mouth disease (FMD) is a severe infection caused by a picornavirus that affects livestock and wildlife. Persistence in ruminants is a well-documented feature of Foot-and-mouth disease virus (FMDV) pathogenesis and a major concern for disease control. Persistently infected animals harbor virus for extended periods, providing a unique opportunity to study within-host virus evolution. This study investigated the genetic dynamics of FMDV during persistent infections of naturally infected Asian buffalo. Using next-generation sequencing (NGS) we obtained 21 near complete FMDV genome sequences from 12 sub-clinically infected buffalo over a period of one year. Four animals yielded only one virus isolate and one yielded two isolates of different serotype suggesting a serial infection. Seven persistently infected animals yielded more than one virus of the same serotype showing a long-term intra-host viral genetic divergence at the consensus level of less than 2.5%. Quasi-species analysis showed few nucleotide variants and non-synonymous substitutions of progeny virus despite intra-host persistence of up to 152 days. Phylogenetic analyses of serotype Asia-1 VP1 sequences clustered all viruses from persistent animals with Group VII viruses circulating in Pakistan in 2011, but distinct from those circulating on 2008–2009. Furthermore, signature amino acid (aa) substitutions were found in the antigenically relevant VP1 of persistent viruses compared with viruses from 2008–2009. Intra-host purifying selective pressure was observed, with few codons in structural proteins undergoing positive selection. However, FMD persistent viruses did not show a clear pattern of antigenic selection. Our findings provide insight into the evolutionary dynamics of FMDV populations within naturally occurring subclinical and persistent infections that may have implications to vaccination strategies in the region. PMID:29390015

Genetic stability of foot-and-mouth disease virus during long-term infections in natural hosts.

PubMed

Ramirez-Carvajal, Lisbeth; Pauszek, Steven J; Ahmed, Zaheer; Farooq, Umer; Naeem, Khalid; Shabman, Reed S; Stockwell, Timothy B; Rodriguez, Luis L

2018-01-01

Foot-and-mouth disease (FMD) is a severe infection caused by a picornavirus that affects livestock and wildlife. Persistence in ruminants is a well-documented feature of Foot-and-mouth disease virus (FMDV) pathogenesis and a major concern for disease control. Persistently infected animals harbor virus for extended periods, providing a unique opportunity to study within-host virus evolution. This study investigated the genetic dynamics of FMDV during persistent infections of naturally infected Asian buffalo. Using next-generation sequencing (NGS) we obtained 21 near complete FMDV genome sequences from 12 sub-clinically infected buffalo over a period of one year. Four animals yielded only one virus isolate and one yielded two isolates of different serotype suggesting a serial infection. Seven persistently infected animals yielded more than one virus of the same serotype showing a long-term intra-host viral genetic divergence at the consensus level of less than 2.5%. Quasi-species analysis showed few nucleotide variants and non-synonymous substitutions of progeny virus despite intra-host persistence of up to 152 days. Phylogenetic analyses of serotype Asia-1 VP1 sequences clustered all viruses from persistent animals with Group VII viruses circulating in Pakistan in 2011, but distinct from those circulating on 2008-2009. Furthermore, signature amino acid (aa) substitutions were found in the antigenically relevant VP1 of persistent viruses compared with viruses from 2008-2009. Intra-host purifying selective pressure was observed, with few codons in structural proteins undergoing positive selection. However, FMD persistent viruses did not show a clear pattern of antigenic selection. Our findings provide insight into the evolutionary dynamics of FMDV populations within naturally occurring subclinical and persistent infections that may have implications to vaccination strategies in the region.

Phylogenetic Conflict in Bears Identified by Automated Discovery of Transposable Element Insertions in Low-Coverage Genomes.

PubMed

Lammers, Fritjof; Gallus, Susanne; Janke, Axel; Nilsson, Maria A

2017-10-01

Phylogenetic reconstruction from transposable elements (TEs) offers an additional perspective to study evolutionary processes. However, detecting phylogenetically informative TE insertions requires tedious experimental work, limiting the power of phylogenetic inference. Here, we analyzed the genomes of seven bear species using high-throughput sequencing data to detect thousands of TE insertions. The newly developed pipeline for TE detection called TeddyPi (TE detection and discovery for Phylogenetic Inference) identified 150,513 high-quality TE insertions in the genomes of ursine and tremarctine bears. By integrating different TE insertion callers and using a stringent filtering approach, the TeddyPi pipeline produced highly reliable TE insertion calls, which were confirmed by extensive in vitro validation experiments. Analysis of single nucleotide substitutions in the flanking regions of the TEs shows that these substitutions correlate with the phylogenetic signal from the TE insertions. Our phylogenomic analyses show that TEs are a major driver of genomic variation in bears and enabled phylogenetic reconstruction of a well-resolved species tree, despite strong signals for incomplete lineage sorting and introgression. The analyses show that the Asiatic black, sun, and sloth bear form a monophyletic clade, in which phylogenetic incongruence originates from incomplete lineage sorting. TeddyPi is open source and can be adapted to various TE and structural variation callers. The pipeline makes it possible to confidently extract thousands of TE insertions even from low-coverage genomes (∼10×) of nonmodel organisms. This opens new possibilities for biologists to study phylogenies and evolutionary processes as well as rates and patterns of (retro-)transposition and structural variation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis.

PubMed Central

Nübel, U; Engelen, B; Felske, A; Snaidr, J; Wieshuber, A; Amann, R I; Ludwig, W; Backhaus, H

1996-01-01

Sequence heterogeneities in 16S rRNA genes from individual strains of Paenibacillus polymyxa were detected by sequence-dependent separation of PCR products by temperature gradient gel electrophoresis (TGGE). A fragment of the 16S rRNA genes, comprising variable regions V6 to V8, was used as a target sequence for amplifications. PCR products from P. polymyxa (type strain) emerged as a well-defined pattern of bands in the gradient gel. Six plasmids with different inserts, individually demonstrating the migration characteristics of single bands of the pattern, were obtained by cloning the PCR products. Their sequences were analyzed as a representative sample of the total heterogeneity. An amount of 10 variant nucleotide positions in the fragment of 347 bp was observed, with all substitutions conserving the relevant secondary structures of the V6 and V8 regions in the RNA molecules. Hybridizations with specifically designed probes demonstrated different chromosomal locations of the respective rRNA genes. Amplifications of reverse-transcribed rRNA from ribosome preparations, as well as whole-cell hybridizations, revealed a predominant representation of particular sequences in ribosomes of exponentially growing laboratory cultures. Different strains of P. polymyxa showed not only remarkably differing patterns of PCR products in TGGE analysis but also discriminative whole-cell labeling with the designed oligonucleotide probes, indicating the different representation of individual sequences in active ribosomes. Our results demonstrate the usefulness of TGGE for the structural analysis of heterogeneous rRNA genes together with their expression, stress problems of the generation of meaningful data for 16S rRNA sequences and probe designs, and might have consequences for evolutionary concepts. PMID:8824607

Quantitation of base substitutions in eukaryotic 5S rRNA: selection for the maintenance of RNA secondary structure.

PubMed

Curtiss, W C; Vournakis, J N

1984-01-01

Eukaryotic 5S rRNA sequences from 34 diverse species were compared by the following method: (1) The sequences were aligned; (2) the positions of substitutions were located by comparison of all possible pairs of sequences; (3) the substitution sites were mapped to an assumed general base pairing model; and (4) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. An analysis of the sequence and structure variability in each region of the molecule is presented. It was found that the degree of base substitution varies over a wide range, from absolute conservation to occurrence of over 90% of the possible observable substitutions. The substitutions are located primarily in stem regions of the 5S rRNA secondary structure. More than 88% of the substitutions in helical regions maintain base pairing. The disruptive substitutions are primarily located at the edges of helical regions, resulting in shortening of the helical regions and lengthening of the adjacent nonpaired regions. Base stacking patterns determined by the R-Y model are mapped onto the general secondary structure. Intrastrand and interstrand stacking could stabilize alternative coaxial structures and limit the conformational flexibility of nonpaired regions. Two short contiguous regions are 100% conserved in all species. This may reflect evolutionary constraints imposed at the DNA level by the requirement for binding of a 5S gene transcription initiation factor during gene expression.

Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

PubMed Central

Khan, A S

1984-01-01

The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

Altered erythrocyte nucleotide patterns are characteristic of inherited disorders of purine or pyrimidine metabolism.

PubMed

Simmonds, H A; Fairbanks, L D; Morris, G S; Webster, D R; Harley, E H

1988-02-15

This paper compares erythrocyte nucleotide levels in patients with eight different inherited purine or pyrimidine enzyme defects identified amongst a variety of patients referred predominantly for investigation of severe neurological abnormalities, or immunodeficiency syndromes. Characteristic nucleotide patterns were identified only in the six disorders (four involving purine and two pyrimidine metabolism) where there was clinical evidence of cellular toxicity. They were frequently related to the accumulation of abnormal metabolites in body fluids. These erythrocyte studies have demonstrated the following. 1. ATP depletion is not an invariable feature of adenosine deaminase (ADA) deficiency, but the accumulation of the deoxyribonucleotides dATP, or dGTP, is diagnostic of ADA, or purine nucleoside phosphorylase (PNP) deficiency, respectively. The early accumulation of dATP in foetal blood is a valuable aid to prenatal diagnosis of ADA deficiency. 2. GTP depletion appears to reflect the degree of CNS involvement in hypoxanthine-guanine phosphoribosyltransferase and PNP deficiency, as well as PP-ribose-P synthetase superactivity. Other diagnostic changes involving increased pyrimidine sugars and increased or decreased NAD levels, or ZTP in Lesch Nyhan erythrocytes, show no consistent correlation with the clinical manifestations. 3. These altered nucleotide levels afford a novel means for carrier detection of the X-linked defect associated with aberrant PP-ribose-P synthetase activity, where no other test is yet available. Measurement of erythrocyte nucleotide levels thus provides a simple and rapid aid to diagnosis and may sometimes be essential for determining prognosis, carrier detection, or monitoring therapy. These characteristic 'fingerprints' may give some insight into the mechanism by which the abnormal gene product produces disease. Such grossly altered nucleotide levels could also result in loss of erythrocyte flexibility, increased destruction and hence the anaemia, or other clinical manifestations, observed in some disorders.

Hydrophobic Amino Acids in the Human Immunodeficiency Virus Type 1 p2 and Nucleocapsid Proteins Can Contribute to the Rescue of Deleted Viral RNA Packaging Signals

PubMed Central

Rong, Liwei; Russell, Rodney S.; Hu, Jing; Guan, Yongjun; Kleiman, Lawrence; Liang, Chen; Wainberg, Mark A.

2001-01-01

An RNA fragment of 75 nucleotides, which is located between the primer binding site and the 5′ major splice donor site in human immunodeficiency virus type 1, has been shown to participate in specific encapsidation of viral RNA. Compensation studies have identified two second-site mutations, namely, MP2 (a T12I substitution in p2) and MNC (a T24I substitution in the nucleocapsid [NC] protein) that were involved in the rescue of various deletions in the aforementioned RNA region (i.e., BH-D1, BH-D2, and BH-LD3). To study whether the MP2 and MNC point mutations exert their compensatory effects in a cis manner, production of Gag proteins was blocked by insertion of stop codons into LD3, LD3-MP2-MNC, and wild-type BH10 such that the constructs generated, i.e., LD3-DG, LD3-MP2-MNC-DG, and BH-DG, only provided RNA transcripts for packaging. The results of cotransfection experiments showed that the LD3-MP2-MNC-DG viral RNA was packaged as inefficiently as LD3-DG; in contrast, BH-DG was efficiently packaged. Therefore, nucleotide substitutions in MP2 and MNC did not act in a cis manner to correct the packaging deficits in LD3. Next, we deliberately changed the T12 in p2 or the T24 in the NC to each of 19 other amino acids. We found that amino acids with long hydrophobic side chains, i.e., V, L, I, and M, were favored at either position 12 in p2 or at position 24 in NC to compensate for the above-mentioned deletions. Further studies showed that only a few amino acids could not be used at these two sites by the wild-type virus due to decreased RNA levels in the virion or abnormal Gag protein processing. In this case, W, D, and E could not substitute for T12 in p2, and S, D, and N could not substitute for T24 in NC, without affecting viral infectivity. Therefore, the long hydrophobic side chains of V, L, I, and M are necessary for these amino acids to rescue the BH-D1, BH-D2, and BH-LD3 mutated viruses. PMID:11461996

HLA-DQB1*03 Confers Susceptibility to Chronic Hepatitis C in Japanese: A Genome-Wide Association Study

PubMed Central

Takahashi, Atsushi; Hayes, C. Nelson; Urabe, Yuji; Abe, Hiromi; Kawaoka, Tomokazu; Tsuge, Masataka; Hiraga, Nobuhiko; Imamura, Michio; Kawakami, Yoshiiku; Aikata, Hiroshi; Takahashi, Shoichi; Akuta, Norio; Suzuki, Fumitaka; Ikeda, Kenji; Kumada, Hiromitsu; Karino, Yoshiyasu; Toyota, Joji; Tsunoda, Tatsuhiko; Kubo, Michiaki; Kamatani, Naoyuki; Nakamura, Yusuke; Chayama, Kazuaki

2013-01-01

Hepatitis C virus (HCV) establishes a chronic infection in 70-80% of infected individuals. Many researchers have examined the effect of human leukocyte antigen (HLA) on viral persistence because of its critical role in the immune response against exposure to HCV, but almost all studies have proven to be inconclusive. To identify genetic risk factors for chronic HCV infection, we analyzed 458,207 single nucleotide polymorphisms (SNPs) in 481 chronic HCV patients and 2,963 controls in a Japanese cohort. Next, we performed a replication study with an independent panel of 4,358 cases and 1,114 controls. We further confirmed the association in 1,379 cases and 25,817 controls. In the GWAS phase, we found 17 SNPs that showed suggestive association (P < 1 × 10-5). After the first replication study, we found one intronic SNP in the HLA-DQ locus associated with chronic HCV infection, and when we combined the two studies, the association reached the level of genome-wide significance. In the second replication study, we again confirmed the association (P combined = 3.59 × 10−16, odds ratio [OR] = 0.79). Subsequent analysis revealed another SNP, rs1130380, with a stronger association (OR=0.72). This nucleotide substitution causes an amino acid substitution (R55P) in the HLA-DQB1 protein specific to the DQB1*03 allele, which is common worldwide. In addition, we confirmed an association with the previously reported IFNL3-IFNL4 locus and propose that the effect of DQB1*03 on HCV persistence might be affected by the IFNL4 polymorphism. Our findings suggest that a common amino acid substitution in HLA-DQB1 affects susceptibility to chronic infection with HCV in the Japanese population and may not be independent of the IFNL4 genotype. PMID:24376798

Diversity of interferon inducible Mx gene in horses and association of variations with susceptibility vis-à-vis resistance against equine influenza infection.

PubMed

Manuja, Balvinder K; Manuja, Anju; Dahiya, Rajni; Singh, Sandeep; Sharma, R C; Gahlot, S K

2014-10-01

Equine influenza (EI) is primarily an infection of the upper respiratory tract and is one of the major infectious respiratory diseases of economic importance in equines. Re-emergence of the disease, species jumping by H3N8 virus in canines and possible threat of human pandemic due to the unpredictable nature of the virus have necessitated research on devising strategies for preventing the disease. The myxovirus resistance protein (Mx) has been reported to confer resistance to Orthomyxo virus infection by modifying cellular functions needed along the viral replication pathway. Polymorphisms and differential antiviral activities of Mx gene have been reported in pigs and chicken. Here we report the diversity of Mx gene, its expression in response to stimulation with interferon (IFN) α/β and their association with EI resistance and susceptibility in Marwari horses. Blood samples were collected from horses declared positive for equine influenza and in contact animals with a history of no clinical signs. Mx gene was amplified by reverse transcription from total RNA isolated from peripheral blood mononuclear cells (PBMCs) stimulated with IFN α/β using gene specific primers. The amplified gene products from representative samples were cloned and sequenced. Nucleotide sequences and deduced amino acid sequences were analyzed. Out of a total 24 amino acids substitutions sorting intolerant from tolerant (SIFT) analysis predicted 13 substitutions with functional consequences. Five substitutions (V67A, W123L, E346Y, N347Y, S689N) were observed only in resistant animals. Evolutionary distances based on nucleotide sequences with in equines ranged between 0.3-2.0% and 20-24% with other species. On phylogenetic analysis all equine sequences clustered together while other species formed separate clades. Copyright © 2014 Elsevier B.V. All rights reserved.

Multiple primary tumors of the upper aerodigestive tract: is there a role for constitutional mutations in the p53 gene?

PubMed

Gallo, O; Sardi, I; Pepe, G; Franchi, A; Attanasio, M; Giusti, B; Bocciolini, C; Abbate, R

1999-07-19

Head-and-neck cancer (HNC) patients have a high risk of developing second primary tumors of the upper aerodigestive tract, the main cause of death. Although the roles of tobacco and diet in multiple head-and-neck carcinogenesis have been thoroughly investigated, little is known about individual genetic susceptibility factors involved in this process. Genomic instability, reflecting the propensity and the susceptibility of the genome to acquire multiple alterations, could be considered a driving force behind multiple carcinogenesis. Mutation of the p53 tumor-suppressor gene has been proposed to play an important role in this process. Therefore, we evaluated the incidence of inherited p53 germ-line alteration(s) in a population of 24 consecutive HNC patients and their first-degree relatives affected by multiple malignancies as well as the occurrence of p53 somatic acquired mutation(s) in 16 cancers, including first and second primaries from 5 HNCs of the same group. Mutations in exons 4-11 of the p53 gene were investigated using SSCP-PCR analysis and DNA sequencing. Analysis was extended to the peripheral blood and cancer biopsies available from first-degree relatives of cancer-prone families with p53 germ-line mutations. p53 germ-line mutations were identified in the peripheral blood and corresponding cancers of 3 HNC patients who had multiple malignancies. The only missense mutation detected was mapped in exon 6; it is a GTG to GAG substitution with an amino acid change from Val to Glu at codon 197. The remaining 2 p53 germ-line mutations were single-nucleotide substitutions without amino acid change in exon 6 (codon 213, CGA to CGG) and in exon 8 (codon 295, CCT to CCC), respectively. These mutations were found in HNC patients with a family history of cancer. Abnormal expression of wild-type p53 protein in normal and pathological tissues from patients with the same sense single-nucleotide substitutions was detected by immuno-histochemistry.

Reconstructing the origin and transmission dynamics of the 1967–68 foot-and-mouth disease epidemic in the United Kingdom☆

PubMed Central

Wright, Caroline F.; Knowles, Nick J.; Di Nardo, Antonello; Paton, David J.; Haydon, Daniel T.; King, Donald P.

2013-01-01

A large epidemic of foot-and-mouth disease (FMD) occurred in the United Kingdom (UK) over a seven month period in Northwest England from late 1967 to the summer of 1968. This was preceded by a number of smaller FMD outbreaks in the country, two in 1967, in Hampshire and Warwickshire and one in Northumberland during 1966. The causative agent of all four events was identified as FMD virus (FMDV) serotype O and the source of the large epidemic was attributed to infected bone marrow in lamb products imported from Argentina. However, the diagnostic tools available at the time were unable to entirely rule out connections with the earlier UK FMD outbreaks, as well as other potential sources from Europe. The aim of this study was to apply molecular sequencing to investigate the likely source of this epidemic using VP1 region and full genome (FG) sequences determined directly from clinical epithelium samples (n = 13) or cell culture isolates (n = 6), from this and contemporary outbreaks in the UK, Europe and South America. Analysis of the VP1 sequences provided evidence for at least three separate incursions of FMDV into the UK including one independent introduction that was responsible for the main 1967/68 epidemic. Analysis of FG sequences from the main 1967/68 outbreak (n = 10) revealed nucleotide substitutions at 94 genomic sites providing evidence for the linear accumulation of nucleotide substitutions (rate = 2.42 × 10−5 nt substitutions/site/day). However, there were five samples where this linear relationship was absent, indicating evolutional dormancy of the virus, presumably outside a host. These results help define the evolutionary dynamics of FMDV during an epidemic and contribute to the knowledge and understanding from which to base future outbreak control strategies. PMID:24035793

Genetic Diversity of Hepatitis A Virus in China: VP3-VP1-2A Genes and Evidence of Quasispecies Distribution in the Isolates

PubMed Central

Cao, Jingyuan; Zhou, Wenting; Yi, Yao; Jia, Zhiyuan; Bi, Shengli

2013-01-01

Hepatitis A virus (HAV) is the most common cause of infectious hepatitis throughout the world, spread largely by the fecal-oral route. To characterize the genetic diversity of the virus circulating in China where HAV in endemic, we selected the outbreak cases with identical sequences in VP1-2A junction region and compiled a panel of 42 isolates. The VP3-VP1-2A regions of the HAV capsid-coding genes were further sequenced and analyzed. The quasispecies distribution was evaluated by cloning the VP3 and VP1-2A genes in three clinical samples. Phylogenetic analysis demonstrated that the same genotyping results could be obtained whether using the complete VP3, VP1, or partial VP1-2A genes for analysis in this study, although some differences did exist. Most isolates clustered in sub-genotype IA, and fewer in sub-genotype IB. No amino acid mutations were found at the published neutralizing epitope sites, however, several unique amino acid substitutions in the VP3 or VP1 region were identified, with two amino acid variants closely located to the immunodominant site. Quasispecies analysis showed the mutation frequencies were in the range of 7.22x10-4 -2.33x10-3 substitutions per nucleotide for VP3, VP1, or VP1-2A. When compared with the consensus sequences, mutated nucleotide sites represented the minority of all the analyzed sequences sites. HAV replicated as a complex distribution of closely genetically related variants referred to as quasispecies, and were under negative selection. The results indicate that diverse HAV strains and quasispecies inside the viral populations are presented in China, with unique amino acid substitutions detected close to the immunodominant site, and that the possibility of antigenic escaping mutants cannot be ruled out and needs to be further analyzed. PMID:24069343

Evolution of the neuraminidase gene of seasonal influenza A and B viruses in Thailand between 2010 and 2015.

PubMed

Tewawong, Nipaporn; Vichiwattana, Preeyaporn; Korkong, Sumeth; Klinfueng, Sirapa; Suntronwong, Nungruthai; Thongmee, Thanunrat; Theamboonlers, Apiradee; Vongpunsawad, Sompong; Poovorawan, Yong

2017-01-01

The neuraminidase inhibitors (NAIs) oseltamivir and zanamivir are commonly used for the treatment and control of influenza A and B virus infection. However, the emergence of new influenza virus strains with reduced susceptibility to NAIs may appear with the use of these antivirals or even naturally. We therefore screened the neuraminidase (NA) sequences of seasonal influenza virus A(H1N1), A(H1N1)pdm09, A(H3N2), and influenza B virus strains identified in Thailand for the presence of substitutions previously reported to reduce susceptibility to NAIs. We initially examined oseltamivir resistance (characterized by the H275Y mutation in the NA gene) in 485 A(H1N1)pdm09 strains circulating in Thailand and found that 0.82% (4/485) had this substitution. To further evaluate the evolution of the NA gene, we also randomly selected 98 A(H1N1)pdm09, 158 A(H3N2), and 69 influenza B virus strains for NA gene amplification and sequencing, which revealed various amino acid mutations in the active site of the NA protein previously shown to be associated with reduced susceptibility to NAIs. Phylogenetic analysis of the influenza virus strains from this study and elsewhere around the world, together with the estimations of nucleotide substitution rates and selection pressure, and the predictions of B-cell epitopes and N-linked glycosylation sites all provided evidence for the ongoing evolution of NA. The overall rates of NA evolution for influenza A viruses were higher than for influenza B virus at the nucleotide level, although influenza B virus possessed more genealogical diversity than that of influenza A viruses. The continual surveillance of the antigenic changes associated with the NA protein will not only contribute to the influenza virus database but may also provide a better understanding of selection pressure exerted by antiviral use.

Evolution of the neuraminidase gene of seasonal influenza A and B viruses in Thailand between 2010 and 2015

PubMed Central

Tewawong, Nipaporn; Vichiwattana, Preeyaporn; Korkong, Sumeth; Klinfueng, Sirapa; Suntronwong, Nungruthai; Thongmee, Thanunrat; Theamboonlers, Apiradee; Vongpunsawad, Sompong; Poovorawan, Yong

2017-01-01

The neuraminidase inhibitors (NAIs) oseltamivir and zanamivir are commonly used for the treatment and control of influenza A and B virus infection. However, the emergence of new influenza virus strains with reduced susceptibility to NAIs may appear with the use of these antivirals or even naturally. We therefore screened the neuraminidase (NA) sequences of seasonal influenza virus A(H1N1), A(H1N1)pdm09, A(H3N2), and influenza B virus strains identified in Thailand for the presence of substitutions previously reported to reduce susceptibility to NAIs. We initially examined oseltamivir resistance (characterized by the H275Y mutation in the NA gene) in 485 A(H1N1)pdm09 strains circulating in Thailand and found that 0.82% (4/485) had this substitution. To further evaluate the evolution of the NA gene, we also randomly selected 98 A(H1N1)pdm09, 158 A(H3N2), and 69 influenza B virus strains for NA gene amplification and sequencing, which revealed various amino acid mutations in the active site of the NA protein previously shown to be associated with reduced susceptibility to NAIs. Phylogenetic analysis of the influenza virus strains from this study and elsewhere around the world, together with the estimations of nucleotide substitution rates and selection pressure, and the predictions of B-cell epitopes and N-linked glycosylation sites all provided evidence for the ongoing evolution of NA. The overall rates of NA evolution for influenza A viruses were higher than for influenza B virus at the nucleotide level, although influenza B virus possessed more genealogical diversity than that of influenza A viruses. The continual surveillance of the antigenic changes associated with the NA protein will not only contribute to the influenza virus database but may also provide a better understanding of selection pressure exerted by antiviral use. PMID:28410396

Identification and Molecular Analysis of Four New Alleles at the W1 Locus Associated with Flower Color in Soybean

PubMed Central

Sundaramoorthy, Jagadeesh; Park, Gyu Tae; Chang, Jeong Ho; Lee, Jeong-Dong; Kim, Jeong Hoe; Seo, Hak Soo; Chung, Gyuhwa; Song, Jong Tae

2016-01-01

In soybean, flavonoid 3′5′-hydroxylase (F3′5′H) and dihydroflavonol-4-reductase (DFR) play a crucial role in the production of anthocyanin pigments. Loss-of-function of the W1 locus, which encodes the former, or W3 and W4, which encode the latter, always produces white flowers. In this study, we searched for new genetic components responsible for the production of white flowers in soybean and isolated four white-flowered mutant lines, i.e., two Glycine soja accessions (CW12700 and CW13381) and two EMS-induced mutants of Glycine max (PE1837 and PE636). F3′5′H expression in CW12700, PE1837, and PE636 was normal, whereas that in CW13381 was aberrant and missing the third exon. Sequence analysis of F3′5′H of CW13381 revealed the presence of an indel (~90-bp AT-repeat) in the second intron. In addition, the F3′5′H of CW12700, PE1837, and PE636 harbored unique single-nucleotide substitutions. The single nucleotide polymorphisms resulted in substitutions of amino acid residues located in or near the SRS4 domain of F3′5′H, which is essential for substrate recognition. 3D structure modeling of F3′5′H indicated that the substitutions could interfere with an interaction between the substrate and heme group and compromise the conformation of the active site of F3′5′H. Recombination analysis revealed a tight correlation between all of the mutant alleles at the W1 locus and white flower color. On the basis of the characterization of the new mutant alleles, we discussed the biological implications of F3′5′H and DFR in the determination of flower colors in soybean. PMID:27442124

Hierarchical Self Assembly of Patterns from the Robinson Tilings: DNA Tile Design in an Enhanced Tile Assembly Model

PubMed Central

Padilla, Jennifer E.; Liu, Wenyan; Seeman, Nadrian C.

2012-01-01

We introduce a hierarchical self assembly algorithm that produces the quasiperiodic patterns found in the Robinson tilings and suggest a practical implementation of this algorithm using DNA origami tiles. We modify the abstract Tile Assembly Model, (aTAM), to include active signaling and glue activation in response to signals to coordinate the hierarchical assembly of Robinson patterns of arbitrary size from a small set of tiles according to the tile substitution algorithm that generates them. Enabling coordinated hierarchical assembly in the aTAM makes possible the efficient encoding of the recursive process of tile substitution. PMID:23226722

Hierarchical Self Assembly of Patterns from the Robinson Tilings: DNA Tile Design in an Enhanced Tile Assembly Model.

PubMed

Padilla, Jennifer E; Liu, Wenyan; Seeman, Nadrian C

2012-06-01

We introduce a hierarchical self assembly algorithm that produces the quasiperiodic patterns found in the Robinson tilings and suggest a practical implementation of this algorithm using DNA origami tiles. We modify the abstract Tile Assembly Model, (aTAM), to include active signaling and glue activation in response to signals to coordinate the hierarchical assembly of Robinson patterns of arbitrary size from a small set of tiles according to the tile substitution algorithm that generates them. Enabling coordinated hierarchical assembly in the aTAM makes possible the efficient encoding of the recursive process of tile substitution.

Candida uthaithanina sp. nov., an anamorphic yeast species in Nakaseomyces clade isolated in Thailand.

PubMed

Limtong, Savitree; Jindamorakot, Sasitorn; Am-In, Somjit; Kaewwichian, Rungluk; Nitiyon, Sukanya; Yongmanitchai, Wichien; Nakase, Takashi

2011-05-01

Three yeast stains were isolated from two unknown fruits (strains DD2-22-1(T) and SK44) and moss (strain ST-449) in Thailand. Analysis of the D1/D2 domain of the large subunit (LSU) rRNA gene sequences of the three strains revealed that they belonged to the same species. In terms of pairwise sequence similarity, Candida cf. glabrata UWO(PS) 98-110.4 and Candida nivariensis were the closest undescribed and recognized taxa, but the levels of nucleotide substitutions were 1.7-1.9% and 2.0-2.2%, respectively. The levels of nucleotide substitutions were sufficient to justify the description of a separate species of Candida. In the phylogenetic tree based on the D1/D2 domain of the LSU rRNA gene the three strains were placed in a separate branch in the Nakaseomyces clade with C. cf. glabrata UWO(PS)98-110.4, C. nivariensis, Candida glabrata, Candida bracarensis, Candida kungkrabaensis and Nakaseomyces delphensis. Phenotypic characteristics of the three strains were similar which included proliferation by multilateral budding, absence of ascospores, arthrospores or ballistospores; negative for Diazonium blue B and urease tests. The major ubiquinone was Q-6. On the basis of the above findings, the three strains were assigned to a single novel species of Candida, for which the name Candida uthaithanina sp. nov is proposed. The type strain is DD2-22-1(T) (= BCC 29899(T) = NBRC 104876(T) = CBS 10932(T)).

Candida phyllophila sp. nov. and Candida vitiphila sp. nov., two novel yeast species from grape phylloplane in Thailand.

PubMed

Limtong, Savitree; Kaewwichian, Rungluk

2013-01-01

Three strains (K59(T), K60 and K70 (T)) representing two novel yeast species were isolated from the external surface of leaves of different wine grape (Vitis vinifera) plants, which were collected from the Kanchanaburi Research Station (N14°07'15.1″ E099°19'05.6″), Wang Dong Sub-district, Mueang District, Kanchanaburi Province, Thailand, by an enrichment technique. The sequences of the D1/D2 domain of the large subunit (LSU) rRNA gene of two strains (K59(T) and K60) were identical and differed from that of strain K70(T). In terms of pairwise sequence similarity of the D1/D2 domain, the closest species to the three strains was Candida asparagi but with 2.3% nucleotide substitutions for strains K59(T) and K60, and 2.1% nucleotide substitutions for strain K70(T). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics and the sequence analysis of the D1/D2 domain of the large subunit (LSU) rRNA gene, the three strains were assigned to be two novel Candida species. Two strains (K59(T) and K60) were assigned as Candida phyllophila sp. nov. (type strain K59(T)=BCC 42662(T)=NBRC 107776(T)=CBS 12671(T)). Candida vitiphila sp. nov. is proposed for strain K70(T) (=BCC 42663(T)=NBRC 107777(T)=CBS 12672(T)).

Stabilization of a nucleotide-binding domain of the cystic fibrosis transmembrane conductance regulator yields insight into disease-causing mutations.

PubMed

Vernon, Robert M; Chong, P Andrew; Lin, Hong; Yang, Zhengrong; Zhou, Qingxian; Aleksandrov, Andrei A; Dawson, Jennifer E; Riordan, John R; Brouillette, Christie G; Thibodeau, Patrick H; Forman-Kay, Julie D

2017-08-25

Characterization of the second nucleotide-binding domain (NBD2) of the cystic fibrosis transmembrane conductance regulator (CFTR) has lagged behind research into the NBD1 domain, in part because NBD1 contains the F508del mutation, which is the dominant cause of cystic fibrosis. Research on NBD2 has also been hampered by the overall instability of the domain and the difficulty of producing reagents. Nonetheless, multiple disease-causing mutations reside in NBD2, and the domain is critical for CFTR function, because channel gating involves NBD1/NBD2 dimerization, and NBD2 contains the catalytically active ATPase site in CFTR. Recognizing the paucity of structural and biophysical data on NBD2, here we have defined a bioinformatics-based method for manually identifying stabilizing substitutions in NBD2, and we used an iterative process of screening single substitutions against thermal melting points to both produce minimally mutated stable constructs and individually characterize mutations. We present a range of stable constructs with minimal mutations to help inform further research on NBD2. We have used this stabilized background to study the effects of NBD2 mutations identified in cystic fibrosis (CF) patients, demonstrating that mutants such as N1303K and G1349D are characterized by lower stability, as shown previously for some NBD1 mutations, suggesting a potential role for NBD2 instability in the pathology of CF. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Effect of a single polymorphism in the Japanese quail NK-lysin gene on antimicrobial activity.

PubMed

Ishige, Taichiro; Hara, Hiromi; Hirano, Takashi; Kono, Tomohiro; Hanzawa, Kei

2016-01-01

NK-lysins are cationic peptides that play important roles in host protection, and are an important constituent of innate immunity. We identified nine single-nucleotide polymorphisms (SNPs) in the NK-lysin open reading frame (ORF) from 32 Japanese quails in six strains: A, B, ND, K, P, and Y. The G to A substitution at nucleotide position 272 in the ORF resulted in a Gly (G) to Asp (D) amino acid substitution (Cj31G and Cj31D alleles). The Cj31D allele was detected in P (frequency 0.76) and Y (frequency 0.03) strains. We compared the antimicrobial activities of four synthetic peptides from the helix 2-loop-helix 3 region of avian NK-lysins against Escherichia coli: Cj31G and Cj31D from quail and Gg29N and Gg29D from chicken. The antimicrobial activities of the four peptides decreased in the following order: Gg29N > Cj31G > Gg29D > Cj31D (P < 0.05). Although there were no differences in the predicted secondary structure of the Cj31G and Cj31D, the net charge of the Cj31G was higher than that of Cj31D. These data indicated that the antimicrobial activity of CjNKL is influenced by net charge, similar to that which has been observed in chicken. © 2015 Japanese Society of Animal Science.

Nucleotide and deduced amino acid sequence of the envelope gene of the Vasilchenko strain of TBE virus; comparison with other flaviviruses.

PubMed

Gritsun, T S; Frolova, T V; Pogodina, V V; Lashkevich, V A; Venugopal, K; Gould, E A

1993-02-01

A strain of tick-borne encephalitis virus known as Vasilchenko (Vs) exhibits relatively low virulence characteristics in monkeys, Syrian hamsters and humans. The gene encoding the envelope glycoprotein of this virus was cloned and sequenced. Alignment of the sequence with those of other known tick-borne flaviviruses and identification of the recognised amino acid genetic marker EHLPTA confirmed its identity as a member of the TBE complex. However, Vs virus was distinguishable from eastern and western tick-borne serotypes by the presence of the sequence AQQ at amino acid positions 232-234 and also by the presence of other specific amino acid substitutions which may be genetic markers for these viruses and could determine their pathogenetic characteristics. When compared with other tick-borne flaviviruses, Vs virus had 12 unique amino acid substitutions including an additional potential glycosylation site at position (315-317). The Vs virus strain shared closest nucleotide and amino acid homology (84.5% and 95.5% respectively) with western and far eastern strains of tick-borne encephalitis virus. Comparison with the far eastern serotype of tick-borne encephalitis virus, by cross-immunoelectrophoresis of Vs virions and PAGE analysis of the extracted virion proteins, revealed differences in surface charge and virus stability that may account for the different virulence characteristics of Vs virus. These results support and enlarge upon previous data obtained from molecular and serological analysis.

Identification of Sequence Variation in the Apolipoprotein A2 Gene and Their Relationship with Serum High-Density Lipoprotein Cholesterol Levels.

PubMed

Bandarian, Fatemeh; Daneshpour, Maryam Sadat; Hedayati, Mehdi; Naseri, Mohsen; Azizi, Fereidoun

2016-01-01

Apolipoprotein A2 (APOA2) is the second major apolipoprotein of the high-density lipoprotein cholesterol (HDL-C). The study aim was to identify APOA2 gene variation in individuals within two extreme tails of HDL-C levels and its relationship with HDL-C level. This cross-sectional survey was conducted on participants from Tehran Glucose and Lipid Study (TLGS) at Research Institute for Endocrine Sciences, Tehran, Iran from April 2012 to February 2013. In total, 79 individuals with extreme low HDL-C levels (≤5th percentile for age and gender) and 63 individuals with extreme high HDL-C levels (≥95th percentile for age and gender) were selected. Variants were identified using DNA amplification and direct sequencing. Screen of all exons and the core promoter region of APOA2 gene identified nine single nucleotide substitutions and one microsatellite; five of which were known and four were new variants. Of these nine variants, two were common tag single nucleotide polymorphisms (SNPs) and seven were rare SNPs. Both exonic substitutions were missense mutations and caused an amino acid change. There was a significant association between the new missense mutation (variant Chr.1:16119226, Ala98Pro) and HDL-C level. None of two common tag SNPs of rs6413453 and rs5082 contributes to the HDL-C trait in Iranian population, but a new missense mutation in APOA2 in our population has a significant association with HDL-C.

Characterization of HIV-1 Resistance to Tenofovir Alafenamide In Vitro

PubMed Central

Johnson, Audun; Miller, Michael D.; Callebaut, Christian

2015-01-01

Tenofovir alafenamide (TAF) is an investigational prodrug of the HIV-1 nucleotide reverse transcriptase (RT) inhibitor (NtRTI) tenofovir (TFV), with improved potency and drug delivery properties over the current prodrug, tenofovir disoproxil fumarate (TDF). TAF is currently in phase 3 clinical studies for the treatment of HIV-1 infection, in combination with other antiretroviral agents. Phase 1 and 2 studies have shown that TAF was associated with increased peripheral blood mononuclear cell (PBMC) drug loading and increased suppression of HIV-1 replication compared to treatment with TDF. In this study, selection of in vitro resistance to both TAF and the parent compound, TFV, led to the emergence of HIV-1 with the K65R amino acid substitution in RT with 6.5-fold-reduced susceptibility to TAF. Although TAF is more potent than TFV in vitro, the antiviral susceptibilities to TAF and TFV of a large panel of nucleoside/nucleotide RT inhibitor (NRTI)-resistant mutants were highly correlated (R2 = 0.97), indicating that the two compounds have virtually the same resistance profile when assessed as fold change from the wild type. TAF showed full antiviral activity in PBMCs against primary HIV-1 isolates with protease inhibitor, nonnucleoside RT inhibitor (NNRTI), or integrase strand transfer inhibitor resistance but reduced activity against isolates with extensive NRTI resistance amino acid substitutions. However, the increased cell loading of TFV with TAF versus TDF observed in vivo suggests that TAF may retain activity against TDF-resistant mutant viruses. PMID:26149983

Measles virus genetic evolution throughout an imported epidemic outbreak in a highly vaccinated population.

PubMed

Muñoz-Alía, Miguel Ángel; Fernández-Muñoz, Rafael; Casasnovas, José María; Porras-Mansilla, Rebeca; Serrano-Pardo, Ángela; Pagán, Israel; Ordobás, María; Ramírez, Rosa; Celma, María Luisa

2015-01-22

Measles virus circulates endemically in African and Asian large urban populations, causing outbreaks worldwide in populations with up-to-95% immune protection. We studied the natural genetic variability of genotype B3.1 in a population with 95% vaccine coverage throughout an imported six month measles outbreak. From first pass viral isolates of 47 patients we performed direct sequencing of genomic cDNA. Whilst no variation from index case sequence occurred in the Nucleocapsid gene hyper-variable carboxy end, in the Hemagglutinin gene, main target for neutralizing antibodies, we observed gradual nucleotide divergence from index case along the outbreak (0% to 0.380%, average 0.138%) with the emergence of transient and persistent non-synonymous and synonymous mutations. Little or no variation was observed between the index and last outbreak cases in Phosphoprotein, Nucleocapsid, Matrix and Fusion genes. Most of the H non-synonymous mutations were mapped on the protein surface near antigenic and receptors binding sites. We estimated a MV-Hemagglutinin nucleotide substitution rate of 7.28 × 10-6 substitutions/site/day by a Bayesian phylogenetic analysis. The dN/dS analysis did not suggest significant immune or other selective pressures on the H gene during the outbreak. These results emphasize the usefulness of MV-H sequence analysis in measles epidemiological surveillance and elimination programs, and in detection of potentially emergence of measles virus neutralization-resistant mutants. Copyright © 2014 Elsevier B.V. All rights reserved.

Phylogeny of mitochondrial DNA clones in tassel-eared squirrels Sciurus aberti.

PubMed

Wettstein, P J; Lager, P; Jin, L; States, J; Lamb, T; Chakraborty, R

1994-12-01

The tassel-eared squirrel, Sciurus aberti, includes six subspecies which occupy restrictive and apparently identical habitats in Ponderosa pine forests in the south-western United States and Mexico; the strict habitat requirement of this species is based on dietary requirements which are only fulfilled in these forests. To examine evolutionary relationships among certain subspecies of S. aberti, we obtained estimates of nucleotide diversity within subspecies as well as nucleotide divergence between subspecies using mitochondrial DNA (mtDNA) analysis. Restriction site polymorphisms were identified in samples of the four US subspecies: S. a. aberti (Abert), S. a. kaibabensis (Kaibab), S. a. ferreus (Ferreus), and S. a. chuscensis (Chuska) Fourteen mtDNA clones were resolved that were, with one exception, uniquely subspecific. Dendrograms constructed by neighbour-joining and maximum parsimony methods revealed two major assemblages: (1) an Abert/Kaibab group; and (2) a Ferreus/Chuska group. The Abert vs. Ferreus clones exhibited the greatest net nucleotide divergence, with a lineage separation estimate approximating 572,000 years ago assuming a nucleotide substitution rate of 7.15 x 10(-9)/year/site. Five out of ten Chuska squirrels shared a clone with one Abert sample; the relative sizes of these two populations and their respective ranges as well as their close proximity support the proposal for relatively recent intermixing of Abert and Chuska populations resulting in what appears to be Abert-->Chuska migration. Nucleotide diversity within subspecies ranked as Kaibab < Ferreus < Abert < Chuska; the relatively high diversity for the Chuska sample is based on the apparent introgression of Abert mtDNA. The relative diversity exhibited by Kaibab, Ferreus and Aberti samples corresponds to the range size of the respective subspecies.

Significant contribution of the 3′→5′ exonuclease activity to the high fidelity of nucleotide incorporation catalyzed by human DNA polymerase ϵ

PubMed Central

Zahurancik, Walter J.; Klein, Seth J.; Suo, Zucai

2014-01-01

Most eukaryotic DNA replication is performed by A- and B-family DNA polymerases which possess a faithful polymerase activity that preferentially incorporates correct over incorrect nucleotides. Additionally, many replicative polymerases have an efficient 3′→5′ exonuclease activity that excises misincorporated nucleotides. Together, these activities contribute to overall low polymerase error frequency (one error per 106–108 incorporations) and support faithful eukaryotic genome replication. Eukaryotic DNA polymerase ϵ (Polϵ) is one of three main replicative DNA polymerases for nuclear genomic replication and is responsible for leading strand synthesis. Here, we employed pre-steady-state kinetic methods and determined the overall fidelity of human Polϵ (hPolϵ) by measuring the individual contributions of its polymerase and 3′→5′ exonuclease activities. The polymerase activity of hPolϵ has a high base substitution fidelity (10−4–10−7) resulting from large decreases in both nucleotide incorporation rate constants and ground-state binding affinities for incorrect relative to correct nucleotides. The 3′→5′ exonuclease activity of hPolϵ further enhances polymerization fidelity by an unprecedented 3.5 × 102 to 1.2 × 104-fold. The resulting overall fidelity of hPolϵ (10−6–10−11) justifies hPolϵ to be a primary enzyme to replicate human nuclear genome (0.1–1.0 error per round). Consistently, somatic mutations in hPolϵ, which decrease its exonuclease activity, are connected with mutator phenotypes and cancer formation. PMID:25414327

DNA Sequence-Dependent Ionic Currents in Ultra-Small Solid-State Nanopores†

PubMed Central

Comer, Jeffrey

2016-01-01

Measurements of ionic currents through nanopores partially blocked by DNA have emerged as a powerful method for characterization of the DNA nucleotide sequence. Although the effect of the nucleotide sequence on the nanopore blockade current has been experimentally demonstrated, prediction and interpretation of such measurements remain a formidable challenge. Using atomic resolution computational approaches, here we show how the sequence, molecular conformation, and pore geometry affect the blockade ionic current in model solid-state nanopores. We demonstrate that the blockade current from a DNA molecule is determined by the chemical identities and conformations of at least three consecutive nucleotides. We find the blockade currents produced by the nucleotide triplets to vary considerably with their nucleotide sequence despite having nearly identical molecular conformations. Encouragingly, we find blockade current differences as large as 25% for single-base substitutions in ultra small (1.6 nm × 1.1 nm cross section; 2 nm length) solid-state nanopores. Despite the complex dependence of the blockade current on the sequence and conformation of the DNA triplets, we find that, under many conditions, the number of thymine bases is positively correlated with the current, whereas the number of purine bases and the presence of both purine and pyrimidines in the triplet are negatively correlated with the current. Based on these observations, we construct a simple theoretical model that relates the ion current to the base content of a solid-state nanopore. Furthermore, we show that compact conformations of DNA in narrow pores provide the greatest signal-to-noise ratio for single base detection, whereas reduction of the nanopore length increases the ionic current noise. Thus, the sequence dependence of nanopore blockade current can be theoretically rationalized, although the predictions will likely need to be customized for each nanopore type. PMID:27103233

Comparative analysis of the prion protein gene sequences in African lion.

PubMed

Wu, Chang-De; Pang, Wan-Yong; Zhao, De-Ming

2006-10-01

The prion protein gene of African lion (Panthera Leo) was first cloned and polymorphisms screened. The results suggest that the prion protein gene of eight African lions is highly homogenous. The amino acid sequences of the prion protein (PrP) of all samples tested were identical. Four single nucleotide polymorphisms (C42T, C81A, C420T, T600C) in the prion protein gene (Prnp) of African lion were found, but no amino acid substitutions. Sequence analysis showed that the higher homology is observed to felis catus AF003087 (96.7%) and to sheep number M31313.1 (96.2%) Genbank accessed. With respect to all the mammalian prion protein sequences compared, the African lion prion protein sequence has three amino acid substitutions. The homology might in turn affect the potential intermolecular interactions critical for cross species transmission of prion disease.

Connexin 26 (GJB2) mutation in an Argentinean patient with keratitis-ichthyosis-deafness (KID) syndrome: a case report.

PubMed

Dalamón, Viviana Karina; Buonfiglio, Paula; Larralde, Margarita; Craig, Patricio; Lotersztein, Vanesa; Choate, Keith; Pallares, Norma; Diamante, Vicente; Elgoyhen, Ana Belén

2016-05-04

Keratitis-Ichthyosis-Deafness (KID) syndrome is a rare condition characterized by pre-lingual sensorineural deafness with skin hyperkeratinization. The primary cause of the disease is a loss-of-function mutation in the GJB2 gene. Mutations in Argentinean patients have not been described. We studied a 2 year-old boy with bilateral congenital sensorineural deafness with dry skin over the entire body, hypotrichosis of the scalp, thin and light-blond hair. Analysis of the GJB2 gene nucleotide sequence revealed the substitution of guanine-148 by adenine predicted to result in an Asp50Asn amino acid substitution. This is the first KID report in a patient from Argentina. This de novo mutation proved to be the cause of keratitis-ichthyosis-deafness syndrome (KID-syndrome) in the patient, and has implications in medical genetic practice.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dinh, Phat X.; Panda, Debasis; Das, Phani B.

Using a recombinant vesicular stomatitis virus encoding eGFP fused in-frame with an essential viral replication protein, the phosphoprotein P, we show that during passage in culture, the virus mutates the nucleotide C289 within eGFP of the fusion protein PeGFP to A or T, resulting in R97S/C amino acid substitution and loss of fluorescence. The resultant non-fluorescent virus exhibits increased fitness and growth advantage over its fluorescent counterpart. The growth advantage of the non-fluorescent virus appears to be due to increased transcription and replication activities of the PeGFP protein carrying the R97S/C substitution. Further, our results show that the R97S/C mutationmore » occurs prior to accumulation of mutations that can result in loss of expression of the gene inserted at the G-L gene junction. These results suggest that fitness gain is more important for the recombinant virus than elimination of expression of the heterologous gene.« less

A nucleotide substitution in one of the beta-tubulin genes of Trichoderma viride confers resistance to the antimitotic drug methyl benzimidazole-2-yl-carbamate.

PubMed

Goldman, G H; Temmerman, W; Jacobs, D; Contreras, R; Van Montagu, M; Herrera-Estrella, A

1993-07-01

We characterized a Trichoderma viride strain that is resistant to the antimitotic drug methyl benzimidazole-2-yl-carbamate (MBC). This species has two beta-tubulin genes (tub1 and tub2) and by reverse genetics we showed that a mutation in the tub2 gene confers MBC resistance in this strain. Comparison of the tub2 sequence of the mutant strain with that of the wild type revealed that a single amino acid substitution of tyrosine for histidine at a position 6 is responsible for the MBC tolerance. Furthermore, we showed that this gene can be used as a homologous dominant selectable marker in T. viride transformation. Both tubulin genes were completely sequenced. They differ by 48 residues and the degree of identity between their deduced amino acid sequences is 86.3%.

Clay catalysis of oligonucleotide formation: kinetics of the reaction of the 5'-phosphorimidazolides of nucleotides with the non-basic heterocycles uracil and hypoxanthine

NASA Technical Reports Server (NTRS)

Kawamura, K.; Ferris, J. P.

1999-01-01

The montmorillonite clay catalyzed condensation of activated monocleotides to oligomers of RNA is a possible first step in the formation of the proposed RNA world. The rate constants for the condensation of the phosphorimidazolide of adenosine were measured previously and these studies have been extended to the phosphorimidazolides of inosine and uridine in the present work to determine of substitution of neutral heterocycles for the basic adenine ring changes the reaction rate or regioselectivity. The oligomerization reactions of the 5'-phosphoromidazolides of uridine (ImpU) and inosine (ImpI) on montmorillonite yield oligo(U)s and oligo(I)s as long as heptamers. The rate constants for oligonucleotide formation were determined by measuring the rates of formation of the oligomers by HPLC. Both the apparent rate constants in the reaction mixture and the rate constants on the clay surface were calculated using the partition coefficients of the oligomers between the aqueous and clay phases. The rate constants for trimer formation are much greater than those dimer synthesis but there was little difference in the rate constants for the formation of trimers and higher oligomers. The overall rates of oligomerization of the phosphorimidazolides of purine and pyrimidine nucleosides in the presence of montmorillonite clay are the same suggesting that RNA formed on the primitive Earth could have contained a variety of heterocyclic bases. The rate constants for oligomerization of pyrimidine nucleotides on the clay surface are significantly higher than those of purine nucleotides since the pyrimidine nucleotides bind less strongly to the clay than do the purine nucleotides. The differences in the binding is probably due to Van der Waals interactions between the purine bases and the clay surface. Differences in the basicity of the heterocyclic ring in the nucleotide have little effect on the oligomerization process.

Candida konsanensis sp. nov., a new yeast species isolated from Jasminum adenophyllum in Thailand with potentially carboxymethyl cellulase-producing capability.

PubMed

Sarawan, Somporn; Mahakhan, Polson; Jindamorakot, Sasitorn; Vichitphan, Kanit; Vichitphan, Sukanda; Sawaengkaew, Jutaporn

2013-08-01

A new yeast species (KKU-FW10) belonging to the Candida genus was isolated from Jasminum adenophyllum in the Plant Genetic Conservation Project under The Royal Initiative of Her Royal Highness Princess Maha Chakri Sirindhorn area, Chulabhorn Dam, Konsan district within Chaiyaphum province in Thailand. The strain was identified via analysis of nucleotide sequences from the D1/D2 domain of 26S ribosomal DNA and based on its morphological, physiological and biochemical characteristics. The sequence obtained from yeast isolate KKU-FW10 was 97 percent identical to that of Candida chanthaburiensis (GenBank accession number AB500861.1), with 506/517 (nucleotides identity/total nucleotides) matching nucleotides, nine substitutions and two gaps being detected. This species belonged to the Candida clade. Regarding morphological characteristics, isolate KKU-FW10 presents cream-colored butyrous colonies, vegetative reproduction through budding and, round cells without filaments or ascospores. The major ubiquinone detected was Q-9. The above results suggest that isolate KKU-FW10 is a new member of the genus Candida, and the name Candida konsanensis is proposed for this yeast. The type strain of the new species is KKU-FW10(T) (= BCC 52588(T), = NBRC 109082(T), = CBS 12666(T)). In addition, this KKU-FW10 could potentially produce 58.24 Units/ml of carboxymethyl cellulase when it was cultured in YP broth containing 1.0 % carboxymethyl cellulose for 24 h.

Complete nucleotide sequence of pig (Sus scrofa) mitochondrial genome and dating evolutionary divergence within Artiodactyla.

PubMed

Lin, C S; Sun, Y L; Liu, C Y; Yang, P C; Chang, L C; Cheng, I C; Mao, S J; Huang, M C

1999-08-05

The complete nucleotide sequence of the pig (Sus scrofa) mitochondrial genome, containing 16613bp, is presented in this report. The genome is not a specific length because of the presence of the variable numbers of tandem repeats, 5'-CGTGCGTACA in the displacement loop (D-loop). Genes responsible for 12S and 16S rRNAs, 22 tRNAs, and 13 protein-coding regions are found. The genome carries very few intergenic nucleotides with several instances of overlap between protein-coding or tRNA genes, except in the D-loop region. For evaluating the possible evolutionary relationships between Artiodactyla and Cetacea, the nucleotide substitutions and amino acid sequences of 13 protein-coding genes were aligned by pairwise comparisons of the pig, cow, and fin whale. By comparing these sequences, we suggest that there is a closer relationship between the pig and cow than that between either of these species and fin whale. In addition, the accumulation of transversions and gaps in pig 12S and 16S rRNA genes was compared with that in other eutherian species, including cow, fin whale, human, horse, and harbor seal. The results also reveal a close phylogenetic relationship between pig and cow, as compared to fin whale and others. Thus, according to the sequence differences of mitochondrial rRNA genes in eutherian species, the evolutionary separation of pig and cow occurred about 53-60 million years ago.

Characterization of durum wheat high molecular weight glutenin subunits Bx20 and By20 sequences by a molecular and proteomic approach.

PubMed

Santagati, Vito Davide; Sestili, Francesco; Lafiandra, Domenico; D'Ovidio, Renato; Rogniaux, Helene; Masci, Stefania

2016-07-01

Wheat high molecular weight glutenin subunit variation is important because of its great influence on glutenin polymer structure, that is related to dough technological properties. Among the different subunits, the pair Bx20 and By20 is known to have a negative effect on quality, but the reasons are not clear: Bx20 has two cysteines, which theoretically make this subunit a chain extender of the glutenin polymer, just like the other Bx subunits, showing four cysteines, two of which should be involved in intra-molecular disulfide bonds. By20 has never been characterized so far at molecular level. Here we report the nucleotide sequences of Bx20 and By20 genes isolated from the durum wheat cultivar 'Lira 45' and the validation of the corresponding deduced amino acid sequences by using MALDI-TOF and LC-MS/MS. Four nucleotide differences were identified in the Bx20 gene with respect to the deduced sequence present in NCBI, causing two amino acid substitutions. For the By20 subunit, nucleotide and amino acid sequences revealed a great similarity to By15, both at gene and protein levels, showing five nucleotide changes generating two amino acid differences. No evidence of post-translational modifications has been found. Hypotheses are formulated in regard to relationships with technological quality. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Interactive computer programs for the graphic analysis of nucleotide sequence data.

PubMed Central

Luckow, V A; Littlewood, R K; Rownd, R H

1984-01-01

A group of interactive computer programs have been developed which aid in the collection and graphical analysis of nucleotide and protein sequence data. The programs perform the following basic functions: a) enter, edit, list, and rearrange sequence data; b) permit automatic entry of nucleotide sequence data directly from an autoradiograph into the computer; c) search for restriction sites or other specified patterns and plot a linear or circular restriction map, or print their locations; d) plot base composition; e) analyze homology between sequences by plotting a two-dimensional graphic matrix; and f) aid in plotting predicted secondary structures of RNA molecules. PMID:6546437

A new general model for predicting melting thermodynamics of complementary and mismatched B-form duplexes containing locked nucleic acids: application to probe design for digital PCR detection of somatic mutations.

PubMed

Hughesman, Curtis; Fakhfakh, Kareem; Bidshahri, Roza; Lund, H Louise; Haynes, Charles

2015-02-17

Advances in real-time polymerase chain reaction (PCR), as well as the emergence of digital PCR (dPCR) and useful modified nucleotide chemistries, including locked nucleic acids (LNAs), have created the potential to improve and expand clinical applications of PCR through their ability to better quantify and differentiate amplification products, but fully realizing this potential will require robust methods for designing dual-labeled hydrolysis probes and predicting their hybridization thermodynamics as a function of their sequence, chemistry, and template complementarity. We present here a nearest-neighbor thermodynamic model that accurately predicts the melting thermodynamics of a short oligonucleotide duplexed either to its perfect complement or to a template containing mismatched base pairs. The model may be applied to pure-DNA duplexes or to duplexes for which one strand contains any number and pattern of LNA substitutions. Perturbations to duplex stability arising from mismatched DNA:DNA or LNA:DNA base pairs are treated at the Gibbs energy level to maintain statistical significance in the regressed model parameters. This approach, when combined with the model's accounting of the temperature dependencies of the melting enthalpy and entropy, permits accurate prediction of T(m) values for pure-DNA homoduplexes or LNA-substituted heteroduplexes containing one or two independent mismatched base pairs. Terms accounting for changes in solution conditions and terminal addition of fluorescent dyes and quenchers are then introduced so that the model may be used to accurately predict and thereby tailor the T(m) of a pure-DNA or LNA-substituted hydrolysis probe when duplexed either to its perfect-match template or to a template harboring a noncomplementary base. The model, which builds on classic nearest-neighbor thermodynamics, should therefore be of use to clinicians and biologists who require probes that distinguish and quantify two closely related alleles in either a quantitative PCR or dPCR assay. This potential is demonstrated by using the model to design allele-specific probes that completely discriminate and quantify clinically relevant mutant alleles (BRAF V600E and KIT D816V) in a dPCR assay.

Within-Host Variations of Human Papillomavirus Reveal APOBEC Signature Mutagenesis in the Viral Genome.

PubMed

Hirose, Yusuke; Onuki, Mamiko; Tenjimbayashi, Yuri; Mori, Seiichiro; Ishii, Yoshiyuki; Takeuchi, Takamasa; Tasaka, Nobutaka; Satoh, Toyomi; Morisada, Tohru; Iwata, Takashi; Miyamoto, Shingo; Matsumoto, Koji; Sekizawa, Akihiko; Kukimoto, Iwao

2018-06-15

Persistent infection with oncogenic human papillomaviruses (HPVs) causes cervical cancer, accompanied by the accumulation of somatic mutations into the host genome. There are concomitant genetic changes in the HPV genome during viral infection; however, their relevance to cervical carcinogenesis is poorly understood. Here, we explored within-host genetic diversity of HPV by performing deep-sequencing analyses of viral whole-genome sequences in clinical specimens. The whole genomes of HPV types 16, 52, and 58 were amplified by type-specific PCR from total cellular DNA of cervical exfoliated cells collected from patients with cervical intraepithelial neoplasia (CIN) and invasive cervical cancer (ICC) and were deep sequenced. After constructing a reference viral genome sequence for each specimen, nucleotide positions showing changes with >0.5% frequencies compared to the reference sequence were determined for individual samples. In total, 1,052 positions of nucleotide variations were detected in HPV genomes from 151 samples (CIN1, n = 56; CIN2/3, n = 68; ICC, n = 27), with various numbers per sample. Overall, C-to-T and C-to-A substitutions were the dominant changes observed across all histological grades. While C-to-T transitions were predominantly detected in CIN1, their prevalence was decreased in CIN2/3 and fell below that of C-to-A transversions in ICC. Analysis of the trinucleotide context encompassing substituted bases revealed that TpCpN, a preferred target sequence for cellular APOBEC cytosine deaminases, was a primary site for C-to-T substitutions in the HPV genome. These results strongly imply that the APOBEC proteins are drivers of HPV genome mutation, particularly in CIN1 lesions. IMPORTANCE HPVs exhibit surprisingly high levels of genetic diversity, including a large repertoire of minor genomic variants in each viral genotype. Here, by conducting deep-sequencing analyses, we show for the first time a comprehensive snapshot of the within-host genetic diversity of high-risk HPVs during cervical carcinogenesis. Quasispecies harboring minor nucleotide variations in viral whole-genome sequences were extensively observed across different grades of CIN and cervical cancer. Among the within-host variations, C-to-T transitions, a characteristic change mediated by cellular APOBEC cytosine deaminases, were predominantly detected throughout the whole viral genome, most strikingly in low-grade CIN lesions. The results strongly suggest that within-host variations of the HPV genome are primarily generated through the interaction with host cell DNA-editing enzymes and that such within-host variability is an evolutionary source of the genetic diversity of HPVs. Copyright © 2018 American Society for Microbiology.

Genetic Lineage and Reassortment of Influenza C Viruses Circulating between 1947 and 2014

PubMed Central

Sugawara, Kanetsu; Furuse, Yuki; Shimotai, Yoshitaka; Hongo, Seiji; Oshitani, Hitoshi; Mizuta, Katsumi; Nishimura, Hidekazu

2016-01-01

ABSTRACT Since influenza C virus was first isolated in 1947, the virus has been only occasionally isolated by cell culture; there are only four strains for which complete genome sequences are registered. Here, we analyzed a total of 106 complete genomes, ranging from the first isolate from 1947 to recent isolates from 2014, to determine the genetic lineages of influenza C virus, the reassortment events, and the rates of nucleotide substitution. The results showed that there are six lineages, named C/Taylor, C/Mississippi, C/Aichi, C/Yamagata, C/Kanagawa, and C/Sao Paulo. They contain both antigenic and genetic lineages of the hemagglutinin-esterase (HE) gene, and the internal genes PB2, PB1, P3, NP, M, and NS are divided into two major lineages, a C/Mississippi/80-related lineage and a C/Yamagata/81-related lineage. Reassortment events were found over the entire period of 68 years. Several outbreaks of influenza C virus between 1990 and 2014 in Japan consisted of reassortant viruses, suggesting that the genomic constellation is related to influenza C virus epidemics. The nucleotide sequences were highly homologous to each other. The minimum percent identity between viruses ranged from 91.1% for the HE gene to 96.1% for the M gene, and the rate of nucleotide substitution for the HE gene was the highest, at 5.20 × 10−4 substitutions/site/year. These results indicate that reassortment is an important factor that increases the genetic diversity of influenza C virus, resulting in its ability to prevail in humans. IMPORTANCE Influenza C virus is a pathogen that causes acute respiratory illness in children and results in hospitalization of infants. We previously demonstrated (Y. Matsuzaki et al., J Clin Virol 61:87–93, 2014, http://dx.doi.org/10.1016/j.jcv.2014.06.017) that periodic epidemics of this virus occurred in Japan between 1996 and 2014 and that replacement of the dominant antigenic group occurred every several years as a result of selection by herd immunity. However, the antigenicity of the HE glycoprotein is highly stable, and antigenic drift has not occurred for at least 30 years. Here, we analyzed a total of 106 complete genomes spanning 68 years for the first time, and we found that influenza C viruses are circulating worldwide while undergoing reassortment as well as selection by herd immunity, resulting in an increased ability to prevail in humans. The results presented in this study contribute to the understanding of the evolution, including reassortment events, underlying influenza C virus epidemics. PMID:27384661

Triphenylamine-Thienothiophene Organic Charge-Transport Molecular Materials: Effect of Substitution Pattern on their Thermal, Photoelectrochemical, and Photovoltaic Properties.

PubMed

Le, Thi Huong; Dao, Quang-Duy; Nghiêm, Mai-Phuong; Péralta, Sébastien; Guillot, Regis; Pham, Quoc Nghi; Fujii, Akihiko; Ozaki, Masanori; Goubard, Fabrice; Bui, Thanh-Tuân

2018-04-25

Two readily accessible thienothiophene-triphenylamine charge-transport materials have been synthesized by simply varying the substitution pattern of the triphenylamine groups on a central thienothiophene π-linker. The impact of the substitution pattern on the thermal, photoelectrochemical, and photovoltaic properties of these materials was evaluated and, based on theoretical and experimental studies, we found that the isomer in which the triphenylamine groups were located at the 2,5-positions of the thienothiophene core (TT-2,5-TPA) had better π-conjugation than the 3,6-isomer (TT-3,6-TPA). Whilst the thermal, morphological, and hydrophobic properties of the two materials were similar, their optoelectrochemical and photovoltaic properties were noticeably impacted. When applied as hole-transport materials in hybrid perovskite solar cells, the 2,5-isomer exhibited a power-conversion efficiency of 13.6 %, much higher than that of its 3,6-counterpart (0.7 %) under the same standard conditions. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Selectivity in the Addition Reactions of Organometallic Reagents to Aziridine-2-carboxaldehydes: The Effects of Protecting Groups and Substitution Patterns

PubMed Central

Kulshrestha, Aman; Schomaker, Jennifer M.; Holmes, Daniel; Staples, Richard J.; Jackson, James E.; Borhan, Babak

2014-01-01

Good to excellent stereo-selectivity has been found in the addition reactions of Grignard and organo-zinc reagents to N-protected aziridine-2-carboxaldehydes. Specifically, high syn selectivity was obtained with benzyl-protected cis, tert-butyloxycar-bonyl-protected trans, and tosyl-pro-tected 2,3-disubstituted aziridine-2-car-boxaldehydes. Furthermore, rate and selectivity effects of ring substituents, temperature, solvent, and Lewis acid and base modifiers were studied. The diastereomeric preference of addition is dominated by the substrate aziri-dines’ substitution pattern and especially the electronic character and conformational preferences of the nitrogen protecting groups. To help rationalize the observed stereochemical outcomes, conformational and electronic structural analyses of a series of model systems representing the various substitution patterns have been explored by density functional calculations at the B3LYP/6–31G* level of theory with the SM8 solvation model to account for solvent effects. PMID:21928447

Identification and Characterization of Novel Variations in Platelet G-Protein Coupled Receptor (GPCR) Genes in Patients Historically Diagnosed with Type 1 von Willebrand Disease.

PubMed

Stockley, Jacqueline; Nisar, Shaista P; Leo, Vincenzo C; Sabi, Essa; Cunningham, Margaret R; Eikenboom, Jeroen C; Lethagen, Stefan; Schneppenheim, Reinhard; Goodeve, Anne C; Watson, Steve P; Mundell, Stuart J; Daly, Martina E

2015-01-01

The clinical expression of type 1 von Willebrand disease may be modified by co-inheritance of other mild bleeding diatheses. We previously showed that mutations in the platelet P2Y12 ADP receptor gene (P2RY12) could contribute to the bleeding phenotype in patients with type 1 von Willebrand disease. Here we investigated whether variations in platelet G protein-coupled receptor genes other than P2RY12 also contributed to the bleeding phenotype. Platelet G protein-coupled receptor genes P2RY1, F2R, F2RL3, TBXA2R and PTGIR were sequenced in 146 index cases with type 1 von Willebrand disease and the potential effects of identified single nucleotide variations were assessed using in silico methods and heterologous expression analysis. Seven heterozygous single nucleotide variations were identified in 8 index cases. Two single nucleotide variations were detected in F2R; a novel c.-67G>C transversion which reduced F2R transcriptional activity and a rare c.1063C>T transition predicting a p.L355F substitution which did not interfere with PAR1 expression or signalling. Two synonymous single nucleotide variations were identified in F2RL3 (c.402C>G, p.A134 =; c.1029 G>C p.V343 =), both of which introduced less commonly used codons and were predicted to be deleterious, though neither of them affected PAR4 receptor expression. A third single nucleotide variation in F2RL3 (c.65 C>A; p.T22N) was co-inherited with a synonymous single nucleotide variation in TBXA2R (c.6680 C>T, p.S218 =). Expression and signalling of the p.T22N PAR4 variant was similar to wild-type, while the TBXA2R variation introduced a cryptic splice site that was predicted to cause premature termination of protein translation. The enrichment of single nucleotide variations in G protein-coupled receptor genes among type 1 von Willebrand disease patients supports the view of type 1 von Willebrand disease as a polygenic disorder.

Amino Acid Substitution in Trichophyton rubrum Squalene Epoxidase Associated with Resistance to Terbinafine

PubMed Central

Osborne, Colin S.; Leitner, Ingrid; Favre, Bertrand; Ryder, Neil S.

2005-01-01

There has only been one clinically confirmed case of terbinafine resistance in dermatophytes, where six sequential Trichophyton rubrum isolates from the same patient were found to be resistant to terbinafine and cross-resistant to other squalene epoxidase (SE) inhibitors. Microsomal SE activity from these resistant isolates was insensitive to terbinafine, suggesting a target-based mechanism of resistance (B. Favre, M. Ghannoum, and N. S. Ryder, Med. Mycol. 42:525-529, 2004). In this study, we have characterized at the molecular level the cause of the resistant phenotype of these clinical isolates. Cloning and sequencing of the SE gene and cDNA from T. rubrum revealed the presence of an intron in the gene and an open reading frame encoding a protein of 489 residues, with an equivalent similarity (57%) to both yeast and mammalian SEs. The nucleotide sequences of SE from two terbinafine-susceptible strains were identical whereas those of terbinafine-resistant strains, serially isolated from the same patient, each contained the same single missense introducing the amino acid substitution L393F. Introduction of the corresponding substitution in the Candida albicans SE gene (L398F) and expression of this gene in Saccharomyces cerevisiae conferred a resistant phenotype to the transformants when compared to those expressing the wild-type sequence. Terbinafine resistance in these T. rubrum clinical isolates appears to be due to a single amino acid substitution in SE. PMID:15980358

A glycine-to-glutamate substitution abolishes alanine:glyoxylate aminotransferase catalytic activity in a subset of patients with primary hyperoxaluria type 1.

PubMed

Purdue, P E; Lumb, M J; Allsop, J; Minatogawa, Y; Danpure, C J

1992-05-01

We have synthesized and sequenced alanine:glyoxylate aminotransferase (AGT; HGMW-approved symbol for the gene--AGXT) cDNA from the liver of a primary hyperoxaluria type 1 (PH1) patient who had normal levels of hepatic peroxisomal immunoreactive AGT protein, but no AGT catalytic activity. This revealed the presence of a single point mutation (G----A at cDNA nucleotide 367), which is predicted to cause a glycine-to-glutamate substitution at residue 82 of the AGT protein. This mutation is located in exon 2 of the AGT gene and leads to the loss of an AvaI restriction site. Exon 2-specific PCR followed by AvaI digestion showed that this patient was homozygous for this mutation. In addition, three other PH1 patients, one related to and two unrelated to, but with enzymological phenotype similar to that of the first patient, were also shown to be homozygous for the mutation. However, one other phenotypically similar PH1 patient was shown to lack this mutation. The mechanism by which the glycine-to-glutamate substitution at residue 82 causes loss of catalytic activity remains to be resolved. However, the protein sequence in this region is highly conserved between different mammals, and the substitution at residue 82 is predicted to cause significant local structural alterations.

4D-π-1A type β-substituted ZnII-porphyrins: ideal green sensitizers for building-integrated photovoltaics.

PubMed

Covezzi, A; Orbelli Biroli, A; Tessore, F; Forni, A; Marinotto, D; Biagini, P; Di Carlo, G; Pizzotti, M

2016-10-18

Two novel green β-substituted Zn II -porphyrins, G1 and G2, based on a 4D-π-1A type substitution pattern have been synthesized. Their enhanced push-pull character, by reduction of H-L energy gaps, promotes broadening and red-shifting of absorption bands. The effective synthetic pathway and the remarkable spectroscopic properties make G2 ideal for BIPV application.

Effect of acyl donor chain length and substitutions pattern on the enzymatic acylation of flavonoids.

PubMed

Ardhaoui, M; Falcimaigne, A; Ognier, S; Engasser, J M; Moussou, P; Pauly, G; Ghoul, M

2004-06-10

Rutin and esculin were enzymatically acylated with different aliphatic acids as acyl donors (fatty acids, dicarboxylic acids and omega-substituted fatty acids) by an immobilized lipase from Candida antarctica. The effect of the water content and the acyl donors pattern on the flavonoid initial acylation rate and conversion yield were investigated. The obtained results indicated that the water content of the medium has a strong effect on the performance of these reactions. The best conversion yields were reached when the water content was kept lower than 200 ppm. At low water content of the medium, these syntheses are influenced by carbon chain length and substitution pattern of the acyl donors. Higher conversion yields of esculin and rutin (>70%) were obtained with aliphatic acids having high carbon chain length (>12). Moreover, it has been found that the amine and thiol groups on omega-substituted fatty acid chain were unfavourable to these reactions. The 1H NMR and 13C NMR analyses of some synthesized esters (esculin and rutin palmitate) show that only monoesters were produced and that the esterification takes place on the primary OH of glucose moiety of the esculin and on the secondary 4"'-OH of the rhamnose residue of rutin. Copyright 2004 Elsevier B.V.

The emergence and evolution of life in a "fatty acid world" based on quantum mechanics.

PubMed

Tamulis, Arvydas; Grigalavicius, Mantas

2011-02-01

Quantum mechanical based electron correlation interactions among molecules are the source of the weak hydrogen and Van der Waals bonds that are critical to the self-assembly of artificial fatty acid micelles. Life on Earth or elsewhere could have emerged in the form of self-reproducing photoactive fatty acid micelles, which gradually evolved into nucleotide-containing micelles due to the enhanced ability of nucleotide-coupled sensitizer molecules to absorb visible light. Comparison of the calculated absorption spectra of micelles with and without nucleotides confirmed this idea and supports the idea of the emergence and evolution of nucleotides in minimal cells of a so-called Fatty Acid World. Furthermore, the nucleotide-caused wavelength shift and broadening of the absorption pattern potentially gives these molecules an additional valuable role, other than a purely genetic one in the early stages of the development of life. From the information theory point of view, the nucleotide sequences in such micelles carry positional information providing better electron transport along the nucleotide-sensitizer chain and, in addition, providing complimentary copies of that information for the next generation. Nucleotide sequences, which in the first period of evolution of fatty acid molecules were useful just for better absorbance of the light in the longer wavelength region, later in the PNA or RNA World, took on the role of genetic information storage.

Candida funiuensi sp. nov., a cellobiose-fermenting yeast species isolated from rotten wood.

PubMed

Wang, Yun; Ren, Yong-Cheng; Zhang, Zheng-Tian; Wu, Fu-Hua; Ke, Tao; Hui, Feng-Li

2015-06-01

Two strains of an asexual cellobiose-fermenting yeast species were isolated from rotten wood samples collected in Funiu Mountain Nature Reserve in Henan Province, central China. Molecular phylogenetic analysis that included the nearly complete small subunit (SSU), the internal transcribed spacer (ITS) region and the D1/D2 domains of the large subunit (LSU) rDNA showed that these strains belonged to the Candida kruisii clade, with Candida kruisii and Candida cretensis as their closest phylogenetic neighbours. The nucleotide differences between the novel strains and the type strains of C. kruisii and C. cretensis were 30 and 36 substitutions, respectively, in the D1/D2 LSU rDNA, 40 and 44 substitutions, respectively, in the ITS region and 19 and 23 substitutions, respectively, in the SSU rDNA. The novel strains can also be distinguished from their closest described species, C. kruisii and C. cretensis, by a number of physiological characteristics, and represent a novel species of the genus Candida, for which the name Candida funiuensis sp. nov. is proposed. The type strain is NYNU 14625T ( = CICC 33050T = CBS 13911T). The Mycobank number is MB 811503.

A single base substitution in the coding region for neurophysin II associated with familial central diabetes insipidus.

PubMed Central

Ito, M; Mori, Y; Oiso, Y; Saito, H

1991-01-01

To elucidate the molecular mechanism of familial central diabetes insipidus (FDI), we sequenced the arginine vasopressin-neurophysin II (AVP-NPII) gene in 2 patients belonging to a pedigree that is consistent with an autosomal dominant mode of inheritance. 10 patients with idiopathic central diabetes insipidus (IDI) and 5 normals were also studied. The AVP-NPII gene, locating on chromosome 20, consists of three exons that encode putative signal peptide, AVP, NPII, and glycoprotein. Using polymerase chain reaction, fragments including the promoter region and all coding regions were amplified from genomic DNA and subjected to direct sequencing. Sequences of 10 patients with IDI were identical with those of normals, while in 2 patients with FDI, a single base substitution was detected in one of two alleles of the AVP-NPII gene, indicating they were heterozygotes for this mutation. It was a G----A transition at nucleotide position 1859 in the second exon, resulting in a substitution of Gly for Ser at amino acid position 57 in the NPII moiety. It was speculated that the mutated AVP-NPII precursor or the mutated NPII molecule, through their conformational changes, might be responsible for AVP deficiency. Images PMID:1840604

Evolution of toll-like receptors in the context of terrestrial ungulates and cetaceans diversification.

PubMed

Ishengoma, Edson; Agaba, Morris

2017-02-16

Toll-like receptors (TLRs) are the frontline actors in the innate immune response to various pathogens and are expected to be targets of natural selection in species adapted to habitats with contrasting pathogen burdens. The recent publication of genome sequences of giraffe and okapi together afforded the opportunity to examine the evolution of selected TLRs in broad range of terrestrial ungulates and cetaceans during their complex habitat diversification. Through direct sequence comparisons and standard evolutionary approaches, the extent of nucleotide and protein sequence diversity in seven Toll-like receptors (TLR2, TLR3, TLR4, TLR5, TLR7, TLR9 and TLR10) between giraffe and closely related species was determined. In addition, comparison of the patterning of key TLR motifs and domains between giraffe and related species was performed. The quantification of selection pressure and divergence on TLRs among terrestrial ungulates and cetaceans was also performed. Sequence analysis shows that giraffe has 94-99% nucleotide identity with okapi and cattle for all TLRs analyzed. Variations in the number of Leucine-rich repeats were observed in some of TLRs between giraffe, okapi and cattle. Patterning of key TLR domains did not reveal any significant differences in the domain architecture among giraffe, okapi and cattle. Molecular evolutionary analysis for selection pressure identifies positive selection on key sites for all TLRs examined suggesting that pervasive evolutionary pressure has taken place during the evolution of terrestrial ungulates and cetaceans. Analysis of positively selected sites showed some site to be part of Leucine-rich motifs suggesting functional relevance in species-specific recognition of pathogen associated molecular patterns. Notably, clade analysis reveals significant selection divergence between terrestrial ungulates and cetaceans in viral sensing TLR3. Mapping of giraffe TLR3 key substitutions to the structure of the receptor indicates that at least one of giraffe altered sites coincides with TLR3 residue known to play a critical role in receptor signaling activity. There is overall structural conservation in TLRs among giraffe, okapi and cattle indicating that the mechanism for innate immune response utilizing TLR pathways may not have changed very much during the evolution of these species. However, a broader phylogenetic analysis revealed signatures of adaptive evolution among terrestrial ungulates and cetaceans, including the observed selection divergence in TLR3. This suggests that long term ecological dynamics has led to species-specific innovation and functional variation in the mechanisms mediating innate immunity in terrestrial ungulates and cetaceans.

Canine distemper virus neutralization activity is low in human serum and it is sensitive to an amino acid substitution in the hemagglutinin protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Xinsheng, E-mail: xzhang@iavi.org; Molecular and Cellular Biology Program, State University of New York, Brooklyn, NY; Wallace, Olivia L.

Serum was analyzed from 146 healthy adult volunteers in eastern Africa to evaluate measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb) prevalence and potency. MV plaque reduction neutralization test (PRNT) results indicated that all sera were positive for MV nAbs. Furthermore, the 50% neutralizing dose (ND50) for the majority of sera corresponded to antibody titers induced by MV vaccination. CDV nAbs titers were low and generally were detected in sera with high MV nAb titers. A mutant CDV was generated that was less sensitive to neutralization by human serum. The mutant virus genome had 10 nucleotide substitutions,more » which coded for single amino acid substitutions in the fusion (F) and hemagglutinin (H) glycoproteins and two substitutions in the large polymerase (L) protein. The H substitution occurred in a conserved region involved in receptor interactions among morbilliviruses, implying that this region is a target for cross-reactive neutralizing antibodies. - Highlights: • Screened 146 serum samples for measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb). • MV nAb is prevalent in the sera. • CDV neutralizing activity is generally low or absent and when detected it is present in sera with high MV nAb titers. • A neutralization-resistant CDV mutant was isolated using human serum selection. • A mutation was identified in the receptor-binding region of CDV hemagglutinin protein that confers the neutralization resistance.« less

TARGET Researchers Identify Mutations in SIX1/2 and microRNA Processing Genes in Favorable Histology Wilms Tumor | Office of Cancer Genomics

Cancer.gov

TARGET researchers molecularly characterized favorable histology Wilms tumor (FHWT), a pediatric renal cancer. Comprehensive genome and transcript analyses revealed single-nucleotide substitution/deletion mutations in microRNA processing genes (15% of FHWT patients) and Sine Oculis Homeobox Homolog 1/2 (SIX1/2) genes (7% of FHWT patients). SIX1/2 genes play a critical role in renal development and were not previously associated with FHWT, thus presenting a novel role for SIX1/2 pathway aberrations in this disease.

Determination of the amino acid change responsible for the nontoxic, cross-reactive exotoxin A protein (CRM 66) of Pseudomonas aeruginosa PAO-PR1.

PubMed Central

Wick, M J; Iglewski, B H

1988-01-01

Analysis of purified exotoxin A from parental Pseudomonas aeruginosa PAO1 and mutant strain PAO-PR1, which produces enzymatically inactive exotoxin A (CRM 66), revealed that CRM 66 lost 90% of parental enzymatic activity. Nucleotide sequence analysis of cloned exotoxin A genes showed a single amino acid substitution in CRM 66. Position 426 in the mature protein of parental (PAO1) exotoxin A is histidine, whereas in CRM 66, it is tyrosine. Images PMID:3141388

Gene-Specific Substitution Profiles Describe the Types and Frequencies of Amino Acid Changes during Antibody Somatic Hypermutation.

PubMed

Sheng, Zizhang; Schramm, Chaim A; Kong, Rui; Mullikin, James C; Mascola, John R; Kwong, Peter D; Shapiro, Lawrence

2017-01-01

Somatic hypermutation (SHM) plays a critical role in the maturation of antibodies, optimizing recognition initiated by recombination of V(D)J genes. Previous studies have shown that the propensity to mutate is modulated by the context of surrounding nucleotides and that SHM machinery generates biased substitutions. To investigate the intrinsic mutation frequency and substitution bias of SHMs at the amino acid level, we analyzed functional human antibody repertoires and developed mGSSP (method for gene-specific substitution profile), a method to construct amino acid substitution profiles from next-generation sequencing-determined B cell transcripts. We demonstrated that these gene-specific substitution profiles (GSSPs) are unique to each V gene and highly consistent between donors. We also showed that the GSSPs constructed from functional antibody repertoires are highly similar to those constructed from antibody sequences amplified from non-productively rearranged passenger alleles, which do not undergo functional selection. This suggests the types and frequencies, or mutational space, of a majority of amino acid changes sampled by the SHM machinery to be well captured by GSSPs. We further observed the rates of mutational exchange between some amino acids to be both asymmetric and context dependent and to correlate weakly with their biochemical properties. GSSPs provide an improved, position-dependent alternative to standard substitution matrices, and can be utilized to developing software for accurately modeling the SHM process. GSSPs can also be used for predicting the amino acid mutational space available for antigen-driven selection and for understanding factors modulating the maturation pathways of antibody lineages in a gene-specific context. The mGSSP method can be used to build, compare, and plot GSSPs; we report the GSSPs constructed for 69 common human V genes (DOI: 10.6084/m9.figshare.3511083) and provide high-resolution logo plots for each (DOI: 10.6084/m9.figshare.3511085).

Impact of IL-10 (−1082) Promoter–Single Nucleotide Polymorphism on the Outcome of Hepatitis C Virus Genotype 4 Infection

PubMed Central

Helal, Soheir F.; Gomaa, Howayda E.; Thabet, Eman H.; Younan, Mariam A.; Helmy, Neveen A.

2014-01-01

Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (−1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (−1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (−1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). CONCLUSION No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects. PMID:24833945

Impact of IL-10 (-1082) promoter-single nucleotide polymorphism on the outcome of hepatitis C virus genotype 4 infection.

PubMed

Helal, Soheir F; Gomaa, Howayda E; Thabet, Eman H; Younan, Mariam A; Helmy, Neveen A

2014-01-01

Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (-1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (-1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (-1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects.

The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

PubMed

Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

2008-04-01

The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

PubMed Central

Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

2008-01-01

The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

Identification of two allelic IgG1 C(H) coding regions (Cgamma1) of cat.

PubMed

Kanai, T H; Ueda, S; Nakamura, T

2000-01-31

Two types of cDNA encoding IgG1 heavy chain (gamma1) were isolated from a single domestic short-hair cat. Sequence analysis indicated a higher level of similarity of these Cgamma1 sequences to human Cgamma1 sequence (76.9 and 77.0%) than to mouse sequence (70.0 and 69.7%) at the nucleotide level. Predicted primary structures of both the feline Cgamma1 genes, designated as Cgamma1a and Cgamma1b, were similar to that of human Cgamma1 gene, for instance, as to the size of constant domains, the presence of six conserved cysteine residues involved in formation of the domain structure, and the location of a conserved N-linked glycosylation site. Sequence comparison between the two alleles showed that 7 out of 10 nucleotide differences were within the C(H)3 domain coding region, all leading to nonsynonymous changes in amino acid residues. Partial sequence analysis of genomic clones showed three nucleotide substitutions between the two Cgamma1 alleles in the intron between the CH2 and C(H)3 domain coding regions. In 12 domestic short-hair cats used in this study, the frequency of Cgamma1a allele (62.5%) was higher than that of the Cgamma1b allele (37.5%).

Altering the spectrum of immunoglobulin V gene somatic hypermutation by modifying the active site of AID.

PubMed

Wang, Meng; Rada, Cristina; Neuberger, Michael S

2010-01-18

High-affinity antibodies are generated by somatic hypermutation with nucleotide substitutions introduced into the IgV in a semirandom fashion, but with intrinsic mutational hotspots strategically located to optimize antibody affinity maturation. The process is dependent on activation-induced deaminase (AID), an enzyme that can deaminate deoxycytidine in DNA in vitro, where its activity is sensitive to the identity of the 5'-flanking nucleotide. As a critical test of whether such DNA deamination activity underpins antibody diversification and to gain insight into the extent to which the antibody mutation spectrum is dependent on the intrinsic substrate specificity of AID, we investigated whether it is possible to change the IgV mutation spectrum by altering AID's active site such that it prefers a pyrimidine (rather than a purine) flanking the targeted deoxycytidine. Consistent with the DNA deamination mechanism, B cells expressing the modified AID proteins yield altered IgV mutation spectra (exhibiting a purine-->pyrimidine shift in flanking nucleotide preference) and altered hotspots. However, AID-catalyzed deamination of IgV targets in vitro does not yield the same degree of hotspot dominance to that observed in vivo, indicating the importance of features beyond AID's active site and DNA local sequence environment in determining in vivo hotspot dominance.

A Tradeoff Drives the Evolution of Reduced Metal Resistance in Natural Populations of Yeast

PubMed Central

Chang, Shang-Lin; Leu, Jun-Yi

2011-01-01

Various types of genetic modification and selective forces have been implicated in the process of adaptation to novel or adverse environments. However, the underlying molecular mechanisms are not well understood in most natural populations. Here we report that a set of yeast strains collected from Evolution Canyon (EC), Israel, exhibit an extremely high tolerance to the heavy metal cadmium. We found that cadmium resistance is primarily caused by an enhanced function of a metal efflux pump, PCA1. Molecular analyses demonstrate that this enhancement can be largely attributed to mutations in the promoter sequence, while mutations in the coding region have a minor effect. Reconstruction experiments show that three single nucleotide substitutions in the PCA1 promoter quantitatively increase its activity and thus enhance the cells' cadmium resistance. Comparison among different yeast species shows that the critical nucleotides found in EC strains are conserved and functionally important for cadmium resistance in other species, suggesting that they represent an ancestral type. However, these nucleotides had diverged in most Saccharomyces cerevisiae populations, which gave cells growth advantages under conditions where cadmium is low or absent. Our results provide a rare example of a selective sweep in yeast populations driven by a tradeoff in metal resistance. PMID:21483812

Analysis of alkaptonuria (AKU) mutations and polymorphisms reveals that the CCC sequence motif is a mutational hot spot in the homogentisate 1,2 dioxygenase gene (HGO).

PubMed Central

Beltrán-Valero de Bernabé, D; Jimenez, F J; Aquaron, R; Rodríguez de Córdoba, S

1999-01-01

We recently showed that alkaptonuria (AKU) is caused by loss-of-function mutations in the homogentisate 1,2 dioxygenase gene (HGO). Herein we describe haplotype and mutational analyses of HGO in seven new AKU pedigrees. These analyses identified two novel single-nucleotide polymorphisms (INV4+31A-->G and INV11+18A-->G) and six novel AKU mutations (INV1-1G-->A, W60G, Y62C, A122D, P230T, and D291E), which further illustrates the remarkable allelic heterogeneity found in AKU. Reexamination of all 29 mutations and polymorphisms thus far described in HGO shows that these nucleotide changes are not randomly distributed; the CCC sequence motif and its inverted complement, GGG, are preferentially mutated. These analyses also demonstrated that the nucleotide substitutions in HGO do not involve CpG dinucleotides, which illustrates important differences between HGO and other genes for the occurrence of mutation at specific short-sequence motifs. Because the CCC sequence motifs comprise a significant proportion (34.5%) of all mutated bases that have been observed in HGO, we conclude that the CCC triplet is a mutational hot spot in HGO. PMID:10205262

Fullerene Cyanation Does Not Always Increase Electron Affinity: Experimental and Theoretical Study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Clikeman, Tyler T.; Deng, Shihu; Popov, Alexey A.

2015-01-01

The electron affinities of C70 derivatives with trifluoromethyl, methyl and cyano groups were studied experimentally and theoretically using low-temperature photoelectron spectroscopy (LT PES) and density functional theory (DFT). The electronic effects of these functional groups were determined and found to be highly dependent on the addition patterns. Substitution of CF3 for CN for the same addition pattern increases the experimental electron affinity by 70 meV per substitution. The synthesis of a new fullerene derivative, C70(CF3)10(CN)2, is reported for the first time

The complete mitochondrial genome of the citrus red mite Panonychus citri (Acari: Tetranychidae): high genome rearrangement and extremely truncated tRNAs

PubMed Central

2010-01-01

Background The family Tetranychidae (Chelicerata: Acari) includes ~1200 species, many of which are of agronomic importance. To date, mitochondrial genomes of only two Tetranychidae species have been sequenced, and it has been found that these two mitochondrial genomes are characterized by many unusual features in genome organization and structure such as gene order and nucleotide frequency. The scarcity of available sequence data has greatly impeded evolutionary studies in Acari (mites and ticks). Information on Tetranychidae mitochondrial genomes is quite important for phylogenetic evaluation and population genetics, as well as the molecular evolution of functional genes such as acaricide-resistance genes. In this study, we sequenced the complete mitochondrial genome of Panonychus citri (Family Tetranychidae), a worldwide citrus pest, and provide a comparison to other Acari. Results The mitochondrial genome of P. citri is a typical circular molecule of 13,077 bp, and contains the complete set of 37 genes that are usually found in metazoans. This is the smallest mitochondrial genome within all sequenced Acari and other Chelicerata, primarily due to the significant size reduction of protein coding genes (PCGs), a large rRNA gene, and the A + T-rich region. The mitochondrial gene order for P. citri is the same as those for P. ulmi and Tetranychus urticae, but distinctly different from other Acari by a series of gene translocations and/or inversions. The majority of the P. citri mitochondrial genome has a high A + T content (85.28%), which is also reflected by AT-rich codons being used more frequently, but exhibits a positive GC-skew (0.03). The Acari mitochondrial nad1 exhibits a faster amino acid substitution rate than other genes, and the variation of nucleotide substitution patterns of PCGs is significantly correlated with the G + C content. Most tRNA genes of P. citri are extremely truncated and atypical (44-65, 54.1 ± 4.1 bp), lacking either the T- or D-arm, as found in P. ulmi, T. urticae, and other Acariform mites. Conclusions The P. citri mitochondrial gene order is markedly different from those of other chelicerates, but is conserved within the family Tetranychidae indicating that high rearrangements have occurred after Tetranychidae diverged from other Acari. Comparative analyses suggest that the genome size, gene order, gene content, codon usage, and base composition are strongly variable among Acari mitochondrial genomes. While extremely small and unusual tRNA genes seem to be common for Acariform mites, further experimental evidence is needed. PMID:20969792

Large-Scale Genomic Analysis of Codon Usage in Dengue Virus and Evaluation of Its Phylogenetic Dependence

PubMed Central

Lara-Ramírez, Edgar E.; Salazar, Ma Isabel; López-López, María de Jesús; Salas-Benito, Juan Santiago; Sánchez-Varela, Alejandro

2014-01-01

The increasing number of dengue virus (DENV) genome sequences available allows identifying the contributing factors to DENV evolution. In the present study, the codon usage in serotypes 1–4 (DENV1–4) has been explored for 3047 sequenced genomes using different statistics methods. The correlation analysis of total GC content (GC) with GC content at the three nucleotide positions of codons (GC1, GC2, and GC3) as well as the effective number of codons (ENC, ENCp) versus GC3 plots revealed mutational bias and purifying selection pressures as the major forces influencing the codon usage, but with distinct pressure on specific nucleotide position in the codon. The correspondence analysis (CA) and clustering analysis on relative synonymous codon usage (RSCU) within each serotype showed similar clustering patterns to the phylogenetic analysis of nucleotide sequences for DENV1–4. These clustering patterns are strongly related to the virus geographic origin. The phylogenetic dependence analysis also suggests that stabilizing selection acts on the codon usage bias. Our analysis of a large scale reveals new feature on DENV genomic evolution. PMID:25136631

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rechkoblit, Olga; Delaney, James C.; Essigmann, John M.

DNA is susceptible to alkylation damage by a number of environmental agents that modify the Watson-Crick edge of the bases. Such lesions, if not repaired, may be bypassed by Y-family DNA polymerases. The bypass polymerase Dpo4 is strongly inhibited by 1-methylguanine (m1G) and 3-methylcytosine (m3C), with nucleotide incorporation opposite these lesions being predominantly mutagenic. Further, extension after insertion of both correct and incorrect bases, introduces additional base substitution and deletion errors. Crystal structures of the Dpo4 ternary extension complexes with correct and mismatched 3'-terminal primer bases opposite the lesions reveal that both m1G and m3C remain positioned within the DNAmore » template/primer helix. However, both correct and incorrect pairing partners exhibit pronounced primer terminal nucleotide distortion, being primarily evicted from the DNA helix when opposite m1G or misaligned when pairing with m3C. Our studies provide insights into mechanisms related to hindered and mutagenic bypass of methylated lesions and models associated with damage recognition by repair demethylases.« less

Phosphorylation of XPB helicase regulates TFIIH nucleotide excision repair activity

PubMed Central

Coin, Frédéric; Auriol, Jérome; Tapias, Angel; Clivio, Pascale; Vermeulen, Wim; Egly, Jean-Marc

2004-01-01

Nucleotide excision repair (NER) removes damage from DNA in a tightly regulated multiprotein process. The xeroderma pigmentosum group B (XPB) helicase subunit of TFIIH functions in NER and transcription. The serine 751 (S751) residue of XPB was found to be phosphorylated in vivo. This phosphorylation inhibits NER and the microinjection of a phosphomimicking XPB-S751E mutant is unable to correct the NER defect of XP-B cells. Conversely, XPB-S751 dephosphorylation or its substitution with alanine (S751A) restores NER both in vivo and in vitro. Surprisingly, phospho/dephosphorylation of S751 spares TFIIH-dependent transcription. Finally, the phosphorylation of XPB-S751 does not impair the TFIIH unwinding of the DNA around the lesion, but rather prevents the 5′ incision triggered by the ERCC1-XPF endonuclease. These data support an additional role for XPB in promoting the incision of the damaged fragment and reveal a point of NER regulation on TFIIH without interference in its transcription activity. PMID:15549133

Four novel cystic fibrosis mutations in splice junction sequences affecting the CFTR nucleotide binding folds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Doerk, T.; Wulbrand, U.; Tuemmler, B.

1993-03-01

Single cases of the four novel splice site mutations 1525[minus]1 G [r arrow] A (intron 9), 3601[minus]2 A [r arrow] G (intron 18), 3850[minus]3 T [r arrow] G (intron 19), and 4374+1 G [r arrow] T (intron 23) were detected in the CFTR gene of cystic fibrosis patients of Indo-Iranian, Turkish, Polish, and Germany descent. The nucleotide substitutions at the +1, [minus]1, and [minus]2 positions all destroy splice sites and lead to severe disease alleles associated with features typical of gastrointestinal and pulmonary cystic fibrosis disease. The 3850[minus]3 T-to-G change was discovered in a very mildly affected 33-year-old [Delta]F508 compoundmore » heterozygote, suggesting that the T-to-G transversion at the less conserved [minus]3 position of the acceptor splice site may retain some wildtype function. 13 refs., 1 fig., 2 tabs.« less

Mechanistic determinants of the directionality and energetics of active export by a heterodimeric ABC transporter

DOE PAGES

Grossmann, Nina; Vakkasoglu, Ahmet S.; Hulpke, Sabine; ...

2014-11-07

The ATP-binding cassette (ABC) transporter associated with antigen processing (TAP) participates in immune surveillance by moving proteasomal products into the endoplasmic reticulum (ER) lumen for major histocompatibility complex class I loading and cell surface presentation to cytotoxic T cells. Here we delineate the mechanistic basis for antigen translocation. Notably, TAP works as a molecular diode, translocating peptide substrates against the gradient in a strict unidirectional way. We reveal the importance of the D-loop at the dimer interface of the two nucleotide-binding domains (NBDs) in coupling substrate translocation with ATP hydrolysis and defining transport vectoriality. Substitution of the converved aspartate, whichmore » coordinates the ATP-binding site, decreases NBD dimerization affinity and turns the unidirectional primary active pump into a passive bidirectional nucleotide-gated facilitator. Thus, ATP hydrolysis is not required for translocation per se, but is essential for both active and unidirectional transport. As a result, our data provide detailed mechanistic insight into how heterodimeric ABC exporters operate.« less

Heterogeneity of D2 dopamine receptors in different brain regions.

PubMed Central

Leonard, M N; Macey, C A; Strange, P G

1987-01-01

The binding of [3H]spiperone has been examined in membranes derived from different regions of bovine brain. In caudate nucleus, nucleus accumbens, olfactory tubercle and putamen binding is to D2 dopamine and 5HT2 serotonin receptors, whereas in cingulate cortex only serotonin 5HT2 receptor binding can be detected. D2 dopamine receptors were examined in detail in caudate nucleus, olfactory tubercle and putamen using [3H]spiperone binding in the presence of 0.3 microM-mianserin (to block 5HT2 serotonin receptors). No evidence for heterogeneity among D2 dopamine receptors either between brain regions or within a brain region was found from the displacements of [3H]spiperone binding by a range of antagonists, including dibenzazepines and substituted benzamides. Regulation of agonist binding by guanine nucleotides did, however, differ between regions. In caudate nucleus a population of agonist binding sites appeared resistant to guanine nucleotide regulation, whereas this was not the case in olfactory tubercle and putamen. PMID:2963621

Cross-host evolution of severe acute respiratory syndrome coronavirus in palm civet and human

PubMed Central

Song, Huai-Dong; Tu, Chang-Chun; Zhang, Guo-Wei; Wang, Sheng-Yue; Zheng, Kui; Lei, Lian-Cheng; Chen, Qiu-Xia; Gao, Yu-Wei; Zhou, Hui-Qiong; Xiang, Hua; Zheng, Hua-Jun; Chern, Shur-Wern Wang; Cheng, Feng; Pan, Chun-Ming; Xuan, Hua; Chen, Sai-Juan; Luo, Hui-Ming; Zhou, Duan-Hua; Liu, Yu-Fei; He, Jian-Feng; Qin, Peng-Zhe; Li, Ling-Hui; Ren, Yu-Qi; Liang, Wen-Jia; Yu, Ye-Dong; Anderson, Larry; Wang, Ming; Xu, Rui-Heng; Wu, Xin-Wei; Zheng, Huan-Ying; Chen, Jin-Ding; Liang, Guodong; Gao, Yang; Liao, Ming; Fang, Ling; Jiang, Li-Yun; Li, Hui; Chen, Fang; Di, Biao; He, Li-Juan; Lin, Jin-Yan; Tong, Suxiang; Kong, Xiangang; Du, Lin; Hao, Pei; Tang, Hua; Bernini, Andrea; Yu, Xiao-Jing; Spiga, Ottavia; Guo, Zong-Ming; Pan, Hai-Yan; He, Wei-Zhong; Manuguerra, Jean-Claude; Fontanet, Arnaud; Danchin, Antoine; Niccolai, Neri; Li, Yi-Xue; Wu, Chung-I; Zhao, Guo-Ping

2005-01-01

The genomic sequences of severe acute respiratory syndrome coronaviruses from human and palm civet of the 2003/2004 outbreak in the city of Guangzhou, China, were nearly identical. Phylogenetic analysis suggested an independent viral invasion from animal to human in this new episode. Combining all existing data but excluding singletons, we identified 202 single-nucleotide variations. Among them, 17 are polymorphic in palm civets only. The ratio of nonsynonymous/synonymous nucleotide substitution in palm civets collected 1 yr apart from different geographic locations is very high, suggesting a rapid evolving process of viral proteins in civet as well, much like their adaptation in the human host in the early 2002–2003 epidemic. Major genetic variations in some critical genes, particularly the Spike gene, seemed essential for the transition from animal-to-human transmission to human-to-human transmission, which eventually caused the first severe acute respiratory syndrome outbreak of 2002/2003. PMID:15695582

Molecular epidemiology of Epizootic haematopoietic necrosis virus (EHNV).

PubMed

Hick, Paul M; Subramaniam, Kuttichantran; Thompson, Patrick M; Waltzek, Thomas B; Becker, Joy A; Whittington, Richard J

2017-11-01

Low genetic diversity of Epizootic haematopoietic necrosis virus (EHNV) was determined for the complete genome of 16 isolates spanning the natural range of hosts, geography and time since the first outbreaks of disease. Genomes ranged from 125,591-127,487 nucleotides with 97.47% pairwise identity and 106-109 genes. All isolates shared 101 core genes with 121 potential genes predicted within the pan-genome of this collection. There was high conservation within 90,181 nucleotides of the core genes with isolates separated by average genetic distance of 3.43 × 10 -4 substitutions per site. Evolutionary analysis of the core genome strongly supported historical epidemiological evidence of iatrogenic spread of EHNV to naïve hosts and establishment of endemic status in discrete ecological niches. There was no evidence of structural genome reorganization, however, the complement of non-core genes and variation in repeat elements enabled fine scale molecular epidemiological investigation of this unpredictable pathogen of fish. Copyright © 2017 Elsevier Inc. All rights reserved.

Fatty acid carbon is essential for dNTP synthesis in endothelial cells

PubMed Central

Missiaen, Rindert; Queiroz, Karla CS; Borgers, Gitte; Elia, Ilaria; Zecchin, Annalisa; Cantelmo, Anna Rita; Christen, Stefan; Goveia, Jermaine; Heggermont, Ward; Goddé, Lucica; Vinckier, Stefan; Van Veldhoven, Paul P.; Eelen, Guy; Schoonjans, Luc; Gerhardt, Holger; Dewerchin, Mieke; Baes, Myriam; De Bock, Katrien; Ghesquière, Bart; Lunt, Sophia Y.; Fendt, Sarah-Maria; Carmeliet, Peter

2015-01-01

The metabolism of endothelial cells (ECs) during vessel sprouting remains poorly studied. Here, we report that endothelial loss of CPT1a, a rate-limiting enzyme of fatty acid oxidation (FAO), caused vascular sprouting defects due to impaired proliferation, not migration of ECs. Reduction of FAO in ECs did not cause energy depletion or disturb redox homeostasis, but impaired de novo nucleotide synthesis for DNA replication. Isotope labeling studies in control ECs showed that fatty acid carbons substantially replenished the Krebs cycle, and were incorporated into aspartate (a nucleotide precursor), uridine monophosphate (a precursor of pyrimidine nucleoside triphosphates) and DNA. CPT1a silencing reduced these processes and depleted EC stores of aspartate and deoxyribonucleoside triphosphates. Acetate (metabolized to acetyl-CoA, thereby substituting for the depleted FAO-derived acetyl-CoA) or a nucleoside mix rescued the phenotype of CPT1a-silenced ECs. Finally, CPT1 blockade inhibited pathological ocular angiogenesis, suggesting a novel strategy for blocking angiogenesis. PMID:25830893

MIPs and Aptamers for Recognition of Proteins in Biomimetic Sensing.

PubMed

Menger, Marcus; Yarman, Aysu; Erdőssy, Júlia; Yildiz, Huseyin Bekir; Gyurcsányi, Róbert E; Scheller, Frieder W

2016-07-18

Biomimetic binders and catalysts have been generated in order to substitute the biological pendants in separation techniques and bioanalysis. The two major approaches use either "evolution in the test tube" of nucleotides for the preparation of aptamers or total chemical synthesis for molecularly imprinted polymers (MIPs). The reproducible production of aptamers is a clear advantage, whilst the preparation of MIPs typically leads to a population of polymers with different binding sites. The realization of binding sites in the total bulk of the MIPs results in a higher binding capacity, however, on the expense of the accessibility and exchange rate. Furthermore, the readout of the bound analyte is easier for aptamers since the integration of signal generating labels is well established. On the other hand, the overall negative charge of the nucleotides makes aptamers prone to non-specific adsorption of positively charged constituents of the sample and the "biological" degradation of non-modified aptamers and ionic strength-dependent changes of conformation may be challenging in some application.

Multilocus amplicon sequencing of Pseudomonas aeruginosa cystic fibrosis airways isolates collected prior to and after early antipseudomonal chemotherapy.

PubMed

Fischer, Sebastian; Greipel, Leonie; Klockgether, Jens; Dorda, Marie; Wiehlmann, Lutz; Cramer, Nina; Tümmler, Burkhard

2017-05-01

Early antimicrobial chemotherapy can prevent or at least delay chronic cystic fibrosis (CF) airways infections with Pseudomonas aeruginosa. During a 10-year study period P. aeruginosa was detected for the first time in 54 CF patients regularly seen at the CF centre Hannover. Amplicon sequencing of 34 loci of the P. aeruginosa core genome was performed in baseline and post-treatment isolates of the 15 CF patients who had remained P. aeruginosa - positive after the first round of antipseudomonal chemotherapy. Deep sequencing uncovered coexisting alternative nucleotides at in total 33 of 55,284 examined genome positions including six non-synonymous polymorphisms in the lasR gene, a key regulator of quorum sensing. After early treatment 42 of 50 novel nucleotide substitutions had emerged in exopolysaccharide biosynthesis, efflux pump and porin genes. Early treatment selects pathoadaptive mutations in P. aeruginosa that are typical for chronic infections of CF lungs. Copyright © 2016 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

Discovery of a novel HLA-B*51 variant, B*51:112, in a Taiwanese bone marrow donor and identification of the plausible HLA haplotype in association with B*51:112.

PubMed

Yang, K L; Lee, S K; Lin, P Y

2012-10-01

The sequence of B*51:112 is identical to the sequence of B*51:01:01 in exons 2, 3 and 4, except the nucleotides at positions 206 (C→A) and 213 (C→G). The nucleotide replacement caused one amino acid substitution at residue 45 (T→K). The plausible HLA-A, -B and -DRB1 haplotype in association with B*51:112 may be deduced as HLA-A*02-B*51:112-DRB1*12. The generation of B*51:112 was probably as the result of a DNA recombination event where B*40:01:01 acted as a sequence donor donating a segment of the DNA sequence to the recipient sequence B*51:01:01. The donor carrying B*51:112 was a Minna Taiwanese whose ancestor came to Taiwan from the southern region of China. © 2012 Blackwell Publishing Ltd.

Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany.

PubMed

Hernández-Frederick, C J; Cereb, N; Giani, A S; Ruppel, J; Maraszek, A; Pingel, J; Sauter, J; Schmidt, A H; Yang, S Y

2016-01-01

We characterized 549 new human leukocyte antigen (HLA) class I and class II alleles found in newly registered stem cell donors as a result of high-throughput HLA typing. New alleles include 101 HLA-A, 132 HLA-B, 105 HLA-C, 2 HLA-DRB1, 89 HLA-DQB1 and 120 HLA-DPB1 alleles. Mainly, new alleles comprised single nucleotide variations when compared with homologous sequences. We identified nonsynonymous nucleotide mutations in 70.7% of all new alleles, synonymous variations in 26.4% and nonsense substitutions in 2.9% (null alleles). Some new alleles (55, 10.0%) were found multiple times, HLA-DPB1 alleles being the most frequent among these. Furthermore, as several new alleles were identified in individuals from ethnic minority groups, the relevance of recruiting donors belonging to such groups and the importance of ethnicity data collection in donor centers and registries is highlighted. © 2015 The Authors. HLA published by John Wiley & Sons Ltd.

CodonLogo: a sequence logo-based viewer for codon patterns.

PubMed

Sharma, Virag; Murphy, David P; Provan, Gregory; Baranov, Pavel V

2012-07-15

Conserved patterns across a multiple sequence alignment can be visualized by generating sequence logos. Sequence logos show each column in the alignment as stacks of symbol(s) where the height of a stack is proportional to its informational content, whereas the height of each symbol within the stack is proportional to its frequency in the column. Sequence logos use symbols of either nucleotide or amino acid alphabets. However, certain regulatory signals in messenger RNA (mRNA) act as combinations of codons. Yet no tool is available for visualization of conserved codon patterns. We present the first application which allows visualization of conserved regions in a multiple sequence alignment in the context of codons. CodonLogo is based on WebLogo3 and uses the same heuristics but treats codons as inseparable units of a 64-letter alphabet. CodonLogo can discriminate patterns of codon conservation from patterns of nucleotide conservation that appear indistinguishable in standard sequence logos. The CodonLogo source code and its implementation (in a local version of the Galaxy Browser) are available at http://recode.ucc.ie/CodonLogo and through the Galaxy Tool Shed at http://toolshed.g2.bx.psu.edu/.

Patterns and rates of viral evolution in HIV-1 subtype B infected females and males.

PubMed

Dapp, Michael J; Kober, Kord M; Chen, Lennie; Westfall, Dylan H; Wong, Kim; Zhao, Hong; Hall, Breana M; Deng, Wenjie; Sibley, Thomas; Ghorai, Suvankar; Kim, Katie; Chen, Natalie; McHugh, Sarah; Au, Lily; Cohen, Mardge; Anastos, Kathryn; Mullins, James I

2017-01-01

Biological sex differences affect the course of HIV infection, with untreated women having lower viral loads compared to their male counterparts but, for a given viral load, women have a higher rate of progression to AIDS. However, the vast majority of data on viral evolution, a process that is clearly impacted by host immunity and could be impacted by sex differences, has been derived from men. We conducted an intensive analysis of HIV-1 gag and env-gp120 evolution taken over the first 6-11 years of infection from 8 Women's Interagency HIV Study (WIHS) participants who had not received combination antiretroviral therapy (ART). This was compared to similar data previously collected from men, with both groups infected with HIV-1 subtype B. Early virus populations in men and women were generally homogenous with no differences in diversity between sexes. No differences in ensuing nucleotide substitution rates were found between the female and male cohorts studied herein. As previously reported for men, time to peak diversity in env-gp120 in women was positively associated with time to CD4+ cell count below 200 (P = 0.017), and the number of predicted N-linked glycosylation sites generally increased over time, followed by a plateau or decline, with the majority of changes localized to the V1-V2 region. These findings strongly suggest that the sex differences in HIV-1 disease progression attributed to immune system composition and sensitivities are not revealed by, nor do they impact, global patterns of viral evolution, the latter of which proceeds similarly in women and men.

Four Japanese male patients with juvenile retinoschisis: only three have mutations in the RS1 gene.

PubMed

Hayashi, Takaaki; Omoto, Satoshi; Takeuchi, Tomokazu; Kozaki, Kenichi; Ueoka, Yasuo; Kitahara, Kenji

2004-11-01

To describe the clinical phenotypes of four unrelated Japanese male patients with juvenile retinoschisis and to investigate occurrences of mutations in the RS1 gene. Observational case series and experimental study. Fundus examinations, fluorescein angiography, and single-flash electroretinography (ERG) were carried out. In one patient, optical coherence tomography (OCT) was performed. The coding regions of the RS1 gene that encodes retinoschisin were amplified by polymerase chain reaction (PCR). The PCR products were purified and directly sequenced. The four affected patients showed cystoid- or wheel-like foveal changes with a little or no fluorescein leakage and negative b-wave patterns in both eyes. The OCT images of foveal retinoschisis disclosed that splitting occurs in the putative fibers of Henle. In three patients, we identified three different missense mutations (p.S73P, p.Y89C, p.R209C) in the functionally important discoidin domain of the RS1 gene. The p.S73P mutation has not been previously reported. In contrast, no nucleotide substitutions were detected in the fourth patient whose parents were unrelated and asymptomatic. No other member of this family for three generations has had juvenile retinoschisis. Because serine 73 is conserved in the mouse ortholog and other discoidin proteins, the proline 73 allele is therefore very likely to encode a defective retinoschisin. Although the inheritance pattern is uncertain in the patient without the RS1 mutation, the clinical and ERG findings were indistinguishable from those of patients with RS1 mutations. This finding points to the genetic heterogeneity of juvenile retinoschisis.

Nucleotide variability and linkage disequilibrium patterns in the porcine MUC4 gene.

PubMed

Yang, Ming; Yang, Bin; Yan, Xueming; Ouyang, Jing; Zeng, Weihong; Ai, Huashui; Ren, Jun; Huang, Lusheng

2012-07-13

MUC4 is a type of membrane anchored glycoprotein and serves as the major constituent of mucus that covers epithelial surfaces of many tissues such as trachea, colon and cervix. MUC4 plays important roles in the lubrication and protection of the surface epithelium, cell proliferation and differentiation, immune response, cell adhesion and cancer development. To gain insights into the evolution of the porcine MUC4 gene, we surveyed the nucleotide variability and linkage disequilibrium (LD) within this gene in Chinese indigenous breeds and Western commercial breeds. A total of 53 SNPs covering the MUC4 gene were genotyped on 5 wild boars and 307 domestic pigs representing 11 Chinese breeds and 3 Western breeds. The nucleotide variability, haplotype phylogeny and LD extent of MUC4 were analyzed in these breeds. Both Chinese and Western breeds had considerable nucleotide diversity at the MUC4 locus. Western pig breeds like Duroc and Large White have comparable nucleotide diversity as many of Chinese breeds, thus artificial selection for lean pork production have not reduced the genetic variability of MUC4 in Western commercial breeds. Haplotype phylogeny analyses indicated that MUC4 had evolved divergently in Chinese and Western pigs. The dendrogram of genetic differentiation between breeds generally reflected demographic history and geographical distribution of these breeds. LD patterns were unexpectedly similar between Chinese and Western breeds, in which LD usually extended less than 20 kb. This is different from the presumed high LD extent (more than 100 kb) in Western commercial breeds. The significant positive Tajima'D, and Fu and Li's D statistics in a few Chinese and Western breeds implied that MUC4 might undergo balancing selection in domestic breeds. Nevertheless, we cautioned that the significant statistics could be upward biased by SNP ascertainment process. Chinese and Western breeds have similar nucleotide diversity but evolve divergently in the MUC4 region. Western breeds exhibited unusual low LD extent at the MUC4 locus, reflecting the complexity of nucleotide variability of pig genome. The finding suggests that high density (e.g. 1SNP/10 kb) markers are required to capture the underlying causal variants at such regions.

Implications of the plastid genome sequence of typha (typhaceae, poales) for understanding genome evolution in poaceae.

PubMed

Guisinger, Mary M; Chumley, Timothy W; Kuehl, Jennifer V; Boore, Jeffrey L; Jansen, Robert K

2010-02-01

Plastid genomes of the grasses (Poaceae) are unusual in their organization and rates of sequence evolution. There has been a recent surge in the availability of grass plastid genome sequences, but a comprehensive comparative analysis of genome evolution has not been performed that includes any related families in the Poales. We report on the plastid genome of Typha latifolia, the first non-grass Poales sequenced to date, and we present comparisons of genome organization and sequence evolution within Poales. Our results confirm that grass plastid genomes exhibit acceleration in both genomic rearrangements and nucleotide substitutions. Poaceae have multiple structural rearrangements, including three inversions, three genes losses (accD, ycf1, ycf2), intron losses in two genes (clpP, rpoC1), and expansion of the inverted repeat (IR) into both large and small single-copy regions. These rearrangements are restricted to the Poaceae, and IR expansion into the small single-copy region correlates with the phylogeny of the family. Comparisons of 73 protein-coding genes for 47 angiosperms including nine Poaceae genera confirm that the branch leading to Poaceae has significantly accelerated rates of change relative to other monocots and angiosperms. Furthermore, rates of sequence evolution within grasses are lower, indicating a deceleration during diversification of the family. Overall there is a strong correlation between accelerated rates of genomic rearrangements and nucleotide substitutions in Poaceae, a phenomenon that has been noted recently throughout angiosperms. The cause of the correlation is unknown, but faulty DNA repair has been suggested in other systems including bacterial and animal mitochondrial genomes.

Influence of nucleotide modifications at the C2’ position on the Hoogsteen base-paired parallel-stranded duplex of poly(A) RNA

PubMed Central

Copp, William; Denisov, Alexey Y.; Xie, Jingwei; Noronha, Anne M.; Liczner, Christopher; Safaee, Nozhat

2017-01-01

Abstract Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2′-deoxyribose, 2′-O-methyl-ribose, 2′-deoxy-2′-fluoro-ribose, arabinose and 2′-deoxy-2′-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2’ modifications gave a variety of effects. Arabinose and 2′-deoxy-2′-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2′-O-methyl and 2′-deoxy-2′-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. PMID:28973475

Influence of nucleotide modifications at the C2' position on the Hoogsteen base-paired parallel-stranded duplex of poly(A) RNA.

PubMed

Copp, William; Denisov, Alexey Y; Xie, Jingwei; Noronha, Anne M; Liczner, Christopher; Safaee, Nozhat; Wilds, Christopher J; Gehring, Kalle

2017-09-29

Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2'-deoxyribose, 2'-O-methyl-ribose, 2'-deoxy-2'-fluoro-ribose, arabinose and 2'-deoxy-2'-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2' modifications gave a variety of effects. Arabinose and 2'-deoxy-2'-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2'-O-methyl and 2'-deoxy-2'-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

New evidence for positive selection helps explain the paternal age effect observed in achondroplasia

PubMed Central

Shinde, Deepali N.; Elmer, Dominik P.; Calabrese, Peter; Boulanger, Jérôme; Arnheim, Norman; Tiemann-Boege, Irene

2013-01-01

There are certain de novo germline mutations associated with genetic disorders whose mutation rates per generation are orders of magnitude higher than the genome average. Moreover, these mutations occur exclusively in the male germ line and older men have a higher probability of having an affected child than younger ones, known as the paternal age effect (PAE). The classic example of a genetic disorder exhibiting a PAE is achondroplasia, caused predominantly by a single-nucleotide substitution (c.1138G>A) in FGFR3. To elucidate what mechanisms might be driving the high frequency of this mutation in the male germline, we examined the spatial distribution of the c.1138G>A substitution in a testis from an 80-year-old unaffected man. Using a technology based on bead-emulsion amplification, we were able to measure mutation frequencies in 192 individual pieces of the dissected testis with a false-positive rate lower than 2.7 × 10−6. We observed that most mutations are clustered in a few pieces with 95% of all mutations occurring in 27% of the total testis. Using computational simulations, we rejected the model proposing an elevated mutation rate per cell division at this nucleotide site. Instead, we determined that the observed mutation distribution fits a germline selection model, where mutant spermatogonial stem cells have a proliferative advantage over unmutated cells. Combined with data on several other PAE mutations, our results support the idea that the PAE, associated with a number of Mendelian disorders, may be explained primarily by a selective mechanism. PMID:23740942

[Genetic diagnostics of pathogenic splicing abnormalities in the clinical laboratory--pitfalls and screening approaches].

PubMed

Niimi, Hideki; Ogawa, Tomomi; Note, Rhougou; Hayashi, Shirou; Ueno, Tomohiro; Harada, Kenu; Uji, Yoshinori; Kitajima, Isao

2010-12-01

In recent years, genetic diagnostics of pathogenic splicing abnormalities are increasingly recognized as critically important in the clinical genetic diagnostics. It is reported that approximately 10% of pathogenic mutations causing human inherited diseases are splicing mutations. Nonetheless, it is still difficult to identify splicing abnormalities in routine genetic diagnostic settings. Here, we studied two different kinds of cases with splicing abnormalities. The first case is a protein S deficiency. Nucleotide analyses revealed that the proband had a previously reported G to C substitution in the invariant AG dinucleotide at the splicing acceptor site of intronl/exon2, which produces multiple splicing abnormalities resulting in protein S deficiency. The second case is an antithrombin (AT) deficiency. This proband had a previously reported G to A substitution, at nucleotide position 9788 in intron 4, 14 bp in front of exon 5, which created a de novo exon 5 splice site and resulted in AT deficiency. From a practical standpoint, we discussed the pitfalls, attentions, and screening approaches in genetic diagnostics of pathogenic splicing abnormalities. Due to the difficulty with full-length sequence analysis of introns, and the lack of RNA samples, splicing mutations may escape identification. Although current genetic testing remains to be improved, to screen for splicing abnormalities more efficiently, it is significant to use an appropriate combination of various approaches such as DNA and/or RNA samples, splicing mutation databases, bioinformatic tools to detect splice sites and cis-regulatory elements, and in vitro and/or in vivo experimentally methods as needed.

Molecular characterization of kudoid parasites (Myxozoa: Multivalvulida) from somatic muscles of Pacific bluefin (Thunnus orientalis) and yellowfin (T. albacores) tuna.

PubMed

Abe, Niichiro; Maehara, Tomofumi

2013-06-01

The public health importance of Kudoa infection in fish remains unclear. Recently in Japan a Kudoa species, K. septempunctata, was newly implicated as a causative agent of unidentified food poisoning related to the consumption of raw olive flounder. Other marine fishery products are also suspected as causative raw foods of unidentified food poisoning. For this study, we detected kudoid parasites from sliced raw muscle tissues of a young Pacific bluefin and an adult yellowfin tuna. No cyst or pseudocyst was evident in muscles macroscopically, but pseudocysts were detected in both samples histologically. One substitution (within 1100 bp overlap) and ten substitutions (within 753 bp overlap) were found respectively between the partial sequences of 18S and 28S rDNAs from both isolates. Nucleotide sequence similarity searching of 18S and 28S rDNAs from both isolates showed the highest identity with those of K. neothunni from tuna. Based on the spore morphology, the mode of parasitism, and the nucleotide sequence similarity, these isolates from a Pacific bluefin and a yellowfin tuna were identified as K. neothunni. Phylogenetic analysis of the 28S rDNA sequence revealed that K. neothunni is classifiable into two genotypes: one from Pacific bluefin and the other from yellowfin tuna. Recently, an unidentified kudoid parasite morphologically and genetically similar K. neothunni were detected from stocked tuna samples in unidentified food poisoning cases in Japan. The possibility exists that K. neothunni, especially from the Pacific bluefin tuna, causes food poisoning, as does K. septempunctata.

The estimation of genetic divergence

NASA Technical Reports Server (NTRS)

Holmquist, R.; Conroy, T.

1981-01-01

Consideration is given to the criticism of Nei and Tateno (1978) of the REH (random evolutionary hits) theory of genetic divergence in nucleic acids and proteins, and to their proposed alternative estimator of total fixed mutations designated X2. It is argued that the assumption of nonuniform amino acid or nucleotide substitution will necessarily increase REH estimates relative to those made for a model where each locus has an equal likelihood of fixing mutations, thus the resulting value will not be an overestimation. The relative values of X2 and measures calculated on the basis of the PAM and REH theories for the number of nucleotide substitutions necessary to explain a given number of observed amino acid differences between two homologous proteins are compared, and the smaller values of X2 are attributed to (1) a mathematical model based on the incorrect assumption that an entire structural gene is free to fix mutations and (2) the assumptions of different numbers of variable codons for the X2 and REH calculations. Results of a repeat of the computer simulations of Nei and Tateno are presented which, in contrast to the original results, confirm the REH theory. It is pointed out that while a negative correlation is observed between estimations of the fixation intensity per varion and the number of varions for a given pair of sequences, the correlation between the two fixation intensities and varion numbers of two different pairs of sequences need not be negative. Finally, REH theory is used to resolve a paradox concerning the high rate of covarion turnover and the nature of general function sites as permanent covarions.

Identification of Sequence Variation in the Apolipoprotein A2 Gene and Their Relationship with Serum High-Density Lipoprotein Cholesterol Levels

PubMed Central

Bandarian, Fatemeh; Daneshpour, Maryam Sadat; Hedayati, Mehdi; Naseri, Mohsen; Azizi, Fereidoun

2016-01-01

Background: Apolipoprotein A2 (APOA2) is the second major apolipoprotein of the high-density lipoprotein cholesterol (HDL-C). The study aim was to identify APOA2 gene variation in individuals within two extreme tails of HDL-C levels and its relationship with HDL-C level. Methods: This cross-sectional survey was conducted on participants from Tehran Glucose and Lipid Study (TLGS) at Research Institute for Endocrine Sciences, Tehran, Iran from April 2012 to February 2013. In total, 79 individuals with extreme low HDL-C levels (≤5th percentile for age and gender) and 63 individuals with extreme high HDL-C levels (≥95th percentile for age and gender) were selected. Variants were identified using DNA amplification and direct sequencing. Results: Screen of all exons and the core promoter region of APOA2 gene identified nine single nucleotide substitutions and one microsatellite; five of which were known and four were new variants. Of these nine variants, two were common tag single nucleotide polymorphisms (SNPs) and seven were rare SNPs. Both exonic substitutions were missense mutations and caused an amino acid change. There was a significant association between the new missense mutation (variant Chr.1:16119226, Ala98Pro) and HDL-C level. Conclusion: None of two common tag SNPs of rs6413453 and rs5082 contributes to the HDL-C trait in Iranian population, but a new missense mutation in APOA2 in our population has a significant association with HDL-C. PMID:26590203

A base substitution in the donor site of intron 12 of KIT gene is responsible for the dominant white coat colour of blue fox (Alopex lagopus).

PubMed

Yan, S Q; Hou, J N; Bai, C Y; Jiang, Y; Zhang, X J; Ren, H L; Sun, B X; Zhao, Z H; Sun, J H

2014-04-01

The dominant white coat colour of farmed blue fox is inherited as a monogenic autosomal dominant trait and is suggested to be embryonic lethal in the homozygous state. In this study, the transcripts of KIT were identified by RT-PCR for a dominant white fox and a normal blue fox. Sequence analysis showed that the KIT transcript in normal blue fox contained the full-length coding sequence of 2919 bp (GenBank Acc. No KF530833), but in the dominant white individual, a truncated isoform lacking the entire exon 12 specifically co-expressed with the normal transcript. Genomic DNA sequencing revealed that a single nucleotide polymorphism (c.1867+1G>T) in intron 12 appeared only in the dominant white individuals and a 1-bp ins/del polymorphism in the same intron showed in individuals representing two different coat colours. Genotyping results of the SNP with PCR-RFLP in 185 individuals showed all 90 normal blue foxes were homozygous for the G allele, and all dominant white individuals were heterozygous. Due to the truncated protein with a deletion of 35 amino acids and an amino acid replacement (p.Pro623Ala) located in the conserved ATP binding domain, we propose that the mutant receptor had absent tyrosine kinase activity. These findings reveal that the base substitution at the first nucleotide of intron 12 of KIT gene, resulting in skipping of exon 12, is a causative mutation responsible for the dominant white phenotype of blue fox. © 2013 Stichting International Foundation for Animal Genetics.

Proviral Features of Human T Cell Leukemia Virus Type 1 in Carriers with Indeterminate Western Blot Analysis Results

PubMed Central

Sekizuka, Tsuyoshi; Yamochi, Tadanori; Firouzi, Sanaz; Sato, Tomoo; Umeki, Kazumi; Sasaki, Daisuke; Hasegawa, Hiroo; Kubota, Ryuji; Sobata, Rieko; Matsumoto, Chieko; Kaneko, Noriaki; Momose, Haruka; Araki, Kumiko; Saito, Masumichi; Nosaka, Kisato; Utsunomiya, Atae; Koh, Ki-Ryang; Ogata, Masao; Uchimaru, Kaoru; Iwanaga, Masako; Sagara, Yasuko; Yamano, Yoshihisa; Okayama, Akihiko; Miura, Kiyonori; Satake, Masahiro; Saito, Shigeru; Itabashi, Kazuo; Yamaguchi, Kazunari; Kuroda, Makoto; Watanabe, Toshiki; Okuma, Kazu

2017-01-01

ABSTRACT Western blotting (WB) for human T cell leukemia virus type 1 (HTLV-1) is performed to confirm anti-HTLV-1 antibodies detected at the initial screening of blood donors and in pregnant women. However, the frequent occurrence of indeterminate results is a problem with this test. We therefore assessed the cause of indeterminate WB results by analyzing HTLV-1 provirus genomic sequences. A quantitative PCR assay measuring HTLV-1 provirus in WB-indeterminate samples revealed that the median proviral load was approximately 100-fold lower than that of WB-positive samples (0.01 versus 0.71 copy/100 cells). Phylogenic analysis of the complete HTLV-1 genomes of WB-indeterminate samples did not identify any specific phylogenetic groups. When we analyzed the nucleotide changes in 19 HTLV-1 isolates from WB-indeterminate samples, we identified 135 single nucleotide substitutions, composed of four types, G to A (29%), C to T (19%), T to C (19%), and A to G (16%). In the most frequent G-to-A substitution, 64% occurred at GG dinucleotides, indicating that APOBEC3G is responsible for mutagenesis in WB-indeterminate samples. Moreover, interestingly, five WB-indeterminate isolates had nonsense mutations in Pol and/or Tax, Env, p12, and p30. These findings suggest that WB-indeterminate carriers have low production of viral antigens because of a combination of a low proviral load and mutations in the provirus, which may interfere with host recognition of HTLV-1 antigens. PMID:28701419

Proviral Features of Human T Cell Leukemia Virus Type 1 in Carriers with Indeterminate Western Blot Analysis Results.

PubMed

Kuramitsu, Madoka; Sekizuka, Tsuyoshi; Yamochi, Tadanori; Firouzi, Sanaz; Sato, Tomoo; Umeki, Kazumi; Sasaki, Daisuke; Hasegawa, Hiroo; Kubota, Ryuji; Sobata, Rieko; Matsumoto, Chieko; Kaneko, Noriaki; Momose, Haruka; Araki, Kumiko; Saito, Masumichi; Nosaka, Kisato; Utsunomiya, Atae; Koh, Ki-Ryang; Ogata, Masao; Uchimaru, Kaoru; Iwanaga, Masako; Sagara, Yasuko; Yamano, Yoshihisa; Okayama, Akihiko; Miura, Kiyonori; Satake, Masahiro; Saito, Shigeru; Itabashi, Kazuo; Yamaguchi, Kazunari; Kuroda, Makoto; Watanabe, Toshiki; Okuma, Kazu; Hamaguchi, Isao

2017-09-01

Western blotting (WB) for human T cell leukemia virus type 1 (HTLV-1) is performed to confirm anti-HTLV-1 antibodies detected at the initial screening of blood donors and in pregnant women. However, the frequent occurrence of indeterminate results is a problem with this test. We therefore assessed the cause of indeterminate WB results by analyzing HTLV-1 provirus genomic sequences. A quantitative PCR assay measuring HTLV-1 provirus in WB-indeterminate samples revealed that the median proviral load was approximately 100-fold lower than that of WB-positive samples (0.01 versus 0.71 copy/100 cells). Phylogenic analysis of the complete HTLV-1 genomes of WB-indeterminate samples did not identify any specific phylogenetic groups. When we analyzed the nucleotide changes in 19 HTLV-1 isolates from WB-indeterminate samples, we identified 135 single nucleotide substitutions, composed of four types, G to A (29%), C to T (19%), T to C (19%), and A to G (16%). In the most frequent G-to-A substitution, 64% occurred at GG dinucleotides, indicating that APOBEC3G is responsible for mutagenesis in WB-indeterminate samples. Moreover, interestingly, five WB-indeterminate isolates had nonsense mutations in Pol and/or Tax, Env, p12, and p30. These findings suggest that WB-indeterminate carriers have low production of viral antigens because of a combination of a low proviral load and mutations in the provirus, which may interfere with host recognition of HTLV-1 antigens. Copyright © 2017 American Society for Microbiology.

Bioorganometallic chemistry. 8. The molecular recognition of aromatic and aliphatic amino acids and substituted aromatic and aliphatic carboxylic acid guests with supramolecular ({eta}{sup 5}-pentamethylcyclopentadienyl)rhodium - nucleobase, nucleoside, and nucleotide cyclic trimer hosts via non-covalent {pi}-{pi} and hydrophobic interactions in water: Steric, electronic, and conformational parameters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, H.; Ogo, Seiji; Fish, R.H.

Molecular recognition, via non-covalent processes such as hydrogen bonding, {pi}-{pi}, and hydrophobic interactions, is an important biological phenomenon for guests, such as drugs, proteins, and other important biological molecules with, for example, host DNA/RNA. We have studied a novel molecular recognition process using guests that encompass aromatic and aliphatic amino acids [L-alanine, L-glutamine (L-Gln), L-histidine, L-isoleucine(L-Ile), L-leucine(L-Leu), L-phenylalanine(L-Phe), L-proline, L-tryptophan(L-Trp), L-valine(L-Val)], substituted aromatic carboxylic acids o-, m-, p-aminobenzoic acids (G1-3), benzoic acid (G4), phenylacetic acid (G5), p-methoxyphenylacetic acid (G6), o-methyoxybenozoic acid (G9), o-nitrobenzoic acid (G10), and aliphatic carboxylic acids [cyclohexylacetic acid (G7), 1-adamantanecarboxylic acid (G8)] with supramolecular, bioorganometallic hosts, ({eta}{supmore » 5}-pentamethylcyclopentadienyl)rhodium (Cp{sup *}Rh)-nucleobase, nucleoside, and nucleotide cyclic trimer complexes in aqueous solution at pH 7, utilizing {sup 1}H NMR, NOE, and molecular modeling techniques, and, as well, determining association constants (K{sub a}) and free energies of complexation ({Delta}{degree}G). The host-guest complexation occurs predominantly via non-covalent {pi}-{pi}, hydrophobic, and possible subtle H-bonding interactions, with steric, electronic, and molecular conformational parameters as important criteria. 8 refs., 6 figs., 3 tabs.« less

EST-derived SNP discovery and selective pressure analysis in Pacific white shrimp ( Litopenaeus vannamei)

NASA Astrophysics Data System (ADS)

Liu, Chengzhang; Wang, Xia; Xiang, Jianhai; Li, Fuhua

2012-09-01

Pacific white shrimp has become a major aquaculture and fishery species worldwide. Although a large scale EST resource has been publicly available since 2008, the data have not yet been widely used for SNP discovery or transcriptome-wide assessment of selective pressure. In this study, a set of 155 411 expressed sequence tags (ESTs) from the NCBI database were computationally analyzed and 17 225 single nucleotide polymorphisms (SNPs) were predicted, including 9 546 transitions, 5 124 transversions and 2 481 indels. Among the 7 298 SNP substitutions located in functionally annotated contigs, 58.4% (4 262) are non-synonymous SNPs capable of introducing amino acid mutations. Two hundred and fifty nonsynonymous SNPs in genes associated with economic traits have been identified as candidates for markers in selective breeding. Diversity estimates among the synonymous nucleotides were on average 3.49 times greater than those in non-synonymous, suggesting negative selection. Distribution of non-synonymous to synonymous substitutions (Ka/Ks) ratio ranges from 0 to 4.01, (average 0.42, median 0.26), suggesting that the majority of the affected genes are under purifying selection. Enrichment analysis identified multiple gene ontology categories under positive or negative selection. Categories involved in innate immune response and male gamete generation are rich in positively selected genes, which is similar to reports in Drosophila and primates. This work is the first transcriptome-wide assessment of selective pressure in a Penaeid shrimp species. The functionally annotated SNPs provide a valuable resource of potential molecular markers for selective breeding.

Emergence and localized circulation of a vaccine-derived poliovirus in an isolated mountain community in Guangxi, China.

PubMed

Yan, Dongmei; Li, Li; Zhu, Shuangli; Zhang, Yong; An, Junjing; Wang, Dongyan; Wen, Ning; Jorba, Jaume; Liu, Wei; Zhong, Ge; Huang, Lin; Kew, Olen; Liang, Xiaofeng; Xu, Wenbo

2010-09-01

From March to May 2006, type 1 circulating vaccine-derived poliovirus (cVDPV) was isolated from one case patient with acute flaccid paralysis (AFP) and six unimmunized healthy contacts in isolated mountain villages in Guangxi, China. We conducted epidemiological investigations in the affected communities and nucleotide sequence analyses of the cVDPV isolates. The results of the investigations showed that the AFP patient, an unimmunized 10-year-old boy, and five laboratory-confirmed contacts lived in the same village; one contact lived in a neighboring village. Only approximately 27% of children 5 to 10 years of age in the affected villages had received three or more doses of the trivalent oral poliovirus vaccine (OPV). Nucleotide sequence analyses revealed that the cVDPV isolates differed from the Sabin 1 (S1) isolate at 1.4 to 2.2% of VP1 nucleotide positions and shared 12 nucleotide substitutions within VP1. All isolates were S1/S2/S1/S3 recombinants sharing common recombination junctions. Key determinants of attenuation were replaced. Phylogenetic analysis suggested that the cVDPV circulated locally for approximately 12 months following the initiating OPV dose. No VDPVs were found after mass OPV immunizations, conducted from May to June 2006, that targeted all children <12 years of age. Our findings reinforce the point that VDPVs can emerge and spread in isolated communities with immunity gaps. Maintenance of sensitive AFP and poliovirus surveillance is essential to permit early detection and a rapid response to VDPV circulation.

Novel Bis-(arylsulfonamide) hydroxamate-Based Selective MMP Inhibitors

PubMed Central

Subramaniam, Rajesh; Haldar, Manas K.; Tobwala, Shakila; Ganguly, Bratati; Srivastava, D. K.; Mallik, Sanku

2008-01-01

A series of bis-(arylsulfonamide) hydroxamate inhibitors were synthesized. These compounds exhibit good potency against MMP-7 and MMP-9 depending on the nature, steric bulk and substitution pattern of the substituents in the benzene ring. In general, the preliminary structure-activity relationships (SAR) suggest that among the DAPA hydroxamates (i) electron-rich benzene rings of the sulfonamides may produce better inhibitors than electron-poor analogs. However, potential H-bond acceptors can reverse the trend depending on the isozyme; (ii) isozyme-selectivity between MMP-7 and -9 can be conferred through steric bulk and substitution pattern of the substituents in the benzene ring and (iii) the MMP-10 inhibition pattern of the compounds paralleled that for MMP-9. PMID:18442906

Structural Basis for the ATP-dependent Configuration of Adenylation Active Site in Bacillus subtilis o-Succinylbenzoyl-CoA Synthetase*

PubMed Central

Chen, Yaozong; Sun, Yueru; Song, Haigang; Guo, Zhihong

2015-01-01

o-Succinylbenzoyl-CoA synthetase, or MenE, is an essential adenylate-forming enzyme targeted for development of novel antibiotics in the menaquinone biosynthesis. Using its crystal structures in a ligand-free form or in complex with nucleotides, a conserved pattern is identified in the interaction between ATP and adenylating enzymes, including acyl/aryl-CoA synthetases, adenylation domains of nonribosomal peptide synthetases, and luciferases. It involves tight gripping interactions of the phosphate-binding loop (P-loop) with the ATP triphosphate moiety and an open-closed conformational change to form a compact adenylation active site. In MenE catalysis, this ATP-enzyme interaction creates a new binding site for the carboxylate substrate, allowing revelation of the determinants of substrate specificities and in-line alignment of the two substrates for backside nucleophilic substitution reaction by molecular modeling. In addition, the ATP-enzyme interaction is suggested to play a crucial catalytic role by mutation of the P-loop residues hydrogen-bonded to ATP. Moreover, the ATP-enzyme interaction has also clarified the positioning and catalytic role of a conserved lysine residue in stabilization of the transition state. These findings provide new insights into the adenylation half-reaction in the domain alteration catalytic mechanism of the adenylate-forming enzymes. PMID:26276389

Aldehyde dehydrogenase 2 in aplastic anemia, Fanconi anemia and hematopoietic stem cells.

PubMed

Van Wassenhove, Lauren D; Mochly-Rosen, Daria; Weinberg, Kenneth I

2016-09-01

Maintenance of the hematopoietic stem cell (HSC) compartment depends on the ability to metabolize exogenously and endogenously generated toxins, and to repair cellular damage caused by such toxins. Reactive aldehydes have been demonstrated to cause specific genotoxic injury, namely DNA interstrand cross-links. Aldehyde dehydrogenase 2 (ALDH2) is a member of a 19 isoenzyme ALDH family with different substrate specificities, subcellular localization, and patterns of expression. ALDH2 is localized in mitochondria and is essential for the metabolism of acetaldehyde, thereby placing it directly downstream of ethanol metabolism. Deficiency in ALDH2 expression and function are caused by a single nucleotide substitution and resulting amino acid change, called ALDH2*2. This genetic polymorphism affects 35-45% of East Asians (about ~560 million people), and causes the well-known Asian flushing syndrome, which results in disulfiram-like reactions after ethanol consumption. Recently, the ALDH2*2 genotype has been found to be associated with marrow failure, with both an increased risk of sporadic aplastic anemia and more rapid progression of Fanconi anemia. This review discusses the unexpected interrelationship between aldehydes, ALDH2 and hematopoietic stem cell biology, and in particular its relationship to Fanconi anemia. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Length Variation of Cag/Caa Trinucleotide Repeats in Natural Populations of Drosophila Melanogaster and Its Relation to the Recombination Rate

PubMed Central

Michalakis, Y.; Veuille, M.

1996-01-01

Eleven genes distributed along the Drosophila melanogaster chromosome 2 and showing exonic tandem repeats of glutamine codons (CAG or CAA) were surveyed for length variation in a sample of four European and African populations. Only one gene was monomorphic. Eight genes were polymorphic in all populations, with a total number of alleles varying between five and 12 for 120 chromosomes. The average heterozygozity per locus and population was 0.41. Selective neutrality in length variation could not be rejected under the assumptions of the infinite allele model. Significant population subdivision was found though no geographical pattern emerged, all populations being equally different. Significant linkage disequilibrium was found in four out of seven cases where the genetic distance between loci was <1 cM and was negligible when the distance was larger. There is evidence that these associations were established after the populations separated. An unexpected result was that variation at each locus was independent of the coefficient of exchange, although the latter ranged from zero to the relatively high value of 6.7%. This would indicate that background selection and selective hitchhiking, which are thought to affect levels of nucleotide substitution polymorphism, have no effect on trinucleotide repeat variation. PMID:8844158

Long-term evolution of the Luteoviridae: time scale and mode of virus speciation.

PubMed

Pagán, Israel; Holmes, Edward C

2010-06-01

Despite their importance as agents of emerging disease, the time scale and evolutionary processes that shape the appearance of new viral species are largely unknown. To address these issues, we analyzed intra- and interspecific evolutionary processes in the Luteoviridae family of plant RNA viruses. Using the coat protein gene of 12 members of the family, we determined their phylogenetic relationships, rates of nucleotide substitution, times to common ancestry, and patterns of speciation. An associated multigene analysis enabled us to infer the nature of selection pressures and the genomic distribution of recombination events. Although rates of evolutionary change and selection pressures varied among genes and species and were lower in some overlapping gene regions, all fell within the range of those seen in animal RNA viruses. Recombination breakpoints were commonly observed at gene boundaries but less so within genes. Our molecular clock analysis suggested that the origin of the currently circulating Luteoviridae species occurred within the last 4 millennia, with intraspecific genetic diversity arising within the last few hundred years. Speciation within the Luteoviridae may therefore be associated with the expansion of agricultural systems. Finally, our phylogenetic analysis suggested that viral speciation events tended to occur within the same plant host species and country of origin, as expected if speciation is largely sympatric, rather than allopatric, in nature.

Extreme selective sweeps independently targeted the X chromosomes of the great apes

PubMed Central

Nam, Kiwoong; Munch, Kasper; Hobolth, Asger; Dutheil, Julien Yann; Veeramah, Krishna R.; Woerner, August E.; Hammer, Michael F.; Mailund, Thomas; Schierup, Mikkel Heide

2015-01-01

The unique inheritance pattern of the X chromosome exposes it to natural selection in a way that is different from that of the autosomes, potentially resulting in accelerated evolution. We perform a comparative analysis of X chromosome polymorphism in 10 great ape species, including humans. In most species, we identify striking megabase-wide regions, where nucleotide diversity is less than 20% of the chromosomal average. Such regions are found exclusively on the X chromosome. The regions overlap partially among species, suggesting that the underlying targets are partly shared among species. The regions have higher proportions of singleton SNPs, higher levels of population differentiation, and a higher nonsynonymous-to-synonymous substitution ratio than the rest of the X chromosome. We show that the extent to which diversity is reduced is incompatible with direct selection or the action of background selection and soft selective sweeps alone, and therefore, we suggest that very strong selective sweeps have independently targeted these specific regions in several species. The only genomic feature that we can identify as strongly associated with loss of diversity is the location of testis-expressed ampliconic genes, which also have reduced diversity around them. We hypothesize that these genes may be responsible for selective sweeps in the form of meiotic drive caused by an intragenomic conflict in male meiosis. PMID:25941379

Evolution of disease response genes in loblolly pine: insights from candidate genes.

PubMed

Ersoz, Elhan S; Wright, Mark H; González-Martínez, Santiago C; Langley, Charles H; Neale, David B

2010-12-06

Host-pathogen interactions that may lead to a competitive co-evolution of virulence and resistance mechanisms present an attractive system to study molecular evolution because strong, recent (or even current) selective pressure is expected at many genomic loci. However, it is unclear whether these selective forces would act to preserve existing diversity, promote novel diversity, or reduce linked neutral diversity during rapid fixation of advantageous alleles. In plants, the lack of adaptive immunity places a larger burden on genetic diversity to ensure survival of plant populations. This burden is even greater if the generation time of the plant is much longer than the generation time of the pathogen. Here, we present nucleotide polymorphism and substitution data for 41 candidate genes from the long-lived forest tree loblolly pine, selected primarily for their prospective influences on host-pathogen interactions. This dataset is analyzed together with 15 drought-tolerance and 13 wood-quality genes from previous studies. A wide range of neutrality tests were performed and tested against expectations from realistic demographic models. Collectively, our analyses found that axr (auxin response factor), caf1 (chromatin assembly factor) and gatabp1 (gata binding protein 1) candidate genes carry patterns consistent with directional selection and erd3 (early response to drought 3) displays patterns suggestive of a selective sweep, both of which are consistent with the arm-race model of disease response evolution. Furthermore, we have identified patterns consistent with diversifying selection at erf1-like (ethylene responsive factor 1), ccoaoemt (caffeoyl-CoA-O-methyltransferase), cyp450-like (cytochrome p450-like) and pr4.3 (pathogen response 4.3), expected under the trench-warfare evolution model. Finally, a drought-tolerance candidate related to the plant cell wall, lp5, displayed patterns consistent with balancing selection. In conclusion, both arms-race and trench-warfare models seem compatible with patterns of polymorphism found in different disease-response candidate genes, indicating a mixed strategy of disease tolerance evolution for loblolly pine, a major tree crop in southeastern United States.

Patterns of nucleotide diversity and phenotypes of two domestication related genes (OsC1 and Wx) in indigenous rice varieties in Northeast India

PubMed Central

2014-01-01

Background During the domestication of crops, individual plants with traits desirable for human needs have been selected from their wild progenitors. Consequently, genetic and nucleotide diversity of genes associated with these selected traits in crop plants are expected to be lower than their wild progenitors. In the present study, we surveyed the pattern of nucleotide diversity of two selected trait specific genes, Wx and OsC1, which regulate amylose content and apiculus coloration respectively in cultivated rice varieties. The analyzed samples were collected from a wide geographic area in Northeast (NE) India, and included contrasting phenotypes considered to be associated with selected genes, namely glutinous and nonglutinous grains and colored and colorless apiculus. Results No statistically significant selection signatures were detected in both Wx and OsC1gene sequences. However, low level of selection that varied across the length of each gene was evident. The glutinous type varieties showed higher levels of nucleotide diversity at the Wx locus (πtot = 0.0053) than nonglutinous type varieties (πtot = 0.0043). The OsC1 gene revealed low levels of selection among the colorless apiculus varieties with lower nucleotide diversity (πtot = 0.0010) than in the colored apiculus varieties (πtot = 0.0023). Conclusions The results revealed that functional mutations at Wx and OsC1genes considered to be associated with specific phenotypes do not necessarily correspond to the phenotypes in indigenous rice varieties in NE India. This suggests that other than previously reported genomic regions may also be involved in determination of these phenotypes. PMID:24935343

Zn-metalloprotease sequences in extremophiles

NASA Astrophysics Data System (ADS)

Holden, T.; Dehipawala, S.; Golebiewska, U.; Cheung, E.; Tremberger, G., Jr.; Williams, E.; Schneider, P.; Gadura, N.; Lieberman, D.; Cheung, T.

2010-09-01

The Zn-metalloprotease family contains conserved amino acid structures such that the nucleotide fluctuation at the DNA level would exhibit correlated randomness as described by fractal dimension. A nucleotide sequence fractal dimension can be calculated from a numerical series consisting of the atomic numbers of each nucleotide. The structure's vibration modes can also be studied using a Gaussian Network Model. The vibration measure and fractal dimension values form a two-dimensional plot with a standard vector metric that can be used for comparison of structures. The preference for amino acid usage in extremophiles may suppress nucleotide fluctuations that could be analyzed in terms of fractal dimension and Shannon entropy. A protein level cold adaptation study of the thermolysin Zn-metalloprotease family using molecular dynamics simulation was reported recently and our results show that the associated nucleotide fluctuation suppression is consistent with a regression pattern generated from the sequences's fractal dimension and entropy values (R-square { 0.98, N =5). It was observed that cold adaptation selected for high entropy and low fractal dimension values. Extension to the Archaemetzincin M54 family in extremophiles reveals a similar regression pattern (R-square = 0.98, N = 6). It was observed that the metalloprotease sequences of extremely halophilic organisms possess high fractal dimension and low entropy values as compared with non-halophiles. The zinc atom is usually bonded to the histidine residue, which shows limited levels of vibration in the Gaussian Network Model. The variability of the fractal dimension and entropy for a given protein structure suggests that extremophiles would have evolved after mesophiles, consistent with the bias usage of non-prebiotic amino acids by extremophiles. It may be argued that extremophiles have the capacity to offer extinction protection during drastic changes in astrobiological environments.

Genetic diversity of three surface protein genes in Plasmodium malariae from three Asian countries.

PubMed

Srisutham, Suttipat; Saralamba, Naowarat; Sriprawat, Kanlaya; Mayxay, Mayfong; Smithuis, Frank; Nosten, Francois; Pukrittayakamee, Sasithon; Day, Nicholas P J; Dondorp, Arjen M; Imwong, Mallika

2018-01-11

Genetic diversity of the three important antigenic proteins, namely thrombospondin-related anonymous protein (TRAP), apical membrane antigen 1 (AMA1), and 6-cysteine protein (P48/45), all of which are found in various developmental stages of Plasmodium parasites is crucial for targeted vaccine development. While studies related to the genetic diversity of these proteins are available for Plasmodium falciparum and Plasmodium vivax, barely enough information exists regarding Plasmodium malariae. The present study aims to demonstrate the genetic variations existing among these three genes in P. malariae by analysing their diversity at nucleotide and protein levels. Three surface protein genes were isolated from 45 samples collected in Thailand (N = 33), Myanmar (N = 8), and Lao PDR (N = 4), using conventional polymerase chain reaction (PCR) assay. Then, the PCR products were sequenced and analysed using BioEdit, MEGA6, and DnaSP programs. The average pairwise nucleotide diversities (π) of P. malariae trap, ama1, and p48/45 were 0.00169, 0.00413, and 0.00029, respectively. The haplotype diversities (Hd) of P. malariae trap, ama1, and p48/45 were 0.919, 0.946, and 0.130, respectively. Most of the nucleotide substitutions were non-synonymous, which indicated that the genetic variations of these genes were maintained by positive diversifying selection, thus, suggesting their role as a potential target of protective immune response. Amino acid substitutions of P. malariae TRAP, AMA1, and P48/45 could be categorized to 17, 20, and 2 unique amino-acid variants, respectively. For further vaccine development, carboxyl terminal of P48/45 would be a good candidate according to conserved amino acid at low genetic diversity (π = 0.2-0.3). High mutational diversity was observed in P. malariae trap and ama1 as compared to p48/45 in P. malariae samples isolated from Thailand, Myanmar, and Lao PDR. Taken together, these results suggest that P48/45 might be a good vaccine candidate against P. malariae infection because of its sufficiently low genetic diversity and highly conserved amino acids especially on the carboxyl end.

Non-synonymous single nucleotide polymorphisms in the watermelon eIF4E gene are closely associated with resistance to zucchini yellow mosaic virus.

PubMed

Ling, Kai-Shu; Harris, Karen R; Meyer, Jenelle D F; Levi, Amnon; Guner, Nihat; Wehner, Todd C; Bendahmane, Abdelhafid; Havey, Michael J

2009-12-01

Zucchini yellow mosaic virus (ZYMV) is one of the most economically important potyviruses infecting cucurbit crops worldwide. Using a candidate gene approach, we cloned and sequenced eIF4E and eIF(iso)4E gene segments in watermelon. Analysis of the nucleotide sequences between the ZYMV-resistant watermelon plant introduction PI 595203 (Citrullus lanatus var. lanatus) and the ZYMV-susceptible watermelon cultivar 'New Hampshire Midget' ('NHM') showed the presence of single nucleotide polymorphisms (SNPs). Initial analysis of the identified SNPs in association studies indicated that SNPs in the eIF4E, but not eIF(iso)4E, were closely associated to the phenotype of ZYMV-resistance in 70 F(2) and 114 BC(1R) progenies. Subsequently, we focused our efforts in obtaining the entire genomic sequence of watermelon eIF4E. Three SNPs were identified between PI 595203 and NHM. One of the SNPs (A241C) was in exon 1 and the other two SNPs (C309A and T554G) were in the first intron of the gene. SNP241 which resulted in an amino acid substitution (proline to threonine) was shown to be located in the critical cap recognition and binding area, similar to that of several plant species resistance to potyviruses. Analysis of a cleaved amplified polymorphism sequence (CAPS) marker derived from this SNP in F(2) and BC(1R) populations demonstrated a cosegregation between the CAPS-2 marker and their ZYMV resistance or susceptibility phenotype. When we investigated whether such SNP mutation in the eIF4E was also conserved in several other PIs of C. lanatus var. citroides, we identified a different SNP (A171G) resulting in another amino acid substitution (D71G) from four ZYMV-resistant C. lanatus var. citroides (PI 244018, PI 482261, PI 482299, and PI 482322). Additional CAPS markers were also identified. Availability of all these CAPS markers will enable marker-aided breeding of watermelon for ZYMV resistance.

Relative similarity within purine nucleotide and ligand structures operating on nitric oxide synthetase, guanylyl cyclase and potassium (K ATP, BK Ca) channels.

PubMed

Williams, W Robert

2011-01-01

Purine nucleotides play a central role in signal transduction events initiated at the cell membrane. The NO-cGMP-cGK pathway, in particular, mediates events involving NOS and some classes of K(+) ion channel. The aim of this study is to investigate relative molecular similarity within the ligands binding to NOS, K(ATP), BK(Ca) channels and regulatory nucleotides. Minimum energy conformers of the ligand structures were superimposed and fitted to L-arginine and the nucleotides of adenine and guanine using a computational program. Distinctive patterns were evident in the fitting of NOS isoform antagonists to L-arginine. K(ATP) channel openers and antagonists superimposed on the glycosidic linkage and imidazole ring of the purine nucleotides, and guanidinium and ribose groups of GTP in the case of glibenclamide. The fits of BK(Ca) channel openers and antagonists to cGMP were characterized by the linear dimensions of their structures; distances between terminal oxy groups in respect of dexamethasone and aldosterone. The findings provide structural evidence for the functional interaction between K(+) channel openers/antagonists and the regulatory nucleotides. Use of the purine nucleotide template systematizes the considerable heterogeneity evident within the structures of ligands operating on K(+) ion channels. © 2010 The Author. JPP © 2010 Royal Pharmaceutical Society.

Quantitative Analysis of Single-Nucleotide Polymorphism for Rapid Detection of TR34/L98H- and TR46/Y121F/T289A-Positive Aspergillus fumigatus Isolates Obtained from Patients in Iran from 2010 to 2014

PubMed Central

Mohammadi, Faezeh; Hashemi, Seyed Jamal; Zoll, Jan; Melchers, Willem J. G.; Rafati, Haleh; Dehghan, Parvin; Rezaie, Sasan; Tolooe, Ali; Tamadon, Yalda; van der Lee, Henrich A.; Verweij, Paul E.

2015-01-01

We employed an endpoint genotyping method to update the prevalence rate of positivity for the TR34/L98H mutation (a 34-bp tandem repeat mutation in the promoter region of the cyp51A gene in combination with a substitution at codon L98) and the TR46/Y121F/T289A mutation (a 46-bp tandem repeat mutation in the promoter region of the cyp51A gene in combination with substitutions at codons Y121 and T289) among clinical Aspergillus fumigatus isolates obtained from different regions of Iran over a recent 5-year period (2010 to 2014). The antifungal activities of itraconazole, voriconazole, and posaconazole against 172 clinical A. fumigatus isolates were investigated using the European Committee on Antimicrobial Susceptibility Testing (EUCAST) broth microdilution method. For the isolates with an azole resistance phenotype, the cyp51A gene and its promoter were amplified and sequenced. In addition, using a LightCycler 480 real-time PCR system, a novel endpoint genotyping analysis method targeting single-nucleotide polymorphisms was evaluated to detect the L98H and Y121F mutations in the cyp51A gene of all isolates. Of the 172 A. fumigatus isolates tested, the MIC values of itraconazole (≥16 mg/liter) and voriconazole (>4 mg/liter) were high for 6 (3.5%). Quantitative analysis of single-nucleotide polymorphisms showed the TR34/L98H mutation in the cyp51A genes of six isolates. No isolates harboring the TR46/Y121F/T289A mutation were detected. DNA sequencing of the cyp51A gene confirmed the results of the novel endpoint genotyping method. By microsatellite typing, all of the azole-resistant isolates had genotypes different from those previously recovered from Iran and from the Dutch TR34/L98H controls. In conclusion, there was not a significant increase in the prevalence of azole-resistant A. fumigatus isolates harboring the TR34/L98H resistance mechanism among isolates recovered over a recent 5-year period (2010 to 2014) in Iran. A quantitative assay detecting a single-nucleotide polymorphism in the cyp51A gene of A. fumigatus is a reliable tool for the rapid screening and monitoring of TR34/L98H- and TR46/Y121F/T289A-positive isolates and can easily be incorporated into clinical mycology algorithms. PMID:26525787

Staining diatoms with rhodamine dyes: control of emission colour in photonic biocomposites

PubMed Central

Kucki, Melanie; Fuhrmann-Lieker, Thomas

2012-01-01

The incorporation of rhodamine dyes in the cell wall of diatoms Coscinodiscus granii and Coscinodiscus wailesii for the production of luminescent hybrid nanostructures is investigated. By systematic variation of the substitution pattern of the rhodamine core, we found that carbonic acids are considerably better suited than esters because of their physiological compatibility. The amino substitution pattern that controls the optical properties of the chromophore has no critical influence on dye uptake and incorporation, thus a variety of biocomposites with different emission maxima can be prepared. Applications in biomineralization studies as well as in materials science are envisioned. PMID:21865248