Science.gov

Sample records for nucleotide substitution pattern

  1. Plastid sequence evolution: a new pattern of nucleotide substitutions in the Cucurbitaceae.

    PubMed

    Decker-Walters, Deena S; Chung, Sang-Min; Staub, Jack E

    2004-05-01

    Nucleotide substitutions (i.e., point mutations) are the primary driving force in generating DNA variation upon which selection can act. Substitutions called transitions, which entail exchanges between purines (A = adenine, G = guanine) or pyrimidines (C = cytosine, T = thymine), typically outnumber transversions (e.g., exchanges between a purine and a pyrimidine) in a DNA strand. With an increasing number of plant studies revealing a transversion rather than transition bias, we chose to perform a detailed substitution analysis for the plant family Cucurbitaceae using data from several short plastid DNA sequences. We generated a phylogenetic tree for 19 taxa of the tribe Benincaseae and related genera and then scored conservative substitution changes (e.g., those not exhibiting homoplasy or reversals) from the unambiguous branches of the tree. Neither the transition nor (A+T)/(G+C) biases found in previous studies were supported by our overall data. More importantly, we found a novel and symmetrical substitution bias in which Gs had been preferentially replaced by A, As by C, Cs by T, and Ts by G, resulting in the G-->A-->C-->T-->G substitution series. Understanding this pattern will lead to new hypotheses concerning plastid evolution, which in turn will affect the choices of substitution models and other tree-building algorithms for phylogenetic analyses based on nucleotide data.

  2. [The patterns and influences of insertions, deletions and nucleotide substitutions in Solanaceae chloroplast genome].

    PubMed

    Tang, Ping; Wang, Qiang; Chen, Jian-Qun

    2008-11-01

    Nucleotide substitution and indels (insertions and deletions) events are the major evolutionary driving forces. Comparisons of the indels and nucleotide substitution patterns were made in the chloroplast genomes between Solanum lycopersicum L. and Solanum bulbocastanum L., Nicotiana tomentosiformis L. and Nicotiana tabacum L. in Solanaceae. The influence of mutation on genome composition was analyzed. The indels and substitutions were not randomly distributed throughout the chloroplast genomes. The indels were in AT-rich regions. One base pair indels accounted for above 30% of the total indels. Most of the indels were short of 10 bp. The nucleotide substitutions showed Ts/Tv bias, but transversion frequency of T-->G and A-->C was increased significantly. Ts/Tv rates were lineage-specific. The Ts/Tv rate between S. lycopersicum and S. bulbocastanum was lower than that between N. tomentosiformis and N. tabacum. (A+T)/(G+C) rates varied in different lineages, which had an influence on (G+C)% of genomes. The changes in the (A+T)/(G+C) rates might correlate with the life histories of different species.

  3. Nucleotide substitution patterns can predict the requirements for drug-resistance of HIV-1 proteins.

    PubMed

    Keulen, W; Boucher, C; Berkhout, B

    1996-06-01

    The enzyme reverse transcriptase (RT) plays a fundamental role in the replication of the human immunodeficiency virus type 1 (HIV-1) and several antiviral agents that target this key enzyme have been developed. Unfortunately, treatment of patients with RT inhibitors results in the appearance of drug-resistant variants with specific mutations in the RT protein. We hypothesized that if "difficult' resistance mutations (e.g. transversions/double-hits) are consistently observed at certain positions, it is likely that "easier' nucleotide substitutions (transitions/single-hits) at that codon do not result in a drug-resistant and/or active RT enzyme. In this study, we examined codon changes involved in RT drug resistance against nucleoside and non-nucleoside inhibitors and listed all easier substitutions, which apparently were not selected, either due to reduced enzyme RT activity or lack of drug resistance. These predictions on the requirements for resistance were confirmed by published mutational data on RT variants. We also propose that differences in mutation type can explain the order of appearance of substitutions in case multiple amino acid changes are required for optimal fitness. Differences in mutation pattern have been reported for drug-resistant HIV-1 variants selected in tissue culture compared with variants found in treated patients. In contrast to the in vivo situation, a relatively small population size is handled in in vitro tissue culture systems and this may limit the chances of creating a resistance mutation. Indeed, inspection of the codon changes indicates that the in vitro culture system is more strongly biased towards the relatively easy nucleotide substitutions. These results suggest that the nucleotide substitution pattern can provide important information on RT drug resistance.

  4. Evaluation of Ancestral Sequence Reconstruction Methods to Infer Nonstationary Patterns of Nucleotide Substitution.

    PubMed

    Matsumoto, Tomotaka; Akashi, Hiroshi; Yang, Ziheng

    2015-07-01

    Inference of gene sequences in ancestral species has been widely used to test hypotheses concerning the process of molecular sequence evolution. However, the approach may produce spurious results, mainly because using the single best reconstruction while ignoring the suboptimal ones creates systematic biases. Here we implement methods to correct for such biases and use computer simulation to evaluate their performance when the substitution process is nonstationary. The methods we evaluated include parsimony and likelihood using the single best reconstruction (SBR), averaging over reconstructions weighted by the posterior probabilities (AWP), and a new method called expected Markov counting (EMC) that produces maximum-likelihood estimates of substitution counts for any branch under a nonstationary Markov model. We simulated base composition evolution on a phylogeny for six species, with different selective pressures on G+C content among lineages, and compared the counts of nucleotide substitutions recorded during simulation with the inference by different methods. We found that large systematic biases resulted from (i) the use of parsimony or likelihood with SBR, (ii) the use of a stationary model when the substitution process is nonstationary, and (iii) the use of the Hasegawa-Kishino-Yano (HKY) model, which is too simple to adequately describe the substitution process. The nonstationary general time reversible (GTR) model, used with AWP or EMC, accurately recovered the substitution counts, even in cases of complex parameter fluctuations. We discuss model complexity and the compromise between bias and variance and suggest that the new methods may be useful for studying complex patterns of nucleotide substitution in large genomic data sets.

  5. Genome-wide analyses of Geraniaceae plastid DNA reveal unprecedented patterns of increased nucleotide substitutions

    PubMed Central

    Guisinger, Mary M.; Kuehl, Jennifer V.; Boore, Jeffrey L.; Jansen, Robert K.

    2008-01-01

    Angiosperm plastid genomes are generally conserved in gene content and order with rates of nucleotide substitutions for protein-coding genes lower than for nuclear protein-coding genes. A few groups have experienced genomic change, and extreme changes in gene content and order are found within the flowering plant family Geraniaceae. The complete plastid genome sequence of Pelargonium X hortorum (Geraniaceae) reveals the largest and most rearranged plastid genome identified to date. Highly elevated rates of sequence evolution in Geraniaceae mitochondrial genomes have been reported, but rates in Geraniaceae plastid genomes have not been characterized. Analysis of nucleotide substitution rates for 72 plastid genes for 47 angiosperm taxa, including nine Geraniaceae, show that values of dN are highly accelerated in ribosomal protein and RNA polymerase genes throughout the family. Furthermore, dN/dS is significantly elevated in the same two classes of plastid genes as well as in ATPase genes. A relatively high dN/dS ratio could be interpreted as evidence of two phenomena, namely positive or relaxed selection, neither of which is consistent with our current understanding of plastid genome evolution in photosynthetic plants. These analyses are the first to use protein-coding sequences from complete plastid genomes to characterize rates and patterns of sequence evolution for a broad sampling of photosynthetic angiosperms, and they reveal unprecedented accumulation of nucleotide substitutions in Geraniaceae. To explain these remarkable substitution patterns in the highly rearranged Geraniaceae plastid genomes, we propose a model of aberrant DNA repair coupled with altered gene expression. PMID:19011103

  6. Patterns of Nucleotide Substitution in Mitochondrial Protein Coding Genes of Vertebrates

    PubMed Central

    Kumar, S.

    1996-01-01

    Maximum likelihood methods were used to study the differences in substitution rates among the four nucleotides and among different nucleotide sites in mitochondrial protein-coding genes of vertebrates. In the 1st+2nd codon position data, the frequency of nucleotide G is negatively correlated with evolutionary rates of genes, substitution rates vary substantially among sites, and the transition/transversion rate bias (R) is two to five times larger than that expected at random. Generally, largest transition biases and greatest differences in substitution rates among sites are found in the highly conserved genes. The 3rd positions in placental mammal genes exhibit strong nucleotide composition biases and the transitional rates exceed transversional rates by one to two orders of magnitude. Tamura-Nei and Hasegawa-Kishino-Yano models with gamma distributed variable rates among sites (gamma parameter, α) adequately describe the nucleotide substitution process in 1st+2nd position data. In these data, ignoring differences in substitution rates among sites leads to largest biases while estimating substitution rates. Kimura's two-parameter model with variable-rates among sites performs satisfactorily in likelihood estimation of R, α, and overall amount of evolution for 1st+2nd position data. It can also be used to estimate pairwise distances with appropriate values of α for a majority of genes. PMID:8722802

  7. DNA replication timing and higher-order nuclear organization determine single-nucleotide substitution patterns in cancer genomes.

    PubMed

    Liu, Lin; De, Subhajyoti; Michor, Franziska

    2013-01-01

    Single-nucleotide substitutions are a defining characteristic of cancer genomes. Many single-nucleotide substitutions in cancer genomes arise because of errors in DNA replication, which is spatio-temporally stratified. Here we propose that DNA replication patterns help shape the mutational landscapes of normal and cancer genomes. Using data on five fully sequenced cancer types and two personal genomes, we determined that the frequency of intergenic single-nucleotide substitution is significantly higher in late DNA replication timing regions, even after controlling for a number of genomic features. Furthermore, some substitution signatures are more frequent in certain DNA replication timing zones. Finally, integrating data on higher-order nuclear organization, we found that genomic regions in close spatial proximity to late-replicating domains display similar mutation spectra as the late-replicating regions themselves. These data suggest that DNA replication timing together with higher-order genomic organization contribute to the patterns of single-nucleotide substitution in normal and cancer genomes.

  8. Relaxed clocks and inferences of heterogeneous patterns of nucleotide substitution and divergence time estimates across whales and dolphins (Mammalia: Cetacea).

    PubMed

    Dornburg, Alex; Brandley, Matthew C; McGowen, Michael R; Near, Thomas J

    2012-02-01

    Various nucleotide substitution models have been developed to accommodate among lineage rate heterogeneity, thereby relaxing the assumptions of the strict molecular clock. Recently developed "uncorrelated relaxed clock" and "random local clock" (RLC) models allow decoupling of nucleotide substitution rates between descendant lineages and are thus predicted to perform better in the presence of lineage-specific rate heterogeneity. However, it is uncertain how these models perform in the presence of punctuated shifts in substitution rate, especially between closely related clades. Using cetaceans (whales and dolphins) as a case study, we test the performance of these two substitution models in estimating both molecular rates and divergence times in the presence of substantial lineage-specific rate heterogeneity. Our RLC analyses of whole mitochondrial genome alignments find evidence for up to ten clade-specific nucleotide substitution rate shifts in cetaceans. We provide evidence that in the uncorrelated relaxed clock framework, a punctuated shift in the rate of molecular evolution within a subclade results in posterior rate estimates that are either misled or intermediate between the disparate rate classes present in baleen and toothed whales. Using simulations, we demonstrate abrupt changes in rate isolated to one or a few lineages in the phylogeny can mislead rate and age estimation, even when the node of interest is calibrated. We further demonstrate how increasing prior age uncertainty can bias rate and age estimates, even while the 95% highest posterior density around age estimates decreases; in other words, increased precision for an inaccurate estimate. We interpret the use of external calibrations in divergence time studies in light of these results, suggesting that rate shifts at deep time scales may mislead inferences of absolute molecular rates and ages.

  9. Variance estimation for nucleotide substitution models.

    PubMed

    Chen, Weishan; Wang, Hsiuying

    2015-09-01

    The current variance estimators for most evolutionary models were derived when a nucleotide substitution number estimator was approximated with a simple first order Taylor expansion. In this study, we derive three variance estimators for the F81, F84, HKY85 and TN93 nucleotide substitution models, respectively. They are obtained using the second order Taylor expansion of the substitution number estimator, the first order Taylor expansion of a squared deviation and the second order Taylor expansion of a squared deviation, respectively. These variance estimators are compared with the existing variance estimator in terms of a simulation study. It shows that the variance estimator, which is derived using the second order Taylor expansion of a squared deviation, is more accurate than the other three estimators. In addition, we also compare these estimators with an estimator derived by the bootstrap method. The simulation shows that the performance of this bootstrap estimator is similar to the estimator derived by the second order Taylor expansion of a squared deviation. Since the latter one has an explicit form, it is more efficient than the bootstrap estimator.

  10. Rates of nucleotide substitution in sexual and anciently asexual rotifers

    PubMed Central

    Welch, David B. Mark; Meselson, Matthew S.

    2001-01-01

    The class Bdelloidea of the phylum Rotifera is the largest well studied eukaryotic taxon in which males and meiosis are unknown, and the only one for which these indications of ancient asexuality are supported by cytological and molecular genetic evidence. We estimated the rates of synonymous and nonsynonymous substitutions in the hsp82 heat shock gene in bdelloids and in facultatively sexual rotifers of the class Monogononta, employing distance based and maximum likelihood methods. Relative-rate tests, using acanthocephalan rotifers as an outgroup, showed slightly higher rates of nonsynonymous substitution and slightly lower rates of synonymous substitution in bdelloids as compared with monogononts. The opposite trend, however, was seen in intraclass pairwise comparisons. If, as it seems, bdelloids have evolved asexually, an equality of bdelloid and monogonont substitution rates would suggest that the maintenance of sexual reproduction in monogononts is not attributable to an effect of sexual reproduction in limiting the load of deleterious nucleotide substitutions. PMID:11381112

  11. Nucleotide substitutions in vanC-2 gene of Enterococcus casseliflavus isolates obtained from chickens.

    PubMed Central

    Murase, T.; Mito, Y.; Otsuki, K.; Suzuki, R.; Yamai, S.

    2002-01-01

    DNA sequencing of the vanC-2 gene was partially carried out on 10 isolates of Enterococcus casseliflavus obtained from 8 samples of imported chickens in Japan between July 1999 and June 2001 to evaluate the variation in the gene. Forty nucleotide substitutions in 36 codons were identified within 345 base pairs when compared with the vanC-2 sequence of the reference strain E. casseliflavus ATCC25788. Identical nucleotide substitutions were commonly found in the isolates recovered from chickens imported from both Brazil and China. Pulsed-field gel electrophoresis (PFGE) patterns of NotI-digested chromosomal DNA of these strains were distinguished by two, or more than six, band differences. These observations suggest that sequencing of the vanC-2 gene may be helpful for epidemiological investigation in combination with the PFGE analyses of the isolates, although particular genotypes are unlikely to be restricted to each of the countries that exported chickens. PMID:12403118

  12. Genome-Wide Heterogeneity of Nucleotide Substitution Model Fit

    PubMed Central

    Arbiza, Leonardo; Patricio, Mateus; Dopazo, Hernán; Posada, David

    2011-01-01

    At a genomic scale, the patterns that have shaped molecular evolution are believed to be largely heterogeneous. Consequently, comparative analyses should use appropriate probabilistic substitution models that capture the main features under which different genomic regions have evolved. While efforts have concentrated in the development and understanding of model selection techniques, no descriptions of overall relative substitution model fit at the genome level have been reported. Here, we provide a characterization of best-fit substitution models across three genomic data sets including coding regions from mammals, vertebrates, and Drosophila (24,000 alignments). According to the Akaike Information Criterion (AIC), 82 of 88 models considered were selected as best-fit models at least in one occasion, although with very different frequencies. Most parameter estimates also varied broadly among genes. Patterns found for vertebrates and Drosophila were quite similar and often more complex than those found in mammals. Phylogenetic trees derived from models in the 95% confidence interval set showed much less variance and were significantly closer to the tree estimated under the best-fit model than trees derived from models outside this interval. Although alternative criteria selected simpler models than the AIC, they suggested similar patterns. All together our results show that at a genomic scale, different gene alignments for the same set of taxa are best explained by a large variety of different substitution models and that model choice has implications on different parameter estimates including the inferred phylogenetic trees. After taking into account the differences related to sample size, our results suggest a noticeable diversity in the underlying evolutionary process. All together, we conclude that the use of model selection techniques is important to obtain consistent phylogenetic estimates from real data at a genomic scale. PMID:21824869

  13. Clusters of nucleotide substitutions and insertion/deletion mutations are associated with repeat sequences.

    PubMed

    McDonald, Michael J; Wang, Wei-Chi; Huang, Hsien-Da; Leu, Jun-Yi

    2011-06-01

    The genome-sequencing gold rush has facilitated the use of comparative genomics to uncover patterns of genome evolution, although their causal mechanisms remain elusive. One such trend, ubiquitous to prokarya and eukarya, is the association of insertion/deletion mutations (indels) with increases in the nucleotide substitution rate extending over hundreds of base pairs. The prevailing hypothesis is that indels are themselves mutagenic agents. Here, we employ population genomics data from Escherichia coli, Saccharomyces paradoxus, and Drosophila to provide evidence suggesting that it is not the indels per se but the sequence in which indels occur that causes the accumulation of nucleotide substitutions. We found that about two-thirds of indels are closely associated with repeat sequences and that repeat sequence abundance could be used to identify regions of elevated sequence diversity, independently of indels. Moreover, the mutational signature of indel-proximal nucleotide substitutions matches that of error-prone DNA polymerases. We propose that repeat sequences promote an increased probability of replication fork arrest, causing the persistent recruitment of error-prone DNA polymerases to specific sequence regions over evolutionary time scales. Experimental measures of the mutation rates of engineered DNA sequences and analyses of experimentally obtained collections of spontaneous mutations provide molecular evidence supporting our hypothesis. This study uncovers a new role for repeat sequences in genome evolution and provides an explanation of how fine-scale sequence contextual effects influence mutation rates and thereby evolution.

  14. Correlated evolution of nucleotide substitution rates and allelic variation in Mhc-DRB lineages of primates.

    PubMed

    Garamszegi, László Z; de Groot, Natasja G; Bontrop, Ronald E

    2009-04-12

    The major histocompatibility complex (MHC) is a key model of genetic polymorphism. Selection pressure by pathogens or other microevolutionary forces may result in a high rate of non-synonymous substitutions at the codons specifying the contact residues of the antigen binding sites (ABS), and the maintenance of extreme MHC allelic variation at the population/species level. Therefore, selection forces favouring MHC variability for any reason should cause a correlated evolution between substitution rates and allelic polymorphism. To investigate this prediction, we characterised nucleotide substitution rates and allelic polymorphism (i.e. the number of alleles detected in relation to the number of animals screened) of several Mhc class II DRB lineages in 46 primate species, and tested for a correlation between them. First, we demonstrate that species-specific and lineage-specific evolutionary constraints favour species- and lineage-dependent substitution rate at the codons specifying the ABS contact residues (i.e. certain species and lineages can be characterised by high substitution rate, while others have low rate). Second, we show that although the degree of the non-synonymous substitution rate at the ABS contact residues was systematically higher than the degree of the synonymous substitution rate, these estimates were strongly correlated when we controlled for species-specific and lineage-specific effects, and also for the fact that different studies relied on different sample size. Such relationships between substitution rates of different types could even be extended to the non-contact residues of the molecule. Third, we provide statistical evidence that increased substitution rate along a MHC gene may lead to allelic variation, as a high substitution rate can be observed in those lineages in which many alleles are maintained. Fourth, we show that the detected patterns were independent of phylogenetic constraints. When we used phylogenetic models that control

  15. Correlated evolution of nucleotide substitution rates and allelic variation in Mhc-DRB lineages of primates

    PubMed Central

    Garamszegi, László Z; de Groot, Natasja G; Bontrop, Ronald E

    2009-01-01

    Background The major histocompatibility complex (MHC) is a key model of genetic polymorphism. Selection pressure by pathogens or other microevolutionary forces may result in a high rate of non-synonymous substitutions at the codons specifying the contact residues of the antigen binding sites (ABS), and the maintenance of extreme MHC allelic variation at the population/species level. Therefore, selection forces favouring MHC variability for any reason should cause a correlated evolution between substitution rates and allelic polymorphism. To investigate this prediction, we characterised nucleotide substitution rates and allelic polymorphism (i.e. the number of alleles detected in relation to the number of animals screened) of several Mhc class II DRB lineages in 46 primate species, and tested for a correlation between them. Results First, we demonstrate that species-specific and lineage-specific evolutionary constraints favour species- and lineage-dependent substitution rate at the codons specifying the ABS contact residues (i.e. certain species and lineages can be characterised by high substitution rate, while others have low rate). Second, we show that although the degree of the non-synonymous substitution rate at the ABS contact residues was systematically higher than the degree of the synonymous substitution rate, these estimates were strongly correlated when we controlled for species-specific and lineage-specific effects, and also for the fact that different studies relied on different sample size. Such relationships between substitution rates of different types could even be extended to the non-contact residues of the molecule. Third, we provide statistical evidence that increased substitution rate along a MHC gene may lead to allelic variation, as a high substitution rate can be observed in those lineages in which many alleles are maintained. Fourth, we show that the detected patterns were independent of phylogenetic constraints. When we used phylogenetic

  16. Cytosine-substituted metalloporphyrins: receptors for recognition of nucleotides in ion-selective electrodes.

    PubMed

    Král, Vladimír; Shishkanova, Tatiana V; Sessler, Jonathan L; Brown, Christopher T

    2004-04-21

    A new series of cytosine-substituted metalloporphyrin conjugates (containing Co(II) and Zn(II) as the coordinated metals) were designed and investigated as nucleotide receptors in PVC-membrane-based ion-selective electrodes under neutral conditions. The potentiometric results indicate that these systems, in particular the Co(II)-containing complex, may be potentially useful sensors for complementary nucleotide substrates in the presence of 10 mol% tridodecylmethylammonium chloride (K(Pot.)(5'-GMP/5'-AMP)= 0.045).

  17. Evaluation of the flanking nucleotide sequences of sarcomeric hypertrophic cardiomyopathy substitution mutations.

    PubMed

    Meurs, Kathryn M; Mealey, Katrina L

    2008-07-03

    Hypertrophic cardiomyopathy (HCM) is a familial myocardial disease with a prevalence of 1 in 500. More than 400 causative mutations have been identified in 13 sarcomeric and myofilament related genes, 350 of these are substitution mutations within eight sarcomeric genes. Within a population, examples of recurring identical disease causing mutations that appear to have arisen independently have been noted as well as those that appear to have been inherited from a common ancestor. The large number of novel HCM mutations could suggest a mechanism of increased mutability within the sarcomeric genes. The objective of this study was to evaluate the most commonly reported HCM genes, beta myosin heavy chain (MYH7), myosin binding protein C, troponin I, troponin T, cardiac regulatory myosin light chain, cardiac essential myosin light chain, alpha tropomyosin and cardiac alpha-actin for sequence patterns surrounding the substitution mutations that may suggest a mechanism of increased mutability. The mutations as well as the 10 flanking nucleotides were evaluated for frequency of di-, tri- and tetranucleotides containing the mutation as well as for the presence of certain tri- and tetranculeotide motifs. The most common substitutions were guanine (G) to adenine (A) and cytosine (C) to thymidine (T). The CG dinucleotide had a significantly higher relative mutability than any other dinucleotide (p<0.05). The relative mutability of each possible trinucleotide and tetranucleotide sequence containing the mutation was calculated; none were at a statistically higher frequency than the others. The large number of G to A and C to T mutations as well as the relative mutability of CG may suggest that deamination of methylated CpG is an important mechanism for mutation development in at least some of these cardiac genes.

  18. Genome Hotspots for Nucleotide Substitutions and the Evolution of Influenza A (H1N1) Human Strains

    PubMed Central

    Civetta, Alberto; Ostapchuk, David Cecil Murphy; Nwali, Basil

    2016-01-01

    In recent years a number of studies have brought attention to the role of positive selection during the evolution of antigenic escape by influenza strains. Particularly, the identification of positively selected sites within antigenic domains of viral surface proteins has been used to suggest that the evolution of viral–host receptor binding specificity is driven by selection. Here we show that, following the 1918 outbreak, the antigenic sites of the hemagglutinin (HA) viral surface protein and the stalk region of neuraminidase became substitution hotspots. The hotspots show similar patterns of nucleotide substitution bias at synonymous and nonsynonymous sites. Such bias imposes directionality in amino acid replacements that can influence signals of selection at antigenic sites. Our results suggest that the high accumulation of substitutions within the antigenic sites of HA can explain not only cases of antigenic escape by antigenic drift but also lead to occasional episodes of viral extinction. PMID:26988249

  19. Evolutionary constraints and the neutral theory. [mutation-caused nucleotide substitutions in DNA

    NASA Technical Reports Server (NTRS)

    Jukes, T. H.; Kimura, M.

    1984-01-01

    The neutral theory of molecular evolution postulates that nucleotide substitutions inherently take place in DNA as a result of point mutations followed by random genetic drift. In the absence of selective constraints, the substitution rate reaches the maximum value set by the mutation rate. The rate in globin pseudogenes is about 5 x 10 to the -9th substitutions per site per year in mammals. Rates slower than this indicate the presence of constraints imposed by negative (natural) selection, which rejects and discards deleterious mutations.

  20. Evolutionary constraints and the neutral theory. [mutation-caused nucleotide substitutions in DNA

    NASA Technical Reports Server (NTRS)

    Jukes, T. H.; Kimura, M.

    1984-01-01

    The neutral theory of molecular evolution postulates that nucleotide substitutions inherently take place in DNA as a result of point mutations followed by random genetic drift. In the absence of selective constraints, the substitution rate reaches the maximum value set by the mutation rate. The rate in globin pseudogenes is about 5 x 10 to the -9th substitutions per site per year in mammals. Rates slower than this indicate the presence of constraints imposed by negative (natural) selection, which rejects and discards deleterious mutations.

  1. Coupled nucleotide covariations reveal dynamic RNA interaction patterns.

    PubMed Central

    Gultyaev, A P; Franch, T; Gerdes, K

    2000-01-01

    Evolutionarily conserved structures in related RNA molecules contain coordinated variations (covariations) of paired nucleotides. Analysis of covariations is a very powerful approach to deduce phylogenetically conserved (i.e., functional) conformations, including tertiary interactions. Here we discuss conserved RNA folding pathways that are revealed by covariation patterns. In such pathways, structural requirements for alternative pairings cause some nucleotides to covary with two different partners. Such "coupled" covariations between three or more nucleotides were found in various types of RNAs. The analysis of coupled covariations can unravel important features of RNA folding dynamics and improve phylogeny reconstruction in some cases. Importantly, it is necessary to distinguish between multiple covariations determined by mutually exclusive structures and those determined by tertiary contacts. PMID:11105748

  2. A new approach for estimating the efficiencies of the nucleotide substitution models.

    PubMed

    Som, Anup

    2007-04-01

    In this article, a new approach is presented for estimating the efficiencies of the nucleotide substitution models in a four-taxon case and then this approach is used to estimate the relative efficiencies of six substitution models under a wide variety of conditions. In this approach, efficiencies of the models are estimated by using a simple probability distribution theory. To assess the accuracy of the new approach, efficiencies of the models are also estimated by using the direct estimation method. Simulation results from the direct estimation method confirmed that the new approach is highly accurate. The success of the new approach opens a unique opportunity to develop analytical methods for estimating the relative efficiencies of the substitution models in a straightforward way.

  3. Characterization of Nucleotide Misincorporation Patterns in the Iceman's Mitochondrial DNA

    PubMed Central

    Olivieri, Cristina; Ermini, Luca; Rizzi, Ermanno; Corti, Giorgio; Bonnal, Raoul; Luciani, Stefania; Marota, Isolina; De Bellis, Gianluca; Rollo, Franco

    2010-01-01

    Background The degradation of DNA represents one of the main issues in the genetic analysis of archeological specimens. In the recent years, a particular kind of post-mortem DNA modification giving rise to nucleotide misincorporation (“miscoding lesions”) has been the object of extensive investigations. Methodology/Principal Findings To improve our knowledge regarding the nature and incidence of ancient DNA nucleotide misincorporations, we have utilized 6,859 (629,975 bp) mitochondrial (mt) DNA sequences obtained from the 5,350–5,100-years-old, freeze-desiccated human mummy popularly known as the Tyrolean Iceman or Ötzi. To generate the sequences, we have applied a mixed PCR/pyrosequencing procedure allowing one to obtain a particularly high sequence coverage. As a control, we have produced further 8,982 (805,155 bp) mtDNA sequences from a contemporary specimen using the same system and starting from the same template copy number of the ancient sample. From the analysis of the nucleotide misincorporation rate in ancient, modern, and putative contaminant sequences, we observed that the rate of misincorporation is significantly lower in modern and putative contaminant sequence datasets than in ancient sequences. In contrast, type 2 transitions represent the vast majority (85%) of the observed nucleotide misincorporations in ancient sequences. Conclusions/Significance This study provides a further contribution to the knowledge of nucleotide misincorporation patterns in DNA sequences obtained from freeze-preserved archeological specimens. In the Iceman system, ancient sequences can be clearly distinguished from contaminants on the basis of nucleotide misincorporation rates. This observation confirms a previous identification of the ancient mummy sequences made on a purely phylogenetical basis. The present investigation provides further indication that the majority of ancient DNA damage is reflected by type 2 (cytosine→thymine/guanine→adenine) transitions and

  4. Genome Hotspots for Nucleotide Substitutions and the Evolution of Influenza A (H1N1) Human Strains.

    PubMed

    Civetta, Alberto; Ostapchuk, David Cecil Murphy; Nwali, Basil

    2016-04-08

    In recent years a number of studies have brought attention to the role of positive selection during the evolution of antigenic escape by influenza strains. Particularly, the identification of positively selected sites within antigenic domains of viral surface proteins has been used to suggest that the evolution of viral-host receptor binding specificity is driven by selection. Here we show that, following the 1918 outbreak, the antigenic sites of the hemagglutinin (HA) viral surface protein and the stalk region of neuraminidase became substitution hotspots. The hotspots show similar patterns of nucleotide substitution bias at synonymous and nonsynonymous sites. Such bias imposes directionality in amino acid replacements that can influence signals of selection at antigenic sites. Our results suggest that the high accumulation of substitutions within the antigenic sites of HA can explain not only cases of antigenic escape by antigenic drift but also lead to occasional episodes of viral extinction. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. Enzymatic Cleavage of Type II Restriction Endonucleases on the 2′-O-Methyl Nucleotide and Phosphorothioate Substituted DNA

    PubMed Central

    Zhao, Guojie; Li, Jun; Tong, Zhaoxue; Zhao, Bin; Mu, Runqing; Guan, Yifu

    2013-01-01

    The effects of nucleotide analogue substitution on the cleavage efficiencies of type II restriction endonucleases have been investigated. Six restriction endonucleases (EcoRV, SpeI, XbaI, XhoI, PstI and SphI) were investigated respectively regarding their cleavage when substrates were substituted by 2′-O-methyl nucleotide (2′-OMeN) and phosphorothioate (PS). Substitutions were made in the recognition sequence and the two nucleotides flanking the recognition sequence for each endonuclease. The endonuclease cleavage efficiencies were determined using FRET-based assay. Results demonstrated a position-dependent inhibitory effect of substitution on the cleavage efficiency for all the six endonucleases. In general, the 2′-OMeN substitutions had greater impact than the PS substitutions on the enzymatic activities. Nucleotides of optimal substitutions for protection against RE cleavage were identified. Experimental results and conclusions in this study facilitate our insight into the DNA-protein interactions and the enzymatic cleavage mechanism, particularly for those whose detailed structure information is not available. In addition, the information could benefit the development of bioengineering and synthetic biology. PMID:24260216

  6. Enzymatic cleavage of type II restriction endonucleases on the 2'-O-methyl nucleotide and phosphorothioate substituted DNA.

    PubMed

    Zhao, Guojie; Li, Jun; Tong, Zhaoxue; Zhao, Bin; Mu, Runqing; Guan, Yifu

    2013-01-01

    The effects of nucleotide analogue substitution on the cleavage efficiencies of type II restriction endonucleases have been investigated. Six restriction endonucleases (EcoRV, SpeI, XbaI, XhoI, PstI and SphI) were investigated respectively regarding their cleavage when substrates were substituted by 2'-O-methyl nucleotide (2'-OMeN) and phosphorothioate (PS). Substitutions were made in the recognition sequence and the two nucleotides flanking the recognition sequence for each endonuclease. The endonuclease cleavage efficiencies were determined using FRET-based assay. Results demonstrated a position-dependent inhibitory effect of substitution on the cleavage efficiency for all the six endonucleases. In general, the 2'-OMeN substitutions had greater impact than the PS substitutions on the enzymatic activities. Nucleotides of optimal substitutions for protection against RE cleavage were identified. Experimental results and conclusions in this study facilitate our insight into the DNA-protein interactions and the enzymatic cleavage mechanism, particularly for those whose detailed structure information is not available. In addition, the information could benefit the development of bioengineering and synthetic biology.

  7. Molecular Evolution of the Small Subunit of Ribulose Bisphosphate Carboxylase: Nucleotide Substitution and Gene Conversion

    PubMed Central

    Meagher, R. B.; Berry-Lowe, S.; Rice, K.

    1989-01-01

    The nucleotide sequences encoding the mature portion of 31 ribulose 1,5-bisphosphate carboxylase small subunit (SSU) genes from 17 genera of plants, green algae and cyanobacteria were examined. Among the 465 pairwise sequence comparisons, SSU multigene family members within the same species were more similar to each other in nonsynonymous or replacement nucleotide substitutions (RNS) than they were to SSU sequences in any other organism. The concerted evolution of independent SSU gene lineages within closely related plant species suggests that homogenization of RNS positions has occurred at least once in the life of each genus. The rate of expected RNS among mature SSU sequences was calculated to be 1.25 X 10(-9)/site/yr for the first 70 million years (MY) of divergence with a significant slowing to 0.13 X 10(-9)/site/yr for the next 1,400 MY. The data suggest that mature SSU sequences do not accumulate more than 20% differences in the RNS positions without compensatory changes in other components of this enzyme system. During the first 70 MY of divergence between species, the rate of expected synonymous or silent nucleotide substitutions (SNS) is ~6.6 X 10(-9)/site/yr. This is five times the RNS rate and is similar to the silent rate observed in animals. In striking contrast, SNS and RNS do not show this correlation among SSU gene family members within a species. A mechanism involving gene conversion within the exons followed by selection for biased gene conversion products with conservation of RNS positions and divergence of SNS positions is discussed. A SSU gene tree based on corrected RNS for 31 SSU sequences is presented and agrees well with a species tree based on morphological and cytogenetic traits for the 17 genera examined. SSU gene comparisons may be useful in predicting phylogenetic relationships and in some cases divergence times of various plant, algal and cyanobacterial species. PMID:2515110

  8. Probing the function of nucleotides in the catalytic cores of the 8-17 and 10-23 DNAzymes by abasic nucleotide and C3 spacer substitutions.

    PubMed

    Wang, Bin; Cao, Liqiang; Chiuman, William; Li, Yingfu; Xi, Zhen

    2010-09-07

    8-17 and 10-23 are the two most comprehensively studied RNA-cleaving DNAzymes to date and have the ability to carry out sequence-specific cleavage of both all-RNA or chimeric RNA/DNA substrates. Mutagenesis studies of 8-17 and 10-23 DNAzymes using alternative natural nucleotides to substitute a given nucleotide in the DNAzyme sequence have found that both DNAzymes are able to tolerate a variety of alterations at many sequence locations. Chemical modification studies employing nucleotides containing nonnatural nucleobases have led to findings that some specific entities of selected nucleobases are irreplaceable by other functional groups. In this work, we set out to carry out a mutagenesis study on both 8-17 and 10-23 by substituting individual nucleotides in their catalytic cores with a baseless (abasic) nucleotide or a baseless/sugarless nucleotide containing only acyclic C3 spacer. We observed that the substitution with an abasic nucleotide or C3 spacer at many locations within the catalytic core of both 8-17 and 10-23 was still able to support a significant level of catalytic activity of each DNAzyme, suggesting that both DNAzymes have considerable structural plasticity to maintain their catalytic functions. We also observed that almost all nucleobases in the catalytic core of each DNAzyme appeared to make either an absolutely essential contribution to the function of each DNAzyme or exhibit a "chaperone-like" activity that is important for the optimal function of each DNAzyme; in contrast, only one sugar ring in 8-17 and four in 10-23 were inferred to make some contribution to the optimal function of the relevant DNAzyme. Finally, our study also raised a possibility that the 10-23 DNAzyme might be a special structural variant of the larger 8-17 DNAzyme family.

  9. Numerical taxonomy of the genus Pestivirus based on palindromic nucleotide substitutions in the 5' untranslated region.

    PubMed

    Giangaspero, Massimo; Harasawa, Ryô

    2007-12-01

    The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5' untranslated region (UTR) of Pestivirus RNA have been considered for taxonomical segregation of species, through the evaluation of 430 genomic sequences. On the basis of qualitative and quantitative secondary structure characteristics, six species have been identified: Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Classical swine fever virus (CSFV), Border disease virus (BDV), the tentative species Giraffe and a new proposed taxon named Pronghorn. The first step was qualitative and consisted in the characterization of the different positions of the three stems and loops in the 5' UTR sequences of all the strains under consideration belonging to the genus. Secondary structure sequences showing divergent base-pair combinations have been aligned for comparison. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low-variable positions (LVP) including base-pairs present in less than 80% of the genus. The second step was quantitative, allowing the identification of genomic groups by clustering the base-pair combinations according to LVP. Relatedness among types was evaluated to identify homogeneous groups. Cross comparisons between types within the genus have been evaluated by computing the divergence percentage thus clarifying borderline and multirelated sequences.

  10. Expanded insecticide catabolic activity gained by a single nucleotide substitution in a bacterial carbamate hydrolase gene.

    PubMed

    Öztürk, Başak; Ghequire, Maarten; Nguyen, Thi Phi Oanh; De Mot, René; Wattiez, Ruddy; Springael, Dirk

    2016-12-01

    Carbofuran-mineralizing strain Novosphingobium sp. KN65.2 produces the CfdJ enzyme that converts the N-methylcarbamate insecticide to carbofuran phenol. Purified CfdJ shows a remarkably low KM towards carbofuran. Together with the carbaryl hydrolase CehA of Rhizobium sp. strain AC100, CfdJ represents a new protein family with several uncharacterized bacterial members outside the proteobacteria. Although both enzymes differ by only four amino acids, CehA does not recognize carbofuran as a substrate whereas CfdJ also hydrolyzes carbaryl. None of the CfdJ amino acids that differ from CehA were shown to be silent regarding carbofuran hydrolytic activity but one particular amino acid substitution, i.e., L152 to F152, proved crucial. CfdJ is more efficient in degrading methylcarbamate pesticides with an aromatic side chain whereas CehA is more efficient in degrading the oxime carbamate nematicide oxamyl. The presence of common flanking sequences suggest that the cfdJ gene is located on a remnant of the mobile genetic element Tnceh carrying cehA. Our results suggest that these enzymes can be acquired through horizontal gene transfer and can evolve to degrade new carbamate substrates by limited amino acid substitutions. We demonstrate that a carbaryl hydrolase can gain the additional capacity to degrade carbofuran by a single nucleotide transversion. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  11. Single nucleotide polymorphism mapping and alignment of recombinant chromosome substitution lines in barley.

    PubMed

    Sato, Kazuhiro; Close, Timothy J; Bhat, Prasanna; Muñoz-Amatriaín, María; Muehlbauer, Gary J

    2011-05-01

    Single nucleotide polymorphism (SNP) genotyping is useful for assessing genetic variation in germplasm collections, genetic map development and detection of alien chromosome substitutions. In this study, a diversity analysis using 1,301 SNPs on a set of 37 barley accessions was conducted. This analysis showed a high polymorphism rate between the malting barley cultivar 'Haruna Nijo' and the food barley cultivar 'Akashinriki'. Haruna Nijo and Akashinriki are donors of the barley expressed sequence tag (EST) collections. A doubled haploid (DH) population derived from the cross between Haruna Nijo and Akashinriki was genotyped with 1,448 SNPs. Of these 1,448 SNPs, 734 were polymorphic and distributed on barley linkage groups (chromosomes) as follows: 1H (86), 2H (125), 3H (120), 4H (100), 5H (127), 6H (88) and 7H (88). By using cMAP, we integrated the SNP markers across high-density maps. The SNPs were also used to genotype 98 BC(3)F(4) recombinant chromosome substitution lines (RCSLs) developed from the same cross (Haruna Nijo/Akashinriki). These data were used to create graphical genotypes for each line and thus estimate the location, extent and total number of introgressions from Akashinriki in the Haruna Nijo background. The 35 selected RCSLs sample most of the Akashinriki food barley genome, with only a few missing segments. These resources bring new alleles into the malting barley gene pool from food barley.

  12. An Aberrant Splice Acceptor Site Due to a Novel Intronic Nucleotide Substitution in MSX1 Gene Is the Cause of Congenital Tooth Agenesis in a Japanese Family

    PubMed Central

    Tatematsu, Tadashi; Kimura, Masashi; Nakashima, Mitsuko; Machida, Junichiro; Yamaguchi, Seishi; Shibata, Akio; Goto, Hiroki; Nakayama, Atsuo; Higashi, Yujiro; Miyachi, Hitoshi; Shimozato, Kazuo; Matsumoto, Naomichi; Tokita, Yoshihito

    2015-01-01

    Congenital tooth agenesis is caused by mutations in the MSX1, PAX9, WNT10A, or AXIN2 genes. Here, we report a Japanese family with nonsyndromic tooth agenesis caused by a novel nucleotide substitution in the intronic region between exons 1 and 2 of the MSX1 gene. Because the mutation is located 9 bp before exon 2 (c.452-9G>A), we speculated that the nucleotide substitution would generate an abnormal splice site. Using cDNA analysis of an immortalized patient blood cell, we confirmed that an additional 7-nucleotide sequence was inserted at the splice junction between exons 1 and 2 (c.451_452insCCCTCAG). The consequent frameshift generated a homeodomain-truncated MSX1 (p.R151fsX20). We then studied the subcellular localization of truncated MSX1 protein in COS cells, and observed that it had a whole cell distribution more than a nuclear localization, compared to that of wild-type protein. This result suggests a deletion of the nuclear localization signal, which is mapped to the MSX1 homeodomain. These results indicate that this novel intronic nucleotide substitution is the cause of tooth agenesis in this family. To date, most MSX1 variants isolated from patients with tooth agenesis involve single amino acid substitutions in the highly conserved homeodomain or deletion mutants caused by frameshift or nonsense mutations. We here report a rare case of an intronic mutation of the MSX1 gene responsible for human tooth agenesis. In addition, the missing tooth patterns were slightly but significantly different between an affected monozygotic twin pair of this family, showing that epigenetic or environmental factors also affect the phenotypic variations of missing teeth among patients with nonsyndromic tooth agenesis caused by an MSX1 haploinsufficiency. PMID:26030286

  13. Asymmetrically reduced expression of hand1 homeologs involving a single nucleotide substitution in a cis-regulatory element.

    PubMed

    Ochi, Haruki; Suzuki, Nanoka; Kawaguchi, Akane; Ogino, Hajime

    2017-03-28

    During vertebrate evolution, whole genome duplications resulted in a number of duplicated genes, some of which eventually changed their expression patterns and/or levels via alteration of cis-regulatory sequences. However, the initial process involved in such cis-regulatory changes remains unclear. Therefore, we investigated this process by analyzing the duplicated hand1 genes of Xenopus laevis (hand1.L and hand1.S), which were generated by allotetraploidization 17-18 million years ago, and compared these with their single ortholog in the ancestral-type diploid species X. tropicalis. A dN/dS analysis indicated that hand1.L and hand1.S are still under purifying selection, and thus, their products appear to retain ancestral functional properties. RNA-seq and in situ hybridization analyses revealed that hand1.L and hand1.S have similar expression patterns to each other and to X. tropicalis hand1, but the hand1.S expression level was much lower than the hand1.L expression level in the primordial heart. A comparative sequence analysis, luciferase reporter analysis, ChIP-PCR analysis, and transgenic reporter analysis showed that a single nucleotide substitution in the hand1.S promoter was responsible for the reduced expression in the heart. These findings demonstrated that a small change in the promoter sequence can trigger diversification of duplicated gene expression prior to diversification of their encoded protein functions in a young duplicated genome.

  14. Dopa-responsive dystonia: functional analysis of single nucleotide substitutions within the 5' untranslated GCH1 region.

    PubMed

    Armata, Ioanna A; Balaj, Leonora; Kuster, John K; Zhang, Xuan; Tsai, Shelun; Armatas, Andreas A; Multhaupt-Buell, Trisha J; Soberman, Roy; Breakefield, Xandra O; Ichinose, Hiroshi; Sharma, Nutan

    2013-01-01

    Mutations in the GCH1 gene are associated with childhood onset, dopa-responsive dystonia (DRD). Correct diagnosis of DRD is crucial, given the potential for complete recovery once treated with L-dopa. The majority of DRD associated mutations lie within the coding region of the GCH1 gene, but three additional single nucleotide sequence substitutions have been reported within the 5' untranslated (5'UTR) region of the mRNA. The biologic significance of these 5'UTR GCH1 sequence substitutions has not been analyzed. Luciferase reporter assays, quantitative real time PCR and RNA decay assays, combined with bioinformatics, revealed a pathogenic 5'UTR GCH1 substitution. The +142C>T single nucleotide 5'UTR substitution that segregates with affected status in DRD patients, substantially attenuates translation without altering RNA expression levels or stability. The +142C>T substitution disrupts translation most likely by creating an upstream initiation start codon (uAUG) and an upstream open reading frame (uORF). This is the first GCH1 regulatory substitution reported to act at a post-transcriptional level, increasing the list of genetic diseases caused by abnormal translation and reaffirming the importance of investigating potential regulatory substitutions in genetic diseases.

  15. Evolutionary patterns of amino acid substitutions in 12 Drosophila genomes

    PubMed Central

    2010-01-01

    Background Harnessing vast amounts of genomic data in phylogenetic context stemming from massive sequencing of multiple closely related genomes requires new tools and approaches. We present a tool for the genome-wide analysis of frequencies and patterns of amino acid substitutions in multiple alignments of genes’ coding regions, and a database of amino acid substitutions in the phylogeny of 12 Drosophila genomes. We illustrate the use of these resources to address three types of evolutionary genomics questions: about fluxes in amino acid composition in proteins, about asymmetries in amino acid substitutions and about patterns of molecular evolution in duplicated genes. Results We demonstrate that amino acid composition of Drosophila proteins underwent a significant shift over the last 70 million years encompassed by the studied phylogeny, with less common amino acids (Cys, Met, His) increasing in frequency and more common ones (Ala, Leu, Glu) becoming less frequent. These fluxes are strongly correlated with polarity of source and destination amino acids, resulting in overall systematic decrease of mean polarity of amino acids found in Drosophila proteins. Frequency and radicality of amino acid substitutions are higher in paralogs than in orthologous single-copy genes and are higher in gene families with paralogs than in gene families without surviving duplications. Rate and radicality of substitutions, as expected, are negatively correlated with overall level and uniformity of gene expression. However, these correlations are not observed for substitutions occurring in duplicated genes, indicating a different selective constraint on the evolution of paralogous sequences. Clades resulting from duplications show a marked asymmetry in rate and radicality of amino acid substitutions, possibly a signal of widespread neofunctionalization. These patterns differ among protein families of different functionality, with genes coding for RNA-binding proteins differing from

  16. The distribution of fitness effects caused by single-nucleotide substitutions in an RNA virus

    PubMed Central

    Sanjuán, Rafael; Moya, Andrés; Elena, Santiago F.

    2004-01-01

    Little is known about the mutational fitness effects associated with single-nucleotide substitutions on RNA viral genomes. Here, we used site-directed mutagenesis to create 91 single mutant clones of vesicular stomatitis virus derived from a common ancestral cDNA and performed competition experiments to measure the relative fitness of each mutant. The distribution of nonlethal deleterious effects was highly skewed and had a long, flat tail. As expected, fitness effects depended on whether mutations were chosen at random or reproduced previously described ones. The effect of random deleterious mutations was well described by a log-normal distribution, with -19% reduction of average fitness; the effects distribution of preobserved deleterious mutations was better explained by a β model. The fit of both models was improved when combined with a uniform distribution. Up to 40% of random mutations were lethal. The proportion of beneficial mutations was unexpectedly high. Beneficial effects followed a γ distribution, with expected fitness increases of 1% for random mutations and 5% for preobserved mutations. PMID:15159545

  17. Deblur Rapidly Resolves Single-Nucleotide Community Sequence Patterns

    PubMed Central

    Amir, Amnon; McDonald, Daniel; Navas-Molina, Jose A.; Kopylova, Evguenia; Morton, James T.; Zech Xu, Zhenjiang; Kightley, Eric P.; Thompson, Luke R.; Hyde, Embriette R.; Gonzalez, Antonio

    2017-01-01

    ABSTRACT High-throughput sequencing of 16S ribosomal RNA gene amplicons has facilitated understanding of complex microbial communities, but the inherent noise in PCR and DNA sequencing limits differentiation of closely related bacteria. Although many scientific questions can be addressed with broad taxonomic profiles, clinical, food safety, and some ecological applications require higher specificity. Here we introduce a novel sub-operational-taxonomic-unit (sOTU) approach, Deblur, that uses error profiles to obtain putative error-free sequences from Illumina MiSeq and HiSeq sequencing platforms. Deblur substantially reduces computational demands relative to similar sOTU methods and does so with similar or better sensitivity and specificity. Using simulations, mock mixtures, and real data sets, we detected closely related bacterial sequences with single nucleotide differences while removing false positives and maintaining stability in detection, suggesting that Deblur is limited only by read length and diversity within the amplicon sequences. Because Deblur operates on a per-sample level, it scales to modern data sets and meta-analyses. To highlight Deblur’s ability to integrate data sets, we include an interactive exploration of its application to multiple distinct sequencing rounds of the American Gut Project. Deblur is open source under the Berkeley Software Distribution (BSD) license, easily installable, and downloadable from https://github.com/biocore/deblur. IMPORTANCE Deblur provides a rapid and sensitive means to assess ecological patterns driven by differentiation of closely related taxa. This algorithm provides a solution to the problem of identifying real ecological differences between taxa whose amplicons differ by a single base pair, is applicable in an automated fashion to large-scale sequencing data sets, and can integrate sequencing runs collected over time. PMID:28289731

  18. From single nucleotide substitutions up to chromosomal deletions: genetic pause of leucism-associated disorders in animals.

    PubMed

    Fleck, Katharina; Erhardt, Georg; Lühken, Gesine

    2016-01-01

    Leucism is characterized by a complete or partial white skin and hair in combination with pigmented irides, which can be vivid blue or heterochromatic. This is due to a complete or partial lack of melanocytes. The underlying pathogenesis is a disturbed emigration or differentiation of neural crest-derived cells. Therefore, leucistic phenotypes can be associated with defects, which mainly impair sensory organs and nerves. In humans, a well-known example is the Waardenburg syndrome. Leucism-associated disorders were also described in mouse, rat, hamster, rabbit, mink, cat, dog, pig, sheep, llama, alpaca, cattle and horse. In some of these species already identified causal mutations affect the genes EDN3, EDNRB, KIT, MITF, PAX3, SILV and SOX10. Defect alleles represent different types of genetic variation, ranging from single nucleotide substitutions up to larger chromosomal deletions. Some of the defect alleles produce desired coat color patterns. In some but not all cases, available genetic tests enable breeders to avoid production of animals affected by a leucism-associated disorder.

  19. Species characterization in the genus Pestivirus according to palindromic nucleotide substitutions in the 5'-untranslated region.

    PubMed

    Giangaspero, Massimo; Harasawa, Ryô

    2011-06-01

    The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5'-untranslated region (UTR) of the Pestivirus genome have been considered for taxonomical segregation of the species, through the evaluation of 534 strains. On the basis of qualitative and quantitative secondary structure characteristics, species have been identified within the genus, determining genetic distances between species isolates, clarifying borderline and multirelated sequences, and characterizing and clustering the Pestivirus strains showing unexpected genomic sequences. Nine genomic groups have been identified: the species Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Border disease virus (BDV) and Classical swine fever virus (CSFV) and the tentative species Pronghorn, Giraffe, Bovine viral diarrhea virus 3 (BVDV-3) (HoBi group), Border disease virus 2 (BDV-2) (Italian small ruminant isolates) and Bungowannah. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low variable positions (LVP) including base-pairs present in less than 80% of the genus. The determination of divergence between single strain sequences or genetic groups was obtained easily by comparing base-pairing combinations from aligned secondary structures. This provided clear information such as the level of heterogeneity within a species, the relatedness between species, or facilitating the characterization and clustering of specific strains. The BVDV-1 and BDV species resulted heterogeneous, showing isolates located on a borderline in the species. Within the BVDV-2 species, two main genogroups were identified, with strains showing common sequence characteristics to both groups (multirelated strains). They could be allocated correctly by quantitative analysis. Similarly, the relation between CSFV and BDV species appeared very clearly. Also in this case, ambiguous strain sequences could be clustered in the

  20. Single nucleotide polymorphisms of pattern recognition receptors and chronic periodontitis.

    PubMed

    Sahingur, S E; Xia, X-J; Gunsolley, J; Schenkein, H A; Genco, R J; De Nardin, E

    2011-04-01

    Periodontitis is a multifactorial disease influenced partly by genetics. Activation of pattern recognition receptors (PRRs) can lead to the up-regulation of inflammatory pathways, resulting in periodontal tissue destruction. Hence, functional polymorphisms located in PRRs can explain differences in host susceptibility to periodontitis. This study investigated single nucleotide polymorphisms of PRRs including toll-like receptor (TLR)2 (G2408A), TLR4 (A896G), TLR9 (T1486C), TLR9 (T1237C) and CD14 (C260T) in patients with chronic periodontitis and in periodontally healthy subjects. One-hundred and fourteen patients with chronic periodontitis and 77 periodontally healthy subjects were genotyped using TaqMan® allelic discrimination assays. Fisher's exact test and chi-square analyses were performed to compare genotype and allele frequencies. The frequency of subjects with the CC genotype of CD14 (C260T) (24.6% in the chronic periodontitis group vs. 13% in the periodontally healthy group) and those expressing the T allele of CD14 (C260T) (CT and TT) (75.4% in the chronic periodontitis group vs. 87% in the periodontally healthy group) was statistically different among groups (p = 0.04). Homozygocity for the C allele of the CD14 (C260T) polymorphism (CC) was associated with a two--fold increased susceptibility to periodontitis (p = 0.04; odds ratio, 2.49; 95% confidence interval, 1.06-6.26). Individuals with the CC genotype of TLR9 (T1486C) (14.9% in the chronic periodontitis group vs. 28.6% in the periodontally healthy group) and those expressing the T allele of TLR9 (T1486C) (CT and TT) (85.1% in the chronic periodontitis group vs. 71.4% in the periodontally healthy group) were also significantly differently distributed between groups without adjustment (p = 0.03). Further analysis of nonsmokers revealed a significant difference in the distribution of genotypes between groups for TLR9 (T1486C; p = 0.017) and CD14 (C260T; p = 0.03), polymorphisms again without adjustment

  1. An Efficient Pattern Substitution Watermarking Method for Binary Images

    NASA Astrophysics Data System (ADS)

    Dong, Keming; Kim, Hyoung-Joong

    In this paper, a method to decrease the size of location map for non-overlapping pattern substitution method is presented. Original pattern substitution (PS) method has been proposed by Ho et al.[1] as a reversible watermarking scheme for binary images. They use a pair of two patterns to embed data. Unfortunately, their location map is huge in size. In our method, we propose an efficient mechanism which can decrease the size of location map considerably for un-overlapping version of the PS method. Experiment results show that our method works well on decreasing the size of location map. Comparison results with the original PS method demonstrate that the proposed method achieves more embedding capacity and higher PSNR value due to the reduced size of the location map.

  2. Transient suppression of MLH1 allows effective single-nucleotide substitution by single-stranded DNA oligonucleotides.

    PubMed

    Dekker, Marleen; de Vries, Sandra; Aarts, Marieke; Dekker, Robert; Brouwers, Conny; Wiebenga, Oliver; de Wind, Niels; Cantelli, Erika; Tonelli, Roberto; Te Riele, Hein

    2011-10-01

    Short synthetic single-stranded oligodeoxyribonucleotides (ssODNs) can be used to introduce subtle modifications into the genome of mouse embryonic stem cells (ESCs). We have previously shown that effective application of ssODN-mediated gene targeting in ESC requires (transient) suppression of DNA mismatch repair (MMR). However, whereas transient down-regulation of the mismatch recognition protein MSH2 allowed substitution of 3 or 4 nucleotides, 1 or 2 nucleotide substitutions were still suppressed. We now demonstrate that single- or dinucleotide substitution can effectively be achieved by transient down-regulation of the downstream MMR protein MLH1. By exploiting highly specific real-time PCR, we demonstrate the feasibility of substituting a single basepair in a non-selectable gene. However, disabling the MMR machinery may lead to inadvertent mutations. To obtain insight into the mutation rate associated with transient MMR suppression, we have compared the impact of transient and constitutive MMR deficiency on the repair of frameshift intermediates at mono- and dinucleotide repeats. Repair at these repeats relied on the substrate specificity and functional redundancy of the MSH2/MSH6 and MSH2/MSH3 MMR complexes. MLH1 knockdown increased the level of spontaneous mutagenesis, but modified ESCs remained germ line competent. Thus, transient MLH1 suppression provides a valuable extension of the MSH2 knockdown strategy, allowing rapid generation of mice carrying single basepair alterations in their genome.

  3. Concurrent nucleotide substitution mutations in the human genome are characterized by a significantly decreased transition/transversion ratio.

    PubMed

    Zhu, Wenjuan; Cooper, David N; Zhao, Qiang; Wang, Ye; Liu, Ruihong; Li, Qibin; Férec, Claude; Wang, Yiming; Chen, Jian-Min

    2015-03-01

    There is accumulating evidence that the number of multiple-nucleotide substitutions (MNS) occurring in closely spaced sites in eukaryotic genomes is significantly higher than would be predicted from the random accumulation of independently generated single-nucleotide substitutions (SNS). Although this excess can in principle be accounted for by the concept of transient hypermutability, a general mutational signature of concurrent MNS mutations has not so far been evident. Employing a dataset (N = 449) of "concurrent" double MNS mutations causing human inherited disease, we have identified just such a mutational signature: concurrently generated double MNS mutations exhibit a >twofold lower transition/transversion ratio (termed RTs/Tv ) than independently generated de novo SNS mutations (<0.80 vs. 2.10; P = 2.69 × 10(-14) ). We replicated this novel finding through a similar analysis employing two double MNS variant datasets with differing abundances of concurrent events (150,521 variants with both substitutions on the same haplotypic lineage vs. 94,875 variants whose component substitutions were on different haplotypic lineages) plus 5,430,874 SNS variants, all being derived from the whole-genome sequencing of seven Chinese individuals. Evaluation of the newly observed mutational signature in diverse contexts provides solid support for the postulated role of translesion synthesis DNA polymerases in transient hypermutability.

  4. Taxonomy of genus Hepacivirus. Application of palindromic nucleotide substitutions for the determination of genotypes of human hepatitis C virus species.

    PubMed

    Giangaspero, M; Harasawa, R; Zanetti, A

    2008-11-01

    The palindromic nucleotide substitutions (PNS) in the 5'-untranslated region (UTR) of Pestivirus RNA have been described as a new, simple and practical method for genotyping. Given the genetic relatedness between Pestivirus and hepatitis C virus species, the application of the method was investigated preliminarily on 180 isolates, including reference strains. The keys for hepatitis C virus identification have been determined at the genus, species, genotype and subtype levels. Secondary structure nucleotide substitutions were characteristics to the genus included in a complex stem-loop structure composed of 112-115 nucleotides. Due to the worldwide importance of hepatitis C virus, and the difficulties encountered in the control of the disease, it is, therefore, important to understand the genetic aspects of the virus. The application of the PNS method might represent an additional useful tool for determining the genetic variations among hepatitis C virus strains. The identification of viral types or subtypes based on genetic changes should improve our understanding of hepatitis C virus and might provide markers for biological differences, such as virulence, and improve understanding of the evolution of the virus.

  5. Substitution patterns are GC-biased in divergent sequences across the metazoans.

    PubMed

    Capra, John A; Pollard, Katherine S

    2011-01-01

    The fastest-evolving regions in the human and chimpanzee genomes show a remarkable excess of weak (A,T) to strong (G,C) nucleotide substitutions since divergence from their common ancestor. We investigated the phylogenetic extent and possible causes of this weak to strong (W → S) bias in divergent sequences (BDS) using recently sequenced genomes and recombination maps from eight trios of eukaryotic species. To quantify evidence for BDS, we inferred substitution histories using an efficient maximum likelihood approach with a context-dependent evolutionary model. We then annotated all lineage-specific substitutions in terms of W → S bias and density on the chromosomes. Finally, we used the inferred substitutions to calculate a BDS score-a log odds ratio between substitution type and density-and assessed its statistical significance with Fisher's exact test. Applying this approach, we found significant BDS in the coding and noncoding sequence of human, mouse, dog, stickleback, fruit fly, and worm. We also observed a significant lack of W → S BDS in chicken and yeast. The BDS score varies between species and across the chromosomes within each species. It is most strongly correlated with different genomic features in different species, but a strong correlation with recombination rates is found in several species. Our results demonstrate that a W → S substitution bias in fast-evolving sequences is a widespread phenomenon. The patterns of BDS observed suggest that a recombination-associated process, such as GC-biased gene conversion, is involved in the production of the bias in many species, but the strength of the BDS likely depends on many factors, including genome stability, variability in recombination rate over time and across the genome, the frequency of meiosis, and the amount of outcrossing in each species.

  6. ModelTest Server: a web-based tool for the statistical selection of models of nucleotide substitution online.

    PubMed

    Posada, David

    2006-07-01

    ModelTest server is a web-based application for the selection of models of nucleotide substitution using the program ModelTest. The server takes as input a text file with likelihood scores for the set of candidate models. Models can be selected with hierarchical likelihood ratio tests, or with the Akaike or Bayesian information criteria. The output includes several statistics for the assessment of model selection uncertainty, for model averaging or to estimate the relative importance of model parameters. The server can be accessed at http://darwin.uvigo.es/software/modeltest_server.html.

  7. ModelTest Server: a web-based tool for the statistical selection of models of nucleotide substitution online

    PubMed Central

    Posada, David

    2006-01-01

    ModelTest server is a web-based application for the selection of models of nucleotide substitution using the program ModelTest. The server takes as input a text file with likelihood scores for the set of candidate models. Models can be selected with hierarchical likelihood ratio tests, or with the Akaike or Bayesian information criteria. The output includes several statistics for the assessment of model selection uncertainty, for model averaging or to estimate the relative importance of model parameters. The server can be accessed at . PMID:16845102

  8. The chlorophyll-deficient golden leaf mutation in cucumber is due to a single nucleotide substitution in CsChlI for magnesium chelatase I subunit.

    PubMed

    Gao, Meiling; Hu, Liangliang; Li, Yuhong; Weng, Yiqun

    2016-10-01

    The cucumber chlorophyll-deficient golden leaf mutation is due to a single nucleotide substitution in the CsChlI gene for magnesium chelatase I subunit which plays important roles in the chlorophyll biosynthesis pathway. The Mg-chelatase catalyzes the insertion of Mg(2+) into the protoporphyrin IX in the chlorophyll biosynthesis pathway, which is a protein complex encompassing three subunits CHLI, CHLD, and CHLH. Chlorophyll-deficient mutations in genes encoding the three subunits have played important roles in understanding the structure, function and regulation of this important enzyme. In an EMS mutagenesis population, we identified a chlorophyll-deficient mutant C528 with golden leaf color throughout its development which was viable and able to set fruits and seeds. Segregation analysis in multiple populations indicated that this leaf color mutation was recessively inherited and the green color showed complete dominance over golden color. Map-based cloning identified CsChlI as the candidate gene for this mutation which encoded the CHLI subunit of cucumber Mg-chelatase. The 1757-bp CsChlI gene had three exons and a single nucleotide change (G to A) in its third exon resulted in an amino acid substitution (G269R) and the golden leaf color in C528. This mutation occurred in the highly conserved nucleotide-binding domain of the CHLI protein in which chlorophyll-deficient mutations have been frequently identified. The mutant phenotype, CsChlI expression pattern and the mutated residue in the CHLI protein suggested the mutant allele in C528 is unique among mutations identified so far in different species. This golden leaf mutant not only has its potential in cucumber breeding, but also provides a useful tool in understanding the CHLI function and its regulation in the chlorophyll biosynthesis pathway as well as chloroplast development.

  9. Numerical taxonomy of the genus Pestivirus: new software for genotyping based on the palindromic nucleotide substitutions method.

    PubMed

    Giangaspero, Massimo; Apicella, Claudio; Harasawa, Ryô

    2013-09-01

    The genus Pestivirus from the family Flaviviridae is represented by four established species; Bovine viral diarrhea virus 1 (BVDV-1); Bovine viral diarrhea virus 2 (BVDV-2); Border disease virus (BDV); and Classical swine fever virus (CSFV); as well a tentative species from a Giraffe. The palindromic nucleotide substitutions (PNS) in the 5' untranslated region (UTR) of Pestivirus RNA has been described as a new, simple and practical method for genotyping. New software is described, also named PNS, that was prepared specifically for this PNS genotyping procedure. Pestivirus identification using PNS was evaluated on five hundred and forty-three sequences at genus, species and genotype level using this software. The software is freely available at www.pns-software.com.

  10. Nucleotide substitution type dependence of generation time effect of molecular evolution.

    PubMed

    Kisakibaru, Y; Matsuda, H

    1995-06-01

    Using DNA sequence data of 18 genes from 14 mammals, we analyzed how the average molecular evolution rate per year per site (Vy) depends on the generation time (g). (I) Assuming the relation Vy varies; is directly proportional to g(-alpha), the index of generation time effect, (alpha) was estimated to be about 0.14 for amino acid replacement substitutions (A), and about 0.32 for synonymous substitutions (S). (II) Assuming the relation Vy = V(m)g g-1 + V(e)y, where V(m)g and V(e)y are constant independent of g, the fraction, r(e) = V(e)y/Vy, of the mutation rate independent part (V(e)y) in the total evolution rate (Vy) was estimated under the assumptions of the star phylogeny and the constancy of the mutation rate per generation. r(e) was smallest for mouse with the shortest generation time among our analyzed species, and it was estimated to be about 0.57 for A and 0.31 for S. Both results do not support the view that Vy is equal to the neutral mutation rate per site both for A and for S. They are in line with the thesis that, at least for A and probably even for S, the molecular evolution rate is influenced by some causes other than the mutation rate, such as changing environment.

  11. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    PubMed

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  12. Testing evolutionary models to explain the process of nucleotide substitution in gut bacterial 16S rRNA gene sequences.

    PubMed

    Garcia-Mazcorro, Jose F

    2013-09-01

    The 16S rRNA gene has been widely used as a marker of gut bacterial diversity and phylogeny, yet we do not know the model of evolution that best explains the differences in its nucleotide composition within and among taxa. Over 46 000 good-quality near-full-length 16S rRNA gene sequences from five bacterial phyla were obtained from the ribosomal database project (RDP) by study and, when possible, by within-study characteristics (e.g. anatomical region). Using alignments (RDPX and MUSCLE) of unique sequences, the FINDMODEL tool available at http://www.hiv.lanl.gov/ was utilized to find the model of character evolution (28 models were available) that best describes the input sequence data, based on the Akaike information criterion. The results showed variable levels of agreement (from 33% to 100%) in the chosen models between the RDP-based and the MUSCLE-based alignments among the taxa. Moreover, subgroups of sequences (using either alignment method) from the same study were often explained by different models. Nonetheless, the different representatives of the gut microbiota were explained by different proportions of the available models. This is the first report using evolutionary models to explain the process of nucleotide substitution in gut bacterial 16S rRNA gene sequences. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  13. Deficient nucleotide excision repair increases base-pair substitutions but decreases TGGC frameshifts induced by methylglyoxal in Escherichia coli.

    PubMed

    Murata-Kamiya, N; Kaji, H; Kasai, H

    1999-06-07

    To investigate the mutation spectrum of a well-known mutagen, methylglyoxal, and the influence of nucleotide excision repair (NER) on methylglyoxal-induced mutations, we treated wild-type and NER-deficient (uvrA or uvrC) Escherichia coli strains with methylglyoxal, and analyzed mutations in the chromosomal lacI gene. In the three strains, the cell death and the mutation frequency increased according to the dose of methylglyoxal added to the culture medium. The frequencies of methylglyoxal-induced base-pair substitutions were higher in the NER-deficient strains than in the wild-type strain, in the presence and absence of mucAB gene. Paradoxically, the frequency of methylglyoxal-induced TGGC frameshifts was higher in the wild-type strain than in the NER-deficient strains. When the methylglyoxal-induced mutation spectra in the presence and absence of mucAB gene are compared, the ratios of base-pair substitutions to frameshifts were increased by the effects of mucAB gene. In the three strains, more than 75% of the base-pair substitutions occurred at G:C sites, independent of the mucAB gene. When the mucAB gene was present, G:C-->T:A transversions were predominant, followed by G:C-->A:T transitions. When the mucAB gene was absent, the predominant mutations differed in the three strains: in the wild-type and uvrC strains, G:C-->A:T transitions were predominant, followed by G:C-->T:A transversions, while in the uvrA strains, G:C-->T:A transversions were predominant, followed by G:C-->A:T transitions. These results suggest that NER may be involved in both the repair and the fixation of methylglyoxal-induced mutations.

  14. Analysis of differences in amino acid substitution patterns, using multilevel G-tests.

    PubMed

    Pacholczyk, Marcin; Kimmel, Marek

    2005-07-01

    In this paper, a new algorithm is presented, which makes possible multilevel comparison of BLOSUM protein substitution matrices based on data from different groups of organisms. As an example, a comparison between substitution matrices based on data from two groups of bacterial genomes with different GC content is presented. Our approach includes evaluating the number of amino acid pairs in BLOCKS databases created separately for the two groups of bacteria using protein sequences deposited in the COG database. Differences of distributions of amino acid pair counts are tested using the chi-squared based G-test. Different analysis levels make it possible to distinguish different patterns of amino acid substitution. Application of the algorithm reveals statistically significant differences in amino acid substitution patterns between AT-rich and GC-rich groups of bacterial organisms. The differences are particularly visible in the overall substitution pattern, amino acid conservation pattern and in comparison of substitution patterns for single amino acids. The algorithm presented in this paper can be considered a novel method for multi-level comparison of amino acid substitution patterns. The presented approach is not limited to bacterial organisms and BLOSUM substitution matrices. Statistically significant differences between substitution patterns in the two groups of bacterial organisms with respect to amino acid conservation pattern can be the evidence of different rate of evolutionary change between AT-rich and GC-rich bacterial organisms.

  15. Influence of mandatory generic substitution on pharmaceutical sales patterns: a national study over five years.

    PubMed

    Andersson, Karolina A; Petzold, Max G; Allebeck, Peter; Carlsten, Anders

    2008-02-29

    Mandatory generic substitution was introduced in Sweden in October 2002 in order to try to curb escalating pharmaceutical expenditure. The aim of this study was to investigate how sales patterns for substitutable and non-substitutable pharmaceuticals have developed since the introduction of mandatory generic substitution; furthermore, to compare sales patterns in different groups of the population, based on patients' age and gender. Five therapeutic groups comprising both substitutable and non-substitutable pharmaceuticals were included. The study period was from January 2000 to June 2005. National sales data were used, covering volumes of dispensed prescription medicines (expressed in defined daily doses per 1000 inhabitants and day) of each pharmacological substance in the therapeutic groups for each age and gender group. Sales patterns for substitutable and non-substitutable pharmaceuticals were compared using a descriptive approach. In most therapeutic groups there has been an increase in the volumes of substitutable pharmaceuticals sold since the introduction of the reform, ranging from one third to three times the initial volume; whereas the volumes of non-substitutable pharmaceuticals have levelled out or declined. There were few gender differences in sales patterns of substitutable and non-substitutable drugs. In three therapeutic groups, sales patterns differed across different age groups, and there was a tendency for volumes of recently introduced non-substitutable pharmaceuticals to be proportionally higher in the youngest age groups. Since the introduction of the reform, there has been a proportionally larger increase in sales of substitutable pharmaceuticals compared with sales of non-substitutable pharmaceuticals. This indicates that the reform might have contributed to larger sales of less expensive pharmaceuticals.

  16. Mixture models of nucleotide sequence evolution that account for heterogeneity in the substitution process across sites and across lineages.

    PubMed

    Jayaswal, Vivek; Wong, Thomas K F; Robinson, John; Poladian, Leon; Jermiin, Lars S

    2014-09-01

    Molecular phylogenetic studies of homologous sequences of nucleotides often assume that the underlying evolutionary process was globally stationary, reversible, and homogeneous (SRH), and that a model of evolution with one or more site-specific and time-reversible rate matrices (e.g., the GTR rate matrix) is enough to accurately model the evolution of data over the whole tree. However, an increasing body of data suggests that evolution under these conditions is an exception, rather than the norm. To address this issue, several non-SRH models of molecular evolution have been proposed, but they either ignore heterogeneity in the substitution process across sites (HAS) or assume it can be modeled accurately using the distribution. As an alternative to these models of evolution, we introduce a family of mixture models that approximate HAS without the assumption of an underlying predefined statistical distribution. This family of mixture models is combined with non-SRH models of evolution that account for heterogeneity in the substitution process across lineages (HAL). We also present two algorithms for searching model space and identifying an optimal model of evolution that is less likely to over- or underparameterize the data. The performance of the two new algorithms was evaluated using alignments of nucleotides with 10 000 sites simulated under complex non-SRH conditions on a 25-tipped tree. The algorithms were found to be very successful, identifying the correct HAL model with a 75% success rate (the average success rate for assigning rate matrices to the tree's 48 edges was 99.25%) and, for the correct HAL model, identifying the correct HAS model with a 98% success rate. Finally, parameter estimates obtained under the correct HAL-HAS model were found to be accurate and precise. The merits of our new algorithms were illustrated with an analysis of 42 337 second codon sites extracted from a concatenation of 106 alignments of orthologous genes encoded by the nuclear

  17. Nucleotide diversity patterns of local adaptation at drought-related candidate genes in wild tomatoes.

    PubMed

    Xia, Hui; Camus-Kulandaivelu, Létizia; Stephan, Wolfgang; Tellier, Aurélien; Zhang, Zhenwen

    2010-10-01

    We surveyed nucleotide diversity at two candidate genes LeNCED1 and pLC30-15, involved in an ABA (abscisic acid) signalling pathway, in two closely related tomato species Solanum peruvianum and Solanum chilense. Our six population samples (three for each species) cover a range of mesic to very dry habitats. The ABA pathway plays an important role in the plants' response to drought stress. LeNCED1 is an upstream gene involved in ABA biosynthesis, and pLC30-15 is a dehydrin gene positioned downstream in the pathway. The two genes show very different patterns of nucleotide variation. LeNCED1 exhibits very low nucleotide diversity relative to the eight neutral reference loci that were previously surveyed in these populations. This suggests that strong purifying selection has been acting on this gene. In contrast, pLC30-15 exhibits higher levels of nucleotide diversity and, in particular in S. chilense, higher genetic differentiation between populations than the reference loci, which is indicative of local adaptation. In the more drought-tolerant species S. chilense, one population (from Quicacha) shows a significant haplotype structure, which appears to be the result of positive (diversifying) selection.

  18. PatMatch: a program for finding patterns in peptide and nucleotide sequences

    PubMed Central

    Yan, Thomas; Yoo, Danny; Berardini, Tanya Z.; Mueller, Lukas A.; Weems, Dan C.; Weng, Shuai; Cherry, J. Michael; Rhee, Seung Y.

    2005-01-01

    Here, we present PatMatch, an efficient, web-based pattern-matching program that enables searches for short nucleotide or peptide sequences such as cis-elements in nucleotide sequences or small domains and motifs in protein sequences. The program can be used to find matches to a user-specified sequence pattern that can be described using ambiguous sequence codes and a powerful and flexible pattern syntax based on regular expressions. A recent upgrade has improved performance and now supports both mismatches and wildcards in a single pattern. This enhancement has been achieved by replacing the previous searching algorithm, scan_for_matches [D'Souza et al. (1997), Trends in Genetics, 13, 497–498], with nondeterministic-reverse grep (NR-grep), a general pattern matching tool that allows for approximate string matching [Navarro (2001), Software Practice and Experience, 31, 1265–1312]. We have tailored NR-grep to be used for DNA and protein searches with PatMatch. The stand-alone version of the software can be adapted for use with any sequence dataset and is available for download at The Arabidopsis Information Resource (TAIR) at . The PatMatch server is available on the web at for searching Arabidopsis thaliana sequences. PMID:15980466

  19. Visible Light-Responsive Platinum-Containing Titania Nanoparticle-Mediated Photocatalysis Induces Nucleotide Insertion, Deletion and Substitution Mutations

    PubMed Central

    Sun, Der-Shan; Tseng, Yao-Hsuan; Wu, Wen-Shiang; Wong, Ming-Show; Chang, Hsin-Hou

    2016-01-01

    Conventional photocatalysts are primarily stimulated using ultraviolet (UV) light to elicit reactive oxygen species and have wide applications in environmental and energy fields, including self-cleaning surfaces and sterilization. Because UV illumination is hazardous to humans, visible light-responsive photocatalysts (VLRPs) were discovered and are now applied to increase photocatalysis. However, fundamental questions regarding the ability of VLRPs to trigger DNA mutations and the mutation types it elicits remain elusive. Here, through plasmid transformation and β-galactosidase α-complementation analyses, we observed that visible light-responsive platinum-containing titania (TiO2) nanoparticle (NP)-mediated photocatalysis considerably reduces the number of Escherichia coli transformants. This suggests that such photocatalytic reactions cause DNA damage. DNA sequencing results demonstrated that the DNA damage comprises three mutation types, namely nucleotide insertion, deletion and substitution; this is the first study to report the types of mutations occurring after photocatalysis by TiO2-VLRPs. Our results may facilitate the development and appropriate use of new-generation TiO2 NPs for biomedical applications. PMID:28336836

  20. Visible Light-Responsive Platinum-Containing Titania Nanoparticle-Mediated Photocatalysis Induces Nucleotide Insertion, Deletion and Substitution Mutations.

    PubMed

    Sun, Der-Shan; Tseng, Yao-Hsuan; Wu, Wen-Shiang; Wong, Ming-Show; Chang, Hsin-Hou

    2016-12-28

    Conventional photocatalysts are primarily stimulated using ultraviolet (UV) light to elicit reactive oxygen species and have wide applications in environmental and energy fields, including self-cleaning surfaces and sterilization. Because UV illumination is hazardous to humans, visible light-responsive photocatalysts (VLRPs) were discovered and are now applied to increase photocatalysis. However, fundamental questions regarding the ability of VLRPs to trigger DNA mutations and the mutation types it elicits remain elusive. Here, through plasmid transformation and β-galactosidase α-complementation analyses, we observed that visible light-responsive platinum-containing titania (TiO₂) nanoparticle (NP)-mediated photocatalysis considerably reduces the number of Escherichia coli transformants. This suggests that such photocatalytic reactions cause DNA damage. DNA sequencing results demonstrated that the DNA damage comprises three mutation types, namely nucleotide insertion, deletion and substitution; this is the first study to report the types of mutations occurring after photocatalysis by TiO₂-VLRPs. Our results may facilitate the development and appropriate use of new-generation TiO₂ NPs for biomedical applications.

  1. Temporal Patterns of Nucleotide Misincorporations and DNA Fragmentation in Ancient DNA

    PubMed Central

    Sawyer, Susanna; Krause, Johannes; Guschanski, Katerina; Savolainen, Vincent; Pääbo, Svante

    2012-01-01

    DNA that survives in museum specimens, bones and other tissues recovered by archaeologists is invariably fragmented and chemically modified. The extent to which such modifications accumulate over time is largely unknown but could potentially be used to differentiate between endogenous old DNA and present-day DNA contaminating specimens and experiments. Here we examine mitochondrial DNA sequences from tissue remains that vary in age between 18 and 60,000 years with respect to three molecular features: fragment length, base composition at strand breaks, and apparent C to T substitutions. We find that fragment length does not decrease consistently over time and that strand breaks occur preferentially before purine residues by what may be at least two different molecular mechanisms that are not yet understood. In contrast, the frequency of apparent C to T substitutions towards the 5′-ends of molecules tends to increase over time. These nucleotide misincorporations are thus a useful tool to distinguish recent from ancient DNA sources in specimens that have not been subjected to unusual or harsh treatments. PMID:22479540

  2. Multilocus patterns of nucleotide polymorphism and demographic change in Taxodium distichum (Cupressaceae) in the lower Mississippi River alluvial valley

    USGS Publications Warehouse

    Kusumi, Junko; Zidong, Li; Kado, Tomoyuki; Tsumura, Yoshihiko; Middleton, Beth A.; Tachida, Hidenori

    2010-01-01

    Conclusions: Taxodium distichum had significantly higher nucleotide variation than C. japonica, and its patterns of polymorphism contrasted strikingly with those of the latter, which previously has been inferred to have experienced a reduction in population size.

  3. Population Structure and Its Effects on Patterns of Nucleotide Polymorphism in Teosinte (Zea mays ssp. parviglumis)

    PubMed Central

    Moeller, David A.; Tenaillon, Maud I.; Tiffin, Peter

    2007-01-01

    Surveys of nucleotide diversity in the wild ancestor of maize, Zea mays ssp. parviglumis, have revealed genomewide departures from the standard neutral equilibrium (NE) model. Here we investigate the degree to which population structure may account for the excess of rare polymorphisms frequently observed in species-wide samples. On the basis of sequence data from five nuclear and two chloroplast loci, we found significant population genetic structure among seven subpopulations from two geographic regions. Comparisons of estimates of population genetic parameters from species-wide samples and subpopulation-specific samples showed that population genetic subdivision influenced observed patterns of nucleotide polymorphism. In particular, Tajima's D was significantly higher (closer to zero) in subpopulation-specific samples relative to species-wide samples, and therefore more closely corresponded to NE expectations. In spite of these overall patterns, the extent to which levels and patterns of polymorphism within subpopulations differed from species-wide samples and NE expectations depended strongly on the geographic region (Jalisco vs. Balsas) from which subpopulations were sampled. This may be due to the demographic history of subpopulations in those regions. Overall, these results suggest that explicitly accounting for population structure may be important for studies examining the genetic basis of ecologically and agronomically important traits as well as for identifying loci that have been the targets of selection. PMID:17483429

  4. ModelOMatic: fast and automated model selection between RY, nucleotide, amino acid, and codon substitution models.

    PubMed

    Whelan, Simon; Allen, James E; Blackburne, Benjamin P; Talavera, David

    2015-01-01

    Molecular phylogenetics is a powerful tool for inferring both the process and pattern of evolution from genomic sequence data. Statistical approaches, such as maximum likelihood and Bayesian inference, are now established as the preferred methods of inference. The choice of models that a researcher uses for inference is of critical importance, and there are established methods for model selection conditioned on a particular type of data, such as nucleotides, amino acids, or codons. A major limitation of existing model selection approaches is that they can only compare models acting upon a single type of data. Here, we extend model selection to allow comparisons between models describing different types of data by introducing the idea of adapter functions, which project aggregated models onto the originally observed sequence data. These projections are implemented in the program ModelOMatic and used to perform model selection on 3722 families from the PANDIT database, 68 genes from an arthropod phylogenomic data set, and 248 genes from a vertebrate phylogenomic data set. For the PANDIT and arthropod data, we find that amino acid models are selected for the overwhelming majority of alignments; with progressively smaller numbers of alignments selecting codon and nucleotide models, and no families selecting RY-based models. In contrast, nearly all alignments from the vertebrate data set select codon-based models. The sequence divergence, the number of sequences, and the degree of selection acting upon the protein sequences may contribute to explaining this variation in model selection. Our ModelOMatic program is fast, with most families from PANDIT taking fewer than 150 s to complete, and should therefore be easily incorporated into existing phylogenetic pipelines. ModelOMatic is available at https://code.google.com/p/modelomatic/.

  5. Changes in the free nucleotide and nucleoside pattern of pea seeds in relation to germination

    PubMed Central

    Brown, E. G.

    1965-01-01

    1. Major changes in the free nucleotide and nucleoside pattern of germinating pea seeds are described. 2. During the imbibition phase of germination (0–16hr.) there was a 250% increase in ATP content and a parallel fall in AMP content without detectable change in ADP content. Metabolic implications are discussed. 3. The main nucleoside changes during imbibition were a 93% increase in xanthosine content and a 39% fall in adenosine content. 4. During the last phase of germination, leading to the emergence of the radicle, there is a general fall in free nucleotide content. AMP, ADP and ATP contents decreased 73, 48 and 52% respectively. Acetyl-3′-dephosphocoenzyme A concentration fell by 53%. However, the (NADP++NADPH)/(NAD++NADH) ratio increased, and except for uridine content (52% decrease) the nucleoside pattern changed little. 5. A sixfold increase in the concentration of an unidentified UDP-glycosyl compound occurs at this stage, although the content of UDP-glucose and UDP-galactose remained unchanged. 6. No free purine or pyrimidine bases could be detected at any stage of germination. PMID:14340101

  6. A nonsense nucleotide substitution in the oculocutaneous albinism II gene underlies the original pink-eyed dilution allele (Oca2(p)) in mice.

    PubMed

    Shoji, Haruka; Kiniwa, Yukiko; Okuyama, Ryuhei; Yang, Mu; Higuchi, Keiichi; Mori, Masayuki

    2015-01-01

    The original pink-eyed dilution (p) on chromosome 7 is a very old spontaneous mutation in mice. The oculocutaneous albinism II (Oca2) gene has previously been identified as the p gene. Oca2 transcripts have been shown to be absent in the skin of SJL/J mice with the original p mutant allele (Oca2(p)); however, the molecular genetic lesion underlying the original Oca2(p) allele has never been reported. The NCT mouse (commonly known as Nakano cataract mouse) has a pink-eyed dilution phenotype, which prompted us to undertake a molecular genetic analysis of the Oca2 gene of this strain. Our genetic linkage analysis suggests that the locus for the pink-eyed dilution phenotype of NCT is tightly linked to the Oca2 locus. PCR cloning and nucleotide sequence analysis indicates that the NCT mouse has a nonsense nucleotide substitution at exon 7 of the Oca2 gene. Examination of three mouse strains (NZW/NSlc, SJL/J, and 129X1/SvJJmsSlc) with the original Oca2(p) allele revealed the presence of a nonsense nucleotide substitution identical to that in the NCT strain. RT-PCR analysis revealed that the Oca2 transcripts were absent in the skin of NCT mice, suggesting intervention of the nonsense-mediated mRNA decay pathway. Collectively, the data in this study indicate that the nonsense nucleotide substitution in the Oca2 gene underlies the Oca2(p) allele. Our data also indicate that the NCT mouse can be used not only as a cataract model, but also as a model for human type II oculocutaneous albinism.

  7. Spatial pattern of nucleotide polymorphism indicates molecular adaptation in the bryophyte Sphagnum fimbriatum.

    PubMed

    Szövényi, P; Hock, Zs; Korpelainen, H; Shaw, A Jonathan

    2009-10-01

    In organisms with haploid-dominant life cycles, natural selection is expected to be especially effective because genetic variation is exposed directly to selection. However, in spore-producing plants with high dispersal abilities, among-population migration may counteract local adaptation by continuously redistributing genetic variability. In this study, we tested for adaptation at the molecular level by comparing nucleotide polymorphism in two genes (GapC and Rpb2) in 10 European populations of the peatmoss species, Sphagnum fimbriatum with variability at nine microsatellite loci assumed to be selectively neutral. In line with previous results, the GapC and Rpb2 genes showed strikingly different patterns of nucleotide polymorphism. Neutrality tests and comparison of population differentiation based on the GapC and Rpb2 genes with neutrally evolving microsatellites using coalescent simulations supported non-neutral evolution in GapC, but neutral evolution in the Rpb2 gene. These observations and the positions of the replacement mutations in the GAPDH enzyme (coded by GapC) indicate a significant impact of replacement mutations on enzyme function. Furthermore, the geographic distribution of alternate GapC alleles and/or linked genomic regions suggests that they have had differential success in the recolonization of Europe following the Last Glacial Maximum.

  8. Revisiting a Complex Rearrangement Involving a 619 Base Pairs Deletion, 6 Nucleotide Insertion Followed by a A > G Substitution Causing β°-Thalassemia.

    PubMed

    DabbaghBagheri, Samira; Ghadami, Shirin; Mollazadeh, Faeze; Saadat, Ameneh; Zeinali, Sirous

    2016-12-01

    One of the prevalent inherited blood disorders is thalassemia syndrome that characterized by reduction (β+) or absence (β0) of β globin chain synthesis. The β globin (HBB) gene map in the short arm of chromosome 11 and most of the mutations in this gene are single nucleotide substitutions, insertions or deletions of nucleotides. Nucleotide sequence analysis of a partially deleted β-globin gene from an Iranian carrier of β-thalassemia displayed a complex rearrangement involving a 619 base pairs (bp) deletion. This rearrangement had originally been named as the 619 bp deletion and later on as the 619 bp deletion with a 7 bp insertion. In our study, using by single chain sequencing, we have shown that the actual rearrangement involves a 619 bp deletion, a 6 bp insertion followed by a G > A substitution deleting the exon 3 of the β-globin gene. This clarification has to be inserted into the relevant databases as some of them still site the original 619 bp deletion with wrong breakpoints.

  9. Adsorption of arabinoxylan on cellulosic surfaces: influence of degree of substitution and substitution pattern on adsorption characteristics.

    PubMed

    Köhnke, Tobias; Ostlund, Asa; Brelid, Harald

    2011-07-11

    This study presents results that show that the fine structure of arabinoxylan affects its interaction with cellulosic surfaces, an important understanding when designing and evaluating properties of xylan-cellulose-based materials. Arabinoxylan samples, with well-defined structures, were prepared from a wheat flour arabinoxylan with targeted enzymatic hydrolysis. Turbidity measurements and analyses using NMR diffusometry showed that the solubility and the hydrodynamic properties of arabinoxylan are determined not only by the degree of substitution but also by the substitution pattern. On the basis of results obtained from adsorption experiments on microcrystalline cellulose particles and on cellulosic model surfaces investigated with quartz crystal microbalance with dissipation monitoring, it was also found that arabinoxylan adsorbs irreversibly on cellulosic surfaces and that the adsorption characteristics, as well as the properties of the adsorbed layer, are controlled by the fine structure of the xylan molecule.

  10. Synthesis of isocoumarins with different substituted patterns via Passerini-aldol sequence.

    PubMed

    Ma, Guan-Hua; Jiang, Bo; Tu, Xing-Jun; Ning, Yi; Tu, Shu-Jiang; Li, Guigen

    2014-09-05

    An efficient combination between the Passerini three-component reaction and aldol condensation has been developed for the synthesis of bicyclic isocoumarins with different substituted patterns via solvent-dependent domino pathways. These two operationally friendly methods simultaneously install C-O and C-C bonds in a one-pot manner, allowing the utilization of low-cost and readily accessible 2-formylbenzoic acid, isocyanides, and arylglyoxals. Mechanisms of formation of different substituted isocoumarin derivatives are also proposed.

  11. Synthesis of Isocoumarins with Different Substituted Patterns via Passerini–Aldol Sequence

    PubMed Central

    2015-01-01

    An efficient combination between the Passerini three-component reaction and aldol condensation has been developed for the synthesis of bicyclic isocoumarins with different substituted patterns via solvent-dependent domino pathways. These two operationally friendly methods simultaneously install C–O and C–C bonds in a one-pot manner, allowing the utilization of low-cost and readily accessible 2-formylbenzoic acid, isocyanides, and arylglyoxals. Mechanisms of formation of different substituted isocoumarin derivatives are also proposed. PMID:25140818

  12. The nucleotide sequence of HLA-B{sup *}2704 reveals a new amino acid substitution in exon 4 which is also present in HLA-B{sup *}2706

    SciTech Connect

    Rudwaleit, M.; Bowness, P.; Wordsworth, P.

    1996-12-31

    The HLA-B27 subtype HLA-B{sup *}2704 is virtually absent in Caucasians but common in Orientals, where it is associated with ankylosing spondylitis. The amino acid sequence of HLA-B{sup *}2704 has been established by peptide mapping and was shown to differ by two amino acids from HLA-B{sup *}2705, HLA-B{sup *}2704 is characterized by a serine for aspartic acid substitution at position 77 and glutamic acid for valine at position 152. To date, however, no nucleotide sequence confirming these changes at the DNA level has been published. 13 refs., 2 figs.

  13. The Slow:Fast substitution ratio reveals changing patterns of natural selection in gamma-proteobacterial genomes

    SciTech Connect

    Alm, Eric; Shapiro, B. Jesse

    2009-04-15

    Different microbial species are thought to occupy distinct ecological niches, subjecting each species to unique selective constraints, which may leave a recognizable signal in their genomes. Thus, it may be possible to extract insight into the genetic basis of ecological differences among lineages by identifying unusual patterns of substitutions in orthologous gene or protein sequences. We use the ratio of substitutions in slow versus fast-evolving sites (nucleotides in DNA, or amino acids in protein sequence) to quantify deviations from the typical pattern of selective constraint observed across bacterial lineages. We propose that elevated S:F in one branch (an excess of slow-site substitutions) can indicate a functionally-relevant change, due to either positive selection or relaxed evolutionary constraint. In a genome-wide comparative study of gamma-proteobacterial proteins, we find that cell-surface proteins involved with motility and secretion functions often have high S:F ratios, while information-processing genes do not. Change in evolutionary constraints in some species is evidenced by increased S:F ratios within functionally-related sets of genes (e.g., energy production in Pseudomonas fluorescens), while other species apparently evolve mostly by drift (e.g., uniformly elevated S:F across most genes in Buchnera spp.). Overall, S:F reveals several species-specific, protein-level changes with potential functional/ecological importance. As microbial genome projects yield more species-rich gene-trees, the S:F ratio will become an increasingly powerful tool for uncovering functional genetic differences among species.

  14. Comparative study of codon substitution patterns in foot-and-mouth disease virus (serotype O)

    PubMed Central

    Ahn, Insung; Bae, Se-Eun

    2011-01-01

    We compared genetic variations in the VP1 gene of foot-and-mouth disease viruses (FMDVs) isolated since 2000 from various region of the world. We analyzed relative synonymous codon usage (RSCU) and phylogenetic relationship between geographical regions, and calculated the genetic substitution patterns between Korean isolate and those from other countries. We calculated the ratios of synonymously substituted codons (SSC) to all observed substitutions and developed a new analytical parameter, EMC (the ratio of exact matching codons within each synonymous substitution group) to investigate more detailed substitution patterns within each synonymous codon group. We observed that FMDVs showed distinct RSCU patterns according to phylogenetic relationships in the same serotype (serotype O). Moreover, while the SSC and EMC values of FMDVs decreased according to phylogenetic distance, G + C composition at the third codon position was strictly conserved. Although there was little variation among the SSC values of 18 amino acids, more dynamic differences were observed in EMC values. The EMC values of 4- and 6-fold degenerate amino acids showed significantly lower values while most 2-fold degenerate amino acids showed no significant difference. Our findings suggest that different EMC patterns among the 18 amino acids might be an important factor in determining the direction of evolution in FMDV. PMID:21825834

  15. Haemophilia A: database of nucleotide substitutions, deletions, insertions and rearrangements of the factor VIII gene, second edition.

    PubMed Central

    Tuddenham, E G; Schwaab, R; Seehafer, J; Millar, D S; Gitschier, J; Higuchi, M; Bidichandani, S; Connor, J M; Hoyer, L W; Yoshioka, A

    1994-01-01

    A large number of different mutations in the factor VIII (F8) gene have been identified as a cause of haemophilia A. This compilation lists known single base-pair substitutions, deletions and insertions in the F8 gene and reviews the status of the inversional events which account for a substantial proportion of mutations causing severe haemophilia A. PMID:7984443

  16. Virus-Host Coevolution: Common Patterns of Nucleotide Motif Usage in Flaviviridae and Their Hosts

    PubMed Central

    Lobo, Francisco P.; Mota, Bruno E. F.; Pena, Sérgio D. J.; Azevedo, Vasco; Macedo, Andréa M.; Tauch, Andreas; Machado, Carlos R.; Franco, Glória R.

    2009-01-01

    Virus-host biological interaction is a continuous coevolutionary process involving both host immune system and viral escape mechanisms. Flaviviridae family is composed of fast evolving RNA viruses that infects vertebrate (mammals and birds) and/or invertebrate (ticks and mosquitoes) organisms. These host groups are very distinct life forms separated by a long evolutionary time, so lineage-specific anti-viral mechanisms are likely to have evolved. Flaviviridae viruses which infect a single host lineage would be subjected to specific host-induced pressures and, therefore, selected by them. In this work we compare the genomic evolutionary patterns of Flaviviridae viruses and their hosts in an attempt to uncover coevolutionary processes inducing common features in such disparate groups. Especially, we have analyzed dinucleotide and codon usage patterns in the coding regions of vertebrate and invertebrate organisms as well as in Flaviviridae viruses which specifically infect one or both host types. The two host groups possess very distinctive dinucleotide and codon usage patterns. A pronounced CpG under-representation was found in the vertebrate group, possibly induced by the methylation-deamination process, as well as a prominent TpA decrease. The invertebrate group displayed only a TpA frequency reduction bias. Flaviviridae viruses mimicked host nucleotide motif usage in a host-specific manner. Vertebrate-infecting viruses possessed under-representation of CpG and TpA, and insect-only viruses displayed only a TpA under-representation bias. Single-host Flaviviridae members which persistently infect mammals or insect hosts (Hepacivirus and insect-only Flavivirus, respectively) were found to posses a codon usage profile more similar to that of their hosts than to related Flaviviridae. We demonstrated that vertebrates and mosquitoes genomes are under very distinct lineage-specific constraints, and Flaviviridae viruses which specifically infect these lineages appear to be

  17. Development of a Physical Model-Based Algorithm for the Detection of Single-Nucleotide Substitutions by Using Tiling Microarrays

    PubMed Central

    Ono, Naoaki; Suzuki, Shingo; Furusawa, Chikara; Shimizu, Hiroshi; Yomo, Tetsuya

    2013-01-01

    High-density DNA microarrays are useful tools for analyzing sequence changes in DNA samples. Although microarray analysis provides informative signals from a large number of probes, the analysis and interpretation of these signals have certain inherent limitations, namely, complex dependency of signals on the probe sequences and the existence of false signals arising from non-specific binding between probe and target. In this study, we have developed a novel algorithm to detect the single-base substitutions by using microarray data based on a thermodynamic model of hybridization. We modified the thermodynamic model by introducing a penalty for mismatches that represent the effects of substitutions on hybridization affinity. This penalty results in significantly higher detection accuracy than other methods, indicating that the incorporation of hybridization free energy can improve the analysis of sequence variants by using microarray data. PMID:23382915

  18. Genomic patterns of nucleotide diversity in divergent populations of U.S. weedy rice

    PubMed Central

    2010-01-01

    Background Weedy rice (red rice), a conspecific weed of cultivated rice (Oryza sativa L.), is a significant problem throughout the world and an emerging threat in regions where it was previously absent. Despite belonging to the same species complex as domesticated rice and its wild relatives, the evolutionary origins of weedy rice remain unclear. We use genome-wide patterns of single nucleotide polymorphism (SNP) variation in a broad geographic sample of weedy, domesticated, and wild Oryza samples to infer the origin and demographic processes influencing U.S. weedy rice evolution. Results We find greater population structure than has been previously reported for U.S. weedy rice, and that the multiple, genetically divergent populations have separate origins. The two main U.S. weedy rice populations share genetic backgrounds with cultivated O. sativa varietal groups not grown commercially in the U.S., suggesting weed origins from domesticated ancestors. Hybridization between weedy groups and between weedy rice and local crops has also led to the evolution of distinct U.S. weedy rice populations. Demographic simulations indicate differences among the main weedy groups in the impact of bottlenecks on their establishment in the U.S., and in the timing of divergence from their cultivated relatives. Conclusions Unlike prior research, we did not find unambiguous evidence for U.S. weedy rice originating via hybridization between cultivated and wild Oryza species. Our results demonstrate the potential for weedy life-histories to evolve directly from within domesticated lineages. The diverse origins of U.S. weedy rice populations demonstrate the multiplicity of evolutionary forces that can influence the emergence of weeds from a single species complex. PMID:20550656

  19. Palindromic-nucleotide substitutions (PNS) of hepatitis C virus genotypes 1 and 5a from South Africa.

    PubMed

    Prabdial-Sing, N; Giangaspero, M; Puren, A J; Mahlangu, J; Barrow, P; Bowyer, S M

    2011-08-01

    The HCV stem-loop subdomains III-a, -b and -c have been shown to reflect the characteristics of the virus and identify isolates by genus, genotype and subtype. The aim of this study was to investigate the genotype-specific PNS within the 5'UTR of prevalent HCV genotypes (1 and 5a) found in South Africa. The genotype 5a (N = 35) and genotype 1 sequences (N=20) were from patients presenting with liver disease or haemophilia, respectively. PNS HCV typing characteristics, defined previously, were observed. The PNS method differentiated subtypes 1a and 1c from subtype 1b by the base change at nucleotide position 243. A lack of structural data from the variable loci V1 of the 5'UTR did not allow us to further differentiate the subtypes of 1. A nucleotide change from a thymine (T) to a cytosine (C) at position 183 was found among genotype 5a sequences. This mutation changed the stable U-AA bond to a Y AA bulge at base-pair position 32. There was an insertion of a single adenine (A) at position 207. At present PNS analysis is labour intensive but, with development of further software to aid the computer analysis, it has the potential to provide a rapid, reliable alternative to phylogenetic analysis. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Seafood substitutions obscure patterns of mercury contamination in Patagonian toothfish (Dissostichus eleginoides) or "Chilean sea bass".

    PubMed

    Marko, Peter B; Nance, Holly A; van den Hurk, Peter

    2014-01-01

    Seafood mislabeling distorts the true abundance of fish in the sea, defrauds consumers, and can also cause unwanted exposure to harmful pollutants. By combining genetic data with analyses of total mercury content, we have investigated how species substitutions and fishery-stock substitutions obscure mercury contamination in Patagonian toothfish (Dissostichus eleginoides), also known as "Chilean sea bass". Patagonian toothfish show wide variation in mercury concentrations such that consumers may be exposed to either acceptable or unacceptable levels of mercury depending on the geographic origins of the fish and the allowable limits of different countries. Most notably, stocks of Patagonian toothfish in Chile accumulate significantly more mercury than stocks closer to the South Pole, including the South Georgia/Shag Rocks stock, a fishery certified by the Marine Stewardship Council (MSC) as sustainably fished. Consistent with the documented geography of mercury contamination, our analysis showed that, on average, retail fish labeled as MSC-certified Patagonian toothfish had only half the mercury of uncertified fish. However, consideration of genetic data that were informative about seafood substitutions revealed a complex pattern of contamination hidden from consumers: species substitutions artificially inflated the expected difference in mercury levels between MSC-certified and uncertified fish whereas fishery stock substitutions artificially reduced the expected difference in mercury content between MSC-certified and uncertified fish that were actually D. eleginoides. Among MSC-certified fish that were actually D. eleginoides, several with exogenous mtDNA haplotypes (i.e., not known from the certified fishery) had mercury concentrations on par with uncertified fish from Chile. Overall, our analysis of mercury was consistent with inferences from the genetic data about the geographic origins of the fish, demonstrated the potential negative impact of seafood

  1. Using non-homogeneous models of nucleotide substitution to identify host shift events: application to the origin of the 1918 'Spanish' influenza pandemic virus.

    PubMed

    dos Reis, Mario; Hay, Alan J; Goldstein, Richard A

    2009-10-01

    Nonhomogeneous Markov models of nucleotide substitution have received scant attention. Here we explore the possibility of using nonhomogeneous models to identify host shift nodes along phylogenetic trees of pathogens evolving in different hosts. It has been noticed that influenza viruses show marked differences in nucleotide composition in human and avian hosts. We take advantage of this fact to identify the host shift event that led to the 1918 'Spanish' influenza. This disease killed over 50 million people worldwide, ranking it as the deadliest pandemic in recorded history. Our model suggests that the eight RNA segments which eventually became the 1918 viral genome were introduced into a mammalian host around 1882-1913. The viruses later diverged into the classical swine and human H1N1 influenza lineages around 1913-1915. The last common ancestor of human strains dates from February 1917 to April 1918. Because pigs are more readily infected with avian influenza viruses than humans, it would seem that they were the original recipient of the virus. This would suggest that the virus was introduced into humans sometime between 1913 and 1918.

  2. Evolution of Xylan Substitution Patterns in Gymnosperms and Angiosperms: Implications for Xylan Interaction with Cellulose.

    PubMed

    Busse-Wicher, Marta; Li, An; Silveira, Rodrigo L; Pereira, Caroline S; Tryfona, Theodora; Gomes, Thiago C F; Skaf, Munir S; Dupree, Paul

    2016-08-01

    The interaction between cellulose and xylan is important for the load-bearing secondary cell wall of flowering plants. Based on the precise, evenly spaced pattern of acetyl and glucuronosyl (MeGlcA) xylan substitutions in eudicots, we recently proposed that an unsubstituted face of xylan in a 2-fold helical screw can hydrogen bond to the hydrophilic surfaces of cellulose microfibrils. In gymnosperm cell walls, any role for xylan is unclear, and glucomannan is thought to be the important cellulose-binding polysaccharide. Here, we analyzed xylan from the secondary cell walls of the four gymnosperm lineages (Conifer, Gingko, Cycad, and Gnetophyta). Conifer, Gingko, and Cycad xylan lacks acetylation but is modified by arabinose and MeGlcA. Interestingly, the arabinosyl substitutions are located two xylosyl residues from MeGlcA, which is itself placed precisely on every sixth xylosyl residue. Notably, the Gnetophyta xylan is more akin to early-branching angiosperms and eudicot xylan, lacking arabinose but possessing acetylation on alternate xylosyl residues. All these precise substitution patterns are compatible with gymnosperm xylan binding to hydrophilic surfaces of cellulose. Molecular dynamics simulations support the stable binding of 2-fold screw conifer xylan to the hydrophilic face of cellulose microfibrils. Moreover, the binding of multiple xylan chains to adjacent planes of the cellulose fibril stabilizes the interaction further. Our results show that the type of xylan substitution varies, but an even pattern of xylan substitution is maintained among vascular plants. This suggests that 2-fold screw xylan binds hydrophilic faces of cellulose in eudicots, early-branching angiosperm, and gymnosperm cell walls. © 2016 American Society of Plant Biologists. All Rights Reserved.

  3. The intraspecific variability of mitochondrial genes of Agaricus bisporus reveals an extensive group I intron mobility combined with low nucleotide substitution rates.

    PubMed

    Jalalzadeh, Banafsheh; Saré, Idy Carras; Férandon, Cyril; Callac, Philippe; Farsi, Mohammad; Savoie, Jean-Michel; Barroso, Gérard

    2015-02-01

    Intraspecific mitochondrial variability was studied in ten strains of A. bisporus var. bisporus, in a strain representative of A. bisporus var. eurotetrasporus and in a strain of the closely related species Agaricus devoniensis. In A. bisporus, the cox1 gene is the richest in group I introns harboring homing endonuclease genes (heg). This study led to identify group I introns as the main source of cox1 gene polymorphism. Among the studied introns, two groups were distinguished according to the heg they contained. One group harbored heg maintained putatively functional. The other group was composed of eroded heg sequences that appeared to evolve toward their elimination. Low nucleotide substitution rates were found in both types of intronic sequences. This feature was also shared by all types of studied mitochondrial sequences, not only intronic but also genic and intergenic ones, when compared with nuclear sequences. Hence, the intraspecific evolution of A. bisporus mitochondrial genome appears characterized by both an important mobility (presence/absence) of large group I introns and by low nt substitution rates. This stringent conservation of mitochondrial sequences, when compared with their nuclear counterparts, appears irrespective of their apparent functionality and contrasts to what is widely accepted in fungal sequence evolution. This strengthens the usefulness of mtDNA sequences to get clues on intraspecific evolution.

  4. Catalysis of hydrolysis and nucleophilic substitution at the P-N bond of phosphoimidazolide-activated nucleotides in phosphate buffers

    NASA Technical Reports Server (NTRS)

    Kanavarioti, A.; Rosenbach, M. T.

    1991-01-01

    Phosphoimidazolide-activated derivatives of guanosine and cytidine 5'-monophosphates, henceforth called ImpN's, exhibit enhanced rates of degradation in the presence of aqueous inorganic phosphate in the range 4.0 < or = pH < or = 8.6. This degradation is been attributed to (i) nucleophilic substitution of the imidazolide and (ii) catalysis of the P-N bond hydrolysis by phosphate. The first reaction results in the formation of nucleoside 5'-diphosphate and the second in nucleoside 5'-monophosphate. Analysis of the observed rates as well as the product ratios as a function of pH and phosphate concentration allow distinction between various mechanistic possibilities. The results show that both H2PO4- and HPO4(2-) participate in both hydrolysis and nucleophilic substitution. Statistically corrected biomolecular rate constants indicate that the dianion is 4 times more effective as a general base than the monoanion, and 8 times more effective as nucleophile. The low Bronsted value beta = 0.15 calculated for these phosphate species, presumed to act as general bases in facilitating water attack, is consistent with the fact that catalysis of the hydrolysis of the P-N bond in ImpN's has not been detected before. The beta nuc = 0.35 calculated for water, H2PO4-, HPO4(2-), and hydroxide acting as nucleophiles indicates a more associative transition state for nucleotidyl (O2POR- with R = nucleoside) transfers than that observed for phosphoryl (PO3(2-)) transfers (beta nuc = 0.25). With respect to the stability/reactivity of ImpN's under prebiotic conditions, our study shows that these materials would not suffer additional degradation due to inorganic phosphate, assuming the concentrations of phosphate, Pi, on prebiotic Earth were similar to those in the present oceans ([Pi] approximately 2.25 micromoles).

  5. Catalysis of hydrolysis and nucleophilic substitution at the P-N bond of phosphoimidazolide-activated nucleotides in phosphate buffers

    NASA Technical Reports Server (NTRS)

    Kanavarioti, A.; Rosenbach, M. T.

    1991-01-01

    Phosphoimidazolide-activated derivatives of guanosine and cytidine 5'-monophosphates, henceforth called ImpN's, exhibit enhanced rates of degradation in the presence of aqueous inorganic phosphate in the range 4.0 < or = pH < or = 8.6. This degradation is been attributed to (i) nucleophilic substitution of the imidazolide and (ii) catalysis of the P-N bond hydrolysis by phosphate. The first reaction results in the formation of nucleoside 5'-diphosphate and the second in nucleoside 5'-monophosphate. Analysis of the observed rates as well as the product ratios as a function of pH and phosphate concentration allow distinction between various mechanistic possibilities. The results show that both H2PO4- and HPO4(2-) participate in both hydrolysis and nucleophilic substitution. Statistically corrected biomolecular rate constants indicate that the dianion is 4 times more effective as a general base than the monoanion, and 8 times more effective as nucleophile. The low Bronsted value beta = 0.15 calculated for these phosphate species, presumed to act as general bases in facilitating water attack, is consistent with the fact that catalysis of the hydrolysis of the P-N bond in ImpN's has not been detected before. The beta nuc = 0.35 calculated for water, H2PO4-, HPO4(2-), and hydroxide acting as nucleophiles indicates a more associative transition state for nucleotidyl (O2POR- with R = nucleoside) transfers than that observed for phosphoryl (PO3(2-)) transfers (beta nuc = 0.25). With respect to the stability/reactivity of ImpN's under prebiotic conditions, our study shows that these materials would not suffer additional degradation due to inorganic phosphate, assuming the concentrations of phosphate, Pi, on prebiotic Earth were similar to those in the present oceans ([Pi] approximately 2.25 micromoles).

  6. UMD-predictor, a new prediction tool for nucleotide substitution pathogenicity -- application to four genes: FBN1, FBN2, TGFBR1, and TGFBR2.

    PubMed

    Frédéric, Mélissa Yana; Lalande, Marine; Boileau, Catherine; Hamroun, Dalil; Claustres, Mireille; Béroud, Christophe; Collod-Béroud, Gwenaëlle

    2009-06-01

    Approximately half of gene lesions responsible for human inherited diseases are due to an amino acid substitution, showing that this mutational mechanism plays a large role in diseases. Distinguishing neutral sequence variations from those responsible for the phenotype is of major interest in human genetics. Because in vitro validation of mutations is not always possible in diagnostic settings, indirect arguments must be accumulated to define whether a missense variation is causative. To further differentiate neutral variants from pathogenic nucleotide substitutions, we developed a new tool, UMD-Predictor. This tool provides a combinatorial approach that associates the following data: localization within the protein, conservation, biochemical properties of the mutant and wild-type residues, and the potential impact of the variation on mRNA. To evaluate this new tool, we compared it to the SIFT, PolyPhen, and SNAP software, the BLOSUM62 and Yu's Biochemical Matrices. All tools were evaluated using variations from well-validated datasets extracted from four UMD-LSDB databases (UMD-FBN1, UMD-FBN2, UMD-TGFBR1, and UMD-TGFBR2) that contain all published mutations of the corresponding genes, that is, 1,945 mutations, among which 796 different substitutions corresponding to missense mutations. Our results show that the UMD-Predictor algorithm is the most efficient tool to predict pathogenic mutations in this context with a positive predictive value of 99.4%, a sensitivity of 95.4%, and a specificity of 92.2%. It can thus enhance the interpretation of variations in these genes, and could easily be applied to any other disease gene through the freely available UMD generic software (http://www.umd.be).

  7. Helix-forming propensity of aliphatic urea oligomers incorporating noncanonical residue substitution patterns.

    PubMed

    Pendem, Nagendar; Douat, Céline; Claudon, Paul; Laguerre, Michel; Castano, Sabine; Desbat, Bernard; Cavagnat, Dominique; Ennifar, Eric; Kauffmann, Brice; Guichard, Gilles

    2013-03-27

    Aliphatic N,N'-linked oligoureas are peptidomimetic foldamers that adopt a well-defined helical secondary structure stabilized by a collection of remote three-center H-bonds closing 12- and 14-membered pseudorings. Delineating the rules that govern helix formation depending on the nature of constituent units is of practical utility if one aims to utilize this helical fold to place side chains in a given arrangement and elaborate functional helices. In this work, we tested whether the helix geometry is compatible with alternative substitution patterns. The central -NH-CH(R)-CH2-NH-CO- residue in a model oligourea pentamer sequence was replaced by guest units bearing various substitution patterns [e.g., -NH-CH2-CH2-NH-CO-, -NH-CH2-CH(R)-NH-CO-, and -NH-CH(R(1))-CH(R(2))-NH-CO-], levels of preorganization (cyclic vs acyclic residues), and stereochemistries, and the helix formation was systematically assessed. The extent of helix perturbation or stabilization was primarily monitored in solution by Fourier transform IR, NMR, and electronic circular dichroism spectroscopies. Our results indicate that although three new substitution patterns were accommodated in the 2.5-helix, the helical urea backbone in short oligomers is particularly sensitive to variations in the residue substitution pattern (position and stereochemistry). For example, the trans-1,2-diaminocyclohexane unit was experimentally found to break the helix nucleation, but the corresponding cis unit did not. Theoretical calculations helped to rationalize these results. The conformational preferences in this series of oligoureas were also studied at high resolution by X-ray structure analyses of a representative set of modified oligomers.

  8. Determination of Substitution Patterns of Galactans from Green Seaweeds of the Bryopsidales.

    PubMed

    Arata, Paula Ximena; Fernández, Paula Virginia; Ciancia, Marina

    2015-01-01

    Sulfated and pyruvylated galactans are the major soluble polysaccharides produced by seaweeds of the Bryopsidales. Their backbones have a complex and variable pattern of substitution which, until now, has only been elucidated for a few species. Methods for determination of sulfate and pyruvic acid content, and chemical strategies to determine their position in the galactan chain are outlined here. These methods can also be applied to other sulfated and/or pyruvylated polysaccharides.

  9. Movement patterns in rugby sevens: effects of tournament level, fatigue and substitute players.

    PubMed

    Higham, Dean G; Pyne, David B; Anson, Judith M; Eddy, Anthony

    2012-05-01

    Understanding of the physical demands and the effects of fatigue and substitute players in rugby sevens is limited. This study quantified the differences in movement patterns between domestic and international rugby sevens tournaments, the effects of fatigue within and between matches during tournaments, and movement patterns of second half substitute players. Movement patterns of 19 international-level male rugby sevens players were recorded using a Global Positioning System (GPS) device during 11 international and 16 domestic matches (n = 174 files). Maximum velocity, total distance covered, distance covered in velocity zones and number of moderate and high accelerations and decelerations are reported per min of match time. Movement patterns were compared between international and domestic matches, first and second half, first and last tournament match and substitute and full-match players. Substantially greater distance was covered at high velocity (~27% at ≥ 6 ms(-1)) and 4-39% more accelerations and decelerations were performed in international than domestic matches. The relative distance covered by players at velocities >2 ms(-1) and the number of changes in velocity were reduced by 1-16% from first to second half. Small differences were observed in activity at <5 ms(-1) (-8-8%) and moderate accelerations (-18%) from first to last tournament match. All movement variables were higher (2-123%) for substitute players. International rugby sevens competition is more intense than domestic matches. Despite reductions in work-rate within individual matches, there is little indication of accumulated fatigue over a multi-day tournament. Copyright © 2011 Sports Medicine Australia. All rights reserved.

  10. Multilocus patterns of nucleotide polymorphism and demographic change in Taxodium distichum (Cupressaceae) in the lower Mississippi River alluvial valley

    USGS Publications Warehouse

    Kusumi, J.; Zidong, L.; Kado, T.; Tsumura, Y.; Middleton, B.A.; Tachida, H.

    2010-01-01

    Premise of the Study: Studies of the geographic patterns of genetic variation can give important insights into the past population structure of species. Our study species, Taxodium distichum L. (bald-cypress), prefers riparian and wetland habitats and is widely distributed in southeastern North America and Mexico. We compared the genetic variation of T. distichum with that of its close relative, Cryptomeria japonica, which is endemic to Japan. Methods: Nucleotide polymorphisms of T. distichum in the lower Mississippi River alluvial valley, USA, were examined at 10 nuclear loci. Key Results: The average nucleotide diversity at silent sites, 7sil, across the 10 loci in T. distichum was higher than that of C. japonica (7sil = 0.00732 and 0.00322, respectively). In T. distichum, Tajima's D values were each negative at 9 out of 10 loci, which suggests a recent population expansion. Maximum-likelihood and Bayesian estimations of the exponential population growth rate (g) of T. distichum populations indicated that this species had expanded approximately at the rate of 1.7 - 1.0 10 -6 per year in the past. Conclusions: Taxodium distichum had signifi cantly higher nucleotide variation than C. japonica, and its patterns of polymorphism contrasted strikingly with those of the latter, which previously has been inferred to have experienced a reduction in population size.

  11. Structural analysis of substitution patterns in alleles of human immunoglobulin VH genes.

    PubMed

    Romo-González, Tania; Vargas-Madrazo, Enrique

    2005-05-01

    The diversity in repertoires of antibodies (Abs) needed in response to the antigen challenge is produced by evolutionary and somatic processes. The mechanisms operating at a somatic level have been studied in great detail. In contrast, neither the mechanisms nor the strategies of diversification at an evolutionary level have yet been understood in similar detail. Particularly, the substitution patterns in alleles of immunoglobulin genes (Igs) have not been systematically studied. Furthermore, there is a scarcity of studies which link the analysis at a genetic level of the diversification of repertoires with the structural consequences at the protein level of the changes in DNA information. For the purpose of systematically characterizing the strategies of evolutionary diversification through sequence variation at alleles, in this work, we built a database for all the alleles of the IGHV locus in humans reported until now. Based on these data, we performed diverse analyses of substitution patterns and linked these results with studies at the protein level. We found that the sequence diversification in different alleles does not operate with equal intensity for all V genes. Our studies, both of the number of substitutions and of the type of amino acid change per sub-segment of the V-REGION evidenced differences in the selective pressure to which these regions are exposed. The implications of these results for understanding the evolutionary diversification strategies, as well as for the somatic generation of antibody repertoires are discussed.

  12. Substitution pattern elucidation of hydroxypropyl Pinus pinaster (Ait.) bark polyflavonoid derivatives by ESI(-)-MS/MS.

    PubMed

    García Marrero, Danny E; Glasser, Wolfgang G; Pizzi, Antonio; Paczkowski, Sebastian; Laborie, Marie-Pierre G

    2014-10-01

    The structure of condensed tannins (CTs) from Pinus pinaster bark extract and their hydroxypropylated derivatives with four degrees of substitution (DS 1, 2, 3 and 4) has been characterized for the first time using negative-ion mode electrospray ionization tandem mass spectrometry (ESI(-)-MS/MS). The results showed that P. pinaster bark CTs possess structural homogeneity in terms of monomeric units (C(15), catechin). The oligomer sizes were detected to be dimers to heptamers. The derivatives showed typical phenyl-propyl ether mass fragmentation by substituent elimination (58 amu) and inherent C(15) flavonoid fissions. The relative abundance of the product ions revealed a preferential triple, tetra-/penta- and octa- hydroxypropylation substitution pattern in the monomer, dimer and trimer derivatives, respectively. A defined order of -OH reactivity towards propylene oxide was established by means of multistage experiments (A-ring ≥ B-ring > C-ring). A high structural heterogeneity of the modified oligomers was detected.

  13. Effect of point substitutions within the minimal DNA-binding domain of xeroderma pigmentosum group A protein on interaction with DNA intermediates of nucleotide excision repair.

    PubMed

    Maltseva, E A; Krasikova, Y S; Naegeli, H; Lavrik, O I; Rechkunova, N I

    2014-06-01

    Xeroderma pigmentosum factor A (XPA) is one of the key proteins in the nucleotide excision repair (NER) process. The effects of point substitutions in the DNA-binding domain of XPA (positively charged lysine residues replaced by negatively charged glutamate residues: XPA K204E, K179E, K141E, and tandem mutant K141E/K179E) on the interaction of the protein with DNA structures modeling intermediates of the damage recognition and pre-incision stages in NER were analyzed. All these mutations decreased the affinity of the protein to DNA, the effect depending on the substitution and the DNA structure. The mutant as well as wild-type proteins bind with highest efficiency partly open damaged DNA duplex, and the affinity of the mutants to this DNA is reduced in the order: K204E > K179E > K141E = K141/179E. For all the mutants, decrease in DNA binding efficiency was more pronounced in the case of full duplex and single-stranded DNA than with bubble-DNA structure, the difference between protein affinities to different DNA structures increasing as DNA binding activity of the mutant decreased. No effect of the studied XPA mutations on the location of the protein on the partially open DNA duplex was observed using photoinduced crosslinking with 5-I-dUMP in different positions of the damaged DNA strand. These results combined with earlier published data suggest no direct correlation between DNA binding and activity in NER for these XPA mutants.

  14. Patterns of nucleotide diversity in two species of Mimulus are affected by mating system and asymmetric introgression.

    PubMed

    Sweigart, Andrea L; Willis, John H

    2003-11-01

    The evolutionary transition from outcrossing to self-fertilization has far-reaching implications for patterns of intraspecific genetic diversity and the potential for speciation. Using DNA sequence variation at two nuclear loci, we examined the divergence history of two closely related species of Mimulus. To investigate the effects of mating system and introgressive hybridization on the outcrossing M. guttatus and the selfing M. nasutus, we inspected nucleotide diversity within and between natural populations spanning the species' geographic ranges. High sequence similarity among populations of the selfing M. nasutus points to a single evolutionary origin for the species. Consistent with their distinct mating systems, all genetic variation in M. nasutus is distributed among populations, whereas M. guttatus exhibits appreciable levels of nucleotide diversity within populations. Silent genetic diversity is extensive in M. guttatus (mean theta(sil)/site = 0.077) and greatly exceeds the predicted twofold elevation in neutral variation for outcrossers relative to selfers. The finding of several M. guttatus sequences that share complete identity with sequences from M. nasutus suggests that recent asymmetric introgression may have occurred. We argue that exceptionally high nucleotide diversity in M. guttatus is consistent with a long-term history of directional introgression from M. nasutus to M. guttatus throughout the divergence of these two species.

  15. Directed evolution of polymerases to accept nucleotides with nonstandard hydrogen bond patterns.

    PubMed

    Laos, Roberto; Shaw, Ryan; Leal, Nicole A; Gaucher, Eric; Benner, Steven

    2013-08-06

    Artificial genetic systems have been developed by synthetic biologists over the past two decades to include additional nucleotides that form additional nucleobase pairs independent of the standard T:A and C:G pairs. Their use in various tools to detect and analyze DNA and RNA requires polymerases that synthesize duplex DNA containing unnatural base pairs. This is especially true for nested polymerase chain reaction (PCR), which has been shown to dramatically lower noise in multiplexed nested PCR if nonstandard nucleotides are used in their external primers. We report here the results of a directed evolution experiment seeking variants of Taq DNA polymerase that can support the nested PCR amplification with external primers containing two particular nonstandard nucleotides, 2-amino-8-(1'-β-d-2'-deoxyribofuranosyl)imidazo[1,2-a]-1,3,5-triazin-4(8H)-one (trivially called P) that pairs with 6-amino-5-nitro-3-(1'-β-d-2'-deoxyribofuranosyl)-2(1H)-pyridone (trivially called Z). Variants emerging from the directed evolution experiments were shown to pause less when challenged in vitro to incorporate dZTP opposite P in a template. Interestingly, several sites involved in the adaptation of Taq polymerases in the laboratory were also found to have displayed "heterotachy" (different rates of change) in their natural history, suggesting that these sites were involved in an adaptive change in natural polymerase evolution. Also remarkably, the polymerases evolved to be less able to incorporate dPTP opposite Z in the template, something that was not selected. In addition to being useful in certain assay architectures, this result underscores the general rule in directed evolution that "you get what you select for".

  16. Post-transcriptional modification of the wobble nucleotide in anticodon-substituted yeast tRNAArgII after microinjection into Xenopus laevis oocytes.

    PubMed Central

    Fournier, M; Haumont, E; de Henau, S; Gangloff, J; Grosjean, H

    1983-01-01

    An enzymatic procedure for the replacement of the ICG anticodon of yeast tRNAArgII by NCG trinucleotide (N = A, C, G or U) is described. Partial digestion with S1-nuclease and T1-RNAase provides fragments which, when annealed together, form an "anticodon-deprived" yeast tRNAArgII. A novel anticodon, phosphorylated with (32P) label on its 5' terminal residue, is then inserted using T4-RNA ligase. Such "anticodon-substituted" yeast tRNAArgII are microinjected into the cytoplasm of Xenopus laevis oocytes and shown to be able to interact with the anticodon maturation enzymes under in vivo conditions. Our results indicate that when adenosine occurs in the wobble position (A34) in yeast tRNAArgII it is efficiently modified into inosine (I34) while uridine (U34) is transformed into two uridine derivatives, one of which is probably mcm5U. In contrast, when a cytosine (C34) or guanosine (G34) occurs, they are not modified. These results are at variance with those obtained previously under similar conditions with anticodon derivatives of yeast tRNAAsp harbouring A, C, G or U as the first anticodon nucleotide. In this case, guanosine and uridine were modified while adenosine and cytosine were not. Images PMID:6300762

  17. Post-transcriptional modification of the wobble nucleotide in anticodon-substituted yeast tRNAArgII after microinjection into Xenopus laevis oocytes.

    PubMed

    Fournier, M; Haumont, E; de Henau, S; Gangloff, J; Grosjean, H

    1983-02-11

    An enzymatic procedure for the replacement of the ICG anticodon of yeast tRNAArgII by NCG trinucleotide (N = A, C, G or U) is described. Partial digestion with S1-nuclease and T1-RNAase provides fragments which, when annealed together, form an "anticodon-deprived" yeast tRNAArgII. A novel anticodon, phosphorylated with (32P) label on its 5' terminal residue, is then inserted using T4-RNA ligase. Such "anticodon-substituted" yeast tRNAArgII are microinjected into the cytoplasm of Xenopus laevis oocytes and shown to be able to interact with the anticodon maturation enzymes under in vivo conditions. Our results indicate that when adenosine occurs in the wobble position (A34) in yeast tRNAArgII it is efficiently modified into inosine (I34) while uridine (U34) is transformed into two uridine derivatives, one of which is probably mcm5U. In contrast, when a cytosine (C34) or guanosine (G34) occurs, they are not modified. These results are at variance with those obtained previously under similar conditions with anticodon derivatives of yeast tRNAAsp harbouring A, C, G or U as the first anticodon nucleotide. In this case, guanosine and uridine were modified while adenosine and cytosine were not.

  18. Contrasting patterns of nucleotide diversity for four conifers of Alpine European forests

    PubMed Central

    Mosca, Elena; Eckert, Andrew J; Liechty, John D; Wegrzyn, Jill L; La Porta, Nicola; Vendramin, Giovanni G; Neale, David B

    2012-01-01

    A candidate gene approach was used to identify levels of nucleotide diversity and to identify genes departing from neutral expectations in coniferous species of the Alpine European forest. Twelve samples were collected from four species that dominate montane and subalpine forests throughout Europe: Abies alba Mill, Larix decidua Mill, Pinus cembra L., and Pinus mugo Turra. A total of 800 genes, originally resequenced in Pinus taeda L., were resequenced across 12 independent trees for each of the four species. Genes were assigned to two categories, candidate and control, defined through homology-based searches to Arabidopsis. Estimates of nucleotide diversity per site varied greatly between polymorphic candidate genes (range: 0.0004–0.1295) and among species (range: 0.0024–0.0082), but were within the previously established ranges for conifers. Tests of neutrality using stringent significance thresholds, performed under the standard neutral model, revealed one to seven outlier loci for each species. Some of these outliers encode proteins that are involved with plant stress responses and form the basis for further evolutionary enquiries. PMID:23144662

  19. Contrasting patterns of nucleotide diversity for four conifers of Alpine European forests.

    PubMed

    Mosca, Elena; Eckert, Andrew J; Liechty, John D; Wegrzyn, Jill L; La Porta, Nicola; Vendramin, Giovanni G; Neale, David B

    2012-11-01

    A candidate gene approach was used to identify levels of nucleotide diversity and to identify genes departing from neutral expectations in coniferous species of the Alpine European forest. Twelve samples were collected from four species that dominate montane and subalpine forests throughout Europe: Abies alba Mill, Larix decidua Mill, Pinus cembra L., and Pinus mugo Turra. A total of 800 genes, originally resequenced in Pinus taeda L., were resequenced across 12 independent trees for each of the four species. Genes were assigned to two categories, candidate and control, defined through homology-based searches to Arabidopsis. Estimates of nucleotide diversity per site varied greatly between polymorphic candidate genes (range: 0.0004-0.1295) and among species (range: 0.0024-0.0082), but were within the previously established ranges for conifers. Tests of neutrality using stringent significance thresholds, performed under the standard neutral model, revealed one to seven outlier loci for each species. Some of these outliers encode proteins that are involved with plant stress responses and form the basis for further evolutionary enquiries.

  20. The mouse collagen X gene: complete nucleotide sequence, exon structure and expression pattern.

    PubMed Central

    Elima, K; Eerola, I; Rosati, R; Metsäranta, M; Garofalo, S; Perälä, M; De Crombrugghe, B; Vuorio, E

    1993-01-01

    Overlapping genomic clones covering the 7.2 kb mouse alpha 1(X) collagen gene, 0.86 kb of promoter and 1.25 kb of 3'-flanking sequences were isolated from two genomic libraries and characterized by nucleotide sequencing. Typical features of the gene include a unique three-exon structure, similar to that in the chick gene, with the entire triple-helical domain of 463 amino acids coded by a single large exon. The highest degree of amino acid and nucleotide sequence conservation was seen in the coding region for the collagenous and C-terminal non-collagenous domains between the mouse and known chick, bovine and human collagen type X sequences. More divergence between the sequences occurred in the N-terminal non-collagenous domain. Similarity between the mammalian collagen X sequences extended into the 3'-untranslated sequence, particularly near the polyadenylation site. The promoter of the mouse collagen X gene was found to contain two TATAA boxes 159 bp apart; primer extension analyses of the transcription start site revealed that both were functional. The promoter has an unusual structure with a very low G + C content of 28% between positions -220 and -1 of the upstream transcription start site. Northern and in situ hybridization analyses confirmed that the expression of the alpha 1(X) collagen gene is restricted to hypertrophic chondrocytes in tissues undergoing endochondral calcification. The detailed sequence information of the gene is useful for studies on the promoter activity of the gene and for generation of transgenic mice. Images Figure 3 Figure 5 Figure 6 PMID:8424763

  1. Functionalized Celluloses with Regular Substitution Pattern by Glycosynthase-Catalyzed Polymerization.

    PubMed

    Codera, Victoria; Edgar, Kevin J; Faijes, Magda; Planas, Antoni

    2016-04-11

    Control of the monomer sequence in polymers is extraordinarily difficult by chemical synthesis, though Nature routinely exerts such control, including in the biosynthesis of polysaccharides. This inability has prevented us from being able to match the exquisite structure-activity control exhibited in biosynthesis of bioactive natural polysaccharides. We here address a powerful approach, whereby enzyme-catalyzed polymerization of properly modified building blocks is introduced as a simple route affording polysaccharides with controlled sequence and functionalization pattern. Targeting cellulose as a versatile scaffold for novel biomaterials, we describe the preparation of a perfectly alternating polysaccharide with repeat unit 6'-azido-6'-deoxycellobiose by a glycosynthase-catalyzed polymerization using the Humicola insolens cellulase Cel7B E197A mutant, and its further functionalization to give novel modified cellulose derivatives with a regular substitution pattern.

  2. Unique genes in giant viruses: regular substitution pattern and anomalously short size.

    PubMed

    Ogata, Hiroyuki; Claverie, Jean-Michel

    2007-09-01

    Large DNA viruses, including giant mimivirus with a 1.2-Mb genome, exhibit numerous orphan genes possessing no database homologs or genes with homologs solely in close members of the same viral family. Due to their solitary nature, the functions and evolutionary origins of those genes remain obscure. We examined sequence features and evolutionary rates of viral family-specific genes in three nucleo-cytoplasmic large DNA virus (NCLDV) lineages. First, we showed that the proportion of family-specific genes does not correlate with sequence divergence rate. Second, position-dependent nucleotide statistics were similar between family-specific genes and the remaining genes in the genome. Third, we showed that the synonymous-to-nonsynonymous substitution ratios in those viruses are at levels comparable to those estimated for vertebrate proteomes. Thus, the vast majority of family-specific genes do not exhibit an accelerated evolutionary rate, and are thus likely to specify functional polypeptides. On the other hand, these family-specific proteins exhibit several distinct properties: (1) they are shorter, (2) they include a larger fraction of predicted transmembrane proteins, and (3) they are enriched in low-complexity sequences. These results suggest that family-specific genes do not correspond to recent horizontal gene transfer. We propose that their characteristic features are the consequences of the specific evolutionary forces shaping the viral gene repertoires in the context of their parasitic lifestyles.

  3. Unique genes in giant viruses: Regular substitution pattern and anomalously short size

    PubMed Central

    Ogata, Hiroyuki; Claverie, Jean-Michel

    2007-01-01

    Large DNA viruses, including giant mimivirus with a 1.2-Mb genome, exhibit numerous orphan genes possessing no database homologs or genes with homologs solely in close members of the same viral family. Due to their solitary nature, the functions and evolutionary origins of those genes remain obscure. We examined sequence features and evolutionary rates of viral family-specific genes in three nucleo-cytoplasmic large DNA virus (NCLDV) lineages. First, we showed that the proportion of family-specific genes does not correlate with sequence divergence rate. Second, position-dependent nucleotide statistics were similar between family-specific genes and the remaining genes in the genome. Third, we showed that the synonymous-to-nonsynonymous substitution ratios in those viruses are at levels comparable to those estimated for vertebrate proteomes. Thus, the vast majority of family-specific genes do not exhibit an accelerated evolutionary rate, and are thus likely to specify functional polypeptides. On the other hand, these family-specific proteins exhibit several distinct properties: (1) they are shorter, (2) they include a larger fraction of predicted transmembrane proteins, and (3) they are enriched in low-complexity sequences. These results suggest that family-specific genes do not correspond to recent horizontal gene transfer. We propose that their characteristic features are the consequences of the specific evolutionary forces shaping the viral gene repertoires in the context of their parasitic lifestyles. PMID:17652424

  4. Molecular population genetics of the OBP83 genomic region in Drosophila subobscura and D. guanche: contrasting the effects of natural selection and gene arrangement expansion in the patterns of nucleotide variation

    PubMed Central

    Sánchez-Gracia, A; Rozas, J

    2011-01-01

    Chromosomal inversion polymorphism play a major role in the evolutionary dynamics of populations and species because of their effects on the patterns of genetic variability in the genomic regions within inversions. Though there is compelling evidence for the adaptive character of chromosomal polymorphisms, the mechanisms responsible for their maintenance in natural populations is not fully understood. For this type of analysis, Drosophila subobscura is a good model species as it has a rich and extensively studied chromosomal inversion polymorphism system. Here, we examine the patterns of DNA variation in two natural populations segregating for chromosomal arrangements that differentially affect the surveyed genomic region; in particular, we analyse both nucleotide substitutions and insertion/deletion variations in the genomic region encompassing the odorant-binding protein genes Obp83a and Obp83b (Obp83 region). We show that the two main gene arrangements are genetically differentiated, but are consistent with a monophyletic origin of inversions. Nevertheless, these arrangements interchange some genetic information, likely by gene conversion. We also find that the frequency spectrum-based tests indicate that the pattern of nucleotide variation is not at equilibrium; this feature probably reflects the rapid increase in the frequency of the new gene arrangement promoted by positive selection (that is an adaptive change). Furthermore, a comparative analysis of polymorphism and divergence patterns reveals a relaxation of the functional constraints at the Obp83b gene, which might be associated with particular ecological or demographic features of the Canary island endemic species D. guanche PMID:20332808

  5. Lys98 Substitution in Human AP Endonuclease 1 Affects the Kinetic Mechanism of Enzyme Action in Base Excision and Nucleotide Incision Repair Pathways

    PubMed Central

    Timofeyeva, Nadezhda A.; Koval, Vladimir V.; Ishchenko, Alexander A.; Saparbaev, Murat K.; Fedorova, Olga S.

    2011-01-01

    Human apurinic/apyrimidinic endonuclease 1 (APE1) is a key enzyme in the base excision repair (BER) and nucleotide incision repair (NIR) pathways. We recently analyzed the conformational dynamics and kinetic mechanism of wild-type (wt) protein, in a stopped-flow fluorescence study. In this study, we investigated the mutant enzyme APE1K98A using the same approach. Lys98 was known to hydrogen bond to the carboxyl group of Asp70, a residue implicated in binding the divalent metal ion. Our data suggested that the conformational selection and induced fit occur during the enzyme action. We expanded upon the evidence that APE1 can pre-exist in two conformations. The isomerization of an enzyme-product complex in the BER process and the additional isomerization stage of enzyme-substrate complex in the NIR process were established for APE1K98A. These stages had not been registered for the wtAPE1. We found that the K98A substitution resulted in a 12-fold reduction of catalytic constant of 5′-phosphodiester bond hydrolysis in (3-hydroxytetrahydrofuran-2-yl)methyl phosphate (F, tetrahydrofuran) containing substrate, and in 200-fold reduction in 5,6-dihydrouridine (DHU) containing substrate. Thus, the K98A substitution influenced NIR more than BER. We demonstrated that the K98A mutation influenced the formation of primary unspecific enzyme-substrate complex in a complicated manner, depending on the Mg2+ concentration and pH. This mutation obstructed the induced fit of enzyme in the complex with undamaged DNA and F-containing DNA and appreciably decreased the stability of primary complex upon interaction of enzyme with DNA, containing the natural apurinic/apyrimidinic (AP) site. Furthermore, it significantly delayed the activation of the less active form of enzyme during NIR and slowed down the conformational conversion of the complex of enzyme with the cleavage product of DHU-substrate. Our data revealed that APE1 uses the same active site to catalyze the cleavage of DHU- and

  6. Inferring Multiple Refugia and Phylogeographical Patterns in Pinus massoniana Based on Nucleotide Sequence Variation and DNA Fingerprinting

    PubMed Central

    Lin, Chung-Jian; Huang, Chi-Chung; Huang, Chao-Ching; Chiang, Yu-Chung; Chiang, Tzen-Yuh

    2012-01-01

    Background Pinus massoniana, an ecologically and economically important conifer, is widespread across central and southern mainland China and Taiwan. In this study, we tested the central–marginal paradigm that predicts that the marginal populations tend to be less polymorphic than the central ones in their genetic composition, and examined a founders' effect in the island population. Methodology/Principal Findings We examined the phylogeography and population structuring of the P. massoniana based on nucleotide sequences of cpDNA atpB-rbcL intergenic spacer, intron regions of the AdhC2 locus, and microsatellite fingerprints. SAMOVA analysis of nucleotide sequences indicated that most genetic variants resided among geographical regions. High levels of genetic diversity in the marginal populations in the south region, a pattern seemingly contradicting the central–marginal paradigm, and the fixation of private haplotypes in most populations indicate that multiple refugia may have existed over the glacial maxima. STRUCTURE analyses on microsatellites revealed that genetic structure of mainland populations was mediated with recent genetic exchanges mostly via pollen flow, and that the genetic composition in east region was intermixed between south and west regions, a pattern likely shaped by gene introgression and maintenance of ancestral polymorphisms. As expected, the small island population in Taiwan was genetically differentiated from mainland populations. Conclusions/Significance The marginal populations in south region possessed divergent gene pools, suggesting that the past glaciations might have low impacts on these populations at low latitudes. Estimates of ancestral population sizes interestingly reflect a recent expansion in mainland from a rather smaller population, a pattern that seemingly agrees with the pollen record. PMID:22952747

  7. Interrelationships between hydrogen-supplying reactions, respiration rate and extramitochondrial adenine nucleotide pattern.

    PubMed

    Böhme, G; Schönfeld, P; Bohnensack, R; Küster, U; Kunz, W

    1982-01-01

    1. The influence of a diminished hydrogen supply on the regulation of oxidative phosphorylation of isolated rat liver mitochondria in dependence on the extramitochondrial (ATP)/(ADP) ratio was investigated. 2. The hydrogen supply was diminished by using various (beta-hydroxybutyrate)/(acetoacetate) ratios as a redox buffer and the results were compared with those of experiments using perifusion of immobilized mitochondria with non-saturating substrate concentrations. 3. In both experimental approaches the influence of a diminished hydrogen pressure on the maximum (ATP)/(ADP) ratio at minimum flux was low. An extreme decrease in the (beta-hydroxybutyrate)/(acetoacetate) ratio by more than two orders of magnetitude causes the (APT)/(ADP) ratio to decrease by about 50%. 4. The load capacity of oxidative phosphorylation (maximum flux) is considerably decreased by diminished hydrogen pressure. 5. The borderline cases of purely kinetic and thermodynamic limitations of hydrogen supply were calculated by computer simulation with respect to the regulating behaviour of oxidative phosphorylation and changes in the control strength of adenine nucleotide translocator and hydrogen supply in the overall reaction. 6. A prevalent thermodynamic influence of hydrogen supply on oxidative energy transformation in the cell is discussed in the light of experimental data.

  8. Patterns of nucleotide variation and reproductive isolation between a Mimulus allotetraploid and its progenitor species.

    PubMed

    Sweigart, A L; Martin, N H; Willis, J H

    2008-04-01

    Here we report our characterization of a widespread, highly selfing Mimulus allotetraploid formed by interspecific hybridization between M. nasutus and M. guttatus. Nucleotide variation at two nuclear loci (mCYCA and mAP3) within and among tetraploid populations resolves two haplotype clusters for each locus: one shares near identity with sequences from M. nasutus and the other group shares substantial variation with M. guttatus. With respect to the two loci studied, each allotetraploid individual is a 'fixed heterozygote' carrying sequences from both clusters. Moreover, mCYCA variation is consistent with at least two evolutionary origins for the Mimulus allotetraploid. We show that the allotetraploid is strongly reproductively isolated from M. nasutus and M. guttatus; interploidy crosses produce almost no viable seeds. By extension, we infer strong triploid block and argue that Mimulus allotetraploid formation might proceed in one step via the union of unreduced gametes in an M. nasutus-M. guttatus F(1) hybrid. We also discuss the potential roles of mating system and flowering asynchrony in allotetraploid establishment.

  9. Patterns of nucleotide diversity at photoperiod related genes in Norway spruce [Picea abies (L.) Karst].

    PubMed

    Källman, Thomas; De Mita, Stéphane; Larsson, Hanna; Gyllenstrand, Niclas; Heuertz, Myriam; Parducci, Laura; Suyama, Yoshihisa; Lagercrantz, Ulf; Lascoux, Martin

    2014-01-01

    The ability of plants to track seasonal changes is largely dependent on genes assigned to the photoperiod pathway, and variation in those genes is thereby important for adaptation to local day length conditions. Extensive physiological data in several temperate conifer species suggest that populations are adapted to local light conditions, but data on the genes underlying this adaptation are more limited. Here we present nucleotide diversity data from 19 genes putatively involved in photoperiodic response in Norway spruce (Picea abies). Based on similarity to model plants the genes were grouped into three categories according to their presumed position in the photoperiod pathway: photoreceptors, circadian clock genes, and downstream targets. An HKA (Hudson, Kreitman and Aquade) test showed a significant excess of diversity at photoreceptor genes, but no departure from neutrality at circadian genes and downstream targets. Departures from neutrality were also tested with Tajima's D and Fay and Wu's H statistics under three demographic scenarios: the standard neutral model, a population expansion model, and a more complex population split model. Only one gene, the circadian clock gene PaPRR3 with a highly positive Tajima's D value, deviates significantly from all tested demographic scenarios. As the PaPRR3 gene harbours multiple non-synonymous variants it appears as an excellent candidate gene for control of photoperiod response in Norway spruce.

  10. Patterns and Evolution of Nucleotide Landscapes in Seed Plants[W

    PubMed Central

    Serres-Giardi, Laurana; Belkhir, Khalid; David, Jacques; Glémin, Sylvain

    2012-01-01

    Nucleotide landscapes, which are the way base composition is distributed along a genome, strongly vary among species. The underlying causes of these variations have been much debated. Though mutational bias and selection were initially invoked, GC-biased gene conversion (gBGC), a recombination-associated process favoring the G and C over A and T bases, is increasingly recognized as a major factor. As opposed to vertebrates, evolution of GC content is less well known in plants. Most studies have focused on the GC-poor and homogeneous Arabidopsis thaliana genome and the much more GC-rich and heterogeneous rice (Oryza sativa) genome and have often been generalized as a dicot/monocot dichotomy. This vision is clearly phylogenetically biased and does not allow understanding the mechanisms involved in GC content evolution in plants. To tackle these issues, we used EST data from more than 200 species and provided the most comprehensive description of gene GC content across the seed plant phylogeny so far available. As opposed to the classically assumed dicot/monocot dichotomy, we found continuous variations in GC content from the probably ancestral GC-poor and homogeneous genomes to the more derived GC-rich and highly heterogeneous ones, with several independent enrichment episodes. Our results suggest that gBGC could play a significant role in the evolution of GC content in plant genomes. PMID:22492812

  11. Patterns of nucleotide misincorporations during enzymatic amplification and direct large-scale sequencing of ancient DNA.

    PubMed

    Stiller, M; Green, R E; Ronan, M; Simons, J F; Du, L; He, W; Egholm, M; Rothberg, J M; Keates, S G; Keats, S G; Ovodov, N D; Antipina, E E; Baryshnikov, G F; Kuzmin, Y V; Vasilevski, A A; Wuenschell, G E; Termini, J; Hofreiter, M; Jaenicke-Després, V; Pääbo, S

    2006-09-12

    Whereas evolutionary inferences derived from present-day DNA sequences are by necessity indirect, ancient DNA sequences provide a direct view of past genetic variants. However, base lesions that accumulate in DNA over time may cause nucleotide misincorporations when ancient DNA sequences are replicated. By repeated amplifications of mitochondrial DNA sequences from a large number of ancient wolf remains, we show that C/G-to-T/A transitions are the predominant type of such misincorporations. Using a massively parallel sequencing method that allows large numbers of single DNA strands to be sequenced, we show that modifications of C, as well as to a lesser extent of G, residues cause such misincorporations. Experiments where oligonucleotides containing modified bases are used as templates in amplification reactions suggest that both of these types of misincorporations can be caused by deamination of the template bases. New DNA sequencing methods in conjunction with knowledge of misincorporation processes have now, in principle, opened the way for the determination of complete genomes from organisms that became extinct during and after the last glaciation.

  12. An even pattern of xylan substitution is critical for interaction with cellulose in plant cell walls.

    PubMed

    Grantham, Nicholas J; Wurman-Rodrich, Joel; Terrett, Oliver M; Lyczakowski, Jan J; Stott, Katherine; Iuga, Dinu; Simmons, Thomas J; Durand-Tardif, Mylene; Brown, Steven P; Dupree, Ray; Busse-Wicher, Marta; Dupree, Paul

    2017-10-09

    Xylan and cellulose are abundant polysaccharides in vascular plants and essential for secondary cell wall strength. Acetate or glucuronic acid decorations are exclusively found on even-numbered residues in most of the glucuronoxylan polymer. It has been proposed that this even-specific positioning of the decorations might permit docking of xylan onto the hydrophilic face of a cellulose microfibril (1-3) . Consequently, xylan adopts a flattened ribbon-like twofold screw conformation when bound to cellulose in the cell wall (4) . Here we show that ESKIMO1/XOAT1/TBL29, a xylan-specific O-acetyltransferase, is necessary for generation of the even pattern of acetyl esters on xylan in Arabidopsis. The reduced acetylation in the esk1 mutant deregulates the position-specific activity of the xylan glucuronosyltransferase GUX1, and so the even pattern of glucuronic acid on the xylan is lost. Solid-state NMR of intact cell walls shows that, without the even-patterned xylan decorations, xylan does not interact normally with cellulose fibrils. We conclude that the even pattern of xylan substitutions seen across vascular plants enables the interaction of xylan with hydrophilic faces of cellulose fibrils, and is essential for development of normal plant secondary cell walls.Plant cell wall consists of multiple components and complex structure. Here, ssNMR was used to investigate the physical interactions between two principle cell wall components, cellulose and xylan, and demonstrate the mechanism for their interactions.

  13. Genome-wide patterns of recombination, linkage disequilibrium and nucleotide diversity from pooled resequencing and single nucleotide polymorphism genotyping unlock the evolutionary history of Eucalyptus grandis.

    PubMed

    Silva-Junior, Orzenil B; Grattapaglia, Dario

    2015-11-01

    We used high-density single nucleotide polymorphism (SNP) data and whole-genome pooled resequencing to examine the landscape of population recombination (ρ) and nucleotide diversity (ϴw ), assess the extent of linkage disequilibrium (r(2) ) and build the highest density linkage maps for Eucalyptus. At the genome-wide level, linkage disequilibrium (LD) decayed within c. 4-6 kb, slower than previously reported from candidate gene studies, but showing considerable variation from absence to complete LD up to 50 kb. A sharp decrease in the estimate of ρ was seen when going from short to genome-wide inter-SNP distances, highlighting the dependence of this parameter on the scale of observation adopted. Recombination was correlated with nucleotide diversity, gene density and distance from the centromere, with hotspots of recombination enriched for genes involved in chemical reactions and pathways of the normal metabolic processes. The high nucleotide diversity (ϴw = 0.022) of E. grandis revealed that mutation is more important than recombination in shaping its genomic diversity (ρ/ϴw = 0.645). Chromosome-wide ancestral recombination graphs allowed us to date the split of E. grandis (1.7-4.8 million yr ago) and identify a scenario for the recent demographic history of the species. Our results have considerable practical importance to Genome Wide Association Studies (GWAS), while indicating bright prospects for genomic prediction of complex phenotypes in eucalypt breeding. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  14. Introns Structure Patterns of Variation in Nucleotide Composition in Arabidopsis thaliana and Rice Protein-Coding Genes.

    PubMed

    Ressayre, Adrienne; Glémin, Sylvain; Montalent, Pierre; Serre-Giardi, Laurana; Dillmann, Christine; Joets, Johann

    2015-10-07

    Plant genomes present a continuous range of variation in nucleotide composition (G + C content). In coding regions, G + C-poor species tend to have unimodal distributions of G + C content among genes within genomes and slight 5'-3' gradients along genes. In contrast, G + C-rich species display bimodal distributions of G + C content among genes and steep 5'-3' decreasing gradients along genes. The causes of these peculiar patterns are still poorly understood. Within two species (Arabidopsis thaliana and rice), each representative of one side of the continuum, we studied the consequences of intron presence on coding region and intron G + C content at different scales. By properly taking intron structure into account, we showed that, in both species, intron presence is associated with step changes in nucleotide, codon, and amino acid composition. This suggests that introns have a barrier effect structuring G + C content along genes and that previous continuous characterizations of the 5'-3' gradients were artifactual. In external gene regions (located upstream first or downstream last introns), species-specific factors, such as GC-biased gene conversion, are shaping G + C content whereas in internal gene regions (surrounded by introns), G + C content is likely constrained to remain within a range common to both species.

  15. Introns Structure Patterns of Variation in Nucleotide Composition in Arabidopsis thaliana and Rice Protein-Coding Genes

    PubMed Central

    Ressayre, Adrienne; Glémin, Sylvain; Montalent, Pierre; Serre-Giardi, Laurana; Dillmann, Christine; Joets, Johann

    2015-01-01

    Plant genomes present a continuous range of variation in nucleotide composition (G + C content). In coding regions, G + C-poor species tend to have unimodal distributions of G + C content among genes within genomes and slight 5′–3′ gradients along genes. In contrast, G + C-rich species display bimodal distributions of G + C content among genes and steep 5′–3′ decreasing gradients along genes. The causes of these peculiar patterns are still poorly understood. Within two species (Arabidopsis thaliana and rice), each representative of one side of the continuum, we studied the consequences of intron presence on coding region and intron G + C content at different scales. By properly taking intron structure into account, we showed that, in both species, intron presence is associated with step changes in nucleotide, codon, and amino acid composition. This suggests that introns have a barrier effect structuring G + C content along genes and that previous continuous characterizations of the 5′–3′ gradients were artifactual. In external gene regions (located upstream first or downstream last introns), species-specific factors, such as GC-biased gene conversion, are shaping G + C content whereas in internal gene regions (surrounded by introns), G + C content is likely constrained to remain within a range common to both species. PMID:26450849

  16. Levels and Patterns of Nucleotide Variation in Domestication QTL Regions on Rice Chromosome 3 Suggest Lineage-Specific Selection

    PubMed Central

    Xie, Xianfa; Molina, Jeanmaire; Hernandez, Ryan; Reynolds, Andy; Boyko, Adam R.; Bustamante, Carlos D.; Purugganan, Michael D.

    2011-01-01

    Oryza sativa or Asian cultivated rice is one of the major cereal grass species domesticated for human food use during the Neolithic. Domestication of this species from the wild grass Oryza rufipogon was accompanied by changes in several traits, including seed shattering, percent seed set, tillering, grain weight, and flowering time. Quantitative trait locus (QTL) mapping has identified three genomic regions in chromosome 3 that appear to be associated with these traits. We would like to study whether these regions show signatures of selection and whether the same genetic basis underlies the domestication of different rice varieties. Fragments of 88 genes spanning these three genomic regions were sequenced from multiple accessions of two major varietal groups in O. sativa—indica and tropical japonica—as well as the ancestral wild rice species O. rufipogon. In tropical japonica, the levels of nucleotide variation in these three QTL regions are significantly lower compared to genome-wide levels, and coalescent simulations based on a complex demographic model of rice domestication indicate that these patterns are consistent with selection. In contrast, there is no significant reduction in nucleotide diversity in the homologous regions in indica rice. These results suggest that there are differences in the genetic and selective basis for domestication between these two Asian rice varietal groups. PMID:21674010

  17. Assessing patterns of hybridization between North Atlantic eels using diagnostic single-nucleotide polymorphisms.

    PubMed

    Pujolar, J M; Jacobsen, M W; Als, T D; Frydenberg, J; Magnussen, E; Jónsson, B; Jiang, X; Cheng, L; Bekkevold, D; Maes, G E; Bernatchez, L; Hansen, M M

    2014-06-01

    The two North Atlantic eel species, the European eel (Anguilla anguilla) and the American eel (Anguilla rostrata), spawn in partial sympatry in the Sargasso Sea, providing ample opportunity to interbreed. In this study, we used a RAD (Restriction site Associated DNA) sequencing approach to identify species-specific diagnostic single-nucleotide polymorphisms (SNPs) and design a low-density array that combined with screening of a diagnostic mitochondrial DNA marker. Eels from Iceland (N=159) and from the neighboring Faroe Islands (N=29) were genotyped, along with 94 larvae (49 European and 45 American eel) collected in the Sargasso Sea. Our SNP survey showed that the majority of Icelandic eels are pure European eels but there is also an important contribution of individuals of admixed ancestry (10.7%). Although most of the hybrids were identified as F1 hybrids from European eel female × American eel male crosses, backcrosses were also detected, including a first-generation backcross (F1 hybrid × pure European eel) and three individuals identified as second-generation backcrosses originating from American eel × F1 hybrid backcrosses interbreeding with pure European eels. In comparison, no hybrids were observed in the Faroe Islands, the closest bodies of land to Iceland. It is possible that hybrids show an intermediate migratory behaviour between the two parental species that ultimately brings hybrid larvae to the shores of Iceland, situated roughly halfway between the Sargasso Sea and Europe. Only two hybrids were observed among Sargasso Sea larvae, both backcrosses, but no F1 hybrids, that points to temporal variation in the occurrence of hybridization.

  18. Assessing patterns of hybridization between North Atlantic eels using diagnostic single-nucleotide polymorphisms

    PubMed Central

    Pujolar, J M; Jacobsen, M W; Als, T D; Frydenberg, J; Magnussen, E; Jónsson, B; Jiang, X; Cheng, L; Bekkevold, D; Maes, G E; Bernatchez, L; Hansen, M M

    2014-01-01

    The two North Atlantic eel species, the European eel (Anguilla anguilla) and the American eel (Anguilla rostrata), spawn in partial sympatry in the Sargasso Sea, providing ample opportunity to interbreed. In this study, we used a RAD (Restriction site Associated DNA) sequencing approach to identify species-specific diagnostic single-nucleotide polymorphisms (SNPs) and design a low-density array that combined with screening of a diagnostic mitochondrial DNA marker. Eels from Iceland (N=159) and from the neighboring Faroe Islands (N=29) were genotyped, along with 94 larvae (49 European and 45 American eel) collected in the Sargasso Sea. Our SNP survey showed that the majority of Icelandic eels are pure European eels but there is also an important contribution of individuals of admixed ancestry (10.7%). Although most of the hybrids were identified as F1 hybrids from European eel female × American eel male crosses, backcrosses were also detected, including a first-generation backcross (F1 hybrid × pure European eel) and three individuals identified as second-generation backcrosses originating from American eel × F1 hybrid backcrosses interbreeding with pure European eels. In comparison, no hybrids were observed in the Faroe Islands, the closest bodies of land to Iceland. It is possible that hybrids show an intermediate migratory behaviour between the two parental species that ultimately brings hybrid larvae to the shores of Iceland, situated roughly halfway between the Sargasso Sea and Europe. Only two hybrids were observed among Sargasso Sea larvae, both backcrosses, but no F1 hybrids, that points to temporal variation in the occurrence of hybridization. PMID:24424165

  19. Predicting gas chromatography relative retention times for polychlorinated biphenyls using chlorine substitution pattern contribution method.

    PubMed

    Li, An; Gao, Jie; Freels, Sally; Huang, Jun; Yu, Gang

    2016-01-04

    Various quantitative structure retention relationships have been published in an effort to understand and predict chromatographic retention times. This work presents a chlorine substitution pattern contribution (Cl-SPC) model for relative retention times (RRT) of polychlorinated biphenyls (PCBs), using 27 sets of previously published gas chromatography RRT data. The Cl-SPC model calculates the contribution factors (βk) for each of 19 chlorine substitution "patterns" (such as 2-, 2,4-, 2,3,6-, 2,3,4,5,6-, etc.) using multiple linear regression (MLR). The 27 separate MLRs had R(2) values ranging from 0.961 to 1.000; the average absolute errors were 0.55% for the training sets and 0.95% for the test sets. Cross-validation of the model was carried out by splitting each data set into training and test sets for groupings based on nine PCB congener mixes commercialized by AccuStandard. No weakening of the model performance was observed when the size of data set used to develop the model was decreased from 209 to 39 congeners. In addition to the separate models, a single mixed model was fit combining all 27 data sets. The estimated random effects, which reflect the impact of GC configuration and operational conditions on RRTs, are minor compared with the fixed effects estimated for the βk values. The major advantages of the Cl-SPC model are its unmatched simplicity and equally excellent robustness when compared with other quantitative structure retention relationship models.

  20. Characterisation of genotypes among bovine viral diarrhoea virus 2 strains according to palindromic nucleotide substitutions in the 5 untranslated genomic region.

    PubMed

    Giangaspero, M; Harasawa, R

    2004-01-01

    Pestivirus bovine viral diarrhea virus 2 (BVDV-2) strains from 61 isolates from cattle and sheep, and from some adventitious contaminants of biologicals, have been assessed using the palindromic nucleotide substitutions (PNS) method at three variable loci (V1, V2 and V3) located delin the 5' untranslated region (UTR) of genomic RNA. This genotyping procedure is new, simple and practical. Two characteristics of the base pairings common to BVDV-2 species, a C-G or U-A pairing at the V1 locus, and a G*U pairing at the V2 locus, were observed in isolates tested. The PNS method showed six genotypes: BVDV-2a, BVDV-2b, BVDV-2c, BVDV- 2d, BVDV-2e and BVDV-2f. Twenty-five strains showed the BVDV-2a genotype specific combination of three base pairings (A-U in position 1 and C-G or U*G in position 18 in V1 and U-A or U*G in position 4 in V2). Ten strains were identified by a single C-G pairing in position 4 from the bottom of the V2 stem region, characteristic to genotype BVDV-2b. Three strains were assigned to genotype BVDV-2c, due to their recognition by a G*U pairing at the bottom of the V1 stem region. A U-A pairing, characteristic of the BVDV-2d genotype when found in position 18 of the V1 stem region, was observed in fourteen strains. Genotype BVDV- 2e, present in only six South American cattle isolates, was characterized by G-C pairing in position 12, by U-A pairing in position 16 and G_G or G-_A bulges in position 18 in the V1 region. One strain from Argentina was classified as genotype BVDV-2f, showing: A-U pairing in position 9 and 12, U-A in position 16 and G_A bulge in position 18 in V1 region. Two strains were not characterized due to incomplete sequence of V1 locus.

  1. Influence of bromine substitution pattern on the singlet oxygen generation efficiency of two-photon absorbing chromophores.

    PubMed

    Lanoë, Pierre-Henri; Gallavardin, Thibault; Dupin, Aurore; Maury, Olivier; Baldeck, Patrice L; Lindgren, Mikael; Monnereau, Cyrille; Andraud, Chantal

    2012-08-21

    A molecular engineering strategy based on rational variations of the bromine substitution pattern in two-photon absorbing singlet oxygen sensitizers allows studying the relations that exist between the positioning of an inter-system crossing promoter on the charge-transfer chromophore and its ability to generate singlet oxygen.

  2. Substitution patterns in aromatic rings by increment analysis. Model development and application to natural organic matter.

    PubMed

    Perdue, E M; Hertkorn, N; Kettrup, A

    2007-02-01

    The aromatic region of two-dimensional heteronuclear 1H, 13C NMR spectra of natural organic matter and related materials (e.g., 1H and 13C chemical shifts ranging from approximately 5 to 10 and 80 to 140 ppm, respectively) is highly complex and difficult to interpret using conventional approaches. In principle, this region of the NMR spectrum should be amenable to detailed analysis, because the effects of many common substituents on the chemical shifts of aromatic carbon and hydrogen are well documented. This paper describes the development of a model for prediction of substitution patterns in aromatic rings by increment analysis (SPARIA). In the forward mode, SPARIA is used to predict the chemical shifts of 1H and 13C on aromatic moieties containing every possible combination of eight common substituents that are likely to be representative of substituents on aromatic moieties in natural organic matter. The accuracy of SPARIA in the forward mode is evaluated for 29 aromatic compounds (100 peaks) by comparison of predicted chemical shifts for 1H and 13C with experimental values and with predictions of commercially available software for prediction of NMR spectra. The most important development in this paper is the inverse mode that is built into SPARIA. Given chemical shifts for 1H and 13C (such as may be obtained from a two-dimensional, heteronuclear NMR spectrum), the inverse mode of SPARIA calculates all possible combinations of the eight selected substituents that yield chemical shifts within a specified window of chemical shift for both 1H and 13C. Both the distribution of possible substitution patterns and simple descriptive statistics of the distribution are thus obtained. The inverse mode of SPARIA has been tested on the 29 aromatic compounds (100 peaks) that were used to evaluate its forward mode, and the dependence of the inverse process on the size of the chemical shift window has been evaluated. Finally, the inverse mode of SPARIA has been applied to

  3. A genome-wide scan study identifies a single nucleotide substitution in ASIP associated with white versus non-white coat-colour variation in sheep (Ovis aries).

    PubMed

    Li, M-H; Tiirikka, T; Kantanen, J

    2014-02-01

    In sheep, coat colour (and pattern) is one of the important traits of great biological, economic and social importance. However, the genetics of sheep coat colour has not yet been fully clarified. We conducted a genome-wide association study of sheep coat colours by genotyping 47 303 single-nucleotide polymorphisms (SNPs) in the Finnsheep population in Finland. We identified 35 SNPs associated with all the coat colours studied, which cover genomic regions encompassing three known pigmentation genes (TYRP1, ASIP and MITF) in sheep. Eighteen of these associations were confirmed in further tests between white versus non-white individuals, but none of the 35 associations were significant in the analysis of only non-white colours. Across the tests, the s66432.1 in ASIP showed significant association (P=4.2 × 10(-11) for all the colours; P=2.3 × 10(-11) for white versus non-white colours) with the variation in coat colours and strong linkage disequilibrium with other significant variants surrounding the ASIP gene. The signals detected around the ASIP gene were explained by differences in white versus non-white alleles. Further, a genome scan for selection for white coat pigmentation identified a strong and striking selection signal spanning ASIP. Our study identified the main candidate gene for the coat colour variation between white and non-white as ASIP, an autosomal gene that has been directly implicated in the pathway regulating melanogenesis. Together with ASIP, the two other newly identified genes (TYRP1 and MITF) in the Finnsheep, bordering associated SNPs, represent a new resource for enriching sheep coat-colour genetics and breeding.

  4. A genome-wide scan study identifies a single nucleotide substitution in ASIP associated with white versus non-white coat-colour variation in sheep (Ovis aries)

    PubMed Central

    Li, M-H; Tiirikka, T; Kantanen, J

    2014-01-01

    In sheep, coat colour (and pattern) is one of the important traits of great biological, economic and social importance. However, the genetics of sheep coat colour has not yet been fully clarified. We conducted a genome-wide association study of sheep coat colours by genotyping 47 303 single-nucleotide polymorphisms (SNPs) in the Finnsheep population in Finland. We identified 35 SNPs associated with all the coat colours studied, which cover genomic regions encompassing three known pigmentation genes (TYRP1, ASIP and MITF) in sheep. Eighteen of these associations were confirmed in further tests between white versus non-white individuals, but none of the 35 associations were significant in the analysis of only non-white colours. Across the tests, the s66432.1 in ASIP showed significant association (P=4.2 × 10−11 for all the colours; P=2.3 × 10−11 for white versus non-white colours) with the variation in coat colours and strong linkage disequilibrium with other significant variants surrounding the ASIP gene. The signals detected around the ASIP gene were explained by differences in white versus non-white alleles. Further, a genome scan for selection for white coat pigmentation identified a strong and striking selection signal spanning ASIP. Our study identified the main candidate gene for the coat colour variation between white and non-white as ASIP, an autosomal gene that has been directly implicated in the pathway regulating melanogenesis. Together with ASIP, the two other newly identified genes (TYRP1 and MITF) in the Finnsheep, bordering associated SNPs, represent a new resource for enriching sheep coat-colour genetics and breeding. PMID:24022497

  5. Presence of nucleotide substitutions in transcriptional regulatory elements such as the erythroid cell-specific enhancer-like element and the ABO promoter in individuals with phenotypes A3 and B3, respectively.

    PubMed

    Takahashi, Y; Isa, K; Sano, R; Nakajima, T; Kubo, R; Takahashi, K; Kominato, Y; Michino, J; Masuno, A; Tsuneyama, H; Ito, S; Ogasawara, K; Uchikawa, M

    2014-08-01

    An erythroid cell-specific regulatory element, referred to as the +5.8-kb site, has been identified in the first intron of the human ABO blood group gene. Subsequent studies have revealed involvement of deletion or mutation at the site in phenotypes Am , Bm and ABm . We investigated the molecular mechanisms involved in the A3 and B3 phenotypes. Genomic DNAs were prepared from peripheral blood of seven A3 individuals and twelve B3 or AB3 individuals, and the nucleotide sequences were investigated using PCR and sequencing. Promoter assays were performed with K562 cells. Two single point-mutations at +5893 or +5909 in the site on the A-allele were found in A3 individuals, while promoter assays revealed decreased activity at the site as a result of each substitution. In two B3 individuals, a single point-mutation at -77 in the ABO promoter on the B-allele was found, and the substitution was demonstrated to reduce the promoter activity. Nucleotide substitutions in the transcriptional regulatory elements such as the +5.8-kb site and the ABO promoter appear to decrease transcription from the A- and B-alleles, resulting in reduction in A- and B-antigen expression in A3 and B3, respectively. © 2014 International Society of Blood Transfusion.

  6. Analyzing generic and branded substitution patterns in the Netherlands using prescription data

    PubMed Central

    2011-01-01

    Background As in other societies, pharmaceutical expenditures in the Netherlands are rising every year. As a consequence, needs for cost control are often expressed. One possible solution for cost control could come through increasing generic substitution by pharmacists. We aim to analyse the extent and nature of substitution in recent years and estimate the likelihood of generic or branded substitution in Dutch pharmacies in relation to various characteristics. Methods We utilized a linked prescription dataset originating from a general practitioner (GP) and a pharmacy database, both from the northern Netherlands. We selected specific drugs of interest, containing about 55,000 prescriptions from 15 different classes. We used a crossed generalized linear mixed model to estimate the effects that certain patient and pharmacy characteristics as well as timing have on the likelihood that a prescription will eventually be substituted by the pharmacist. Results Generic substitution occurred at 25% of the branded prescriptions. Generic substitution was more likely to occur earlier in time after patent expiry and to patients that were older and more experienced in their drug use. Individually owned pharmacies had a lower probability of generic substitution compared to chain pharmacies. Oppositely, branded substitution occurred in 10% of generic prescriptions and was positively related to the patients' experience in branded use. Individually owned pharmacies were more likely to substitute a generic drug to a branded compared to other pharmacies. Antidepressant and PPI prescriptions were less prone to generic and more prone to branded substitution. Conclusion Analysis of prescription substitution by the pharmacist revealed strong relations between substitution and patient experience on drug use, pharmacy status and timing. These findings can be utilised to design further strategies to enhance generic substitution. PMID:21524312

  7. Patterns of Substitution Rate Variation at Many Nuclear Loci in Two Species Trios in the Brassicaceae Partitioned with ANOVA.

    PubMed

    Braverman, John M; Hamilton, Matthew B; Johnson, Brent A

    2016-10-01

    There are marked variations among loci and among lineages in rates of nucleotide substitution. The generation time hypothesis (GTH) is a neutral explanation for substitution rate heterogeneity that has genomewide application, predicting that species with shorter generation times accumulate DNA sequence substitutions faster than species with longer generation times do since faster genome replication provides more opportunities for mutations to occur and reach fixation by genetic drift. Relatively few studies have rigorously evaluated the GTH in plants, and there are numerous alternative hypotheses for plant substitution rate variation. One major challenge has been finding pairs of closely related plant species with contrasting generation times and appropriate outgroup taxa that all also have DNA sequence data for numerous loci. To test for causes of rate variation, we obtained sequence data for 256 genes for Arabidopsis thaliana, normally reproducing every year, and the biennial Arabidopsis lyrata with three closely related outgroup taxa (Brassica rapa, Capsella grandiflora, and Neslia paniculata) as well as the biennial Brassica oleracea and the annual B. rapa lineage with the outgroup N. paniculata. A sign test indicated that more loci than expected by chance have faster rates of substitution on the branch leading to the annual than to the perennial for one three-species trio but not another. Tajima's 1D and 2D tests, and a likelihood ratio test that incorporated saturation correction, rejected rate homogeneity for up to 26 genes (up to 14 genes when correcting for multiple tests), consistently showing faster rates for the annual lineage in the Arabidopsis species trio. ANOVA showed significant rate heterogeneity between the Arabidopsis and Brassica species trios (about 6 % of rate variation) and among loci (about 26-32 % of rate variation). The lineage-by-locus interaction which would be caused by locus- and lineage-specific natural selection explained about 13

  8. Mating-system variation, demographic history and patterns of nucleotide diversity in the Tristylous plant Eichhornia paniculata.

    PubMed

    Ness, Rob W; Wright, Stephen I; Barrett, Spencer C H

    2010-02-01

    Inbreeding in highly selfing populations reduces effective size and, combined with demographic conditions associated with selfing, this can erode genetic diversity and increase population differentiation. Here we investigate the role that variation in mating patterns and demographic history play in shaping the distribution of nucleotide variation within and among populations of the annual neotropical colonizing plant Eichhornia paniculata, a species with wide variation in selfing rates. We sequenced 10 EST-derived nuclear loci in 225 individuals from 25 populations sampled from much of the geographic range and used coalescent simulations to investigate demographic history. Highly selfing populations exhibited moderate reductions in diversity but there was no significant difference in variation between outcrossing and mixed mating populations. Population size interacted strongly with mating system and explained more of the variation in diversity within populations. Bayesian structure analysis revealed strong regional clustering and selfing populations were highly differentiated on the basis of an analysis of F(st). There was no evidence for a significant loss of within-locus linkage disequilibrium within populations, but regional samples revealed greater breakdown in Brazil than in selfing populations from the Caribbean. Coalescent simulations indicate a moderate bottleneck associated with colonization of the Caribbean from Brazil approximately 125,000 years before the present. Our results suggest that the recent multiple origins of selfing in E. paniculata from diverse outcrossing populations result in higher diversity than expected under long-term equilibrium.

  9. Tuning the Biological Activity Profile of Antibacterial Polymers via Subunit Substitution Pattern

    PubMed Central

    2015-01-01

    Binary nylon-3 copolymers containing cationic and hydrophobic subunits can mimic the biological properties of host-defense peptides, but relationships between composition and activity are not yet well understood for these materials. Hydrophobic subunits in previously studied examples have been limited mostly to cycloalkane-derived structures, with cyclohexyl proving to be particularly promising. The present study evaluates alternative hydrophobic subunits that are isomeric or nearly isomeric with the cyclohexyl example; each has four sp3 carbons in the side chains. The results show that varying the substitution pattern of the hydrophobic subunit leads to relatively small changes in antibacterial activity but causes significant changes in hemolytic activity. We hypothesize that these differences in biological activity profile arise, at least in part, from variations among the conformational propensities of the hydrophobic subunits. The α,α,β,β-tetramethyl unit is optimal among the subunits we have examined, providing copolymers with potent antibacterial activity and excellent prokaryote vs eukaryote selectivity. Bacteria do not readily develop resistance to the new antibacterial nylon-3 copolymers. These findings suggest that variation in subunit conformational properties could be generally valuable in the development of synthetic polymers for biological applications. PMID:24601599

  10. Highly fluorinated 2,2'-biphenols and related compounds: relationship between substitution pattern and herbicidal activity.

    PubMed

    Francke, Robert; Reingruber, Rüdiger; Schollmeyer, Dieter; Waldvogel, Siegfried R

    2013-05-22

    A broad range of halogenated 2,2'-biphenols was tested for applicability as crop protection agents. The activity of these compounds toward four typical pest plants was observed after application by spraying of diluted solutions. Despite their rather simple structure, it was found that the studied compounds reveal a surprisingly high herbicidal impact. To gain a better understanding of the structure-activity relationship, specific sites of the molecule were chemically modified and the core structures thus gradually changed. The influence of the substitution pattern on the herbicidal properties is discussed, and conclusions on the active site of the biphenol structure are drawn. It was observed that type and position of the halogen substituents have a significant influence on the activity of the core structure. The hydroxy functionalities play a crucial role for the effectiveness of the tested compounds. Because the blocking of the hydroxy moiety leads to dramatically deteriorated performances, the presence of these functionalities on the aromatic ring seems to be indispensable.

  11. The effect of the Medicare Part D benzodiazepine exclusion on the utilization patterns of benzodiazepines and substitute medications.

    PubMed

    Chen, Yu-Chieh; Kreling, David H

    2014-01-01

    Although the benzodiazepine exclusion policy in the U.S. Medicare Part D drug coverage program has been studied, little information is available on individual use and switching patterns between benzodiazepines and substitute medications. Patients voluntarily were continuing or stopping benzodiazepines or switching to substitute medications. These individual-level outcomes can provide information beneficial to providers and policymakers to better understand the intended and unintended consequences of exclusion policies. The objective was to determine the effect of the Medicare Part D benzodiazepine exclusion on the utilization patterns of benzodiazepines and substitute medications by a select group of Medicare beneficiaries for a year following implementation of the exclusion. This research focused on the examination of the within-person patterns of benzodiazepine use and factors associated with these patterns. A quasi-experimental, comparative study was used to analyze prescription patterns and multinomial regression models were applied to investigate factors predicting different benzodiazepine use patterns. Pharmacy dispensing data for continuously eligible Medicare beneficiaries with at least one benzodiazepine fill in 2005 were reduced to a comparison group of 216 individuals with continual coverage and an intervention group of 250 individuals who lost coverage for benzodiazepines. Four individual patients' drug use patterns, continuation, switch, fluid movement, and cessation were identified by sorting and arraying pharmacy dispensing data to apply systematic drug file review. Multinomial regression models were used to examine the impact of coverage, demographic, medical, economic, and pharmaceutical factors. Significantly more Medicare seniors who lost benzodiazepine coverage switched to potential substitute medications than those who continued to have coverage. Interestingly, 12 percent of affected seniors and 6 percent of unaffected seniors switched from and

  12. Seafood Substitutions Obscure Patterns of Mercury Contamination in Patagonian Toothfish (Dissostichus eleginoides) or “Chilean Sea Bass”

    PubMed Central

    Marko, Peter B.; Nance, Holly A.; van den Hurk, Peter

    2014-01-01

    Seafood mislabeling distorts the true abundance of fish in the sea, defrauds consumers, and can also cause unwanted exposure to harmful pollutants. By combining genetic data with analyses of total mercury content, we have investigated how species substitutions and fishery-stock substitutions obscure mercury contamination in Patagonian toothfish (Dissostichus eleginoides), also known as “Chilean sea bass”. Patagonian toothfish show wide variation in mercury concentrations such that consumers may be exposed to either acceptable or unacceptable levels of mercury depending on the geographic origins of the fish and the allowable limits of different countries. Most notably, stocks of Patagonian toothfish in Chile accumulate significantly more mercury than stocks closer to the South Pole, including the South Georgia/Shag Rocks stock, a fishery certified by the Marine Stewardship Council (MSC) as sustainably fished. Consistent with the documented geography of mercury contamination, our analysis showed that, on average, retail fish labeled as MSC-certified Patagonian toothfish had only half the mercury of uncertified fish. However, consideration of genetic data that were informative about seafood substitutions revealed a complex pattern of contamination hidden from consumers: species substitutions artificially inflated the expected difference in mercury levels between MSC-certified and uncertified fish whereas fishery stock substitutions artificially reduced the expected difference in mercury content between MSC-certified and uncertified fish that were actually D. eleginoides. Among MSC-certified fish that were actually D. eleginoides, several with exogenous mtDNA haplotypes (i.e., not known from the certified fishery) had mercury concentrations on par with uncertified fish from Chile. Overall, our analysis of mercury was consistent with inferences from the genetic data about the geographic origins of the fish, demonstrated the potential negative impact of seafood

  13. Evolution of Xylan Substitution Patterns in Gymnosperms and Angiosperms: Implications for Xylan Interaction with Cellulose1[CC-BY

    PubMed Central

    Li, An; Gomes, Thiago C.F.

    2016-01-01

    The interaction between cellulose and xylan is important for the load-bearing secondary cell wall of flowering plants. Based on the precise, evenly spaced pattern of acetyl and glucuronosyl (MeGlcA) xylan substitutions in eudicots, we recently proposed that an unsubstituted face of xylan in a 2-fold helical screw can hydrogen bond to the hydrophilic surfaces of cellulose microfibrils. In gymnosperm cell walls, any role for xylan is unclear, and glucomannan is thought to be the important cellulose-binding polysaccharide. Here, we analyzed xylan from the secondary cell walls of the four gymnosperm lineages (Conifer, Gingko, Cycad, and Gnetophyta). Conifer, Gingko, and Cycad xylan lacks acetylation but is modified by arabinose and MeGlcA. Interestingly, the arabinosyl substitutions are located two xylosyl residues from MeGlcA, which is itself placed precisely on every sixth xylosyl residue. Notably, the Gnetophyta xylan is more akin to early-branching angiosperms and eudicot xylan, lacking arabinose but possessing acetylation on alternate xylosyl residues. All these precise substitution patterns are compatible with gymnosperm xylan binding to hydrophilic surfaces of cellulose. Molecular dynamics simulations support the stable binding of 2-fold screw conifer xylan to the hydrophilic face of cellulose microfibrils. Moreover, the binding of multiple xylan chains to adjacent planes of the cellulose fibril stabilizes the interaction further. Our results show that the type of xylan substitution varies, but an even pattern of xylan substitution is maintained among vascular plants. This suggests that 2-fold screw xylan binds hydrophilic faces of cellulose in eudicots, early-branching angiosperm, and gymnosperm cell walls. PMID:27325663

  14. Selectivity in the Addition Reactions of Organometallic Reagents to Aziridine-2-carboxaldehydes: The Effects of Protecting Groups and Substitution Patterns

    PubMed Central

    Kulshrestha, Aman; Schomaker, Jennifer M.; Holmes, Daniel; Staples, Richard J.; Jackson, James E.; Borhan, Babak

    2014-01-01

    Good to excellent stereo-selectivity has been found in the addition reactions of Grignard and organo-zinc reagents to N-protected aziridine-2-carboxaldehydes. Specifically, high syn selectivity was obtained with benzyl-protected cis, tert-butyloxycar-bonyl-protected trans, and tosyl-pro-tected 2,3-disubstituted aziridine-2-car-boxaldehydes. Furthermore, rate and selectivity effects of ring substituents, temperature, solvent, and Lewis acid and base modifiers were studied. The diastereomeric preference of addition is dominated by the substrate aziri-dines’ substitution pattern and especially the electronic character and conformational preferences of the nitrogen protecting groups. To help rationalize the observed stereochemical outcomes, conformational and electronic structural analyses of a series of model systems representing the various substitution patterns have been explored by density functional calculations at the B3LYP/6–31G* level of theory with the SM8 solvation model to account for solvent effects. PMID:21928447

  15. An Autosomal Dominant Cerebellar Ataxia Linked to Chromosome 16q22.1 Is Associated with a Single-Nucleotide Substitution in the 5′ Untranslated Region of the Gene Encoding a Protein with Spectrin Repeat and Rho Guanine-Nucleotide Exchange-Factor Domains

    PubMed Central

    Ishikawa, Kinya; Toru, Shuta; Tsunemi, Taiji; Li, Mingshun; Kobayashi, Kazuhiro; Yokota, Takanori; Amino, Takeshi; Owada, Kiyoshi; Fujigasaki, Hiroto; Sakamoto, Masaki; Tomimitsu, Hiroyuki; Takashima, Minoru; Kumagai, Jiro; Noguchi, Yoshihiro; Kawashima, Yoshiyuki; Ohkoshi, Norio; Ishida, Gen; Gomyoda, Manabu; Yoshida, Mari; Hashizume, Yoshio; Saito, Yuko; Murayama, Shigeo; Yamanouchi, Hiroshi; Mizutani, Toshio; Kondo, Ikuko; Toda, Tatsushi; Mizusawa, Hidehiro

    2005-01-01

    Autosomal dominant cerebellar ataxia (ADCA) is a group of heterogeneous neurodegenerative disorders. By positional cloning, we have identified the gene strongly associated with a form of degenerative ataxia (chromosome 16q22.1–linked ADCA) that clinically shows progressive pure cerebellar ataxia. Detailed examination by use of audiogram suggested that sensorineural hearing impairment may be associated with ataxia in our families. After restricting the candidate region in chromosome 16q22.1 by haplotype analysis, we found that all patients from 52 unrelated Japanese families harbor a heterozygous C→T single-nucleotide substitution, 16 nt upstream of the putative translation initiation site of the gene for a hypothetical protein DKFZP434I216, which we have called “puratrophin-1” (Purkinje cell atrophy associated protein-1). The full-length puratrophin-1 mRNA had an open reading frame of 3,576 nt, predicted to contain important domains, including the spectrin repeat and the guanine-nucleotide exchange factor (GEF) for Rho GTPases, followed by the Dbl-homologous domain, which indicates the role of puratrophin-1 in intracellular signaling and actin dynamics at the Golgi apparatus. Puratrophin-1—normally expressed in a wide range of cells, including epithelial hair cells in the cochlea—was aggregated in Purkinje cells of the chromosome 16q22.1–linked ADCA brains. Consistent with the protein prediction data of puratrophin-1, the Golgi-apparatus membrane protein and spectrin also formed aggregates in Purkinje cells. The present study highlights the importance of the 5′ untranslated region (UTR) in identification of genes of human disease, suggests that a single-nucleotide substitution in the 5′ UTR could be associated with protein aggregation, and indicates that the GEF protein is associated with cerebellar degeneration in humans. PMID:16001362

  16. Ice crystal patterns in artificial gels of extracellular matrix macromolecules after quick-freezing and freeze-substitution.

    PubMed

    Allenspach, A L; Kraemer, T G

    1989-04-01

    Artificial gels, composed of collagen with or without hyaluronate (HA), a glycosaminoglycan (GAG), and chondroitin sulfate (CS), were prepared and quick-frozen for the purpose of studying the influence of composition and concentration on ice patterns. Dilute gels were spread on coverslips, plunged into a slush of 30% isopentane/70% propane (-185 degrees C), freeze-substituted, and examined by phase-contrast microscopy. Ice patterns were revealed as "ice cavities" in the gel after freeze-substitution. Ice morphology in the gels was gel-type-specific, suggesting that composition in dilute gels can influence ice pattern formation. Crystallization patterns reflecting high, intermediate, and low rates of freezing were observed in all gel types. Intermediate freezing in differentiating gel-type-specific ice patterns. Gels which included hyaluronate (HA) and chondroitin sulfate (CS) altered the ice crystal pattern commonly observed in collagen gels. Ice structure in collagen gels consisted predominantly of long, parallel crystals in the herringbone pattern. Ice crystals separated gel into thin, unbranched fibers with a primary spacing of approximately 2 microns. Ice morphology in HA gels formed a mosaic consisting of packets of ice crystals. Contiguous packets were often oriented at right angles to each other. Periodic crossbridges interconnect primary gel fibers of HA gels and interrupt the lengthwise growth of ice crystals. Smooth beads were visible on primary strands in HA gels frozen at intermediate velocities. The addition of CS to collagen gels resulted in formation of randomly oriented ice crystals in gels frozen at intermediate rates. CS has little influence on ice morphology at low freezing velocities. Primary strands in CS gels were decorated with rough-surfaced, osmiophilic aggregates.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. Insight into pattern of codon biasness and nucleotide base usage in serotonin receptor gene family from different mammalian species.

    PubMed

    Dass, J Febin Prabhu; Sudandiradoss, C

    2012-07-15

    5-HT (5-Hydroxy-tryptamine) or serotonin receptors are found both in central and peripheral nervous system as well as in non-neuronal tissues. In the animal and human nervous system, serotonin produces various functional effects through a variety of membrane bound receptors. In this study, we focus on 5-HT receptor family from different mammals and examined the factors that account for codon and nucleotide usage variation. A total of 110 homologous coding sequences from 11 different mammalian species were analyzed using relative synonymous codon usage (RSCU), correspondence analysis (COA) and hierarchical cluster analysis together with nucleotide base usage frequency of chemically similar amino acid codons. The mean effective number of codon (ENc) value of 37.06 for 5-HT(6) shows very high codon bias within the family and may be due to high selective translational efficiency. The COA and Spearman's rank correlation reveals that the nucleotide compositional mutation bias as the major factors influencing the codon usage in serotonin receptor genes. The hierarchical cluster analysis suggests that gene function is another dominant factor that affects the codon usage bias, while species is a minor factor. Nucleotide base usage was reported using Goldman, Engelman, Stietz (GES) scale reveals the presence of high uracil (>45%) content at functionally important hydrophobic regions. Our in silico approach will certainly help for further investigations on critical inference on evolution, structure, function and gene expression aspects of 5-HT receptors family which are potential antipsychotic drug targets.

  18. Assessing substitution patterns, rates and homoplasy at HVRI of Steller sea lions, Eumetopias jubatus.

    PubMed

    Phillips, C D; Trujillo, R G; Gelatt, T S; Smolen, M J; Matson, C W; Honeycutt, R L; Patton, J C; Bickham, J W

    2009-08-01

    Despite the widely recognized incidence of homoplasy characterizing this region, the hypervariable region I (HVRI) of the mitochondrial control region is one of the most frequently used genetic markers for population genetic and phylogeographic studies. We present an evolutionary analysis of HVRI and cytochrome b sequences from a range-wide survey of 1031 Steller sea lions, Eumetopias jubatus, to quantify homoplasy and substitution rate at HVRI. Variation in HVRI was distributed across 41 variable sites in the 238-bp segment examined. All variants at HVR1 were found to be transitions. However, our analyses suggest that a minimum of 101 changes have actually occurred within HVRI with as many as 18 substitutions occurring at a single site. By including this hidden variation into our analyses, several instances of apparent long-range dispersal were resolved to be homoplasies and 8.5-12% of observed HVRI haplotypes were found to have geographic distributions descriptive of convergent molecular evolution rather than identity by descent. We estimate the rate of substitution at HVRI in Steller sea lions to be approximately 24 times that of cytochrome b with an absolute rate of HVRI substitution estimated at 27.45% per million years. These findings have direct implications regarding the utility of HVRI data to generate a variety of evolutionary genetic hypotheses.

  19. Tumor Targeting with Novel 6-Substituted Pyrrolo [2,3-d] Pyrimidine Antifolates with Heteroatom Bridge Substitutions via Cellular Uptake by Folate Receptor α and the Proton-Coupled Folate Transporter and Inhibition of de Novo Purine Nucleotide Biosynthesis.

    PubMed

    Golani, Lalit K; Wallace-Povirk, Adrianne; Deis, Siobhan M; Wong, Jennifer; Ke, Jiyuan; Gu, Xin; Raghavan, Sudhir; Wilson, Mike R; Li, Xinxin; Polin, Lisa; de Waal, Parker W; White, Kathryn; Kushner, Juiwanna; O'Connor, Carrie; Hou, Zhanjun; Xu, H Eric; Melcher, Karsten; Dann, Charles E; Matherly, Larry H; Gangjee, Aleem

    2016-09-08

    Targeted antifolates with heteroatom replacements of the carbon vicinal to the phenyl ring in 1 by N (4), O (8), or S (9), or with N-substituted formyl (5), acetyl (6), or trifluoroacetyl (7) moieties, were synthesized and tested for selective cellular uptake by folate receptor (FR) α and β or the proton-coupled folate transporter. Results show increased in vitro antiproliferative activity toward engineered Chinese hamster ovary cells expressing FRs by 4-9 over the CH2 analogue 1. Compounds 4-9 inhibited de novo purine biosynthesis and glycinamide ribonucleotide formyltransferase (GARFTase). X-ray crystal structures for 4 with FRα and GARFTase showed that the bound conformations of 4 required flexibility for attachment to both FRα and GARFTase. In mice bearing IGROV1 ovarian tumor xenografts, 4 was highly efficacious. Our results establish that heteroatom substitutions in the 3-atom bridge region of 6-substituted pyrrolo[2,3-d]pyrimidines related to 1 provide targeted antifolates that warrant further evaluation as anticancer agents.

  20. Route of administration influences substitution patterns in rats trained to discriminate methadone vs. vehicle.

    PubMed

    Vann, Robert E; Wise, Laura E; Varvel, Stephen A; Philibin, Scott D; Walentiny, D Matthew; Porter, Joseph H

    2009-08-01

    Replacement therapy with the synthetic mu-opioid agonist methadone is an efficacious treatment for opioid abuse. While much is known about methadone's pharmacology, its discriminative stimulus properties remain largely unexplored. The present study sought to establish methadone discrimination in rats. Moreover, some research suggests that route of administration alters the discriminative stimulus of methadone. Thus, the present study also compared intraperitoneal (i.p.) and subcutaneous (s.c.) routes of administration. Male Sprague-Dawley rats were trained to discriminate 3.0mg/kg methadone (i.p.) from vehicle in a two-lever discrimination procedure. Generalization tests were conducted with a variety of compounds administered i.p. and s.c. Methadone fully substituted for itself, yielding ED(50)s of 1.5mg/kg (i.p.) and 0.2mg/kg (s.c.). Naltrexone (i.p.), an opioid antagonist produced a dose-dependent reduction in methadone-appropriate responding. The methadone stereoisomers fully substituted for methadone when given s.c.; however, when administered i.p., (+) and (-) methadone produced partial and no substitution, respectively. Heroin fully generalized to methadone regardless of administration route, while morphine fully substituted when given s.c., but not i.p. The kappa-agonist U50-488 failed to generalize to methadone with either route of administration. These results demonstrated that methadone's discriminative stimulus is mediated through mu-opioid receptor activity and is similar to that of commonly abused opioids (heroin, morphine). Additionally, route of administration produced differential results for many of the drugs tested, suggesting decreased drug bioavailability following i.p. administration due to hepatic first pass metabolism. Taken together, these results suggest that methadone's shared subjective effects with abused opioids, as well as its unique metabolic properties contribute to its efficacy in opioid maintenance therapy.

  1. Decreased Nucleotide and Expression Diversity and Modified Coexpression Patterns Characterize Domestication in the Common Bean[W][OPEN

    PubMed Central

    Bellucci, Elisa; Bitocchi, Elena; Ferrarini, Alberto; Benazzo, Andrea; Biagetti, Eleonora; Klie, Sebastian; Minio, Andrea; Rau, Domenico; Rodriguez, Monica; Panziera, Alex; Venturini, Luca; Attene, Giovanna; Albertini, Emidio; Jackson, Scott A.; Nanni, Laura; Fernie, Alisdair R.; Nikoloski, Zoran; Bertorelle, Giorgio; Delledonne, Massimo; Papa, Roberto

    2014-01-01

    Using RNA sequencing technology and de novo transcriptome assembly, we compared representative sets of wild and domesticated accessions of common bean (Phaseolus vulgaris) from Mesoamerica. RNA was extracted at the first true-leaf stage, and de novo assembly was used to develop a reference transcriptome; the final data set consists of ∼190,000 single nucleotide polymorphisms from 27,243 contigs in expressed genomic regions. A drastic reduction in nucleotide diversity (∼60%) is evident for the domesticated form, compared with the wild form, and almost 50% of the contigs that are polymorphic were brought to fixation by domestication. In parallel, the effects of domestication decreased the diversity of gene expression (18%). While the coexpression networks for the wild and domesticated accessions demonstrate similar seminal network properties, they show distinct community structures that are enriched for different molecular functions. After simulating the demographic dynamics during domestication, we found that 9% of the genes were actively selected during domestication. We also show that selection induced a further reduction in the diversity of gene expression (26%) and was associated with 5-fold enrichment of differentially expressed genes. While there is substantial evidence of positive selection associated with domestication, in a few cases, this selection has increased the nucleotide diversity in the domesticated pool at target loci associated with abiotic stress responses, flowering time, and morphology. PMID:24850850

  2. Global mRNA decay analysis at single nucleotide resolution reveals segmental and positional degradation patterns in a Gram-positive bacterium

    PubMed Central

    2012-01-01

    Background Recent years have shown a marked increase in the use of next-generation sequencing technologies for quantification of gene expression (RNA sequencing, RNA-Seq). The expression level of a gene is a function of both its rate of transcription and RNA decay, and the influence of mRNA decay rates on gene expression in genome-wide studies of Gram-positive bacteria is under-investigated. Results In this work, we employed RNA-Seq in a genome-wide determination of mRNA half-lives in the Gram-positive bacterium Bacillus cereus. By utilizing a newly developed normalization protocol, RNA-Seq was used successfully to determine global mRNA decay rates at the single nucleotide level. The analysis revealed positional degradation patterns, with mRNAs being degraded from both ends of the molecule, indicating that both 5' to 3' and 3' to 5' directions of RNA decay are present in B. cereus. Other operons showed segmental degradation patterns where specific ORFs within polycistrons were degraded at variable rates, underlining the importance of RNA processing in gene regulation. We determined the half-lives for more than 2,700 ORFs in B. cereus ATCC 10987, ranging from less than one minute to more than fifteen minutes, and showed that mRNA decay rate correlates globally with mRNA expression level, GC content, and functional class of the ORF. Conclusions To our knowledge, this study presents the first global analysis of mRNA decay in a bacterium at single nucleotide resolution. We provide a proof of principle for using RNA-Seq in bacterial mRNA decay analysis, revealing RNA processing patterns at the single nucleotide level. PMID:22537947

  3. Dependence of mass spectrometric fragmentation on the bromine substitution pattern of polybrominated diphenyl ethers.

    PubMed

    Wei, Hua; Zhang, Siyu; Wang, Yawei; Wang, Ying; Li, An; Negrusz, Adam; Yu, Gang

    2014-06-01

    This study investigates the link between the bromine substitution and the mass spectrometric fragmentation of polybrominated diphenyl ethers (PBDEs). The mass spectra of 180 PBDEs were obtained in both electron impact (EI) and electron capture negative ionization (ECNI) modes using a single quadrupole mass spectrometer (MS) as well as EI using a tandem MS (MS/MS). The major ions are M(+), [M-2Br](+), [M-2Br](2+) and [M-nBr-28](+) in EI, and Br(-), [HBr2](-) and [C6BrnO](-) in ECNI. In EI-MS, congeners without ortho bromine or having 2,3 substitution on one ring and no ortho bromines on the other were more robust than the others in each homolog. These congeners generated low [M-2Br](+) but relatively high [M-2Br](2+) in EI-MS and negligible [HBr2](-) in ECNI-MS. In EI-MS/MS, the molecular ions of these congeners required higher collision energy to debrominate, and produced additional ions of [M-nBr](+) and [M-nBr-28](+). Full ortho substitution promotes C-O cleavage forming [C6BrnO](-) in ECNI for congeners with >5 bromines. The relationship between the abundance of M(+) and collision energy of the EI-MS/MS was well characterized with a logistic regression model. Principle component analysis found associations between the inflection point collision energy and a few molecular descriptors. Quantum chemistry simulations revealed different EI-induced fragmentation mechanisms among four dibrominated congeners, supporting the hypothesized formation of a stable dibenzofuran-like intermediate during the fragmentation of some congeners but not of others.

  4. Collision induced dissociation-based characterization of nucleotide peptides: fragmentation patterns of microcin C7-C51, an antimicrobial peptide produced by Escherichia coli.

    PubMed

    Petit, Vanessa W; Zirah, Séverine; Rebuffat, Sylvie; Tabet, Jean-Claude

    2008-08-01

    Covalent protein-nucleic acid conjugates form an original class of compounds that occur in nature or can be generated in vitro through cross-linking to investigate domains involved in protein/nucleic acid interactions. Their mass spectrometry fragmentation patterns are poorly characterized. We have used electrospray-ionization mass spectrometry (ESI-MS) combined with collision-induced dissociation (CID) to characterize microcin C7-C51, an antimicrobial nucleotide peptide that targets aspartyl-tRNA synthetase and inhibits translation. The fragments of microcin C7-C51 were analyzed in positive- and negative-ion modes and compared with those of the corresponding unmodified heptapeptide and to the derived aspartyl-adenylate. The positive- and negative-ion mode fragments of microcin C7-C51 provided information on both the nucleotide and peptide moieties. Accurate mass measurement obtained using an LTQ Orbitrap instrument was a key factor for a comprehensive interpretation of the fragments. The experimental results obtained permitted the proposal of stepwise fragmentation pathways involving ion-dipole complexes. The data provide a better understanding of nucleotide peptide fragmentation in the gas phase.

  5. Calibration of a molecular clock in tits (Paridae)--do nucleotide substitution rates of mitochondrial genes deviate from the 2% rule?

    PubMed

    Päckert, Martin; Martens, Jochen; Tietze, Dieter Thomas; Dietzen, Christian; Wink, Michael; Kvist, Laura

    2007-07-01

    The ongoing debate on the reliability of avian molecular clocks is actually based on only a small number of calibrations carried out under different assumptions with respect to the choice and constraints of calibration points or to the use of substitution models. In this study, we provide substitution rate estimates for two mitochondrial genes, cytochrome b and the control region, and age estimates for lineage splits within four subgenera of tits (Paridae: Parus, Cyanistes, Poecile and Periparus). Overall sequence divergence between cytochrome b lineages covers a range of 0.4-1.8% per million years and is thus consistent with the frequently adopted approximation for a sequence divergence between avian lineages of 1.6-2% per my. Overall rate variation is high and encompasses the 2% value in a 95% CI for model corrected data. Mean rate estimates for cytochrome b range between 1.9 and 8.9 x 10(-3) substitutions per site per lineage. Local rates differ significantly between taxonomic levels with lowest estimates for haplotype lineages. At the population/subspecies level mean sequence divergence between lineages matches the 2% rule best for most cytochrome b datasets (1.5-1.9% per my) with maximum estimates for small isolated populations like those of the Canarian P. teneriffae complex (up to 3.9% per my). Overall rate estimates for the control region range at similar values like those for cytochrome b (2.7-8.8 x 10(-3), 0.5-1.8% per my), however, within some subgenera mean rates are higher than those for cytochrome b for uncorrected sequence data. The lowest rates for both genes were calculated for coal tits of subgenus Periparus (0.04-0.6% per my). Model-corrected sequence data tend to result in higher rate estimates than uncorrected data. Increase of the gamma shape parameter goes along with a significant decrease of rate and partly age estimates, too. Divergence times for earliest deep splits within tit subgenera Periparus and Parus were dated to the mid Miocene at

  6. Molecular cloning of the plasma membrane H(+)-ATPase from Kluyveromyces lactis: a single nucleotide substitution in the gene confers ethidium bromide resistance and deficiency in K+ uptake.

    PubMed Central

    Miranda, M; Ramírez, J; Peña, A; Coria, R

    1995-01-01

    A Kluyveromyces lactis strain resistant to ethidium bromide and deficient in potassium uptake was isolated. Studies on the proton-pumping activity of the mutant strain showed that a decreased H(+)-ATPase specific activity was responsible for the observed phenotypes. The putative K. lactis PMA1 gene encoding the plasma membrane H(+)-ATPase was cloned by its ability to relieve the potassium transport defect of this mutant and by reversing its resistance to ethidium bromide. Its deduced amino acid sequence predicts a protein 899 residues long that is structurally colinear in its full length to H(+)-ATPases cloned from different yeasts, except for the presence of a variable N-terminal domain. By PCR-mediated amplification, we identified a transition from G to A that rendered the substitution of the fully conserved methionine at position 699 by isoleucine. We attribute to this amino acid change the low capacity of the mutant H(+)-ATPase to pump out protons. PMID:7730265

  7. Polarizing the Nazarov cyclization: the impact of dienone substitution pattern on reactivity and selectivity.

    PubMed

    He, Wei; Herrick, Ildiko R; Atesin, Tulay A; Caruana, Patrick A; Kellenberger, Colleen A; Frontier, Alison J

    2008-01-23

    The impact of dienone substitution on the Nazarov cyclization has been examined in detail. Substrates bearing different substituents at each of four positions on the dienone backbone were systematically probed in order to identify trends leading to higher reactivity and better selectivity. Desymmetrization of the pentadienyl cation and oxyallyl cation intermediates through placement of polarizing groups at both the C-2 and C-4 positions was found to be particularly effective. These modifications allowed cyclizations to occur in the presence of catalytic amounts of mild Lewis acids. It was also found that stereoconvergent cyclization of mixtures of E and Z isomers of alkylidene beta-ketoesters occurred via an efficient isomerization process that occurred under the reaction conditions.

  8. Splicing abnormality of integrin β4 gene (ITGB4) due to nucleotide substitutions far from splice site underlies pyloric atresia-junctional epidermolysis bullosa syndrome.

    PubMed

    Masunaga, Takuji; Niizeki, Hironori; Yasuda, Fumiyo; Yoshida, Kenji; Amagai, Masayuki; Ishiko, Akira

    2015-04-01

    Pyloric atresia-junctional epidermolysis bullosa syndrome (PA-JEB) is a rare subgroup of epidermolysis bullosa, which is inherited disorder characterized by skin fragile. PA-JEB is caused by mutation of ITGB4 or ITGA6, which encodes integrin β4 or α6, respectively. To clarify the molecular basis of PA-JEB and to expand the mutational database, we carried out the mutational analysis of a 29-year-old Japanese PA-JEB patient. Standard methods were used to prepare, PCR-amplify, and sequence DNA or mRNA in peripheral blood or skin samples, respectively. Sequence analysis revealed two novel mutations in ITGB4, c.264+2TtoA and c.1762-25TtoA. The paternal c.264+2TtoA resided within a splice site consensus region and generated two splice variants resulting in a premature termination codon (PTC). The maternal c.1762-25TtoA was a unique mutation because of its location, 25 bp away from the splice site, and resided in branch-point consensus sequence. This c.1762-25TtoA substitution resulted in generation of two abnormal transcripts each with a PTC. Genotype-phenotype correlation in this case was also unique because the proband showed a non-lethal phenotype regardless of both mutations resulted in only abnormal transcripts with a PTC. The present case expands the mutational database and further elucidates the genotype-phenotype correlation for this rare disease, PA-JEB. Copyright © 2015 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  9. Substitution Pattern Reverses the Fluorescence Response of Coumarin Glycoligands upon Coordination with Silver (I)

    NASA Astrophysics Data System (ADS)

    Shi, De-Tai; Wei, Xiao-Li; Sheng, Yayun; Zang, Yi; He, Xiao-Peng; Xie, Juan; Liu, Guixia; Tang, Yun; Li, Jia; Chen, Guo-Rong

    2014-03-01

    Development of sugar-based fluorescence (FL) chemo-probes is of much interest since sugars are biocompatible, water-soluble and structurally rigid natural starting materials. We report here that fluorescent glycoligands with two triazolyl coumarin moieties installed onto the different positions of an identical glucosyl nucleus exert completely reversed optical response to a metal ion. C3,4-, C2,3- and C4,6-di-substituted coumarin glucosides synthesized by a click reaction similarly showed a selective FL variation in the presence of silver (I) among a range of metal cations in an aqueous solution. However, the variation was determined to be converse: the FL of the C3,4-ligand was quenched whereas that of the C2,3/C4,6-ligand tangibly enhanced. FL and NMR titrations suggested that this divergence was due to the distinct complexation modes of the conformationally constrained ligands with the ion. The optimal motifs of the ligand-ion complexation were predicted by a computational simulation. Finally, the C2,3-ligand was determined to be of low cytotoxicity and applicable in the FL imaging of silver ions internalized by live cells.

  10. Analysis of the structural diversity, substitution patterns, and frequency of nitrogen heterocycles among U.S. FDA approved pharmaceuticals.

    PubMed

    Vitaku, Edon; Smith, David T; Njardarson, Jon T

    2014-12-26

    Nitrogen heterocycles are among the most significant structural components of pharmaceuticals. Analysis of our database of U.S. FDA approved drugs reveals that 59% of unique small-molecule drugs contain a nitrogen heterocycle. In this review we report on the top 25 most commonly utilized nitrogen heterocycles found in pharmaceuticals. The main part of our analysis is divided into seven sections: (1) three- and four-membered heterocycles, (2) five-, (3) six-, and (4) seven- and eight-membered heterocycles, as well as (5) fused, (6) bridged bicyclic, and (7) macrocyclic nitrogen heterocycles. Each section reveals the top nitrogen heterocyclic structures and their relative impact for that ring type. For the most commonly used nitrogen heterocycles, we report detailed substitution patterns, highlight common architectural cores, and discuss unusual or rare structures.

  11. The nucleotide excision repair (NER) system of Helicobacter pylori: Role in mutation prevention and chromosomal import patterns after natural transformation

    PubMed Central

    2012-01-01

    Background Extensive genetic diversity and rapid allelic diversification are characteristics of the human gastric pathogen Helicobacter pylori, and are believed to contribute to its ability to cause chronic infections. Both a high mutation rate and frequent imports of short fragments of exogenous DNA during mixed infections play important roles in generating this allelic diversity. In this study, we used a genetic approach to investigate the roles of nucleotide excision repair (NER) pathway components in H. pylori mutation and recombination. Results Inactivation of any of the four uvr genes strongly increased the susceptibility of H. pylori to DNA damage by ultraviolet light. Inactivation of uvrA and uvrB significantly decreased mutation frequencies whereas only the uvrA deficient mutant exhibited a significant decrease of the recombination frequency after natural transformation. A uvrC mutant did not show significant changes in mutation or recombination rates; however, inactivation of uvrC promoted the incorporation of significantly longer fragments of donor DNA (2.2-fold increase) into the recipient chromosome. A deletion of uvrD induced a hyper-recombinational phenotype. Conclusions Our data suggest that the NER system has multiple functions in the genetic diversification of H. pylori, by contributing to its high mutation rate, and by controlling the incorporation of imported DNA fragments after natural transformation. PMID:22559785

  12. Nucleotide sequence and spatial expression pattern of a drought- and abscisic Acid-induced gene of tomato.

    PubMed

    Plant, A L; Cohen, A; Moses, M S; Bray, E A

    1991-11-01

    The nucleotide sequence of le16, a tomato (Lycopersicon esculentum Mill.) gene induced by drought stress and regulated by abscisic acid specifically in aerial vegetative tissue, is presented. The single open reading frame contained within the gene has the capacity to encode a polypeptide of 12.7 kilodaltons and is interrupted by a small intron. The predicted polypeptide is rich in leucine, glycine, and alanine and has an isoelectric point of 8.7. The amino terminus is hydrophobic and characteristic of signal sequences that target polypeptides for export from the cytoplasm. There is homology (47.2% identity) between the amino terminus of the LE 16 polypeptide and the corresponding amino terminal domain of the maize phospholipid transfer protein. le16 was expressed in drought-stressed leaf, petiole, and stem tissue and to a much lower extent in the pericarp of mature green tomato fruit and developing seeds. No expression was detected in the pericarp of red fruit or in drought-stressed roots. Expression of le16 was also induced in leaf tissue by a variety of other abiotic stresses including polyethylene glycol-mediated water deficit, salinity, cold stress, and heat stress. None of these stresses or direct applications of abscisic acid induced the expression of le16 in the roots of the same plants. The unique expression characteristics of this gene indicates that novel regulatory mechanisms, in addition to endogenous abscisic acid, are involved in controlling gene expression.

  13. Patterns of DNA sequence variation at candidate gene loci in black poplar (Populus nigra L.) as revealed by single nucleotide polymorphisms.

    PubMed

    Chu, Yanguang; Su, Xiaohua; Huang, Qinjun; Zhang, Xianghua

    2009-11-01

    Black poplar (Populus nigra L.) is an economically and ecologically important tree species and an ideal organism for studies of genetic variation. In the present work, we use a candidate gene approach to infer the patterns of DNA variation in natural populations of this species. A total of 312 single nucleotide polymorphisms (SNPs) are found among 8,056 bp sequenced from nine drought-adaptation and photosynthesis-related gene loci. The median SNP frequency is one site per 26 bp. The average nucleotide diversity is calculated to be theta(W) = 0.01074 and pi(T) = 0.00702, higher values than those observed in P. tremula, P. trichocarpa and most conifer species. Tests of neutrality for each gene reveal a general excess of low-frequency mutations, a greater number of haplotypes than expected and an excess of high-frequency derived variants in P. nigra, which is consistent with previous findings that genetic hitchhiking has occurred in this species. Linkage disequilibrium is low, decaying rapidly from 0.45 to 0.20 or less within a distance of 300 bp, although the declines of r(2) are variable among different loci. This is similar to the rate of decay reported in most other tree species. Our dataset is expected to enhance understanding of how evolutionary forces shape genetic variation, and it will contribute to molecular breeding in black poplar.

  14. Abnormal N-glycosylation pattern for brain nucleotide pyrophosphatase-5 (NPP-5) in Mecp2-mutant murine models of Rett syndrome.

    PubMed

    Cortelazzo, Alessio; De Felice, Claudio; Guerranti, Roberto; Signorini, Cinzia; Leoncini, Silvia; Pecorelli, Alessandra; Scalabrì, Francesco; Madonna, Michele; Filosa, Stefania; Della Giovampaola, Cinzia; Capone, Antonietta; Durand, Thierry; Mirasole, Cristiana; Zolla, Lello; Valacchi, Giuseppe; Ciccoli, Lucia; Guy, Jacky; D'Esposito, Maurizio; Hayek, Joussef

    2016-04-01

    Neurological disorders can be associated with protein glycosylation abnormalities. Rett syndrome is a devastating genetic brain disorder, mainly caused by de novo loss-of-function mutations in the methyl-CpG binding protein 2 (MECP2) gene. Although its pathogenesis appears to be closely associated with a redox imbalance, no information on glycosylation is available. Glycoprotein detection strategies (i.e., lectin-blotting) were applied to identify target glycosylation changes in the whole brain of Mecp2 mutant murine models of the disease. Remarkable glycosylation pattern changes for a peculiar 50kDa protein, i.e., the N-linked brain nucleotide pyrophosphatase-5 were evidenced, with decreased N-glycosylation in the presymptomatic and symptomatic mutant mice. Glycosylation changes were rescued by selected brain Mecp2 reactivation. Our findings indicate that there is a causal link between the amount of Mecp2 and the N-glycosylation of NPP-5.

  15. Insertions/Deletions-Associated Nucleotide Polymorphism in Arabidopsis thaliana

    PubMed Central

    Guo, Changjiang; Du, Jianchang; Wang, Long; Yang, Sihai; Mauricio, Rodney; Tian, Dacheng; Gu, Tingting

    2016-01-01

    Although high levels of within-species variation are commonly observed, a general mechanism for the origin of such variation is still lacking. Insertions and deletions (indels) are a widespread feature of genomes and we hypothesize that there might be an association between indels and patterns of nucleotide polymorphism. Here, we investigate flanking sequences around 18 indels (>100 bp) among a large number of accessions of the plant, Arabidopsis thaliana. We found two distinct haplotypes, i.e., a nucleotide dimorphism, present around each of these indels and dimorphic haplotypes always corresponded to the indel-present/-absent patterns. In addition, the peaks of nucleotide diversity between the two divergent alleles were closely associated with these indels. Thus, there exists a close association between indels and dimorphisms. Further analysis suggests that indel-associated substitutions could be an important component of genetic variation shaping nucleotide polymorphism in Arabidopsis. Finally, we suggest a mechanism by which indels might generate these highly divergent haplotypes. This study provides evidence that nucleotide dimorphisms, which are frequently regarded as evidence of frequency-dependent selection, could be explained simply by structural variation in the genome. PMID:27965694

  16. Influence of aromatic substitution patterns on azo dye degradability by Streptomyces spp. and Phanerochaete chrysosporium.

    PubMed Central

    Pasti-Grigsby, M B; Paszczynski, A; Goszczynski, S; Crawford, D L; Crawford, R L

    1992-01-01

    Twenty-two azo dyes were used to study the influence of substituents on azo dye biodegradability and to explore the possibility of enhancing the biodegradabilities of azo dyes without affecting their properties as dyes by changing their chemical structures. Streptomyces spp. and Phanerochaete chrysosporium were used in the study. None of the actinomycetes (Streptomyces rochei A10, Streptomyces chromofuscus A11, Streptomyces diastaticus A12, S. diastaticus A13, and S. rochei A14) degraded the commercially available Acid Yellow 9. Decolorization of monosulfonated mono azo dye derivatives of azobenzene by the Streptomyces spp. was observed with five azo dyes having the common structural pattern of a hydroxy group in the para position relative to the azo linkage and at least one methoxy and/or one alkyl group in an ortho position relative to the hydroxy group. The fungus P. chrysosporium attacked Acid Yellow 9 to some extent and extensively decolorized several azo dyes. A different pattern was seen for three mono azo dye derivatives of naphthol. Streptomyces spp. decolorized Orange I but not Acid Orange 12 or Orange II. P. chrysosporium, though able to transform these three azo dyes, decolorized Acid Orange 12 and Orange II more effectively than Orange I. A correlation was observed between the rate of decolorization of dyes by Streptomyces spp. and the rate of oxidative decolorization of dyes by a commercial preparation of horseradish peroxidase type II, extracellular peroxidase preparations of S. chromofuscus A11, or Mn(II) peroxidase from P. chrysosporium. Ligninase of P. chrysosporium showed a dye specificity different from that of the other oxidative enzymes.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1482183

  17. Strong positive selection and habitat-specific amino acid substitution patterns in MHC from an estuarine fish under intense pollution stress.

    PubMed

    Cohen, Sarah

    2002-11-01

    Population-level studies using the major histocompatibility complex (Mhc) have linked specific alleles with specific diseases, but data requirements are high and the power to detect disease association is low. A novel use of Mhc population surveys involves mapping allelic substitutions onto the inferred structural molecular model to show functional differentiation related to local selective pressures. In the estuarine fish Fundulus heteroclitus, populations experiencing strong differences in antigenic challenges show significant differences in amino acid substitution patterns that are reflected as variation in the structural location of changes between populations. Fish from a population genetically adapted to severe chemical pollution also show novel patterns of DNA substitution at a highly variable Mhc class II B locus including strong signals of positive selection at inferred antigen-binding sites and population-specific signatures of amino acid substitution. Heavily parasitized fish from an extreme PCB-contaminated (U.S. Environmental Protection Agency Superfund) site show enhanced population-specific substitutions in the a-helix portion of the inferred antigen-binding region. In contrast, fish from an unpolluted site show a significantly different pattern focused on the first strand of the B-pleated sheet. Whether Mhc population profile differences represent the direct effects of chemical toxicants or indirect parasite-mediated selection, the result is a composite habitat-specific signature of strong selection and evolution affecting the genetic repertoire of the major histocompatibility complex.

  18. Substantial Regional Variation in Substitution Rates in the Human Genome: Importance of GC Content, Gene Density, and Telomere-Specific Effects

    NASA Astrophysics Data System (ADS)

    Arndt, Peter F.; Hwa, Terence; Petrov, Dmitri A.

    2005-06-01

    This study presents the first global, 1 Mbp level analysis of patterns of nucleotide substitutions along the human lineage. The study is based on the analysis of a large amount of repetitive elements deposited into the human genome since the mammalian radiation, yielding a number of results that would have been difficult to obtain using the more conventional comparative method of analysis. This analysis revealed substantial and consistent variability of rates of substitution, with the variability ranging up to 2-fold among different regions. The rates of substitutions of C or G nucleotides with A or T nucleotides vary much more sharply than the reverse rates suggesting that much of that variation is due to differences in mutation rates rather than in the probabilities of fixation of C/G vs. A/T nucleotides across the genome. For all types of substitution we observe substantially more hotspots than coldspots, with hotspots showing substantial clustering over tens of Mbp's. Our analysis revealed that GC-content of surrounding sequences is the best predictor of the rates of substitution. The pattern of substitution appears very different near telomeres compared to the rest of the genome and cannot be explained by the genome-wide correlations of the substitution rates with GC content or exon density. The telomere pattern of substitution is consistent with natural selection or biased gene conversion acting to increase the GC-content of the sequences that are within 10-15 Mbp away from the telomere.

  19. Phylogeny of Arthropoda inferred from mitochondrial sequences: strategies for limiting the misleading effects of multiple changes in pattern and rates of substitution.

    PubMed

    Hassanin, Alexandre

    2006-01-01

    In this study, mitochondrial sequences were used to investigate the relationships among the major lineages of Arthropoda. The data matrix used for the analyses includes 84 taxa and 3918 nucleotides representing six mitochondrial protein-coding genes (atp6 and 8, cox1-3, and nad2). The analyses of nucleotide composition show that a reverse strand-bias, i.e., characterized by an excess of T relative to A nucleotides and of G relative to C nucleotides, was independently acquired in six different lineages of Arthropoda: (1) the honeybee mite (Varroa), (2) Opisthothelae spiders (Argiope, Habronattus, and Ornithoctonus), (3) scorpions (Euscorpius and Mesobuthus), (4) Hutchinsoniella (Cephalocarid), (5) Tigriopus (Copepod), and (6) whiteflies (Aleurodicus and Trialeurodes). Phylogenetic analyses confirm that these convergences in nucleotide composition can be particularly misleading for tree reconstruction, as unrelated taxa with reverse strand-bias tend to group together in MP, ML, and Bayesian analyses. However, the use of a specific model for minimizing effects of the bias, the "Neutral Transition Exclusion" (NTE) model, allows Bayesian analyses to rediscover most of the higher taxa of Arthropoda. Furthermore, the analyses of branch lengths suggest that three main factors explain accelerated rates of substitution: (1) genomic rearrangements, including duplication of the control region and gene translocation, (2) parasitic lifestyle, and (3) small body size. The comparisons of Bayesian Bootstrap percentages show that the support for many nodes increases when taxa with long branches are excluded from the analyses. It is therefore recommended to select taxa and genes of the mitochondrial genome for inferring phylogenetic relationships among arthropod lineages. The phylogenetic analyses support the existence of a major dichotomy within Arthropoda, separating Pancrustacea and Paradoxopoda. Basal relationships between Pancrustacean lineages are not robust, and the question

  20. Peculiar patterns of amino acid substitution and conservation in the fast evolving tunicate Oikopleura dioica.

    PubMed

    Berná, Luisa; D'Onofrio, Giuseppe; Alvarez-Valin, Fernando

    2012-02-01

    We analyze the patterns and rates of amino acid evolution in tunicates with special interest on the extremely fast evolving Oikopleura dioica. We show that this species, on average, is twice as fast as the already fast evolving Ciona intestinalis. The acceleration in both species seems to be affected by similar evolutionary forces yet to different extent, since a substantial proportion of the most and less accelerated genes are orthologous between the two species. Among the possible causes that underlie the genome wide acceleration in Oikopleura, relaxation of functional constraints appears to be an important one, since all amino acids exhibit surprisingly homogenous levels of divergence. Such homogeneity, however, is not observed in Ciona. Apart from the genome wide acceleration, detailed analysis of functional groups of genes revealed that genes associated with regulatory functions (transcription regulators, chromatin remodeling proteins and metabolic regulators), have been subjected to an even more extreme process of acceleration, suggesting that adaptive evolution is the most probable cause of their unusual exacerbated rates. Another remarkable observation is that cysteine is among the less conserved amino acids, contrary to what is commonly observed in other species. The possible causes of this particular behavior are discussed.

  1. Laminin and type IV collagen isoform substitutions occur in temporally and spatially distinct patterns in developing kidney glomerular basement membranes.

    PubMed

    Abrahamson, Dale R; St John, Patricia L; Stroganova, Larysa; Zelenchuk, Adrian; Steenhard, Brooke M

    2013-10-01

    Kidney glomerular basement membranes (GBMs) undergo laminin and type IV collagen isoform substitutions during glomerular development, which are believed to be required for maturation of the filtration barrier. Specifically, GBMs of earliest glomeruli contain laminin α1β1γ1 and collagen α1α2α1(IV), whereas mature glomeruli contain laminin α5β2γ1 and collagen α3α4α5(IV). Here, we used confocal microscopy to simultaneously evaluate expression of different laminin and collagen IV isoforms in newborn mouse GBMs. Our results show loss of laminin α1 from GBMs in early capillary loop stages and continuous linear deposition of laminin bearing the α5 chain thereafter. In contrast, collagen α1α2α1(IV) persisted in linear patterns into late capillary loop stages, when collagen α3α4α5(IV) first appeared in discontinuous, non-linear patterns. This patchy pattern for collagen α3α4α5(IV) continued into maturing glomeruli where there were lengths of linear, laminin α5-positive GBM entirely lacking either isoform of collagen IV. Relative abundance of laminin and collagen IV mRNAs in newborn and 5-week-old mouse kidneys also differed, with those encoding laminin α1, α5, β1, β2, and γ1, and collagen α1(IV) and α2(IV) chains all significantly declining at 5 weeks, but α3(IV) and α4(IV) were significantly upregulated. We conclude that different biosynthetic mechanisms control laminin and type IV collagen expression in developing glomeruli.

  2. Laminin and Type IV Collagen Isoform Substitutions Occur in Temporally and Spatially Distinct Patterns in Developing Kidney Glomerular Basement Membranes

    PubMed Central

    St. John, Patricia L.; Stroganova, Larysa; Zelenchuk, Adrian; Steenhard, Brooke M.

    2013-01-01

    Kidney glomerular basement membranes (GBMs) undergo laminin and type IV collagen isoform substitutions during glomerular development, which are believed to be required for maturation of the filtration barrier. Specifically, GBMs of earliest glomeruli contain laminin α1β1γ1 and collagen α1α2α1(IV), whereas mature glomeruli contain laminin α5β2γ1 and collagen α3α4α5(IV). Here, we used confocal microscopy to simultaneously evaluate expression of different laminin and collagen IV isoforms in newborn mouse GBMs. Our results show loss of laminin α1 from GBMs in early capillary loop stages and continuous linear deposition of laminin bearing the α5 chain thereafter. In contrast, collagen α1α2α1(IV) persisted in linear patterns into late capillary loop stages, when collagen α3α4α5(IV) first appeared in discontinuous, non-linear patterns. This patchy pattern for collagen α3α4α5(IV) continued into maturing glomeruli where there were lengths of linear, laminin α5-positive GBM entirely lacking either isoform of collagen IV. Relative abundance of laminin and collagen IV mRNAs in newborn and 5-week-old mouse kidneys also differed, with those encoding laminin α1, α5, β1, β2, and γ1, and collagen α1(IV) and α2(IV) chains all significantly declining at 5 weeks, but α3(IV) and α4(IV) were significantly upregulated. We conclude that different biosynthetic mechanisms control laminin and type IV collagen expression in developing glomeruli. PMID:23896970

  3. Effects of disruption of the nucleotide pattern in CRID element and Kozak sequence of interferon β on mRNA stability and protein production.

    PubMed

    Kay, Maryam; Hojati, Zohreh; Heidari, Maryam; Bazi, Zahra; Korbekandi, Hassan

    2015-01-01

    Interferon β (IFNβ) is the most important drug that has been used frequently for multiple sclerosis treatment. This study has tried to improve the IFNβ production by introducing mutations in the coding region of IFNβ, while its amino acid sequence is intact. Two recombinant vectors IFNβ(K) and IFNβ(K+CRID )were designed by site-directed mutagenesis. The IFNβ(K) and IFNβ(K+CRID) have two substitutions in Kozak sequence and four substitutions in CRID sequence, respectively. The Chinese hamster ovary (CHO) cell codon usage optimization was also performed for both of them. They were transiently transfected to CHO-dhfr(-) cell line using Lipofectamine kit (Invitrogen, Grand Island, NY). The amount of mRNA and protein was determined by real time PCR and ELISA. The results of this study indicate that the amount of IFNβ protein produced by CHO cells containing IFNβ(K) has been elevated up to 3.5-fold. On the other hand, enormous amounts of IFNβ mRNA and protein were produced by cells containing IFNβ(K+CRID) construct; more than 4.6-fold and 6-fold, respectively. It could be concluded that disruption of AT pattern in CRID element increase RNA and protein production, improve IFNβ mRNA stability and, may also enhance mRNA half-life. In a similar way, more proteins are produced by modification of Kozak sequence.

  4. 2-Substitution of adenine nucleotide analogues containing a bicyclo[3.1.0]hexane ring system locked in a northern conformation: enhanced potency as P2Y1 receptor antagonists.

    PubMed

    Kim, Hak Sung; Ohno, Michihiro; Xu, Bin; Kim, Hea Ok; Choi, Yongseok; Ji, Xiao D; Maddileti, Savitri; Marquez, Victor E; Harden, T Kendall; Jacobson, Kenneth A

    2003-11-06

    Preference for the northern (N) ring conformation of the ribose moiety of adenine nucleotide 3',5'-bisphosphate antagonists of P2Y(1) receptors was established by using a ring-constrained methanocarba (a bicyclo[3.1.0]hexane) ring as a ribose substitute (Nandanan et al. J. Med. Chem. 2000, 43, 829-842). We have now combined the ring-constrained (N)-methanocarba modification with other functionalities at the 2-position of the adenine moiety. A new synthetic route to this series of bisphosphate derivatives was introduced, consisting of phosphorylation of the pseudoribose moiety prior to coupling with the adenine base. The activity of the newly synthesized analogues was determined by measuring antagonism of 2-methylthio-ADP-stimulated phospholipase C (PLC) activity in 1321N1 human astrocytoma cells expressing the recombinant human P2Y(1) receptor and by using the radiolabeled antagonist [(3)H]2-chloro-N(6)-methyl-(N)-methanocarba-2'-deoxyadenosine 3',5'-bisphosphate 5 in a newly developed binding assay in Sf9 cell membranes. Within the series of 2-halo analogues, the most potent molecule at the hP2Y(1) receptor was an (N)-methanocarba N(6)-methyl-2-iodo analogue 12, which displayed a K(i) value in competition for binding of [(3)H]5 of 0.79 nM and a K(B) value of 1.74 nM for inhibition of PLC. Thus, 12 is the most potent antagonist selective for the P2Y(1) receptor yet reported. The 2-iodo group was substituted with trimethyltin, thus providing a parallel synthetic route for the introduction of an iodo group in this high-affinity antagonist. The (N)-methanocarba-2-methylthio, 2-methylseleno, 2-hexyl, 2-(1-hexenyl), and 2-(1-hexynyl) analogues bound less well, exhibiting micromolar affinity at P2Y(1) receptors. An enzymatic method of synthesis of the 3',5'-bisphosphate from the corresponding 3'-monophosphate, suitable for the preparation of a radiophosphorylated analogue, was explored.

  5. Comparative nucleotide diversity across North American and European populus species.

    PubMed

    Ismail, Mohamed; Soolanayakanahally, Raju Y; Ingvarsson, Pär K; Guy, Robert D; Jansson, Stefan; Silim, Salim N; El-Kassaby, Yousry A

    2012-06-01

    Nucleotide polymorphisms in two North American balsam poplars (Populus trichocarpa Torr. & Gray and P. balsamifera L.; section Tacamahaca), and one Eurasian aspen (P. tremula L.; section Populus) were compared using nine loci involved in defense, stress response, photoperiodism, freezing tolerance, and housekeeping. Nucleotide diversity varied among species and was highest for P. tremula (θ(w) = 0.005, π(T) = 0.007) as compared to P. balsamifera (θ(w) = 0.004, π(T) = 0.005) or P. trichocarpa (θ(w) = 0.002, π(T) = 0.003). Across species, the defense and the stress response loci accounted for the majority of the observed level of nucleotide diversity. In general, the studied loci did not deviate from neutral expectation either at the individual locus (non-significant normalized Fay and Wu's H) or at the multi-locus level (non-significant HKA test). Using molecular clock analysis, section Tacamahaca probably shared a common ancestor with section Populus approximately 4.5 million year ago. Divergence between the two closely related balsam poplars was about 0.8 million years ago, a pattern consistent with an isolation-with-migration (IM) model. As expected, P. tremula showed a five-fold higher substitution rate (2 × 10(-8) substitution/site/year) compared to the North American species (0.4 × 10(-8) substitution/site/year), probably reflecting its complex demographic history. Linkage disequilibrium (LD) varied among species with a more rapid decay in the North American species (<400 bp) in comparison to P. tremula (≫400 bp). The similarities in nucleotide diversity pattern and LD decay of the two balsam poplar species likely reflects the recent time of their divergence.

  6. Eight Nucleotide Substitutions Inhibit Splicing to HPV-16 3′-Splice Site SA3358 and Reduce the Efficiency by which HPV-16 Increases the Life Span of Primary Human Keratinocytes

    PubMed Central

    Li, Xiaoze; Johansson, Cecilia; Cardoso Palacios, Carlos; Mossberg, Anki; Dhanjal, Soniya; Bergvall, Monika; Schwartz, Stefan

    2013-01-01

    The most commonly used 3′-splice site on the human papillomavirus type 16 (HPV-16) genome named SA3358 is used to produce HPV-16 early mRNAs encoding E4, E5, E6 and E7, and late mRNAs encoding L1 and L2. We have previously shown that SA3358 is suboptimal and is totally dependent on a downstream splicing enhancer containingmultiple potential ASF/SF2 binding sites. Here weshow that only one of the predicted ASF/SF2 sites accounts for the majority of the enhancer activity. We demonstrate that single nucleotide substitutions in this predicted ASF/SF2 site impair enhancer function and that this correlates with less efficient binding to ASF/SF2 in vitro. We provide evidence that HPV-16 mRNAs that arespliced to SA3358 interact with ASF/SF2 in living cells. In addition,mutational inactivation of the ASF/SF2 site weakened the enhancer at SA3358 in episomal forms of the HPV-16 genome, indicating that the enhancer is active in the context of the full HPV-16 genome.This resulted in induction of HPV-16 late gene expression as a result of competition from late splice site SA5639. Furthermore, inactivation of the ASF/SF2 site of the SA3358 splicing enhancer reduced the ability of E6- and E7-encoding HPV-16 plasmids to increase the life span of primary keratinocytes in vitro, demonstrating arequirement for an intact splicing enhancer of SA3358 forefficient production of the E6 and E7 mRNAs. These results link the strength of the HPV-16 SA3358 splicing enhancer to expression of E6 and E7 and to the pathogenic properties of HPV-16. PMID:24039800

  7. Effects of Cdh23 single nucleotide substitutions on age-related hearing loss in C57BL/6 and 129S1/Sv mice and comparisons with congenic strains

    PubMed Central

    Johnson, Kenneth R.; Tian, Cong; Gagnon, Leona H.; Jiang, Haiyan; Ding, Dalian; Salvi, Richard

    2017-01-01

    A single nucleotide variant (SNV) of the cadherin 23 gene (Cdh23c.753A), common to many inbred mouse strains, accelerates age-related hearing loss (AHL) and can worsen auditory phenotypes of other mutations. We used homologous recombination in C57BL/6 NJ (B6N) and 129S1/SvImJ (129S1) embryonic stem cells to engineer mouse strains with reciprocal single base pair substitutions (B6-Cdh23c.753A>G and 129S1-Cdh23c.753G>A). We compared ABR thresholds and cochlear pathologies of these SNV mice with those of congenic (B6.129S1-Cdh23Ahl+ and 129S1.B6-Cdh23ahl) and parental (B6N and 129S1) strain mice. Results verified the protective effect of the Cdh23c.753G allele, which prevented high frequency hearing loss in B6 mice to at least 18 months of age, and the AHL-inducing effect of the Cdh23c.753A allele, which worsened hearing loss in 129S1 mice. ABR thresholds differed between 129S-Cdh23c.753A SNV and 129S1.B6-Cdh23ahl congenic mice, and a linkage backcross involving these strains localized a Chr 10 QTL contributing to the difference. These results illustrate the large effects that strain background and congenic regions have on the hearing loss associated with Cdh23c.753alleles. Importantly, the B6-Cdh23c.753Gstrain can be used to eliminate the confounding influence of the Cdh23c.753Avariant in hearing studies of B6 mice and mutant mice on the B6 background. PMID:28287619

  8. BindML/BindML+: Detecting Protein-Protein Interaction Interface Propensity from Amino Acid Substitution Patterns.

    PubMed

    Wei, Qing; La, David; Kihara, Daisuke

    2017-01-01

    Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .

  9. Substitutions at NS3 Residue 155, 156, or 168 of Hepatitis C Virus Genotypes 2 to 6 Induce Complex Patterns of Protease Inhibitor Resistance

    PubMed Central

    Jensen, Sanne B.; Serre, Stéphanie B. N.; Humes, Daryl G.; Ramirez, Santseharay; Li, Yi-Ping; Bukh, Jens

    2015-01-01

    Various protease inhibitors (PIs) currently are becoming available for treatment of hepatitis C virus (HCV). For genotype 1, substitutions at NS3 protease positions 155, 156, and 168 are the main determinants of PI resistance. For other genotypes, similar substitutions were selected during PI treatment but were not characterized systematically. To elucidate the impact of key PI resistance substitutions on genotypes 2 to 6, we engineered the substitutions R155A/E/G/H/K/Q/T, A156G/S/T/V, and D/Q168A/E/G/H/N/V into HCV recombinants expressing genotype 2 to 6 proteases. We evaluated viral fitness and sensitivity to nine PIs (telaprevir, boceprevir, simeprevir, asunaprevir, vaniprevir, faldaprevir, paritaprevir, deldeprevir, and grazoprevir) in Huh7.5 cells. We found that most variants showed decreased fitness compared to that of the original viruses. Overall, R155K, A156G/S, and D/Q168A/E/H/N/V variants showed the highest fitness; however, genotype 4 position 168 variants showed strong fitness impairment. Most variants tested were resistant to several PIs. Resistance levels varied significantly depending on the specific substitution, genotype, and PI. For telaprevir and boceprevir, specific 155 and 156, but not 168, variants proved resistant. For the remaining PIs, most genotype 2, 4, 5, and 6, but not genotype 3, variants showed various resistance levels. Overall, grazoprevir (MK-5172) had the highest efficacy against original viruses and variants. This is the first comprehensive study revealing the impact of described key PI resistance substitutions on fitness and PI resistance of HCV genotypes 2 to 6. In conclusion, the studied substitutions induced resistance to a panel of clinically relevant PIs, including the newer PIs paritaprevir, deldeprevir, and grazoprevir. We discovered complex patterns of resistance, with the impact of substitutions varying from increased sensitivity to high resistance. PMID:26392503

  10. Immunohistochemical staining patterns of p53 can serve as a surrogate marker for TP53 mutations in ovarian carcinoma: an immunohistochemical and nucleotide sequencing analysis.

    PubMed

    Yemelyanova, Anna; Vang, Russell; Kshirsagar, Malti; Lu, Dan; Marks, Morgan A; Shih, Ie Ming; Kurman, Robert J

    2011-09-01

    Immunohistochemical staining for p53 is used as a surrogate for mutational analysis in the diagnostic workup of carcinomas of multiple sites including ovarian cancers. Strong and diffuse immunoexpression of p53 is generally interpreted as likely indicating a TP53 gene mutation. The immunoprofile that correlates with wild-type TP53, however, is not as clear. In particular, the significance of completely negative immunostaining is controversial. The aim of this study was to clarify the relationship of the immunohistochemical expression of p53 with the mutational status of the TP53 gene in ovarian cancer. A total of 57 ovarian carcinomas (43 high-grade serous ovarian/peritoneal carcinomas, 2 malignant mesodermal mixed tumors (carcinosarcomas), 2 low-grade serous carcinomas, 4 clear cell carcinomas, 1 well-differentiated endometrioid carcinoma, and 5 carcinomas with mixed epithelial differentiation) were analyzed for TP53 mutations by nucleotide sequencing (exons 4-9), and subjected to immunohistochemical analysis of p53 expression. Thirty six tumors contained functional mutations and 13 had wild type TP53. Five tumors were found to harbor known TP53 polymorphism and changes in the intron region were detected in three. Tumors with wild-type TP53 displayed a wide range of immunolabeling patterns, with the most common pattern showing ≤10% of positive cells in 6 cases (46%). Mutant TP53 was associated with 60-100% positive cells in 23 cases (64% of cases). This pattern of staining was also seen in three cases with wild-type TP53. Tumors that were completely negative (0% cells staining) had a mutation of TP53 in 65% of cases and wild-type TP53 in 11%. Combining two immunohistochemical labeling patterns associated with TP53 mutations (0% and 60-100% positive cells), correctly identified a mutation in 94% of cases (P<0.001). Immunohistochemical analysis can be used as a robust method for inferring the presence of a TP53 mutation in ovarian carcinomas. In addition to a

  11. Distinct molecular structures and hydrogen bond patterns of α,α-diethyl-substituted cyclic imide, lactam, and acetamide derivatives in the crystalline phase

    NASA Astrophysics Data System (ADS)

    Krivoshein, Arcadius V.; Ordonez, Carlos; Khrustalev, Victor N.; Timofeeva, Tatiana V.

    2016-10-01

    α,α-Dialkyl- and α-alkyl-α-aryl-substituted cyclic imides, lactams, and acetamides show promising anticonvulsant, anxiolytic, and anesthetic activities. While a number of crystal structures of various α-substituted cyclic imides, lactams, and acetamides were reported, no in-depth comparison of crystal structures and solid-state properties of structurally matched compounds have been carried out so far. In this paper, we report molecular structure and intermolecular interactions of three α,α-diethyl-substituted compounds - 3,3-diethylpyrrolidine-2,5-dione, 3,3-diethylpyrrolidin-2-one, and 2,2-diethylacetamide - in the crystalline phase, as studied using single-crystal X-ray diffraction and IR spectroscopy. We found considerable differences in the patterns of H-bonding and packing of the molecules in crystals. These differences correlate with the compounds' melting points and are of significance to physical pharmacy and formulation development of neuroactive drugs.

  12. Long-term expression pattern of melanocyte markers in light- and dark-pigmented dermo-epidermal cultured human skin substitutes.

    PubMed

    Biedermann, Thomas; Klar, Agnieszka S; Böttcher-Haberzeth, Sophie; Michalczyk, Teresa; Schiestl, Clemens; Reichmann, Ernst; Meuli, Martin

    2015-01-01

    Transplantation of pigmented tissue-engineered human autologous skin substitutes represents a promising procedure to cover skin defects. We have already demonstrated that we can restore the patient's native light or dark skin color by adding melanocytes to our dermo-epidermal skin analogs. In this long-term study, we investigated if melanocytes in our skin substitutes continue to express markers as BCL2, SOX9, and MITF, known to be involved in survival, differentiation, and function of melanocytes. Human epidermal melanocytes and keratinocytes, as well as dermal fibroblasts from light- and dark-pigmented skin biopsies were isolated and cultured. Bovine collagen hydrogels containing fibroblasts were prepared, and melanocytes and keratinocytes were seeded in a 1:5 ratio onto the gels. Pigmented dermo-epidermal skin substitutes were transplanted onto full-thickness wounds of immuno-incompetent rats and analyzed for the expression of melanocyte markers after 15 weeks. Employing immunofluorescence staining techniques, we observed that our light and dark dermo-epidermal skin substitutes expressed the same typical melanocyte markers including BCL2, SOX9, and MITF 15 weeks after transplantation as normal human light and dark skin. These data suggest that, even in the long run, our light and dark dermo-epidermal tissue-engineered skin substitutes contain melanocytes that display a characteristic expression pattern as seen in normal pigmented human skin. These findings have crucial clinical implications as such grafts transplanted onto patients should warrant physiological numbers, distribution, and function of melanocytes.

  13. Complex Pattern of Resistance-Associated Substitutions of Hepatitis C Virus after Daclatasvir/Asunaprevir Treatment Failure

    PubMed Central

    Hasebe, Chitomi; Osaki, Yukio; Joko, Kouji; Yagisawa, Hitoshi; Sakita, Shinya; Okushin, Hiroaki; Satou, Takashi; Hisai, Hiroyuki; Abe, Takehiko; Tsuji, Keiji; Tamada, Takashi; Kobashi, Haruhiko; Mitsuda, Akeri; Ide, Yasushi; Ogawa, Chikara; Tsuruta, Syotaro; Takaguchi, Kouichi; Murakawa, Miyako; Asahina, Yasuhiro; Enomoto, Nobuyuki; Izumi, Namiki

    2016-01-01

    Backgrounds & Aims We aimed to clarify the characteristics of resistance-associated substitutions (RASs) after treatment failure with NS5A inhibitor, daclatasvir (DCV) in combination with NS3/4A inhibitor, asunaprevir (ASV), in patients with chronic hepatitis C virus genotype 1b infection. Methods This is a nationwide multicenter study conducted by the Japanese Red Cross Liver Study Group. The sera were obtained from 68 patients with virological failure after 24 weeks of DCV/ASV treatment. RASs in NS5A and NS3 were determined by population sequencing. Results The frequency of signature RASs at position D168 of NS3 was 68%, and at positions L31 and Y93 of NS5A was 79 and 76%, respectively. The frequency of dual signature RASs in NS5A (L31-RAS and Y93-RAS) was 63%. RASs at L28, R30, P32, Q54, P58, and A92 in addition to dual signature RAS were detected in 5, 5, 1, 22, 2, and 0 patients, respectively. In total, triple, quadruple, and quintuple RASs in combination with dual signature RAS were detected in 35, 10, and 1.5% patients, respectively. These RASs were detected in patients without baseline RASs or who prematurely discontinued therapy. Co-existence of D168 RAS in NS3 and L31 and/or Y93 RAS in NS5A was observed in 62% of patients. Conclusion Treatment-emergent RASs after failure with DCV/ASV combination therapy are highly complex in more than 50% of the patients. The identification of complex RAS patterns, which may indicate high levels of resistance to NS5A inhibitors, highlights the need for RAS sequencing when considering re-treatment with regimens including NS5A inhibitors. PMID:27776192

  14. The pattern of expression of guanine nucleotide-binding protein β3 (GNB3) in the retina is conserved across vertebrate species

    PubMed Central

    Ritchey, Eric R.; Bongini, Rachel E.; Code, Kimberly A.; Zelinka, Christopher; Petersen-Jones, Simon; Fischer, Andy J.

    2010-01-01

    Guanine nucleotide-binding protein β3 (GNB3) is an isoform of the β subunit of the heterotrimeric G protein second messenger complex that is commonly associated with transmembrane receptors. The presence of GNB3 in photoreceptors, and possibly bipolar cells, has been confirmed in murine, bovine and primate retinas (Lee et al., 1992, Peng et al., 1992, Huang et al., 2003). Studies have indicated that a mutation in the GNB3 gene causes progressive retinopathy and globe enlargement (RGE) in chickens. The goals of this study were to 1) examine the expression pattern of GNB3 in wild-type and RGE mutant chickens, 2) characterize the types of bipolar cells that express GNB3 and 3) examine whether the expression of GNB3 in the retina is conserved across vertebrate species. We find that chickens homozygous for the RGE allele completely lack GNB3 protein. We find that the pattern of expression of GNB3 in the retina is highly conserved across vertebrate species, including teleost fish (Carassius auratus), frogs (Xenopus laevis), chickens (Gallus domesticus), mice (Mus musculata), guinea pigs (Cavia porcellus), dogs (Canis familiaris) and non-human primates (Macaca fasicularis). Regardless of the species, we find that GNB3 is expressed by Islet1-positive cone ON-bipolar cells and by cone photoreceptors. In some vertebrates, GNB3-immunoreactivity was observed in both rod and cone photoreceptors. A protein-protein alignment of GNB3 across different vertebrates, from fish to humans, indicates a high degree (>92%) of sequence conservation. Given that analogous types of retinal neurons express GNB3 in different species, we propose that the functions and the mechanisms that regulate the expression of GNB3 are highly conserved. PMID:20538044

  15. Site-specific excision repair of 1-nitrosopyrene-induced DNA adducts at the nucleotide level in the HPRT gene of human fibroblasts: effect of adduct conformation on the pattern of site-specific repair.

    PubMed Central

    Wei, D; Maher, V M; McCormick, J J

    1996-01-01

    Studies showing that different types of DNA adducts are repaired in human cells at different rates suggest that DNA adduct conformation is the major determinant of the rate of nucleotide excision repair. However, recent studies of repair of cyclobutane pyrimidine dimers or benzo[a]pyrene diol epoxide (BPDE)-induced adducts at the nucleotide level in DNA of normal human fibroblasts indicate that the rate of repair of the same adduct at different nucleotide positions can vary up to 10-fold, suggesting an important role for local DNA conformation. To see if site-specific DNA repair is a common phenomenon for bulky DNA adducts, we determined the rate of repair of 1-nitrosopyrene (1-NOP)-induced adducts in exon 3 of the hypoxanthine phosphoribosyltransferase gene at the nucleotide level using ligation-mediated PCR. To distinguish between the contributions of adduct conformation and local DNA conformation to the rate of repair, we compared the results obtained with 1-NOP with those we obtained previously using BPDE. The principal DNA adduct formed by either agent involves guanine. We found that rates of repair of 1-NOP-induced adducts also varied significantly at the nucleotide level, but the pattern of site-specific repair differed from that of BPDE-induced adducts at the same guanine positions in the same region of DNA. The average rate of excision repair of 1-NOP adducts in exon 3 was two to three times faster than that of BPDE adducts, but at particular nucleotides the rate was slower or faster than that of BPDE adducts or, in some cases, equal to that of BPDE adducts. These results indicate that the contribution of the local DNA conformation to the rate of repair at a particular nucleotide position depends upon the specific DNA adduct involved. However, the data also indicate that the conformation of the DNA adduct is not the only factor contributing to the rate of repair at different nucleotide positions. Instead, the rate of repair at a particular nucleotide

  16. Large-Scale Analyses of Angiosperm Nucleotide-Binding Site-Leucine-Rich Repeat Genes Reveal Three Anciently Diverged Classes with Distinct Evolutionary Patterns.

    PubMed

    Shao, Zhu-Qing; Xue, Jia-Yu; Wu, Ping; Zhang, Yan-Mei; Wu, Yue; Hang, Yue-Yu; Wang, Bin; Chen, Jian-Qun

    2016-04-01

    Nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes make up the largest plant disease resistance gene family (R genes), with hundreds of copies occurring in individual angiosperm genomes. However, the expansion history of NBS-LRR genes during angiosperm evolution is largely unknown. By identifying more than 6,000 NBS-LRR genes in 22 representative angiosperms and reconstructing their phylogenies, we present a potential framework of NBS-LRR gene evolution in the angiosperm. Three anciently diverged NBS-LRR classes (TNLs, CNLs, and RNLs) were distinguished with unique exon-intron structures and DNA motif sequences. A total of seven ancient TNL, 14 CNL, and two RNL lineages were discovered in the ancestral angiosperm, from which all current NBS-LRR gene repertoires were evolved. A pattern of gradual expansion during the first 100 million years of evolution of the angiosperm clade was observed for CNLs. TNL numbers remained stable during this period but were eventually deleted in three divergent angiosperm lineages. We inferred that an intense expansion of both TNL and CNL genes started from the Cretaceous-Paleogene boundary. Because dramatic environmental changes and an explosion in fungal diversity occurred during this period, the observed expansions of R genes probably reflect convergent adaptive responses of various angiosperm families. An ancient whole-genome duplication event that occurred in an angiosperm ancestor resulted in two RNL lineages, which were conservatively evolved and acted as scaffold proteins for defense signal transduction. Overall, the reconstructed framework of angiosperm NBS-LRR gene evolution in this study may serve as a fundamental reference for better understanding angiosperm NBS-LRR genes.

  17. Differentiation of Erysipelothrix rhusiopathiae strains by nucleotide sequence analysis of a hypervariable region in the spaA gene: discrimination of a live vaccine strain from field isolates.

    PubMed

    Nagai, Shinya; To, Ho; Kanda, Akira

    2008-05-01

    Erysipelothrix rhusiopathiae causes erysipelas in swine and is considered a reemerging disease contributing substantially to economic losses in the swine industry. Since an attenuated live vaccine was commercialized in 1974 in Japan, outbreaks of acute septicemia or subacute urticaria of erysipelas have decreased dramatically. In contrast, a chronic form of erysipelas found during meat inspections in slaughterhouses has been increasing. In this study, a new strain-typing method was developed based on nucleotide sequencing of a hypervariable region in the surface protective antigen (spaA) gene for discrimination of the live vaccine strain from field isolates. Sixteen strains isolated from arthritic lesions found in slaughtered pigs were segregated into 4 major patterns: 1) identical nucleotide sequence with the vaccine strain: 3 isolates; 2) 1 nucleotide substitution (C to A) at position 555: 5 isolates; 3) 1 nucleotide substitution at various positions: 5 isolates; and 4) 2 nucleotide substitutions: 3 isolates. Isolates with the same nucleotide sequence as the vaccine strain were further characterized by other properties, including the mouse pathogenicity test. One strain isolated from pigs on a farm where the live vaccine had been used was found to be closely related to the vaccine strain. The phylogenetic tree constructed based on the spaA sequence suggests that the evolutionary distance of the isolates is related to the pathogenicity in mice. The new strain-typing system based on nucleotide sequencing of the spaA region is useful to discriminate the vaccine strain from field isolates.

  18. The study of neighboring nucleotide composition and transition/transversion bias.

    PubMed

    Zhao, Hui; Li, Qizhai; Li, Jun; Zeng, Changqing; Hu, Songnian; Yu, Jun

    2006-08-01

    Base substitution is one of the raw fuels that produce genetic variation and drive evolution. Recent studies have shown that the genome components affect mutation patterns to some extent. In order to infer the correlation between the Transition/Transversion ratio (Ts/Tv) and the number of immediately adjacent A and T nucleotides, we investigated 3611007 Oryza sativa SNPs (including 45462 coding SNPs, and 242811 intronic SNPs) and 32019 Arabidopsis SNPs. The results show that Ts/Tv is negatively correlated with the number of immediately adjacent A and T in O. sativa and Arabidopsis. We further calculated AT2 (the number of SNPs whose immediately adjacent nucleotides are either A or T) and AT0 (the number of SNPs whose immediately adjacent nucleotides are either C or G) for all 6 types of SNPs. C/G SNP of O. sativa and Arabidopsis has the highest AT2/AT0, which denotes C/G SNP may be influenced by the adjacent A and T nucleotides mostly. For SNPs in O. sativa, the neighboring effect of A and T nucleotides is limited to 2 nucleotides on both sides; for SNPs in Arabidopsis, the effect extends no more than 4 nucleotides on both sides.

  19. Glycine substitutions in the triple-helical region of type VII collagen result in a spectrum of dystrophic epidermolysis bullosa phenotypes and patterns of inheritance

    SciTech Connect

    Christiano, A.M.; McGrath, J.A.; Uitto, J.; Kong Chong Tan

    1996-04-01

    The dystrophic forms of epidermolysis bullosa (DEB) are characterized by fragility of the skin and mucous membranes. DEB can be inherited in either an autosomal dominant or autosomal recessive pattern, and the spectrum of clinical severity is highly variable. The unifying diagnostic hallmark of DEB is abnormalities in the anchoring fibrils, which consist of type VII collagen, and recently, mutations in the corresponding gene, COL7A1, have been disclosed in a number of families. In this study, we report six families with glycine substitution mutations in the triple-helical region of type VII collagen. Among the six families, two demonstrated a mild phenotype, and the inheritance of the mutation was consistent with the dominantly inherited form of DEB. In the four other families, the mutation was silent in the heterozygous state but, when present in the homozygous state, or combined with a second mutation, resulted in a recessively inherited DEB phenotype. Type VII collagen is, therefore, unique among the collagen genes, in that different glycine substitutions can be either silent in heterozygous individuals or result in a dominantly inherited DEB. Inspection of the locations of the glycine substitutions along the COL7A1 polypeptide suggests that the consequences of these mutations, in terms of phenotype and pattern of inheritance, are position independent. 29 refs., 4 figs., 2 tabs.

  20. The influence of the substitution pattern on the molecular conformation of ureido-1,2,5-oxadiazoles, related to STAT3 inhibitors: chemical behavior and structural investigation.

    PubMed

    Villa, Stefania; Masciocchi, Daniela; Gelain, Arianna; Meneghetti, Fiorella

    2012-07-01

    Signal transducer and activator of transcription 3 (STAT3) is a protein constitutively activated by aberrant upstream tyrosine kinase activities in a broad spectrum of human solid and blood tumors. Therefore, the availability of drugs affecting STAT3 may have important therapeutic potential for the treatment of cancer. Pursuing our efforts in exploring the influence of the substitution pattern of the ureido 1,2,5-oxadiazole moiety on the molecular conformation, new compounds substituted at positions 3 and 4 on the furazane ring were synthesized. The inhibition properties vs. STAT3 of the novel compounds were evaluated in a dual-luciferase assay, using HCT-116 cells, and the results evidenced a moderate activity only for the compounds endowed with a planar arrangement. Crystallographic studies of the new derivatives were performed in order to evidence the peculiar chemical behavior and to evaluate how structural modulations affected the biological properties.

  1. Chromium and Tantalum Site Substitution Patterns in Ni3Al (L1(sub 2))gamma(prime)- Precipitates

    NASA Technical Reports Server (NTRS)

    Booth-Morrison, Christopher; Mao, Zugang; Seidman, David N.; Noebe, Ronald D.

    2008-01-01

    The site substitution behavior of Cr and Ta in the Ni3Al (Ll2)-type gamma'-precipitates of a Ni-Al-Cr-Ta alloy is investigated by atom-probe tomography (APT) and first-principles calculations. Measurements of the gamma'-phase composition by APT suggest that Al, Cr, and Ta share the Al sublattice sites of the gamma'-precipitates. The calculated substitutional energies of the solute atoms at the Ni and Al sublattice sites indicate that Ta has a strong preference for the Al sites, while Cr has a weak Al site preference. Furthermore, Ta is shown to replace Cr at the Al sublattice sites of the gamma'-precipitates, altering the elemental phase partitioning behavior of the Ni-Al-Cr-Ta alloy.

  2. Chromium and Tantalum Site Substitution Patterns in Ni3Al (L1(sub 2))gamma(prime)- Precipitates

    NASA Technical Reports Server (NTRS)

    Booth-Morrison, Christopher; Mao, Zugang; Seidman, David N.; Noebe, Ronald D.

    2008-01-01

    The site substitution behavior of Cr and Ta in the Ni3Al (Ll2)-type gamma'-precipitates of a Ni-Al-Cr-Ta alloy is investigated by atom-probe tomography (APT) and first-principles calculations. Measurements of the gamma'-phase composition by APT suggest that Al, Cr, and Ta share the Al sublattice sites of the gamma'-precipitates. The calculated substitutional energies of the solute atoms at the Ni and Al sublattice sites indicate that Ta has a strong preference for the Al sites, while Cr has a weak Al site preference. Furthermore, Ta is shown to replace Cr at the Al sublattice sites of the gamma'-precipitates, altering the elemental phase partitioning behavior of the Ni-Al-Cr-Ta alloy.

  3. Cyanoethylation of the glucans dextran and pullulan: Substitution pattern and formation of nanostructures and entrapment of magnetic nanoparticles

    PubMed Central

    Fiege, Kathrin; Lünsdorf, Heinrich; Atarijabarzadeh, Sevil

    2012-01-01

    Summary Cyanoethylglucans with a degree of substitution in the range of 0.74 to 2.40 for dextran and 0.84 to 2.42 for pullulan were obtained by Michael addition of acrylonitrile to the glucans under various conditions. Products were thoroughly characterized, comprising elementary analysis, NMR and ATR–IR spectroscopy, and analysis of the substituent distribution in the glucosyl units by GC–FID and GC–MS of the constituting monosaccharide derivatives. Nanostructuring of the highly substituted cyanoethylpolysaccharides was performed by dialysis against a non-solvent. In the presence of ferromagnetic iron-oxide nanoparticles, multicore cyanoethylglucan-coated ferromagnetic nanoparticles were formed by selective entrapment. The specific interaction between cyano groups and iron could be proven. The size distribution and morphology of the nanoparticles were analyzed by dynamic light scattering (DLS), scanning electron microscopy (SEM) and energy-filtered transmission electron microscopy (EF–TEM) with parallel electron energy loss spectroscopy (PEELS). PMID:22563354

  4. Epithelial and stromal developmental patterns in a novel substitute of the human skin generated with fibrin-agarose biomaterials.

    PubMed

    Carriel, Víctor; Garzón, Ingrid; Jiménez, Jose-María; Oliveira, Ana-Celeste-Ximenes; Arias-Santiago, Salvador; Campos, Antonio; Sánchez-Quevedo, Maria-Carmen; Alaminos, Miguel

    2012-01-01

    Development of human skin substitutes by tissue engineering may offer new therapeutic alternatives to the use of autologous tissue grafts. For that reason, it is necessary to investigate and develop new biocompatible biomaterials that support the generation of a proper human skin construct. In this study, we generated a novel model of bioengineered human skin substitute using human cells obtained from skin biopsies and fibrin-agarose biomaterials and we evaluated this model both at the ex vivo and the in vivo levels. Once the dermal fibroblasts and the epithelial keratinocytes were isolated and expanded in culture, we used fibrin-agarose scaffolds for the development of a full-thickness human skin construct, which was evaluated after 1, 2, 3 and 4 weeks of development ex vivo. The skin substitutes were then grafted onto immune-deficient nude mice and analyzed at days 10, 20, 30 and 40 postimplantation using transmission electron microscopy, histochemistry and immunofluorescence. The results demonstrated that the fibrin-agarose artificial skin had adequate biocompatibility and proper biomechanical properties. A proper development of both the bioengineered dermis and epidermis was found after 30 days in vivo, although the tissues kept ex vivo and those implanted in the animal model for 10 or 20 days showed lower levels of differentiation. In summary, our model of fibrin-agarose skin equivalent was able to reproduce the structure and histological architecture of the native human skin, especially after long-term in vivo implantation, suggesting that these tissues could reproduce the native skin.

  5. Intraspecific nucleotide variation in Anopheles gambiae: new insights into the biology of malaria vectors.

    PubMed

    Morlais, Isabelle; Ponçon, Nicolas; Simard, Frédéric; Cohuet, Anna; Fontenille, Didier

    2004-12-01

    The Anopheles gambiae genome sequence, together with the recent development of molecular tools for genome-wide analysis, promises new insights into the biology of the malaria vector. These insights should help define the best possible breakdown point for interrupting transmission in the mosquito vector. A survey of the intraspecific nucleotide diversity in coding regions of three different mosquito strains showed an average of one single nucleotide polymorphism (SNP) every 125 coding base pairs. High levels of nucleotide polymorphism were observed in mosquito immune-related genes and pathogen recognition receptors harbored higher replacement substitutions. Genotyping at SNP loci in natural populations of An. gambiae from three malaria foci showed contrasting patterns. The distribution of mutation Y443H in the thioester-containing protein 3 (TEP3) gene suggested this mutational event has occurred under selective constraints. Our results show that SNP-based studies will be valuable in identifying the sequence variation associated with phenotypic traits shaping vector competence.

  6. Substituting Coomassie Brilliant Blue for bromophenol blue in two-dimensional electrophoresis buffers improves the resolution of focusing patterns.

    PubMed

    Vilain, S; Cosette, P; Charlionet, R; Hubert, M; Lange, C; Junter, G A; Jouenne, T

    2001-12-01

    In a new area of postgenomics challenges, the optimization of protein identification has become a central goal in microbiochemistry. In this work, we demonstrate that the substitution of Coomassie Brilliant Blue for bromophenol blue in two-dimensional electrophoresis (2-DE) buffers improves the focusing of whole proteins from Pseudomonas aeruginosa. This improvement of focusing concerns more particularly basic proteins. This enhancement may be attributed to a better transfer from the first to the second dimension, which probably highlights an increase in the solubility of proteins in the IPG strips. Hence, the use of an efficient tracking dye in the 2-DE buffers may enlarge protein recovery on proteome maps.

  7. Aberrant 3′ splice sites in human disease genes: mutation pattern, nucleotide structure and comparison of computational tools that predict their utilization

    PubMed Central

    Vořechovský, Igor

    2006-01-01

    The frequency distribution of mutation-induced aberrant 3′ splice sites (3′ss) in exons and introns is more complex than for 5′ splice sites, largely owing to sequence constraints upstream of intron/exon boundaries. As a result, prediction of their localization remains a challenging task. Here, nucleotide sequences of previously reported 218 aberrant 3′ss activated by disease-causing mutations in 131 human genes were compared with their authentic counterparts using currently available splice site prediction tools. Each tested algorithm distinguished authentic 3′ss from cryptic sites more effectively than from de novo sites. The best discrimination between aberrant and authentic 3′ss was achieved by the maximum entropy model. Almost one half of aberrant 3′ss was activated by AG-creating mutations and ∼95% of the newly created AGs were selected in vivo. The overall nucleotide structure upstream of aberrant 3′ss was characterized by higher purine content than for authentic sites, particularly in position −3, that may be compensated by more stringent requirements for positive and negative nucleotide signatures centred around position −11. A newly developed online database of aberrant 3′ss will facilitate identification of splicing mutations in a gene or phenotype of interest and future optimization of splice site prediction tools. PMID:16963498

  8. Pyrazole complexes as anion receptors: effects of changing the metal, the pyrazole substitution pattern, and the number of pyrazole ligands.

    PubMed

    Nieto, Sonia; Pérez, Julio; Riera, Lucía; Riera, Víctor; Miguel, Daniel; Golen, James A; Rheingold, Arnold L

    2007-04-16

    Compound cis,fac-[Mo(eta3-allyl)(CO)2(Hdmpz)3]BAr'4 (1) (Hdmpz = 3,5-dimethylpyrazole, Ar' = 3,5-bis(trifluoromethyl)phenyl) undergoes rapid substitution of one of the pyrazole ligands by anions, including the low nucleophilic ReO4-, a reaction that afforded [Mo(OReO3)(eta3-allyl)(CO)2(Hdmpz)2] (2), structurally characterized by X-ray diffraction. The new compounds fac-[Mn(CO)3(Hdmpz)3]BAr'4 (4a) and fac-[Mn(CO)3(HtBupz)3]BAr'4 (4b) (HtBupz = 3(5)-tert-butylpyrazole) also undergo pyrazole substitution with most anions, and the product from the reaction with nitrate was crystallographically characterized. Compounds 4a,b were found to be substitutionally stable toward perrhenate, and the adducts [Mn(CO)3(Hdmpz)3].[ReO4] (7a) and [Mn(CO)3(HtBupz)3].[ReO4].[Bu4N].[BAr'4] (7b), crystallographically characterized, display hydrogen bonds between one of the perrhenate oxygens and the N-H groups of two of the pyrazole ligands. The structurally similar adduct [Re(CO)3(Hdmpz)3].[ReO4] (8) was found to result from the interaction of [Re(CO)3(Hdmpz)3]BAr'4 with perrhenate. The reaction of [Re(OTf)(CO)5] with 3,5-dimethylpyrazole (Hdmpz) afforded [Re(CO)5(Hdmpz)]OTf (9). The reaction of 9 with Hdmpz and NaBAr'4 yielded [Re(CO)4(Hdmpz)2]BAr'4 (10), which was found to be unstable toward chloride anion. In contrast, the new compound fac,cis-[Re(CO)3(CNtBu)(Hdmpz)2]BAr'4 (11) is stable in solution in the presence of different anions. Binding constants for 11 with chloride, bromide, and nitrate are 1-2 orders of magnitude lower than those found for these anions and rhenium tris(pyrazole) hosts, indicating that the presence of the third pyrazole ligand is crucial. Compounds fac-[Re(CO)3(HPhpz)3]BAr'4 (14) (HPhpz = 3(5)-phenylpyrazole) and fac-[Re(CO)3(HIndz)3]BAr'4 (15) (HIndz = indazole) are, in terms of anion binding strength and selectivity, inferior to those with dimethylpyrazole or tert-butylpyrazole ligands.

  9. Contrasting substitution patterns between HA proteins of avian and human influenza viruses: Implication for monitoring human influenza epidemics.

    PubMed

    Liao, Yu-Chieh; Chen, Feng-Chi; Hsiung, Chao A

    2010-11-23

    The HA1 domain of influenza A viruses is critical for immune escape and host receptor recognition. However, the association between HA1 evolution and host species-specific adaptations remains unclear. We have identified the amino acid sites that are related to the host species-specific adaptations by systematically comparing the evolutionary dynamics of HA1 between human and avian hosts for both H1N1 and H3N2 viruses. We can thus refine the "positively selected sites" in the HA1 domain of these two virus subtypes to those that occur only in humans. We further demonstrate that the refined sets can accurately reflect influenza epidemics. Our retrospective study shows that when substitutions occur at more than three out of these identified sites in the same year, an epidemic is very likely to occur. Therefore, our approach could potentially be used in determining whether new influenza vaccines are needed.

  10. Lipoteichoic acid of Streptococcus oralis Uo5: a novel biochemical structure comprising an unusual phosphorylcholine substitution pattern compared to Streptococcus pneumoniae.

    PubMed

    Gisch, Nicolas; Schwudke, Dominik; Thomsen, Simone; Heß, Nathalie; Hakenbeck, Regine; Denapaite, Dalia

    2015-11-18

    Members of the Mitis group of streptococci possess teichoic acids (TAs) as integral components of their cell wall that are unique among Gram-positive bacteria. Both, lipoteichoic (LTA) and wall teichoic acid, are formed by the same biosynthetic pathway, are of high complexity and contain phosphorylcholine (P-Cho) residues. These residues serve as anchors for choline-binding proteins (CBPs), some of which have been identified as virulence factors of the human pathogen Streptococcus pneumoniae. We investigated the LTA structure of its close relative Streptococcus oralis. Our analysis revealed that S. oralis Uo5 LTA has an overall architecture similar to pneumococcal LTA (pnLTA) and can be considered as a subtype of type IV LTA. Its structural complexity is even higher than that of pnLTA and its composition differs in number and type of carbohydrate moieties, inter-residue connectivities and especially the P-Cho substitution pattern. Here, we report the occurrence of a saccharide moiety substituted with two P-Cho residues, which is unique as yet in bacterial derived surface carbohydrates. Finally, we could link the observed important structural variations between S. oralis and S. pneumoniae LTA to the divergent enzymatic repertoire for their TA biosynthesis.

  11. Intramolecular charge transfer in aminobenzonitriles and tetrafluoro counterparts: fluorescence explained by competition between low lying excited states and radiationless deactivation. Part II: influence of substitution on luminescence patterns.

    PubMed

    Segado, Mireia; Mercier, Yannick; Gómez, Isabel; Reguero, Mar

    2016-03-07

    In this paper, we study the mechanisms of charge transfer, luminescence and radiationless decay of three derivatives of 4-aminobenzonitrile (ABN): dimethyl-ABN (DMABN) and the tetrafluorinated derivatives, ABN-4F and DMABN-4F. Our CASSCF/CASPT2 computations explain the different luminescence patterns observed in these three compounds and in comparison with the parent system, ABN, in spite of their similar architecture. We have found that the modifications made by the different substitutions in ABN tune the relative energies of the locally excited (LE) and charge transfer (CT) excited states due to electronic and structural factors. In all cases, the only potentially emitting species of CT character is the twisted-ICT. The increasing stabilization of this later species in the series formed by ABN-4F, DMABN and DMABN-4F explains the increasing intensity of the anomalous emission band in these compounds. Nevertheless, other factors like probability of emission vs. nonradiative decay must have also been taken into account. In fact fluoro-substitution increases the accessibility to conical intersections of the excited states with the ground state, opening an internal conversion channel that decreases the fluorescence quantum yield in the fluorinated derivatives. Our results also show that the involvement of the π-σ* state in the CT process is only possible in ABN-4F, but even in this case it is not probable.

  12. Lipoteichoic acid of Streptococcus oralis Uo5: a novel biochemical structure comprising an unusual phosphorylcholine substitution pattern compared to Streptococcus pneumoniae

    PubMed Central

    Gisch, Nicolas; Schwudke, Dominik; Thomsen, Simone; Heß, Nathalie; Hakenbeck, Regine; Denapaite, Dalia

    2015-01-01

    Members of the Mitis group of streptococci possess teichoic acids (TAs) as integral components of their cell wall that are unique among Gram-positive bacteria. Both, lipoteichoic (LTA) and wall teichoic acid, are formed by the same biosynthetic pathway, are of high complexity and contain phosphorylcholine (P-Cho) residues. These residues serve as anchors for choline-binding proteins (CBPs), some of which have been identified as virulence factors of the human pathogen Streptococcus pneumoniae. We investigated the LTA structure of its close relative Streptococcus oralis. Our analysis revealed that S. oralis Uo5 LTA has an overall architecture similar to pneumococcal LTA (pnLTA) and can be considered as a subtype of type IV LTA. Its structural complexity is even higher than that of pnLTA and its composition differs in number and type of carbohydrate moieties, inter-residue connectivities and especially the P-Cho substitution pattern. Here, we report the occurrence of a saccharide moiety substituted with two P-Cho residues, which is unique as yet in bacterial derived surface carbohydrates. Finally, we could link the observed important structural variations between S. oralis and S. pneumoniae LTA to the divergent enzymatic repertoire for their TA biosynthesis. PMID:26577602

  13. Patterns of Nucleotide Diversity of the ldpA Circadian Gene in Closely Related Species of Cyanobacteria from Extreme Cold Deserts

    PubMed Central

    Ng, Ka Wai; Pointing, Stephen B.

    2013-01-01

    In the circadian system of cyanobacteria, the ldpA gene is a component of the input to the clock. We comparatively analyzed nucleotide polymorphism of this gene in populations of two closely related species of cyanobacteria (denoted as Synechococcus species S1 and S2, respectively) from extreme cold deserts in Antarctica, the Canadian Arctic, and Tibet. Although both species manifested similarly high haplotype diversities (0.990 and 0.809, respectively), the nucleotide diversity differed significantly (0.0091 in S1 and 0.0037 in S2). The populations of species S2 were more differentiated (FST = 0.2242) compared to those of species S1 (FST between 0.0296 and 0.1188). An analysis of positive selection with several tests yielded highly significant values (P < 0.01) for both species. On the other hand, these results may be somewhat compromised by fluctuating population sizes of the species. The apparent selection pressure coupled with the pronounced demographic factors, such as population expansion, small effective population size, and genetic drift, may thus result in the observed significant interpopulation differentiation and subsequent speciation of cyanobacteria. PMID:23263969

  14. Patterns of Nucleotide Diversity at the Regions Encompassing the Drosophila Insulin-Like Peptide (dilp) Genes: Demography vs. Positive Selection in Drosophila melanogaster

    PubMed Central

    Guirao-Rico, Sara; Aguadé, Montserrat

    2013-01-01

    In Drosophila, the insulin-signaling pathway controls some life history traits, such as fertility and lifespan, and it is considered to be the main metabolic pathway involved in establishing adult body size. Several observations concerning variation in body size in the Drosophila genus are suggestive of its adaptive character. Genes encoding proteins in this pathway are, therefore, good candidates to have experienced adaptive changes and to reveal the footprint of positive selection. The Drosophila insulin-like peptides (DILPs) are the ligands that trigger the insulin-signaling cascade. In Drosophila melanogaster, there are several peptides that are structurally similar to the single mammalian insulin peptide. The footprint of recent adaptive changes on nucleotide variation can be unveiled through the analysis of polymorphism and divergence. With this aim, we have surveyed nucleotide sequence variation at the dilp1-7 genes in a natural population of D. melanogaster. The comparison of polymorphism in D. melanogaster and divergence from D. simulans at different functional classes of the dilp genes provided no evidence of adaptive protein evolution after the split of the D. melanogaster and D. simulans lineages. However, our survey of polymorphism at the dilp gene regions of D. melanogaster has provided some evidence for the action of positive selection at or near these genes. The regions encompassing the dilp1-4 genes and the dilp6 gene stand out as likely affected by recent adaptive events. PMID:23308258

  15. Nucleotide sequence variation of the chloroplast trnK/matK region in two wild Fagopyrum (Polygonaceae) species, F. leptopodum and F. statice.

    PubMed

    Ohsako, T; Ohnishi, O

    2001-02-01

    Nucleotide sequence polymorphisms of the intron of the chloroplast trnK (UUU) gene, including a matK gene, were investigated within two wild Fagopyrum species, F. leptopodum and F. statice, to assess the degree and pattern of the inter- and intraspecific differences in coding and noncoding chloroplast DNA regions in higher plants. Ten and five accessions were used for F. leptopodum and F. statice, respectively. The length of the trnK intron region in these species ranged from 2494 to 2506 bp. In the trnK intron, the net nucleotide substitution number per site (Da) between the two species was 0.00109, lower than the nucleotide diversity (pi), 0.00195 for F. leptopodum and 0.00144 for F. statice, suggesting a low level of interspecific divergence. This result seems to be due to the phylogenetic pattern that both species are interspersed with each other, which was revealed by the phylogenetic analyses based on the nucleotide substitutions and indels. In the matK gene region (1524 bp), seven and two nucleotide substitutions were found within F. leptopodum and F. statice, respectively. All of the nine nucleotide substitutions (eight of which were nonsynonymous) within and between F. leptopodum and F. statice were clustered in the 5' part of the matK gene region, and no variation was found in the 3' part. This suggests that most of the 3' part is occupied by the conserved domains that are important for the binding activity of the gene product to the precursor mRNA, and therefore implies that the 3' part is more functionally constrained than the 5' part.

  16. Modulation of the Substitution Pattern of 5-Aryl-2-Aminoimidazoles Allows Fine-Tuning of Their Antibiofilm Activity Spectrum and Toxicity

    PubMed Central

    Peeters, Elien; Hooyberghs, Geert; Robijns, Stijn; Waldrant, Kai; De Weerdt, Ami; Delattin, Nicolas; Liebens, Veerle; Kucharíková, Soňa; Tournu, Hélène; Verstraeten, Natalie; Dovgan, Barbara; Girandon, Lenart; Fröhlich, Mirjam; De Brucker, Katrijn; Michiels, Jan; Cammue, Bruno P. A.; Thevissen, Karin; Vanderleyden, Jozef; Van der Eycken, Erik

    2016-01-01

    We previously synthesized several series of compounds, based on the 5-aryl-2-aminoimidazole scaffold, that showed activity preventing the formation of Salmonella enterica serovar Typhimurium and Pseudomonas aeruginosa biofilms. Here, we further studied the activity spectrum of a number of the most active N1- and 2N-substituted 5-aryl-2-aminoimidazoles against a broad panel of biofilms formed by monospecies and mixed species of bacteria and fungi. An N1-substituted compound showed very strong activity against the biofilms formed by Gram-negative and Gram-positive bacteria and the fungus Candida albicans but was previously shown to be toxic against various eukaryotic cell lines. In contrast, 2N-substituted compounds were nontoxic and active against biofilms formed by Gram-negative bacteria and C. albicans but had reduced activity against biofilms formed by Gram-positive bacteria. In an attempt to develop nontoxic compounds with potent activity against biofilms formed by Gram-positive bacteria for application in antibiofilm coatings for medical implants, we synthesized novel compounds with substituents at both the N1 and 2N positions and tested these compounds for antibiofilm activity and toxicity. Interestingly, most of these N1-,2N-disubstituted 5-aryl-2-aminoimidazoles showed very strong activity against biofilms formed by Gram-positive bacteria and C. albicans in various setups with biofilms formed by monospecies and mixed species but lost activity against biofilms formed by Gram-negative bacteria. In light of application of these compounds as anti-infective coatings on orthopedic implants, toxicity against two bone cell lines and the functionality of these cells were tested. The N1-,2N-disubstituted 5-aryl-2-aminoimidazoles in general did not affect the viability of bone cells and even induced calcium deposition. This indicates that modulating the substitution pattern on positions N1 and 2N of the 5-aryl-2-aminoimidazole scaffold allows fine-tuning of both the

  17. Modulation of the Substitution Pattern of 5-Aryl-2-Aminoimidazoles Allows Fine-Tuning of Their Antibiofilm Activity Spectrum and Toxicity.

    PubMed

    Peeters, Elien; Hooyberghs, Geert; Robijns, Stijn; Waldrant, Kai; De Weerdt, Ami; Delattin, Nicolas; Liebens, Veerle; Kucharíková, Soňa; Tournu, Hélène; Verstraeten, Natalie; Dovgan, Barbara; Girandon, Lenart; Fröhlich, Mirjam; De Brucker, Katrijn; Van Dijck, Patrick; Michiels, Jan; Cammue, Bruno P A; Thevissen, Karin; Vanderleyden, Jozef; Van der Eycken, Erik; Steenackers, Hans P

    2016-11-01

    We previously synthesized several series of compounds, based on the 5-aryl-2-aminoimidazole scaffold, that showed activity preventing the formation of Salmonella enterica serovar Typhimurium and Pseudomonas aeruginosa biofilms. Here, we further studied the activity spectrum of a number of the most active N1- and 2N-substituted 5-aryl-2-aminoimidazoles against a broad panel of biofilms formed by monospecies and mixed species of bacteria and fungi. An N1-substituted compound showed very strong activity against the biofilms formed by Gram-negative and Gram-positive bacteria and the fungus Candida albicans but was previously shown to be toxic against various eukaryotic cell lines. In contrast, 2N-substituted compounds were nontoxic and active against biofilms formed by Gram-negative bacteria and C. albicans but had reduced activity against biofilms formed by Gram-positive bacteria. In an attempt to develop nontoxic compounds with potent activity against biofilms formed by Gram-positive bacteria for application in antibiofilm coatings for medical implants, we synthesized novel compounds with substituents at both the N1 and 2N positions and tested these compounds for antibiofilm activity and toxicity. Interestingly, most of these N1-,2N-disubstituted 5-aryl-2-aminoimidazoles showed very strong activity against biofilms formed by Gram-positive bacteria and C. albicans in various setups with biofilms formed by monospecies and mixed species but lost activity against biofilms formed by Gram-negative bacteria. In light of application of these compounds as anti-infective coatings on orthopedic implants, toxicity against two bone cell lines and the functionality of these cells were tested. The N1-,2N-disubstituted 5-aryl-2-aminoimidazoles in general did not affect the viability of bone cells and even induced calcium deposition. This indicates that modulating the substitution pattern on positions N1 and 2N of the 5-aryl-2-aminoimidazole scaffold allows fine-tuning of both the

  18. Genes Translocated into the Plastid Inverted Repeat Show Decelerated Substitution Rates and Elevated GC Content

    PubMed Central

    Li, Fay-Wei; Kuo, Li-Yaung; Pryer, Kathleen M.; Rothfels, Carl J.

    2016-01-01

    Plant chloroplast genomes (plastomes) are characterized by an inverted repeat (IR) region and two larger single copy (SC) regions. Patterns of molecular evolution in the IR and SC regions differ, most notably by a reduced rate of nucleotide substitution in the IR compared to the SC region. In addition, the organization and structure of plastomes is fluid, and rearrangements through time have repeatedly shuffled genes into and out of the IR, providing recurrent natural experiments on how chloroplast genome structure can impact rates and patterns of molecular evolution. Here we examine four loci (psbA, ycf2, rps7, and rps12 exon 2–3) that were translocated from the SC into the IR during fern evolution. We use a model-based method, within a phylogenetic context, to test for substitution rate shifts. All four loci show a significant, 2- to 3-fold deceleration in their substitution rate following translocation into the IR, a phenomenon not observed in any other, nontranslocated plastid genes. Also, we show that after translocation, the GC content of the third codon position and of the noncoding regions is significantly increased, implying that gene conversion within the IR is GC-biased. Taken together, our results suggest that the IR region not only reduces substitution rates, but also impacts nucleotide composition. This finding highlights a potential vulnerability of correlating substitution rate heterogeneity with organismal life history traits without knowledge of the underlying genome structure. PMID:27401175

  19. Unravelling evolution of Nanog, the key transcription factor involved in self-renewal of undifferentiated embryonic stem cells, by pattern recognition in nucleotide and tandem repeats characteristics.

    PubMed

    Pashaiasl, Maryam; Khodadadi, Khodadad; Kayvanjoo, Amir Hossein; Pashaei-Asl, Roghiyeh; Ebrahimie, Esmaeil; Ebrahimi, Mansour

    2016-03-10

    Nanog, an important transcription factor in embryonic stem cells (ESC), is the key factor in maintaining pluripotency to establish ESC identity and has the ability to induce embryonic germ layers. Nanog is responsible for self-renewal and pluripotency of stem cells as well as cancer invasiveness, tumor cell proliferation, motility and drug-resistance. Understanding the underlying mechanisms of Nanog evolution and regulation can lead to future advances in treatment of cancers. Recent integration of machine learning models with genetics has provided a powerful tool for knowledge discovery and uncovering evolutionary pathways. Herein, sequences of 47 Nanog genes from various species were extracted and two datasets of features were computationally extracted from these sequences. At the first dataset, 76 nucleotide acid attributes were calculated for each Nanog sequence. The second dataset was prepared based on the 10,480 repeated nucleotide sequences (from 5 to 50bp lengths). Then, various data mining algorithms such as decision tree models were applied on these datasets to find the evolutionary pathways of Nanog diversion. Attribute weighting models were highlighted features such as the frequencies of AA and GC as the most important genomic features in Nanog gene classification and differentiation. Similar findings were obtained by tree induction algorithms. Results from the second database showed that some short sequence strings, such as ACTACT, TCCTGA, CCTGA, GAAGAC, and TATCCC can be effectively used to identify Nanog genes in various species. The outcomes of this study, for the first time, unravels the importance of particular genomic features in Nanog gene evolution paving roads toward better understanding of stem cell development and human targeted disorder therapy.

  20. Peruvian and globally reported amino acid substitutions on the Mycobacterium tuberculosis pyrazinamidase suggest a conserved pattern of mutations associated to pyrazinamide resistance

    PubMed Central

    Zimic, Mirko; Sheen, Patricia; Quiliano, Miguel; Gutierrez, Andrés; Gilman, Robert H.

    2010-01-01

    Resistance to pyrazinamide in Mycobacterium tuberculosis is usually associated with a reduction of pyrazinamidase activity caused by mutations in pncA, the pyrazinamidase coding gene. Pyrazinamidase is a hydrolase that converts pyrazinamide, the antituberculous drug against the latent stage, to the active compound, pyrazinoic acid. To better understand the relationship between pncA mutations and pyrazinamide-resistance, it is necessary to analyze the distribution of pncA mutations from pyrazinamide resistant strains. We determined the distribution of Peruvian and globally reported pncA missense mutations from M. tuberculosis clinical isolates resistant to pyrazinamide. The distributions of the single amino acid substitutions were compared at the secondary-structure-domains level. The distribution of the Peruvian mutations followed a similar pattern as the mutations reported globally. A consensus clustering of mutations was observed in hot-spot regions located in the metal coordination site and to a lesser extent in the active site of the enzyme. The data was not able to reject the null hypothesis that both distributions are similar, suggesting that pncA mutations associated to pyrazinamide resistance in M. tuberculosis, follow a conserved pattern responsible to impair the pyrazinamidase activity. PMID:19963078

  1. The impact of single nucleotide polymorphisms on patterns of non-contact musculoskeletal soft tissue injuries in a football player population according to ethnicity.

    PubMed

    Pruna, Ricard; Ribas, Jordi; Montoro, Jose Bruno; Artells, Rosa

    2015-02-02

    The prevention, diagnosis, and management of non-contact musculoskeletal soft tissue injuries (NCMSTIs) related to participation in sports are key components of sport and exercise medicine. Epidemiological data have demonstrated the existence of interindividual differences in the severity of NCMSTIs, indicating that these injuries occur as a consequence of both extrinsic and intrinsic factors, including genetic variations. We have collected data on NCMSTIs suffered by 73 elite players of White, black African and Hispanic ethnicity of European football over the course of three consecutive seasons. We have also examined eight single nucleotide polymorphisms (SNPs) in genes related to tissue recovery and tissue repair in blood drawn from the players and correlated our findings with type and severity of injuries in each ethnic group. The frequency of the SNPs varied among the three ethnic sub-groups (p<0.0001). Among Whites, a significant relationship was observed between ligament injuries and ELN (p=0.001) and between tendinous injuries and ELN (p=0.05) and IGF2 (p=0.05). Among Hispanics, there was a significant relation between muscle injuries and ELN (p=0.032) and IGF2 (p=0.016). Interracial genotypic differences may be important in the study of NCMSTIs. A genetic profile based on SNPs may be useful tool to describe each individual's injuribility risk and provide specific treatment and preventive care for football players. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

  2. Multilocus patterns of nucleotide diversity and divergence reveal positive selection at candidate genes related to cold hardiness in coastal Douglas Fir (Pseudotsuga menziesii var. menziesii).

    Treesearch

    A. Eckert; J. Wegrzyn; B. Pande; K. Jermstad; J. Lee; J. Liechty; B. Tearse; K. Krutovsky; D. Neale

    2009-01-01

    Forest trees exhibit remarkable adaptations to their environments. The genetic basis for phenotypic adaptation to climatic gradients has been established through a long history of common garden, provenance, and genecological studies. The identities of genes underlying these traits, however, have remained elusive and thus so have the patterns of adaptive molecular...

  3. Substitute Solutions.

    ERIC Educational Resources Information Center

    Jones, Kevin R.; Hawkins, Amber

    2000-01-01

    In summer 1999, a group of Park City, Utah, school administrators, personnel directors, human-resource specialists, and substitute teacher coordinators brainstormed on improving the recruitment, training, and retention of substitute teachers. Providing effective preservice and on-the-job training and professional recognition are key suggestions.…

  4. A novel HLA-B*51 allele (B*5116) identified by nucleotide sequencing.

    PubMed

    Tamouza, R; Carbonnelle, E; Schaeffer, V; Sadki, K; Abed, Y; Marzais, F; Poirier, J C; Fortier, C; Toubert, A; Raffoux, C; Charron, D

    2000-02-01

    We report here an additional HLA-B*51 variant designated HLA-B*5116. Detected by an abnormal serological reactivity pattern, this variant was identified as a B*51 allele by polymerase chain reaction using sequence-specific primers (PCR-SSP) and characterized by nucleotide sequencing. The new variant sequence match closely with the classical HLA-B*5101 excepted two adjacent nucleotide substitutions at positions 216 and 217 of the third exon and the subsequent Leucine to Glutamic acid change at codon 163 of the alpha2 domain (CTG-->GAG). This new variant was not detected in three different ethnic groups (French, Algerian and Lebanese) suggesting a very rare frequency.

  5. [Bone substitutes].

    PubMed

    Jordana, Fabienne; Le Visage, Catherine; Weiss, Pierre

    2017-01-01

    Bone substitutes, used to fill a defect after a surgery or a trauma, provide a mechanical support and might induce bone healing. They constitute an alternative to autogenous bone grafts, the 'gold standard' which remains the reference despite its risk of postoperative complications. The clinician choice of a bone substitute is based on the required bone volume, the handling (injectability, malleability) and mechanical properties (setting time, viscosity, resorbability among others) of the material. Bone substitutes are commonly used in orthopedic surgery, neurosurgery, stomatology and dental applications. Their use increases steadily, with the recent clinical development of injectable forms. In addition, novel technologies by subtractive or additive techniques allow today the production of controlled architecture materials. Here, we present a bone substitutes classification according to their origin (natural or synthetic) and chemical composition, and the most common use of these substitutes. © 2017 médecine/sciences – Inserm.

  6. Skin Substitutes

    PubMed Central

    Howe, Nicole; Cohen, George

    2014-01-01

    In a relatively short timespan, a wealth of new skin substitutes made of synthetic and biologically derived materials have arisen for the purpose of wound healing of various etiologies. This review article focuses on providing an overview of skin substitutes including their indications, contraindications, benefits, and limitations. The result of this overview was an appreciation of the vast array of options available for clinicians, many of which did not exist a short time ago. Yet, despite the rapid expansion this field has undergone, no ideal skin substitute is currently available. More research in the field of skin substitutes and wound healing is required not only for the development of new products made of increasingly complex biomolecular material, but also to compare the existing skin substitutes. PMID:25371771

  7. Master Amino acid Pattern as substitute for dietary proteins during a weight-loss diet to achieve the body's nitrogen balance equilibrium with essentially no calories.

    PubMed

    Lucà-Moretti, M; Grandi, A; Lucà, E; Muratori, G; Nofroni, M G; Mucci, M P; Gambetta, P; Stimolo, R; Drago, P; Giudice, G; Tamburlin, N

    2003-01-01

    Results of this multicentric study have shown that by giving 10 g (10 tablets) of Master Amino acid Pattern (MAP) as a substitute for dietary proteins, once a day, to 114 overweight participants undergoing the American Nutrition Clinics/Overweight Management Program (ANC/OMP), the participants' nitrogen balance could be maintained in equilibrium with essentially no calories (MAP 1 g=0.04 kcal), thereby preserving the body's structural and functional proteins, eliminating excessive water retention from the interstitial compartment, and preventing the sudden weight increase after study conclusion commonly known as the yo-yo effect. Study results have shown that the use of MAP, in conjunction with the ANC/OMP, has proven to be safe and effective by preventing those adverse effects associated with a negative nitrogen balance, such as oversized or flabby tissue, stretch marks, sagging of breast tissue, increased hair loss, faded hair color, and fragile or brittle nails. Also preventing those anomalies commonly associated with weight-loss diets, such as hunger, weakness, headache caused by ketosis, constipation, or decreased libido, the use of MAP, in conjunction with the ANC/OMP, allowed for mean weight loss of 1.4 kg (3 lb) per week.

  8. Master Amino acid Pattern as sole and total substitute for dietary proteins during a weight-loss diet to achieve the body's nitrogen balance equilibrium.

    PubMed

    Lucà-Moretti, M; Grandi, A; Lucà, E; Muratori, G; Nofroni, M G; Mucci, M P; Gambetta, P; Stimolo, R; Drago, P; Giudice, G; Tamburlin, N; Karbalai, M; Valente, C; Moras, G

    2003-01-01

    Results of this multicentric study have shown that by giving Master Amino acid Pattern (MAP) as a sole and total substitute of dietary proteins to 500 overweight participants undergoing the American Nutrition Clinics/Overweight Management Program (ANC/OMP), the participants' body nitrogen balance could be maintained in equilibrium with essentially no calories (MAP 1 g=0.04 kcal), thereby preserving the body's structural and functional proteins, eliminating excessive water retention from the interstitial compartment, and preventing the sudden weight increase after study conclusion commonly known as the yo-yo effect. Study results have shown that the use of MAP, in conjunction with the ANC/OMP regimen, has proven to be safe and effective by preventing those adverse effects associated with a negative nitrogen balance, such as oversized or flabby tissue, stretch marks, the sagging of breast tissue, increased hair loss, faded hair color, and fragile or brittle nails. Also prevented were those anomalies commonly associated with weight-loss diets, such as hunger, weakness, headache caused by ketosis, constipation, and decreased libido. The use of MAP in conjunction with the ANC/OMP also allowed for mean weight loss of 2.5 kg (5.5 lb) per week, achieved through reduction of excessive fat tissue and elimination of excessive water retention from the interstitial compartment.

  9. Substitution of Feline Leukemia Virus Long Terminal Repeat Sequences into Murine Leukemia Virus Alters the Pattern of Insertional Activation and Identifies New Common Insertion Sites

    PubMed Central

    Johnson, Chassidy; Lobelle-Rich, Patricia A.; Puetter, Adriane; Levy, Laura S.

    2005-01-01

    The recombinant retrovirus, MoFe2-MuLV (MoFe2), was constructed by replacing the U3 region of Moloney murine leukemia virus (M-MuLV) with homologous sequences from the FeLV-945 LTR. NIH/Swiss mice neonatally inoculated with MoFe2 developed T-cell lymphomas of immature thymocyte surface phenotype. MoFe2 integrated infrequently (0 to 9%) near common insertion sites (CISs) previously identified for either parent virus. Using three different strategies, CISs in MoFe2-induced tumors were identified at six loci, none of which had been previously reported as CISs in tumors induced by either parent virus in wild-type animals. Two of the newly identified CISs had not previously been implicated in lymphoma in any retrovirus model. One of these, designated 3-19, encodes the p101 regulatory subunit of phosphoinositide-3-kinase-gamma. The other, designated Rw1, is predicted to encode a protein that functions in the immune response to virus infection. Thus, substitution of FeLV-945 U3 sequences into the M-MuLV long terminal repeat (LTR) did not alter the target tissue for M-MuLV transformation but significantly altered the pattern of CIS utilization in the induction of T-cell lymphoma. These observations support a growing body of evidence that the distinctive sequence and/or structure of the retroviral LTR determines its pattern of insertional activation. The findings also demonstrate the oligoclonal nature of retrovirus-induced lymphomas by demonstrating proviral insertions at CISs in subdominant populations in the tumor mass. Finally, the findings demonstrate the utility of novel recombinant retroviruses such as MoFe2 to contribute new genes potentially relevant to the induction of lymphoid malignancy. PMID:15596801

  10. Inferring divergence of context-dependent substitution rates in Drosophila genomes with applications to comparative genomics.

    PubMed

    Chachick, Ran; Tanay, Amos

    2012-07-01

    Nucleotide substitution is a major evolutionary driving force that can incrementally and stochastically give rise to broad divergence patterns among species. The substitution process at each genomic position is frequently modeled independently of the other positions, although complex interactions between nearby bases are known to significantly affect mutation rates. Here, we study the evolution of 12 fly genomes using new algorithms for accurate inference of parameter-rich substitution models. By comparing models between lineages, we reveal the evolutionary histories of substitution rates at different flanking nucleotide contexts. We demonstrate these driving forces of molecular evolution to be constantly changing, suggesting that neutral drift of mutation rates is an important factor in the evolution of genomes and their sequence composition. This observation is used to develop a scalable approach for parameter-rich comparative genomics. By screening short DNA sequences, we demonstrate how homeoboxes and other transcription factor binding motifs are highly conserved based on our parameter-rich models but not according to standard conservation assays. With the increasing availability of genome sequences, rich substitution models become an attractive and practical approach for evolutionary analysis in general and comparative genomics in particular.

  11. Association of the UCP-1 single nucleotide polymorphism A-3826G with the dampness-phlegm pattern among Korean stroke patients

    PubMed Central

    2012-01-01

    Background Patients with stroke have various syndromes and symptoms. Through pattern identification (PI), traditional Korean medicine (TKM) classifies the several syndromes and symptoms of stroke patients into five categories: Fire-heat (FH), Dampness-phlegm (DP), Yin-deficiency (YD), Qi-deficiency (QD) and Blood-stasis (BS). DP has been associated with obesity and hyperlipidemia. Uncoupling protein-1 (UCP-1), which plays a major role in thermogenesis and energy expenditure can increase the risk of obesity and can be related metabolic disorders. In this study, we elucidated the association of three polymorphisms located in the UCP-1 promoter and coding region with DP among Korean stroke patients. Methods 1,593 patients with cerebral infarction (583/DP, 1,010/non-DP) and 587 normal subjects were enrolled. The genotypes A-3826G, G-1766A and Ala64Thr (G+1068A) for each subject were determined by polymerase chain reaction with TaqMan probes and five percent of subjects were re-genotyped by sequencing method to confirm the accuracy of genotyping. The results were analyzed using a multiple logistic regression model to evaluate the genetic associations: the UCP-1polymorphisms of normal versus those of DP subjects and those of normal versus those of non-DP subjects. Results A significantly higher percentage of subjects in the DP group possessed the A-3826G G allele than the A allele (OR=1.508, p=0.006). Furthermore, the number of subjects with the GG type of A-1766G was significantly lower in the non-DP group than the normal group in the recessive model (OR=0.606, p=0.042). In addition, an analysis of the relationship among 2 SNPs of UCP-1 and lipid serum concentration showed that the serum level of HDL cholesterol was significantly higher in subjects with the A-3826G G allele in the normal group (p=0.032). Serum triglyceride and HDL cholesterol were also associated with the A-1766G variant in the recessive model (p=0.002, p=0.046). Conclusions These results suggest that

  12. Plant Cyclic Nucleotide Signalling

    PubMed Central

    Martinez-Atienza, Juliana; Van Ingelgem, Carl; Roef, Luc

    2007-01-01

    The presence of the cyclic nucleotides 3′,5′-cyclic adenyl monophosphate (cAMP) and 3′,5′-cyclic guanyl monophosphate (cGMP) in plants is now generally accepted. In addition, cAMP and cGMP have been implicated in the regulation of important plant processes such as stomatal functioning, monovalent and divalent cation fluxes, chloroplast development, gibberellic acid signalling, pathogen response and gene transcription. However, very little is known regarding the components of cyclic nucleotide signalling in plants. In this addendum, the evidence for specific mechanisms of plant cyclic nucleotide signalling is evaluated and discussed. PMID:19704553

  13. Nonrandom spatial distribution of synonymous substitutions in the GP63 gene from Leishmania.

    PubMed Central

    Alvarez-Valin, F; Tort, J F; Bernardi, G

    2000-01-01

    In this work we analyze the variability in substitution rates in the GP63 gene from Leishmania. By using a sliding window to estimate substitution rates along the gene, we found that the rate of synonymous substitutions along the GP63 gene is highly correlated with both the rate of amino acid substitution and codon bias. Furthermore, we show that comparisons involving genes that represent independent phylogenetic lines yield very similar divergence/conservation patterns, thus suggesting that deterministic forces (i.e., nonstochastic forces such as selection) generated these patterns. We present evidence indicating that the variability in substitution rates is unambiguously related to functionally relevant features. In particular, there is a clear relationship between rates and the tertiary structure of the encoded protein since all divergent segments are located on the surface of the molecule and facing one side (almost parallel to the cell membrane) on the exposed surface of the organism. Remarkably, the protein segments encoded by these variable regions encircle the active site in a funnel-like distribution. These results strongly suggest that the pattern of nucleotide divergence and, notably, of synonymous divergence is affected by functional constraints. PMID:10924466

  14. Structure-function relationship of substituted bromomethylcoumarins in nucleoside specificity of RNA alkylation.

    PubMed

    Kellner, Stefanie; Kollar, Laura Bettina; Ochel, Antonia; Ghate, Manjunath; Helm, Mark

    2013-01-01

    Selective alkylation of RNA nucleotides is an important field of RNA biochemistry, e.g. in applications of fluorescent labeling or in structural probing experiments, yet detailed structure-function studies of labeling agents are rare. Here, bromomethylcoumarins as reactive compounds for fluorescent labeling of RNA are developed as an attractive scaffold on which electronic properties can be modulated by varying the substituents. Six different 4-bromomethyl-coumarins of various substitution patterns were tested for nucleotide specificity of RNA alkylation using tRNA from Escherichia coli as substrate. Using semi-quantitative LC-MS/MS analysis, reactions at mildly acidic and slightly alkaline pH were compared. For all tested compounds, coumarin conjugates with 4-thiouridine, pseudouridine, guanosine, and uridine were identified, with the latter largely dominating. This data set shows that selectivity of ribonucleotide alkylation depends on the substitution pattern of the reactive dye, and even more strongly on the modulation of the reaction conditions. The latter should be therefore carefully optimized when striving to achieve selectivity. Interestingly, the highest selectivity for labeling of a modified nucleoside, namely of 4-thiouridine, was achieved with a compound whose selectivity was somewhat less dependent on reaction conditions than the other compounds. In summary, bromomethylcoumarin derivatives are a highly interesting class of compounds, since their selectivity for 4-thiouridine can be efficiently tuned by variation of substitution pattern and reaction conditions.

  15. Nucleotide sequence variation of the envelope protein gene identifies two distinct genotypes of yellow fever virus.

    PubMed

    Chang, G J; Cropp, B C; Kinney, R M; Trent, D W; Gubler, D J

    1995-09-01

    The evolution of yellow fever virus over 67 years was investigated by comparing the nucleotide sequences of the envelope (E) protein genes of 20 viruses isolated in Africa, the Caribbean, and South America. Uniformly weighted parsimony algorithm analysis defined two major evolutionary yellow fever virus lineages designated E genotypes I and II. E genotype I contained viruses isolated from East and Central Africa. E genotype II viruses were divided into two sublineages: IIA viruses from West Africa and IIB viruses from America, except for a 1979 virus isolated from Trinidad (TRINID79A). Unique signature patterns were identified at 111 nucleotide and 12 amino acid positions within the yellow fever virus E gene by signature pattern analysis. Yellow fever viruses from East and Central Africa contained unique signatures at 60 nucleotide and five amino acid positions, those from West Africa contained unique signatures at 25 nucleotide and two amino acid positions, and viruses from America contained such signatures at 30 nucleotide and five amino acid positions in the E gene. The dissemination of yellow fever viruses from Africa to the Americas is supported by the close genetic relatedness of genotype IIA and IIB viruses and genetic evidence of a possible second introduction of yellow fever virus from West Africa, as illustrated by the TRINID79A virus isolate. The E protein genes of American IIB yellow fever viruses had higher frequencies of amino acid substitutions than did genes of yellow fever viruses of genotypes I and IIA on the basis of comparisons with a consensus amino acid sequence for the yellow fever E gene. The great variation in the E proteins of American yellow fever virus probably results from positive selection imposed by virus interaction with different species of mosquitoes or nonhuman primates in the Americas.

  16. Nucleotide sequence variation of the envelope protein gene identifies two distinct genotypes of yellow fever virus.

    PubMed Central

    Chang, G J; Cropp, B C; Kinney, R M; Trent, D W; Gubler, D J

    1995-01-01

    The evolution of yellow fever virus over 67 years was investigated by comparing the nucleotide sequences of the envelope (E) protein genes of 20 viruses isolated in Africa, the Caribbean, and South America. Uniformly weighted parsimony algorithm analysis defined two major evolutionary yellow fever virus lineages designated E genotypes I and II. E genotype I contained viruses isolated from East and Central Africa. E genotype II viruses were divided into two sublineages: IIA viruses from West Africa and IIB viruses from America, except for a 1979 virus isolated from Trinidad (TRINID79A). Unique signature patterns were identified at 111 nucleotide and 12 amino acid positions within the yellow fever virus E gene by signature pattern analysis. Yellow fever viruses from East and Central Africa contained unique signatures at 60 nucleotide and five amino acid positions, those from West Africa contained unique signatures at 25 nucleotide and two amino acid positions, and viruses from America contained such signatures at 30 nucleotide and five amino acid positions in the E gene. The dissemination of yellow fever viruses from Africa to the Americas is supported by the close genetic relatedness of genotype IIA and IIB viruses and genetic evidence of a possible second introduction of yellow fever virus from West Africa, as illustrated by the TRINID79A virus isolate. The E protein genes of American IIB yellow fever viruses had higher frequencies of amino acid substitutions than did genes of yellow fever viruses of genotypes I and IIA on the basis of comparisons with a consensus amino acid sequence for the yellow fever E gene. The great variation in the E proteins of American yellow fever virus probably results from positive selection imposed by virus interaction with different species of mosquitoes or nonhuman primates in the Americas. PMID:7637022

  17. Evolving nucleotide binding surfaces

    NASA Technical Reports Server (NTRS)

    Kieber-Emmons, T.; Rein, R.

    1981-01-01

    An analysis is presented of the stability and nature of binding of a nucleotide to several known dehydrogenases. The employed approach includes calculation of hydrophobic stabilization of the binding motif and its intermolecular interaction with the ligand. The evolutionary changes of the binding motif are studied by calculating the Euclidean deviation of the respective dehydrogenases. Attention is given to the possible structural elements involved in the origin of nucleotide recognition by non-coded primordial polypeptides.

  18. Fluorinated Nucleotide Modifications Modulate Allele Selectivity of SNP-Targeting Antisense Oligonucleotides.

    PubMed

    Østergaard, Michael E; Nichols, Josh; Dwight, Timothy A; Lima, Walt; Jung, Michael E; Swayze, Eric E; Seth, Punit P

    2017-06-16

    Antisense oligonucleotides (ASOs) have the potential to discriminate between subtle RNA mismatches such as SNPs. Certain mismatches, however, allow ASOs to bind at physiological conditions and result in RNA cleavage mediated by RNase H. We showed that replacing DNA nucleotides in the gap region of an ASO with other chemical modification can improve allele selectivity. Herein, we systematically substitute every position in the gap region of an ASO targeting huntingtin gene (HTT) with fluorinated nucleotides. Potency is determined in cell culture against mutant HTT (mtHTT) and wild-type HTT (wtHTT) mRNA and RNase H cleavage intensities, and patterns are investigated. This study profiled five different fluorinated nucleotides and showed them to have predictable, site-specific effects on RNase H cleavage, and the cleavage patterns were rationalized from a published X-ray structure of human RNase H1. The results herein can be used as a guide for future projects where ASO discrimination of SNPs is important. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Aryl substitution of pentacenes

    PubMed Central

    Waterloo, Andreas R; Sale, Anna-Chiara; Lehnherr, Dan; Hampel, Frank

    2014-01-01

    Summary A series of 11 new pentacene derivatives has been synthesized, with unsymmetrical substitution based on a trialkylsilylethynyl group at the 6-position and various aryl groups appended to the 13-position. The electronic and physical properties of the new pentacene chromophores have been analyzed by UV–vis spectroscopy (solution and thin films), thermoanalytical methods (DSC and TGA), cyclic voltammetry, as well as X-ray crystallography (for 8 derivatives). X-ray crystallography has been specifically used to study the influence of unsymmetrical substitution on the solid-state packing of the pentacene derivatives. The obtained results add to our ability to better predict substitution patterns that might be helpful for designing new semiconductors for use in solid-state devices. PMID:25161729

  20. Substitution rates in hepatitis delta virus.

    PubMed

    Krushkal, J; Li, W H

    1995-12-01

    Substitution rates were estimated for the coding and noncoding regions of the hepatitis delta virus (HDV). The estimated rates of synonymous substitution in HDV were lower than the rates of substitution at non-synonymous sites and in the noncoding region. HDV has lower synonymous substitution rates than the hepatitis C virus, though both are RNA viruses. The relatively low rate of synonymous substitution in HDV may be due to a strong preference of G and C nucleotides at third codon positions. Variation in substitution rate among HDV lineages may be correlated with the clinical development of the HDV-induced hepatitis. The phylogenetic tree inferred for 24 HDV strains reveals similarities between lineages isolated from the same geographic region.

  1. Correlated Evolution of Nucleotide Positions within Splice Sites in Mammals.

    PubMed

    Denisov, Stepan; Bazykin, Georgii; Favorov, Alexander; Mironov, Andrey; Gelfand, Mikhail

    2015-01-01

    Splice sites (SSs)--short nucleotide sequences flanking introns--are under selection for spliceosome binding, and adhere to consensus sequences. However, non-consensus nucleotides, many of which probably reduce SS performance, are frequent. Little is known about the mechanisms maintaining such apparently suboptimal SSs. Here, we study the correlations between strengths of nucleotides occupying different positions of the same SS. Such correlations may arise due to epistatic interactions between positions (i.e., a situation when the fitness effect of a nucleotide in one position depends on the nucleotide in another position), their evolutionary history, or to other reasons. Within both the intronic and the exonic parts of donor SSs, nucleotides that increase (decrease) SS strength tend to co-occur with other nucleotides increasing (respectively, decreasing) it, consistent with positive epistasis. Between the intronic and exonic parts of donor SSs, the correlations of nucleotide strengths tend to be negative, consistent with negative epistasis. In the course of evolution, substitutions at a donor SS tend to decrease the strength of its exonic part, and either increase or do not change the strength of its intronic part. In acceptor SSs, the situation is more complicated; the correlations between adjacent positions appear to be driven mainly by avoidance of the AG dinucleotide which may cause aberrant splicing. In summary, both the content and the evolution of SSs is shaped by a complex network of interdependences between adjacent nucleotides that respond to a range of sometimes conflicting selective constraints.

  2. Correlated Evolution of Nucleotide Positions within Splice Sites in Mammals

    PubMed Central

    Denisov, Stepan; Bazykin, Georgii; Favorov, Alexander; Mironov, Andrey; Gelfand, Mikhail

    2015-01-01

    Splice sites (SSs)—short nucleotide sequences flanking introns—are under selection for spliceosome binding, and adhere to consensus sequences. However, non-consensus nucleotides, many of which probably reduce SS performance, are frequent. Little is known about the mechanisms maintaining such apparently suboptimal SSs. Here, we study the correlations between strengths of nucleotides occupying different positions of the same SS. Such correlations may arise due to epistatic interactions between positions (i.e., a situation when the fitness effect of a nucleotide in one position depends on the nucleotide in another position), their evolutionary history, or to other reasons. Within both the intronic and the exonic parts of donor SSs, nucleotides that increase (decrease) SS strength tend to co-occur with other nucleotides increasing (respectively, decreasing) it, consistent with positive epistasis. Between the intronic and exonic parts of donor SSs, the correlations of nucleotide strengths tend to be negative, consistent with negative epistasis. In the course of evolution, substitutions at a donor SS tend to decrease the strength of its exonic part, and either increase or do not change the strength of its intronic part. In acceptor SSs, the situation is more complicated; the correlations between adjacent positions appear to be driven mainly by avoidance of the AG dinucleotide which may cause aberrant splicing. In summary, both the content and the evolution of SSs is shaped by a complex network of interdependences between adjacent nucleotides that respond to a range of sometimes conflicting selective constraints. PMID:26642327

  3. Solvent substitution

    SciTech Connect

    Not Available

    1990-01-01

    The DOE Environmental Restoration and Waste Management Office of Technology Development and the Air Force Engineering and Services Center convened the First Annual International Workshop on Solvent Substitution on December 4--7, 1990. The primary objectives of this joint effort were to share information and ideas among attendees in order to enhance the development and implementation of required new technologies for the elimination of pollutants associated with industrial use of hazardous and toxic solvents; and to aid in accelerating collaborative efforts and technology transfer between government and industry for solvent substitution. There were workshop sessions focusing on Alternative Technologies, Alternative Solvents, Recovery/Recycling, Low VOC Materials and Treatment for Environmentally Safe Disposal. The 35 invited papers presented covered a wide range of solvent substitution activities including: hardware and weapons production and maintenance, paint stripping, coating applications, printed circuit boards, metal cleaning, metal finishing, manufacturing, compliance monitoring and process control monitoring. This publication includes the majority of these presentations. In addition, in order to further facilitate information exchange and technology transfer, the US Air Force and DOE solicited additional papers under a general Call for Papers.'' These papers, which underwent review and final selection by a peer review committee, are also included in this combined Proceedings/Compendium. For those involved in handling, using or managing hazardous and toxic solvents, this document should prove to be a valuable resource, providing the most up-to-date information on current technologies and practices in solvent substitution. Individual papers are abstracted separated.

  4. Prokaryotic Nucleotide Excision Repair

    PubMed Central

    Kisker, Caroline; Kuper, Jochen; Van Houten, Bennett

    2013-01-01

    Nucleotide excision repair (NER) has allowed bacteria to flourish in many different niches around the globe that inflict harsh environmental damage to their genetic material. NER is remarkable because of its diverse substrate repertoire, which differs greatly in chemical composition and structure. Recent advances in structural biology and single-molecule studies have given great insight into the structure and function of NER components. This ensemble of proteins orchestrates faithful removal of toxic DNA lesions through a multistep process. The damaged nucleotide is recognized by dynamic probing of the DNA structure that is then verified and marked for dual incisions followed by excision of the damage and surrounding nucleotides. The opposite DNA strand serves as a template for repair, which is completed after resynthesis and ligation. PMID:23457260

  5. Prokaryotic nucleotide excision repair.

    PubMed

    Kisker, Caroline; Kuper, Jochen; Van Houten, Bennett

    2013-03-01

    Nucleotide excision repair (NER) has allowed bacteria to flourish in many different niches around the globe that inflict harsh environmental damage to their genetic material. NER is remarkable because of its diverse substrate repertoire, which differs greatly in chemical composition and structure. Recent advances in structural biology and single-molecule studies have given great insight into the structure and function of NER components. This ensemble of proteins orchestrates faithful removal of toxic DNA lesions through a multistep process. The damaged nucleotide is recognized by dynamic probing of the DNA structure that is then verified and marked for dual incisions followed by excision of the damage and surrounding nucleotides. The opposite DNA strand serves as a template for repair, which is completed after resynthesis and ligation.

  6. Direct C-C coupling of two Ni-salphen complexes to yield dinickel-disalphen complexes with symmetric and non-symmetric substitution-patterns.

    PubMed

    Bugenhagen, B E C; Prosenc, M H

    2016-04-25

    The synthesis of symmetric and non-symmetric 5,5'-linked disalophen Ni(ii) complexes by the Suzuki-Miyaura-reaction is reported. Also, the synthesis and structural characterization of four Ni(ii)-precursor complexes are presented. The 5-Br-substituted mononuclear complexes and are coupled to the pinacolborane substituted complexes and yielding the four dinuclear dinickel complexes in good yields. The crystal structure of dinuclear complex was obtained revealing a coplanar arrangement between the two salophen fragments. Electronic spectra as well as DFT-calculations on the ground states and excitation energies are reported and they reveal a small coupling between the electronically saturated Ni-salophen complexes.

  7. The application and performance of single nucleotide polymorphism markers for population genetic analyses of Lepidoptera

    USDA-ARS?s Scientific Manuscript database

    Single nucleotide polymorphisms (SNPs) are nucleotide substitution mutations that tend to be at high densities within eukaryotic genomes. The development of assays that detect allelic variation at SNP loci is attractive for genome mapping, population genetics, and phylogeographic applications. A p...

  8. Nucleotide signalling during inflammation

    PubMed Central

    Idzko, Marco; Ferrari, Davide; Eltzschig, Holger K.

    2014-01-01

    Inflammatory conditions are associated with the extracellular release of nucleotides, particularly ATP. In the extracellular compartment, ATP predominantly functions as a signalling molecule through the activation of purinergic P2 receptors. Metabotropic P2Y receptors are G-protein-coupled, whereas ionotropic P2X receptors are ATP-gated ion channels. Here we discuss how signalling events through P2 receptors alter the outcomes of inflammatory or infectious diseases. Recent studies implicate a role for P2X/P2Ysignalling in mounting appropriate inflammatory responses critical for host defence against invading pathogens or tumours. Conversely, P2X/P2Y signalling can promote chronic inflammation during ischaemia and reperfusion injury, inflammatory bowel disease or acute and chronic diseases of the lungs. Although nucleotide signalling has been used clinically in patients before, research indicates an expanding field of opportunities for specifically targeting individual P2 receptors for the treatment of inflammatory or infectious diseases. PMID:24828189

  9. Different patterns of sexual dysfunctions associated with psychiatric disorders and psychopharmacological treatment. Results of an investigation by semistructured interview of schizophrenic and neurotic patients and methadone-substituted opiate addicts.

    PubMed

    Teusch, L; Scherbaum, N; Böhme, H; Bender, S; Eschmann-Mehl, G; Gastpar, M

    1995-05-01

    Little is known about sexual dysfunctions associated with psychiatric disorders and psychopharmacological treatment. In the present study schizophrenic patients (n = 45, mostly under neuroleptic treatment), neurotic patients (n = 50, mostly treated without medication), methadone-substituted opiate addicts (n = 37), and normal controls (n = 41) were included. They were interviewed with the aid of a sex-differentiated semistructured questionnaire on sexual function. All the methadone-substituted opiate addicts and nearly all the schizophrenic patients suffered from dysfunctions in at least one criterion. The three clinical groups differed significantly from the controls in sexual interest, emotional arousal, physiological arousal (erectile function/vaginal lubrication), performance (ejaculatory function/vaginism, dyspareunia), and orgasm satisfaction. Characteristic patterns of dysfunction were found in the male patients. The schizophrenic patients had significantly more dysfunctions of interest, physiological arousal, performance, and orgasm than the controls. Emotional arousal, erectile and ejaculatory functions, and orgasm satisfaction were impaired more frequently in the male schizophrenics than in the neurotic patients. Reduced sexual interest, emotional arousal, and orgasm satisfaction were reported more frequently by the methadone-substituted opiate addicts than by the neurotic men. Emotional arousal was even more frequently reduced than in the schizophrenic men. There was no correlation between sexual dysfunction and particular neuroleptics or neuroleptic or methadone dosage. The results are compared with the literature and suggestions made for further investigations.

  10. Nucleotide cleaving agents and method

    DOEpatents

    Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.

    2000-01-01

    The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

  11. Regulation of innate immunity by extracellular nucleotides

    PubMed Central

    Gorini, Stefania; Gatta, Lucia; Pontecorvo, Laura; Vitiello, Laura; la Sala, Andrea

    2013-01-01

    Extracellular ATP (eATP) is the most abundant among extracellular nucleotides and is commonly considered as a classical danger signal, which stimulates immune responses in the presence of tissue injury. In fact, increased nucleotide concentration in the extracellular space is generally closely associated with tissue stress or damage. However non-lytic nucleotide release may also occur in many cell types under a variety of conditions. Extracellular nucleotides are sensed by a class of plasma membrane receptors called P2 purinergic receptors (P2Rs). P2 receptors are expressed by all immunological cells and their activation elicits different responses. Extracellular ATP can act as an initiator or terminator of immune responses being able to induce different effects on immune cells depending on the pattern of P2 receptors engaged, the duration of the stimulus and its concentration in the extracellular milieu. Millimolar (high) concentrations of extracellular ATP, induce predominantly proinflammatory effects, while micromolar (low) doses exert mainly tolerogenic/immunosuppressive action. Moreover small, but significant differences in the pattern of P2 receptor expression in mice and humans confer diverse capacities of ATP in regulating the immune response. PMID:23358447

  12. [Connective tissue dysplasia, magnesium, and nucleotide polymorphisms].

    PubMed

    Torshin, I Iu; Gromova, O A

    2008-01-01

    Undifferentiated connective tissue dysplasia (UCTD) is one of most common diseases of the connective tissue. High frequency of UCTD in population along with the fact that it can provoke a number of other diseases make UCTD an important object of the modern biomedical research in the areas of cardiology, neurology, rheumatology and pulmonology. Modern diagnostics and determination of the predisposition to UCTD allow elaboration of personalized therapy. In particular, Mg-containing supplements and medications can be effectively used in the therapy of UCTD. In one of our previous works we have analyzed possible molecular mechanisms of UCTD etiology as well as therapeutic action of magnesium. The use of data on nucleotide polymorphisms as complementation of standard medical diagnostics is one of perspective trends of the post-genomic medical research. The present work suggest a number of nucleotide polymorphisms that can be used in genetic association analyses of the UCTD as of well as therapeutic efficiency of magnesium treatment. Selection and analysis of the polymorphisms was done on the base of molecular mechanisms we had proposed earlier, comprehensive analysis of published data and also with the use of an integral approach to analysis of the functional effects of the nucleotide polymorphisms and corresponding amino acid substitutions.

  13. Structures of a DNA Polymerase Inserting Therapeutic Nucleotide Analogues.

    PubMed

    Schaich, Matthew A; Smith, Mallory R; Cloud, Ashley S; Holloran, Sean M; Freudenthal, Bret D

    2017-09-01

    Members of the nucleoside analogue class of cancer therapeutics compete with canonical nucleotides to disrupt numerous cellular processes, including nucleotide homeostasis, DNA and RNA synthesis, and nucleotide metabolism. Nucleoside analogues are triphosphorylated and subsequently inserted into genomic DNA, contributing to the efficacy of therapeutic nucleosides in multiple ways. In some cases, the altered base acts as a mutagen, altering the DNA sequence to promote cellular death; in others, insertion of the altered nucleotide triggers DNA repair pathways, which produce lethal levels of cytotoxic intermediates such as single and double stranded DNA breaks. As a prerequisite to many of these biological outcomes, the modified nucleotide must be accommodated in the DNA polymerase active site during nucleotide insertion. Currently, the molecular contacts that mediate DNA polymerase insertion of modified nucleotides remain unknown for multiple therapeutic compounds, despite decades of clinical use. To determine how modified bases are inserted into duplex DNA, we used mammalian DNA polymerase β (pol β) to visualize the structural conformations of four therapeutically relevant modified nucleotides, 6-thio-2'-deoxyguanosine-5'-triphosphate (6-TdGTP), 5-fluoro-2'-deoxyuridine-5'-triphosphate (5-FdUTP), 5-formyl-deoxycytosine-5'-triphosphate (5-FodCTP), and 5-formyl-deoxyuridine-5'-triphosphate (5-FodUTP). Together, the structures reveal a pattern in which the modified nucleotides utilize Watson-Crick base pairing interactions similar to that of unmodified nucleotides. The nucleotide modifications were consistently positioned in the major groove of duplex DNA, accommodated by an open cavity in pol β. These results provide novel information for the rational design of new therapeutic nucleoside analogues and a greater understanding of how modified nucleotides are tolerated by polymerases.

  14. Electrophoretic Transport of Single DNA Nucleotides through Nanoslits: A Molecular Dynamics Simulation Study.

    PubMed

    Xia, Kai; Novak, Brian R; Weerakoon-Ratnayake, Kumuditha M; Soper, Steven A; Nikitopoulos, Dimitris E; Moldovan, Dorel

    2015-09-03

    There is potential for flight time based DNA sequencing involving disassembly into individual nucleotides which would pass through a nanochannel with two or more detectors. We performed molecular dynamics simulations of electrophoretic motion of single DNA nucleotides through 3 nm wide hydrophobic slits with both smooth and rough walls. The electric field (E) varied from 0.0 to 0.6 V/nm. The nucleotides adsorb and desorb from walls multiple times during their transit through the slit. The nucleotide-wall interactions differed due to nucleotide hydrophobicities and wall roughness which determined duration and frequency of nucleotide adsorptions and their velocities while adsorbed. Transient association of nucleotides with one, two, or three sodium ions occurred, but the mean association numbers (ANs) were weak functions of nucleotide type. Nucleotide-wall interactions contributed more to separation of nucleotide flight time distributions than ion association and thus indicate that nucleotide-wall interactions play a defining role in successfully discriminating between nucleotides on the basis of their flight times through nanochannels/slits. With smooth walls, smaller nucleotides moved faster, but with rough walls larger nucleotides moved faster due to fewer favorable wall adsorption sites. This indicates that roughness, or surface patterning, might be exploited to achieve better time-of-flight based discrimination between nucleotides.

  15. Template polymerization of nucleotide analogues

    NASA Technical Reports Server (NTRS)

    Orgel, L. E.

    1991-01-01

    Recent work on the template-directed reactions of the natural D-nucleotides has made it clear that l-nucleotides and nucleotide-like derivatives of other sugars would strongly inhibit the formation of long oligonucleotides. Consequently, attention is focusing on molecules simpler than nucleotides that might have acted as monomers of an information transfer system. We have begun a general exploration of the template directed reactions of diverse peptide analogues. I will present work by Dr. Taifeng Wu on oxidative oligomerization of phosphorothioates and of Dr. Mary Tohidi on the cyclic polymerization of nucleoside and related cyclic pyrophosphates.

  16. Nucleotide sequence of SHV-2 beta-lactamase gene

    SciTech Connect

    Garbarg-Chenon, A.; Godard, V.; Labia, R.; Nicolas, J.C. )

    1990-07-01

    The nucleotide sequence of plasmid-mediated beta-lactamase SHV-2 from Salmonella typhimurium (SHV-2pHT1) was determined. The gene was very similar to chromosomally encoded beta-lactamase LEN-1 of Klebsiella pneumoniae. Compared with the sequence of the Escherichia coli SHV-2 enzyme (SHV-2E.coli) obtained by protein sequencing, the deduced amino acid sequence of SHV-2pHT1 differed by three amino acid substitutions.

  17. Mutating three residues in the bovine rod cyclic nucleotide-activated channel can switch a nucleotide from inactive to active.

    PubMed Central

    Scott, S P; Cummings, J; Joe, J C; Tanaka, J C

    2000-01-01

    Cyclic nucleotide-gated (CNG) channels, which were initially studied in retina and olfactory neurons, are activated by cytoplasmic cGMP or cAMP. Detailed comparisons of nucleotide-activated currents using nucleotide analogs and mutagenesis revealed channel-specific residues in the nucleotide-binding domain that regulate the binding and channel-activation properties. Of particular interest are N(1)-oxide cAMP, which does not activate bovine rod channels, and Rp-cGMPS, which activates bovine rod, but not catfish, olfactory channels. Previously, we showed that four residues coordinate the purine interactions in the binding domain and that three of these residues vary in the alpha subunits of the bovine rod, catfish, and rat olfactory channels. Here we show that both N(1)-oxide cAMP and Rp-cGMPS activate rat olfactory channels. A mutant of the bovine rod alpha subunit, substituted with residues from the rat olfactory channel at the three variable positions, was weakly activated by N(1)-oxide cAMP, and a catfish olfactory-like bovine rod mutant lost activation by Rp-cGMPS. These experiments underscore the functional importance of purine contacts with three residues in the cyclic nucleotide-binding domain. Molecular models of nucleotide analogs in the binding domains, constructed with AMMP, showed differences in the purine contacts among the channels that might account for activation differences. PMID:10777730

  18. Estimation of evolutionary distances between nucleotide sequences.

    PubMed

    Zharkikh, A

    1994-09-01

    A formal mathematical analysis of the substitution process in nucleotide sequence evolution was done in terms of the Markov process. By using matrix algebra theory, the theoretical foundation of Barry and Hartigan's (Stat. Sci. 2:191-210, 1987) and Lanave et al.'s (J. Mol. Evol. 20:86-93, 1984) methods was provided. Extensive computer simulation was used to compare the accuracy and effectiveness of various methods for estimating the evolutionary distance between two nucleotide sequences. It was shown that the multiparameter methods of Lanave et al.'s (J. Mol. Evol. 20:86-93, 1984), Gojobori et al.'s (J. Mol. Evol. 18:414-422, 1982), and Barry and Hartigan's (Stat. Sci. 2:191-210, 1987) are preferable to others for the purpose of phylogenetic analysis when the sequences are long. However, when sequences are short and the evolutionary distance is large, Tajima and Nei's (Mol. Biol. Evol. 1:269-285, 1984) method is superior to others.

  19. Computational study of cation substitutions in apatites

    SciTech Connect

    Tamm, Toomas . E-mail: tamm@yki.ttu.ee; Peld, Merike

    2006-05-15

    Density-functional theory plane-wave modeling of fluor- and hydroxyapatites has been performed, where one or two calcium ions per unit cell were replaced with cadmium or zinc cations. It was found that cadmium ions favor Ca(1) positions in fluorapatites and Ca(2) positions in hydroxyapatites, in agreement with experiment. A similar pattern is predicted for zinc substitutions. In the doubly substituted cases, where only hydroxyapatites were modeled, a preference for the substituting ions to be located in Ca(2) position was also observed. Displacement of the hydroxide ions from their symmetrical positions on the hexagonal axis can be used to explain the preferred configurations of substituting ions around the axis. -- Deformation of the hydroxide ion chain due to substitutions around the ion channel in substituted hydroxyapatites.

  20. Multiple Base Substitution Corrections in DNA Sequence Evolution

    NASA Astrophysics Data System (ADS)

    Kowalczuk, M.; Mackiewicz, P.; Szczepanik, D.; Nowicka, A.; Dudkiewicz, M.; Dudek, M. R.; Cebrat, S.

    We discuss the Jukes and Cantor's one-parameter model and Kimura's two-parameter model unability to describe evolution of asymmetric DNA molecules. The standard distance measure between two DNA sequences, which is the number of substitutions per site, should include the effect of multiple base substitutions separately for each type of the base. Otherwise, the respective tables of substitutions cannot reconstruct the asymmetric DNA molecule with respect to the composition. Basing on Kimura's neutral theory, we have derived a linear law for the correlation of the mean survival time of nucleotides under constant mutation pressure and their fraction in the genome. According to the law, the corrections to Kimura's theory have been discussed to describe evolution of genomes with asymmetric nucleotide composition. We consider the particular case of the strongly asymmetric Borrelia burgdorferi genome and we discuss in detail the corrections, which should be introduced into the distance measure between two DNA sequences to include multiple base substitutions.

  1. Labeled nucleotide phosphate (NP) probes

    DOEpatents

    Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

    2009-02-03

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  2. Natural History of Human Respiratory Syncytial Virus Inferred from Phylogenetic Analysis of the Attachment (G) Glycoprotein with a 60-Nucleotide Duplication

    PubMed Central

    Trento, Alfonsina; Viegas, Mariana; Galiano, Mónica; Videla, Cristina; Carballal, Guadalupe; Mistchenko, Alicia S.; Melero, José A.

    2006-01-01

    A total of 47 clinical samples were identified during an active surveillance program of respiratory infections in Buenos Aires (BA) (1999 to 2004) that contained sequences of human respiratory syncytial virus (HRSV) with a 60-nucleotide duplication in the attachment (G) protein gene. This duplication was analogous to that previously described for other three viruses also isolated in Buenos Aires in 1999 (A. Trento et al., J. Gen. Virol. 84:3115-3120, 2003). Phylogenetic analysis indicated that BA sequences with that duplication shared a common ancestor (dated about 1998) with other HRSV G sequences reported worldwide after 1999. The duplicated nucleotide sequence was an exact copy of the preceding 60 nucleotides in early viruses, but both copies of the duplicated segment accumulated nucleotide substitutions in more recent viruses at a rate apparently higher than in other regions of the G protein gene. The evolution of the viruses with the duplicated G segment apparently followed the overall evolutionary pattern previously described for HRSV, and this genotype has replaced other prevailing antigenic group B genotypes in Buenos Aires and other places. Thus, the duplicated segment represents a natural tag that can be used to track the dissemination and evolution of HRSV in an unprecedented setting. We have taken advantage of this situation to reexamine the molecular epidemiology of HRSV and to explore the natural history of this important human pathogen. PMID:16378999

  3. Natural history of human respiratory syncytial virus inferred from phylogenetic analysis of the attachment (G) glycoprotein with a 60-nucleotide duplication.

    PubMed

    Trento, Alfonsina; Viegas, Mariana; Galiano, Mónica; Videla, Cristina; Carballal, Guadalupe; Mistchenko, Alicia S; Melero, José A

    2006-01-01

    A total of 47 clinical samples were identified during an active surveillance program of respiratory infections in Buenos Aires (BA) (1999 to 2004) that contained sequences of human respiratory syncytial virus (HRSV) with a 60-nucleotide duplication in the attachment (G) protein gene. This duplication was analogous to that previously described for other three viruses also isolated in Buenos Aires in 1999 (A. Trento et al., J. Gen. Virol. 84:3115-3120, 2003). Phylogenetic analysis indicated that BA sequences with that duplication shared a common ancestor (dated about 1998) with other HRSV G sequences reported worldwide after 1999. The duplicated nucleotide sequence was an exact copy of the preceding 60 nucleotides in early viruses, but both copies of the duplicated segment accumulated nucleotide substitutions in more recent viruses at a rate apparently higher than in other regions of the G protein gene. The evolution of the viruses with the duplicated G segment apparently followed the overall evolutionary pattern previously described for HRSV, and this genotype has replaced other prevailing antigenic group B genotypes in Buenos Aires and other places. Thus, the duplicated segment represents a natural tag that can be used to track the dissemination and evolution of HRSV in an unprecedented setting. We have taken advantage of this situation to reexamine the molecular epidemiology of HRSV and to explore the natural history of this important human pathogen.

  4. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    SciTech Connect

    Shin, Joong-Won; Bernstein, Elliot R.

    2014-01-28

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  5. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    NASA Astrophysics Data System (ADS)

    Shin, Joong-Won; Bernstein, Elliot R.

    2014-01-01

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5'-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C-C and C-O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  6. Maximum parsimony, substitution model, and probability phylogenetic trees.

    PubMed

    Weng, J F; Thomas, D A; Mareels, I

    2011-01-01

    The problem of inferring phylogenies (phylogenetic trees) is one of the main problems in computational biology. There are three main methods for inferring phylogenies-Maximum Parsimony (MP), Distance Matrix (DM) and Maximum Likelihood (ML), of which the MP method is the most well-studied and popular method. In the MP method the optimization criterion is the number of substitutions of the nucleotides computed by the differences in the investigated nucleotide sequences. However, the MP method is often criticized as it only counts the substitutions observable at the current time and all the unobservable substitutions that really occur in the evolutionary history are omitted. In order to take into account the unobservable substitutions, some substitution models have been established and they are now widely used in the DM and ML methods but these substitution models cannot be used within the classical MP method. Recently the authors proposed a probability representation model for phylogenetic trees and the reconstructed trees in this model are called probability phylogenetic trees. One of the advantages of the probability representation model is that it can include a substitution model to infer phylogenetic trees based on the MP principle. In this paper we explain how to use a substitution model in the reconstruction of probability phylogenetic trees and show the advantage of this approach with examples.

  7. [Nucleotide receptors and renal function].

    PubMed

    Jankowski, Maciej

    2014-01-01

    Kidney plays a key role in homeostasis of human body. It has heterogenic structure and is characterized by complicated vascular beds and numbers of sympathetic nerves endings. Nucleotides receptors are involved in the regulation of blood flow, a fundamental process for renal function. Plasma is filtrated in renal glomerulus and activity of nucleotides receptors located on cells of glomerular filter modifies the physi- cochemical properties of filter and affects the filtration process. Electrolytes, water and low molecular weight molecules are reabsorbed from tubular fluid or secreted into fluid in proximal and distal tubules. Glomerular filtration rate and activity of tubular processes are regulated via nucleotides receptors by glomerulotubularbalance and tubuloglomerular feedback. Nucleotides receptors are involved in systemic regulation of blood pressure and carbohydrate metabolism.

  8. Nucleotide diversity analysis highlights functionally important genomic regions

    PubMed Central

    Tatarinova, Tatiana V.; Chekalin, Evgeny; Nikolsky, Yuri; Bruskin, Sergey; Chebotarov, Dmitry; McNally, Kenneth L.; Alexandrov, Nickolai

    2016-01-01

    We analyzed functionality and relative distribution of genetic variants across the complete Oryza sativa genome, using the 40 million single nucleotide polymorphisms (SNPs) dataset from the 3,000 Rice Genomes Project (http://snp-seek.irri.org), the largest and highest density SNP collection for any higher plant. We have shown that the DNA-binding transcription factors (TFs) are the most conserved group of genes, whereas kinases and membrane-localized transporters are the most variable ones. TFs may be conserved because they belong to some of the most connected regulatory hubs that modulate transcription of vast downstream gene networks, whereas signaling kinases and transporters need to adapt rapidly to changing environmental conditions. In general, the observed profound patterns of nucleotide variability reveal functionally important genomic regions. As expected, nucleotide diversity is much higher in intergenic regions than within gene bodies (regions spanning gene models), and protein-coding sequences are more conserved than untranslated gene regions. We have observed a sharp decline in nucleotide diversity that begins at about 250 nucleotides upstream of the transcription start and reaches minimal diversity exactly at the transcription start. We found the transcription termination sites to have remarkably symmetrical patterns of SNP density, implying presence of functional sites near transcription termination. Also, nucleotide diversity was significantly lower near 3′ UTRs, the area rich with regulatory regions. PMID:27774999

  9. Nucleotide diversity analysis highlights functionally important genomic regions.

    PubMed

    Tatarinova, Tatiana V; Chekalin, Evgeny; Nikolsky, Yuri; Bruskin, Sergey; Chebotarov, Dmitry; McNally, Kenneth L; Alexandrov, Nickolai

    2016-10-24

    We analyzed functionality and relative distribution of genetic variants across the complete Oryza sativa genome, using the 40 million single nucleotide polymorphisms (SNPs) dataset from the 3,000 Rice Genomes Project (http://snp-seek.irri.org), the largest and highest density SNP collection for any higher plant. We have shown that the DNA-binding transcription factors (TFs) are the most conserved group of genes, whereas kinases and membrane-localized transporters are the most variable ones. TFs may be conserved because they belong to some of the most connected regulatory hubs that modulate transcription of vast downstream gene networks, whereas signaling kinases and transporters need to adapt rapidly to changing environmental conditions. In general, the observed profound patterns of nucleotide variability reveal functionally important genomic regions. As expected, nucleotide diversity is much higher in intergenic regions than within gene bodies (regions spanning gene models), and protein-coding sequences are more conserved than untranslated gene regions. We have observed a sharp decline in nucleotide diversity that begins at about 250 nucleotides upstream of the transcription start and reaches minimal diversity exactly at the transcription start. We found the transcription termination sites to have remarkably symmetrical patterns of SNP density, implying presence of functional sites near transcription termination. Also, nucleotide diversity was significantly lower near 3' UTRs, the area rich with regulatory regions.

  10. Disproportional plastome-wide increase of substitution rates and relaxed purifying selection in genes of carnivorous Lentibulariaceae.

    PubMed

    Wicke, Susann; Schäferhoff, Bastian; dePamphilis, Claude W; Müller, Kai F

    2014-03-01

    Carnivorous Lentibulariaceae exhibit the most sophisticated implementation of the carnivorous syndrome in plants. Their unusual lifestyle coincides with distinct genomic peculiarities such as the smallest angiosperm nuclear genomes and extremely high nucleotide substitution rates across all genomic compartments. Here, we report the complete plastid genomes from each of the three genera Pinguicula, Utricularia, and Genlisea, and investigate plastome-wide changes in their molecular evolution as the carnivorous syndrome unfolds. We observe a size reduction by up to 9% mostly due to the independent loss of genes for the plastid NAD(P)H dehydrogenase and altered proportions of plastid repeat DNA, as well as a significant plastome-wide increase of substitution rates and microstructural changes. Protein-coding genes across all gene classes show a disproportional elevation of nonsynonymous substitutions, particularly in Utricularia and Genlisea. Significant relaxation of purifying selection relative to noncarnivores occurs in the plastid-encoded fraction of the photosynthesis ATP synthase complex, the photosystem I, and in several other photosynthesis and metabolic genes. Shifts in selective regimes also affect housekeeping genes including the plastid-encoded polymerase, for which evidence for relaxed purifying selection was found once during the transition to carnivory, and a second time during the diversification of the family. Lentibulariaceae significantly exhibit enhanced rates of nucleotide substitution in most of the 130 noncoding regions. Various factors may underlie the observed patterns of relaxation of purifying selection and substitution rate increases, such as reduced net photosynthesis rates, alternative paths of nutrient uptake (including organic carbon), and impaired DNA repair mechanisms.

  11. A genome-wide view of Caenorhabditis elegans base-substitution mutation processes

    PubMed Central

    Denver, Dee R.; Dolan, Peter C.; Wilhelm, Larry J.; Sung, Way; Lucas-Lledó, J. Ignacio; Howe, Dana K.; Lewis, Samantha C.; Okamoto, Kazu; Thomas, W. Kelley; Lynch, Michael; Baer, Charles F.

    2009-01-01

    Knowledge of mutation processes is central to understanding virtually all evolutionary phenomena and the underlying nature of genetic disorders and cancers. However, the limitations of standard molecular mutation detection methods have historically precluded a genome-wide understanding of mutation rates and spectra in the nuclear genomes of multicellular organisms. We applied two high-throughput DNA sequencing technologies to identify and characterize hundreds of spontaneously arising base-substitution mutations in 10 Caenorhabditis elegans mutation-accumulation (MA)-line nuclear genomes. C. elegans mutation rate estimates were similar to previous calculations based on smaller numbers of mutations. Mutations were distributed uniformly within and among chromosomes and were not associated with recombination rate variation in the MA lines, suggesting that intragenomic variation in genetic hitchhiking and/or background selection are primarily responsible for the chromosomal distribution patterns of polymorphic nucleotides in C. elegans natural populations. A strong mutational bias from G/C to A/T nucleotides was detected in the MA lines, implicating oxidative DNA damage as a major endogenous mutagenic force in C. elegans. The observed mutational bias also suggests that the C. elegans nuclear genome cannot be at equilibrium because of mutation alone. Transversions dominate the spectrum of spontaneous mutations observed here, whereas transitions dominate patterns of allegedly neutral polymorphism in natural populations of C. elegans and many other animal species; this observation challenges the assumption that natural patterns of molecular variation in noncoding regions of the nuclear genome accurately reflect underlying mutation processes. PMID:19805298

  12. Nucleophilic Aromatic Substitution.

    ERIC Educational Resources Information Center

    Avila, Walter B.; And Others

    1990-01-01

    Described is a microscale organic chemistry experiment which demonstrates one feasible route in preparing ortho-substituted benzoic acids and provides an example of nucleophilic aromatic substitution chemistry. Experimental procedures and instructor notes for this activity are provided. (CW)

  13. Nucleophilic Aromatic Substitution.

    ERIC Educational Resources Information Center

    Avila, Walter B.; And Others

    1990-01-01

    Described is a microscale organic chemistry experiment which demonstrates one feasible route in preparing ortho-substituted benzoic acids and provides an example of nucleophilic aromatic substitution chemistry. Experimental procedures and instructor notes for this activity are provided. (CW)

  14. Cyclic Nucleotide-Gated Channel Block by Hydrolysis-Resistant Tetracaine Derivatives

    PubMed Central

    Andrade, Adriana L.; Melich, Kenneth; Whatley, G. Gregory; Kirk, Sarah R.; Karpen, Jeffrey W.

    2011-01-01

    To meet a pressing need for better cyclic nucleotide-gated (CNG) channel antagonists, we have increased the biological stability of tetracaine-based blockers by synthesizing amide and thioamide linkage substitutions of tetracaine (1) and a higher affinity octyl tail derivative (5). We report the apparent KD values, the mechanism of block, and the in vitro hydrolysis rates for these compounds. The ester linkage substitutions did not adversely affect CNG channel block; unexpectedly, thioamide substitution in 1 (compound 8) improved block significantly. Furthermore, the ester linkage substitutions did not appear to affect the mechanism of block in terms of the strong state preference for closed channels. All ester substituted compounds, especially the thioamide substitutions, were more resistant to hydrolysis by serum cholinesterase than their ester counterparts. These findings have implications for dissecting the physiological roles of CNG channels, treating certain forms of retinal degeneration, and possibly the current clinical uses of compound 1. PMID:21634421

  15. The A-nucleotide preference of HIV-1 in the context of its structured RNA genome

    PubMed Central

    van Hemert, Formijn J.; van der Kuyl, Antoinette C.; Berkhout, Ben

    2013-01-01

    A bipartition of HIV-1 RNA genome sequences into single- and double-stranded nucleotides is possible based on the secondary structure model of a complete 9 kb genome. Subsequent analysis revealed that the well-known lentiviral property of A-accumulation is profoundly present in single-stranded domains, yet absent in double-stranded domains. Mutational rate analysis by means of an unrestricted model of nucleotide substitution suggests the presence of an evolutionary equilibrium to preserve this biased nucleotide distribution. PMID:23235488

  16. Metalated nucleotide chemisorption on hydroxyapatite.

    PubMed

    Benedetti, Michele; Antonucci, Daniela; De Castro, Federica; Girelli, Chiara R; Lelli, Marco; Roveri, Norberto; Fanizzi, Francesco P

    2015-12-01

    The experiments here reported evidence on the importance of the residual charge of a nucleotide derivative, for the adsorption on nHAP (hydroxyapatite nanocrystals), in water solution. We found that the simple presence of phosphates on the nucleotide derivative does not guarantee adsorption on nHAP. On the other hand, we demonstrated that a cationic or neutral charge on a nucleotide derivative produces a strongly reduced chemical adsorption (chemisorption) whereas, in the presence of a net negative charge, relevant adsorption on nHAP is observed. The number of phosphates can only modulate the adsorption efficiency of a molecule provided that this latter bears an overall negative charge. The neutral zwitterionic nucleotide Pt(II) complexes, bearing negatively charged phosphates, are unable to give stable chemisorption. Previous considerations are important to model the binding ability of phosphate bearing nucleotide derivatives or molecules on hydroxyapatite. The findings reported in the present paper could be relevant in bone tissue targeting or nHAP mediated drug delivery.

  17. Nucleotide sequences important for translation initiation of enterovirus RNA.

    PubMed Central

    Iizuka, N; Yonekawa, H; Nomoto, A

    1991-01-01

    An infectious cDNA clone was constructed from the genome of coxsackievirus B1 strain. A number of RNA transcripts that have mutations in the 5' noncoding region were synthesized in vitro from the modified cDNA clones and examined for their abilities to act as mRNAs in a cell-free translation system prepared from HeLa S3 cells. RNAs that lack nucleotide sequences at positions 568 to 726 and 565 to 726 were found to be less efficient and inactive mRNAs, respectively. To understand the biological significance of this region of RNA, small deletions and point mutations were introduced in the nucleotide sequence between positions 538 and 601. Except for a nucleotide substitution at 592 (U----C) within the 7-base conserved sequence, mutations introduced in the sequence downstream of position 568 did not affect much, if any, of the ability of RNA to act as mRNA. Except for a point mutation at 558 (C----U), mutations upstream of position 567 appeared to inactivate the mRNA. In the upstream region, a sequence consisting of 21 nucleotides at positions 546 to 566 is perfectly conserved in the 5' noncoding regions of enterovirus and rhinovirus genomes. These results suggest that the 7-base conserved sequence functions to maintain the efficiency of translation initiation and that the nucleotide sequence upstream of position 567, including the 21-base conserved sequence, plays essential roles in translation initiation. A deletion mutant whose genome lacks the nucleotide sequence at positions 568 to 726 showed a small-plaque phenotype and less virulence against suckling mice than the wild-type virus. Thus, reduction of the efficiency of translation initiation may result in the construction of enteroviruses with the lower-virulence phenotype. Images PMID:1651409

  18. MAC: identifying and correcting annotation for multi-nucleotide variations.

    PubMed

    Wei, Lei; Liu, Lu T; Conroy, Jacob R; Hu, Qiang; Conroy, Jeffrey M; Morrison, Carl D; Johnson, Candace S; Wang, Jianmin; Liu, Song

    2015-08-01

    Next-Generation Sequencing (NGS) technologies have rapidly advanced our understanding of human variation in cancer. To accurately translate the raw sequencing data into practical knowledge, annotation tools, algorithms and pipelines must be developed that keep pace with the rapidly evolving technology. Currently, a challenge exists in accurately annotating multi-nucleotide variants (MNVs). These tandem substitutions, when affecting multiple nucleotides within a single protein codon of a gene, result in a translated amino acid involving all nucleotides in that codon. Most existing variant callers report a MNV as individual single-nucleotide variants (SNVs), often resulting in multiple triplet codon sequences and incorrect amino acid predictions. To correct potentially misannotated MNVs among reported SNVs, a primary challenge resides in haplotype phasing which is to determine whether the neighboring SNVs are co-located on the same chromosome. Here we describe MAC (Multi-Nucleotide Variant Annotation Corrector), an integrative pipeline developed to correct potentially mis-annotated MNVs. MAC was designed as an application that only requires a SNV file and the matching BAM file as data inputs. Using an example data set containing 3024 SNVs and the corresponding whole-genome sequencing BAM files, we show that MAC identified eight potentially mis-annotated SNVs, and accurately updated the amino acid predictions for seven of the variant calls. MAC can identify and correct amino acid predictions that result from MNVs affecting multiple nucleotides within a single protein codon, which cannot be handled by most existing SNV-based variant pipelines. The MAC software is freely available and represents a useful tool for the accurate translation of genomic sequence to protein function.

  19. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    NASA Astrophysics Data System (ADS)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  20. Patterns of Protein Evolution in Cytochrome c Oxidase 1 (COI) from the Class Arachnida

    PubMed Central

    Young, Monica R; Hebert, Paul D. N.

    2015-01-01

    Because sequence information is now available for the 648bp barcode region of cytochrome c oxidase 1 (COI) from more than 400,000 animal species, this gene segment can be used to probe patterns of mitochondrial evolution. The present study examines levels of amino acid substitution and the frequency of indels in COI from 4177 species of arachnids, including representatives from all 16 orders and 43% of its families (267/625). It examines divergences at three taxonomic levels—among members of each order to an outgroup, among families in each order and among BINs, a species proxy, in each family. Order Distances vary fourfold (0.10–0.39), while the mean of the Family Distances for the ten orders ranges fivefold (0.07–0.35). BIN Distances show great variation, ranging from 0.01 or less in 12 families to more than 0.25 in eight families. Patterns of amino acid substitution in COI are generally congruent with previously reported variation in nucleotide substitution rates in arachnids, but provide some new insights, such as clear rate acceleration in the Opiliones. By revealing a strong association between elevated rates of nucleotide and amino acid substitution, this study builds evidence for the selective importance of the rate variation among arachnid lineages. Moreover, it establishes that groups whose COI genes have elevated levels of amino acid substitution also regularly possess indels, a dramatic form of protein reconfiguration. Overall, this study suggests that the mitochondrial genome of some arachnid groups is dynamic with high rates of amino acid substitution and frequent indels, while it is ‘locked down’ in others. Dynamic genomes are most prevalent in arachnids with short generation times, but the possible impact of breeding system deserves investigation since many of the rapidly evolving lineages reproduce by haplodiploidy, a mode of reproduction absent in ‘locked down’ taxa. PMID:26308206

  1. The EMBL Nucleotide Sequence Database.

    PubMed

    Stoesser, Guenter; Baker, Wendy; van den Broek, Alexandra; Camon, Evelyn; Garcia-Pastor, Maria; Kanz, Carola; Kulikova, Tamara; Leinonen, Rasko; Lin, Quan; Lombard, Vincent; Lopez, Rodrigo; Redaschi, Nicole; Stoehr, Peter; Tuli, Mary Ann; Tzouvara, Katerina; Vaughan, Robert

    2002-01-01

    The EMBL Nucleotide Sequence Database (aka EMBL-Bank; http://www.ebi.ac.uk/embl/) incorporates, organises and distributes nucleotide sequences from all available public sources. EMBL-Bank is located and maintained at the European Bioinformatics Institute (EBI) near Cambridge, UK. In an international collaboration with DDBJ (Japan) and GenBank (USA), data are exchanged amongst the collaborating databases on a daily basis. Major contributors to the EMBL database are individual scientists and genome project groups. Webin is the preferred web-based submission system for individual submitters, whilst automatic procedures allow incorporation of sequence data from large-scale genome sequencing centres and from the European Patent Office (EPO). Database releases are produced quarterly. Network services allow free access to the most up-to-date data collection via FTP, email and World Wide Web interfaces. EBI's Sequence Retrieval System (SRS), a network browser for databanks in molecular biology, integrates and links the main nucleotide and protein databases plus many other specialized databases. For sequence similarity searching, a variety of tools (e.g. Blitz, Fasta, BLAST) are available which allow external users to compare their own sequences against the latest data in the EMBL Nucleotide Sequence Database and SWISS-PROT. All resources can be accessed via the EBI home page at http://www.ebi.ac.uk.

  2. Nucleotide variation in genes invloved in wood formation in two pine species

    Treesearch

    David Pot; Lisa McMillan; Craig Echt; Gregoire Le Provost; Pauline Garnier-Gere; Sheree Cato; Christophe Plomion

    2005-01-01

    Nucleotide diversity in eight genes related to wood formation was investigated in two pine species, Pinus pinaster and P. radiata. The nucleotide diversity patterns observed and their properties were compared between the two species according to the specific characteristics of the samples analysed. A lower diversity was observed in P. radiata...

  3. Effect on platelet functions of derivatives of cyclic nucleotides.

    PubMed

    Pareti, F I; Carrera, D; Mannucci, L; Mannucci, P M

    1978-04-30

    Derivatives of cyclic nucleotides were evaluated for their ability to inhibit platelet aggregation and the release reaction. Derivatives substituted in position 8 (mainly 8-Br-cyclic GMP) were more active than 3'-5' cyclic AMP, and their relative potency in inhibiting platelet aggregation and 14C-serotonin release was comparable to that of N62-0'-dibutyryl-cyclic AMP. Compounds substituted in position 6 or 2'-0 were not effective. The active compounds, which were also tested for their ability to stimulate platelet adenylate cyclase or to inhibit cyclic AMP phosphodiesterase, did not modify the intracellular levels of cyclic AMP. Since previous animal experiments have shown that these derivatives cause less side effects than cyclic AMP and its dibutyryl derivative in animals, it is suggested that modification of the cyclophosphate molecule might make it possible to find compounds active only on platelet function without interfering with other biological systems.

  4. Formation of Silver Nanostructures by Rolling Circle Amplification Using Boranephosphonate-Modified Nucleotides.

    PubMed

    Russell, Camilla; Roy, Subhadeep; Ganguly, Saheli; Qian, Xiaoyan; Caruthers, Marvin H; Nilsson, Mats

    2015-07-07

    We investigate the efficiency of incorporation of boranephosphonate-modified nucleotides by phi29 DNA polymerase and present a simple method for forming large defined silver nanostructures by rolling circle amplification (RCA) using boranephosphonate internucleotide linkages. RCA is a linear DNA amplification technique that can use specifically circularized DNA probes for detection of target nucleic acids and proteins. The resulting product is a collapsed single-stranded DNA molecule with tandem repeats of the DNA probe. By substituting each of the natural nucleotides with the corresponding 5'-(α-P-borano)deoxynucleosidetriphosphate, only a small reduction in amplification rate is observed. Also, by substituting all four natural nucleotides, it is possible to enzymatically synthesize a micrometer-sized, single-stranded DNA molecule with only boranephosphonate internucleotide linkages. Well-defined silver particles are then readily formed along the rolling circle product.

  5. Nucleotide diversity and linkage disequilibrium in balsam poplar (Populus balsamifera).

    PubMed

    Olson, Matthew S; Robertson, Amanda L; Takebayashi, Naoki; Silim, Salim; Schroeder, William R; Tiffin, Peter

    2010-04-01

    *Current perceptions that poplars have high levels of nucleotide variation, large effective population sizes, and rapid decay of linkage disequilibrium are based primarily on studies from one poplar species, Populus tremula. *We analysed 590 gene fragments (average length 565 bp) from each of 15 individuals from different populations from throughout the range of Populus balsamifera. *Nucleotide diversity (theta(total) = 0.0028, pi = 0.0027) was low compared with other trees and model agricultural systems. Patterns of nucleotide diversity and site frequency spectra were consistent with purifying selection on replacement and intron sites. When averaged across all loci we found no evidence for decay of linkage disequilibrium across 750 bp, consistent with the low estimates of the scaled recombination parameter, rho = 0.0092. *Compared with P. tremula, a well studied congener with a similar distribution, P. balsamifera has low diversity and low effective recombination, both of which indicate a lower effective population size in P. balsamifera. Patterns of diversity and linkage indicate that there is considerable variation in population genomic patterns among poplar species and unlike P. tremula, association mapping techniques in balsam poplar should consider sampling single nucleotide polymorphisms (SNPs) at well-spaced intervals.

  6. Differential Mutation Patterns in Thymidine Kinase and DNA Polymerase Genes of Herpes Simplex Virus Type 1 Clones Passaged in the Presence of Acyclovir or Penciclovir

    PubMed Central

    Suzutani, Tatsuo; Ishioka, Ken; De Clercq, Erik; Ishibashi, Kei; Kaneko, Hisatoshi; Kira, Toshihiko; Hashimoto, Koh-ichi; Ogasawara, Masahiro; Ohtani, Katsuki; Wakamiya, Nobutaka; Saijo, Masayuki

    2003-01-01

    A total of 21 clones of acyclovir (ACV)-resistant (ACVr) herpes simplex virus type 1 (HSV-1) and 23 clones of penciclovir (PCV)-resistant (PCVr) HSV-1, emerging during serial passages in the presence of ACV or PCV, were isolated under conditions excluding contamination of resistant mutants in the starting virus culture, and their mutations in the thymidine kinase (TK) and DNA polymerase (DNA Pol) genes were analyzed comparatively. Mutations in the TK genes from ACVr mutants consisted of 50% single nucleotide substitutions and 50% frameshift mutations, while the corresponding figures for the PCVr mutants were 4 and 96%, respectively (P < 0.001). Eight of the 21 ACVr clones, but none of the 23 PCVr clones, had mutations in DNA Pol. Only nucleotide substitution(s) could be detected in the DNA Pol gene, as the gene is essential for virus replication. Therefore, the results for the DNA Pol mutants are concordant with those for the TK mutants in that a single nucleotide substitution was commonly observed in the ACVr, but not in the PCVr, mutants. These results clearly point to differential mutation patterns between ACVr and PCVr HSV-1 clones. PMID:12709344

  7. Guanine nucleotide binding properties of the mammalian RalA protein produced in Escherichia coli.

    PubMed

    Frech, M; Schlichting, I; Wittinghofer, A; Chardin, P

    1990-04-15

    The simian ralA cDNA was inserted in a ptac expression vector, and high amounts of soluble ral protein were expressed in Escherichia coli. The purified p24ral contains 1 mol of bound nucleotide/mol of protein that can be exchanged against external nucleotide. The ral protein exchanges GDP with a t 1/2 of 90 min at 37 degrees C in the presence of Mg2+, and has a low GTPase activity (0.07 min-1 at 37 degrees C). We have also studied its affinity for various guanine nucleotides and analogs. NMR measurements show that the three-dimensional environment around the nucleotide is similar in p21ras and p24ral. In addition to these studies on the wild-type ral protein, we used in vitro mutagenesis to introduce substitutions corresponding to the Val12, Val12 + Thr59, and Leu61 substitutions of p21ras. These mutant ral proteins display altered nucleotide exchange kinetics and GTPase activities, however, the effects of the substitutions are less pronounced than in the ras proteins. p24ralVal12 + Thr59 autophosphorylates on the substituted Thr, as a side reaction of the GTP hydrolysis, but the rate is much lower than those of the Thr59 mutants of p21ras. These results show that ras and ral proteins have similar structures and biochemical properties. Significant differences are found, however, in the contribution of the Mg2+ ion to GDP binding, in the rate of the GTPase reaction and in the sensitivity of these two proteins to substitutions around the phosphate-binding site, suggesting that the various "small G-proteins" of the ras family perform different functions.

  8. A Hand to Substitutes

    ERIC Educational Resources Information Center

    Javernick, Ellen

    2005-01-01

    In the days before computers, passing on information to substitutes was difficult. Now teachers can individualize their lesson plans to guarantee that substitute teachers and the students will both have a good day. This article provides some plan-ahead procedures that have worked for the author.

  9. Working with Substitute Teachers.

    ERIC Educational Resources Information Center

    Wilson, Karen

    1999-01-01

    Resolving the perennial problem of substitute teachers' high turnover and low availability is feasible, if principals welcome, orient, and assign them properly. Regular teachers should prepare a folder containing class lists, daily schedules, seating charts, expectations of students, and meaningful lesson plans. Substitutes should be treated as…

  10. Florida's Substitute Teachers.

    ERIC Educational Resources Information Center

    Odutola, Adeniji A.; Etemadi, Judy N.

    2002-01-01

    Describes the statutory duties of the Florida Education Standards Commission, highlighting a study of the working conditions of Florida's substitute teachers. Researchers collected data on school board policies regarding substitutes' educational levels required, initial training and staff development opportunities required, salary schedules, and…

  11. The Single Nucleotide Polymorphism Consortium

    NASA Technical Reports Server (NTRS)

    Morgan, Michael

    2003-01-01

    I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.

  12. The Single Nucleotide Polymorphism Consortium

    NASA Technical Reports Server (NTRS)

    Morgan, Michael

    2003-01-01

    I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.

  13. Sustainability and substitutability.

    PubMed

    Fenichel, Eli P; Zhao, Jinhua

    2015-02-01

    Developing a quantitative science of sustainability requires bridging mathematical concepts from fields contributing to sustainability science. The concept of substitutability is central to sustainability but is defined differently by different fields. Specifically, economics tends to define substitutability as a marginal concept while fields such as ecology tend to focus on limiting behaviors. We explain how to reconcile these different views. We develop a model where investments can be made in knowledge to increase the elasticity of substitution. We explore the set of sustainable and optimal trajectories for natural capital extraction and built and knowledge capital accumulation. Investments in substitutability through knowledge stock accumulation affect the value of natural capital. Results suggest that investing in the knowledge stock, which can enhance substitutability, is critical to desirable sustainable outcomes. This result is robust even when natural capital is not managed optimally. This leads us to conclude that investments in the knowledge stock are of first order importance for sustainability.

  14. Applications of adenine nucleotide measurements in oceanography

    NASA Technical Reports Server (NTRS)

    Holm-Hansen, O.; Hodson, R.; Azam, F.

    1975-01-01

    The methodology involved in nucleotide measurements is outlined, along with data to support the premise that ATP concentrations in microbial cells can be extrapolated to biomass parameters. ATP concentrations in microorganisms and nucleotide analyses are studied.

  15. Substitution rate and natural selection in parvovirus B19

    PubMed Central

    Stamenković, Gorana G.; Ćirković, Valentina S.; Šiljić, Marina M.; Blagojević, Jelena V.; Knežević, Aleksandra M.; Joksić, Ivana D.; Stanojević, Maja P.

    2016-01-01

    The aim of this study was to estimate substitution rate and imprints of natural selection on parvovirus B19 genotype 1. Studied datasets included 137 near complete coding B19 genomes (positions 665 to 4851) for phylogenetic and substitution rate analysis and 146 and 214 partial genomes for selection analyses in open reading frames ORF1 and ORF2, respectively, collected 1973–2012 and including 9 newly sequenced isolates from Serbia. Phylogenetic clustering assigned majority of studied isolates to G1A. Nucleotide substitution rate for total coding DNA was 1.03 (0.6–1.27) x 10−4 substitutions/site/year, with higher values for analyzed genome partitions. In spite of the highest evolutionary rate, VP2 codons were found to be under purifying selection with rare episodic positive selection, whereas codons under diversifying selection were found in the unique part of VP1, known to contain B19 immune epitopes important in persistent infection. Analyses of overlapping gene regions identified nucleotide positions under opposite selective pressure in different ORFs, suggesting complex evolutionary mechanisms of nucleotide changes in B19 viral genomes. PMID:27775080

  16. ADP-2Ho as a Phasing Tool for Nucleotide-Containing Proteins

    SciTech Connect

    Ku,S.; Smith, G.; Howell, P.

    2007-01-01

    Trivalent holmium ions were shown to isomorphously replace magnesium ions to form an ADP-2Ho complex in the nucleotide-binding domain of Bacillus subtilis 5-methylthioribose (MTR) kinase. This nucleotide-holmium complex provided sufficient phasing power to allow SAD and SIRAS phasing of this previously unknown structure using the L{sub III} absorption edge of holmium. The structure of ADP-2Ho reveals that the two Ho ions are approximately 4 {angstrom} apart and are likely to share their ligands: the phosphoryl O atoms of ADP and a water molecule. The structure determination of MTR kinase using data collected using Cu K X-radiation was also attempted. Although the heavy-atom substructure determination was successful, interpretation of the map was more challenging. The isomorphous substitution of holmium for magnesium in the MTR kinase-nucleotide complex suggests that this could be a useful phasing tool for other metal-dependent nucleotide-containing proteins.

  17. 40 CFR 721.981 - Substituted naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... naphthalenyl-substituted azonaphthol chromium complex. 721.981 Section 721.981 Protection of Environment...-substituted naphthalenyl-substituted azonaphthol chromium complex. (a) Chemical substance and significant new... naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex (PMN P-93-1631) is subject...

  18. 40 CFR 721.981 - Substituted naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... naphthalenyl-substituted azonaphthol chromium complex. 721.981 Section 721.981 Protection of Environment...-substituted naphthalenyl-substituted azonaphthol chromium complex. (a) Chemical substance and significant new... naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex (PMN P-93-1631) is subject...

  19. 40 CFR 721.981 - Substituted naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... naphthalenyl-substituted azonaphthol chromium complex. 721.981 Section 721.981 Protection of Environment...-substituted naphthalenyl-substituted azonaphthol chromium complex. (a) Chemical substance and significant new... naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex (PMN P-93-1631) is subject...

  20. 40 CFR 721.981 - Substituted naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... naphthalenyl-substituted azonaphthol chromium complex. 721.981 Section 721.981 Protection of Environment...-substituted naphthalenyl-substituted azonaphthol chromium complex. (a) Chemical substance and significant new... naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex (PMN P-93-1631) is subject...

  1. 40 CFR 721.981 - Substituted naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... naphthalenyl-substituted azonaphthol chromium complex. 721.981 Section 721.981 Protection of Environment...-substituted naphthalenyl-substituted azonaphthol chromium complex. (a) Chemical substance and significant new... naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex (PMN P-93-1631) is subject...

  2. Sugar substitutes during pregnancy

    PubMed Central

    Pope, Eliza; Koren, Gideon; Bozzo, Pina

    2014-01-01

    Abstract Question I have a pregnant patient who regularly consumes sugar substitutes and she asked me if continuing their use would affect her pregnancy or child. What should I tell her, and are there certain options that are better for use during pregnancy? Answer Although more research is required to fully determine the effects of in utero exposure to sugar substitutes, the available data do not suggest adverse effects in pregnancy. However, it is recommended that sugar substitutes be consumed in moderate amounts, adhering to the acceptable daily intake standards set by regulatory agencies. PMID:25392440

  3. Sugar substitutes during pregnancy.

    PubMed

    Pope, Eliza; Koren, Gideon; Bozzo, Pina

    2014-11-01

    I have a pregnant patient who regularly consumes sugar substitutes and she asked me if continuing their use would affect her pregnancy or child. What should I tell her, and are there certain options that are better for use during pregnancy? Although more research is required to fully determine the effects of in utero exposure to sugar substitutes, the available data do not suggest adverse effects in pregnancy. However, it is recommended that sugar substitutes be consumed in moderate amounts, adhering to the acceptable daily intake standards set by regulatory agencies. Copyright© the College of Family Physicians of Canada.

  4. European Nucleotide Archive in 2016

    PubMed Central

    Toribio, Ana Luisa; Alako, Blaise; Amid, Clara; Cerdeño-Tarrága, Ana; Clarke, Laura; Cleland, Iain; Fairley, Susan; Gibson, Richard; Goodgame, Neil; ten Hoopen, Petra; Jayathilaka, Suran; Kay, Simon; Leinonen, Rasko; Liu, Xin; Martínez-Villacorta, Josué; Pakseresht, Nima; Rajan, Jeena; Reddy, Kethi; Rosello, Marc; Silvester, Nicole; Smirnov, Dmitriy; Vaughan, Daniel; Zalunin, Vadim; Cochrane, Guy

    2017-01-01

    The European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena) offers a rich platform for data sharing, publishing and archiving and a globally comprehensive data set for onward use by the scientific community. With a broad scope spanning raw sequencing reads, genome assemblies and functional annotation, the resource provides extensive data submission, search and download facilities across web and programmatic interfaces. Here, we outline ENA content and major access modalities, highlight major developments in 2016 and outline a number of examples of data reuse from ENA. PMID:27899630

  5. New nucleotide analogues with enhanced signal properties.

    PubMed

    Cherkasov, Dmitry; Biet, Thorsten; Bäuml, Englbert; Traut, Walther; Lohoff, Michael

    2010-01-01

    We describe synthesis and testing of a novel type of dye-modified nucleotides which we call macromolecular nucleotides (m-Nucs). Macromolecular nucleotides comprise a nucleotide moiety, a macromolecular linear linker, and a large macromolecular ligand carrying multiple fluorescent dyes. With incorporation of the nucleotide moiety into the growing nucleic acid strand during enzymatic synthesis, the macromolecular ligand together with the coupled dyes is bound to the nucleic acid. By the use of this new class of modified nucleotides, signals from multiple dye molecules can be obtained after a single enzymatic incorporation event. The modified nucleotides are considered especially useful in the fields of nanobiotechnology, where signal stability and intensity is a limiting factor.

  6. [Sugar substitutes in the diabetic diet].

    PubMed

    Mehnert, H

    1976-01-01

    considerable increase after glucose administration. Investigations in adult-type diabetics revealed a better utilization of fructose than glucose. With correct dosage, sugar substitutes are able to increase the carbohydrate tolerance and, under certain conditions, to achieve a relative stabilization of the metabolism of unstable diabetics. The antiketogenic activity of sugar substitutes is particularly pronounced. Side-effects such as high blood levels of urea, lactate, triglycerides and bilirubin or a decrease in hepatic adenin nucleotides do not occur after oral administration, nor are they of importance after intravenous administration with correct dosage. The osmotic diarrhoea occurring after intake of sorbitol or xylitol is caused by their slow absorption and limits the consumption of these sugar substitutes. In the often obese adult-type diabetics, the calorie intake inherent in the consumption of diabetic sugars may have an unfavourable influence on their weight...

  7. Synthesis of substituted pyrazines

    SciTech Connect

    Pagoria, Philip F.; Zhang, Mao Xi

    2016-10-04

    A method for synthesizing a pyrazine-containing material according to one embodiment includes contacting an iminodiacetonitrile derivative with a base and a reagent selected from a group consisting of hydroxylamine, a hydroxylamine salt, an aliphatic primary amine, a secondary amine, an aryl-substituted alkylamine a heteroaryl-substituted alkyl amine, an alcohol, an alkanolamine and an aryl alcoholamine. Additional methods and several reaction products are presented. ##STR00001##

  8. Nucleotide-binding properties of kinase-deficient epidermal-growth-factor-receptor mutants.

    PubMed

    Cheng, K; Koland, J G

    1998-02-15

    The nucleotide-binding properties of wild-type epidermal- growth-factor (EGF)-receptor protein tyrosine kinase (PTK) and EGF-receptor mutants with site-specific amino acid substitutions known to attenuate protein kinase activity were analysed by a fluorescence competition assay employing the nucleotide analogue 2'(3')-O-(2,4,6-trinitrophenyl)adenosine 5'-triphosphate. Binding affinities for ATP and Mn.ATP complex were determined for the PTK domains of the wild-type and two mutant proteins. Surprisingly, mutation of the highly conserved Lys-721 residue in the nucleotide-binding site of the EGF- receptor PTK domain did not abolish ATP and Mn.ATP binding, although the binding affinity for the Mn.ATP complex was significantly reduced. A second kinase-inactivating mutation that targeted the highly conserved Asp-813 residue had little effect on the nucleotide-binding properties of the EGF-receptor PTK domain. These results indicated that the principle effect of these two kinase-inactivating amino acid substitutions is not to block nucleotide binding, but is instead an inhibition of the phospho-transfer reaction.

  9. Nucleotide-binding properties of kinase-deficient epidermal-growth-factor-receptor mutants.

    PubMed Central

    Cheng, K; Koland, J G

    1998-01-01

    The nucleotide-binding properties of wild-type epidermal- growth-factor (EGF)-receptor protein tyrosine kinase (PTK) and EGF-receptor mutants with site-specific amino acid substitutions known to attenuate protein kinase activity were analysed by a fluorescence competition assay employing the nucleotide analogue 2'(3')-O-(2,4,6-trinitrophenyl)adenosine 5'-triphosphate.Binding affinities for ATP and Mn.ATP complex were determined for the PTK domains of the wild-type and two mutant proteins. Surprisingly, mutation of the highly conserved Lys-721 residue in the nucleotide-binding site of the EGF- receptor PTK domain did not abolish ATP and Mn.ATP binding, although the binding affinity for the Mn.ATP complex was significantly reduced. A second kinase-inactivating mutation that targeted the highly conserved Asp-813 residue had little effect on the nucleotide-binding properties of the EGF-receptor PTK domain. These results indicated that the principle effect of these two kinase-inactivating amino acid substitutions is not to block nucleotide binding, but is instead an inhibition of the phospho-transfer reaction. PMID:9461530

  10. Nucleotide composition of CO1 sequences in Chelicerata (Arthropoda): detecting new mitogenomic rearrangements.

    PubMed

    Arabi, Juliette; Judson, Mark L I; Deharveng, Louis; Lourenço, Wilson R; Cruaud, Corinne; Hassanin, Alexandre

    2012-02-01

    Here we study the evolution of nucleotide composition in third codon-positions of CO1 sequences of Chelicerata, using a phylogenetic framework, based on 180 taxa and three markers (CO1, 18S, and 28S rRNA; 5,218 nt). The analyses of nucleotide composition were also extended to all CO1 sequences of Chelicerata found in GenBank (1,701 taxa). The results show that most species of Chelicerata have a positive strand bias in CO1, i.e., in favor of C nucleotides, including all Amblypygi, Palpigradi, Ricinulei, Solifugae, Uropygi, and Xiphosura. However, several taxa show a negative strand bias, i.e., in favor of G nucleotides: all Scorpiones, Opisthothelae spiders and several taxa within Acari, Opiliones, Pseudoscorpiones, and Pycnogonida. Several reversals of strand-specific bias can be attributed to either a rearrangement of the control region or an inversion of a fragment containing the CO1 gene. Key taxa for which sequencing of complete mitochondrial genomes will be necessary to determine the origin and nature of mtDNA rearrangements involved in the reversals are identified. Acari, Opiliones, Pseudoscorpiones, and Pycnogonida were found to show a strong variability in nucleotide composition. In addition, both mitochondrial and nuclear genomes have been affected by higher substitution rates in Acari and Pseudoscorpiones. The results therefore indicate that these two orders are more liable to fix mutations of all types, including base substitutions, indels, and genomic rearrangements.

  11. Substitution of anticonvulsant drugs

    PubMed Central

    Steinhoff, Bernhard J; Runge, Uwe; Witte, Otto W; Stefan, Hermann; Hufnagel, Andreas; Mayer, Thomas; Krämer, Günter

    2009-01-01

    Changing from branded drugs to generic alternatives, or between different generic formulations, is common practice aiming at reducing health care costs. It has been suggested that antiepileptic drugs (AEDs) should be exempt from substitution because of the potential negative consequences of adverse events and breakthrough seizures. Controlled data are lacking on the risk of substitution. However, retrospective data from large medical claims databases suggest that switching might be associated with increased use of AED and non-AED medications, and health care resources (including hospitalization). In addition, some anecdotal evidence from patients and health care providers’ surveys suggest a potentially negative impact of substitution. Well-controlled data are needed to assess the real risk associated with substitution, allowing health care professionals involved in the care of patients with epilepsy to make informed decisions. This paper reviews currently available literature, based on which the authors suggest that the decision to substitute should be made on an individual basis by the physician and an informed patient. Unendorsed or undisclosed substitution at the pharmacy level should be discouraged. PMID:19707254

  12. Nucleotide Metabolism and DNA Replication.

    PubMed

    Warner, Digby F; Evans, Joanna C; Mizrahi, Valerie

    2014-10-01

    The development and application of a highly versatile suite of tools for mycobacterial genetics, coupled with widespread use of "omics" approaches to elucidate the structure, function, and regulation of mycobacterial proteins, has led to spectacular advances in our understanding of the metabolism and physiology of mycobacteria. In this article, we provide an update on nucleotide metabolism and DNA replication in mycobacteria, highlighting key findings from the past 10 to 15 years. In the first section, we focus on nucleotide metabolism, ranging from the biosynthesis, salvage, and interconversion of purine and pyrimidine ribonucleotides to the formation of deoxyribonucleotides. The second part of the article is devoted to DNA replication, with a focus on replication initiation and elongation, as well as DNA unwinding. We provide an overview of replication fidelity and mutation rates in mycobacteria and summarize evidence suggesting that DNA replication occurs during states of low metabolic activity, and conclude by suggesting directions for future research to address key outstanding questions. Although this article focuses primarily on observations from Mycobacterium tuberculosis, it is interspersed, where appropriate, with insights from, and comparisons with, other mycobacterial species as well as better characterized bacterial models such as Escherichia coli. Finally, a common theme underlying almost all studies of mycobacterial metabolism is the potential to identify and validate functions or pathways that can be exploited for tuberculosis drug discovery. In this context, we have specifically highlighted those processes in mycobacterial DNA replication that might satisfy this critical requirement.

  13. Nonsynonymous substitution in abalone sperm fertilization genes exceeds substitution in introns and mitochondrial DNA

    PubMed Central

    Metz, Edward C.; Robles-Sikisaka, Refugio; Vacquier, Victor D.

    1998-01-01

    Strong positive Darwinian selection acts on two sperm fertilization proteins, lysin and 18-kDa protein, from abalone (Haliotis). To understand the phylogenetic context for this dramatic molecular evolution, we obtained sequences of mitochondrial cytochrome c oxidase subunit I (mtCOI), and genomic sequences of lysin, 18-kDa, and a G protein subunit. Based on mtDNA differentiation, four north Pacific abalone species diverged within the past 2 million years (Myr), and remaining north Pacific species diverged over a period of 4–20 Myr. Between-species nonsynonymous differences in lysin and 18-kDa exons exceed nucleotide differences in introns by 3.5- to 24-fold. Remarkably, in some comparisons nonsynonymous substitutions in lysin and 18-kDa genes exceed synonymous substitutions in mtCOI. Lysin and 18-kDa intron/exon segments were sequenced from multiple red abalone individuals collected over a 1,200-km range. Only two nucleotide changes and two sites of slippage variation were detected in a total of >29,000 nucleotides surveyed. However, polymorphism in mtCOI and a G protein intron was found in this species. This finding suggests that positive selection swept one lysin allele and one 18-kDa allele to fixation. Similarities between mtCOI and lysin gene trees indicate that rapid adaptive evolution of lysin has occurred consistently through the history of the group. Comparisons with mtCOI molecular clock calibrations suggest that nonsynonymous substitutions accumulate 2–50 times faster in lysin and 18-kDa genes than in rapidly evolving mammalian genes. PMID:9724763

  14. Acid-Soluble Nucleotides of Pinto Bean Leaves at Different Stages of Development 1

    PubMed Central

    Weinstein, L. H.; McCune, D. C.; Mancini, Jill F.; van Leuken, P.

    1969-01-01

    Acid-soluble nucleotides of unifoliate leaves of Pinto bean plants (Phaseolus vulgaris L.) were determined at young, mature, and senescent stages of development. At least 25 components could be distinguished on the basis of inorganic phosphorus determinations and 37 or more fractions on the basis of 32P labeling, with adenosine di- and triphosphates accounting for 60% of the total moles of nucleotide. The total nucleotide P and inorganic P, on a fresh weight basis, decreased about 44% between each stage of leaf development, but decrements in the levels of individual nucleotides varied from this over-all pattern. Minor changes in the relative abundance of the individual nucleotides accompanied aging although the percentage of purine-containing nucleotides decreased with age. Total 32P activity per leaf in the nucleotide pool increased about 3-fold between the young and mature leaves and decreased slightly as leaves became senescent. In general, the specific activities of the nucleotides increased with increased age and adenosine-, guanosine-, uridine-, and cytidine triphosphates and adenosine diphosphate accounted for approximately 90% of the total activity. The changes in the relative sizes and energy status of the nucleotide pools were not so obvious as the changes in other metabolites that have been reported to accompany aging in leaf tissue. PMID:16657232

  15. Mosaic organization of DNA nucleotides

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Havlin, S.; Simons, M.; Stanley, H. E.; Goldberger, A. L.

    1994-01-01

    Long-range power-law correlations have been reported recently for DNA sequences containing noncoding regions. We address the question of whether such correlations may be a trivial consequence of the known mosaic structure ("patchiness") of DNA. We analyze two classes of controls consisting of patchy nucleotide sequences generated by different algorithms--one without and one with long-range power-law correlations. Although both types of sequences are highly heterogenous, they are quantitatively distinguishable by an alternative fluctuation analysis method that differentiates local patchiness from long-range correlations. Application of this analysis to selected DNA sequences demonstrates that patchiness is not sufficient to account for long-range correlation properties.

  16. Mosaic organization of DNA nucleotides

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Havlin, S.; Simons, M.; Stanley, H. E.; Goldberger, A. L.

    1994-01-01

    Long-range power-law correlations have been reported recently for DNA sequences containing noncoding regions. We address the question of whether such correlations may be a trivial consequence of the known mosaic structure ("patchiness") of DNA. We analyze two classes of controls consisting of patchy nucleotide sequences generated by different algorithms--one without and one with long-range power-law correlations. Although both types of sequences are highly heterogenous, they are quantitatively distinguishable by an alternative fluctuation analysis method that differentiates local patchiness from long-range correlations. Application of this analysis to selected DNA sequences demonstrates that patchiness is not sufficient to account for long-range correlation properties.

  17. Nucleotide Excision Repair in Eukaryotes

    PubMed Central

    Schärer, Orlando D.

    2013-01-01

    Nucleotide excision repair (NER) is the main pathway used by mammals to remove bulky DNA lesions such as those formed by UV light, environmental mutagens, and some cancer chemotherapeutic adducts from DNA. Deficiencies in NER are associated with the extremely skin cancer-prone inherited disorder xeroderma pigmentosum. Although the core NER reaction and the factors that execute it have been known for some years, recent studies have led to a much more detailed understanding of the NER mechanism, how NER operates in the context of chromatin, and how it is connected to other cellular processes such as DNA damage signaling and transcription. This review emphasizes biochemical, structural, cell biological, and genetic studies since 2005 that have shed light on many aspects of the NER pathway. PMID:24086042

  18. Nucleotide excision repair in humans

    PubMed Central

    Spivak, Graciela

    2015-01-01

    The demonstration of DNA damage excision and repair replication by Setlow, Howard-Flanders, Hanawalt and their colleagues in the early 1960s, constituted the discovery of the ubiquitous pathway of nucleotide excision repair (NER). The serial steps in NER are similar in organisms from unicellular bacteria to complex mammals and plants, and involve recognition of lesions, adducts or structures that disrupt the DNA double helix, removal of a short oligonucleotide containing the offending lesion, synthesis of a repair patch copying the opposite undamaged strand, and ligation, to restore the DNA to its original form. The transcription-coupled repair (TCR) subpathway of NER, discovered nearly two decades later, is dedicated to the removal of lesions from the template DNA strands of actively transcribed genes. In this review I will outline the essential factors and complexes involved in NER in humans, and will comment on additional factors and metabolic processes that affect the efficiency of this important process. PMID:26388429

  19. The substitutability of reinforcers

    PubMed Central

    Green, Leonard; Freed, Debra E.

    1993-01-01

    Substitutability is a construct borrowed from microeconomics that describes a continuum of possible interactions among the reinforcers in a given situation. Highly substitutable reinforcers, which occupy one end of the continuum, are readily traded for each other due to their functional similarity. Complementary reinforcers, at the other end of the continuum, tend to be consumed jointly in fairly rigid proportion, and therefore cannot be traded for one another except to achieve that proportion. At the center of the continuum are reinforcers that are independent with respect to each other; consumption of one has no influence on consumption of another. Psychological research and analyses in terms of substitutability employ standard operant conditioning paradigms in which humans and nonhumans choose between alternative reinforcers. The range of reinforcer interactions found in these studies is more readily accommodated and predicted when behavior-analytic models of choice consider issues of substitutability. New insights are gained into such areas as eating and drinking, electrical brain stimulation, temporal separation of choice alternatives, behavior therapy, drug use, and addictions. Moreover, the generalized matching law (Baum, 1974) gains greater explanatory power and comprehensiveness when measures of substitutability are included. PMID:16812696

  20. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, D.B.; Lao, G.

    1998-01-06

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

  1. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, David B.; Lao, Guifang

    1998-01-01

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

  2. The influence of genomic context on mutation patterns in the human genome inferred from rare variants

    PubMed Central

    Schaibley, Valerie M.; Zawistowski, Matthew; Wegmann, Daniel; Ehm, Margaret G.; Nelson, Matthew R.; St. Jean, Pamela L.; Abecasis, Gonçalo R.; Novembre, John; Zöllner, Sebastian; Li, Jun Z.

    2013-01-01

    Understanding patterns of spontaneous mutations is of fundamental interest in studies of human genome evolution and genetic disease. Here, we used extremely rare variants in humans to model the molecular spectrum of single-nucleotide mutations. Compared to common variants in humans and human–chimpanzee fixed differences (substitutions), rare variants, on average, arose more recently in the human lineage and are less affected by the potentially confounding effects of natural selection, population demographic history, and biased gene conversion. We analyzed variants obtained from a population-based sequencing study of 202 genes in >14,000 individuals. We observed considerable variability in the per-gene mutation rate, which was correlated with local GC content, but not recombination rate. Using >20,000 variants with a derived allele frequency ≤10−4, we examined the effect of local GC content and recombination rate on individual variant subtypes and performed comparisons with common variants and substitutions. The influence of local GC content on rare variants differed from that on common variants or substitutions, and the differences varied by variant subtype. Furthermore, recombination rate and recombination hotspots have little effect on rare variants of any subtype, yet both have a relatively strong impact on multiple variant subtypes in common variants and substitutions. This observation is consistent with the effect of biased gene conversion or selection-dependent processes. Our results highlight the distinct biases inherent in the initial mutation patterns and subsequent evolutionary processes that affect segregating variants. PMID:23990608

  3. The influence of genomic context on mutation patterns in the human genome inferred from rare variants.

    PubMed

    Schaibley, Valerie M; Zawistowski, Matthew; Wegmann, Daniel; Ehm, Margaret G; Nelson, Matthew R; St Jean, Pamela L; Abecasis, Gonçalo R; Novembre, John; Zöllner, Sebastian; Li, Jun Z

    2013-12-01

    Understanding patterns of spontaneous mutations is of fundamental interest in studies of human genome evolution and genetic disease. Here, we used extremely rare variants in humans to model the molecular spectrum of single-nucleotide mutations. Compared to common variants in humans and human-chimpanzee fixed differences (substitutions), rare variants, on average, arose more recently in the human lineage and are less affected by the potentially confounding effects of natural selection, population demographic history, and biased gene conversion. We analyzed variants obtained from a population-based sequencing study of 202 genes in >14,000 individuals. We observed considerable variability in the per-gene mutation rate, which was correlated with local GC content, but not recombination rate. Using >20,000 variants with a derived allele frequency ≤ 10(-4), we examined the effect of local GC content and recombination rate on individual variant subtypes and performed comparisons with common variants and substitutions. The influence of local GC content on rare variants differed from that on common variants or substitutions, and the differences varied by variant subtype. Furthermore, recombination rate and recombination hotspots have little effect on rare variants of any subtype, yet both have a relatively strong impact on multiple variant subtypes in common variants and substitutions. This observation is consistent with the effect of biased gene conversion or selection-dependent processes. Our results highlight the distinct biases inherent in the initial mutation patterns and subsequent evolutionary processes that affect segregating variants.

  4. Identifying single nucleotides by tunnelling current

    NASA Astrophysics Data System (ADS)

    Tsutsui, Makusu; Taniguchi, Masateru; Yokota, Kazumichi; Kawai, Tomoji

    2010-04-01

    A major goal in medical research is to develop a DNA sequencing technique that is capable of reading an entire human genome at low cost. Recently, it was proposed that DNA sequencing could be performed by measuring the electron transport properties of the individual nucleotides in a DNA molecule. Here, we report electrical detection of single nucleotides using two configurable nanoelectrodes and show that electron transport through single nucleotides occurs by tunnelling. We also demonstrate statistical identification of the nucleotides based on their electrical conductivity, thereby providing an experimental basis for a DNA sequencing technology based on measurements of electron transport.

  5. A Family of Routes to Substituted Phenols, Including Meta-Substituted Phenols.

    PubMed

    Shao, Wenjie; Clive, Derrick L J

    2015-12-18

    A new family of routes to substituted phenols has been developed. 2-Bromo-3-methoxycyclohex-2-en-1-ones are readily deprotonated at C-6, and the resulting anions react smoothly with a variety of electrophiles; treatment with DBU in PhMe at room temperature then results in efficient aromatization to benzene derivatives of a regiochemically defined substitution pattern. This sequence affords phenolic azides (ArN3), sulfides (ArSR, ArSAr'), selenides (ArSePh), alcohols [ArCH(OH)R], amino derivatives [ArCH(NHSO2Ar')R), and 1,2-benzenediols. A complementary set of substitution patterns is obtained by DIBAL-H reduction or reaction with a Grignard reagent before aromatization; the latter process gives compounds in which the newly introduced substituent is meta to the phenolic hydroxyl.

  6. Ring-substituted 11-oxo-11H-indeno[1,2-b]quinoline-6-carboxamides with similar patterns of cytotoxicity to the dual topo I/II inhibitor DACA.

    PubMed

    Deady, L W; Desneves, J; Kaye, A J; Thompson, M; Finlay, G J; Baguley, B C; Denny, W A

    1999-12-01

    A series of ring-substituted analogues of the topoisomerase inhibitor 11-oxo-11H-indeno[1,2-b]quinoline-6-carboxamides was prepared and evaluated. The compounds were prepared by Pfitzinger reaction of the appropriate isatin-7-carboxylic acids and 1-indanones, followed by selective thermal decarboxylation of the resulting tetracyclic diacids, subsequent oxidation of the methylene group with alkaline permanganate under carefully controlled conditions, and 1,1'-carbonyldiimidazole-induced amidation. The compounds were evaluated in a panel of cell lines in culture. The largest increases in cytotoxicity (five to tenfold) were shown by 4-substituted analogues, with the 4-Cl derivative having an IC50 of 8 nM against the Lewis lung carcinoma.

  7. Asymmetry in Object Substitution Masking Occurs Relative to the Direction of Spatial Attention Shift

    ERIC Educational Resources Information Center

    Hirose, Nobuyuki; Osaka, Naoyuki

    2010-01-01

    A sparse mask that persists beyond the duration of a target can reduce its visibility, a phenomenon called "object substitution masking". Y. Jiang and M. M. Chun (2001a) found an asymmetric pattern of substitution masking such that a mask on the peripheral side of the target caused stronger substitution masking than on the central side.…

  8. Changes in the aggregation patterns of Z-2,3-diphenylpropenoic acid and its methyl ester on substituting the olefinic hydrogen with CF 3 group—an FT-IR study

    NASA Astrophysics Data System (ADS)

    Kiss, J. T.; Felföldi, K.; Pálinkó, I.

    2005-06-01

    While in the unsubstituted Z-2,3-diphenylpropenoic acid and its methyl ester the olefinic protons rarely were part of any hydrogen bonding interaction, upon substitution by CF 3 group, the possibility of (aromatic)C-H⋯F intermolecular hydrogen bond appeared and indeed realised for the molecules ( E-2,3-diphenyl-3-CF 3-propenoic acid and its methyl ester) in the solid state. This type of close contact was indicated experimentally by FT-IR spectroscopy.

  9. Nucleotide and phylogenetic analyses of the Chlamydia trachomatis ompA gene indicates it is a hotspot for mutation

    USDA-ARS?s Scientific Manuscript database

    Background: Serovars of the human pathogen Chlamydia trachomatis occupy one of three specific tissue niches. Genomic analyses indicate that the serovars have a phylogeny congruent with their pathobiology and have an average substitution rate of less than one nucleotide per kilobase. The ompA gene, h...

  10. Nucleotide sequence of mouse satellite DNA.

    PubMed Central

    Hörz, W; Altenburger, W

    1981-01-01

    The nucleotide sequence of uncloned mouse satellite DNA has been determined by analyzing Sau96I restriction fragments that correspond to the repeat unit of the satellite DNA. An unambiguous sequence of 234 bp has been obtained. The sequence of the first 250 bases from dimeric satellite fragments present in Sau96I limit digests corresponds almost exactly to two tandemly arranged monomer sequences including a complete Sau96I site in the center. This is in agreement with the hypothesis that a low level of divergence which cannot be detected in sequence analyses of uncloned DNA is responsible for the appearance of dimeric fragments. Most of the sequence of the 5% fraction of Sau96 monomers that are susceptible to TaqI has also been determined and has been found to agree completely with the prototype sequence. The monomer sequence is internally repetitious being composed of eight diverged subrepeats. The divergence pattern has interesting implications for theories on the evolution of mouse satellite DNA. PMID:6261227

  11. Essential role of vesicular nucleotide transporter in vesicular storage and release of nucleotides in platelets

    PubMed Central

    Hiasa, Miki; Togawa, Natsuko; Miyaji, Takaaki; Omote, Hiroshi; Yamamoto, Akitsugu; Moriyama, Yoshinori

    2014-01-01

    Abstract Nucleotides are stored in the dense granules of platelets. The release of nucleotides triggers one of the first steps in a series of cascades responsible for blood coagulation. However, the mechanism of how the nucleotides are accumulated in the granules is still far less understood. The transporter protein responsible for storage of nucleotides in the neuroendocrine cells has been identified and characterized. We hypothesized that the vesicular nucleotide transporter (VNUT) is also involved in the vesicular storage of nucleotides in platelets. In this article, we present three lines of evidence that VNUT is responsible for the vesicular storage of nucleotides in platelets and that vesicular ATP transport is crucial for platelet function, detection and characterization of VNUT activity in platelets isolated from healthy humans and MEG‐01 cells, RNA interference experiments on MEG‐01 cells, and studies on nucleotide transport and release with a selective inhibitor. PMID:24907298

  12. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    NASA Astrophysics Data System (ADS)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-02-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  13. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    NASA Astrophysics Data System (ADS)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  14. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

    PubMed

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

    2017-02-03

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  15. Thermodynamics of 2'-ribose substitutions in UUCG tetraloops.

    PubMed Central

    Williams, D J; Boots, J L; Hall, K B

    2001-01-01

    The ribose 2'-hydroxyl group confers upon RNA many unique molecular properties. To better appreciate its contribution to structure and stability and to monitor how substitutions of the 2' hydroxyl can alter an RNA molecule, each loop pyrimidine ribonucleotide in the UUCG tetraloop was substituted with a nucleotide containing either a fluorine (2'-F), hydrogen (2'-H), amino (2'-NH2), or methoxy (2'-OCH3) group, in the context of both the C:G and G:C loop-closing base pair. The thermodynamic parameters of these tetraloop variants have been determined and NMR experiments used to monitor the structural changes resulting from the substitutions. The modified riboses are better tolerated in the G[UUCG]C tetraloop, which may be due to its increased loop flexibility relative to the C[UUCG]G loop. Even for these simple substitutions, the free-energy change reflects a complex interplay of hydrogen bonding, solvation effects, and intrinsic pucker preferences of the nucleotides. PMID:11214179

  16. Maintaining a conserved methylation in plant and insect U2 snRNA through compensatory mutation by nucleotide insertion.

    PubMed

    Huang, Zhan-Peng; Zhou, Hui; Qu, Liang-Hu

    2005-10-01

    The extensive post-transcriptional modification of U2 snRNA is required for spliceosome assembly and pre-mRNA splicing in vertebrates. However, the rare modification of U2 snRNA in yeast implies a different mechanism for regulating spliceosome biogenesis in single-celled eukaryotes. To understand the evolutionary pattern of U2 snRNA methylation, we determined for the first time, the 2'-O-methylations of U2 snRNA in Oryza sativa, Arabidopsis thaliana and Drosophila melanogaster, and revealed two methylations which are conserved in a crucial region of U2 snRNA in plants. Interestingly, one of the methylations, U2-Cm29 is also methylated in D. melanogaster, but not in vertebrates. According to the methylation of U2-C29, computational analysis of databases identified three canonical box C/D snoRNAs, named OsmgU2-29, AtmgU2-29 and DmmgU2-28, as small methylation guides of U2 snRNA from O. sativa, A. thaliana and D. melanogaster, respectively. Although very divergent in their sequence, the three snoRNAs exhibit in common an 11 nucleotide-long sequence complementarity to corresponding U2 snRNA, implying a functional constraint on the modification during evolution. Interestingly, a nucleotide is found to be inserted both in U2 snRNA and DmmgU2-28 and maintains a perfect match of duplex specifying the methylation of C28 in Drosophila U2 snRNA. This is the first time a new model is being provided for compensatory mutations between a small guide RNA and its target by nucleotide insertion, instead of the known nucleotide substitution. In contrast to small Cajal body-specific RNAs (scaRNAs), the snoRNAs are similar to the reported singlet guide RNAs and are known to localize in nucleolus. IUBMB Life, 57: 693-699, 2005.

  17. RNAs Containing Modified Nucleotides Fail To Trigger RIG-I Conformational Changes for Innate Immune Signaling

    PubMed Central

    Durbin, Ann Fiegen; Wang, Chen; Marcotrigiano, Joseph

    2016-01-01

    ABSTRACT Invading pathogen nucleic acids are recognized and bound by cytoplasmic (retinoic acid-inducible gene I [RIG-I]-like) and membrane-bound (Toll-like) pattern recognition receptors to activate innate immune signaling. Modified nucleotides, when present in RNA molecules, diminish the magnitude of these signaling responses. However, mechanisms explaining the blunted signaling have not been elucidated. In this study, we used several independent biological assays, including inhibition of virus replication, RIG-I:RNA binding assays, and limited trypsin digestion of RIG-I:RNA complexes, to begin to understand how RNAs containing modified nucleotides avoid or suppress innate immune signaling. The experiments were based on a model innate immune activating RNA molecule, the polyU/UC RNA domain of hepatitis C virus, which was transcribed in vitro with canonical nucleotides or with one of eight modified nucleotides. The approach revealed signature assay responses associated with individual modified nucleotides or classes of modified nucleotides. For example, while both N-6-methyladenosine (m6A) and pseudouridine nucleotides correlate with diminished signaling, RNA containing m6A modifications bound RIG-I poorly, while RNA containing pseudouridine bound RIG-I with high affinity but failed to trigger the canonical RIG-I conformational changes associated with robust signaling. These data advance understanding of RNA-mediated innate immune signaling, with additional relevance for applying nucleotide modifications to RNA therapeutics. PMID:27651356

  18. Performing Substitute Teaching

    ERIC Educational Resources Information Center

    Bletzer, Keith V.

    2010-01-01

    Formal education is both a right and an obligation bestowed on young people in most all nations of the world. Teachers (adults) and students (youth) form a co-present dyadic contract that must be maintained within the classroom. Substitute teachers fill a role in sustaining the integrity of this teacher-student link, whenever teachers are absent.…

  19. The Age of Substitutability

    ERIC Educational Resources Information Center

    Goeller, H. E.; Weinberg, Alvin M.

    1976-01-01

    Dwindling mineral resources might cause a shift from nonrenewable resources to renewable resources and inexhaustible elements such as iron and aluminum. Alternative energy sources such as breeder, fusion, solar, and geothermal power must be developed for production and recycling of materials. Substitution and, hence, living standards ultimately…

  20. No cheap substitutes.

    PubMed

    Griffiths, Peter

    2016-06-15

    The Nuffield Trust report on reshaping the healthcare workforce was published last month. Its conclusions were widely reported as a recommendation to 'train up' nurses as a solution to junior doctor shortages, with support workers, in turn, substituting for registered nurses.

  1. The Age of Substitutability

    ERIC Educational Resources Information Center

    Goeller, H. E.; Weinberg, Alvin M.

    1976-01-01

    Dwindling mineral resources might cause a shift from nonrenewable resources to renewable resources and inexhaustible elements such as iron and aluminum. Alternative energy sources such as breeder, fusion, solar, and geothermal power must be developed for production and recycling of materials. Substitution and, hence, living standards ultimately…

  2. Performing Substitute Teaching

    ERIC Educational Resources Information Center

    Bletzer, Keith V.

    2010-01-01

    Formal education is both a right and an obligation bestowed on young people in most all nations of the world. Teachers (adults) and students (youth) form a co-present dyadic contract that must be maintained within the classroom. Substitute teachers fill a role in sustaining the integrity of this teacher-student link, whenever teachers are absent.…

  3. Screening Substitute Teachers.

    ERIC Educational Resources Information Center

    Kakkuri, Mark

    2000-01-01

    The screening process a school district uses in hiring substitute teachers is critical to striking a balance between required qualifications and immediate need. Typically, screening involves at least one of the following: pre-screening, paper and pencil screening, interviews, and background checks, each of which is used to different degrees…

  4. Organizing Substitute Teachers.

    ERIC Educational Resources Information Center

    Vail, Kathleen

    2000-01-01

    Many substitute teachers are underpaid, undertrained, and "invisible" employees lacking health benefits and respect from regular colleagues. Grass-roots organizing efforts have improved working conditions for subs in two Florida and California districts. Districts' improvement initiatives should be guided by concerns for student…

  5. Nucleotide Selectivity of Antibiotic Kinases▿

    PubMed Central

    Shakya, Tushar; Wright, Gerard D.

    2010-01-01

    Antibiotic kinases, which include aminoglycoside and macrolide phosphotransferases (APHs and MPHs), pose a serious threat to currently used antimicrobial therapies. These enzymes show structural and functional homology with Ser/Thr/Tyr kinases, which is suggestive of a common ancestor. Surprisingly, recent in vitro studies using purified antibiotic kinase enzymes have revealed that a number are able to utilize GTP as the antibiotic phospho donor, either preferentially or exclusively compared to ATP, the canonical phosphate donor in most biochemical reactions. To further explore this phenomenon, we examined three enzymes, APH(3′)-IIIa, APH(2″)-Ib, and MPH(2′)-I, using a competitive assay that mimics in vivo nucleotide triphosphate (NTP) concentrations and usage by each enzyme. Downstream analysis of reaction products by high-performance liquid chromatography enabled the determination of partitioning of phosphate flux from NTP donors to antibiotics. Using this ratio along with support from kinetic analysis and inhibitor studies, we find that under physiologic concentrations of NTPs, APH(3′)-IIIa exclusively uses ATP, MPH(2′)-I exclusively uses GTP, and APH(2″)-Ib is able to use both species with a preference for GTP. These differences reveal likely different pathways in antibiotic resistance enzyme evolution and can be exploited in selective inhibitor design to counteract resistance. PMID:20231391

  6. Automated Identification of Nucleotide Sequences

    NASA Technical Reports Server (NTRS)

    Osman, Shariff; Venkateswaran, Kasthuri; Fox, George; Zhu, Dian-Hui

    2007-01-01

    STITCH is a computer program that processes raw nucleotide-sequence data to automatically remove unwanted vector information, perform reverse-complement comparison, stitch shorter sequences together to make longer ones to which the shorter ones presumably belong, and search against the user s choice of private and Internet-accessible public 16S rRNA databases. ["16S rRNA" denotes a ribosomal ribonucleic acid (rRNA) sequence that is common to all organisms.] In STITCH, a template 16S rRNA sequence is used to position forward and reverse reads. STITCH then automatically searches known 16S rRNA sequences in the user s chosen database(s) to find the sequence most similar to (the sequence that lies at the smallest edit distance from) each spliced sequence. The result of processing by STITCH is the identification of the most similar well-described bacterium. Whereas previously commercially available software for analyzing genetic sequences operates on one sequence at a time, STITCH can manipulate multiple sequences simultaneously to perform the aforementioned operations. A typical analysis of several dozen sequences (length of the order of 103 base pairs) by use of STITCH is completed in a few minutes, whereas such an analysis performed by use of prior software takes hours or days.

  7. Nucleotide selectivity of antibiotic kinases.

    PubMed

    Shakya, Tushar; Wright, Gerard D

    2010-05-01

    Antibiotic kinases, which include aminoglycoside and macrolide phosphotransferases (APHs and MPHs), pose a serious threat to currently used antimicrobial therapies. These enzymes show structural and functional homology with Ser/Thr/Tyr kinases, which is suggestive of a common ancestor. Surprisingly, recent in vitro studies using purified antibiotic kinase enzymes have revealed that a number are able to utilize GTP as the antibiotic phospho donor, either preferentially or exclusively compared to ATP, the canonical phosphate donor in most biochemical reactions. To further explore this phenomenon, we examined three enzymes, APH(3')-IIIa, APH(2'')-Ib, and MPH(2')-I, using a competitive assay that mimics in vivo nucleotide triphosphate (NTP) concentrations and usage by each enzyme. Downstream analysis of reaction products by high-performance liquid chromatography enabled the determination of partitioning of phosphate flux from NTP donors to antibiotics. Using this ratio along with support from kinetic analysis and inhibitor studies, we find that under physiologic concentrations of NTPs, APH(3')-IIIa exclusively uses ATP, MPH(2')-I exclusively uses GTP, and APH(2'')-Ib is able to use both species with a preference for GTP. These differences reveal likely different pathways in antibiotic resistance enzyme evolution and can be exploited in selective inhibitor design to counteract resistance.

  8. Nucleotide excision repair in humans.

    PubMed

    Spivak, Graciela

    2015-12-01

    The demonstration of DNA damage excision and repair replication by Setlow, Howard-Flanders, Hanawalt and their colleagues in the early 1960s, constituted the discovery of the ubiquitous pathway of nucleotide excision repair (NER). The serial steps in NER are similar in organisms from unicellular bacteria to complex mammals and plants, and involve recognition of lesions, adducts or structures that disrupt the DNA double helix, removal of a short oligonucleotide containing the offending lesion, synthesis of a repair patch copying the opposite undamaged strand, and ligation, to restore the DNA to its original form. The transcription-coupled repair (TCR) subpathway of NER, discovered nearly two decades later, is dedicated to the removal of lesions from the template DNA strands of actively transcribed genes. In this review I will outline the essential factors and complexes involved in NER in humans, and will comment on additional factors and metabolic processes that affect the efficiency of this important process. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. A novel technique for detecting single nucleotide polymorphisms by analyzing consumed allele-specific primers.

    PubMed

    Watanabe, G; Umetsu, K; Yuasa, I; Sato, M; Sakabe, M; Naito, E; Yamanouchi, H; Suzuki, T

    2001-02-01

    We present a simple and rapid polymerase chain reaction (PCR)-based technique, termed consumed allele-specific primer analysis (CASPA), as a new strategy for single nucleotide polymorphism (SNP) analysis. The method involves the use of labeled allele-specific primers, differing in length, with several noncomplementary nucleotides added in the 5'-terminal region. After PCR amplification, the amounts of the remaining primers not incorporated into the PCR products are determined. Thus, nucleotide substitutions are identified by measuring the consumption of primers. In this study, the CASPA method was successfully applied to ABO genotyping. In the present method, the allele-specific primer only anneals with the target polymorphic site on the DNA, so it is not necessary to analyze the PCR products. Therefore, this method is only little affected by modification of the PCR products. The CASPA method is expected to be a useful tool for typing of SNPs.

  10. IRE1α nucleotide sequence cleavage specificity in the unfolded protein response.

    PubMed

    Poothong, Juthakorn; Sopha, Pattarawut; Kaufman, Randal J; Tirasophon, Witoon

    2017-01-01

    Inositol-requiring enzyme 1 (IRE1) is a conserved sensor of the unfolded protein response that has protein kinase and endoribonuclease (RNase) enzymatic activities and thereby initiates HAC1/XBP1 splicing. Previous studies demonstrated that human IRE1α (hIRE1α) does not cleave Saccharomyces cerevisiae HAC1 mRNA. Using an in vitro cleavage assay, we show that adenine to cytosine nucleotide substitution at the +1 position in the 3' splice site of HAC1 RNA is required for specific cleavage by hIRE1α. A similar restricted nucleotide specificity in the RNA substrate was observed for XBP1 splicing in vivo. Together these findings underscore the essential role of cytosine nucleotide at +1 in the 3' splice site for determining cleavage specificity of hIRE1α.

  11. Intraspecific nucleotide sequence differences in the major noncoding region of human mitochondrial DNA.

    PubMed Central

    Horai, S; Hayasaka, K

    1990-01-01

    Nucleotide sequences of the major noncoding region of human mitochondrial DNA (mtDNA) from 95 human placentas have been determined. These sequences include at least a 482-bp-long region encompassing most of the D-loop-forming region. Comparisons of these sequences with those previously determined have revealed remarkable features of nucleotide substitutions and insertion/deletion events. The nucleotide diversity among the sequences is estimated as 1.45%, which is three- to fourfold higher than the corresponding value estimated from restriction-enzyme analysis of whole mtDNA genome. A hypervariable region has also been defined. In this 14-bp region, 17 different sequences were detected. More than 97% of the base changes are transitions. A significantly nonrandom distribution of nucleotide substitutions and sequence length variations were also noted. The phylogenetic analysis indicates that diversity among the negroids is much larger than that among the caucasoids or the mongoloids. In fact, part of the negroids first diverged from other humans in the phylogenetic tree. A striking finding in the phylogenetic analysis is that the mongoloids can be separated into two distinct groups. Divergence of part of the mongoloids follows the earliest divergence of part of the negroids. The remainder of the mongoloids subsequently diverged together with the caucasoids. This observation confirmed our earlier study, which clearly demonstrated, by the restriction-enzyme analysis, existence of two distinct groups in the Japanese. Images Figure 3 PMID:2316527

  12. Patterns of population genetic structure for springtails and mites in southern Victoria Land, Antarctica.

    PubMed

    McGaughran, Angela; Hogg, Ian D; Stevens, Mark I

    2008-02-01

    We sequenced the mitochondrial (mt) DNA cytochrome c oxidase subunit I gene to examine comparative phylogeographic patterns for the springtail Gomphiocephalus hodgsoni and the mite Stereotydeus mollis throughout their ranges in southern Victoria Land, Antarctica. Our aim was to extend previous genetic work to encompass a large ice-free area in the Dry Valleys. In particular, we sought to determine if this new region harboured high levels of genetic diversity and if patterns of genetic structure were congruent across taxa. Phylogenetic and nested clade analyses for G. hodgsoni and S. mollis showed similar patterns of population sub-structuring among locations and highlighted several potential refugia that may have existed during glacial maxima. We identified greater levels of genetic divergence in S. mollis and suggest that there is a nucleotide substitution (mutation) rate difference between S. mollis and G. hodgsoni, and/or that S. mollis has had a longer association with the Antarctic landscape.

  13. Long-range correlations in nucleotide sequences

    NASA Astrophysics Data System (ADS)

    Peng, C.-K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Sciortino, F.; Simons, M.; Stanley, H. E.

    1992-03-01

    DNA SEQUENCES have been analysed using models, such as an it-step Markov chain, that incorporate the possibility of short-range nucleotide correlations1. We propose here a method for studying the stochastic properties of nucleotide sequences by constructing a 1:1 map of the nucleotide sequence onto a walk, which we term a 'DNA walk'. We then use the mapping to provide a quantitative measure of the correlation between nucleotides over long distances along the DNA chain. Thus we uncover in the nucleotide sequence a remarkably long-range power law correlation that implies a new scale-invariant property of DNA. We find such long-range correlations in intron-containing genes and in nontranscribed regulatory DNA sequences, but not in complementary DNA sequences or intron-less genes.

  14. Long-range correlations in nucleotide sequences

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Sciortino, F.; Simons, M.; Stanley, H. E.

    1992-01-01

    DNA sequences have been analysed using models, such as an n-step Markov chain, that incorporate the possibility of short-range nucleotide correlations. We propose here a method for studying the stochastic properties of nucleotide sequences by constructing a 1:1 map of the nucleotide sequence onto a walk, which we term a 'DNA walk'. We then use the mapping to provide a quantitative measure of the correlation between nucleotides over long distances along the DNA chain. Thus we uncover in the nucleotide sequence a remarkably long-range power law correlation that implies a new scale-invariant property of DNA. We find such long-range correlations in intron-containing genes and in nontranscribed regulatory DNA sequences, but not in complementary DNA sequences or intron-less genes.

  15. Long-range correlations in nucleotide sequences

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Sciortino, F.; Simons, M.; Stanley, H. E.

    1992-01-01

    DNA sequences have been analysed using models, such as an n-step Markov chain, that incorporate the possibility of short-range nucleotide correlations. We propose here a method for studying the stochastic properties of nucleotide sequences by constructing a 1:1 map of the nucleotide sequence onto a walk, which we term a 'DNA walk'. We then use the mapping to provide a quantitative measure of the correlation between nucleotides over long distances along the DNA chain. Thus we uncover in the nucleotide sequence a remarkably long-range power law correlation that implies a new scale-invariant property of DNA. We find such long-range correlations in intron-containing genes and in nontranscribed regulatory DNA sequences, but not in complementary DNA sequences or intron-less genes.

  16. Thermodynamics of RNA duplexes modified with unlocked nucleic acid nucleotides

    PubMed Central

    Pasternak, Anna; Wengel, Jesper

    2010-01-01

    Thermodynamics provides insights into the influence of modified nucleotide residues on stability of nucleic acids and is crucial for designing duplexes with given properties. In this article, we introduce detailed thermodynamic analysis of RNA duplexes modified with unlocked nucleic acid (UNA) nucleotide residues. We investigate UNA single substitutions as well as model mismatch and dangling end effects. UNA residues placed in a central position makes RNA duplex structure less favourable by 4.0–6.6 kcal/mol. Slight destabilization, by ∼0.5–1.5 kcal/mol, is observed for 5′- or 3′-terminal UNA residues. Furthermore, thermodynamic effects caused by UNA residues are extremely additive with ΔG°37 conformity up to 98%. Direct mismatches involving UNA residues decrease the thermodynamic stability less than unmodified mismatches in RNA duplexes. Additionally, the presence of UNA residues adjacent to unpaired RNA residues reduces mismatch discrimination. Thermodynamic analysis of UNA 5′- and 3′-dangling ends revealed that stacking interactions of UNA residues are always less favourable than that of RNA residues. Finally, circular dichroism spectra imply no changes in overall A-form structure of UNA–RNA/RNA duplexes relative to the unmodified RNA duplexes. PMID:20562222

  17. Nucleotide specificity of the RNA editing reaction in pea chloroplasts.

    PubMed

    Nakajima, Yuki; Mulligan, R Michael

    2005-12-01

    A sensitive in vitro editing assay for the pea chloroplast petB editing site has been developed and utilized to study the mechanism of C-to-U editing in chloroplast extracts. The in vitro editing assay was characterized by several criteria including: linearity with extract amount; linearity over time; dependence on assay components; and specificity of editing site conversion. The increase in the extent C-to-U conversion of the petB editing site was nearly linear with the amount chloroplast protein extract added, although the reaction appeared to decline in rate after approximately 30 min. The assay was tested for the importance of various assay components, and the omission of protease inhibitor and ATP was shown to dramatically reduce the extent of the editing reaction. Sequence analysis of cDNA clones obtained after an in vitro editing reaction demonstrated that 12 of 17 (71%) clones were edited, and that no other nucleotide changes in these cDNAs were detected. Thus, the fidelity and specificity of the in vitro editing system appears to be excellent, and this system should be suitable to study both mechanism of the editing reaction and editing site selection. The in vitro editing reaction was strongly stimulated by the addition of ATP, and all four NTPs and dNTPs stimulated the editing reaction except for rGTP, which had no effect. Thus, the nucleotide specificity of the editing reaction is broad, and is similar in this respect to the mitochondrial editing system. Most enzyme or processes specifically utilize ATP or GTP for phosphorylation and the ability to substitute other NTPs and dNTPs is unusual. RNA helicases have a similar broad nucleotide specificity and this may reflect the involvement of an RNA helicase in plant organelle editing.

  18. Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens

    PubMed Central

    Weiß, Clemens L.; Schuenemann, Verena J.; Devos, Jane; Shirsekar, Gautam; Reiter, Ella; Gould, Billie A.; Stinchcombe, John R.; Krause, Johannes

    2016-01-01

    Herbaria archive a record of changes of worldwide plant biodiversity harbouring millions of specimens that contain DNA suitable for genome sequencing. To profit from this resource, it is fundamental to understand in detail the process of DNA degradation in herbarium specimens. We investigated patterns of DNA fragmentation and nucleotide misincorporation by analysing 86 herbarium samples spanning the last 300 years using Illumina shotgun sequencing. We found an exponential decay relationship between DNA fragmentation and time, and estimated a per nucleotide fragmentation rate of 1.66 × 10−4 per year, which is six times faster than the rate estimated for ancient bones. Additionally, we found that strand breaks occur specially before purines, and that depurination-driven DNA breakage occurs constantly through time and can to a great extent explain decreasing fragment length over time. Similar to what has been found analysing ancient DNA from bones, we found a strong correlation between the deamination-driven accumulation of cytosine to thymine substitutions and time, which reinforces the importance of substitution patterns to authenticate the ancient/historical nature of DNA fragments. Accurate estimations of DNA degradation through time will allow informed decisions about laboratory and computational procedures to take advantage of the vast collection of worldwide herbarium specimens. PMID:27429780

  19. Preliminary analysis of the mitochondrial genome evolutionary pattern in primates.

    PubMed

    Zhao, Liang; Zhang, Xingtao; Tao, Xingkui; Wang, Weiwei; Li, Ming

    2012-08-01

    Since the birth of molecular evolutionary analysis, primates have been a central focus of study and mitochondrial DNA is well suited to these endeavors because of its unique features. Surprisingly, to date no comprehensive evaluation of the nucleotide substitution patterns has been conducted on the mitochondrial genome of primates. Here, we analyzed the evolutionary patterns and evaluated selection and recombination in the mitochondrial genomes of 44 Primates species downloaded from GenBank. The results revealed that a strong rate heterogeneity occurred among sites and genes in all comparisons. Likewise, an obvious decline in primate nucleotide diversity was noted in the subunit rRNAs and tRNAs as compared to the protein-coding genes. Within 13 protein-coding genes, the pattern of nonsynonymous divergence was similar to that of overall nucleotide divergence, while synonymous changes differed only for individual genes, indicating that the rate heterogeneity may result from the rate of change at nonsynonymous sites. Codon usage analysis revealed that there was intermediate codon usage bias in primate protein-coding genes, and supported the idea that GC mutation pressure might determine codon usage and that positive selection is not the driving force for the codon usage bias. Neutrality tests using site-specific positive selection from a Bayesian framework indicated no sites were under positive selection for any gene, consistent with near neutrality. Recombination tests based on the pairwise homoplasy test statistic supported complete linkage even for much older divergent primate species. Thus, with the exception of rate heterogeneity among mitochondrial genes, evaluating the validity assumed complete linkage and selective neutrality in primates prior to phylogenetic or phylogeographic analysis seems unnecessary.

  20. Nucleotides as nucleophiles: reactions of nucleotides with phosphoimidazolide activated guanosine

    NASA Technical Reports Server (NTRS)

    Kanavarioti, A.; Rosenbach, M. T.; Hurley, T. B.

    1991-01-01

    An earlier study of the reaction of phosphoimidazolide activated nucleosides (ImpN) in aqueous phosphate buffers indicated two modes of reaction of the phosphate monoanion and dianion. The first mode is catalysis of the hydrolysis of the P-N bond in ImpN's which leads to imidazole and nucleoside 5'-monophosphate. The second represents a nucleophilic substitution of the imidazole to yield the nucleoside 5'-diphosphate. This earlier study thus served as a model for the reaction of ImpN with nucleoside monophosphates (pN) because the latter can be regarded as phosphate derivatives. In the present study we investigated the reaction of guanosine 5'-phosphate-2-methylimidazolide, 2-MeImpG, in the presence of pN (N = guanosine, adenosine and uridine) in the range 6.9 less than or equal to pH less than or equal to 7.7. We observed that pN's do act as nucleophiles to form NppG, and as general base to enhance the hydrolysis of the P-N bond in 2-MeImpG, i.e. pN show the same behavior as inorganic phosphate. The kinetic analysis yields the following rate constants for the dianion pN2-: knpN = 0.17 +/- 0.02 M-1 h-1 for nucleophilic attack and khpN = 0.11 +/- 0.07 M-1 h-1 for general base catalysis of the hydrolysis. These rate constants which are independent of the nucleobase compare with kp.2 = 0.415 M-1 h-1 and khp2. = 0.217 M-1 h-1 for the reactions of HPO4(2-). In addition, this study shows that under conditions where pN presumably form stacks, the reaction mechanism remains unchanged although in quantitative terms stacked pN are somewhat less reactive. Attack by the 2'-OH and 3'-OH groups of the ribose moiety in amounts greater than or equal to 1% is not observed; this is attributed to the large difference in nucleophilicity in the neutral pH range between the phosphate group and the ribose hydroxyls. This nucleophilicity rank is not altered by stacking.

  1. Sensory Substitution for Wounded Servicemembers

    DTIC Science & Technology

    2009-10-28

    traumatic brain injury (TBI) and two civilians, all with partial visual impairment , evaluated the vision sensory substitution systems. The servicemember...Mobility Augmentation; Wounded Service Members; Human-Centered Computing; Vision Augmentation, Vision , Balance and Hearing; Sensory Substitution-enabled...mitigation of vision sensory and mobility losses. 2) Improved the usefulness of available sensory substitution technologies for injured military

  2. Nonenzymatic oligomerization reactions on templates containing inosinic acid or diaminopurine nucleotide residues

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1999-01-01

    The template-directed oligomerization of nucleoside-5'-phosphoro-2-methyl imidazolides on standard oligonucleotide templates has been studied extensively. Here, we describe experiments with templates in which inosinic acid (I) is substituted for guanylic acid, or 2,6-diaminopurine nucleotide (D) for adenylic acid. We find that the substitution of I for G in a template is strongly inhibitory and prevents any incorporation of C into internal positions in the oligomeric products of the reaction. The substitution of D for A, on the contrary, leads to increased incorporation of U into the products. We found no evidence for the template-directed facilitation of oligomerization of A or I through A-I base pairing. The significance of these results for prebiotic chemistry is discussed.

  3. Nonenzymatic oligomerization reactions on templates containing inosinic acid or diaminopurine nucleotide residues

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1999-01-01

    The template-directed oligomerization of nucleoside-5'-phosphoro-2-methyl imidazolides on standard oligonucleotide templates has been studied extensively. Here, we describe experiments with templates in which inosinic acid (I) is substituted for guanylic acid, or 2,6-diaminopurine nucleotide (D) for adenylic acid. We find that the substitution of I for G in a template is strongly inhibitory and prevents any incorporation of C into internal positions in the oligomeric products of the reaction. The substitution of D for A, on the contrary, leads to increased incorporation of U into the products. We found no evidence for the template-directed facilitation of oligomerization of A or I through A-I base pairing. The significance of these results for prebiotic chemistry is discussed.

  4. Identification of repeats in DNA sequences using nucleotide distribution uniformity.

    PubMed

    Yin, Changchuan

    2017-01-07

    Repetitive elements are important in genomic structures, functions and regulations, yet effective methods in precisely identifying repetitive elements in DNA sequences are not fully accessible, and the relationship between repetitive elements and periodicities of genomes is not clearly understood. We present an ab initio method to quantitatively detect repetitive elements and infer the consensus repeat pattern in repetitive elements. The method uses the measure of the distribution uniformity of nucleotides at periodic positions in DNA sequences or genomes. It can identify periodicities, consensus repeat patterns, copy numbers and perfect levels of repetitive elements. The results of using the method on different DNA sequences and genomes demonstrate efficacy and accuracy in identifying repeat patterns and periodicities. The complexity of the method is linear with respect to the lengths of the analyzed sequences. The Python programs in this study are freely available to the public upon request or at https://github.com/cyinbox/DNADU. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Nucleotide capacitance calculation for DNA sequencing

    SciTech Connect

    Lu, Jun-Qiang; Zhang, Xiaoguang

    2008-01-01

    Using a first-principles linear response theory, the capacitance of the DNA nucleotides, adenine, cytosine, guanine and thymine, are calculated. The difference in the capacitance between the nucleotides is studied with respect to conformational distortion. The result suggests that although an alternate current capacitance measurement of a single-stranded DNA chain threaded through a nano-gap electrodes may not sufficient to be used as a stand alone method for rapid DNA sequencing, the capacitance of the nucleotides should be taken into consideration in any GHz-frequency electric measurements and may also serve as an additional criterion for identifying the DNA sequence.

  6. Plant cyclic nucleotide signalling: facts and fiction.

    PubMed

    Martinez-Atienza, Juliana; Van Ingelgem, Carl; Roef, Luc; Maathuis, Frans Jm

    2007-11-01

    The presence of the cyclic nucleotides 3',5'-cyclic adenyl monophosphate (cAMP) and 3',5'-cyclic guanyl monophosphate (cGMP) in plants is now generally accepted. In addition, cAMP and cGMP have been implicated in the regulation of important plant processes such as stomatal functioning, monovalent and divalent cation fluxes, chloroplast development, gibberellic acid signalling, pathogen response and gene transcription. However, very little is known regarding the components of cyclic nucleotide signalling in plants. In this addendum, the evidence for specific mechanisms of plant cyclic nucleotide signalling is evaluated and discussed.

  7. Single Nucleotide Polymorphisms and Osteoarthritis

    PubMed Central

    Wang, Ting; Liang, Yuting; Li, Hong; Li, Haibo; He, Quanze; Xue, Ying; Shen, Cong; Zhang, Chunhua; Xiang, Jingjing; Ding, Jie; Qiao, Longwei; Zheng, Qiping

    2016-01-01

    Abstract Osteoarthritis (OA) is a complex disorder characterized by degenerative articular cartilage and is largely attributed to genetic risk factors. Single nucleotide polymorphisms (SNPs) are common DNA variants that have shown promising and efficiency, compared with positional cloning, to map candidate genes of complex diseases, including OA. In this study, we aim to provide an overview of multiple SNPs from a number of genes that have recently been linked to OA susceptibility. We also performed a comprehensive meta-analysis to evaluate the association of SNP rs7639618 of double von Willebrand factor A domains (DVWA) gene with OA susceptibility. A systematic search of studies on the association of SNPs with susceptibility to OA was conducted in PubMed and Google scholar. Studies subjected to meta-analysis include human and case-control studies that met the Hardy–Weinberg equilibrium model and provide sufficient data to calculate an odds ratio (OR). A total of 9500 OA cases and 9365 controls in 7 case-control studies relating to SNP rs7639618 were included in this study and the ORs with 95% confidence intervals (CIs) were calculated. Over 50 SNPs from different genes have been shown to be associated with either hip (23), or knee (20), or both (13) OA. The ORs of these SNPs for OA and the subtypes are not consistent. As to SNP rs7639618 of DVWA, increased knee OA risk was observed in all genetic models analyzed. Specifically, people from Asian with G-allele showed significantly increased risk of knee OA (A versus G: OR = 1.28, 95% CI 1.13–1.46; AA versus GG: OR = 1.60, 95% CI 1.25–2.05; GA versus GG: OR = 1.31, 95% CI 1.18–1.44; AA versus GA+GG: OR = 1.34, 95% CI 1.12–1.61; AA+GA versus GG: OR = 1.40, 95% CI 1.19–1.64), but not in Caucasians or with hip OA. Our results suggest that multiple SNPs play different roles in the pathogenesis of OA and its subtypes; SNP rs7639618 of DVWA gene is associated with a significantly increased

  8. EspM2 is a RhoA guanine nucleotide exchange factor

    PubMed Central

    Arbeloa, Ana; Garnett, James; Lillington, James; Bulgin, Richard R; Berger, Cedric N; Lea, Susan M; Matthews, Steve; Frankel, Gad

    2010-01-01

    We investigated how the type III secretion system WxxxE effectors EspM2 of enterohaemorrhagic Escherichia coli, which triggers stress fibre formation, and SifA of Salmonella enterica serovar Typhimurium, which is involved in intracellular survival, modulate Rho GTPases. We identified a direct interaction between EspM2 or SifA and nucleotide-free RhoA. Nuclear Magnetic Resonance Spectroscopy revealed that EspM2 has a similar fold to SifA and the guanine nucleotide exchange factor (GEF) effector SopE. EspM2 induced nucleotide exchange in RhoA but not in Rac1 or H-Ras, while SifA induced nucleotide exchange in none of them. Mutating W70 of the WxxxE motif or L118 and I127 residues, which surround the catalytic loop, affected the stability of EspM2. Substitution of Q124, located within the catalytic loop of EspM2, with alanine, greatly attenuated the RhoA GEF activity in vitro and the ability of EspM2 to induce stress fibres upon ectopic expression. These results suggest that binding of SifA to RhoA does not trigger nucleotide exchange while EspM2 is a unique Rho GTPase GEF. PMID:20039879

  9. Identical substitutions in magnesium chelatase paralogs result in chlorophyll deficient soybean mutants

    USDA-ARS?s Scientific Manuscript database

    The soybean (Glycine max (L.) Merr.) chlorophyll deficient line MinnGold is a spontaneous mutant characterized by yellow foliage. Map-based cloning and transgenic complementation revealed that the mutant phenotype is caused by a non-synonymous nucleotide substitution in the third exon of a Mg-chelat...

  10. Advances in targeting cyclic nucleotide phosphodiesterases

    PubMed Central

    Maurice, Donald H.; Ke, Hengming; Ahmad, Faiyaz; Wang, Yousheng; Chung, Jay; Manganiello, Vincent C.

    2014-01-01

    Cyclic nucleotide phosphodiesterases (PDEs) catalyse the hydrolysis of cyclic AMP and cyclic GMP, thereby regulating the intracellular concentrations of these cyclic nucleotides, their signalling pathways and, consequently, myriad biological responses in health and disease. Currently, a small number of PDE inhibitors are used clinically for treating the pathophysiological dysregulation of cyclic nucleotide signalling in several disorders, including erectile dysfunction, pulmonary hypertension, acute refractory cardiac failure, intermittent claudication and chronic obstructive pulmonary disease. However, pharmaceutical interest in PDEs has been reignited by the increasing understanding of the roles of individual PDEs in regulating the subcellular compartmentalization of specific cyclic nucleotide signalling pathways, by the structure-based design of novel specific inhibitors and by the development of more sophisticated strategies to target individual PDE variants. PMID:24687066

  11. Methodologies in Creating Skin Substitutes

    PubMed Central

    Nicholas, Mathew N; Jeschke, Marc G; Amini-Nik, Saeid

    2016-01-01

    The creation of skin substitutes has significantly decreased morbidity and mortality of skin wounds. Although there are still a number of disadvantages of currently available skin substitutes, there has been a significant decline in research advances over the past several years in improving these skin substitutes. Clinically most skin substitutes used are acellular and do not use growth factors to assist wound healing, key areas of potential in this field of research. This article discusses the five necessary attributes of an ideal skin substitute. It comprehensively discusses the three major basic components of currently available skin substitutes: scaffold materials, growth factors, and cells, comparing and contrasting what has been used so far. It then examines a variety of techniques in how to incorporate these basic components together to act as a guide for further research in the field to create cellular skin substitutes with clinically better results. PMID:27154041

  12. Quantitative NMR Analysis of Partially Substituted Biodiesel Glycerols

    SciTech Connect

    Nagy, M.; Alleman, T. L.; Dyer, T.; Ragauskas, A. J.

    2009-01-01

    Phosphitylation of hydroxyl groups in biodiesel samples with 2-chloro-4,4,5,5-tetramethyl-1,3,2-dioxaphospholane followed by 31P-NMR analysis provides a rapid quantitative analytical technique for the determination of substitution patterns on partially esterified glycerols. The unique 31P-NMR chemical shift data was established with a series mono and di-substituted fatty acid esters of glycerol and then utilized to characterize an industrial sample of partially processed biodiesel.

  13. 40 CFR 721.10214 - Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ....-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic). 721.10214 Section 721.10214... Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic... identified generically as poly(oxyalkylenediyl),.alpha.-substituted...

  14. 40 CFR 721.10214 - Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ....-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic). 721.10214 Section 721.10214... Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic... identified generically as poly(oxyalkylenediyl),.alpha.-substituted...

  15. 40 CFR 721.10214 - Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ....-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic). 721.10214 Section 721.10214... Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic... identified generically as poly(oxyalkylenediyl),.alpha.-substituted...

  16. Antagonistic regulation of native Ca2+- and ATP-sensitive cation channels in brain capillaries by nucleotides and decavanadate.

    PubMed

    Csanády, László; Adam-Vizi, Vera

    2004-06-01

    Regulation by cytosolic nucleotides of Ca2+- and ATP-sensitive nonselective cation channels (CA-NSCs) in rat brain capillary endothelial cells was studied in excised inside-out patches. Open probability (Po) was suppressed by cytosolic nucleotides with apparent KI values of 17, 9, and 2 microM for ATP, ADP, and AMP, as a consequence of high-affinity inhibition of channel opening rate and low-affinity stimulation of closing rate. Cytosolic [Ca2+] and voltage affected inhibition of Po, but not of opening rate, by ATP, suggesting that the conformation of the nucleotide binding site is influenced only by the state of the channel gate, not by that of the Ca2+ and voltage sensors. ATP inhibition was unaltered by channel rundown. Nucleotide structure affected inhibitory potency that was little sensitive to base substitutions, but was greatly diminished by 3'-5' cyclization, removal of all phosphates, or complete omission of the base. In contrast, decavanadate potently (K1/2 = 90 nM) and robustly stimulated Po, and functionally competed with inhibitory nucleotides. From kinetic analyses we conclude that (a) ATP, ADP, and AMP bind to a common site; (b) inhibition by nucleotides occurs through simple reversible binding, as a consequence of tighter binding to the closed-channel relative to the open-channel conformation; (c) the conformation of the nucleotide binding site is not directly modulated by Ca2+ and voltage; (d) the differences in inhibitory potency of ATP, ADP, and AMP reflect their different affinities for the closed channel; and (e) though decavanadate is the only example found to date of a compound that stimulates Po with high affinity even in the presence of millimolar nucleotides, apparently by competing for the nucleotide binding site, a comparable mechanism might allow CA-NSC channels to open in living cells despite physiological levels of nucleotides. Decavanadate now provides a valuable tool for studying native CA-NSC channels and for screening cloned

  17. Nucleotide release provides a mechanism for airway surface liquid homeostasis.

    PubMed

    Lazarowski, Eduardo R; Tarran, Robert; Grubb, Barbara R; van Heusden, Catharina A; Okada, Seiko; Boucher, Richard C

    2004-08-27

    Nucleotides within the airway surface liquid (ASL) regulate airway epithelial ion transport rates by Ca(2+) -and protein kinase C-dependent mechanisms via activation of specific P2Y receptors. Extracellular adenine nucleotides also serve as precursors for adenosine, which promotes cyclic AMP-mediated activation of the cystic fibrosis transmembrane regulator chloride channel via A(2b) adenosine receptors. A biological role for extracellular ATP in ASL volume homeostasis has been suggested by the demonstration of regulated ATP release from airway epithelia. However, nucleotide hydrolysis at the airway surface makes it difficult to assess the magnitude of ATP release and the relative abundance of adenyl purines and, hence, to define their biological functions. We have combined ASL microsampling and high performance liquid chromatography analysis of fluorescent 1,N(6)-ethenoadenine derivatives to measure adenyl purines in ASL. We found that adenosine, AMP, and ADP accumulated in high concentrations relative to ATP within the ASL covering polarized primary human normal or cystic fibrosis airway epithelial cells. By using immortalized epithelial cell monolndogenayers that eously express a luminal A(2b) adenosine receptor, we found that basal as well asforskolin-promoted cyclic AMP production was reduced by exogenous adenosine deaminase, suggesting that A(2b) receptors sense endogenous adenosine within the ASL. The physiological role of adenosine was further established by illustrating that adenosine removal or inhibition of adenosine receptors in primary cultures impaired ASL volume regulation. Our data reveal a complex pattern of nucleotides/nucleosides in ASL under resting conditions and suggest that adenosine may play a key role in regulating ASL volume homeostasis.

  18. Nucleotide Release Provides a Mechanism for Airway Surface Liquid Homeostasis*

    PubMed Central

    Lazarowski, Eduardo R.; Tarran, Robert; Grubb, Barbara R.; van Heusden, Catharina A.; Okada, Seiko; Boucher, Richard C.

    2010-01-01

    Nucleotides within the airway surface liquid (ASL) regulate airway epithelial ion transport rates by Ca2+- and protein kinase C-dependent mechanisms via activation of specific P2Y receptors. Extracellular adenine nucleotides also serve as precursors for adenosine, which promotes cyclic AMP-mediated activation of the cystic fibrosis transmembrane regulator chloride channel via A2b adenosine receptors. A biological role for extracellular ATP in ASL volume homeostasis has been suggested by the demonstration of regulated ATP release from airway epithelia. However, nucleotide hydrolysis at the airway surface makes it difficult to assess the magnitude of ATP release and the relative abundance of adenyl purines and, hence, to define their biological functions. We have combined ASL microsampling and high performance liquid chromatography analysis of fluorescent 1,N6-ethenoadenine derivatives to measure adenyl purines in ASL. We found that adenosine, AMP, and ADP accumulated in high concentrations relative to ATP within the ASL covering polarized primary human normal or cystic fibrosis airway epithelial cells. By using immortalized epithelial cell monolayers that endogenously express a luminal A2b adenosine receptor, we found that basal as well as forskolin-promoted cyclic AMP production was reduced by exogenous adenosine deaminase, suggesting that A2b receptors sense endogenous adenosine within the ASL. The physiological role of adenosine was further established by illustrating that adenosine removal or inhibition of adenosine receptors in primary cultures impaired ASL volume regulation. Our data reveal a complex pattern of nucleotides/nucleosides in ASL under resting conditions and suggest that adenosine may play a key role in regulating ASL volume homeostasis. PMID:15210701

  19. Convergent evolution of marine mammals is associated with distinct substitutions in common genes.

    PubMed

    Zhou, Xuming; Seim, Inge; Gladyshev, Vadim N

    2015-11-09

    Phenotypic convergence is thought to be driven by parallel substitutions coupled with natural selection at the sequence level. Multiple independent evolutionary transitions of mammals to an aquatic environment offer an opportunity to test this thesis. Here, whole genome alignment of coding sequences identified widespread parallel amino acid substitutions in marine mammals; however, the majority of these changes were not unique to these animals. Conversely, we report that candidate aquatic adaptation genes, identified by signatures of likelihood convergence and/or elevated ratio of nonsynonymous to synonymous nucleotide substitution rate, are characterized by very few parallel substitutions and exhibit distinct sequence changes in each group. Moreover, no significant positive correlation was found between likelihood convergence and positive selection in all three marine lineages. These results suggest that convergence in protein coding genes associated with aquatic lifestyle is mainly characterized by independent substitutions and relaxed negative selection.

  20. Convergent evolution of marine mammals is associated with distinct substitutions in common genes

    PubMed Central

    Zhou, Xuming; Seim, Inge; Gladyshev, Vadim N.

    2015-01-01

    Phenotypic convergence is thought to be driven by parallel substitutions coupled with natural selection at the sequence level. Multiple independent evolutionary transitions of mammals to an aquatic environment offer an opportunity to test this thesis. Here, whole genome alignment of coding sequences identified widespread parallel amino acid substitutions in marine mammals; however, the majority of these changes were not unique to these animals. Conversely, we report that candidate aquatic adaptation genes, identified by signatures of likelihood convergence and/or elevated ratio of nonsynonymous to synonymous nucleotide substitution rate, are characterized by very few parallel substitutions and exhibit distinct sequence changes in each group. Moreover, no significant positive correlation was found between likelihood convergence and positive selection in all three marine lineages. These results suggest that convergence in protein coding genes associated with aquatic lifestyle is mainly characterized by independent substitutions and relaxed negative selection. PMID:26549748

  1. The Label-Free Unambiguous Detection and Symbolic Display of Single Nucleotide Polymorphisms on DNA Origami

    PubMed Central

    Subramanian, Hari K. K.; Chakraborty, Banani; Sha, Ruojie; Seeman, Nadrian C.

    2011-01-01

    Single Nucleotide Polymorphisms (SNPs) are the most common genetic variation in the human genome. Kinetic methods based on branch migration have proved successful for detecting SNPs because a mispair inhibits the progress of branch migration in the direction of the mispair. We have combined the effectiveness of kinetic methods with AFM of DNA origami patterns to produce a direct visual readout of the target nucleotide contained in the probe sequence. The origami contains graphical representations of the four nucleotide alphabetic characters, A, T, G and C, and the symbol containing the test nucleotide identity vanishes in the presence of the probe. The system also works with pairs of probes, corresponding to heterozygous diploid genomes. PMID:21235216

  2. A type of nucleotide motif that distinguishes tobamovirus species more efficiently than nucleotide signatures.

    PubMed

    Gibbs, A J; Armstrong, J S; Gibbs, M J

    2004-10-01

    The complete genomic sequences of forty-eight tobamoviruses were classified and found to form at least twelve species clusters. Individual species were not conveniently defined by 'nucleotide signatures' (i.e. strings of one or more nucleotides unique to a taxon) as these were scattered sparsely throughout the genomes and were mostly single nucleotides. By contrast all the species were concisely and uniquely distinguished by short nucleotide motifs consisting of conserved genus-specific sites intercalated with variable sites that provided species-specific combinations of nucleotides (nucleotide combination motifs; NC-motifs). We describe the procedure for finding NC-motifs in a convenient and phylogenetically conserved region of the tobamovirus RNA polymerase gene, the '4404-50 motif'. NC-motifs have been found in other sets of homologous sequences, and are convenient for use in published taxonomic descriptions.

  3. Polyimides comprising substituted benzidines

    NASA Technical Reports Server (NTRS)

    Harris, Frank W. (Inventor)

    1991-01-01

    A new class of polyimides and copolyimides made from substituted benzidines and aromatic dianhydrides and other aromatic diamines. The polyimides obtained with said diamines are distinguished by excellent thermal, excellent solubility, excellent electrical properties such as very low dielectric constants, excellent clarity and mechanical properties making the polyimides ideally suited as coating materials for microelectronic apparatii, as membranes for selective molecular or gas separation, as fibers in molecular composites, as high tensile strength, high compression strength fibers, as film castable coatings, or as fabric components.

  4. Dynamic Nucleotide Mutation Gradients and Control Region Usage in Squamate Reptile Mitochondrial Genomes

    PubMed Central

    Castoe, T.A.; Gu, W.; de Koning, A.P.J.; Daza, J.M.; Jiang, Z.J.; Parkinson, C.L.; Pollock, D.D.

    2010-01-01

    Gradients of nucleotide bias and substitution rates occur in vertebrate mitochondrial genomes due to the asymmetric nature of the replication process. The evolution of these gradients has previously been studied in detail in primates, but not in other vertebrate groups. From the primate study, the strengths of these gradients are known to evolve in ways that can substantially alter the substitution process, but it is unclear how rapidly they evolve over evolutionary time or how different they may be in different lineages or groups of vertebrates. Given the importance of mitochondrial genomes in phylogenetics and molecular evolutionary research, a better understanding of how asymmetric mitochondrial substitution gradients evolve would contribute key insights into how this gradient evolution may mislead evolutionary inferences, and how it may also be incorporated into new evolutionary models. Most snake mitochondrial genomes have an additional interesting feature, 2 nearly identical control regions, which vary among different species in the extent that they are used as origins of replication. Given the expanded sampling of complete snake genomes currently available, together with 2 additional snakes sequenced in this study, we reexamined gradient strength and CR usage in alethinophidian snakes as well as several lizards that possess dual CRs. Our results suggest that nucleotide substitution gradients (and corresponding nucleotide bias) and CR usage is highly labile over the ∼200 m.y. of squamate evolution, and demonstrates greater overall variability than previously shown in primates. The evidence for the existence of such gradients, and their ability to evolve rapidly and converge among unrelated species suggests that gradient dynamics could easily mislead phylogenetic and molecular evolutionary inferences, and argues strongly that these dynamics should be incorporated into phylogenetic models. PMID:20215734

  5. regSNPs: a strategy for prioritizing regulatory single nucleotide substitutions

    PubMed Central

    Teng, Mingxiang; Ichikawa, Shoji; Padgett, Leah R.; Wang, Yadong; Mort, Matthew; Cooper, David N.; Koller, Daniel L.; Foroud, Tatiana; Edenberg, Howard J.; Econs, Michael J.; Liu, Yunlong

    2012-01-01

    Motivation: One of the fundamental questions in genetics study is to identify functional DNA variants that are responsible to a disease or phenotype of interest. Results from large-scale genetics studies, such as genome-wide association studies (GWAS), and the availability of high-throughput sequencing technologies provide opportunities in identifying causal variants. Despite the technical advances, informatics methodologies need to be developed to prioritize thousands of variants for potential causative effects. Results: We present regSNPs, an informatics strategy that integrates several established bioinformatics tools, for prioritizing regulatory SNPs, i.e. the SNPs in the promoter regions that potentially affect phenotype through changing transcription of downstream genes. Comparing to existing tools, regSNPs has two distinct features. It considers degenerative features of binding motifs by calculating the differences on the binding affinity caused by the candidate variants and integrates potential phenotypic effects of various transcription factors. When tested by using the disease-causing variants documented in the Human Gene Mutation Database, regSNPs showed mixed performance on various diseases. regSNPs predicted three SNPs that can potentially affect bone density in a region detected in an earlier linkage study. Potential effects of one of the variants were validated using luciferase reporter assay. Contact: yunliu@iupui.edu Supplementary information: Supplementary data are available at Bioinformatics online PMID:22611130

  6. One single nucleotide difference alters the differential expression of spliced RNAs between HBV genotypes A and D.

    PubMed

    Huang, Chien-Chiao; Kuo, Tzer-Min; Yeh, Chau-Ting; Hu, Cheng-Po; Chen, Ya-Ling; Tsai, Yue-Lin; Chen, Mong-Liang; Chou, Yu-Chi; Chang, Chungming

    2013-06-01

    Hepatitis B virus (HBV) is generally classified into eight genotypes (A to H) based on genomic sequence divergence. The sequence variation among the different HBV genotypes suggests that the spliced RNAs should be different from genotype to genotype. However, the cis-acting element involved in the modulation of the distinct expression profiles of spliced HBV RNAs remains unidentified. Moreover, the biological role of splicing in the life cycle of HBV is not yet understood. In this study, spliced RNAs generated from genotypes A and D were carefully characterized in transfected HepG2 cells. The species and frequency of the spliced RNAs were dramatically different in the two genotypes. Of note, a population of multiply spliced RNAs with intron 2067-2350 excision was identified in HBV genotype A-transfected HepG2 cells, but not in genotype D transfected HepG2 cells. Further, we found a single nucleotide difference (2335) located within the polypyrimidine tract of the splice acceptor site 2350 between the two genotypes, and a single base substitution at 2335 was able to convert the splicing pattern of genotype D (or genotype A) to that of genotype A (or genotype D). These findings suggest that different unique splice sites may be preferentially used in different HBV genotypes resulting in distinct populations of spliced RNAs. The possible significance of the distinct spliced RNAs generated from the different HBV genotypes in HBV infection is discussed. Copyright © 2013. Published by Elsevier B.V.

  7. Multifaceted Material Substitution: The Case of NdFeB Magnets, 2010-2015

    NASA Astrophysics Data System (ADS)

    Smith, Braeton J.; Eggert, Roderick G.

    2016-07-01

    Substitution is an important response for material users when faced with disruption to the availability or price of an essential material. In economic terms, substitution refers to the ability of firms to alter their patterns of material use in response to exogenous market shocks. Substitution comes in different forms which vary from situation to situation. This paper uses expert opinion to identify the specific forms of substitution that occurred in permanent magnets, specifically neodymium-iron-boron magnets, following the significant increase in rare earth prices in 2010-2011. The paper provides a framework for understanding the multifaceted nature of substitution and assesses the relative importance of five different types of substitution. Technology-for-element, grade-for-grade, and system-for-system substitution appear to have been more important than element-for-element and magnet-for-magnet substitution. Cost pass-through and absorption were also important responses.

  8. SVOP Is a Nucleotide Binding Protein

    PubMed Central

    Yao, Jia; Bajjalieh, Sandra M.

    2009-01-01

    Background Synaptic Vesicle Protein 2 (SV2) and SV2-related protein (SVOP) are transporter-like proteins that localize to neurotransmitter-containing vesicles. Both proteins share structural similarity with the major facilitator (MF) family of small molecule transporters. We recently reported that SV2 binds nucleotides, a feature that has also been reported for another MF family member, the human glucose transporter 1 (Glut1). In the case of Glut1, nucleotide binding affects transport activity. In this study, we determined if SVOP also binds nucleotides and assessed its nucleotide binding properties. Methodology/Principal Findings We performed in vitro photoaffinity labeling experiments with the photoreactive ATP analogue, 8-azido-ATP[γ] biotin and purified recombinant SVOP-FLAG fusion protein. We found that SVOP is a nucleotide-binding protein, although both its substrate specificity and binding site differ from that of SV2. Within the nucleotides tested, ATP, GTP and NAD show same level of inhibition on SVOP-FLAG labeling. Dose dependent studies indicated that SVOP demonstrates the highest affinity for NAD, in contrast to SV2, which binds both NAD and ATP with equal affinity. Mapping of the binding site revealed a single region spanning transmembrane domains 9–12, which contrasts to the two binding sites in the large cytoplasmic domains in SV2A. Conclusions/Significance SVOP is the third MF family member to be found to bind nucleotides. Given that the binding sites are unique in SVOP, SV2 and Glut1, this feature appears to have arisen separately. PMID:19390693

  9. Substituted hydroxyapatites for bone repair.

    PubMed

    Shepherd, Jennifer H; Shepherd, David V; Best, Serena M

    2012-10-01

    Calcium phosphates such as hydroxyapatite have a wide range of applications both in bone grafts and for the coating of metallic implants, largely as a result of their chemical similarity to the mineral component of bone. However, to more accurately mirror the chemistry, various substitutions, both cationic (substituting for the calcium) and anionic (substituting for the phosphate or hydroxyl groups) have been produced. Significant research has been carried out in the field of substituted apatites and this paper aims to summarise some of the key effect of substitutions including magnesium, zinc, strontium, silicon and carbonate on physical and biological characteristics. Even small substitutions have been shown to have very significant effects on thermal stability, solubility, osteoclastic and osteoblastic response in vitro and degradation and bone regeneration in vivo.

  10. Cyclic nucleotide phosphodiesterases (PDEs): coincidence detectors acting to spatially and temporally integrate cyclic nucleotide and non-cyclic nucleotide signals.

    PubMed

    Maurice, Donald H; Wilson, Lindsay S; Rampersad, Sarah N; Hubert, Fabien; Truong, Tammy; Kaczmarek, Milosz; Brzezinska, Paulina; Freitag, Silja I; Umana, M Bibiana; Wudwud, Alie

    2014-04-01

    The cyclic nucleotide second messengers cAMP and cGMP each affect virtually all cellular processes. Although these hydrophilic small molecules readily diffuse throughout cells, it is remarkable that their ability to activate their multiple intracellular effectors is spatially and temporally selective. Studies have identified a critical role for compartmentation of the enzymes which hydrolyse and metabolically inactivate these second messengers, the PDEs (cyclic nucleotide phosphodiesterases), in this specificity. In the present article, we describe several examples from our work in which compartmentation of selected cAMP- or cGMP-hydrolysing PDEs co-ordinate selective activation of cyclic nucleotide effectors, and, as a result, selectively affect cellular functions. It is our belief that therapeutic strategies aimed at targeting PDEs within these compartments will allow greater selectivity than those directed at inhibiting these enzymes throughout the cells.

  11. Multifunctionality of a Picornavirus Polymerase Domain: Nuclear Localization Signal and Nucleotide Recognition

    PubMed Central

    Ferrer-Orta, Cristina; de la Higuera, Ignacio; Caridi, Flavia; Sánchez-Aparicio, María Teresa; Moreno, Elena; Perales, Celia; Singh, Kamalendra; Sarafianos, Stefan G.; Sobrino, Francisco; Domingo, Esteban

    2015-01-01

    ABSTRACT The N-terminal region of the foot-and-mouth disease virus (FMDV) 3D polymerase contains the sequence MRKTKLAPT (residues 16 to 24) that acts as a nuclear localization signal. A previous study showed that substitutions K18E and K20E diminished the transport to the nucleus of 3D and 3CD and severely impaired virus infectivity. These residues have also been implicated in template binding, as seen in the crystal structures of different 3D-RNA elongation complexes. Here, we report the biochemical and structural characterization of different mutant polymerases harboring substitutions at residues 18 and 20, in particular, K18E, K18A, K20E, K20A, and the double mutant K18A K20A (KAKA). All mutant enzymes exhibit low RNA binding activity, low processivity, and alterations in nucleotide recognition, including increased incorporation of ribavirin monophosphate (RMP) relative to the incorporation of cognate nucleotides compared with the wild-type enzyme. The structural analysis shows an unprecedented flexibility of the 3D mutant polymerases, including both global rearrangements of the closed-hand architecture and local conformational changes at loop β9-α11 (within the polymerase motif B) and at the template-binding channel. Specifically, in 3D bound to RNA, both K18E and K20E induced the opening of new pockets in the template channel where the downstream templating nucleotide at position +2 binds. The comparisons of free and RNA-bound enzymes suggest that the structural rearrangements may occur in a concerted mode to regulate RNA replication, processivity, and fidelity. Thus, the N-terminal region of FMDV 3D that acts as a nuclear localization signal (NLS) and in template binding is also involved in nucleotide recognition and can affect the incorporation of nucleotide analogues. IMPORTANCE The study documents multifunctionality of a nuclear localization signal (NLS) located at the N-terminal region of the foot-and-mouth disease viral polymerase (3D). Amino acid

  12. Nucleotide triphosphates are required for the transport of glycolate oxidase into peroxisomes.

    PubMed

    Brickner, D G; Olsen, L J

    1998-01-01

    All peroxisomal proteins are nuclear encoded, synthesized on free cytosolic ribosomes, and posttranslationally targeted to the organelle. We have used an in vitro assay to reconstitute protein import into pumpkin (Cucurbita pepo) glyoxysomes, a class of peroxisome found in the cotyledons of oilseed plants, to study the mechanisms involved in protein transport across peroxisome membranes. Results indicate that ATP hydrolysis is required for protein import into peroxisomes; nonhydrolyzable analogs of ATP could not substitute for this requirement. Nucleotide competition studies suggest that there may be a nucleotide binding site on a component of the translocation machinery. Peroxisomal protein import also was supported by GTP hydrolysis. Nonhydrolyzable analogs of GTP did not substitute in this process. Experiments to determine the cation specificity of the nucleotide requirement show that the Mg2+ salt was preferred over other divalent and monovalent cations. The role of a putative protonmotive force across the peroxisomal membrane was also examined. Although low concentrations of ionophores had no effect on protein import, relatively high concentrations of all ionophores tested consistently reduced the level of protein import by approximately 50%. This result suggests that a protonmotive force is not absolutely required for peroxisomal protein import.

  13. Explicit Substitutions and All That

    NASA Technical Reports Server (NTRS)

    Ayala-Rincon, Mauricio; Munoz, Cesar

    2000-01-01

    Explicit substitution calculi are extensions of the lambda-calculus where the substitution mechanism is internalized into the theory. This feature makes them suitable for implementation and theoretical study of logic-based tools such as strongly typed programming languages and proof assistant systems. In this paper we explore new developments on two of the most successful styles of explicit substitution calculi: the lambda sigma- and lambda S(e)-calculi.

  14. Explicit Substitutions and All That

    NASA Technical Reports Server (NTRS)

    Ayala-Rincon, Mauricio; Munoz, Cesar; Busnell, Dennis M. (Technical Monitor)

    2000-01-01

    Explicit substitution calculi are extensions of the Lambda-calculus where the substitution mechanism is internalized into the theory. This feature makes them suitable for implementation and theoretical study of logic-based tools such as strongly typed programming languages and proof assistant systems. In this paper we explore new developments on two of the most successful styles of explicit substitution calculi: the lambda(sigma)- and lambda(s(e))-calculi.

  15. Why so many noncoding nucleotides? The eukaryote genome as an epigenetic machine.

    PubMed

    Zuckerkandl, Emile

    2002-05-01

    It is recalled that dispensability of sequences and neutral substitution rate must not be construed to be markers of nonfunctionality. Different aspects of functionality relate to differently-sized nucleotide communities. At the time cells became nucleated, a boom of epigenetic processes led to uses of DNA that required many more nucleotides operating collectively than do functions definable in terms of classical genetics. Each order of magnitude of nucleotide plurality was colonized by functions germane to that order. The eukaryote genome became a great epigenetic machine. Sequences of different levels of nucleotide plurality are briefly discussed from the point of view of their functional relevance. By their activities as both transcribed genes and cis-acting repeats, SINEs and LINEs are the principal link between genetic and epigenetic processes. SINEs can act as local repeats to produce position effect variegation (PEV) in a nearby gene. PEV may thus represent a general method of overall transcriptional regulation at the level of cell collectivities. When tracking the scale dependence of nucleotide function, one finds the 100 kb order of nucleotide plurality to provide epigenetically the basis at once for PEV, imprinting, and cell determination, with sectorial repressibility a trait common to the three. In sectorial repressibility, introns may play a structural role favoring the stability of higher-order chromatin structures. At that level of nucleotide involvement, nonconserved nonhomologous nonprotein-coding sequences may often play the same structural roles. In addition, genomic distance per se--and, therefore, the mass of intervening nucleotides--can have functional effects. Distances between enhancers and promoters need to be probed in this respect. At the 1,000 kb level of nucleotide function, attention is focused on the formation of centromeres. It is one of the levels of nucleotide plurality per function where specificity in the generation of DNA

  16. Are substitution rates and RNA editing correlated?

    PubMed Central

    2010-01-01

    Background RNA editing is a post-transcriptional process that, in seed plants, involves a cytosine to uracil change in messenger RNA, causing the translated protein to differ from that predicted by the DNA sequence. RNA editing occurs extensively in plant mitochondria, but large differences in editing frequencies are found in some groups. The underlying processes responsible for the distribution of edited sites are largely unknown, but gene function, substitution rate, and gene conversion have been proposed to influence editing frequencies. Results We studied five mitochondrial genes in the monocot order Alismatales, all showing marked differences in editing frequencies among taxa. A general tendency to lose edited sites was observed in all taxa, but this tendency was particularly strong in two clades, with most of the edited sites lost in parallel in two different areas of the phylogeny. This pattern is observed in at least four of the five genes analyzed. Except in the groups that show an unusually low editing frequency, the rate of C-to-T changes in edited sites was not significantly higher that in non-edited 3rd codon positions. This may indicate that selection is not actively removing edited sites in nine of the 12 families of the core Alismatales. In all genes but ccmB, a significant correlation was found between frequency of change in edited sites and synonymous substitution rate. In general, taxa with higher substitution rates tend to have fewer edited sites, as indicated by the phylogenetically independent correlation analyses. The elimination of edited sites in groups that lack or have reduced levels of editing could be a result of gene conversion involving a cDNA copy (retroprocessing). If so, this phenomenon could be relatively common in the Alismatales, and may have affected some groups recurrently. Indirect evidence of retroprocessing without a necessary correlation with substitution rate was found mostly in families Alismataceae and Hydrocharitaceae

  17. Proofreading of misincorporated nucleotides in DNA transcription

    NASA Astrophysics Data System (ADS)

    Voliotis, Margaritis; Cohen, Netta; Molina-París, Carmen; Liverpool, Tanniemola B.

    2012-06-01

    The accuracy of DNA transcription is crucial for the proper functioning of the cell. Although RNA polymerases demonstrate selectivity for correct nucleotides, additional active mechanisms of transcriptional error correction are required to achieve observed levels of fidelity. Recent experimental findings have shed light on a particular mechanism of transcriptional error correction involving: (i) diffusive translocation of the RNA polymerase along the DNA (backtracking) and (ii) irreversible RNA cleavage. This mechanism achieves preferential cleavage of misincorporated nucleotides by biasing the local rates of translocation. Here, we study how misincorporated nucleotides affect backtracking dynamics and how this effect determines the level of transcriptional fidelity. We consider backtracking as a diffusive process in a periodic, one-dimensional energy landscape, which at a coarse-grained level gives rise to a hopping process between neighboring local minima. We propose a model for how misincorporated nucleotides deform this energy landscape and hence affect the hopping rates. In particular, we show that this model can be used to derive both the theoretical limit on the fidelity (i.e. the minimum fraction of misincorporated nucleotides) and the actual fidelity relative to this optimum, achieved for specific combinations of the cleavage and polymerization rates. Finally, we study how external factors influencing backtracking dynamics affect transcriptional fidelity. We show that biologically relevant loads, similar to those exerted by nucleosomes or other transcriptional barriers, increase error correction.

  18. Proofreading of misincorporated nucleotides in DNA transcription

    NASA Astrophysics Data System (ADS)

    Voliotis, Margaritis; Cohen, Netta; Molina-París, Carmen; Liverpool, Tanniemola B.

    2012-06-01

    The accuracy of DNA transcription is crucial for the proper functioning of the cell. Although RNA polymerases demonstrate selectivity for correct nucleotides, additional active mechanisms of transcriptional error correction are required to achieve observed levels of fidelity. Recent experimental findings have shed light on a particular mechanism of transcriptional error correction involving: (i) diffusive translocation of the RNA polymerase along the DNA (backtracking) and (ii) irreversible RNA cleavage. This mechanism achieves preferential cleavage of misincorporated nucleotides by biasing the local rates of translocation. Here, we study how misincorporated nucleotides affect backtracking dynamics and how this effect determines the level of transcriptional fidelity. We consider backtracking as a diffusive process in a periodic, one-dimensional energy landscape, which at a coarse-grained level gives rise to a hopping process between neighbouring local minima. We propose a model for how misincorporated nucleotides deform this energy landscape and hence affect the hopping rates. In particular, we show that this model can be used to derive both the theoretical limit on the fidelity (i.e. the minimum fraction of misincorporated nucleotides) and the actual fidelity relative to this optimum, achieved for specific combinations of the cleavage and polymerization rates. Finally, we study how external factors influencing backtracking dynamics affect transcriptional fidelity. We show that biologically relevant loads, similar to those exerted by nucleosomes or other transcriptional barriers, increase error correction.

  19. Vesicular nucleotide transporter regulates the nucleotide content in airway epithelial mucin granules

    PubMed Central

    Sesma, Juliana I.; Kreda, Silvia M.; Okada, Seiko F.; van Heusden, Catharina; Moussa, Lama; Jones, Lisa C.; O'Neal, Wanda K.; Togawa, Natsuko; Hiasa, Miki; Moriyama, Yoshinori

    2013-01-01

    Nucleotides within the airway surface liquid promote fluid secretion via activation of airway epithelial purinergic receptors. ATP is stored within and released from mucin granules as co-cargo with mucins, but the mechanism by which ATP, and potentially other nucleotides, enter the lumen of mucin granules is not known. We assessed the contribution of the recently identified SLC17A9 vesicle nucleotide transporter (VNUT) to the nucleotide availability within isolated mucin granules and further examined the involvement of VNUT in mucin granule secretion-associated nucleotide release. RT-PCR and Western blot analyses indicated that VNUT is abundantly expressed in airway epithelial goblet-like Calu-3 cells, migrating as a duplex with apparent mobility of 55 and 60 kDa. Subcellular fractionation studies indicated that VNUT55 was associated with high-density mucin granules, whereas VNUT60 was associated with low-density organelles. Immunofluorescence studies showed that recombinant VNUT localized to mucin granules and other organelles. Mucin granules isolated from VNUT short hairpin RNA-expressing cells exhibited a marked reduction of ATP, ADP, AMP, and UTP levels within granules. Ca2+-regulated vesicular ATP release was markedly reduced in these cells, but mucin secretion was not affected. These results suggest that VNUT is the relevant nucleotide transporter responsible for the uptake of cytosolic nucleotides into mucin granules. By controlling the entry of nucleotides into mucin granules, VNUT contributes to the release of purinergic signaling molecules necessary for the proper hydration of co-released mucins. PMID:23467297

  20. Vesicular nucleotide transporter regulates the nucleotide content in airway epithelial mucin granules.

    PubMed

    Sesma, Juliana I; Kreda, Silvia M; Okada, Seiko F; van Heusden, Catharina; Moussa, Lama; Jones, Lisa C; O'Neal, Wanda K; Togawa, Natsuko; Hiasa, Miki; Moriyama, Yoshinori; Lazarowski, Eduardo R

    2013-05-15

    Nucleotides within the airway surface liquid promote fluid secretion via activation of airway epithelial purinergic receptors. ATP is stored within and released from mucin granules as co-cargo with mucins, but the mechanism by which ATP, and potentially other nucleotides, enter the lumen of mucin granules is not known. We assessed the contribution of the recently identified SLC17A9 vesicle nucleotide transporter (VNUT) to the nucleotide availability within isolated mucin granules and further examined the involvement of VNUT in mucin granule secretion-associated nucleotide release. RT-PCR and Western blot analyses indicated that VNUT is abundantly expressed in airway epithelial goblet-like Calu-3 cells, migrating as a duplex with apparent mobility of 55 and 60 kDa. Subcellular fractionation studies indicated that VNUT55 was associated with high-density mucin granules, whereas VNUT60 was associated with low-density organelles. Immunofluorescence studies showed that recombinant VNUT localized to mucin granules and other organelles. Mucin granules isolated from VNUT short hairpin RNA-expressing cells exhibited a marked reduction of ATP, ADP, AMP, and UTP levels within granules. Ca(2+)-regulated vesicular ATP release was markedly reduced in these cells, but mucin secretion was not affected. These results suggest that VNUT is the relevant nucleotide transporter responsible for the uptake of cytosolic nucleotides into mucin granules. By controlling the entry of nucleotides into mucin granules, VNUT contributes to the release of purinergic signaling molecules necessary for the proper hydration of co-released mucins.

  1. Nucleotide variability in the 5-enolpyruvylshikimate-3-phosphate synthase gene from Eleusine indica (L.) Gaertn.

    PubMed

    Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S

    2008-02-01

    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.

  2. Nucleotide Metabolism in Salt-Stressed Zea mays L. Root Tips: I. Adenine and Uridine Nucleotides.

    PubMed

    Peterson, T A; Nieman, R H; Clark, R A

    1987-12-01

    Corn plants (Zea mays L. cv Pioneer 3906) were grown in a glass house on control and saline nutrient solutions, in winter and summer. There were two saline treatments, both with osmotic potential = -0.4 megapascal but with different Ca(2+)/Na(+) ratios: 0.03 and 0.73. Root tips and shoot meristems (culm tissue) of 26 day-old plants were analyzed for nucleotides to ascertain if there were correlations between nucleotide pool size and the reduced growth on saline cultures. Several other cell components also were determined. Plants grown in winter were only half as large as those grown in summer mainly because of the lower light intensity and lower temperature. But the relative yield reduction on salt treatment compared to the control was similar in winter and summer. The two different salt treatments caused similar yield reductions. Neither salt treatment affected nucleotide pools in culm tissue, with the possible exception of UDPG in winter. In the case of root tips, salt treatment had little or no effect on nucleotide pool sizes in winter when many already seemed near a critical minimum, but in summer it reduced several pools including ATP, total adenine nucleotide, UTP, total uridine nucleotide, and UDP-glucose. The reductions were greatest on the salt treatment with low Ca(2+)/Na(+). There was no simple correlation between the effects of salt stress on growth and on nucleotide pool size. The nucleotide pools of culm tissue indicated that in some respects this tissue was effectively insulated from the salt stress. Roots that were in direct contact with the saline solution indicated significant reductions in nucleotide pools only in the summer whereas growth was reduced both summer and winter. It is possible that the nucleotide concentrations of root cells in winter were already near a critical minimum so that nucleotide synthesis and growth were tightly linked. Significant reductions in nucleotide pools that would be expected to affect growth were more evident in

  3. The International Nucleotide Sequence Database Collaboration

    PubMed Central

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Takagi, Toshihisa; Sequence Database Collaboration, International Nucleotide

    2016-01-01

    The International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org) comprises three global partners committed to capturing, preserving and providing comprehensive public-domain nucleotide sequence information. The INSDC establishes standards, formats and protocols for data and metadata to make it easier for individuals and organisations to submit their nucleotide data reliably to public archives. This work enables the continuous, global exchange of information about living things. Here we present an update of the INSDC in 2015, including data growth and diversification, new standards and requirements by publishers for authors to submit their data to the public archives. The INSDC serves as a model for data sharing in the life sciences. PMID:26657633

  4. Single nucleotide polymorphisms of mucosa-associated lymphoid tissue 1 in oral carcinoma cells and gingival fibroblasts.

    PubMed

    Oyama, Go; Midorikawa, Toshiaki; Matsumoto, Yasutaka; Takeyama, Mayu; Yamada, Kenji; Nozawa, Takaomi; Morikawa, Masako; Imai, Kazushi

    2013-07-01

    Oral carcinoma patients with inactivation of mucosa-associated lymphoid tissue 1 (MALT1) expression worsen their prognoses. Although the genetic mutation could be responsible for the inactivation, no information is available at present. In the present study, genomic DNA of oral carcinoma cells (HOC313, TSU, HSC2, HSC3, KOSC2, KOSC3, SCCKN, OSC19, Ca9.22, and Ho1u1 cells) and normal gingival fibroblasts (GF12 cells) derived from a Japanese population were amplified by polymerase chain reaction using primer sets spanning MALT1 exons, and nucleotide substitutions were analyzed by the single strand conformation polymorphism analysis. The substitutions were commonly observed in all cells, which express MALT1 at various levels. The substitutions at exons 1 and 9 were located at the 5' untranslated region and replaced (336)Asp to Asn, respectively, and others were positioned at the introns. Among the intronic substitutions, four were matched with the single nucleotide polymorphisms (SNPs) registered at the database. Since all cells were derived from a Japanese population, all substitutions detected are the SNPs. Absence of the carcinoma cell-specific mutation suggests that the inactivation of MALT1 expression but not the mutation promotes oral carcinoma progression.

  5. Halogen substituents on the aromatic moiety of the tetracaine scaffold improve potency of cyclic nucleotide-gated channel block.

    PubMed

    Kirk, Sarah R; Andrade, Adriana L; Melich, Kenneth; Jackson, Evan P; Cuellar, Elysia; Karpen, Jeffrey W

    2011-11-01

    A series of new tetracaine derivatives with substituents on the aromatic ring was prepared and evaluated for block of retinal rod cyclic nucleotide-gated (CNG) channels. Aromatic substitutions had little effect starting with the basic tetracaine scaffold, but electron-withdrawing substituents significantly improved the blocking potency of an octyl-tail derivative of tetracaine. In particular, halogen substitutions at either the 2- or 3-position on the ring resulted in compounds that were up to eight-fold more potent than the parent octyl-tail derivative and up to 50-fold more potent than tetracaine.

  6. Halogen substituents on the aromatic moiety of the tetracaine scaffold improve potency of cyclic nucleotide-gated channel block

    PubMed Central

    Kirk, Sarah R.; Andrade, Adriana L.; Melich, Kenneth; Jackson, Evan P.; Cuellar, Elysia; Karpen, Jeffrey W.

    2011-01-01

    A series of new tetracaine derivatives with substituents on the aromatic ring was prepared and evaluated for block of retinal rod cyclic nucleotide-gated (CNG) channels. Aromatic substitutions had little effect starting with the basic tetracaine scaffold, but electron-withdrawing substituents significantly improved the blocking potency of an octyl-tail derivative of tetracaine. In particular, halogen substitutions at either the 2- or 3-position on the ring resulted in compounds that were up to 8-fold more potent than the parent octyl-tail derivative and up to 50-fold more potent than tetracaine. PMID:21944857

  7. RsiteDB: a database of protein binding pockets that interact with RNA nucleotide bases.

    PubMed

    Shulman-Peleg, Alexandra; Nussinov, Ruth; Wolfson, Haim J

    2009-01-01

    We present a new database and an on-line search engine, which store and query the protein binding pockets that interact with single-stranded RNA nucleotide bases. The database consists of a classification of binding sites derived from protein-RNA complexes. Each binding site is assigned to a cluster of similar binding sites in other protein-RNA complexes. Cluster members share similar spatial arrangements of physico-chemical properties, thus can reveal novel similarity between proteins and RNAs with different sequences and folds. The clusters provide 3D consensus binding patterns important for protein-nucleotide recognition. The database search engine allows two types of useful queries: first, given a PDB code of a protein-RNA complex, RsiteDB can detail and classify the properties of the protein binding pockets accommodating extruded RNA nucleotides not involved in local RNA base pairing. Second, given an unbound protein structure, RsiteDB can perform an on-line structural search against the constructed database of 3D consensus binding patterns. Regions similar to known patterns are predicted to serve as binding sites. Alignment of the query to these patterns with their corresponding RNA nucleotides allows making unique predictions of the protein-RNA interactions at the atomic level of detail. This database is accessible at http://bioinfo3d.cs.tau.ac.il/RsiteDB.

  8. The International Nucleotide Sequence Database Collaboration.

    PubMed

    Nakamura, Yasukazu; Cochrane, Guy; Karsch-Mizrachi, Ilene

    2013-01-01

    The International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), one of the longest-standing global alliances of biological data archives, captures, preserves and provides comprehensive public domain nucleotide sequence information. Three partners of the INSDC work in cooperation to establish formats for data and metadata and protocols that facilitate reliable data submission to their databases and support continual data exchange around the world. In this article, the INSDC current status and update for the year of 2012 are presented. Among discussed items of international collaboration meeting in 2012, BioSample database and changes in submission are described as topics.

  9. Displacement, Substitution, Sublimation: A Bibliography.

    ERIC Educational Resources Information Center

    Pedrini, D. T.; Pedrini, Bonnie C.

    Sigmund Freund worked with the mechanisms of displacement, substitution, and sublimation. These mechanisms have many similarities and have been studied diagnostically and therapeutically. Displacement and substitution seem to fit in well with phobias, hysterias, somatiyations, prejudices, and scapegoating. Phobias, prejudices, and scapegoating…

  10. Substitute Teachers: The Professional Contradiction.

    ERIC Educational Resources Information Center

    Shreeve, William C.; And Others

    The substitute teacher's public image was investigated by means of an informal survey of part-time and full-time teachers in Washington. Survey results revealed that working conditions appeared to be the largest factor in damaging the self-image of most substitute teachers. The majority of full-time teachers and administrators surveyed were…

  11. Substitution in recreation choice behavior

    Treesearch

    George L. Peterson; Daniel J. Stynes; Donald H. Rosenthal; John F. Dwyer

    1985-01-01

    This review discusses concepts and theories of substitution in recreation choice. It brings together the literature of recreation research, psychology, geography, economics, and transportation. Parallel and complementary developments need integration into an improved theory of substitution. Recreation decision behavior is characterized as a nested or sequential choice...

  12. Formative Assessment for Substitute Teachers.

    ERIC Educational Resources Information Center

    Shepherd, Ron

    2001-01-01

    Describes one school district's mandatory 2-hour workshop designed to certify substitute teachers. The workshop explains the district's expectations of substitute teachers, provides information and instructional techniques to facilitate learning and proper classroom control, and allows questions and concerns to be raised and clarified by…

  13. Novel interactions of fluorinated nucleotide derivatives targeting orotidine-5′-monophosphate decarboxylase

    PubMed Central

    Lewis, Melissa; Avina, Maria Elena Meza; Wei, Lianhu; Crandall, Ian E.; Bello, Angelica Mara; Poduch, Ewa; Liu, Yan; Paige, Christopher J.; Kain, Kevin C.; Pai, Emil F.; Kotra, Lakshmi P.

    2011-01-01

    Fluorinated nucleosides and nucleotides are of considerable interest to medicinal chemists due to their antiviral, anticancer, and other biological activities. However, their direct interactions at target binding sites are not well understood. A new class of 2′-deoxy-2′-fluoro-C6-substituted uridine and UMP derivatives were synthesized and evaluated as inhibitors of orotidine-5′-monophosphate decarboxylase (ODCase). These compounds were synthesized from the key intermediate, fully-protected 2′-deoxy-2′-fluorouridine. Among the synthesized compounds, 2′-deoxy-2′-fluoro-6-iodo-UMP covalently inhibited human ODCase with a second-order rate constant of 0.62 ± 0.02 M−1sec−1. Interestingly, the 6-cyano-2′-fluoro derivative covalently interacted with ODCase defying the conventional thinking, where its ribosyl derivative undergoes transformation into BMP by ODCase. This confirms that the 2′-fluoro moiety influences the chemistry at the C6 position of the nucleotides, thus interactions in the active site of ODCase. Molecular interactions of the 2′-fluorinated nucleotides are compared to those with the 3′-fluorinated nucleotides bound to the corresponding target enzyme, and the carbohydrate moieties were shown to bind in different conformations. PMID:21417464

  14. A new single nucleotide polymorphism in the ryanodine gene of chicken skeletal muscle.

    PubMed

    Droval, A A; Binneck, E; Marin, S R R; Paião, F G; Oba, A; Nepomuceno, A L; Shimokomaki, M

    2012-04-03

    Some genes affect meat quality in chickens. We looked for polymorphisms in the Gallus gallus α-RyR gene (homologous to RyR 1) that could be associated with PSE (pale, soft and exudative) meat. Because RyR genes are over 100,000 bp long and code for proteins with about 5000 amino acids, primers were designed to amplify a fragment of hotspot region 2, a region with a high density of mutations in other species. Total blood DNA was extracted from 50 birds, 25 that had PSE meat and 25 normal chickens. The DNA samples were amplified by PCR, cloned, sequenced, and used to identify single nucleotide polymorphisms (SNPs). The amplified fragment of α-RyR was 604 nucleotides in length; 181 nucleotides were similar to two exons from a hypothetical turkey cDNA sequence for α-RyR. A non-synonymous nucleotide substitution (G/A) was identified in at least one of the three sequenced clones obtained from nine animals, six PSE (HAL+) birds and three normal (HAL-) birds; they were heterozygous for this mutation. This SNP causes a change from Val to Met in the α-RYR protein. Since the frequencies of this SNP were not significantly different in the PSE versus normal chickens, it appears that this mutation (in heterozygosity) does not alter the structure or function of the muscle protein, making it an inappropriate candidate as a genetic marker for PSE meat.

  15. In vitro bypass of UV-induced lesions by Escherichia coli DNA polymerase I: specificity of nucleotide incorporation

    SciTech Connect

    Rabkin, S.D.; Moore, P.D.; Strauss, B.D.

    1983-03-01

    A variety of DNA polymerases, synthesizing in vitro on an UV-irradiated phiX174 DNA template, terminate synthesis one nucleotide before the 3' pyrimidines of putative dimers on the template. We have devised a system using Escherichia coli DNA polymerase I (Klenow fragment) that can synthesize past at least some of these dimers. The bypass is carried out in a multistep process--first, the incorporation of nucleotides opposite the pyrimidines in the dimer and, then, the addition of nucleotides complementary to the bases distal to the dimer. The insertion of a nucleotide opposite the first (3') pryimidine of a putative dimer in the presence of Mn/sup 2 +/ occurs in a concentration-dependent fashion with a 3- to 4-fold preference for purine nucleotides over pyrimidine nucleotides. In the presence of Mg/sup 2 +/, insertion is less frequent. Correlation of these results with in vivo mutation data suggests a role for the polymerase in determining the spectrum of base substitution mutagenesis in SOS induced cells.

  16. Reprogramming the purine nucleotide cofactor requirement of Drosophila P element transposase in vivo.

    PubMed Central

    Mul, Y M; Rio, D C

    1997-01-01

    Guanosine triphosphate (GTP)-binding proteins are involved in controlling a wide range of fundamental cellular processes. In vitro studies have indicated a role for GTP during Drosophila P element transposition. Here we show that P element transposase contains a non-canonical GTP-binding domain that is critical for its ability to mediate transposition in Drosophila cells. Moreover, a single amino acid substitution could switch the nucleotide binding-specificity of transposase from GTP to xanthosine triphosphate (XTP). Importantly, this mutant protein could no longer function effectively in transposition in vivo but required addition of exogenous xanthine or xanthosine for reactivation. These results suggest that transposition may be controlled by physiological GTP levels and demonstrate that a single mutation can switch the nucleotide specificity for a complex cellular process in vivo. PMID:9250688

  17. Asymmetric Context-Dependent Mutation Patterns Revealed through Mutation–Accumulation Experiments

    PubMed Central

    Sung, Way; Ackerman, Matthew S.; Gout, Jean-François; Miller, Samuel F.; Williams, Emily; Foster, Patricia L.; Lynch, Michael

    2015-01-01

    Despite the general assumption that site-specific mutation rates are independent of the local sequence context, a growing body of evidence suggests otherwise. To further examine context-dependent patterns of mutation, we amassed 5,645 spontaneous mutations in wild- type (WT) and mismatch-repair deficient (MMR–) mutation–accumulation (MA) lines of the gram-positive model organism Bacillus subtilis. We then analyzed>7,500 spontaneous base-substitution mutations across B. subtilis, Escherichia coli, and Mesoplasma florum WT and MMR– MA lines, finding a context-dependent mutation pattern that is asymmetric around the origin of replication. Different neighboring nucleotides can alter site-specific mutation rates by as much as 75-fold, with sites neighboring G:C base pairs or dimers involving alternating pyrimidine–purine and purine–pyrimidine nucleotides having significantly elevated mutation rates. The influence of context-dependent mutation on genome architecture is strongest in M. florum, consistent with the reduced efficiency of selection in organisms with low effective population size. If not properly accounted for, the disparities arising from patterns of context-dependent mutation can significantly influence interpretations of positive and purifying selection. PMID:25750180

  18. Substitution scanning identifies a novel, catalytically active ibrutinib-resistant BTK cysteine 481 to threonine (C481T) variant.

    PubMed

    Hamasy, A; Wang, Q; Blomberg, K E M; Mohammad, D K; Yu, L; Vihinen, M; Berglöf, A; Smith, C I E

    2017-01-01

    Irreversible Bruton tyrosine kinase (BTK) inhibitors, ibrutinib and acalabrutinib have demonstrated remarkable clinical responses in multiple B-cell malignancies. Acquired resistance has been identified in a sub-population of patients in which mutations affecting BTK predominantly substitute cysteine 481 in the kinase domain for catalytically active serine, thereby ablating covalent binding of inhibitors. Activating substitutions in the BTK substrate phospholipase Cγ2 (PLCγ2) instead confers resistance independent of BTK. Herein, we generated all six possible amino acid substitutions due to single nucleotide alterations for the cysteine 481 codon, in addition to threonine, requiring two nucleotide substitutions, and performed functional analysis. Replacement by arginine, phenylalanine, tryptophan or tyrosine completely inactivated the catalytic activity, whereas substitution with glycine caused severe impairment. BTK with threonine replacement was catalytically active, similar to substitution with serine. We identify three potential ibrutinib resistance scenarios for cysteine 481 replacement: (1) Serine, being catalytically active and therefore predominating among patients. (2) Threonine, also being catalytically active, but predicted to be scarce, because two nucleotide changes are needed. (3) As BTK variants replaced with other residues are catalytically inactive, they presumably need compensatory mutations, therefore being very scarce. Glycine and tryptophan variants were not yet reported but likely also provide resistance.

  19. Substitution scanning identifies a novel, catalytically active ibrutinib-resistant BTK cysteine 481 to threonine (C481T) variant

    PubMed Central

    Hamasy, A; Wang, Q; Blomberg, K E M; Mohammad, D K; Yu, L; Vihinen, M; Berglöf, A; Smith, C I E

    2017-01-01

    Irreversible Bruton tyrosine kinase (BTK) inhibitors, ibrutinib and acalabrutinib have demonstrated remarkable clinical responses in multiple B-cell malignancies. Acquired resistance has been identified in a sub-population of patients in which mutations affecting BTK predominantly substitute cysteine 481 in the kinase domain for catalytically active serine, thereby ablating covalent binding of inhibitors. Activating substitutions in the BTK substrate phospholipase Cγ2 (PLCγ2) instead confers resistance independent of BTK. Herein, we generated all six possible amino acid substitutions due to single nucleotide alterations for the cysteine 481 codon, in addition to threonine, requiring two nucleotide substitutions, and performed functional analysis. Replacement by arginine, phenylalanine, tryptophan or tyrosine completely inactivated the catalytic activity, whereas substitution with glycine caused severe impairment. BTK with threonine replacement was catalytically active, similar to substitution with serine. We identify three potential ibrutinib resistance scenarios for cysteine 481 replacement: (1) Serine, being catalytically active and therefore predominating among patients. (2) Threonine, also being catalytically active, but predicted to be scarce, because two nucleotide changes are needed. (3) As BTK variants replaced with other residues are catalytically inactive, they presumably need compensatory mutations, therefore being very scarce. Glycine and tryptophan variants were not yet reported but likely also provide resistance. PMID:27282255

  20. Accurate prediction of the functional significance of single nucleotide polymorphisms and mutations in the ABCA1 gene.

    PubMed

    Brunham, Liam R; Singaraja, Roshni R; Pape, Terry D; Kejariwal, Anish; Thomas, Paul D; Hayden, Michael R

    2005-12-01

    The human genome contains an estimated 100,000 to 300,000 DNA variants that alter an amino acid in an encoded protein. However, our ability to predict which of these variants are functionally significant is limited. We used a bioinformatics approach to define the functional significance of genetic variation in the ABCA1 gene, a cholesterol transporter crucial for the metabolism of high density lipoprotein cholesterol. To predict the functional consequence of each coding single nucleotide polymorphism and mutation in this gene, we calculated a substitution position-specific evolutionary conservation score for each variant, which considers site-specific variation among evolutionarily related proteins. To test the bioinformatics predictions experimentally, we evaluated the biochemical consequence of these sequence variants by examining the ability of cell lines stably transfected with the ABCA1 alleles to elicit cholesterol efflux. Our bioinformatics approach correctly predicted the functional impact of greater than 94% of the naturally occurring variants we assessed. The bioinformatics predictions were significantly correlated with the degree of functional impairment of ABCA1 mutations (r2 = 0.62, p = 0.0008). These results have allowed us to define the impact of genetic variation on ABCA1 function and to suggest that the in silico evolutionary approach we used may be a useful tool in general for predicting the effects of DNA variation on gene function. In addition, our data suggest that considering patterns of positive selection, along with patterns of negative selection such as evolutionary conservation, may improve our ability to predict the functional effects of amino acid variation.

  1. A stochastic evolution model for residue Insertion-Deletion Independent from Substitution.

    PubMed

    Lèbre, Sophie; Michel, Christian J

    2010-12-01

    We develop here a new class of stochastic models of gene evolution based on residue Insertion-Deletion Independent from Substitution (IDIS). Indeed, in contrast to all existing evolution models, insertions and deletions are modeled here by a concept in population dynamics. Therefore, they are not only independent from each other, but also independent from the substitution process. After a separate stochastic analysis of the substitution and the insertion-deletion processes, we obtain a matrix differential equation combining these two processes defining the IDIS model. By deriving a general solution, we give an analytical expression of the residue occurrence probability at evolution time t as a function of a substitution rate matrix, an insertion rate vector, a deletion rate and an initial residue probability vector. Various mathematical properties of the IDIS model in relation with time t are derived: time scale, time step, time inversion and sequence length. Particular expressions of the nucleotide occurrence probability at time t are given for classical substitution rate matrices in various biological contexts: equal insertion rate, insertion-deletion only and substitution only. All these expressions can be directly used for biological evolutionary applications. The IDIS model shows a strongly different stochastic behavior from the classical substitution only model when compared on a gene dataset. Indeed, by considering three processes of residue insertion, deletion and substitution independently from each other, it allows a more realistic representation of gene evolution and opens new directions and applications in this research field. Copyright © 2010 Elsevier Ltd. All rights reserved.

  2. Control of ligand specificity in cyclic nucleotide-gated channels from rod photoreceptors and olfactory epithelium.

    PubMed Central

    Altenhofen, W; Ludwig, J; Eismann, E; Kraus, W; Bönigk, W; Kaupp, U B

    1991-01-01

    Cyclic nucleotide-gated ionic channels in photoreceptors and olfactory sensory neurons are activated by binding of cGMP or cAMP to a receptor site on the channel polypeptide. By site-directed mutagenesis and functional expression of bovine wild-type and mutant channels in Xenopus oocytes, we have tested the hypothesis that an alanine/threonine difference in the cyclic nucleotide-binding site determines the specificity of ligand binding, as has been proposed for cyclic nucleotide-dependent protein kinases [Weber, I.T., Shabb, J.B. & Corbin, J.D. (1989) Biochemistry 28, 6122-6127]. The wild-type olfactory channel is approximately 25-fold more sensitive to both cAMP and cGMP than the wild-type rod photoreceptor channel, and both channels are 30- to 40-fold more sensitive to cGMP than to cAMP. Substitution of the respective threonine by alanine in the rod photoreceptor and olfactory channels decreases the cGMP sensitivity of channel activation 30-fold but little affects activation by cAMP. Substitution of threonine by serine, an amino acid that also carries a hydroxyl group, even improves cGMP sensitivity of the wild-type channels 2- to 5-fold. We conclude that the hydroxyl group of Thr-560 (rod) and Thr-537 (olfactory) forms an additional hydrogen bond with cGMP, but not cAMP, and thereby provides the structural basis for ligand discrimination in cyclic nucleotide-gated channels. PMID:1719541

  3. Control of ligand specificity in cyclic nucleotide-gated channels from rod photoreceptors and olfactory epithelium.

    PubMed

    Altenhofen, W; Ludwig, J; Eismann, E; Kraus, W; Bönigk, W; Kaupp, U B

    1991-11-01

    Cyclic nucleotide-gated ionic channels in photoreceptors and olfactory sensory neurons are activated by binding of cGMP or cAMP to a receptor site on the channel polypeptide. By site-directed mutagenesis and functional expression of bovine wild-type and mutant channels in Xenopus oocytes, we have tested the hypothesis that an alanine/threonine difference in the cyclic nucleotide-binding site determines the specificity of ligand binding, as has been proposed for cyclic nucleotide-dependent protein kinases [Weber, I.T., Shabb, J.B. & Corbin, J.D. (1989) Biochemistry 28, 6122-6127]. The wild-type olfactory channel is approximately 25-fold more sensitive to both cAMP and cGMP than the wild-type rod photoreceptor channel, and both channels are 30- to 40-fold more sensitive to cGMP than to cAMP. Substitution of the respective threonine by alanine in the rod photoreceptor and olfactory channels decreases the cGMP sensitivity of channel activation 30-fold but little affects activation by cAMP. Substitution of threonine by serine, an amino acid that also carries a hydroxyl group, even improves cGMP sensitivity of the wild-type channels 2- to 5-fold. We conclude that the hydroxyl group of Thr-560 (rod) and Thr-537 (olfactory) forms an additional hydrogen bond with cGMP, but not cAMP, and thereby provides the structural basis for ligand discrimination in cyclic nucleotide-gated channels.

  4. Y-Single Nucleotide Polymorphisms Diversity in Chinese Indigenous Horse.

    PubMed

    Han, Haoyuan; Zhang, Qin; Gao, Kexin; Yue, Xiangpeng; Zhang, Tao; Dang, Ruihua; Lan, Xianyong; Chen, Hong; Lei, Chuzhao

    2015-08-01

    In contrast to high genetic diversity of mitochondrial DNA (mtDNA), equine Y chromosome shows extremely low variability, implying limited patrilines in the domesticated horse. In this study, we applied direct sequencing and restriction fragment length polymorphism (RFLP) methods to investigate the polymorphisms of 33 Y chromosome specific loci in 304 Chinese indigenous horses from 13 breeds. Consequently, two Y-single nucleotide polymorphisms (SNPs) (Y-45701/997 and Y-50869) and one Y-indel (Y-45288) were identified. Of those, the Y-50869 (T>A) revealed the highest variation frequency (24.67%), whereas it was only 3.29% and 1.97% in Y-45288 (T/-) and Y-45701/997 (G>T) locus, respectively. These three mutations accounted for 27.96% of the total samples and identified five Y-SNP haplotypes, demonstrating genetic diversity of Y chromosome in Chinese horses. In addition, all the five Y-SNP haplotypes were shared by different breeds. Among 13 horse breeds analyzed, Balikun horse displayed the highest nucleotide diversity (π = 5.6×10(-4)) and haplotype diversity (h = 0.527), while Ningqiang horse showed the lowest nucleotide diversity (π = 0.00000) and haplotype diversity (h = 0.000). The results also revealed that Chinese horses had a different polymorphic pattern of Y chromosome from European and American horses. In conclusion, Chinese horses revealed genetic diversity of Y chromosome, however more efforts should be made to better understand the domestication and paternal origin of Chinese indigenous horses.

  5. Block of cyclic nucleotide-gated channels by tetracaine derivatives: role of apolar interactions at two distinct locations

    PubMed Central

    Strassmaier, Timothy; Kirk, Sarah R.; Banerji, Tapasree; Karpen, Jeffrey W.

    2008-01-01

    A series of new tetracaine derivatives was synthesized to explore the effects of hydrophobic character on blockade of cyclic nucleotide-gated (CNG) channels. Increasing the hydrophobicity at either of two positions on the tetracaine scaffold, the tertiary amine or the butyl tail, yields blockers with increased potency. However, shape also plays an important role. While gradual increases in length of the butyl tail lead to increased potency, substitution of the butyl tail with branched alkyl or cyclic groups is deleterious. PMID:18055205

  6. Muon-Substituted Malonaldehyde: Transforming a Transition State into a Stable Structure by Isotope Substitution.

    PubMed

    Goli, Mohammad; Shahbazian, Shant

    2016-02-12

    Isotope substitutions are usually conceived to play a marginal role on the structure and bonding pattern of molecules. However, a recent study [Angew. Chem. Int. Ed. 2014, 53, 13706-13709; Angew. Chem. 2014, 126, 13925-13929] further demonstrates that upon replacing a proton with a positively charged muon, as the lightest radioisotope of hydrogen, radical changes in the nature of the structure and bonding of certain species may take place. The present report is a primary attempt to introduce another example of structural transformation on the basis of the malonaldehyde system. Accordingly, upon replacing the proton between the two oxygen atoms of malonaldehyde with the positively charged muon a serious structural transformation is observed. By using the ab initio nuclear-electronic orbital non-Born-Oppenheimer procedure, the nuclear configuration of the muon-substituted species is derived. The resulting nuclear configuration is much more similar to the transition state of the proton transfer in malonaldehyde rather than to the stable configuration of malonaldehyde. The comparison of the "atoms in molecules" (AIM) structure of the muon-substituted malonaldehyde and the AIM structure of the stable and the transition-state configurations of malonaldehyde also unequivocally demonstrates substantial similarities of the muon-substituted malonaldehyde to the transition state.

  7. Nucleotide composition and codon usage bias of SRY gene.

    PubMed

    Choudhury, M N; Uddin, A; Chakraborty, S

    2017-01-26

    The SRY gene is present within the sex-determining region of the Y chromosome which is responsible for maleness in mammals. The nonuniform usage of synonymous codons in the mRNA transcript for encoding a particular amino acid is the codon usage bias (CUB). Analysis of codon usage pattern is important to understand the genetic and molecular organisation of a gene. It also helps in heterologous gene expression, design of primer and synthetic gene. However, the analysis of codon usage bias of SRY gene was not yet studied. We have used bioinformatic tools to analyse codon usage bias of SRY gene across mammals. Codon bias index (CBI) indicated that the overall extent of codon usage bias was weak. The relative synonymous codon usage (RSCU) analysis suggested that most frequently used codons had an A or C at the third codon position. Compositional constraint played an important role in codon usage pattern as evident from correspondence analysis (CA). Significant correlation among nucleotides constraints indicated that both mutation pressure and natural selection affect the codon usage pattern. Neutrality plot suggested that natural selection might play a major role, while mutation pressure might play a minor role in codon usage pattern in SRY gene in different species of mammals.

  8. How Do Substitute Teachers Substitute? An Empirical Study of Substitute-Teacher Labor Supply

    ERIC Educational Resources Information Center

    Gershenson, Seth

    2012-01-01

    This paper examines the daily labor supply of a potentially important, but often overlooked, source of instruction in U.S. public schools: substitute teachers. I estimate a sequential binary-choice model of substitute teachers' job-offer acceptance decisions using data on job offers made by a randomized automated calling system. Importantly, this…

  9. How Do Substitute Teachers Substitute? An Empirical Study of Substitute-Teacher Labor Supply

    ERIC Educational Resources Information Center

    Gershenson, Seth

    2012-01-01

    This paper examines the daily labor supply of a potentially important, but often overlooked, source of instruction in U.S. public schools: substitute teachers. I estimate a sequential binary-choice model of substitute teachers' job-offer acceptance decisions using data on job offers made by a randomized automated calling system. Importantly, this…

  10. The Complete Nucleotide Sequence of the Mitochondrial Genome of Bactrocera minax (Diptera: Tephritidae)

    PubMed Central

    Zhang, Bin; Nardi, Francesco; Hull-Sanders, Helen; Wan, Xuanwu; Liu, Yinghong

    2014-01-01

    The complete 16,043 bp mitochondrial genome (mitogenome) of Bactrocera minax (Diptera: Tephritidae) has been sequenced. The genome encodes 37 genes usually found in insect mitogenomes. The mitogenome information for B. minax was compared to the homologous sequences of Bactrocera oleae, Bactrocera tryoni, Bactrocera philippinensis, Bactrocera carambolae, Bactrocera papayae, Bactrocera dorsalis, Bactrocera correcta, Bactrocera cucurbitae and Ceratitis capitata. The analysis indicated the structure and organization are typical of, and similar to, the nine closely related species mentioned above, although it contains the lowest genome-wide A+T content (67.3%). Four short intergenic spacers with a high degree of conservation among the nine tephritid species mentioned above and B. minax were observed, which also have clear counterparts in the control regions (CRs). Correlation analysis among these ten tephritid species revealed close positive correlation between the A+T content of zero-fold degenerate sites (P0FD), the ratio of nucleotide substitution frequency at P0FD sites to all degenerate sites (zero-fold degenerate sites, two-fold degenerate sites and four-fold degenerate sites) and amino acid sequence distance (ASD) were found. Further, significant positive correlation was observed between the A+T content of four-fold degenerate sites (P4FD) and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites; however, we found significant negative correlation between ASD and the A+T content of P4FD, and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites. A higher nucleotide substitution frequency at non-synonymous sites compared to synonymous sites was observed in nad4, the first time that has been observed in an insect mitogenome. A poly(T) stretch at the 5′ end of the CR followed by a [TA(A)]n-like stretch was also found. In addition, a highly conserved G+A-rich sequence block was observed in front of the

  11. The complete nucleotide sequence of the mitochondrial genome of Bactrocera minax (Diptera: Tephritidae).

    PubMed

    Zhang, Bin; Nardi, Francesco; Hull-Sanders, Helen; Wan, Xuanwu; Liu, Yinghong

    2014-01-01

    The complete 16,043 bp mitochondrial genome (mitogenome) of Bactrocera minax (Diptera: Tephritidae) has been sequenced. The genome encodes 37 genes usually found in insect mitogenomes. The mitogenome information for B. minax was compared to the homologous sequences of Bactrocera oleae, Bactrocera tryoni, Bactrocera philippinensis, Bactrocera carambolae, Bactrocera papayae, Bactrocera dorsalis, Bactrocera correcta, Bactrocera cucurbitae and Ceratitis capitata. The analysis indicated the structure and organization are typical of, and similar to, the nine closely related species mentioned above, although it contains the lowest genome-wide A+T content (67.3%). Four short intergenic spacers with a high degree of conservation among the nine tephritid species mentioned above and B. minax were observed, which also have clear counterparts in the control regions (CRs). Correlation analysis among these ten tephritid species revealed close positive correlation between the A+T content of zero-fold degenerate sites (P0FD), the ratio of nucleotide substitution frequency at P0FD sites to all degenerate sites (zero-fold degenerate sites, two-fold degenerate sites and four-fold degenerate sites) and amino acid sequence distance (ASD) were found. Further, significant positive correlation was observed between the A+T content of four-fold degenerate sites (P4FD) and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites; however, we found significant negative correlation between ASD and the A+T content of P4FD, and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites. A higher nucleotide substitution frequency at non-synonymous sites compared to synonymous sites was observed in nad4, the first time that has been observed in an insect mitogenome. A poly(T) stretch at the 5' end of the CR followed by a [TA(A)]n-like stretch was also found. In addition, a highly conserved G+A-rich sequence block was observed in front of the

  12. A recombinant RNA bacteriophage system to identify functionally important nucleotides in a self-cleaving ribozyme

    PubMed Central

    2014-01-01

    Background RNA bacteriophages like Qbeta and MS2 are well known for their high mutation rate, short infection cycle and strong selection against foreign inserts. The hammerhead ribozyme (HHRz) is a small self-cleaving RNA molecule whose active residues have previously been identified by mutational analysis of each individual base. Here the functionally important bases of HHRz were determined in a single screening experiment by inserting the HHRz into the genome of MS2. Findings The minimal HHRz of satellite Tobacco ringspot virus was cloned into the genome of RNA bacteriophage MS2. Sequence analysis of the surviving phages revealed that the majority had acquired single base-substitutions that apparently inactivated the HHRz. The positions of these substitutions exactly matched that of the previously determined core residues of the HHRz. Conclusions Natural selection against a ribozyme in the genome of MS2 can be used to quickly identify nucleotides required for self-cleavage. PMID:24946926

  13. High-Throughput Genotyping with Single Nucleotide Polymorphisms

    PubMed Central

    Ranade, Koustubh; Chang, Mau-Song; Ting, Chih-Tai; Pei, Dee; Hsiao, Chin-Fu; Olivier, Michael; Pesich, Robert; Hebert, Joan; Chen, Yii-Der I.; Dzau, Victor J.; Curb, David; Olshen, Richard; Risch, Neil; Cox, David R.; Botstein, David

    2001-01-01

    To make large-scale association studies a reality, automated high-throughput methods for genotyping with single-nucleotide polymorphisms (SNPs) are needed. We describe PCR conditions that permit the use of the TaqMan or 5′ nuclease allelic discrimination assay for typing large numbers of individuals with any SNP and computational methods that allow genotypes to be assigned automatically. To demonstrate the utility of these methods, we typed >1600 individuals for a G-to-T transversion that results in a glutamate-to-aspartate substitution at position 298 in the endothelial nitric oxide synthase gene, and a G/C polymorphism (newly identified in our laboratory) in intron 8 of the 11–β hydroxylase gene. The genotyping method is accurate—we estimate an error rate of fewer than 1 in 2000 genotypes, rapid—with five 96-well PCR machines, one fluorescent reader, and no automated pipetting, over one thousand genotypes can be generated by one person in one day, and flexible—a new SNP can be tested for association in less than one week. Indeed, large-scale genotyping has been accomplished for 23 other SNPs in 13 different genes using this method. In addition, we identified three “pseudo-SNPs” (WIAF1161, WIAF2566, and WIAF335) that are probably a result of duplication. PMID:11435409

  14. Cardiac Cyclic Nucleotide Phosphodiesterases: Function, Regulation, and Therapeutic Prospects

    PubMed Central

    Knight, W. E.; Yan, C.

    2014-01-01

    The second messengers cAMP and cGMP exist in multiple discrete compartments and regulate a variety of biological processes in the heart. The cyclic nucleotide phosphodiesterases, by catalyzing the hydrolysis of cAMP and cGMP, play crucial roles in controlling the amplitude, duration, and compartmentalization of cyclic nucleotide signaling. Over 60 phosphodiesterase isoforms, grouped into 11 families, have been discovered to date. In the heart, both cAMP- and cGMP-hydrolyzing phosphodiesterases play important roles in physiology and pathology. At least 7 of the 11 phosphodiesterase family members appear to be expressed in the myocardium, and evidence supports phosphodiesterase involvement in regulation of many processes important for normal cardiac function including pacemaking and contractility, as well as many pathological processes including remodeling and myocyte apoptosis. Pharmacological inhibitors for a number of phosphodiesterase families have also been used clinically or preclinically to treat several types of cardiovascular disease. In addition, phosphodiesterase inhibitors are also being considered for treatment of many forms of disease outside the cardiovascular system, raising the possibility of cardiovascular side effects of such agents. This review will discuss the roles of phosphodiesterases in the heart, in terms of expression patterns, regulation, and involvement in physiological and pathological functions. Additionally, the cardiac effects of various phosphodiesterase inhibitors, both potentially beneficial and detrimental, will be discussed. PMID:22951903

  15. Function Identification of the Nucleotides in Key cis-Element of DYSFUNCTIONAL TAPETUM1 (DYT1) Promoter

    PubMed Central

    Zhou, Shumin; Zhang, Hongli; Li, Ruisha; Hong, Qiang; Li, Yang; Xia, Qunfang; Zhang, Wei

    2017-01-01

    As a core regulatory gene of the anther development, DYSFUNCTIONAL TAPETUM1 (DYT1) was expressed in tapetum preferentially. Previous study had confirmed that a “CTCC” sequence within DYT1 promoter was indispensable for correct DYT1 expression. However, precise analysis on the function of each nucleotide of this sequence still lacks. Here we employed site mutation assay to identify the function roles of the nucleotides. As a result, the “T” and final “C” of “CTCC” were found essential for the temporal and spatial specificity of DYT1 expression, whereas the other two “C” nucleotides exhibited substitutable somewhat. The substitutes of two flanking nucleotides of “CTCC,” however, hardly affected the normal promoter function, suggesting that the “CTCC” sequence as a whole did meet the standard of a canonical cis-element by definition. In addition, it was found that as short as 497 bp DYT1 promoter was sufficient for tissue-specific expression, while longer 505 bp DYT1 promoter sequence was sufficient for species-specific expression. PMID:28261229

  16. Activation of ras p21 transforming properties associated with an increase in the release rate of bound guanine nucleotide.

    PubMed Central

    Lacal, J C; Aaronson, S A

    1986-01-01

    An Ala-to-Thr substitution at position 59 activates the transforming properties of the p21ras protein without impairment of GTPase activity, a biochemical alteration associated with other activating mutations. To investigate the basis for the transforming properties of the Thr-59 mutant, we characterized guanine nucleotide release. This reaction exhibited a slow rate and stringent temperature requirements. To further dissect the release reaction, we used monoclonal antibodies directed against different epitopes of the p21 molecule. One monoclonal specifically interfered with nucleotide release, while others which recognized different regions of the molecule blocked nucleotide binding. Mutants with the Thr-59 substitution exhibited a three- to ninefold-higher rate of GDP and GTP release than normal p21 or mutants with other activating lesions. This alteration in the Thr-59 mutant would have the effect of increasing its rate of nucleotide exchange. In an intracellular environment with a high GTP/GDP ratio, this would favor the association of GTP with the Thr-59 mutant. Consistent with knowledge of known G-regulatory proteins, these findings support a model in which the p21-GTP complex is the biologically active form of the p21 protein. PMID:3540608

  17. Components of an Effective Substitute Teacher Program.

    ERIC Educational Resources Information Center

    Purvis, Johnny R.; Garvey, Ruth C.

    1993-01-01

    Discusses the need for a comprehensive substitute teacher program in schools along with the important components of such a program. Identifies the roles of the principal, regular teacher, substitute teacher, and the superintendent in an effective substitute teacher program. (HB)

  18. Substitution and the USDA Forest Service log export restrictions.

    Treesearch

    Gary R. Lindell

    1980-01-01

    With some exceptions, the substitution of national forest timber for exported private timber is forbidden by regulations. Certain firms may use a limited amount of national forest timber as replacement for exported private timber, however, in accordance with their pattern of purchases and exports from 1971 through 1973. About 359 million board feet of national forest...

  19. Patterns of Somatic Mutations in Immunoglobulin Variable Genes

    PubMed Central

    Golding, G. Brian; Gearhart, Patricia J.; Glickman, Barry W.

    1987-01-01

    The mechanism responsible for somatic mutation in the variable genes of antibodies is unknown and may differ from previously described mechanisms that produce mutation in DNA. We have analyzed 421 somatic mutations from the rearranged immunoglobulin variable genes of mice to determine (1) if the nucleotide substitutions differ from those generated during meiosis and (2) if the presence of nearby direct and inverted repeated sequences could template mutations around the variable gene. The results reveal a difference in the pattern of substitutions obtained from somatic mutations vs. meiotic mutations. An increased frequency of T:A to C:G transitions and a decreased frequency of mutations involving a G in the somatic mutants compared to the meiotic mutants is indicated. This suggests that the mutational processes responsible for somatic mutation in antibody genes differs from that responsible for mutation during meiosis. An analysis of the local DNA sequences revealed many direct repeats and palindromic sequences that were capable of templating some of the known mutations. Although additional factors may be involved in targeting mutations to the variable gene, mistemplating by nearby repeats may provide a mechanism for the enhancement of somatic mutation. PMID:3557109

  20. Effects of 2'-O-methyl nucleotide on ligation capability of T4 DNA ligase.

    PubMed

    Zhao, Bin; Tong, Zhaoxue; Zhao, Guojie; Mu, Runqing; Shang, Hong; Guan, Yifu

    2014-09-01

    To further understand the ligation mechanism, effects of 2'-O-methyl nucleotide (2'-OMeN) on the T4 DNA ligation efficiency were investigated. Fluorescence resonance energy transfer assay was used to monitor the nick-joining process by T4 DNA ligase. Results showed that substitutions at 5'- and 3'-ends of the nick decreased the ligation efficiency by 48.7% ± 6.7% and 70.6% ± 4.0%, respectively. Substitutions at both 5'- and 3'-ends decreased the ligation efficiency by 76.6% ± 1.3%. Corresponding kinetic parameters, Vmax, Km, and kcat, have been determined in each case by using the Michaelis-Menten equation. The kinetic data showed that the 2'-OMeN substitutions reduced the maximal initial velocity and increased the Michaelis constant of T4 DNA ligase. Mismatches at 5'- and 3'-ends of the nick have also shown different influences on the ligation. Results here showed that the sugar pucker conformation at 3'-end impairs the ligation efficiency more profoundly than that at 5'-end. Different concentrations of Mg(2+), Ca(2+), K(+), Na(+), and ATP were also demonstrated to affect the T4 DNA ligase activity. These results enriched our knowledge about the effects of 2'-OMeN substitutions on the T4 DNA ligase.

  1. DESIGNING ENVIRONMENTALLY BENIGN SOLVENT SUBSTITUTES

    EPA Science Inventory

    Since the signing of 1987 Montreal Protocol, reducing and eliminating the use of harmful solvents has become an internationally imminent environmental protection mission. Solvent substitution is an effective way to achieve this goal. The Program for Assisting the Replacement of...

  2. DESIGNING ENVIRONMENTALLY BENIGN SOLVENT SUBSTITUTES

    EPA Science Inventory

    Since the signing of 1987 Montreal Protocol, reducing and eliminating the use of harmful solvents has become an internationally imminent environmental protection mission. Solvent substitution is an effective way to achieve this goal. The Program for Assisting the Replacement of...

  3. Nucleophilic Substitution by Benzodithioate Anions.

    ERIC Educational Resources Information Center

    Bonnans-Plaisance, Chantal; Gressier, Jean-Claude

    1988-01-01

    Describes a two-session experiment designed to provide a good illustration of, and to improve student knowledge of, the Grignard reaction and nucleophilic substitution. Discusses the procedure, experimental considerations, and conclusion of this experiment. (CW)

  4. Nucleotide sequence of papaya mosaic virus RNA.

    PubMed

    Sit, T L; Abouhaidar, M G; Holy, S

    1989-09-01

    The RNA genome of papaya mosaic virus is 6656 nucleotides long [excluding the poly(A) tail] with six open reading frames (ORFs) more than 200 nucleotides long. The four nearest the 5' end each overlap with adjacent ORFs and could code for proteins with Mr 176307, 26248, 11949 and 7224 (ORFs 1 to 4). The fifth ORF produces the capsid protein of Mr 23043 and the sixth ORF, located completely within ORF1, could code for a protein with Mr 14113. The translation products of ORFs 1 to 3 show strong similarity with those of other potexviruses but the ORF 4 protein has only limited similarity with the other potexvirus ORF 4 proteins of 7K to 11K.

  5. Radiation and thermal stabilities of adenine nucleotides.

    PubMed

    Demidov, V V; Potaman, V N; Solyanina, I P; Trofimov, V I

    1995-03-01

    We have investigated in detail radiation and thermal stabilities and transformations of adenosine mono- and triphosphates in liquid and frozen solid aqueous solutions within a wide range of absorbed radiation dose (up to 75 kGy) and temperature (up to 160 degrees C). Dephosphorylation is the main pathway of high temperature hydrolysis of adenine nucleotides. Basic thermodynamic and kinetic parameters of this process have been determined. Radiolysis of investigated compounds at room temperature results in scission of N-glycosidic bond with a radiation yield about of 1 mol/100 eV. Solution freezing significantly enhances radiation stability of nucleotides as well as other biomolecules. This circumstance is essential in the discussion of panspermia concepts.

  6. Blood substitutes based on nanobiotechnology.

    PubMed

    Chang, Thomas Ming Swi

    2006-08-01

    Stimulated by concerns of potential infective agents in donated blood, commercial enterprises have attempted to develop blood substitutes since the 1900s. After several years of development, a few of the many leads are showing promise. In this article, nanobiotechnological approaches that are now in phase III clinical trials are reviewed, followed by a discussion of how important basic knowledge gained is being used to develop new generations of blood substitutes based on nanobiotechnology.

  7. Can cannabis be considered a substitute medication for alcohol?

    PubMed

    Subbaraman, Meenakshi Sabina

    2014-01-01

    Substituting cannabis for alcohol may reduce drinking and related problems among alcohol-dependent individuals. Some even recommend prescribing medical cannabis to individuals attempting to reduce drinking. The primary aim of this review is to assess whether cannabis satisfies the seven previously published criteria for substitute medications for alcohol [e.g. 'reduces alcohol-related harms'; 'is safer in overdose than alcohol'; 'should offer significant health economic benefits'; see Chick and Nutt ((2012) Substitution therapy for alcoholism: time for a reappraisal? J Psychopharmacol 26:205-12)]. Literature review. All criteria appear either satisfied or partially satisfied, though studies relying on medical cannabis patients may be limited by selection bias and/or retrospective designs. Individual-level factors, such as severity of alcohol problems, may also moderate substitution. There is no clear pattern of outcomes related to cannabis substitution. Most importantly, the recommendation to prescribe alcohol-dependent individuals cannabis to help reduce drinking is premature. Future studies should use longitudinal data to better understand the consequences of cannabis substitution.

  8. Can Cannabis be Considered a Substitute Medication for Alcohol?

    PubMed Central

    Subbaraman, Meenakshi Sabina

    2014-01-01

    Aims: Substituting cannabis for alcohol may reduce drinking and related problems among alcohol-dependent individuals. Some even recommend prescribing medical cannabis to individuals attempting to reduce drinking. The primary aim of this review is to assess whether cannabis satisfies the seven previously published criteria for substitute medications for alcohol [e.g. ‘reduces alcohol-related harms’; ‘is safer in overdose than alcohol’; ‘should offer significant health economic benefits’; see Chick and Nutt ((2012) Substitution therapy for alcoholism: time for a reappraisal? J Psychopharmacol 26:205–12)]. Methods: Literature review. Results: All criteria appear either satisfied or partially satisfied, though studies relying on medical cannabis patients may be limited by selection bias and/or retrospective designs. Individual-level factors, such as severity of alcohol problems, may also moderate substitution. Conclusions: There is no clear pattern of outcomes related to cannabis substitution. Most importantly, the recommendation to prescribe alcohol-dependent individuals cannabis to help reduce drinking is premature. Future studies should use longitudinal data to better understand the consequences of cannabis substitution. PMID:24402247

  9. Mass spectrometry analysis of nucleosides and nucleotides.

    PubMed

    Dudley, Ed; Bond, Liz

    2014-01-01

    Mass spectrometry has been widely utilised in the study of nucleobases, nucleosides and nucleotides as components of nucleic acids and as bioactive metabolites in their own right. In this review, the application of mass spectrometry to such analysis is overviewed in relation to various aspects regarding the analytical mass spectrometric and chromatographic techniques applied and also the various applications of such analysis. © 2013 Wiley Periodicals, Inc.

  10. Isolation of fast purine nucleotide synthase ribozymes.

    PubMed

    Lau, Matthew W L; Cadieux, Kelly E C; Unrau, Peter J

    2004-12-08

    Here we report the in vitro selection of fast ribozymes capable of promoting the synthesis of a purine nucleotide (6-thioguanosine monophosphate) from tethered 5-phosphoribosyl 1-pyrophosphate (PRPP) and 6-thioguanine ((6S)Gua). The two most proficient purine synthases have apparent efficiencies of 284 and 230 M(-1) min(-1) and are both significantly more efficient than pyrimidine nucleotide synthase ribozymes selected previously by a similar approach. Interestingly, while both ribozymes showed good substrate discrimination, one ribozyme had no detectable affinity for 6-thioguanine while the second had a K(m) of approximately 80 muM, indicating that these ribozymes use considerably different modes of substrate recognition. The purine synthases were isolated after 10 rounds of selection from two high-diversity RNA pools. The first pool contained a long random sequence region. The second pool contained random sequence elements interspersed with the mutagenized helical elements of a previously characterized 4-thiouridine synthase ribozyme. While nearly all of the ribozymes isolated from this biased pool population appeared to have benefited from utilizing one of the progenitor's helical elements, little evidence for more complicated secondary structure preservation was evident. The discovery of purine synthases, in addition to pyrimidine synthases, demonstrates the potential for nucleotide synthesis in an 'RNA World' and provides a context from which to study small molecule RNA catalysis.

  11. Evolution of functional six-nucleotide DNA.

    PubMed

    Zhang, Liqin; Yang, Zunyi; Sefah, Kwame; Bradley, Kevin M; Hoshika, Shuichi; Kim, Myong-Jung; Kim, Hyo-Joong; Zhu, Guizhi; Jiménez, Elizabeth; Cansiz, Sena; Teng, I-Ting; Champanhac, Carole; McLendon, Christopher; Liu, Chen; Zhang, Wen; Gerloff, Dietlind L; Huang, Zhen; Tan, Weihong; Benner, Steven A

    2015-06-03

    Axiomatically, the density of information stored in DNA, with just four nucleotides (GACT), is higher than in a binary code, but less than it might be if synthetic biologists succeed in adding independently replicating nucleotides to genetic systems. Such addition could also add functional groups not found in natural DNA, but useful for molecular performance. Here, we consider two new nucleotides (Z and P, 6-amino-5-nitro-3-(1'-β-D-2'-deoxyribo-furanosyl)-2(1H)-pyridone and 2-amino-8-(1'-β-D-2'-deoxyribofuranosyl)-imidazo[1,2-a]-1,3,5-triazin-4(8H)-one). These are designed to pair via complete Watson-Crick geometry. These were added to a library of oligonucleotides used in a laboratory in vitro evolution (LIVE) experiment; the GACTZP library was challenged to deliver molecules that bind selectively to liver cancer cells, but not to untransformed liver cells. Unlike in classical in vitro selection, low levels of mutation allow this system to evolve to create binding molecules not necessarily present in the original library. Over a dozen binding species were recovered. The best had Z and/or P in their sequences. Several had multiple, nearby, and adjacent Zs and Ps. Only the weaker binders contained no Z or P at all. This suggests that this system explored much of the sequence space available to this genetic system and that GACTZP libraries are richer reservoirs of functionality than standard libraries.

  12. Nucleotide excision repair in Escherichia coli.

    PubMed Central

    Van Houten, B

    1990-01-01

    One of the best-studied DNA repair pathways is nucleotide excision repair, a process consisting of DNA damage recognition, incision, excision, repair resynthesis, and DNA ligation. Escherichia coli has served as a model organism for the study of this process. Recently, many of the proteins that mediate E. coli nucleotide excision have been purified to homogeneity; this had led to a molecular description of this repair pathway. One of the key repair enzymes of this pathway is the UvrABC nuclease complex. The individual subunits of this enzyme cooperate in a complex series of partial reactions to bind to and incise the DNA near a damaged nucleotide. The UvrABC complex displays a remarkable substrate diversity. Defining the structural features of DNA lesions that provide the specificity for damage recognition by the UvrABC complex is of great importance, since it represents a unique form of protein-DNA interaction. Using a number of in vitro assays, researchers have been able to elucidate the action mechanism of the UvrABC nuclease complex. Current research is devoted to understanding how these complex events are mediated within the living cell. PMID:2181258

  13. [Nucleotide receptors in learning and neuronal plasticity].

    PubMed

    Czajkowski, Rafał

    2014-01-01

    Nucleotide signalling plays an important role in neuronal plasticity and learning. Nucleotides are released at the synaptic terminals and may act pre- and postsynaptically by activating Pland P2 receptors. The A1 receptor, activated tonically by resting concentration of adenosine regulates basal neurotransmission. The A2A receptor is activated by increased adenosine levels and participates in plastic changes. ATP may act as an independent neurotransmitter on the P2X1 receptor, or via P2X3 subtype as a neuromodulator that affects NMDA receptor signalling. The G protein coupled P2Y receptors also evoke neuromodulatory effect on the neuronal plasticity, inhibiting LTD in prefrontal cortex. P2X7 receptor is responsible for communication between astrocytes and for synchronizing their activity. ATP and adenosine released by astrocytes act as neuromodulators both at the release site and heterosynaptically. Taken together, these multiple actions of nucleotides constitute a mechanism regulating homeostatic processes that are necessary for proper brain functioning: synaptic scaling and metaplasticity.

  14. Nucleotide-Dependent Bioautocatalytic Timer Reaction.

    PubMed

    Chen, Ting-Ru; Hsu, Ching-Fong; Chen, Chih-Lin; Witek, Henryk A; Urban, Pawel L

    2016-09-16

    We describe a biochemical timer composed of three biocatalytic reactions involving three types of adenylate nucleotides: adenosine triphosphate (ATP), adenosine diphosphate (ADP), and adenosine monophosphate (AMP). The timer is triggered by a small amount of ATP or ADP. An abrupt increase in the ATP concentration (following numerous amplification cycles) leads to a sudden increase of luminescence from the reaction mixture. The time point when the luminescence appears is found to be a function of the initial concentration of the triggering nucleotide (5.0 × 10(-8)-1.0 × 10(-6) M), even in the presence of a complex biological matrix. The mechanism of the observed dependence of the time of luminescence increase on the concentration has been confirmed with simple kinetic models. Due to the biocompatibility of the proposed trienzymatic reaction scheme (sensitivity to common nucleotides and occurrence in a neutral pH aqueous environment), the scheme can be used in bioengineered systems that require modulation of the response time (light emission) by concentration.

  15. Diminution in adenine nucleotide hydrolysis by platelets and serum from rats submitted to Walker 256 tumour.

    PubMed

    Buffon, Andréia; Ribeiro, Vanessa B; Schanoski, Alessandra S; Sarkis, João J F

    2006-01-01

    Extracellular adenine nucleotide hydrolysis in the circulation is mediated by the action of an NTPDase (CD39, apyrase) and of a 5'-nucleotidase (CD73), presenting as a final product, adenosine. Among other properties described for adenine nucleotides, an anti-cancer activity is suggested, since ATP is considered a cytotoxic molecule in several tumour cell systems. Conversely, some studies demonstrate that adenosine presents a tumour-promoting activity. In this study, we evaluated the pattern of adenine nucleotide hydrolysis by serum and platelets from rats submitted to the Walker 256 tumour model. Extracellular adenine nucleotide hydrolysis by blood serum and platelets obtained from rats at, 6, 10 and 15 days after the subcutaneous Walker 256 tumour inoculation, was evaluated. Our results demonstrate a significant reduction in ATP, ADP and AMP hydrolysis in blood serum at 6, 10 and 15 days after tumour induction. In platelets, a significant reduction in ATP and AMP hydrolysis was observed at 10 and 15 days after tumour induction, while an inhibition of ADP hydrolysis was observed at all times studied. Based on these results, it is possible to suggest a physiologic protection mechanism against the tumoral process in circulation. The inhibition in nucleotide hydrolysis observed probably maintains ATP levels elevated (cytotoxic compound) and, at the same time, reduces the adenosine production (tumour-promoting molecule) in the circulation.

  16. Non-Natural Nucleotides as Probes for the Mechanism and Fidelity of DNA Polymerases

    PubMed Central

    Lee, Irene; Berdis, Anthony J.

    2009-01-01

    DNA is a remarkable macromolecule that functions primarily as the carrier of the genetic information of organisms ranging from viruses to bacteria to eukaryotes. The ability of DNA polymerases to efficiently and accurately replicate genetic material represents one of the most fundamental yet complex biological processes found in nature. The central dogma of DNA polymerization is that the efficiency and fidelity of this biological process is dependent upon proper hydrogen-bonding interactions between an incoming nucleotide and its templating partner. However, the foundation of this dogma has been recently challenged by the demonstration that DNA polymerases can effectively and, in some cases, selectively incorporate non-natural nucleotides lacking classic hydrogen-bonding capabilities into DNA. In this review, we describe the results of several laboratories that have employed a variety of non-natural nucleotide analogs to decipher the molecular mechanism of DNA polymerization. The use of various non-natural nucleotides has lead to the development of several different models that can explain how efficient DNA synthesis can occur in the absence of hydrogen-bonding interactions. These models include the influence of steric fit and shape complementarity, hydrophobicity and solvation energies, base-stacking capabilities, and negative selection as alternatives to rules invoking simple recognition of hydrogen bonding patterns. Discussions are also provided regarding how the kinetics of primer extension and exonuclease proofreading activities associated with high-fidelity DNA polymerases are influenced by the absence of hydrogen-bonding functional groups exhibited by non-natural nucleotides. PMID:19733263

  17. Discovery of nucleotide polymorphisms in the Musa gene pool by Ecotilling.

    PubMed

    Till, Bradley J; Jankowicz-Cieslak, Joanna; Sági, László; Huynh, Owen A; Utsushi, Hiroe; Swennen, Rony; Terauchi, Ryohei; Mba, Chikelu

    2010-11-01

    Musa (banana and plantain) is an important genus for the global export market and in local markets where it provides staple food for approximately 400 million people. Hybridization and polyploidization of several (sub)species, combined with vegetative propagation and human selection have produced a complex genetic history. We describe the application of the Ecotilling method for the discovery and characterization of nucleotide polymorphisms in diploid and polyploid accessions of Musa. We discovered over 800 novel alleles in 80 accessions. Sequencing and band evaluation shows Ecotilling to be a robust and accurate platform for the discovery of polymorphisms in homologous and homeologous gene targets. In the process of validating the method, we identified two single nucleotide polymorphisms that may be deleterious for the function of a gene putatively important for phototropism. Evaluation of heterozygous polymorphism and haplotype blocks revealed a high level of nucleotide diversity in Musa accessions. We further applied a strategy for the simultaneous discovery of heterozygous and homozygous polymorphisms in diploid accessions to rapidly evaluate nucleotide diversity in accessions of the same genome type. This strategy can be used to develop hypotheses for inheritance patterns of nucleotide polymorphisms within and between genome types. We conclude that Ecotilling is suitable for diversity studies in Musa, that it can be considered for functional genomics studies and as tool in selecting germplasm for traditional and mutation breeding approaches.

  18. A Simple, General Result for the Variance of Substitution Number in Molecular Evolution.

    PubMed

    Houchmandzadeh, Bahram; Vallade, Marcel

    2016-07-01

    The number of substitutions (of nucleotides, amino acids, etc.) that take place during the evolution of a sequence is a stochastic variable of fundamental importance in the field of molecular evolution. Although the mean number of substitutions during molecular evolution of a sequence can be estimated for a given substitution model, no simple solution exists for the variance of this random variable. We show in this article that the computation of the variance is as simple as that of the mean number of substitutions for both short and long times. Apart from its fundamental importance, this result can be used to investigate the dispersion index R, that is, the ratio of the variance to the mean substitution number, which is of prime importance in the neutral theory of molecular evolution. By investigating large classes of substitution models, we demonstrate that although [Formula: see text], to obtain R significantly larger than unity necessitates in general additional hypotheses on the structure of the substitution model. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. Recognizing nucleotides by cross-tunneling currents for DNA sequencing

    NASA Astrophysics Data System (ADS)

    Bagci, V. M. K.; Kaun, Chao-Cheng

    2011-07-01

    Using first-principles calculations, we study electron transport through nucleotides inside a rectangular nanogap formed by two pairs of gold electrodes which are perpendicular and parallel to the nucleobase plane. We propose that this setup will enhance the nucleotide selectivity of tunneling signals to a great extent. Information from three electrical probing processes offers full nucleotide recognition, which survives the noise from neighboring nucleotides and configuration fluctuations.

  20. De Novo Assembly of Highly Substituted Morpholines and Piperazines

    PubMed Central

    2017-01-01

    The morpholine and piperazine with their remarkable physical and biochemical properties are popular heterocycles in organic and medicinal chemistry used in rational property design. However, in the majority of cases these rings are added to an existing molecule in a building block approach thus limiting their substitution pattern and diversity. Here we introduce a versatile de novo synthesis of the morpholine and piperazine rings using multicomponent reaction chemistry. The large scale amenable building blocks can be further substituted at up to four positions, making this a very versatile scaffold synthesis strategy. Our methods thus fulfill the increasing demand for novel building block design and nontraditional scaffolds which previously were not accessible PMID:28102692

  1. Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

    SciTech Connect

    Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

    1987-02-01

    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

  2. The Conserved Lysine-265 Allosterically Modulates Nucleotide- and Actin-binding Site Coupling in Myosin-2.

    PubMed

    Behrens, Vincent A; Münnich, Stefan; Adler-Gunzelmann, Georg; Thiel, Claudia; Henn, Arnon; Latham, Sharissa L; Taft, Manuel H

    2017-08-09

    Myosin motor proteins convert chemical energy into force and movement through their interactions with nucleotide and filamentous actin (F-actin). The evolutionarily conserved lysine-265 (K265) of the myosin-2 motor from Dictyostelium discoideum (Dd) is proposed to be a key residue in an allosteric communication pathway that mediates actin-nucleotide coupling. To better understand the role of K265, point mutations were introduced within the Dd myosin-2 M765-2R framework, replacing this lysine with alanine (K265A), glutamic acid (K265E) or glutamine (K265Q), and the functional and kinetic properties of the resulting myosin motors were assessed. The alanine and glutamic acid substitutions reduced actin-activated ATPase activity, slowed the in vitro sliding velocity and attenuated the inhibitory potential of the allosteric myosin inhibitor pentabromopseudilin (PBP). However, glutamine substitution did not substantially change these parameters. Structural modelling suggests that K265 interacts with D590 and Q633 to establish a pivotal allosteric branching point. Based on our results, we propose: (1) that the K265-D590 interaction functions to reduce myosins basal ATPase activity in the absence of F-actin, and (2) that the dynamic formation of the K265-Q633 salt bridge upon actin cleft closure regulates the activation of product release by actin filaments.

  3. Novel missense mutation in the cyclic nucleotide-binding domain of HERG causes long QT syndrome

    SciTech Connect

    Satler, C.A.; Walsh, E.P.; Vesely, M.R.

    1996-10-02

    Autosomal-dominant long QT syndrome (LQT) is an inherited disorder, predisposing affected individuals to sudden death from tachyarrhythmias. To identify the gene(s) responsible for LQT, we identified and characterized an LQT family consisting of 48 individuals. DNA was screened with 150 microsatellite polymorphic markers encompassing approximately 70% of the genome. We found evidence for linkage of the LQT phenotype to chromosome 7(q35-36). Marker D7S636 yielded a maximum lod score of 6.93 at a recombination fraction ({theta}) of 0.00. Haplotype analysis further localized the LQT gene within a 6-2-cM interval. HERG encodes a potassium channel which has been mapped to this region. Single-strand conformational polymorphism analyses demonstrated aberrant bands that were unique to all affected individuals. DNA sequencing of the aberrant bands demonstrated a G to A substitution in all affected patients; this point mutation results in the substitution of a highly conserved valine residue with a methionine (V822M) in the cyclic nucleotide-binding domain of this potassium channel. The cosegregation of this distinct mutation with LQT demonstrates that HERG is the LQT gene in this pedigree. Furthermore, the location and character of this mutation suggests that the cyclic nucleotide-binding domain of the potassium channel encoded by HERG plays an important role in normal cardiac repolarization and may decrease susceptibility to ventricular tachyarrhythmias. 38 refs., 7 figs., 2 tabs.

  4. Triphosphate Reorientation of the Incoming Nucleotide as a Fidelity Checkpoint in Viral RNA-dependent RNA Polymerases.

    PubMed

    Yang, Xiaorong; Liu, Xinran; Musser, Derek M; Moustafa, Ibrahim M; Arnold, Jamie J; Cameron, Craig E; Boehr, David D

    2017-03-03

    The nucleotide incorporation fidelity of the viral RNA-dependent RNA polymerase (RdRp) is important for maintaining functional genetic information but, at the same time, is also important for generating sufficient genetic diversity to escape the bottlenecks of the host's antiviral response. We have previously shown that the structural dynamics of the motif D loop are closely related to nucleotide discrimination. Previous studies have also suggested that there is a reorientation of the triphosphate of the incoming nucleotide, which is essential before nucleophilic attack from the primer RNA 3'-hydroxyl. Here, we have used (31)P NMR with poliovirus RdRp to show that the binding environment of the triphosphate is different when correct versus incorrect nucleotide binds. We also show that amino acid substitutions at residues known to interact with the triphosphate can alter the binding orientation/environment of the nucleotide, sometimes lead to protein conformational changes, and lead to substantial changes in RdRp fidelity. The analyses of other fidelity variants also show that changes in the triphosphate binding environment are not always accompanied by changes in the structural dynamics of the motif D loop or other regions known to be important for RdRp fidelity, including motif B. Altogether, our studies suggest that the conformational changes in motifs B and D, and the nucleoside triphosphate reorientation represent separable, "tunable" fidelity checkpoints.

  5. Nucleotide sequence of the 3'-noncoding region of alfalfa mosaic virus RNA 4 and its homology with the genomic RNAs.

    PubMed Central

    Koper-Zwarthoff, E C; Brederode, F T; Walstra, P; Bol, J F

    1979-01-01

    A 226-nucleotide fragment was derived from alfalfa mosaic virus RNA 4 (ALMV RNA 4), the subgenomic messenger for viral coat protein, and its sequence was deduced by in vitro labeling with polynucleotide kinase and application of RNA sequencing techniques. The fragment contains the 3'-terminal 45 nucleotides of the coat protein cistron and the complete 3'-noncoding region of 182 nucleotides. The total length of RNA 4 was calculated to be 881 nucleotides. AlMV RNAs 1, 2 and 3 were elongated with a 3'-terminal poly(A) stretch and subjected to sequence analysis by using a specific primer, reverse transcriptase and chain terminators. This revealed and extensive homology between the 3'-terminal 140 to 150 nucleotides of all four ALMV RNAs. Despite a number of base substitutions, the secondary structure of the homologous region is highly conserved. The observed homology indicates that, as with RNA 4, the sites with a high affinity for the viral coat protein are located at the 3'-termini of the genomic RNAs. Images PMID:537914

  6. Mutation Master: profiles of substitutions in hepatitis C virus RNA of the core, alternate reading frame, and NS2 coding regions.

    PubMed

    Walewski, José L; Gutierrez, Julio A; Branch-Elliman, Westyn; Stump, Decherd D; Keller, Toby R; Rodriguez, Alfredo; Benson, Gary; Branch, Andrea D

    2002-05-01

    The RNA genome of the hepatitis C virus (HCV) undergoes rapid evolutionary change. Efforts to control this virus would benefit from the advent of facile methods to identify characteristic features of HCV RNA and proteins, and to condense the vast amount of mutational data into a readily interpretable form. Many HCV sequences are available in GenBank. To facilitate analysis, consensus sequences were constructed to eliminate the overrepresentation of certain genotypes, such as genotype 1, and a novel package of sequence analysis tools was developed. Mutation Master generates profiles of point mutations in a population of sequences and produces a set of visual displays and tables indicating the number, frequency, and character of substitutions. It can be used to analyze hundreds of sequences at a time. When applied to 255 HCV core protein sequences, Mutation Master identified variable domains and a series of mutations meriting further investigation. It flagged position 4, for example, where 90% or more of all sequences in genotypes 1, 2, 4, and 5, have N4, whereas those in genotypes 3, 6, 7, 8, 9, and 10 have L4. This pattern is noteworthy: L (hydrophobic) to N (polar) substitutions are generally rare, and genotypes 1, 2, 4, and 5 do not form a recognized super family of sequences. Thus, the L4N substitution probably arose independently several times. Moreover, not one member of genotypes 1, 2, 4, or 5 has L4 and not one member of genotypes 3, 6, 7, 8, 9, or 10 has N4. This nonoverlapping pattern suggests that coordinated changes at position 4 and a second site are required to yield a viable virus. The package generated a table of genotype-specific substitutions whose future analysis may help to identify interacting amino acids. Three substitutions were present in 100% of genotype 2 members and absent from all others: A68D, R74K, and R114H. Finally, this study revealed thatARFP, a novel protein encoded in an overlapping reading frame, is as conserved as conventional

  7. Mutation Master: profiles of substitutions in hepatitis C virus RNA of the core, alternate reading frame, and NS2 coding regions.

    PubMed Central

    Walewski, José L; Gutierrez, Julio A; Branch-Elliman, Westyn; Stump, Decherd D; Keller, Toby R; Rodriguez, Alfredo; Benson, Gary; Branch, Andrea D

    2002-01-01

    The RNA genome of the hepatitis C virus (HCV) undergoes rapid evolutionary change. Efforts to control this virus would benefit from the advent of facile methods to identify characteristic features of HCV RNA and proteins, and to condense the vast amount of mutational data into a readily interpretable form. Many HCV sequences are available in GenBank. To facilitate analysis, consensus sequences were constructed to eliminate the overrepresentation of certain genotypes, such as genotype 1, and a novel package of sequence analysis tools was developed. Mutation Master generates profiles of point mutations in a population of sequences and produces a set of visual displays and tables indicating the number, frequency, and character of substitutions. It can be used to analyze hundreds of sequences at a time. When applied to 255 HCV core protein sequences, Mutation Master identified variable domains and a series of mutations meriting further investigation. It flagged position 4, for example, where 90% or more of all sequences in genotypes 1, 2, 4, and 5, have N4, whereas those in genotypes 3, 6, 7, 8, 9, and 10 have L4. This pattern is noteworthy: L (hydrophobic) to N (polar) substitutions are generally rare, and genotypes 1, 2, 4, and 5 do not form a recognized super family of sequences. Thus, the L4N substitution probably arose independently several times. Moreover, not one member of genotypes 1, 2, 4, or 5 has L4 and not one member of genotypes 3, 6, 7, 8, 9, or 10 has N4. This nonoverlapping pattern suggests that coordinated changes at position 4 and a second site are required to yield a viable virus. The package generated a table of genotype-specific substitutions whose future analysis may help to identify interacting amino acids. Three substitutions were present in 100% of genotype 2 members and absent from all others: A68D, R74K, and R114H. Finally, this study revealed thatARFP, a novel protein encoded in an overlapping reading frame, is as conserved as conventional

  8. HPLC purification of RNA aptamers up to 59 nucleotides with single-nucleotide resolution.

    PubMed

    Huang, Zhen; Lin, Chi-Yen; Jaremko, William; Niu, Li

    2015-01-01

    An RNA sample is usually heterogeneous. RNA heterogeneity refers to difference in length or size (i.e., number of nucleotides [nt]), sequence, or alternative but coexisting conformations. Separation and purification of RNA is generally required for investigating the structure and function of RNA, such as RNA catalysis and RNA structure determination by nuclear magnetic resonance or crystallography. Separation and purification of RNA is also required for using RNAs as functional probes and therapeutics as well as building blocks for RNA nanoparticles. Previously established protocols are limited in separating RNAs longer than 25 nt by single-nucleotide resolution. When the length of RNAs becomes longer, single-nucleotide separation of RNAs becomes more challenging. Here we describe protocols, by the use of ion-pair, reverse-phase high-performance liquid chromatography (HPLC), to extend our ability to separate regular RNAs up to 59 nt with single-nucleotide resolution. For chemically modified RNAs at 2' positions on the ribose, we can resolve RNAs of similar sizes even with a 26 Da difference. This is much less than 320 Da, an average single-nucleotide molecular weight difference.

  9. Apolipoprotein A-I mutant proteins having cysteine substitutions and polynucleotides encoding same

    DOEpatents

    Oda, Michael N.; Forte, Trudy M.

    2007-05-29

    Functional Apolipoprotein A-I mutant proteins, having one or more cysteine substitutions and polynucleotides encoding same, can be used to modulate paraoxonase's arylesterase activity. These ApoA-I mutant proteins can be used as therapeutic agents to combat cardiovascular disease, atherosclerosis, acute phase response and other inflammatory related diseases. The invention also includes modifications and optimizations of the ApoA-I nucleotide sequence for purposes of increasing protein expression and optimization.

  10. Abasic pivot substitution harnesses target specificity of RNA interference.

    PubMed

    Lee, Hye-Sook; Seok, Heeyoung; Lee, Dong Ha; Ham, Juyoung; Lee, Wooje; Youm, Emilia Moonkyung; Yoo, Jin Seon; Lee, Yong-Seung; Jang, Eun-Sook; Chi, Sung Wook

    2015-12-18

    Gene silencing via RNA interference inadvertently represses hundreds of off-target transcripts. Because small interfering RNAs (siRNAs) can function as microRNAs, avoiding miRNA-like off-target repression is a major challenge. Functional miRNA-target interactions are known to pre-require transitional nucleation, base pairs from position 2 to the pivot (position 6). Here, by substituting nucleotide in pivot with abasic spacers, which prevent base pairing and alleviate steric hindrance, we eliminate miRNA-like off-target repression while preserving on-target activity at ∼ 80-100%. Specifically, miR-124 containing dSpacer pivot substitution (6pi) loses seed-mediated transcriptome-wide target interactions, repression activity and biological function, whereas other conventional modifications are ineffective. Application of 6pi allows PCSK9 siRNA to efficiently lower plasma cholesterol concentration in vivo, and abolish potentially deleterious off-target phenotypes. The smallest spacer, C3, also shows the same improvement in target specificity. Abasic pivot substitution serves as a general means to harness the specificity of siRNA experiments and therapeutic applications.

  11. Abasic pivot substitution harnesses target specificity of RNA interference

    PubMed Central

    Lee, Hye-Sook; Seok, Heeyoung; Lee, Dong Ha; Ham, Juyoung; Lee, Wooje; Youm, Emilia Moonkyung; Yoo, Jin Seon; Lee, Yong-Seung; Jang, Eun-Sook; Chi, Sung Wook

    2015-01-01

    Gene silencing via RNA interference inadvertently represses hundreds of off-target transcripts. Because small interfering RNAs (siRNAs) can function as microRNAs, avoiding miRNA-like off-target repression is a major challenge. Functional miRNA–target interactions are known to pre-require transitional nucleation, base pairs from position 2 to the pivot (position 6). Here, by substituting nucleotide in pivot with abasic spacers, which prevent base pairing and alleviate steric hindrance, we eliminate miRNA-like off-target repression while preserving on-target activity at ∼80–100%. Specifically, miR-124 containing dSpacer pivot substitution (6pi) loses seed-mediated transcriptome-wide target interactions, repression activity and biological function, whereas other conventional modifications are ineffective. Application of 6pi allows PCSK9 siRNA to efficiently lower plasma cholesterol concentration in vivo, and abolish potentially deleterious off-target phenotypes. The smallest spacer, C3, also shows the same improvement in target specificity. Abasic pivot substitution serves as a general means to harness the specificity of siRNA experiments and therapeutic applications. PMID:26679372

  12. 14 CFR 1260.55 - Reports substitution.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... AGREEMENTS General Special Conditions § 1260.55 Reports substitution. Reports Substitution October 2000 Technical Reports may be substituted for the required Performance Reports. The title page of such reports... 14 Aeronautics and Space 5 2013-01-01 2013-01-01 false Reports substitution. 1260.55 Section...

  13. 14 CFR 1260.55 - Reports substitution.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... AGREEMENTS General Special Conditions § 1260.55 Reports substitution. Reports Substitution October 2000 Technical Reports may be substituted for the required Performance Reports. The title page of such reports... 14 Aeronautics and Space 5 2011-01-01 2010-01-01 true Reports substitution. 1260.55 Section...

  14. 14 CFR 1260.55 - Reports substitution.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... AGREEMENTS General Special Conditions § 1260.55 Reports substitution. Reports Substitution October 2000 Technical Reports may be substituted for the required Performance Reports. The title page of such reports... 14 Aeronautics and Space 5 2012-01-01 2012-01-01 false Reports substitution. 1260.55 Section...

  15. 14 CFR 1260.55 - Reports substitution.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... AGREEMENTS General Special Conditions § 1260.55 Reports substitution. Reports Substitution October 2000 Technical Reports may be substituted for the required Performance Reports. The title page of such reports... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Reports substitution. 1260.55 Section...

  16. The Successful Substitute Teacher. Fastback 475.

    ERIC Educational Resources Information Center

    McHugh, Sheila J.

    This booklet discusses how to develop successful substitute teachers, explaining that most substitutes do not receive the respect necessary to be effective. School districts must take such steps as adopting fair substitute hiring practices, allowing for the regular placement of substitutes in the same school over the year, and including…

  17. Assessing the State of Substitution Models Describing Noncoding RNA Evolution

    PubMed Central

    Allen, James E.; Whelan, Simon

    2014-01-01

    Phylogenetic inference is widely used to investigate the relationships between homologous sequences. RNA molecules have played a key role in these studies because they are present throughout life and tend to evolve slowly. Phylogenetic inference has been shown to be dependent on the substitution model used. A wide range of models have been developed to describe RNA evolution, either with 16 states describing all possible canonical base pairs or with 7 states where the 10 mismatched nucleotides are reduced to a single state. Formal model selection has become a standard practice for choosing an inferential model and works well for comparing models of a specific type, such as comparisons within nucleotide models or within amino acid models. Model selection cannot function across different sized state spaces because the likelihoods are conditioned on different data. Here, we introduce statistical state-space projection methods that allow the direct comparison of likelihoods between nucleotide models and 7-state and 16-state RNA models. To demonstrate the general applicability of our new methods, we extract 287 RNA families from genomic alignments and perform model selection. We find that in 281/287 families, RNA models are selected in preference to nucleotide models, with simple 7-state RNA models selected for more conserved families with shorter stems and more complex 16-state RNA models selected for more divergent families with longer stems. Other factors, such as the function of the RNA molecule or the GC-content, have limited impact on model selection. Our models and model selection methods are freely available in the open-source PHASE 3.0 software. PMID:24391153

  18. Esters of pyromellitic acid. Part I. Esters of achiral alcohols: regioselective synthesis of partial and mixed pyromellitate esters, mechanism of transesterification in the quantitative esterification of the pyromellitate system using orthoformate esters, and a facile synthesis of the ortho pyromellitate diester substitution pattern.

    PubMed

    Paine, John B

    2008-07-04

    Mild conditions and reversible anhydride formation allow a relative differentiation to be made of the four equivalent carbonyl groups of pyromellitic dianhydride (PMDA, benzene-1,2,4,5-tetracarboxylic dianhydride) in esterification, leading to regioselective methods to generate a wide range of partially or totally esterified products or products bearing differing esterifying groups at the different positions. Pyromellitate monoester anhydrides form efficiently in dichloromethane/triethylamine from 1 equiv of the alcohol. Under the same conditions, two different alcohols can be made to react sequentially. With 2 equiv of an alcohol, the usual mixture of meta and para diesters is obtained, separated by crystallization from HOAc. Meta and para dibenzyl pyromellitates served as regiospecific sources of other diesters, by further esterification followed by hydrogenolysis. Refluxing orthoformate triesters were found to effect quantitative esterification of the pyromellitate system under autocatalytic conditions; minor ester exchange with pre-existing esters (0-5% of total product) was ascribed to reversible anhydride formation. For general esterification with alcohols, partial ester acid chlorides were obtained using oxalyl chloride. Pyromellitate triesters afforded the ortho diester anhydrides upon distillation, thereby providing facile entry into the mostly novel ortho substitution pattern in this system. The requisite triesters were prepared by selective saponification or by the prior incorporation of one benzyl ester substituent, which could be removed by catalytic hydrogenolysis. The various benzyl esters of pyromellitates hydrogenolyzed smoothly to release the carboxylic acid groups without disturbance of pyromellitate aromaticity.

  19. Patterns of Y and X chromosome DNA sequence divergence during the Felidae radiation.

    PubMed Central

    Pecon Slattery, J; O'Brien, S J

    1998-01-01

    The 37 species of modern cats have evolved from approximately eight phylogenetic lineages within the past 10 to 15 million years. The Felidae family has been described with multiple measures of morphologic and molecular evolutionary methods that serve as a framework for tracking gene divergence during brief evolutionary periods. In this report, we compare the mode and tempo of evolution of noncoding sequences of a large intron within Zfy (783 bp) and Zfx (854 bp), homologous genes located on the felid Y and X chromosomes, respectively. Zfy sequence variation evolves at about twice the rate of Zfx, and both gene intron sequences track feline hierarchical topologies accurately. As homoplasies are infrequent in patterns of nucleotide substitution, the Y chromosome sequence displays a remarkable degree of phylogenetic consistency among cat species and provides a highly informative glimpse of divergence of sex chromosome sequences in Felidae. PMID:9539439

  20. [Progress of bone graft substitute].

    PubMed

    Zhang, Yongguang; Wang, Zhiqiang

    2008-10-01

    To sum up the recent progress of common bone graft substitute and to forecast the possible directions for further research. Recent original articles about investigation and application for bone graft substitute were extensively reviewed. Several common bone graft substitutes were selected and expounded in different categories. Bone graft was an essential treatment in order to provide structural support, fill bone cavity and promote bone defect healing. The gold standard for bone graft was autograft which is subject to many restrictions. In recent years, the research and development of bone graft substitute have received public attention. A very great progress has been made in the research and application of allograft bones, synthetic bones and engineered bones, and some research results have been put into use for real products. There still exist many problems in present bone graft substitutes. Combining various biomaterials and using the specific processing technology to develop a biomaterial which has the similar mechanical and chemical properties and physical structures to autograft so as to promote bone defect healing is the direction for future research.

  1. CFTR: the nucleotide binding folds regulate the accessibility and stability of the activated state

    PubMed Central

    1996-01-01

    The functional roles of the two nucleotide binding folds, NBF1 and NBF2, in the activation of the cystic fibrosis transmembrane conductance regulator (CFTR) were investigated by measuring the rates of activation and deactivation of CFTR Cl- conductance in Xenopus oocytes. Activation of wild-type CFTR in response to application of forskolin and 3-isobutyl-1-methylxanthine (IBMX) was described by a single exponential. Deactivation after washout of the cocktail consisted of two phases: an initial slow phase, described by a latency, and an exponential decline. Rate analysis of CFTR variants bearing analogous mutations in NBF1 and NBF2 permitted us to characterize amino acid substitutions according to their effects on the accessibility and stability of the active state. Access to the active state was very sensitive to substitutions for the invariant glycine (G551) in NBF1, where mutations to alanine (A), serine (S), or aspartic acid (D) reduced the apparent on rate by more than tenfold. The analogous substitutions in NBF2 (G1349) also reduced the on rate, by twofold to 10-fold, but substantially destabilized the active state as well, as judged by increased deactivation rates. In the putative ATP-binding pocket of either NBF, substitution of alanine, glutamine (Q), or arginine (R) for the invariant lysine (K464 or K1250) reduced the on rate similarly, by two- to fourfold. In contrast, these analogous substitutions produced opposite effects on the deactivation rate. NBF1 mutations destabilized the active state, whereas the analogous substitutions in NBF2 stabilized the active state such that activation was prolonged compared with that seen with wild-type CFTR. Substitution of asparagine (N) for a highly conserved aspartic acid (D572) in the ATP-binding pocket of NBF1 dramatically slowed the on rate and destabilized the active state. In contrast, the analogous substitution in NBF2 (D1370N) did not appreciably affect the on rate and markedly stabilized the active state

  2. Expansion of inverted repeat does not decrease substitution rates in Pelargonium plastid genomes.

    PubMed

    Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

    2017-04-01

    For species with minor inverted repeat (IR) boundary changes in the plastid genome (plastome), nucleotide substitution rates were previously shown to be lower in the IR than the single copy regions (SC). However, the impact of large-scale IR expansion/contraction on plastid nucleotide substitution rates among closely related species remains unclear. We included plastomes from 22 Pelargonium species, including eight newly sequenced genomes, and used both pairwise and model-based comparisons to investigate the impact of the IR on sequence evolution in plastids. Ten types of plastome organization with different inversions or IR boundary changes were identified in Pelargonium. Inclusion in the IR was not sufficient to explain the variation of nucleotide substitution rates. Instead, the rate heterogeneity in Pelargonium plastomes was a mixture of locus-specific, lineage-specific and IR-dependent effects. Our study of Pelargonium plastomes that vary in IR length and gene content demonstrates that the evolutionary consequences of retaining these repeats are more complicated than previously suggested.

  3. Covariation in Frequencies of Substitution, Deletion, Transposition, and Recombination During Eutherian Evolution

    PubMed Central

    Hardison, Ross C.; Roskin, Krishna M.; Yang, Shan; Diekhans, Mark; Kent, W. James; Weber, Ryan; Elnitski, Laura; Li, Jia; O'Connor, Michael; Kolbe, Diana; Schwartz, Scott; Furey, Terrence S.; Whelan, Simon; Goldman, Nick; Smit, Arian; Miller, Webb; Chiaromonte, Francesca; Haussler, David

    2003-01-01

    Six measures of evolutionary change in the human genome were studied, three derived from the aligned human and mouse genomes in conjunction with the Mouse Genome Sequencing Consortium, consisting of (1) nucleotide substitution per fourfold degenerate site in coding regions, (2) nucleotide substitution per site in relics of transposable elements active only before the human–mouse speciation, and (3) the nonaligning fraction of human DNA that is nonrepetitive or in ancestral repeats; and three derived from human genome data alone, consisting of (4) SNP density, (5) frequency of insertion of transposable elements, and (6) rate of recombination. Features 1 and 2 are measures of nucleotide substitutions at two classes of “neutral” sites, whereas 4 is a measure of recent mutations. Feature 3 is a measure dominated by deletions in mouse, whereas 5 represents insertions in human. It was found that all six vary significantly in megabase-sized regions genome-wide, and many vary together. This indicates that some regions of a genome change slowly by all processes that alter DNA, and others change faster. Regional variation in all processes is correlated with, but not completely accounted for, by GC content in human and the difference between GC content in human and mouse. [Supplemental material is available online at www.genome.org and http://www.soe.ucsc.edu/research/compbio/covariation/.] PMID:12529302

  4. Evolution of Functional Six-Nucleotide DNA

    PubMed Central

    Zhang, Liqin; Yang, Zunyi; Sefah, Kwame; Bradley, Kevin M.; Hoshika, Shuichi; Kim, Myong-Jung; Kim, Hyo-Joong; Zhu1, Guizhi; Jiménez, Elizabeth; Cansiz, Sena; Teng, I-Ting; Champanhac, Carole; McLendon, Christopher; Liu, Chen; Zhang, Wen; Gerloff, Dietlind L.

    2015-01-01

    Axiomatically, the density of information stored in DNA, with just four nucleotides (GACT), is higher than in a binary code, but less than it might be if synthetic biologists succeed in adding independently replicating nucleotides to genetic systems. Such addition could also add additional functional groups, not found in natural DNA but useful for molecular performance. Here, we consider two new nucleotides (Z and P, 6-amino-5-nitro-3-(1′-β-D-2′-deoxyribo-furanosyl)-2(1H)-pyridone and 2-amino-8-(1′-β-D-2′-deoxyribofuranosyl)-imidazo[1,2-a]-1,3,5-triazin-4(8H)-one). These are designed to pair via strict Watson-Crick geometry. These were added to lies in a ibrarlaboratory in vitro evolution (LIVE) experiment; the GACTZP library was challenged to deliver molecules that bind selectively to liver cancer cells, but not to untransformed liver cells. Unlike in classical in vitro selection systems, low levels of mutation allow this system to evolve to create binding molecules not necessarily present in the original library. Over a dozen binding species were recovered. The best had Z and/or P in their sequences. Several had multiple, nearby, and adjacent Z’s and P’s. Only the weaker binders contained no Z or P at all. This suggests that this system explored much of the sequence space available to this genetic system, and that GACTZP libraries are richer reservoir of functionality than standard libraries. PMID:25966323

  5. Single-nucleotide polymorphism mutation spectra and resistance to quinolones in Salmonella enterica serovar Enteritidis with a mutator phenotype.

    PubMed

    Levy, Dan D; Sharma, Bhavana; Cebula, Thomas A

    2004-07-01

    Resistance to quinolone antibiotics has been associated with single-nucleotide polymorphisms (SNPs) in the quinolone resistance-determining region (QRDR) of gyrA. Mutations in the gyrA gene were compared by using mutant populations derived from wild-type Salmonella enterica serovar Enteritidis and its isogenic mutS::Tn10 mutator counterpart. Spontaneous mutants arising during nonselective growth were isolated by selection with either nalidixic acid, enrofloxacin, or ciprofloxacin. QRDR SNPs were identified in approximately 70% (512 of 695) of the isolates via colony hybridization with radiolabeled oligonucleotide probes. Notably, transition base substitution SNPs in the QRDR were dramatically increased in mutants derived from the mutS strain. Some, but not all, antibiotic-resistant mutants lacking QRDR SNPs were resistant to tetracycline and chloramphenicol, consistent with alterations in nonspecific efflux pumps or other membrane transport mechanisms. Changing the selection conditions shifted the mutation spectrum. Selection with ciprofloxacin was least likely to yield a mutant harboring either a QRDR SNP or chloramphenicol resistance. Selection with enrofloxacin was more likely to yield mutants containing Ser83-->Phe mutations, whereas selection with ciprofloxacin or nalidixic acid favored recovery of Asp87-->Gly mutants. Fluoroquinolone-resistant Salmonella strains isolated from veterinary or clinical settings frequently display a mutational spectrum with a preponderance of transition SNPs in the QRDR, the pattern found in vitro among mutS mutator mutants reported here. Both the preponderance of transition mutations and the varied mutation spectra reported for veterinary and clinical isolates suggest that bacterial mutators defective in methyl-directed mismatch repair may play a role in the emergence of quinolone and fluoroquinolone resistance in feral settings.

  6. Biocomputational analysis of evolutionary relationship between toll-like receptor and nucleotide-binding oligomerization domain-like receptors genes

    PubMed Central

    Bhardwaj, Rabia; Mukhopadhyay, Chandra Shekhar; Deka, Dipak; Verma, Ramneek; Dubey, P. P.; Arora, J. S.

    2016-01-01

    Aim: The active domains (TIR and NACHT) of the pattern recognition receptors (PRRs: Toll-like receptors [TLRs] and nucleotide-binding oligomerization domain [NOD]-like receptors [NLR], respectively) are the major hotspots of evolution as natural selection has crafted their final structure by substitution of residues over time. This paper addresses the evolutionary perspectives of the TLR and NLR genes with respect to the active domains in terms of their chronological fruition, functional diversification, and species-specific stipulation. Materials and Methods: A total of 48 full-length cds (and corresponding peptide) of the domains were selected as representatives of each type of PRRs, belonging to divergent animal species, for the biocomputational analyses. The secondary and tertiary structure of the taurine TIR and NACHT domains was predicted to compare the relatedness among the domains under study. Results: Multiple sequence alignment and phylogenetic tree results indicated that these host-specific PRRs formed entirely different clusters, with active domains of NLRs (NACHT) evolved earlier as compared to the active domains of TLRs (TIR). Each type of TLR or NLR shows comparatively less variation among the animal species due to the specificity of action against the type of microbes. Conclusion: It can be concluded from the study that there has been no positive selection acting on the domains associated with disease resistance which is a fitness trait indicating the extent of purifying pressure on the domains. Gene duplication could be a possible reason of genesis of similar kinds of TLRs (virus or bacteria specific). PMID:27956772

  7. Substitution of tryptophan 89 with tyrosine switches the DNA binding mode of PC4.

    PubMed

    Huang, Jinguang; Zhao, Yanxiang; Liu, Huaian; Huang, Dan; Cheng, Xiankun; Zhao, Wensheng; Taylor, Ian A; Liu, Junfeng; Peng, You-Liang

    2015-03-05

    PC4, a well-known general transcription cofactor, has multiple functions in transcription and DNA repair. Residue W89, is engaged in stacking interactions with DNA in PC4, but substituted by tyrosine in some PC4 orthologous proteins. In order to understand the consequences and reveal the molecular details of this substitution we have determined the crystal structures of the PC4 orthologue MoSub1 and a PC4 W89Y mutant in complex with DNA. In the structure of MoSub1-DNA complex, Y74 interacts directly with a single nucleotide of oligo DNA. By comparison, the equivalent residue, W89 in wild type PC4 interacts with two nucleotides and the base of the second nucleotide has distinct orientation relative to that of the first one. A hydrophobic patch around W89 that favours interaction with two nucleotides is not formed in the PC4 W89Y mutant. Therefore, the change of the surface hydrophobicity around residue 89 results in a difference between the modes of DNA interaction. These results indicate that the conserved Y74 in MoSub1 or W89 in PC4, are not only key residues in making specific interactions with DNA but also required to determine the DNA binding mode of PC4 proteins.

  8. Structure-substitution limit correlation study on Cr{sup 3+} substituted polycrystalline yttrium iron garnet

    SciTech Connect

    Modi, K. B.; Saija, K. G.; Sharma, P. U.; Lakhani, V. K.; Vasoya, N. H.; Pathak, T. K.; Zankat, K. B.

    2016-05-06

    Polycrystalline samples of Cr{sup 3+} - substituted yttrium iron garnet (Y{sub 3}Fe{sub 5}O{sub 12}) system with general chemical formula, Y{sub 3}Fe{sub 5-x}Cr{sub x}O{sub 12}, x = 0.0, 0.2, 0.4 and 0.6 were synthesized by double sintering ceramic technique and characterized by X-ray powder diffractometry. The Rietveld fitted X-ray diffraction patterns analysis revealed mono phase formation for x = 0.0 - 0.4 compositions while x = 0.6 composition possesses mixed phase character. The observed substitution limit has been discussed in the light of ionic size of substituent, electrostatic energy, electronic configuration and synthesis parameters. These observations strongly suggest that the electronic configuration of Cr{sup 3+}, which is favorable to the formation of d2sp3 (octahedral) type bonds, must be important. In the case of Cr{sup 3+}, the substitution does not appear to proceed well for x much greater than 0.5, this limitation probably is a consequence of the strong preference of a smaller ion Cr{sup 3+}, for a larger octahedral site which quickly leads to a condition not comparable with the requirement of the structure. The distribution of cations, mean ionic radii and theoretical lattice constant values have been determined.

  9. Molybdenum, Tungsten, and Aluminium Substitution for Enhancement of the Thermoelectric Performance of Higher Manganese Silicides

    NASA Astrophysics Data System (ADS)

    Nhi Truong, D. Y.; Berthebaud, David; Gascoin, Franck; Kleinke, Holger

    2015-10-01

    An easy and efficient process involving ball milling under soft conditions and spark plasma sintering was used to synthesize higher manganese silicide (HMS)-based compounds, for example MnSi1.75Ge0.02, with different molybdenum, tungsten, and aluminium substitution. The x-ray diffraction patterns of the samples after sintering showed the main phase to be HMS with the presence of some side products. Molybdenum substitution enlarges the unit cells more than tungsten substitution, owing to its greater solubility in the HMS structure, whereas substitution with aluminium did not substantially alter the cell parameters. The electrical resistivity of HMS-based compounds was reduced by <10% by this substitution, because of increased carrier concentrations. Changes of the Seebeck coefficient were insignificant after molybdenum and aluminium substitution whereas tungsten substitution slightly reduced the thermopower of the base material by approximately 8% over the whole temperature range; this was ascribed to reduced carrier mobility as a result of enhanced scattering. Substitution with any combination of two of these elements resulted in no crucial modification of the electrical properties of the base material. Large decreases of lattice thermal conductivity were observed, because of enhanced phonon scattering, with the highest reduction up to 25% for molybdenum substitution; this resulted in a 20% decrease of total thermal conductivity, which contributed to improvement of the figure of merit ZT of the HMS-based materials. The maximum ZT value was approximately 0.40 for the material with 2 at.% molybdenum substitution at the Mn sites.

  10. Magnesium substitution in brushite cements.

    PubMed

    Alkhraisat, Mohammad Hamdan; Cabrejos-Azama, Jatsue; Rodríguez, Carmen Rueda; Jerez, Luis Blanco; Cabarcos, Enrique López

    2013-01-01

    The use of magnesium-doped ceramics has been described to modify brushite cements and improve their biological behavior. However, few studies have analyzed the efficiency of this approach to induce magnesium substitution in brushite crystals. Mg-doped ceramics composed of Mg-substituted β-TCP, stanfieldite and/or farringtonite were reacted with primary monocalcium phosphate (MCP) in the presence of water. The cement setting reaction has resulted in the formation of brushite and newberyite within the cement matrix. Interestingly, the combination of SAED and EDX analyses of single crystal has indicated the occurrence of magnesium substitution within brushite crystals. Moreover, the effect of magnesium ions on the structure, and mechanical and setting properties of the new cements was characterized as well as the release of Ca(2+) and Mg(2+) ions. Further research would enhance the efficiency of the system to incorporate larger amounts of magnesium ions within brushite crystals.

  11. Bone Graft Substitution and Augmentation.

    PubMed

    Nauth, Aaron; Lane, Joseph; Watson, J Tracy; Giannoudis, Peter

    2015-12-01

    Selection of appropriate bone graft or bone graft substitute requires careful recognition of the bone healing needs of the patient's specific clinical problem and a thorough understanding of the different properties possessed by the available bone grafts and substitutes. Although autogenous iliac crest bone graft remains the gold standard of treatment for delayed unions, nonunions, and bone defects, there are a number of promising alternatives available, and emerging evidence suggests that they can be very effective when used in the proper setting. Among these, reamer-irrigator-aspirator bone graft, bone marrow concentrate, bone morphogenetic proteins, and calcium phosphate cements have received a great deal of attention in the literature. This review describes these grafts in detail along with the evidence for their use. In addition, a framework is provided for selecting the appropriate graft or substitute based on their provided properties.

  12. Substitution systems and nonextensive statistics

    NASA Astrophysics Data System (ADS)

    García-Morales, V.

    2015-12-01

    Substitution systems evolve in time by generating sequences of symbols from a finite alphabet: At a certain iteration step, the existing symbols are systematically replaced by blocks of Nk symbols also within the alphabet (with Nk, a natural number, being the length of the kth block of the substitution). The dynamics of these systems leads naturally to fractals and self-similarity. By using B-calculus (García-Morales, 2012) universal maps for deterministic substitution systems both of constant and non-constant length, are formulated in 1D. It is then shown how these systems can be put in direct correspondence with Tsallis entropy. A 'Second Law of Thermodynamics' is also proved for these systems in the asymptotic limit of large words.

  13. Palladium-Catalyzed Aerobic Dehydrogenation of Substituted Cyclohexanones to Phenols

    PubMed Central

    Izawa, Yusuke; Pun, Doris; Stahl, Shannon S.

    2011-01-01

    Aromatic molecules are key constituents of many pharmaceuticals, electronic materials and commodity plastics. The utility of these molecules directly reflects the identity and pattern of substituents on the aromatic ring. Here, we report the discovery of a palladium(II) catalyst system, incorporating an unconventional ortho-dimethylaminopyridine ligand, for the conversion of substituted cyclohexanones to the corresponding phenols. The reaction proceeds via successive dehydrogenation of two saturated carbon-carbon bonds of the six-membered ring and uses molecular oxygen as the hydrogen acceptor. This reactivity demonstrates a versatile and efficient strategy for the synthesis of substituted aromatic molecules with fundamentally different selectivity constraints from the numerous existing synthetic methods that rely on substitution of a pre-existing aromatic ring. PMID:21659567

  14. Synthesis of Randomly Substituted Anionic Cyclodextrins in Ball Milling.

    PubMed

    Jicsinszky, László; Caporaso, Marina; Calcio Gaudino, Emanuela; Giovannoli, Cristina; Cravotto, Giancarlo

    2017-03-19

    A number of influencing factors mean that the random substitution of cyclodextrins (CD) in solution is difficult to reproduce. Reaction assembly in mechanochemistry reduces the number of these factors. However, lack of water can improve the reaction outcomes by minimizing the reagent's hydrolysis. High-energy ball milling is an efficient, green and simple method for one-step reactions and usually reduces degradation and byproduct formation. Anionic CD derivatives have successfully been synthesized in the solid state, using a planetary ball mill. Comparison with solution reactions, the solvent-free conditions strongly reduced the reagent hydrolysis and resulted in products of higher degree of substitution (DS) with more homogeneous DS distribution. The synthesis of anionic CD derivatives can be effectively performed under mechanochemical activation without significant changes to the substitution pattern but the DS distributions were considerably different from the products of solution syntheses.

  15. Effects of genotype on rates of substitution during experimental evolution.

    PubMed

    Wong, Alex; Seguin, Kimberley

    2015-07-01

    Rates of molecular evolution may vary widely between populations, yet the causes of this variation are still incompletely understood. Genetic differences between populations may make an important contribution to variation in rates of evolution, owing to differences in fitness, population size, mutation rates, or in the distribution of fitness effects (DFEs) of available beneficial mutations. By whole genome sequencing of Escherichia coli populations experimentally evolved in the presence of a quinolone antibiotic, we found that rates of substitution varied by genotype, with evidence for a contribution from a genotype's starting fitness. Subsequent targeted sequencing showed that genotypes with high average substitution rates were more likely to undergo the simultaneous fixation of several mutations, consistent with theoretical models of multiple mutation dynamics. Moreover, patterns of substitution were indicative of epistatic relationships between known resistance mutations. © 2015 The Author(s). Evolution © 2015 The Society for the Study of Evolution.

  16. 40 CFR 721.2577 - Copper complex of (substituted sulfonaphthyl azo substituted phenyl) disulfonaphthyl azo, amine...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Copper complex of (substituted... Copper complex of (substituted sulfonaphthyl azo substituted phenyl) disulfonaphthyl azo, amine salt... substances identified generically as copper complex of (substituted sulfonaphthyl azo substituted...

  17. 40 CFR 721.2577 - Copper complex of (substituted sulfonaphthyl azo substituted phenyl) disulfonaphthyl azo, amine...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Copper complex of (substituted... Copper complex of (substituted sulfonaphthyl azo substituted phenyl) disulfonaphthyl azo, amine salt... substances identified generically as copper complex of (substituted sulfonaphthyl azo substituted...

  18. 40 CFR 721.2577 - Copper complex of (substituted sulfonaphthyl azo substituted phenyl) disulfonaphthyl azo, amine...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Copper complex of (substituted... Copper complex of (substituted sulfonaphthyl azo substituted phenyl) disulfonaphthyl azo, amine salt... substances identified generically as copper complex of (substituted sulfonaphthyl azo substituted...

  19. 40 CFR 721.2577 - Copper complex of (substituted sulfonaphthyl azo substituted phenyl) disulfonaphthyl azo, amine...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Copper complex of (substituted... Copper complex of (substituted sulfonaphthyl azo substituted phenyl) disulfonaphthyl azo, amine salt... substances identified generically as copper complex of (substituted sulfonaphthyl azo substituted...

  20. 40 CFR 721.10126 - Alkyl amino substituted triazine amino substituted benezenesulfonic acid reaction product with...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... substituted triazine amino substituted benezenesulfonic acid reaction product with naphthalenesulfonato azo... substituted triazine amino substituted benezenesulfonic acid reaction product with naphthalenesulfonato azo... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Alkyl amino substituted triazine amino...

  1. 40 CFR 721.10126 - Alkyl amino substituted triazine amino substituted benezenesulfonic acid reaction product with...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... substituted triazine amino substituted benezenesulfonic acid reaction product with naphthalenesulfonato azo... substituted triazine amino substituted benezenesulfonic acid reaction product with naphthalenesulfonato azo... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Alkyl amino substituted triazine amino...

  2. 40 CFR 721.10126 - Alkyl amino substituted triazine amino substituted benezenesulfonic acid reaction product with...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... substituted triazine amino substituted benezenesulfonic acid reaction product with naphthalenesulfonato azo... substituted triazine amino substituted benezenesulfonic acid reaction product with naphthalenesulfonato azo... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Alkyl amino substituted triazine amino...

  3. 40 CFR 721.10126 - Alkyl amino substituted triazine amino substituted benezenesulfonic acid reaction product with...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... substituted triazine amino substituted benezenesulfonic acid reaction product with naphthalenesulfonato azo... substituted triazine amino substituted benezenesulfonic acid reaction product with naphthalenesulfonato azo... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Alkyl amino substituted triazine amino...

  4. 40 CFR 721.10126 - Alkyl amino substituted triazine amino substituted benezenesulfonic acid reaction product with...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... substituted triazine amino substituted benezenesulfonic acid reaction product with naphthalenesulfonato azo... substituted triazine amino substituted benezenesulfonic acid reaction product with naphthalenesulfonato azo... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Alkyl amino substituted triazine amino...

  5. 40 CFR 721.10040 - Substituted acridine naphtha substituted benzamide (generic).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Substituted acridine naphtha... Significant New Uses for Specific Chemical Substances § 721.10040 Substituted acridine naphtha substituted... substance identified generically as a substituted acridine naphtha substituted benzamide (PMN P-02-522) is...

  6. Germline methylation patterns determine the distribution of recombination events in the dog genome.

    PubMed

    Berglund, Jonas; Quilez, Javier; Arndt, Peter F; Webster, Matthew T

    2014-12-19

    The positive-regulatory domain containing nine gene, PRDM9, which strongly associates with the location of recombination events in several vertebrates, is inferred to be inactive in the dog genome. Here, we address several questions regarding the control of recombination and its influence on genome evolution in dogs. First, we address whether the association between CpG islands (CGIs) and recombination hotspots is generated by lack of methylation, GC-biased gene conversion (gBGC), or both. Using a genome-wide dog single nucleotide polymorphism data set and comparisons of the dog genome with related species, we show that recombination-associated CGIs have low CpG mutation rates, and that CpG mutation rate is negatively correlated with recombination rate genome wide, indicating that nonmethylation attracts the recombination machinery. We next use a neighbor-dependent model of nucleotide substitution to disentangle the effects of CpG mutability and gBGC and analyze the effects that loss of PRDM9 has on these rates. We infer that methylation patterns have been stable during canid genome evolution, but that dog CGIs have experienced a drastic increase in substitution rate due to gBGC, consistent with increased levels of recombination in these regions. We also show that gBGC is likely to have generated many new CGIs in the dog genome, but these mostly occur away from genes, whereas the number of CGIs in gene promoter regions has not increased greatly in recent evolutionary history. Recombination has a major impact on the distribution of CGIs that are detected in the dog genome due to the interaction between methylation and gBGC. The results indicate that germline methylation patterns are the main determinant of recombination rates in the absence of PRDM9. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. Phylogenomic analyses reveal convergent patterns of adaptive evolution in elephant and human ancestries.

    PubMed

    Goodman, Morris; Sterner, Kirstin N; Islam, Munirul; Uddin, Monica; Sherwood, Chet C; Hof, Patrick R; Hou, Zhuo-Cheng; Lipovich, Leonard; Jia, Hui; Grossman, Lawrence I; Wildman, Derek E

    2009-12-08

    Specific sets of brain-expressed genes, such as aerobic energy metabolism genes, evolved adaptively in the ancestry of humans and may have evolved adaptively in the ancestry of other large-brained mammals. The recent addition of genomes from two afrotherians (elephant and tenrec) to the expanding set of publically available sequenced mammalian genomes provided an opportunity to test this hypothesis. Elephants resemble humans by having large brains and long life spans; tenrecs, in contrast, have small brains and short life spans. Thus, we investigated whether the phylogenomic patterns of adaptive evolution are more similar between elephant and human than between either elephant and tenrec lineages or human and mouse lineages, and whether aerobic energy metabolism genes are especially well represented in the elephant and human patterns. Our analyses encompassed approximately 6,000 genes in each of these lineages with each gene yielding extensive coding sequence matches in interordinal comparisons. Each gene's nonsynonymous and synonymous nucleotide substitution rates and dN/dS ratios were determined. Then, from gene ontology information on genes with the higher dN/dS ratios, we identified the more prevalent sets of genes that belong to specific functional categories and that evolved adaptively. Elephant and human lineages showed much slower nucleotide substitution rates than tenrec and mouse lineages but more adaptively evolved genes. In correlation with absolute brain size and brain oxygen consumption being largest in elephants and next largest in humans, adaptively evolved aerobic energy metabolism genes were most evident in the elephant lineage and next most evident in the human lineage.

  8. Germline Methylation Patterns Determine the Distribution of Recombination Events in the Dog Genome

    PubMed Central

    Berglund, Jonas; Quilez, Javier; Arndt, Peter F.; Webster, Matthew T.

    2015-01-01

    The positive-regulatory domain containing nine gene, PRDM9, which strongly associates with the location of recombination events in several vertebrates, is inferred to be inactive in the dog genome. Here, we address several questions regarding the control of recombination and its influence on genome evolution in dogs. First, we address whether the association between CpG islands (CGIs) and recombination hotspots is generated by lack of methylation, GC-biased gene conversion (gBGC), or both. Using a genome-wide dog single nucleotide polymorphism data set and comparisons of the dog genome with related species, we show that recombination-associated CGIs have low CpG mutation rates, and that CpG mutation rate is negatively correlated with recombination rate genome wide, indicating that nonmethylation attracts the recombination machinery. We next use a neighbor-dependent model of nucleotide substitution to disentangle the effects of CpG mutability and gBGC and analyze the effects that loss of PRDM9 ha