Detecting Single-Nucleotide Substitutions Induced by Genome Editing.
Miyaoka, Yuichiro; Chan, Amanda H; Conklin, Bruce R
2016-08-01
The detection of genome editing is critical in evaluating genome-editing tools or conditions, but it is not an easy task to detect genome-editing events-especially single-nucleotide substitutions-without a surrogate marker. Here we introduce a procedure that significantly contributes to the advancement of genome-editing technologies. It uses droplet digital polymerase chain reaction (ddPCR) and allele-specific hydrolysis probes to detect single-nucleotide substitutions generated by genome editing (via homology-directed repair, or HDR). HDR events that introduce substitutions using donor DNA are generally infrequent, even with genome-editing tools, and the outcome is only one base pair difference in 3 billion base pairs of the human genome. This task is particularly difficult in induced pluripotent stem (iPS) cells, in which editing events can be very rare. Therefore, the technological advances described here have implications for therapeutic genome editing and experimental approaches to disease modeling with iPS cells. © 2016 Cold Spring Harbor Laboratory Press.
Dornburg, Alex; Brandley, Matthew C; McGowen, Michael R; Near, Thomas J
2012-02-01
Various nucleotide substitution models have been developed to accommodate among lineage rate heterogeneity, thereby relaxing the assumptions of the strict molecular clock. Recently developed "uncorrelated relaxed clock" and "random local clock" (RLC) models allow decoupling of nucleotide substitution rates between descendant lineages and are thus predicted to perform better in the presence of lineage-specific rate heterogeneity. However, it is uncertain how these models perform in the presence of punctuated shifts in substitution rate, especially between closely related clades. Using cetaceans (whales and dolphins) as a case study, we test the performance of these two substitution models in estimating both molecular rates and divergence times in the presence of substantial lineage-specific rate heterogeneity. Our RLC analyses of whole mitochondrial genome alignments find evidence for up to ten clade-specific nucleotide substitution rate shifts in cetaceans. We provide evidence that in the uncorrelated relaxed clock framework, a punctuated shift in the rate of molecular evolution within a subclade results in posterior rate estimates that are either misled or intermediate between the disparate rate classes present in baleen and toothed whales. Using simulations, we demonstrate abrupt changes in rate isolated to one or a few lineages in the phylogeny can mislead rate and age estimation, even when the node of interest is calibrated. We further demonstrate how increasing prior age uncertainty can bias rate and age estimates, even while the 95% highest posterior density around age estimates decreases; in other words, increased precision for an inaccurate estimate. We interpret the use of external calibrations in divergence time studies in light of these results, suggesting that rate shifts at deep time scales may mislead inferences of absolute molecular rates and ages.
Nishizawa, M; Nishizawa, K
2000-10-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.
Nishizawa, Manami; Nishizawa, Kazuhisa
2000-01-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the ‘between gene’ GC content heterogeneity, which is linked to ‘isochores’, is a principal factor associated with the bias in substitution patterns in human, ‘within gene’ heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed. PMID:11000273
Park, Seongjun; Ruhlman, Tracey A.; Weng, Mao-Lun; Hajrah, Nahid H.; Sabir, Jamal S.M.
2017-01-01
Abstract Geraniaceae have emerged as a model system for investigating the causes and consequences of variation in plastid and mitochondrial genomes. Incredible structural variation in plastid genomes (plastomes) and highly accelerated evolutionary rates have been reported in selected lineages and functional groups of genes in both plastomes and mitochondrial genomes (mitogenomes), and these phenomena have been implicated in cytonuclear incompatibility. Previous organelle genome studies have included limited sampling of Geranium, the largest genus in the family with over 400 species. This study reports on rates and patterns of nucleotide substitutions in plastomes and mitogenomes of 17 species of Geranium and representatives of other Geraniaceae. As detected across other angiosperms, substitution rates in the plastome are 3.5 times higher than the mitogenome in most Geranium. However, in the branch leading to Geranium brycei/Geranium incanum mitochondrial genes experienced significantly higher dN and dS than plastid genes, a pattern that has only been detected in one other angiosperm. Furthermore, rate accelerations differ in the two organelle genomes with plastomes having increased dN and mitogenomes with increased dS. In the Geranium phaeum/Geranium reflexum clade, duplicate copies of clpP and rpoA genes that experienced asymmetric rate divergence were detected in the single copy region of the plastome. In the case of rpoA, the branch leading to G. phaeum/G. reflexum experienced positive selection or relaxation of purifying selection. Finally, the evolution of acetyl-CoA carboxylase is unusual in Geraniaceae because it is only the second angiosperm family where both prokaryotic and eukaryotic ACCases functionally coexist in the plastid. PMID:28854633
Park, Seongjun; Ruhlman, Tracey A; Weng, Mao-Lun; Hajrah, Nahid H; Sabir, Jamal S M; Jansen, Robert K
2017-06-01
Geraniaceae have emerged as a model system for investigating the causes and consequences of variation in plastid and mitochondrial genomes. Incredible structural variation in plastid genomes (plastomes) and highly accelerated evolutionary rates have been reported in selected lineages and functional groups of genes in both plastomes and mitochondrial genomes (mitogenomes), and these phenomena have been implicated in cytonuclear incompatibility. Previous organelle genome studies have included limited sampling of Geranium, the largest genus in the family with over 400 species. This study reports on rates and patterns of nucleotide substitutions in plastomes and mitogenomes of 17 species of Geranium and representatives of other Geraniaceae. As detected across other angiosperms, substitution rates in the plastome are 3.5 times higher than the mitogenome in most Geranium. However, in the branch leading to Geranium brycei/Geranium incanum mitochondrial genes experienced significantly higher dN and dS than plastid genes, a pattern that has only been detected in one other angiosperm. Furthermore, rate accelerations differ in the two organelle genomes with plastomes having increased dN and mitogenomes with increased dS. In the Geranium phaeum/Geranium reflexum clade, duplicate copies of clpP and rpoA genes that experienced asymmetric rate divergence were detected in the single copy region of the plastome. In the case of rpoA, the branch leading to G. phaeum/G. reflexum experienced positive selection or relaxation of purifying selection. Finally, the evolution of acetyl-CoA carboxylase is unusual in Geraniaceae because it is only the second angiosperm family where both prokaryotic and eukaryotic ACCases functionally coexist in the plastid. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Does the choice of nucleotide substitution models matter topologically?
Hoff, Michael; Orf, Stefan; Riehm, Benedikt; Darriba, Diego; Stamatakis, Alexandros
2016-03-24
In the context of a master level programming practical at the computer science department of the Karlsruhe Institute of Technology, we developed and make available an open-source code for testing all 203 possible nucleotide substitution models in the Maximum Likelihood (ML) setting under the common Akaike, corrected Akaike, and Bayesian information criteria. We address the question if model selection matters topologically, that is, if conducting ML inferences under the optimal, instead of a standard General Time Reversible model, yields different tree topologies. We also assess, to which degree models selected and trees inferred under the three standard criteria (AIC, AICc, BIC) differ. Finally, we assess if the definition of the sample size (#sites versus #sites × #taxa) yields different models and, as a consequence, different tree topologies. We find that, all three factors (by order of impact: nucleotide model selection, information criterion used, sample size definition) can yield topologically substantially different final tree topologies (topological difference exceeding 10 %) for approximately 5 % of the tree inferences conducted on the 39 empirical datasets used in our study. We find that, using the best-fit nucleotide substitution model may change the final ML tree topology compared to an inference under a default GTR model. The effect is less pronounced when comparing distinct information criteria. Nonetheless, in some cases we did obtain substantial topological differences.
Schwarz, Erika N; Ruhlman, Tracey A; Weng, Mao-Lun; Khiyami, Mohammad A; Sabir, Jamal S M; Hajarah, Nahid H; Alharbi, Njud S; Rabah, Samar O; Jansen, Robert K
2017-04-01
This study represents the most comprehensive plastome-wide comparison of nucleotide substitution rates across the three subfamilies of Fabaceae: Caesalpinioideae, Mimosoideae, and Papilionoideae. Caesalpinioid and mimosoid legumes have large, unrearranged plastomes compared with papilionoids, which exhibit varying levels of rearrangement including the loss of the inverted repeat (IR) in the IR-lacking clade (IRLC). Using 71 genes common to 39 legume taxa representing all the three subfamilies, we show that papilionoids consistently have higher nucleotide substitution rates than caesalpinioids and mimosoids, and rates in the IRLC papilionoids are generally higher than those in the IR-containing papilionoids. Unsurprisingly, this pattern was significantly correlated with growth habit as most papilionoids are herbaceous, whereas caesalpinioids and mimosoids are largely woody. Both nonsynonymous (dN) and synonymous (dS) substitution rates were also correlated with several biological features including plastome size and plastomic rearrangements such as the number of inversions and indels. In agreement with previous reports, we found that genes in the IR exhibit between three and fourfold reductions in the substitution rates relative to genes within the large single-copy or small single-copy regions. Furthermore, former IR genes in IR-lacking taxa exhibit accelerated rates compared with genes contained in the IR.
Wada, A; Kunieda, T; Nishimura, M; Kakizoe-Ishida, Y; Watanabe, N; Ohkawa, K; Tsudzuki, M
2005-01-01
"Tawny" is an autosomal recessive coat color mutation found in a wild population of Mus musculus molossinus. The inbred strain MSKR carries the mutation. The causative gene Mc1r(taw) of the tawny phenotype is the second recessive allele at the melanocortin 1 receptor locus and is dominant to the first recessive allele, "recessive yellow" (Mc1r(e)). The Mc1r(taw) gene has six nucleotide substitutions, and its forecasted transcript has three amino acid substitutions (i.e., V101A, V216A, W252C). Though the nucleotide substitutions leading to V101A and V216A exist in various mouse strains, the nucleotide substitution leading to W252C exists in only tawny-colored mice. Thus this substitution is considered to be responsible for the expression of the tawny coat color. The frequency of the allele having this nucleotide substitution was 9.21% in the wild M. m. molossinus population inhabiting Sakai City, Osaka Prefecture, Japan, where the ancestral mice of the MSKR strain were captured.
Evolutionary constraints and the neutral theory. [mutation-caused nucleotide substitutions in DNA
NASA Technical Reports Server (NTRS)
Jukes, T. H.; Kimura, M.
1984-01-01
The neutral theory of molecular evolution postulates that nucleotide substitutions inherently take place in DNA as a result of point mutations followed by random genetic drift. In the absence of selective constraints, the substitution rate reaches the maximum value set by the mutation rate. The rate in globin pseudogenes is about 5 x 10 to the -9th substitutions per site per year in mammals. Rates slower than this indicate the presence of constraints imposed by negative (natural) selection, which rejects and discards deleterious mutations.
Nei, M; Tateno, Y
1981-01-01
Conducting computer simulations, Nei and Tateno (1978) have shown that Jukes and Holmquist's (1972) method of estimating the number of nucleotide substitutions tends to give an overestimate and the estimate obtained has a large variance. Holmquist and Conroy (1980) repeated some parts of our simulation and claim that the overestimation of nucleotide substitutions in our paper occurred mainly because we used selected data. Examination of Holmquist and Conroy's simulation indicates that their results are essentially the same as ours when the Jukes-Holmquist method is used, but since they used a different method of computation their estimates of nucleotide substitutions differed substantially from ours. Another problem in Holmquist and Conroy's Letter is that they confused the expected number of nucleotide substitution with the number in a sample. This confusion has resulted in a number of unnecessary arguments. They also criticized our X2 measure, but this criticism is apparently due to a misunderstanding of the assumptions of our method and a failure to use our method in the way we described. We believe that our earlier conclusions remain unchanged.
2010-01-01
Bombyx mori and Bombyx mandarina are morphologically and physiologically similar. In this study, we compared the nucleotide variations in the complete mitochondrial (mt) genomes between the domesticated silkmoth, B. mori, and its wild ancestors, Chinese B. mandarina (ChBm) and Japanese B. mandarina (JaBm). The sequence divergence and transition mutation ratio between B. mori and ChBm are significantly smaller than those observed between B. mori and JaBm. The preference of transition by DNA strands between B. mori and ChBm is consistent with that between B. mori and JaBm, however, the regional variation in nucleotide substitution rate shows a different feature. These results suggest that the ChBm mt genome is not undergoing the same evolutionary process as JaBm, providing evidence for selection on mtDNA. Moreover, investigation of the nucleotide sequence divergence in the A+T-rich region of Bombyx mt genomes also provides evidence for the assumption that the A+T-rich region might not be the fastest evolving region of the mtDNA of insects. PMID:21637625
Genome-wide heterogeneity of nucleotide substitution model fit.
Arbiza, Leonardo; Patricio, Mateus; Dopazo, Hernán; Posada, David
2011-01-01
At a genomic scale, the patterns that have shaped molecular evolution are believed to be largely heterogeneous. Consequently, comparative analyses should use appropriate probabilistic substitution models that capture the main features under which different genomic regions have evolved. While efforts have concentrated in the development and understanding of model selection techniques, no descriptions of overall relative substitution model fit at the genome level have been reported. Here, we provide a characterization of best-fit substitution models across three genomic data sets including coding regions from mammals, vertebrates, and Drosophila (24,000 alignments). According to the Akaike Information Criterion (AIC), 82 of 88 models considered were selected as best-fit models at least in one occasion, although with very different frequencies. Most parameter estimates also varied broadly among genes. Patterns found for vertebrates and Drosophila were quite similar and often more complex than those found in mammals. Phylogenetic trees derived from models in the 95% confidence interval set showed much less variance and were significantly closer to the tree estimated under the best-fit model than trees derived from models outside this interval. Although alternative criteria selected simpler models than the AIC, they suggested similar patterns. All together our results show that at a genomic scale, different gene alignments for the same set of taxa are best explained by a large variety of different substitution models and that model choice has implications on different parameter estimates including the inferred phylogenetic trees. After taking into account the differences related to sample size, our results suggest a noticeable diversity in the underlying evolutionary process. All together, we conclude that the use of model selection techniques is important to obtain consistent phylogenetic estimates from real data at a genomic scale.
Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S
2003-05-01
Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.
NASA Astrophysics Data System (ADS)
Arndt, Peter F.; Hwa, Terence; Petrov, Dmitri A.
2005-06-01
This study presents the first global, 1 Mbp level analysis of patterns of nucleotide substitutions along the human lineage. The study is based on the analysis of a large amount of repetitive elements deposited into the human genome since the mammalian radiation, yielding a number of results that would have been difficult to obtain using the more conventional comparative method of analysis. This analysis revealed substantial and consistent variability of rates of substitution, with the variability ranging up to 2-fold among different regions. The rates of substitutions of C or G nucleotides with A or T nucleotides vary much more sharply than the reverse rates suggesting that much of that variation is due to differences in mutation rates rather than in the probabilities of fixation of C/G vs. A/T nucleotides across the genome. For all types of substitution we observe substantially more hotspots than coldspots, with hotspots showing substantial clustering over tens of Mbp's. Our analysis revealed that GC-content of surrounding sequences is the best predictor of the rates of substitution. The pattern of substitution appears very different near telomeres compared to the rest of the genome and cannot be explained by the genome-wide correlations of the substitution rates with GC content or exon density. The telomere pattern of substitution is consistent with natural selection or biased gene conversion acting to increase the GC-content of the sequences that are within 10-15 Mbp away from the telomere.
Comparative nucleotide diversity across North American and European populus species.
Ismail, Mohamed; Soolanayakanahally, Raju Y; Ingvarsson, Pär K; Guy, Robert D; Jansson, Stefan; Silim, Salim N; El-Kassaby, Yousry A
2012-06-01
Nucleotide polymorphisms in two North American balsam poplars (Populus trichocarpa Torr. & Gray and P. balsamifera L.; section Tacamahaca), and one Eurasian aspen (P. tremula L.; section Populus) were compared using nine loci involved in defense, stress response, photoperiodism, freezing tolerance, and housekeeping. Nucleotide diversity varied among species and was highest for P. tremula (θ(w) = 0.005, π(T) = 0.007) as compared to P. balsamifera (θ(w) = 0.004, π(T) = 0.005) or P. trichocarpa (θ(w) = 0.002, π(T) = 0.003). Across species, the defense and the stress response loci accounted for the majority of the observed level of nucleotide diversity. In general, the studied loci did not deviate from neutral expectation either at the individual locus (non-significant normalized Fay and Wu's H) or at the multi-locus level (non-significant HKA test). Using molecular clock analysis, section Tacamahaca probably shared a common ancestor with section Populus approximately 4.5 million year ago. Divergence between the two closely related balsam poplars was about 0.8 million years ago, a pattern consistent with an isolation-with-migration (IM) model. As expected, P. tremula showed a five-fold higher substitution rate (2 × 10(-8) substitution/site/year) compared to the North American species (0.4 × 10(-8) substitution/site/year), probably reflecting its complex demographic history. Linkage disequilibrium (LD) varied among species with a more rapid decay in the North American species (<400 bp) in comparison to P. tremula (≫400 bp). The similarities in nucleotide diversity pattern and LD decay of the two balsam poplar species likely reflects the recent time of their divergence.
Chiusano, M L; D'Onofrio, G; Alvarez-Valin, F; Jabbari, K; Colonna, G; Bernardi, G
1999-09-30
We investigated the relationships between the nucleotide substitution rates and the predicted secondary structures in the three states representation (alpha-helix, beta-sheet, and coil). The analysis was carried out on 34 alignments, each of which comprised sequences belonging to at least four different mammalian orders. The rates of synonymous substitution were found to be significantly different in regions predicted to be alpha-helix, beta-sheet, or coil. Likewise, the nonsynonymous rates also differ, although expectedly at a lower extent, in the three types of secondary structure, suggesting that different selective constraints associated with the different structures are affecting in a similar way the synonymous and nonsynonymous rates. Moreover, the base composition of the third codon positions is different in coding sequence regions corresponding to different secondary structures of proteins.
Morton, B R; Oberholzer, V M; Clegg, M T
1997-09-01
Substitutions occurring in noncoding sequences of the plant chloroplast genome violate the independence of sites that is assumed by substitution models in molecular evolution. The probability that a substitution at a site is a transversion, as opposed to a transition, increases significantly with increasing A + T content of the two adjacent nucleotides. In the present study, this dependency of substitutions on local context is examined further in a number of noncoding regions from the chloroplast genome of members of the grass family (Poaceae). Two features were examined; the influence of specific neighboring bases, as opposed to the general A + T content, on transversion proportion and an influence on substitutions by nucleotides other than the two immediately adjacent to the site of substitution. In both cases, a significant effect was found. In the case of specific nucleotides, transversion proportion is significantly higher at sites with a pyrimidine immediately 5' on either strand. Substitutions at sites of the type YNR, where N is the site of substitution, have the highest rate of transversion. This specific effect is secondary to the A + T content effect such that, in terms of proportion of substitutions that are transversions, the nucleotides are ranked T > A > C > G as to their effect when they are immediately 5' to the site of substitution. In the case of nucleotides other than the immediate neighbors, a significant influence on substitution dynamics is observed in the case where the two neighboring bases are both A and/or T. Thus, substitutions are primarily, but not exclusively, influenced by the composition of the two nucleotides that are immediately adjacent. These results indicate that the pattern of molecular evolution of the plant chloroplast genome is extremely complex as a result of a variety of inter-site dependencies.
Gao, Meiling; Hu, Liangliang; Li, Yuhong; Weng, Yiqun
2016-10-01
The cucumber chlorophyll-deficient golden leaf mutation is due to a single nucleotide substitution in the CsChlI gene for magnesium chelatase I subunit which plays important roles in the chlorophyll biosynthesis pathway. The Mg-chelatase catalyzes the insertion of Mg(2+) into the protoporphyrin IX in the chlorophyll biosynthesis pathway, which is a protein complex encompassing three subunits CHLI, CHLD, and CHLH. Chlorophyll-deficient mutations in genes encoding the three subunits have played important roles in understanding the structure, function and regulation of this important enzyme. In an EMS mutagenesis population, we identified a chlorophyll-deficient mutant C528 with golden leaf color throughout its development which was viable and able to set fruits and seeds. Segregation analysis in multiple populations indicated that this leaf color mutation was recessively inherited and the green color showed complete dominance over golden color. Map-based cloning identified CsChlI as the candidate gene for this mutation which encoded the CHLI subunit of cucumber Mg-chelatase. The 1757-bp CsChlI gene had three exons and a single nucleotide change (G to A) in its third exon resulted in an amino acid substitution (G269R) and the golden leaf color in C528. This mutation occurred in the highly conserved nucleotide-binding domain of the CHLI protein in which chlorophyll-deficient mutations have been frequently identified. The mutant phenotype, CsChlI expression pattern and the mutated residue in the CHLI protein suggested the mutant allele in C528 is unique among mutations identified so far in different species. This golden leaf mutant not only has its potential in cucumber breeding, but also provides a useful tool in understanding the CHLI function and its regulation in the chlorophyll biosynthesis pathway as well as chloroplast development.
Andersson, Karolina A; Petzold, Max G; Allebeck, Peter; Carlsten, Anders
2008-02-29
Mandatory generic substitution was introduced in Sweden in October 2002 in order to try to curb escalating pharmaceutical expenditure. The aim of this study was to investigate how sales patterns for substitutable and non-substitutable pharmaceuticals have developed since the introduction of mandatory generic substitution; furthermore, to compare sales patterns in different groups of the population, based on patients' age and gender. Five therapeutic groups comprising both substitutable and non-substitutable pharmaceuticals were included. The study period was from January 2000 to June 2005. National sales data were used, covering volumes of dispensed prescription medicines (expressed in defined daily doses per 1000 inhabitants and day) of each pharmacological substance in the therapeutic groups for each age and gender group. Sales patterns for substitutable and non-substitutable pharmaceuticals were compared using a descriptive approach. In most therapeutic groups there has been an increase in the volumes of substitutable pharmaceuticals sold since the introduction of the reform, ranging from one third to three times the initial volume; whereas the volumes of non-substitutable pharmaceuticals have levelled out or declined. There were few gender differences in sales patterns of substitutable and non-substitutable drugs. In three therapeutic groups, sales patterns differed across different age groups, and there was a tendency for volumes of recently introduced non-substitutable pharmaceuticals to be proportionally higher in the youngest age groups. Since the introduction of the reform, there has been a proportionally larger increase in sales of substitutable pharmaceuticals compared with sales of non-substitutable pharmaceuticals. This indicates that the reform might have contributed to larger sales of less expensive pharmaceuticals.
2013-01-01
Background Dengue virus (DENV) infection represents a significant public health problem in many subtropical and tropical countries. Although genetically closely related, the four serotypes of DENV differ in antigenicity for which cross protection among serotypes is limited. It is also believed that both multi-serotype infection as well as the evolution of viral antigenicity may have confounding effects in increased dengue epidemics. Numerous studies have been performed that investigated genetic diversity of DENV, but the precise mechanism(s) of dengue virus evolution are not well understood. Results We investigated genome-wide genetic diversity and nucleotide substitution patterns in the four serotypes among samples collected from different countries in Asia and Central and South America and sequenced as part of the Genome Sequencing Center for Infectious Diseases at the Broad Institute. We applied bioinformatics, statistical and coalescent simulation methods to investigate diversity of codon sequences of DENV samples representing the four serotypes. We show that fixation of nucleotide substitutions is more prominent among the inter-continental isolates (Asian and American) of serotypes 1, 2 and 3 compared to serotype 4 isolates (South and Central America) and are distributed in a non-random manner among the genes encoded by the virus. Nearly one third of the negatively selected sites are associated with fixed mutation sites within serotypes. Our results further show that of all the sites showing evidence of recombination, the majority (~84%) correspond to sites under purifying selection in the four serotypes. The analysis further shows that genetic recombination occurs within specific codons, albeit with low frequency (< 5% of all recombination sites) throughout the DENV genome of the four serotypes and reveals significant enrichment (p < 0.05) among sites under purifying selection in the virus. Conclusion The study provides the first evidence for intracodon
Posada, David
2006-01-01
ModelTest server is a web-based application for the selection of models of nucleotide substitution using the program ModelTest. The server takes as input a text file with likelihood scores for the set of candidate models. Models can be selected with hierarchical likelihood ratio tests, or with the Akaike or Bayesian information criteria. The output includes several statistics for the assessment of model selection uncertainty, for model averaging or to estimate the relative importance of model parameters. The server can be accessed at . PMID:16845102
Nucleotide Substitution in 3' Arm of Bovine MIR-2467 in Five Cattle Breeds.
Łukaszewicz, Aneta; Basiak, Szymon; Proskura, Witold Stanisław; Dybus, Andrzej
2015-01-01
The T > C single nucleotide polymorphism (SNP) in the MIR2467 gene was investigated in order to confirm its presence in cattle genome and to check for possible differences in its genotype distribution among different breeds. Additional purpose of the study was to investigate in silico potential effect of that substitution on the structure and stability of precursor mir-2467. The study involved 634 individuals of five cattle breeds: Angus, Hereford, Holstein-Friesian, Jersey, and Limousin, which were genotyped using PCR-RFLP assay. In this study, the presence of T > C polymorphism at position 24 was observed in all the cattle breeds excepting Hereford. In addition, the differences in the genotype distribution among analyzed breeds were indicated. On the basis of minimum free energy structure prediction, the C allele was indicated to have possible impact on decreasing the stability of the pre-mir-2467, thus altering its ability to regulate target genes expression.
Foster, Patricia L; Niccum, Brittany A; Popodi, Ellen; Townes, Jesse P; Lee, Heewook; MohammedIsmail, Wazim; Tang, Haixu
2018-06-15
Mismatch repair (MMR) is a major contributor to replication fidelity, but its impact varies with sequence context and the nature of the mismatch. Mutation accumulation experiments followed by whole-genome sequencing of MMR-defective E. coli strains yielded ≈30,000 base-pair substitutions, revealing mutational patterns across the entire chromosome. The base-pair substitution spectrum was dominated by A:T > G:C transitions, which occurred predominantly at the center base of 5'N A C3'+5'G T N3' triplets. Surprisingly, growth on minimal medium or at low temperature attenuated these mutations. Mononucleotide runs were also hotspots for base-pair substitutions, and the rate at which these occurred increased with run length. Comparison with ≈2000 base-pair substitutions accumulated in MMR-proficient strains revealed that both kinds of hotspots appeared in the wild-type spectrum and so are likely to be sites of frequent replication errors. In MMR-defective strains transitions were strand biased, occurring twice as often when A and C rather than T and G were on the lagging-strand template. Loss of nucleotide diphosphate kinase increases the cellular concentration of dCTP, which resulted in increased rates of mutations due to misinsertion of C opposite A and T. In an mmr ndk double mutant strain, these mutations were more frequent when the template A and T were on the leading strand, suggesting that lagging-strand synthesis was more error-prone or less well corrected by proofreading than was leading strand synthesis. Copyright © 2018, Genetics.
Galtier, N; Boursot, P
2000-03-01
A new, model-based method was devised to locate nucleotide changes in a given phylogenetic tree. For each site, the posterior probability of any possible change in each branch of the tree is computed. This probabilistic method is a valuable alternative to the maximum parsimony method when base composition is skewed (i.e., different from 25% A, 25% C, 25% G, 25% T): computer simulations showed that parsimony misses more rare --> common than common --> rare changes, resulting in biased inferred change matrices, whereas the new method appeared unbiased. The probabilistic method was applied to the analysis of the mutation and substitution processes in the mitochondrial control region of mouse. Distinct change patterns were found at the polymorphism (within species) and divergence (between species) levels, rejecting the hypothesis of a neutral evolution of base composition in mitochondrial DNA.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Myint, Wazo; Gong, Qingguo; Ahn, Jinwoo
2011-02-04
Research highlights: {yields} Structural consequence by substitution mutations on the isolated SERCA-nucleotide binding (SERCA-N) domain was studied. {yields} The study fills a gap between the previous clinical, physiological, and biochemical data and the molecular basis of SERCA-N. {yields} The E412G mutation, known to be seen in patients with Darier's disease, was found to maintain the active conformation but exhibit reduced protein stability. -- Abstract: Sarcoplasmic reticulum Ca{sup 2+} ATPase (SERCA) is essential for muscle function by transporting Ca{sup 2+} from the cytosol into the sarcoplasmic reticulum through ATP hydrolysis. In this report, the effects of substitution mutations on the isolatedmore » SERCA-nucleotide binding domain (SERCA-N) were studied using NMR. {sup 15}N-{sup 1}H HSQC spectra of substitution mutants at the nucleotide binding site, T441A, R560V, and C561A, showed chemical shift changes, primarily in residues adjacent to the mutation sites, indicating only local effects. Further, the patterns of chemical shift changes upon AMP-PNP binding to these mutants were similar to that of the wild type SERCA-N (WT). In contrast to these nucleotide binding site mutants, a mutant found in patients with Darier's disease, E412G, showed small but significant chemical shift changes throughout the protein and rapid precipitation. However, the AMP-PNP dissociation constant ({approx}2.5 mM) was similar to that of WT ({approx}3.8 mM). These results indicate that the E412G mutant retains its catalytic activity but most likely reduces its stability. Our findings provide molecular insight into previous clinical, physiological, and biochemical observations.« less
Nucleotide substitutions revealing specific functions of Polycomb group genes.
Bajusz, Izabella; Sipos, László; Pirity, Melinda K
2015-04-01
POLYCOMB group (PCG) proteins belong to the family of epigenetic regulators of genes playing important roles in differentiation and development. Mutants of PcG genes were isolated first in the fruit fly, Drosophila melanogaster, resulting in spectacular segmental transformations due to the ectopic expression of homeotic genes. Homologs of Drosophila PcG genes were also identified in plants and in vertebrates and subsequent experiments revealed the general role of PCG proteins in the maintenance of the repressed state of chromatin through cell divisions. The past decades of gene targeting experiments have allowed us to make significant strides towards understanding how the network of PCG proteins influences multiple aspects of cellular fate determination during development. Being involved in the transmission of specific expression profiles of different cell lineages, PCG proteins were found to control wide spectra of unrelated epigenetic processes in vertebrates, such as stem cell plasticity and renewal, genomic imprinting and inactivation of X-chromosome. PCG proteins also affect regulation of metabolic genes being important for switching programs between pluripotency and differentiation. Insight into the precise roles of PCG proteins in normal physiological processes has emerged from studies employing cell culture-based systems and genetically modified animals. Here we summarize the findings obtained from PcG mutant fruit flies and mice generated to date with a focus on PRC1 and PRC2 members altered by nucleotide substitutions resulting in specific alleles. We also include a compilation of lessons learned from these models about the in vivo functions of this complex protein family. With multiple knockout lines, sophisticated approaches to study the consequences of peculiar missense point mutations, and insights from complementary gain-of-function systems in hand, we are now in a unique position to significantly advance our understanding of the molecular basis of
Nucleotide variability and linkage disequilibrium patterns in the porcine MUC4 gene
2012-01-01
Background MUC4 is a type of membrane anchored glycoprotein and serves as the major constituent of mucus that covers epithelial surfaces of many tissues such as trachea, colon and cervix. MUC4 plays important roles in the lubrication and protection of the surface epithelium, cell proliferation and differentiation, immune response, cell adhesion and cancer development. To gain insights into the evolution of the porcine MUC4 gene, we surveyed the nucleotide variability and linkage disequilibrium (LD) within this gene in Chinese indigenous breeds and Western commercial breeds. Results A total of 53 SNPs covering the MUC4 gene were genotyped on 5 wild boars and 307 domestic pigs representing 11 Chinese breeds and 3 Western breeds. The nucleotide variability, haplotype phylogeny and LD extent of MUC4 were analyzed in these breeds. Both Chinese and Western breeds had considerable nucleotide diversity at the MUC4 locus. Western pig breeds like Duroc and Large White have comparable nucleotide diversity as many of Chinese breeds, thus artificial selection for lean pork production have not reduced the genetic variability of MUC4 in Western commercial breeds. Haplotype phylogeny analyses indicated that MUC4 had evolved divergently in Chinese and Western pigs. The dendrogram of genetic differentiation between breeds generally reflected demographic history and geographical distribution of these breeds. LD patterns were unexpectedly similar between Chinese and Western breeds, in which LD usually extended less than 20 kb. This is different from the presumed high LD extent (more than 100 kb) in Western commercial breeds. The significant positive Tajima’D, and Fu and Li’s D statistics in a few Chinese and Western breeds implied that MUC4 might undergo balancing selection in domestic breeds. Nevertheless, we cautioned that the significant statistics could be upward biased by SNP ascertainment process. Conclusions Chinese and Western breeds have similar nucleotide diversity
Nucleotide variability and linkage disequilibrium patterns in the porcine MUC4 gene.
Yang, Ming; Yang, Bin; Yan, Xueming; Ouyang, Jing; Zeng, Weihong; Ai, Huashui; Ren, Jun; Huang, Lusheng
2012-07-13
MUC4 is a type of membrane anchored glycoprotein and serves as the major constituent of mucus that covers epithelial surfaces of many tissues such as trachea, colon and cervix. MUC4 plays important roles in the lubrication and protection of the surface epithelium, cell proliferation and differentiation, immune response, cell adhesion and cancer development. To gain insights into the evolution of the porcine MUC4 gene, we surveyed the nucleotide variability and linkage disequilibrium (LD) within this gene in Chinese indigenous breeds and Western commercial breeds. A total of 53 SNPs covering the MUC4 gene were genotyped on 5 wild boars and 307 domestic pigs representing 11 Chinese breeds and 3 Western breeds. The nucleotide variability, haplotype phylogeny and LD extent of MUC4 were analyzed in these breeds. Both Chinese and Western breeds had considerable nucleotide diversity at the MUC4 locus. Western pig breeds like Duroc and Large White have comparable nucleotide diversity as many of Chinese breeds, thus artificial selection for lean pork production have not reduced the genetic variability of MUC4 in Western commercial breeds. Haplotype phylogeny analyses indicated that MUC4 had evolved divergently in Chinese and Western pigs. The dendrogram of genetic differentiation between breeds generally reflected demographic history and geographical distribution of these breeds. LD patterns were unexpectedly similar between Chinese and Western breeds, in which LD usually extended less than 20 kb. This is different from the presumed high LD extent (more than 100 kb) in Western commercial breeds. The significant positive Tajima'D, and Fu and Li's D statistics in a few Chinese and Western breeds implied that MUC4 might undergo balancing selection in domestic breeds. Nevertheless, we cautioned that the significant statistics could be upward biased by SNP ascertainment process. Chinese and Western breeds have similar nucleotide diversity but evolve divergently in the MUC4
Vargas-Rodríguez, Rosa del Carmen Miluska; da Silva Bastos, Melissa; Menezes, Maria José; Orjuela-Sánchez, Pamela; Ferreira, Marcelo U.
2012-01-01
Emerging resistance to chloroquine (CQ) poses a major challenge for Plasmodium vivax malaria control, and nucleotide substitutions and copy number variation in the P. vivax multidrug resistance 1 (pvmdr-1) locus, which encodes a digestive vacuole membrane transporter, may modulate this phenotype. We describe patterns of genetic variation in pvmdr-1 alleles from Acre and Amazonas in northwestern Brazil, and compare then with those reported in other malaria-endemic regions. The pvmdr-1 mutation Y976F, which is associated with CQ resistance in Southeast Asia and Oceania, remains rare in northwestern Brazil (1.8%) and its prevalence mirrors that of CQ resistance worldwide. Gene amplification of pvmdr-1, which is associated with mefloquine resistance but increased susceptibility to CQ, remains relatively rare in northwestern Brazil (0.9%) and globally (< 4%), but became common (> 10%) in Tak Province, Thailand, possibly because of drug-mediated selection. The global database we have assembled provides a baseline for further studies of genetic variation in pvmdr-1 and drug resistance in P. vivax malaria. PMID:22949516
Vargas-Rodríguez, Rosa del Carmen Miluska; da Silva Bastos, Melissa; Menezes, Maria José; Orjuela-Sánchez, Pamela; Ferreira, Marcelo U
2012-11-01
Emerging resistance to chloroquine (CQ) poses a major challenge for Plasmodium vivax malaria control, and nucleotide substitutions and copy number variation in the P. vivax multidrug resistance 1 (pvmdr-1) locus, which encodes a digestive vacuole membrane transporter, may modulate this phenotype. We describe patterns of genetic variation in pvmdr-1 alleles from Acre and Amazonas in northwestern Brazil, and compare then with those reported in other malaria-endemic regions. The pvmdr-1 mutation Y976F, which is associated with CQ resistance in Southeast Asia and Oceania, remains rare in northwestern Brazil (1.8%) and its prevalence mirrors that of CQ resistance worldwide. Gene amplification of pvmdr-1, which is associated with mefloquine resistance but increased susceptibility to CQ, remains relatively rare in northwestern Brazil (0.9%) and globally (< 4%), but became common (> 10%) in Tak Province, Thailand, possibly because of drug-mediated selection. The global database we have assembled provides a baseline for further studies of genetic variation in pvmdr-1 and drug resistance in P. vivax malaria.
Substitution rate and natural selection in parvovirus B19
Stamenković, Gorana G.; Ćirković, Valentina S.; Šiljić, Marina M.; Blagojević, Jelena V.; Knežević, Aleksandra M.; Joksić, Ivana D.; Stanojević, Maja P.
2016-01-01
The aim of this study was to estimate substitution rate and imprints of natural selection on parvovirus B19 genotype 1. Studied datasets included 137 near complete coding B19 genomes (positions 665 to 4851) for phylogenetic and substitution rate analysis and 146 and 214 partial genomes for selection analyses in open reading frames ORF1 and ORF2, respectively, collected 1973–2012 and including 9 newly sequenced isolates from Serbia. Phylogenetic clustering assigned majority of studied isolates to G1A. Nucleotide substitution rate for total coding DNA was 1.03 (0.6–1.27) x 10−4 substitutions/site/year, with higher values for analyzed genome partitions. In spite of the highest evolutionary rate, VP2 codons were found to be under purifying selection with rare episodic positive selection, whereas codons under diversifying selection were found in the unique part of VP1, known to contain B19 immune epitopes important in persistent infection. Analyses of overlapping gene regions identified nucleotide positions under opposite selective pressure in different ORFs, suggesting complex evolutionary mechanisms of nucleotide changes in B19 viral genomes. PMID:27775080
Plesniak, Leigh; Horiuchi, Yuki; Sem, Daniel; Meinenger, David; Stiles, Linda; Shaffer, Jennifer; Jennings, Patricia A; Adams, Joseph A
2002-11-26
EnvZ is a histidine protein kinase important for osmoregulation in bacteria. While structural data are available for this enzyme, the nucleotide binding pocket is not well characterized. The ATP binding domain (EnvZB) was expressed, and its ability to bind nucleotide derivatives was assessed using equilbrium and stopped-flow fluorescence spectroscopy. The fluorescence emission of the trinitrophenyl derivatives, TNP-ATP and TNP-ADP, increase upon binding to EnvZB. The fluorescence enhancements were quantitatively abolished in the presence of excess ADP, indicating that the fluorescent probes occupy the nucleotide binding pocket. Both TNP-ATP and TNP-ADP bind to EnvZB with high affinity (K(d) = 2-3 microM). The TNP moiety attached to the ribose ring does not impede access of the fluorescent nucleotide into the binding pocket. The association rate constant for TNP-ADP is 7 microM(-1) s(-1), a value consistent with those for natural nucleotides and the eucaryotic protein kinases. Using competition experiments, it was found that ATP and ADP bind 30- and 150-fold more poorly, respectively, than the corresponding TNP-derivatized forms. Surprisingly, the physiological metal Mg(2+) is not required for ADP binding and only enhances ATP affinity by 3-fold. Although portions of the nucleotide pocket are disordered, the recombinant enzyme is highly stable, unfolding only at temperatures in excess of 70 degrees C. The unusually high affinity of the TNP derivatives compared to the natural nucleotides suggests that hydrophobic substitutions on the ribose ring enforce an altered binding mode that may be exploited for drug design strategies.
Maximum parsimony, substitution model, and probability phylogenetic trees.
Weng, J F; Thomas, D A; Mareels, I
2011-01-01
The problem of inferring phylogenies (phylogenetic trees) is one of the main problems in computational biology. There are three main methods for inferring phylogenies-Maximum Parsimony (MP), Distance Matrix (DM) and Maximum Likelihood (ML), of which the MP method is the most well-studied and popular method. In the MP method the optimization criterion is the number of substitutions of the nucleotides computed by the differences in the investigated nucleotide sequences. However, the MP method is often criticized as it only counts the substitutions observable at the current time and all the unobservable substitutions that really occur in the evolutionary history are omitted. In order to take into account the unobservable substitutions, some substitution models have been established and they are now widely used in the DM and ML methods but these substitution models cannot be used within the classical MP method. Recently the authors proposed a probability representation model for phylogenetic trees and the reconstructed trees in this model are called probability phylogenetic trees. One of the advantages of the probability representation model is that it can include a substitution model to infer phylogenetic trees based on the MP principle. In this paper we explain how to use a substitution model in the reconstruction of probability phylogenetic trees and show the advantage of this approach with examples.
Synthesis of Purine Nucleoside and Nucleotide Analogs as Antiparasitic Agents.
1979-09-01
was to conduct studies on the synthesis of purine nucleoside and nucleotide analogs as anti- parasitic agents. The primary target compounds were 5...antiparasitic agents. - Jaffe has proposed that the susceptibility of pathogenic helminths and protozoa to fraudulent purine, in contrast to pyrimidine...8217-substituted derivatives are thus designed to inhibit nucleoside and nucleotide kinases as well as other parasitic enzymes. Mammalian cells, onthe
Metz, Edward C.; Robles-Sikisaka, Refugio; Vacquier, Victor D.
1998-01-01
Strong positive Darwinian selection acts on two sperm fertilization proteins, lysin and 18-kDa protein, from abalone (Haliotis). To understand the phylogenetic context for this dramatic molecular evolution, we obtained sequences of mitochondrial cytochrome c oxidase subunit I (mtCOI), and genomic sequences of lysin, 18-kDa, and a G protein subunit. Based on mtDNA differentiation, four north Pacific abalone species diverged within the past 2 million years (Myr), and remaining north Pacific species diverged over a period of 4–20 Myr. Between-species nonsynonymous differences in lysin and 18-kDa exons exceed nucleotide differences in introns by 3.5- to 24-fold. Remarkably, in some comparisons nonsynonymous substitutions in lysin and 18-kDa genes exceed synonymous substitutions in mtCOI. Lysin and 18-kDa intron/exon segments were sequenced from multiple red abalone individuals collected over a 1,200-km range. Only two nucleotide changes and two sites of slippage variation were detected in a total of >29,000 nucleotides surveyed. However, polymorphism in mtCOI and a G protein intron was found in this species. This finding suggests that positive selection swept one lysin allele and one 18-kDa allele to fixation. Similarities between mtCOI and lysin gene trees indicate that rapid adaptive evolution of lysin has occurred consistently through the history of the group. Comparisons with mtCOI molecular clock calibrations suggest that nonsynonymous substitutions accumulate 2–50 times faster in lysin and 18-kDa genes than in rapidly evolving mammalian genes. PMID:9724763
Simmonds, H A; Fairbanks, L D; Morris, G S; Webster, D R; Harley, E H
1988-02-15
This paper compares erythrocyte nucleotide levels in patients with eight different inherited purine or pyrimidine enzyme defects identified amongst a variety of patients referred predominantly for investigation of severe neurological abnormalities, or immunodeficiency syndromes. Characteristic nucleotide patterns were identified only in the six disorders (four involving purine and two pyrimidine metabolism) where there was clinical evidence of cellular toxicity. They were frequently related to the accumulation of abnormal metabolites in body fluids. These erythrocyte studies have demonstrated the following. 1. ATP depletion is not an invariable feature of adenosine deaminase (ADA) deficiency, but the accumulation of the deoxyribonucleotides dATP, or dGTP, is diagnostic of ADA, or purine nucleoside phosphorylase (PNP) deficiency, respectively. The early accumulation of dATP in foetal blood is a valuable aid to prenatal diagnosis of ADA deficiency. 2. GTP depletion appears to reflect the degree of CNS involvement in hypoxanthine-guanine phosphoribosyltransferase and PNP deficiency, as well as PP-ribose-P synthetase superactivity. Other diagnostic changes involving increased pyrimidine sugars and increased or decreased NAD levels, or ZTP in Lesch Nyhan erythrocytes, show no consistent correlation with the clinical manifestations. 3. These altered nucleotide levels afford a novel means for carrier detection of the X-linked defect associated with aberrant PP-ribose-P synthetase activity, where no other test is yet available. Measurement of erythrocyte nucleotide levels thus provides a simple and rapid aid to diagnosis and may sometimes be essential for determining prognosis, carrier detection, or monitoring therapy. These characteristic 'fingerprints' may give some insight into the mechanism by which the abnormal gene product produces disease. Such grossly altered nucleotide levels could also result in loss of erythrocyte flexibility, increased destruction and hence the
Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G
2017-07-19
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.
Zhang, X; Gottlieb, P A
1995-01-01
Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate
Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A
2012-05-01
The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.
Green, Sol; Baker, Edward N; Laing, William
2011-06-23
Plant sesquiterpene and hemiterpene synthases in the monoterpene synthase dominated TPS-b subgroup are thought to have evolved independently from a monoterpene synthase ancestor. A TPS-b sesquiterpene synthase from apple (MdAFS1), which predominantly produces α-farnesene, can also synthesize the monoterpene (E)-β-ocimene. The dual activity offered a functional link to an ancestral MdAFS1 enzyme and a rational basis for investigation of the evolution of TPS-b sesquiterpene enzymes. Protein modelling and mutagenesis analysis of the MdAFS1 active site identified a non-synonymous nucleotide substitution that could account for the requisite shift in substrate specificity necessary for the emergence of its sesquiterpene activity during the evolution of the TPS-b enzymes. Copyright © 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Kusumi, Junko; Zidong, Li; Kado, Tomoyuki; Tsumura, Yoshihiko; Middleton, Beth A.; Tachida, Hidenori
2010-01-01
Conclusions: Taxodium distichum had significantly higher nucleotide variation than C. japonica, and its patterns of polymorphism contrasted strikingly with those of the latter, which previously has been inferred to have experienced a reduction in population size.
Miceli, G; Silveri, M C; Romani, C; Caramazza, A
1989-04-01
We describe the patterns of omissions (and substitutions) of freestanding grammatical morphemes and the patterns of substitutions of bound grammatical morphemes in 20 so-called agrammatic patients. Extreme variation was observed in the patterns of omissions and substitutions of grammatical morphemes, both in terms of the distribution of errors for different grammatical morphemes as well as in terms of the distribution of omissions versus substitutions. Results are discussed in the context of current debates concerning the possibility of a theoretically motivated distinction between the clinical categories of agrammatism and paragrammatism and, more generally, concerning the theoretical usefulness of any clinical category. The conclusion is reached that the observed heterogeneity in the production of grammatical morphemes among putatively agrammatic patients renders the clinical category of agrammatism, and by extension all other clinical categories from the classical classification scheme (e.g., Broca's aphasia, Wernicke's aphasia, and so forth) to more recent classificatory attempts (e.g., surface dyslexia, deep dysgraphia, and so forth), theoretically useless.
Neill, John D; Newcomer, Benjamin W; Marley, Shonda D; Ridpath, Julia F; Givens, M Daniel
2012-08-06
Bovine viral diarrhea virus (BVDV) strains circulating in livestock herds show significant sequence variation. Conventional wisdom states that most sequence variation arises during acute infections in response to immune or other environmental pressures. A recent study showed that more nucleotide changes were introduced into the BVDV genomic RNA during the establishment of a single fetal persistent infection than following a series of acute infections of naïve cattle. However, it was not known if nucleotide changes were introduce when the virus crossed the placenta and infected the fetus or during the acute infection of the dam. The sequence of the open reading frame (ORF) from viruses isolated from four acutely infected pregnant heifers following exposure to persistently infected (PI) calves was compared to the sequences of the virus from the progenitor PI calf and the virus from the resulting progeny PI calf to determine when genetic change was introduced. This was compared to genetic change found in viruses isolated from a pregnant PI cow and its PI calf, and in three viruses isolated from acutely infected, non-pregnant cattle exposed to PI calves. Most genetic changes previously identified between the progenitor and progeny PI viruses were in place in the acute phase viruses isolated from the dams six days post-exposure to the progenitor PI calf. Additionally, each progeny PI virus had two to three unique nucleotide substitutions that were introduced in crossing the placenta and infection of the fetus. The nucleotide sequence of two acute phase viruses isolated from steers exposed to PI calves revealed that six and seven nucleotide changes were introduced during the acute infection. The sequence of the BVDV-2 virus isolated from an acute infection of a PI calf (BVDV-1a) co-housed with a BVDV-2 PI calf had ten nucleotides that were different from the progenitor PI virus. Finally, twenty nucleotide changes were identified in the PI virus of a calf born to a PI
Economic aspects of drug substitution
Salehi, Hossein; Schweitzer, Stuart O.
1985-01-01
One of the major directions of health policy is the attempt to contain expenditures on pharmaceuticals by encouraging substitution of generic for brand name drug products. Yet, a major marketing survey of prescribing and dispensing patterns in California in 1977 found relatively little drug substitution occurring, and in fact substitution of more expensive products occurred more frequently than did substitution of less expensive products. This article tests alternative models of pharmacy dispensing behavior to better explain substitution patterns and it estimates price functions to measure the extent to which cost savings on generic products are passed on to consumers. PMID:10311162
Li, An; Gomes, Thiago C.F.
2016-01-01
The interaction between cellulose and xylan is important for the load-bearing secondary cell wall of flowering plants. Based on the precise, evenly spaced pattern of acetyl and glucuronosyl (MeGlcA) xylan substitutions in eudicots, we recently proposed that an unsubstituted face of xylan in a 2-fold helical screw can hydrogen bond to the hydrophilic surfaces of cellulose microfibrils. In gymnosperm cell walls, any role for xylan is unclear, and glucomannan is thought to be the important cellulose-binding polysaccharide. Here, we analyzed xylan from the secondary cell walls of the four gymnosperm lineages (Conifer, Gingko, Cycad, and Gnetophyta). Conifer, Gingko, and Cycad xylan lacks acetylation but is modified by arabinose and MeGlcA. Interestingly, the arabinosyl substitutions are located two xylosyl residues from MeGlcA, which is itself placed precisely on every sixth xylosyl residue. Notably, the Gnetophyta xylan is more akin to early-branching angiosperms and eudicot xylan, lacking arabinose but possessing acetylation on alternate xylosyl residues. All these precise substitution patterns are compatible with gymnosperm xylan binding to hydrophilic surfaces of cellulose. Molecular dynamics simulations support the stable binding of 2-fold screw conifer xylan to the hydrophilic face of cellulose microfibrils. Moreover, the binding of multiple xylan chains to adjacent planes of the cellulose fibril stabilizes the interaction further. Our results show that the type of xylan substitution varies, but an even pattern of xylan substitution is maintained among vascular plants. This suggests that 2-fold screw xylan binds hydrophilic faces of cellulose in eudicots, early-branching angiosperm, and gymnosperm cell walls. PMID:27325663
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rudwaleit, M.; Bowness, P.; Wordsworth, P.
1996-12-31
The HLA-B27 subtype HLA-B{sup *}2704 is virtually absent in Caucasians but common in Orientals, where it is associated with ankylosing spondylitis. The amino acid sequence of HLA-B{sup *}2704 has been established by peptide mapping and was shown to differ by two amino acids from HLA-B{sup *}2705, HLA-B{sup *}2704 is characterized by a serine for aspartic acid substitution at position 77 and glutamic acid for valine at position 152. To date, however, no nucleotide sequence confirming these changes at the DNA level has been published. 13 refs., 2 figs.
Kusumi, J.; Zidong, L.; Kado, T.; Tsumura, Y.; Middleton, B.A.; Tachida, H.
2010-01-01
Premise of the Study: Studies of the geographic patterns of genetic variation can give important insights into the past population structure of species. Our study species, Taxodium distichum L. (bald-cypress), prefers riparian and wetland habitats and is widely distributed in southeastern North America and Mexico. We compared the genetic variation of T. distichum with that of its close relative, Cryptomeria japonica, which is endemic to Japan. Methods: Nucleotide polymorphisms of T. distichum in the lower Mississippi River alluvial valley, USA, were examined at 10 nuclear loci. Key Results: The average nucleotide diversity at silent sites, 7sil, across the 10 loci in T. distichum was higher than that of C. japonica (7sil = 0.00732 and 0.00322, respectively). In T. distichum, Tajima's D values were each negative at 9 out of 10 loci, which suggests a recent population expansion. Maximum-likelihood and Bayesian estimations of the exponential population growth rate (g) of T. distichum populations indicated that this species had expanded approximately at the rate of 1.7 - 1.0 10 -6 per year in the past. Conclusions: Taxodium distichum had signifi cantly higher nucleotide variation than C. japonica, and its patterns of polymorphism contrasted strikingly with those of the latter, which previously has been inferred to have experienced a reduction in population size.
Nakamura, Ryohei; Uno, Ayako; Kumagai, Masahiko; Fukushima, Hiroto S.; Morishita, Shinichi; Takeda, Hiroyuki
2017-01-01
The heavily methylated vertebrate genomes are punctuated by stretches of poorly methylated DNA sequences that usually mark gene regulatory regions. It is known that the methylation state of these regions confers transcriptional control over their associated genes. Given its governance on the transcriptome, cellular functions and identity, genome-wide DNA methylation pattern is tightly regulated and evidently predefined. However, how is the methylation pattern determined in vivo remains enigmatic. Based on in silico and in vitro evidence, recent studies proposed that the regional hypomethylated state is primarily determined by local DNA sequence, e.g., high CpG density and presence of specific transcription factor binding sites. Nonetheless, the dependency of DNA methylation on nucleotide sequence has not been carefully validated in vertebrates in vivo. Herein, with the use of medaka (Oryzias latipes) as a model, the sequence dependency of DNA methylation was intensively tested in vivo. Our statistical modeling confirmed the strong statistical association between nucleotide sequence pattern and methylation state in the medaka genome. However, by manipulating the methylation state of a number of genomic sequences and reintegrating them into medaka embryos, we demonstrated that artificially conferred DNA methylation states were predominantly and robustly maintained in vivo, regardless of their sequences and endogenous states. This feature was also observed in the medaka transgene that had passed across generations. Thus, despite the observed statistical association, nucleotide sequence was unable to autonomously determine its own methylation state in medaka in vivo. Our results apparently argue against the notion of the governance on the DNA methylation by nucleotide sequence, but instead suggest the involvement of other epigenetic factors in defining and maintaining the DNA methylation landscape. Further investigation in other vertebrate models in vivo will be needed
Abbott, Jason R; Hodges, Timothy R; Daniels, R Nathan; Patel, Pratiq A; Kennedy, Jack Phillip; Howes, Jennifer E; Akan, Denis T; Burns, Michael C; Sai, Jiqing; Sobolik, Tammy; Beesetty, Yugandhar; Lee, Taekyu; Rossanese, Olivia W; Phan, Jason; Waterson, Alex G; Fesik, Stephen W
2018-06-01
Deregulated RAS activity, often the result of mutation, is implicated in approximately 30% of all human cancers. Despite this statistic, no clinically successful treatment for RAS-driven tumors has yet been developed. One approach for modulating RAS activity is to target and affect the activity of proteins that interact with RAS, such as the guanine nucleotide exchange factor (GEF) son of sevenless homologue 1 (SOS1). Here, we report on structure-activity relationships (SAR) in an indole series of compounds. Using structure-based design, we systematically explored substitution patterns on the indole nucleus, the pendant amino acid moiety, and the linker unit that connects these two fragments. Best-in-class compounds activate the nucleotide exchange process at sub-micromolar concentrations in vitro, increase levels of active RAS-GTP in HeLa cells, and elicit signaling changes in the mitogen-activated protein kinase/extracellular regulated kinase (MAPK/ERK) pathway, resulting in a decrease in pERK1/2 T202/Y204 protein levels at higher compound concentrations.
Expansion of inverted repeat does not decrease substitution rates in Pelargonium plastid genomes.
Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K
2017-04-01
For species with minor inverted repeat (IR) boundary changes in the plastid genome (plastome), nucleotide substitution rates were previously shown to be lower in the IR than the single copy regions (SC). However, the impact of large-scale IR expansion/contraction on plastid nucleotide substitution rates among closely related species remains unclear. We included plastomes from 22 Pelargonium species, including eight newly sequenced genomes, and used both pairwise and model-based comparisons to investigate the impact of the IR on sequence evolution in plastids. Ten types of plastome organization with different inversions or IR boundary changes were identified in Pelargonium. Inclusion in the IR was not sufficient to explain the variation of nucleotide substitution rates. Instead, the rate heterogeneity in Pelargonium plastomes was a mixture of locus-specific, lineage-specific and IR-dependent effects. Our study of Pelargonium plastomes that vary in IR length and gene content demonstrates that the evolutionary consequences of retaining these repeats are more complicated than previously suggested. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Zhang, Bin; Nardi, Francesco; Hull-Sanders, Helen; Wan, Xuanwu; Liu, Yinghong
2014-01-01
The complete 16,043 bp mitochondrial genome (mitogenome) of Bactrocera minax (Diptera: Tephritidae) has been sequenced. The genome encodes 37 genes usually found in insect mitogenomes. The mitogenome information for B. minax was compared to the homologous sequences of Bactrocera oleae, Bactrocera tryoni, Bactrocera philippinensis, Bactrocera carambolae, Bactrocera papayae, Bactrocera dorsalis, Bactrocera correcta, Bactrocera cucurbitae and Ceratitis capitata. The analysis indicated the structure and organization are typical of, and similar to, the nine closely related species mentioned above, although it contains the lowest genome-wide A+T content (67.3%). Four short intergenic spacers with a high degree of conservation among the nine tephritid species mentioned above and B. minax were observed, which also have clear counterparts in the control regions (CRs). Correlation analysis among these ten tephritid species revealed close positive correlation between the A+T content of zero-fold degenerate sites (P0FD), the ratio of nucleotide substitution frequency at P0FD sites to all degenerate sites (zero-fold degenerate sites, two-fold degenerate sites and four-fold degenerate sites) and amino acid sequence distance (ASD) were found. Further, significant positive correlation was observed between the A+T content of four-fold degenerate sites (P4FD) and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites; however, we found significant negative correlation between ASD and the A+T content of P4FD, and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites. A higher nucleotide substitution frequency at non-synonymous sites compared to synonymous sites was observed in nad4, the first time that has been observed in an insect mitogenome. A poly(T) stretch at the 5′ end of the CR followed by a [TA(A)]n-like stretch was also found. In addition, a highly conserved G+A-rich sequence block was observed in front of the
Ardhaoui, M; Falcimaigne, A; Ognier, S; Engasser, J M; Moussou, P; Pauly, G; Ghoul, M
2004-06-10
Rutin and esculin were enzymatically acylated with different aliphatic acids as acyl donors (fatty acids, dicarboxylic acids and omega-substituted fatty acids) by an immobilized lipase from Candida antarctica. The effect of the water content and the acyl donors pattern on the flavonoid initial acylation rate and conversion yield were investigated. The obtained results indicated that the water content of the medium has a strong effect on the performance of these reactions. The best conversion yields were reached when the water content was kept lower than 200 ppm. At low water content of the medium, these syntheses are influenced by carbon chain length and substitution pattern of the acyl donors. Higher conversion yields of esculin and rutin (>70%) were obtained with aliphatic acids having high carbon chain length (>12). Moreover, it has been found that the amine and thiol groups on omega-substituted fatty acid chain were unfavourable to these reactions. The 1H NMR and 13C NMR analyses of some synthesized esters (esculin and rutin palmitate) show that only monoesters were produced and that the esterification takes place on the primary OH of glucose moiety of the esculin and on the secondary 4"'-OH of the rhamnose residue of rutin. Copyright 2004 Elsevier B.V.
Hamasy, A; Wang, Q; Blomberg, K E M; Mohammad, D K; Yu, L; Vihinen, M; Berglöf, A; Smith, C I E
2017-01-01
Irreversible Bruton tyrosine kinase (BTK) inhibitors, ibrutinib and acalabrutinib have demonstrated remarkable clinical responses in multiple B-cell malignancies. Acquired resistance has been identified in a sub-population of patients in which mutations affecting BTK predominantly substitute cysteine 481 in the kinase domain for catalytically active serine, thereby ablating covalent binding of inhibitors. Activating substitutions in the BTK substrate phospholipase Cγ2 (PLCγ2) instead confers resistance independent of BTK. Herein, we generated all six possible amino acid substitutions due to single nucleotide alterations for the cysteine 481 codon, in addition to threonine, requiring two nucleotide substitutions, and performed functional analysis. Replacement by arginine, phenylalanine, tryptophan or tyrosine completely inactivated the catalytic activity, whereas substitution with glycine caused severe impairment. BTK with threonine replacement was catalytically active, similar to substitution with serine. We identify three potential ibrutinib resistance scenarios for cysteine 481 replacement: (1) Serine, being catalytically active and therefore predominating among patients. (2) Threonine, also being catalytically active, but predicted to be scarce, because two nucleotide changes are needed. (3) As BTK variants replaced with other residues are catalytically inactive, they presumably need compensatory mutations, therefore being very scarce. Glycine and tryptophan variants were not yet reported but likely also provide resistance. PMID:27282255
Ferrer-Orta, Cristina; de la Higuera, Ignacio; Caridi, Flavia; Sánchez-Aparicio, María Teresa; Moreno, Elena; Perales, Celia; Singh, Kamalendra; Sarafianos, Stefan G.; Sobrino, Francisco; Domingo, Esteban
2015-01-01
ABSTRACT The N-terminal region of the foot-and-mouth disease virus (FMDV) 3D polymerase contains the sequence MRKTKLAPT (residues 16 to 24) that acts as a nuclear localization signal. A previous study showed that substitutions K18E and K20E diminished the transport to the nucleus of 3D and 3CD and severely impaired virus infectivity. These residues have also been implicated in template binding, as seen in the crystal structures of different 3D-RNA elongation complexes. Here, we report the biochemical and structural characterization of different mutant polymerases harboring substitutions at residues 18 and 20, in particular, K18E, K18A, K20E, K20A, and the double mutant K18A K20A (KAKA). All mutant enzymes exhibit low RNA binding activity, low processivity, and alterations in nucleotide recognition, including increased incorporation of ribavirin monophosphate (RMP) relative to the incorporation of cognate nucleotides compared with the wild-type enzyme. The structural analysis shows an unprecedented flexibility of the 3D mutant polymerases, including both global rearrangements of the closed-hand architecture and local conformational changes at loop β9-α11 (within the polymerase motif B) and at the template-binding channel. Specifically, in 3D bound to RNA, both K18E and K20E induced the opening of new pockets in the template channel where the downstream templating nucleotide at position +2 binds. The comparisons of free and RNA-bound enzymes suggest that the structural rearrangements may occur in a concerted mode to regulate RNA replication, processivity, and fidelity. Thus, the N-terminal region of FMDV 3D that acts as a nuclear localization signal (NLS) and in template binding is also involved in nucleotide recognition and can affect the incorporation of nucleotide analogues. IMPORTANCE The study documents multifunctionality of a nuclear localization signal (NLS) located at the N-terminal region of the foot-and-mouth disease viral polymerase (3D). Amino acid
Nucleotide exchange and excision technology DNA shuffling and directed evolution.
Speck, Janina; Stebel, Sabine C; Arndt, Katja M; Müller, Kristian M
2011-01-01
Remarkable success in optimizing complex properties within DNA and proteins has been achieved by directed evolution. In contrast to various random mutagenesis methods and high-throughput selection methods, the number of available DNA shuffling procedures is limited, and protocols are often difficult to adjust. The strength of the nucleotide exchange and excision technology (NExT) DNA shuffling described here is the robust, efficient, and easily controllable DNA fragmentation step based on random incorporation of the so-called 'exchange nucleotides' by PCR. The exchange nucleotides are removed enzymatically, followed by chemical cleavage of the DNA backbone. The oligonucleotide pool is reassembled into full-length genes by internal primer extension, and the recombined gene library is amplified by standard PCR. The technique has been demonstrated by shuffling a defined gene library of chloramphenicol acetyltransferase variants using uridine as fragmentation defining exchange nucleotide. Substituting 33% of the dTTP with dUTP in the incorporation PCR resulted in shuffled clones with an average parental fragment size of 86 bases and revealed a mutation rate of only 0.1%. Additionally, a computer program (NExTProg) has been developed that predicts the fragment size distribution depending on the relative amount of the exchange nucleotide.
WEB-server for search of a periodicity in amino acid and nucleotide sequences
NASA Astrophysics Data System (ADS)
E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.
2017-12-01
A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.
Castoe, T.A.; Gu, W.; de Koning, A.P.J.; Daza, J.M.; Jiang, Z.J.; Parkinson, C.L.; Pollock, D.D.
2010-01-01
Gradients of nucleotide bias and substitution rates occur in vertebrate mitochondrial genomes due to the asymmetric nature of the replication process. The evolution of these gradients has previously been studied in detail in primates, but not in other vertebrate groups. From the primate study, the strengths of these gradients are known to evolve in ways that can substantially alter the substitution process, but it is unclear how rapidly they evolve over evolutionary time or how different they may be in different lineages or groups of vertebrates. Given the importance of mitochondrial genomes in phylogenetics and molecular evolutionary research, a better understanding of how asymmetric mitochondrial substitution gradients evolve would contribute key insights into how this gradient evolution may mislead evolutionary inferences, and how it may also be incorporated into new evolutionary models. Most snake mitochondrial genomes have an additional interesting feature, 2 nearly identical control regions, which vary among different species in the extent that they are used as origins of replication. Given the expanded sampling of complete snake genomes currently available, together with 2 additional snakes sequenced in this study, we reexamined gradient strength and CR usage in alethinophidian snakes as well as several lizards that possess dual CRs. Our results suggest that nucleotide substitution gradients (and corresponding nucleotide bias) and CR usage is highly labile over the ∼200 m.y. of squamate evolution, and demonstrates greater overall variability than previously shown in primates. The evidence for the existence of such gradients, and their ability to evolve rapidly and converge among unrelated species suggests that gradient dynamics could easily mislead phylogenetic and molecular evolutionary inferences, and argues strongly that these dynamics should be incorporated into phylogenetic models. PMID:20215734
Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens.
Weiß, Clemens L; Schuenemann, Verena J; Devos, Jane; Shirsekar, Gautam; Reiter, Ella; Gould, Billie A; Stinchcombe, John R; Krause, Johannes; Burbano, Hernán A
2016-06-01
Herbaria archive a record of changes of worldwide plant biodiversity harbouring millions of specimens that contain DNA suitable for genome sequencing. To profit from this resource, it is fundamental to understand in detail the process of DNA degradation in herbarium specimens. We investigated patterns of DNA fragmentation and nucleotide misincorporation by analysing 86 herbarium samples spanning the last 300 years using Illumina shotgun sequencing. We found an exponential decay relationship between DNA fragmentation and time, and estimated a per nucleotide fragmentation rate of 1.66 × 10(-4) per year, which is six times faster than the rate estimated for ancient bones. Additionally, we found that strand breaks occur specially before purines, and that depurination-driven DNA breakage occurs constantly through time and can to a great extent explain decreasing fragment length over time. Similar to what has been found analysing ancient DNA from bones, we found a strong correlation between the deamination-driven accumulation of cytosine to thymine substitutions and time, which reinforces the importance of substitution patterns to authenticate the ancient/historical nature of DNA fragments. Accurate estimations of DNA degradation through time will allow informed decisions about laboratory and computational procedures to take advantage of the vast collection of worldwide herbarium specimens.
Lin, Chung-Jian; Huang, Chi-Chung; Huang, Chao-Ching; Chiang, Yu-Chung; Chiang, Tzen-Yuh
2012-01-01
Background Pinus massoniana, an ecologically and economically important conifer, is widespread across central and southern mainland China and Taiwan. In this study, we tested the central–marginal paradigm that predicts that the marginal populations tend to be less polymorphic than the central ones in their genetic composition, and examined a founders' effect in the island population. Methodology/Principal Findings We examined the phylogeography and population structuring of the P. massoniana based on nucleotide sequences of cpDNA atpB-rbcL intergenic spacer, intron regions of the AdhC2 locus, and microsatellite fingerprints. SAMOVA analysis of nucleotide sequences indicated that most genetic variants resided among geographical regions. High levels of genetic diversity in the marginal populations in the south region, a pattern seemingly contradicting the central–marginal paradigm, and the fixation of private haplotypes in most populations indicate that multiple refugia may have existed over the glacial maxima. STRUCTURE analyses on microsatellites revealed that genetic structure of mainland populations was mediated with recent genetic exchanges mostly via pollen flow, and that the genetic composition in east region was intermixed between south and west regions, a pattern likely shaped by gene introgression and maintenance of ancestral polymorphisms. As expected, the small island population in Taiwan was genetically differentiated from mainland populations. Conclusions/Significance The marginal populations in south region possessed divergent gene pools, suggesting that the past glaciations might have low impacts on these populations at low latitudes. Estimates of ancestral population sizes interestingly reflect a recent expansion in mainland from a rather smaller population, a pattern that seemingly agrees with the pollen record. PMID:22952747
Karro, J E; Peifer, M; Hardison, R C; Kollmann, M; von Grünberg, H H
2008-02-01
The distribution of guanine and cytosine nucleotides throughout a genome, or the GC content, is associated with numerous features in mammals; understanding the pattern and evolutionary history of GC content is crucial to our efforts to annotate the genome. The local GC content is decaying toward an equilibrium point, but the causes and rates of this decay, as well as the value of the equilibrium point, remain topics of debate. By comparing the results of 2 methods for estimating local substitution rates, we identify 620 Mb of the human genome in which the rates of the various types of nucleotide substitutions are the same on both strands. These strand-symmetric regions show an exponential decay of local GC content at a pace determined by local substitution rates. DNA segments subjected to higher rates experience disproportionately accelerated decay and are AT rich, whereas segments subjected to lower rates decay more slowly and are GC rich. Although we are unable to draw any conclusions about causal factors, the results support the hypothesis proposed by Khelifi A, Meunier J, Duret L, and Mouchiroud D (2006. GC content evolution of the human and mouse genomes: insights from the study of processed pseudogenes in regions of different recombination rates. J Mol Evol. 62:745-752.) that the isochore structure has been reshaped over time. If rate variation were a determining factor, then the current isochore structure of mammalian genomes could result from the local differences in substitution rates. We predict that under current conditions strand-symmetric portions of the human genome will stabilize at an average GC content of 30% (considerably less than the current 42%), thus confirming that the human genome has not yet reached equilibrium.
Ferrer-Orta, Cristina; de la Higuera, Ignacio; Caridi, Flavia; Sánchez-Aparicio, María Teresa; Moreno, Elena; Perales, Celia; Singh, Kamalendra; Sarafianos, Stefan G; Sobrino, Francisco; Domingo, Esteban; Verdaguer, Nuria
2015-07-01
The N-terminal region of the foot-and-mouth disease virus (FMDV) 3D polymerase contains the sequence MRKTKLAPT (residues 16 to 24) that acts as a nuclear localization signal. A previous study showed that substitutions K18E and K20E diminished the transport to the nucleus of 3D and 3CD and severely impaired virus infectivity. These residues have also been implicated in template binding, as seen in the crystal structures of different 3D-RNA elongation complexes. Here, we report the biochemical and structural characterization of different mutant polymerases harboring substitutions at residues 18 and 20, in particular, K18E, K18A, K20E, K20A, and the double mutant K18A K20A (KAKA). All mutant enzymes exhibit low RNA binding activity, low processivity, and alterations in nucleotide recognition, including increased incorporation of ribavirin monophosphate (RMP) relative to the incorporation of cognate nucleotides compared with the wild-type enzyme. The structural analysis shows an unprecedented flexibility of the 3D mutant polymerases, including both global rearrangements of the closed-hand architecture and local conformational changes at loop β9-α11 (within the polymerase motif B) and at the template-binding channel. Specifically, in 3D bound to RNA, both K18E and K20E induced the opening of new pockets in the template channel where the downstream templating nucleotide at position +2 binds. The comparisons of free and RNA-bound enzymes suggest that the structural rearrangements may occur in a concerted mode to regulate RNA replication, processivity, and fidelity. Thus, the N-terminal region of FMDV 3D that acts as a nuclear localization signal (NLS) and in template binding is also involved in nucleotide recognition and can affect the incorporation of nucleotide analogues. The study documents multifunctionality of a nuclear localization signal (NLS) located at the N-terminal region of the foot-and-mouth disease viral polymerase (3D). Amino acid substitutions at this
Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai
2010-01-01
DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705
NASA Technical Reports Server (NTRS)
Kozlov, I. A.; Orgel, L. E.; Bada, J. L. (Principal Investigator)
1999-01-01
The template-directed oligomerization of nucleoside-5'-phosphoro-2-methyl imidazolides on standard oligonucleotide templates has been studied extensively. Here, we describe experiments with templates in which inosinic acid (I) is substituted for guanylic acid, or 2,6-diaminopurine nucleotide (D) for adenylic acid. We find that the substitution of I for G in a template is strongly inhibitory and prevents any incorporation of C into internal positions in the oligomeric products of the reaction. The substitution of D for A, on the contrary, leads to increased incorporation of U into the products. We found no evidence for the template-directed facilitation of oligomerization of A or I through A-I base pairing. The significance of these results for prebiotic chemistry is discussed.
He, Daniel; Lorenz, Robin; Kim, Choel; Herberg, Friedrich W; Lim, Chinten James
2017-12-15
The cyclic adenosine monophosphate (cAMP)- and cyclic guanosine monophosphate (cGMP)-dependent protein kinases (PKA and PKG) are key effectors of cyclic nucleotide signaling. Both share structural features that include tandem cyclic nucleotide-binding (CNB) domains, CNB-A and CNB-B, yet their functions are separated through preferential activation by either cAMP or cGMP. Based on structural studies and modeling, key CNB contact residues have been identified for both kinases. In this study, we explored the requirements for conversion of PKA activation from cAMP-dependent to cGMP-dependent. The consequences of the residue substitutions T192R/A212T within CNB-A or G316R/A336T within CNB-B of PKA-RIα on cyclic nucleotide binding and holoenzyme activation were assessed in vitro using purified recombinant proteins, and ex vivo using RIα-deficient mouse embryonic fibroblasts genetically reconstituted with wild-type or mutant PKA-RIα. In vitro, a loss of binding and activation selectivity was observed when residues in either one of the CNB domains were mutated, while mutations in both CNB domains resulted in a complete switch of selectivity from cAMP to cGMP. The switch in selectivity was also recapitulated ex vivo, confirming their functional roles in cells. Our results highlight the importance of key cyclic nucleotide contacts within each CNB domain and suggest that these domains may have evolved from an ancestral gene product to yield two distinct cyclic nucleotide-dependent protein kinases.
2017-01-01
Synthetic analogs of natural nucleotides have long been utilized for structural studies of canonical and noncanonical nucleic acids, including the extensively investigated polymorphic G-quadruplexes (GQs). Dependence on the sequence and nucleotide modifications of the folding landscape of GQs has been reviewed by several recent studies. Here, an overview is compiled on the thermodynamic stability of the modified GQ folds and on how the stereochemical preferences of more than 70 synthetic and natural derivatives of nucleotides substituting for natural ones determine the stability as well as the conformation. Groups of nucleotide analogs only stabilize or only destabilize the GQ, while the majority of analogs alter the GQ stability in both ways. This depends on the preferred syn or anti N-glycosidic linkage of the modified building blocks, the position of substitution, and the folding architecture of the native GQ. Natural base lesions and epigenetic modifications of GQs explored so far also stabilize or destabilize the GQ assemblies. Learning the effect of synthetic nucleotide analogs on the stability of GQs can assist in engineering a required stable GQ topology, and exploring the in vitro action of the single and clustered natural base damage on GQ architectures may provide indications for the cellular events. PMID:29181193
Trento, Alfonsina; Viegas, Mariana; Galiano, Mónica; Videla, Cristina; Carballal, Guadalupe; Mistchenko, Alicia S.; Melero, José A.
2006-01-01
A total of 47 clinical samples were identified during an active surveillance program of respiratory infections in Buenos Aires (BA) (1999 to 2004) that contained sequences of human respiratory syncytial virus (HRSV) with a 60-nucleotide duplication in the attachment (G) protein gene. This duplication was analogous to that previously described for other three viruses also isolated in Buenos Aires in 1999 (A. Trento et al., J. Gen. Virol. 84:3115-3120, 2003). Phylogenetic analysis indicated that BA sequences with that duplication shared a common ancestor (dated about 1998) with other HRSV G sequences reported worldwide after 1999. The duplicated nucleotide sequence was an exact copy of the preceding 60 nucleotides in early viruses, but both copies of the duplicated segment accumulated nucleotide substitutions in more recent viruses at a rate apparently higher than in other regions of the G protein gene. The evolution of the viruses with the duplicated G segment apparently followed the overall evolutionary pattern previously described for HRSV, and this genotype has replaced other prevailing antigenic group B genotypes in Buenos Aires and other places. Thus, the duplicated segment represents a natural tag that can be used to track the dissemination and evolution of HRSV in an unprecedented setting. We have taken advantage of this situation to reexamine the molecular epidemiology of HRSV and to explore the natural history of this important human pathogen. PMID:16378999
Sattath, Shmuel; Elyashiv, Eyal; Kolodny, Oren; Rinott, Yosef; Sella, Guy
2011-02-10
In Drosophila, multiple lines of evidence converge in suggesting that beneficial substitutions to the genome may be common. All suffer from confounding factors, however, such that the interpretation of the evidence-in particular, conclusions about the rate and strength of beneficial substitutions-remains tentative. Here, we use genome-wide polymorphism data in D. simulans and sequenced genomes of its close relatives to construct a readily interpretable characterization of the effects of positive selection: the shape of average neutral diversity around amino acid substitutions. As expected under recurrent selective sweeps, we find a trough in diversity levels around amino acid but not around synonymous substitutions, a distinctive pattern that is not expected under alternative models. This characterization is richer than previous approaches, which relied on limited summaries of the data (e.g., the slope of a scatter plot), and relates to underlying selection parameters in a straightforward way, allowing us to make more reliable inferences about the prevalence and strength of adaptation. Specifically, we develop a coalescent-based model for the shape of the entire curve and use it to infer adaptive parameters by maximum likelihood. Our inference suggests that ∼13% of amino acid substitutions cause selective sweeps. Interestingly, it reveals two classes of beneficial fixations: a minority (approximately 3%) that appears to have had large selective effects and accounts for most of the reduction in diversity, and the remaining 10%, which seem to have had very weak selective effects. These estimates therefore help to reconcile the apparent conflict among previously published estimates of the strength of selection. More generally, our findings provide unequivocal evidence for strongly beneficial substitutions in Drosophila and illustrate how the rapidly accumulating genome-wide data can be leveraged to address enduring questions about the genetic basis of adaptation.
Walker, S C; Helm, P A; Lavery, L A
1997-08-01
To evaluate the ability of diabetic and nondiabetic individuals to learn to use a lower extremity sensory substitution device to cue gait pattern changes. Case-control study. Gait laboratory. Thirty diabetic persons and 20 age- and education-matched nondiabetic controls responded to advertisements for study participation. Participants walked on a treadmill at three speeds (1, 2, and 2.5mph) with auditory sensory feedback to cue ground contact greater than 80% duration of baseline. The variables measured included gait cycle (steps per minute) and number of times per minute that any step during a trial exceeded 80% duration of ground contacted compared with a measured baseline step length for each speed. Persons in both groups were able to rapidly and significantly alter their gait patterns in response to signals from the sensory substitution device, by changing their gait cycles (nondiabetic group, F(17,124) = 5.27, p < .001; diabetic group, F(5,172) = 3.45, p < .001). Post hoc analyses showed early gait cycle modification and error reduction among both groups. The nondiabetic group learned to use the device significantly more quickly than the diabetic group during the slow (1mph, t = 3.57, p < .001) and average (2mph, t = 2.97, p < .05) trials. By the fast (2.5mph) ambulation trial, both groups were performing equally, suggesting a rapid rate of adjustment to the device. No technical failures from gait trainer malfunction occurred during the study. Diabetic persons with neuropathy effectively used lower extremity sensory substitution, and the technology is now available to manufacture a durable, effective lower extremity sensory substitution system.
Patterns of purine nucleotides in fish erythrocytes.
Leray, C
1979-01-01
1. The purine nucleotides were determined in the whole blood of 9 fresh water teleosts and 2 marine selachians. 2. GTP and ATP accounted for 88-99% of the total erythrocytes purines. 3. The ATP/ADP ratio ranged from 11 to 60 in the erythrocytes of the fish examined. 4. GTP is widely distributed in fish erythrocytes but its level ranged from 1 to 33 nmol/mg Hb (0.4 to 9 mumol/ml erythrocyte). 5. Lepomis and Esox exhibited a GTP/ATP ratio as elevated as in Anguilla; moreover the concentration of GTP per mol of Hb (physiologically most indicative) is higher in Lepomis, Esox, Ictalurus and Silurus than in Anguilla.
Harmsen, Tim; Klaasen, Sjoerd; van de Vrugt, Henri; te Riele, Hein
2018-01-01
Abstract Single-stranded oligodeoxyribonucleotide (ssODN)-mediated repair of CRISPR/Cas9-induced DNA double-strand breaks (DSB) can effectively be used to introduce small genomic alterations in a defined locus. Here, we reveal DNA mismatch repair (MMR) activity is crucial for efficient nucleotide substitution distal from the Cas9-induced DNA break when the substitution is instructed by the 3′ half of the ssODN. Furthermore, protecting the ssODN 3′ end with phosphorothioate linkages enhances MMR-dependent gene editing events. Our findings can be exploited to optimize efficiencies of nucleotide substitutions distal from the DSB and imply that oligonucleotide-mediated gene editing is effectuated by templated break repair. PMID:29447381
Cytosine substituted calix[4]pyrroles: Neutral receptors for 5′-guanosine monophosphate
Sessler, Jonathan L.; Král, Vladimír; Shishkanova, Tatiana V.; Gale, Philip A.
2002-01-01
The synthesis and characterization of two cytosine-substituted calix[4]pyrrole conjugates, bearing the appended cytosine attached at either a β- or meso-pyrrolic position, is described. These systems were tested as nucleotide-selective carriers and as active components of nucleotide-sensing ion-selective electrodes at pH 6.6. Studies of carrier selectivity were made using a Pressman-type model membrane system consisting of an initial pH 6.0 aqueous phase, an intervening dichloromethane barrier containing the calix[4]pyrrole conjugate, and a receiving basic aqueous phase. Good selectivity for the Watson–Crick complementary nucleotide, 5′-guanosine monophosphate (5′-GMP), was seen in the case of the meso-linked conjugate with the relative rates of through-membrane transport being 7.7:4.1:1 for 5′-GMP, 5′-AMP, and 5′-CMP, respectively. By contrast, the β-substituted conjugate, while showing a selectivity for 5′-GMP that was enhanced relative to unsubstituted calix[4]pyrrole, was found to transport 5′-CMP roughly 4.5 times more quickly than 5′-GMP. Higher selectivities were also found for 5′-CMP when both the β- and meso-substituted conjugates were incorporated into polyvinyl chloride membranes and tested as ion selective electrodes at pH 6.6, whereas near-equal selectivities were observed for 5′-CMP and 5′-GMP in the case of unsubstituted calix[4]pyrroles. These seemingly disparate results are consistent with a picture wherein the meso-substituted cytosine calix[4]pyrrole conjugate, but not its β-linked congener, is capable of acting as a ditopic receptor, binding concurrently both the phosphate anion and nucleobase portions of 5′-GMP to the calixpyrrole core and cytosine “tails” of the molecule, respectively, with the effect of this binding being most apparent under the conditions of the transport experiments. PMID:11929967
Srinivasan, A R; Yathindra, N
1977-01-01
A novel description of the conformational characteristics of all the individual nucleotides and the phosphodiesters in tRNAs is presented in the form of a circular plot. This representation furnishes information of the base sequence with the folding patterns of the polynucleotide chain as one traverses along the circumference and with the individual nucleotide and phosphodiester linkage torsions along the radii. The circular plot obtained for yeast tRNAPhe strikingly distinguishes the helical and the loop regions. The variation of the different nucleotide torsions along the entire chain length and their effect on the secondary helical and tertiary loop regions become readily apparent. PMID:339206
Le, Thi Huong; Dao, Quang-Duy; Nghiêm, Mai-Phuong; Péralta, Sébastien; Guillot, Regis; Pham, Quoc Nghi; Fujii, Akihiko; Ozaki, Masanori; Goubard, Fabrice; Bui, Thanh-Tuân
2018-04-25
Two readily accessible thienothiophene-triphenylamine charge-transport materials have been synthesized by simply varying the substitution pattern of the triphenylamine groups on a central thienothiophene π-linker. The impact of the substitution pattern on the thermal, photoelectrochemical, and photovoltaic properties of these materials was evaluated and, based on theoretical and experimental studies, we found that the isomer in which the triphenylamine groups were located at the 2,5-positions of the thienothiophene core (TT-2,5-TPA) had better π-conjugation than the 3,6-isomer (TT-3,6-TPA). Whilst the thermal, morphological, and hydrophobic properties of the two materials were similar, their optoelectrochemical and photovoltaic properties were noticeably impacted. When applied as hole-transport materials in hybrid perovskite solar cells, the 2,5-isomer exhibited a power-conversion efficiency of 13.6 %, much higher than that of its 3,6-counterpart (0.7 %) under the same standard conditions. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition
NASA Astrophysics Data System (ADS)
Štambuk, Nikola
The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.
Analyzing generic and branded substitution patterns in the Netherlands using prescription data.
Pechlivanoglou, Petros; van der Veen, Willem Jan; Bos, Jens H; Postma, Maarten J
2011-04-27
As in other societies, pharmaceutical expenditures in the Netherlands are rising every year. As a consequence, needs for cost control are often expressed. One possible solution for cost control could come through increasing generic substitution by pharmacists. We aim to analyse the extent and nature of substitution in recent years and estimate the likelihood of generic or branded substitution in Dutch pharmacies in relation to various characteristics. We utilized a linked prescription dataset originating from a general practitioner (GP) and a pharmacy database, both from the northern Netherlands. We selected specific drugs of interest, containing about 55,000 prescriptions from 15 different classes. We used a crossed generalized linear mixed model to estimate the effects that certain patient and pharmacy characteristics as well as timing have on the likelihood that a prescription will eventually be substituted by the pharmacist. Generic substitution occurred at 25% of the branded prescriptions. Generic substitution was more likely to occur earlier in time after patent expiry and to patients that were older and more experienced in their drug use. Individually owned pharmacies had a lower probability of generic substitution compared to chain pharmacies. Oppositely, branded substitution occurred in 10% of generic prescriptions and was positively related to the patients' experience in branded use. Individually owned pharmacies were more likely to substitute a generic drug to a branded compared to other pharmacies. Antidepressant and PPI prescriptions were less prone to generic and more prone to branded substitution. Analysis of prescription substitution by the pharmacist revealed strong relations between substitution and patient experience on drug use, pharmacy status and timing. These findings can be utilised to design further strategies to enhance generic substitution.
Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro
2016-01-01
Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874
Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S
2008-02-01
This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.
García Marrero, Danny E; Glasser, Wolfgang G; Pizzi, Antonio; Paczkowski, Sebastian; Laborie, Marie-Pierre G
2014-10-01
The structure of condensed tannins (CTs) from Pinus pinaster bark extract and their hydroxypropylated derivatives with four degrees of substitution (DS 1, 2, 3 and 4) has been characterized for the first time using negative-ion mode electrospray ionization tandem mass spectrometry (ESI(-)-MS/MS). The results showed that P. pinaster bark CTs possess structural homogeneity in terms of monomeric units (C(15), catechin). The oligomer sizes were detected to be dimers to heptamers. The derivatives showed typical phenyl-propyl ether mass fragmentation by substituent elimination (58 amu) and inherent C(15) flavonoid fissions. The relative abundance of the product ions revealed a preferential triple, tetra-/penta- and octa- hydroxypropylation substitution pattern in the monomer, dimer and trimer derivatives, respectively. A defined order of -OH reactivity towards propylene oxide was established by means of multistage experiments (A-ring ≥ B-ring > C-ring). A high structural heterogeneity of the modified oligomers was detected. Copyright © 2014 John Wiley & Sons, Ltd.
USDA-ARS?s Scientific Manuscript database
The soybean (Glycine max (L.) Merr.) chlorophyll deficient line MinnGold is a spontaneous mutant characterized by yellow foliage. Map-based cloning and transgenic complementation revealed that the mutant phenotype is caused by a non-synonymous nucleotide substitution in the third exon of a Mg-chelat...
Nucleotide variation in genes invloved in wood formation in two pine species
David Pot; Lisa McMillan; Craig Echt; Gregoire Le Provost; Pauline Garnier-Gere; Sheree Cato; Christophe Plomion
2005-01-01
Nucleotide diversity in eight genes related to wood formation was investigated in two pine species, Pinus pinaster and P. radiata. The nucleotide diversity patterns observed and their properties were compared between the two species according to the specific characteristics of the samples analysed. A lower diversity was observed in P. radiata...
Kulshrestha, Aman; Schomaker, Jennifer M.; Holmes, Daniel; Staples, Richard J.; Jackson, James E.; Borhan, Babak
2014-01-01
Good to excellent stereo-selectivity has been found in the addition reactions of Grignard and organo-zinc reagents to N-protected aziridine-2-carboxaldehydes. Specifically, high syn selectivity was obtained with benzyl-protected cis, tert-butyloxycar-bonyl-protected trans, and tosyl-pro-tected 2,3-disubstituted aziridine-2-car-boxaldehydes. Furthermore, rate and selectivity effects of ring substituents, temperature, solvent, and Lewis acid and base modifiers were studied. The diastereomeric preference of addition is dominated by the substrate aziri-dines’ substitution pattern and especially the electronic character and conformational preferences of the nitrogen protecting groups. To help rationalize the observed stereochemical outcomes, conformational and electronic structural analyses of a series of model systems representing the various substitution patterns have been explored by density functional calculations at the B3LYP/6–31G* level of theory with the SM8 solvation model to account for solvent effects. PMID:21928447
Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu
2014-10-01
Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.
Seligmann, Hervé
2013-05-07
GenBank's EST database includes RNAs matching exactly human mitochondrial sequences assuming systematic asymmetric nucleotide exchange-transcription along exchange rules: A→G→C→U/T→A (12 ESTs), A→U/T→C→G→A (4 ESTs), C→G→U/T→C (3 ESTs), and A→C→G→U/T→A (1 EST), no RNAs correspond to other potential asymmetric exchange rules. Hypothetical polypeptides translated from nucleotide-exchanged human mitochondrial protein coding genes align with numerous GenBank proteins, predicted secondary structures resemble their putative GenBank homologue's. Two independent methods designed to detect overlapping genes (one based on nucleotide contents analyses in relation to replicative deamination gradients at third codon positions, and circular code analyses of codon contents based on frame redundancy), confirm nucleotide-exchange-encrypted overlapping genes. Methods converge on which genes are most probably active, and which not, and this for the various exchange rules. Mean EST lengths produced by different nucleotide exchanges are proportional to (a) extents that various bioinformatics analyses confirm the protein coding status of putative overlapping genes; (b) known kinetic chemistry parameters of the corresponding nucleotide substitutions by the human mitochondrial DNA polymerase gamma (nucleotide DNA misinsertion rates); (c) stop codon densities in predicted overlapping genes (stop codon readthrough and exchanging polymerization regulate gene expression by counterbalancing each other). Numerous rarely expressed proteins seem encoded within regular mitochondrial genes through asymmetric nucleotide exchange, avoiding lengthening genomes. Intersecting evidence between several independent approaches confirms the working hypothesis status of gene encryption by systematic nucleotide exchanges. Copyright © 2013 Elsevier Ltd. All rights reserved.
Convergent evolution of marine mammals is associated with distinct substitutions in common genes
Zhou, Xuming; Seim, Inge; Gladyshev, Vadim N.
2015-01-01
Phenotypic convergence is thought to be driven by parallel substitutions coupled with natural selection at the sequence level. Multiple independent evolutionary transitions of mammals to an aquatic environment offer an opportunity to test this thesis. Here, whole genome alignment of coding sequences identified widespread parallel amino acid substitutions in marine mammals; however, the majority of these changes were not unique to these animals. Conversely, we report that candidate aquatic adaptation genes, identified by signatures of likelihood convergence and/or elevated ratio of nonsynonymous to synonymous nucleotide substitution rate, are characterized by very few parallel substitutions and exhibit distinct sequence changes in each group. Moreover, no significant positive correlation was found between likelihood convergence and positive selection in all three marine lineages. These results suggest that convergence in protein coding genes associated with aquatic lifestyle is mainly characterized by independent substitutions and relaxed negative selection. PMID:26549748
Hartl, Daniel L.
2008-01-01
Simple models of molecular evolution assume that sequences evolve by a Poisson process in which nucleotide or amino acid substitutions occur as rare independent events. In these models, the expected ratio of the variance to the mean of substitution counts equals 1, and substitution processes with a ratio greater than 1 are called overdispersed. Comparing the genomes of 10 closely related species of Drosophila, we extend earlier evidence for overdispersion in amino acid replacements as well as in four-fold synonymous substitutions. The observed deviation from the Poisson expectation can be described as a linear function of the rate at which substitutions occur on a phylogeny, which implies that deviations from the Poisson expectation arise from gene-specific temporal variation in substitution rates. Amino acid sequences show greater temporal variation in substitution rates than do four-fold synonymous sequences. Our findings provide a general phenomenological framework for understanding overdispersion in the molecular clock. Also, the presence of substantial variation in gene-specific substitution rates has broad implications for work in phylogeny reconstruction and evolutionary rate estimation. PMID:18480070
Maltseva, E A; Krasikova, Y S; Naegeli, H; Lavrik, O I; Rechkunova, N I
2014-06-01
Xeroderma pigmentosum factor A (XPA) is one of the key proteins in the nucleotide excision repair (NER) process. The effects of point substitutions in the DNA-binding domain of XPA (positively charged lysine residues replaced by negatively charged glutamate residues: XPA K204E, K179E, K141E, and tandem mutant K141E/K179E) on the interaction of the protein with DNA structures modeling intermediates of the damage recognition and pre-incision stages in NER were analyzed. All these mutations decreased the affinity of the protein to DNA, the effect depending on the substitution and the DNA structure. The mutant as well as wild-type proteins bind with highest efficiency partly open damaged DNA duplex, and the affinity of the mutants to this DNA is reduced in the order: K204E > K179E > K141E = K141/179E. For all the mutants, decrease in DNA binding efficiency was more pronounced in the case of full duplex and single-stranded DNA than with bubble-DNA structure, the difference between protein affinities to different DNA structures increasing as DNA binding activity of the mutant decreased. No effect of the studied XPA mutations on the location of the protein on the partially open DNA duplex was observed using photoinduced crosslinking with 5-I-dUMP in different positions of the damaged DNA strand. These results combined with earlier published data suggest no direct correlation between DNA binding and activity in NER for these XPA mutants.
USDA-ARS?s Scientific Manuscript database
Background: Serovars of the human pathogen Chlamydia trachomatis occupy one of three specific tissue niches. Genomic analyses indicate that the serovars have a phylogeny congruent with their pathobiology and have an average substitution rate of less than one nucleotide per kilobase. The ompA gene, h...
Robinson, P J; Cranenburgh, R M; Head, I M; Robinson, N J
1997-04-01
The sequence 5'-GCGATCGC-3', designated HIP1, for highly iterated palindrome, was first identified at the borders of a gene-deletion event and subsequently shown to constitute up to 2.5% of the DNA in some cyanobacteria. It is now reported that HIP1 is polyphyletic, occurring in several distinct cyanobacterial lineages and not defining a clade. HIP1 does not introduce gaps into sequence alignments. It aligns with partial HIP1 sites in related sequences showing that it propagates by nucleotide substitutions rather than insertion. Constructs have been created to determine the frequencies at which deletion events occur between palindromes located within the selectable marker neo. Deletion between HIP1 sites was more frequent in Synechococcus PCC 7942 than deletion between control palindromes, 5'-CCGATCGG-3', designated PAL0. However, this is not due to a recombinase that recognises HIP1 and is peculiar to cyanobacteria because similar deletion frequencies were detected in Escherichia coli. Furthermore, the frequency of deletion of DNA flanked asymmetrically by one HIP1 site and one PAL0 site was less than the frequency of deletion of DNA flanked asymmetrically by identical copies of either palindrome. This is consistent with deletion by copy-choice.
Acid-soluble nucleotides of pinto bean leaves at different stages of development.
Weinstein, L H; McCune, D C; Mancini, J F; van Leuken, P
1969-11-01
Acid-soluble nucleotides of unifoliate leaves of Pinto bean plants (Phaseolus vulgaris L.) were determined at young, mature, and senescent stages of development. At least 25 components could be distinguished on the basis of inorganic phosphorus determinations and 37 or more fractions on the basis of (32)P labeling, with adenosine di- and triphosphates accounting for 60% of the total moles of nucleotide. The total nucleotide P and inorganic P, on a fresh weight basis, decreased about 44% between each stage of leaf development, but decrements in the levels of individual nucleotides varied from this over-all pattern.Minor changes in the relative abundance of the individual nucleotides accompanied aging although the percentage of purine-containing nucleotides decreased with age. Total (32)P activity per leaf in the nucleotide pool increased about 3-fold between the young and mature leaves and decreased slightly as leaves became senescent. In general, the specific activities of the nucleotides increased with increased age and adenosine-, guanosine-, uridine-, and cytidine triphosphates and adenosine diphosphate accounted for approximately 90% of the total activity. The changes in the relative sizes and energy status of the nucleotide pools were not so obvious as the changes in other metabolites that have been reported to accompany aging in leaf tissue.
Aryl substitution of pentacenes
Waterloo, Andreas R; Sale, Anna-Chiara; Lehnherr, Dan; Hampel, Frank
2014-01-01
Summary A series of 11 new pentacene derivatives has been synthesized, with unsymmetrical substitution based on a trialkylsilylethynyl group at the 6-position and various aryl groups appended to the 13-position. The electronic and physical properties of the new pentacene chromophores have been analyzed by UV–vis spectroscopy (solution and thin films), thermoanalytical methods (DSC and TGA), cyclic voltammetry, as well as X-ray crystallography (for 8 derivatives). X-ray crystallography has been specifically used to study the influence of unsymmetrical substitution on the solid-state packing of the pentacene derivatives. The obtained results add to our ability to better predict substitution patterns that might be helpful for designing new semiconductors for use in solid-state devices. PMID:25161729
Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V
2015-03-04
Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.
Control of total GFP expression by alterations to the 3′ region nucleotide sequence
2013-01-01
Background Previously, we distinguished the Escherichia coli type II cytoplasmic membrane translocation pathways of Tat, Yid, and Sec for unfolded and folded soluble target proteins. The translocation of folded protein to the periplasm for soluble expression via the Tat pathway was controlled by an N-terminal hydrophilic leader sequence. In this study, we investigated the effect of the hydrophilic C-terminal end and its nucleotide sequence on total and soluble protein expression. Results The native hydrophilic C-terminal end of GFP was obtained by deleting the C-terminal peptide LeuGlu-6×His, derived from pET22b(+). The corresponding clones induced total and soluble GFP expression that was either slightly increased or dramatically reduced, apparently through reconstruction of the nucleotide sequence around the stop codon in the 3′ region. In the expression-induced clones, the hydrophilic C-terminus showed increased Tat pathway specificity for soluble expression. However, in the expression-reduced clone, after analyzing the role of the 5′ poly(A) coding sequence with a substituted synonymous codon, we proved that the longer 5′ poly(A) coding sequence interacted with the reconstructed 3′ region nucleotide sequence to create a new mRNA tertiary structure between the 5′ and 3′ regions, which resulted in reduced total GFP expression. Further, to recover the reduced expression by changing the 3′ nucleotide sequence, after replacing selected C-terminal 5′ codons and the stop codon in the ORF with synonymous codons, total GFP expression in most of the clones was recovered to the undeleted control level. The insertion of trinucleotides after the stop codon in the 3′-UTR recovered or reduced total GFP expression. RT-PCR revealed that the level of total protein expression was controlled by changes in translational or transcriptional regulation, which were induced or reduced by the substitution or insertion of 3′ region nucleotides. Conclusions We found
2014-01-01
Background During the domestication of crops, individual plants with traits desirable for human needs have been selected from their wild progenitors. Consequently, genetic and nucleotide diversity of genes associated with these selected traits in crop plants are expected to be lower than their wild progenitors. In the present study, we surveyed the pattern of nucleotide diversity of two selected trait specific genes, Wx and OsC1, which regulate amylose content and apiculus coloration respectively in cultivated rice varieties. The analyzed samples were collected from a wide geographic area in Northeast (NE) India, and included contrasting phenotypes considered to be associated with selected genes, namely glutinous and nonglutinous grains and colored and colorless apiculus. Results No statistically significant selection signatures were detected in both Wx and OsC1gene sequences. However, low level of selection that varied across the length of each gene was evident. The glutinous type varieties showed higher levels of nucleotide diversity at the Wx locus (πtot = 0.0053) than nonglutinous type varieties (πtot = 0.0043). The OsC1 gene revealed low levels of selection among the colorless apiculus varieties with lower nucleotide diversity (πtot = 0.0010) than in the colored apiculus varieties (πtot = 0.0023). Conclusions The results revealed that functional mutations at Wx and OsC1genes considered to be associated with specific phenotypes do not necessarily correspond to the phenotypes in indigenous rice varieties in NE India. This suggests that other than previously reported genomic regions may also be involved in determination of these phenotypes. PMID:24935343
Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu
2013-01-01
A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sakoyama, Y.; Hong, K.J.; Byun, S.M.
To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: themore » mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.« less
Hunt, C; Morimoto, R I
1985-01-01
We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075
Abasic pivot substitution harnesses target specificity of RNA interference
Lee, Hye-Sook; Seok, Heeyoung; Lee, Dong Ha; Ham, Juyoung; Lee, Wooje; Youm, Emilia Moonkyung; Yoo, Jin Seon; Lee, Yong-Seung; Jang, Eun-Sook; Chi, Sung Wook
2015-01-01
Gene silencing via RNA interference inadvertently represses hundreds of off-target transcripts. Because small interfering RNAs (siRNAs) can function as microRNAs, avoiding miRNA-like off-target repression is a major challenge. Functional miRNA–target interactions are known to pre-require transitional nucleation, base pairs from position 2 to the pivot (position 6). Here, by substituting nucleotide in pivot with abasic spacers, which prevent base pairing and alleviate steric hindrance, we eliminate miRNA-like off-target repression while preserving on-target activity at ∼80–100%. Specifically, miR-124 containing dSpacer pivot substitution (6pi) loses seed-mediated transcriptome-wide target interactions, repression activity and biological function, whereas other conventional modifications are ineffective. Application of 6pi allows PCSK9 siRNA to efficiently lower plasma cholesterol concentration in vivo, and abolish potentially deleterious off-target phenotypes. The smallest spacer, C3, also shows the same improvement in target specificity. Abasic pivot substitution serves as a general means to harness the specificity of siRNA experiments and therapeutic applications. PMID:26679372
Silva-Junior, Orzenil B; Grattapaglia, Dario
2015-11-01
We used high-density single nucleotide polymorphism (SNP) data and whole-genome pooled resequencing to examine the landscape of population recombination (ρ) and nucleotide diversity (ϴw ), assess the extent of linkage disequilibrium (r(2) ) and build the highest density linkage maps for Eucalyptus. At the genome-wide level, linkage disequilibrium (LD) decayed within c. 4-6 kb, slower than previously reported from candidate gene studies, but showing considerable variation from absence to complete LD up to 50 kb. A sharp decrease in the estimate of ρ was seen when going from short to genome-wide inter-SNP distances, highlighting the dependence of this parameter on the scale of observation adopted. Recombination was correlated with nucleotide diversity, gene density and distance from the centromere, with hotspots of recombination enriched for genes involved in chemical reactions and pathways of the normal metabolic processes. The high nucleotide diversity (ϴw = 0.022) of E. grandis revealed that mutation is more important than recombination in shaping its genomic diversity (ρ/ϴw = 0.645). Chromosome-wide ancestral recombination graphs allowed us to date the split of E. grandis (1.7-4.8 million yr ago) and identify a scenario for the recent demographic history of the species. Our results have considerable practical importance to Genome Wide Association Studies (GWAS), while indicating bright prospects for genomic prediction of complex phenotypes in eucalypt breeding. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Timofeyeva, Nadezhda A.; Koval, Vladimir V.; Ishchenko, Alexander A.; Saparbaev, Murat K.; Fedorova, Olga S.
2011-01-01
Human apurinic/apyrimidinic endonuclease 1 (APE1) is a key enzyme in the base excision repair (BER) and nucleotide incision repair (NIR) pathways. We recently analyzed the conformational dynamics and kinetic mechanism of wild-type (wt) protein, in a stopped-flow fluorescence study. In this study, we investigated the mutant enzyme APE1K98A using the same approach. Lys98 was known to hydrogen bond to the carboxyl group of Asp70, a residue implicated in binding the divalent metal ion. Our data suggested that the conformational selection and induced fit occur during the enzyme action. We expanded upon the evidence that APE1 can pre-exist in two conformations. The isomerization of an enzyme-product complex in the BER process and the additional isomerization stage of enzyme-substrate complex in the NIR process were established for APE1K98A. These stages had not been registered for the wtAPE1. We found that the K98A substitution resulted in a 12-fold reduction of catalytic constant of 5′-phosphodiester bond hydrolysis in (3-hydroxytetrahydrofuran-2-yl)methyl phosphate (F, tetrahydrofuran) containing substrate, and in 200-fold reduction in 5,6-dihydrouridine (DHU) containing substrate. Thus, the K98A substitution influenced NIR more than BER. We demonstrated that the K98A mutation influenced the formation of primary unspecific enzyme-substrate complex in a complicated manner, depending on the Mg2+ concentration and pH. This mutation obstructed the induced fit of enzyme in the complex with undamaged DNA and F-containing DNA and appreciably decreased the stability of primary complex upon interaction of enzyme with DNA, containing the natural apurinic/apyrimidinic (AP) site. Furthermore, it significantly delayed the activation of the less active form of enzyme during NIR and slowed down the conformational conversion of the complex of enzyme with the cleavage product of DHU-substrate. Our data revealed that APE1 uses the same active site to catalyze the cleavage of DHU- and
NASA Astrophysics Data System (ADS)
Krivoshein, Arcadius V.; Ordonez, Carlos; Khrustalev, Victor N.; Timofeeva, Tatiana V.
2016-10-01
α,α-Dialkyl- and α-alkyl-α-aryl-substituted cyclic imides, lactams, and acetamides show promising anticonvulsant, anxiolytic, and anesthetic activities. While a number of crystal structures of various α-substituted cyclic imides, lactams, and acetamides were reported, no in-depth comparison of crystal structures and solid-state properties of structurally matched compounds have been carried out so far. In this paper, we report molecular structure and intermolecular interactions of three α,α-diethyl-substituted compounds - 3,3-diethylpyrrolidine-2,5-dione, 3,3-diethylpyrrolidin-2-one, and 2,2-diethylacetamide - in the crystalline phase, as studied using single-crystal X-ray diffraction and IR spectroscopy. We found considerable differences in the patterns of H-bonding and packing of the molecules in crystals. These differences correlate with the compounds' melting points and are of significance to physical pharmacy and formulation development of neuroactive drugs.
A stochastic evolution model for residue Insertion-Deletion Independent from Substitution.
Lèbre, Sophie; Michel, Christian J
2010-12-01
We develop here a new class of stochastic models of gene evolution based on residue Insertion-Deletion Independent from Substitution (IDIS). Indeed, in contrast to all existing evolution models, insertions and deletions are modeled here by a concept in population dynamics. Therefore, they are not only independent from each other, but also independent from the substitution process. After a separate stochastic analysis of the substitution and the insertion-deletion processes, we obtain a matrix differential equation combining these two processes defining the IDIS model. By deriving a general solution, we give an analytical expression of the residue occurrence probability at evolution time t as a function of a substitution rate matrix, an insertion rate vector, a deletion rate and an initial residue probability vector. Various mathematical properties of the IDIS model in relation with time t are derived: time scale, time step, time inversion and sequence length. Particular expressions of the nucleotide occurrence probability at time t are given for classical substitution rate matrices in various biological contexts: equal insertion rate, insertion-deletion only and substitution only. All these expressions can be directly used for biological evolutionary applications. The IDIS model shows a strongly different stochastic behavior from the classical substitution only model when compared on a gene dataset. Indeed, by considering three processes of residue insertion, deletion and substitution independently from each other, it allows a more realistic representation of gene evolution and opens new directions and applications in this research field. Copyright © 2010 Elsevier Ltd. All rights reserved.
Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko
2013-01-01
A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies. PMID:24302812
regSNPs-splicing: a tool for prioritizing synonymous single-nucleotide substitution.
Zhang, Xinjun; Li, Meng; Lin, Hai; Rao, Xi; Feng, Weixing; Yang, Yuedong; Mort, Matthew; Cooper, David N; Wang, Yue; Wang, Yadong; Wells, Clark; Zhou, Yaoqi; Liu, Yunlong
2017-09-01
While synonymous single-nucleotide variants (sSNVs) have largely been unstudied, since they do not alter protein sequence, mounting evidence suggests that they may affect RNA conformation, splicing, and the stability of nascent-mRNAs to promote various diseases. Accurately prioritizing deleterious sSNVs from a pool of neutral ones can significantly improve our ability of selecting functional genetic variants identified from various genome-sequencing projects, and, therefore, advance our understanding of disease etiology. In this study, we develop a computational algorithm to prioritize sSNVs based on their impact on mRNA splicing and protein function. In addition to genomic features that potentially affect splicing regulation, our proposed algorithm also includes dozens structural features that characterize the functions of alternatively spliced exons on protein function. Our systematical evaluation on thousands of sSNVs suggests that several structural features, including intrinsic disorder protein scores, solvent accessible surface areas, protein secondary structures, and known and predicted protein family domains, show significant differences between disease-causing and neutral sSNVs. Our result suggests that the protein structure features offer an added dimension of information while distinguishing disease-causing and neutral synonymous variants. The inclusion of structural features increases the predictive accuracy for functional sSNV prioritization.
Apolipoprotein A-I mutant proteins having cysteine substitutions and polynucleotides encoding same
Oda, Michael N [Benicia, CA; Forte, Trudy M [Berkeley, CA
2007-05-29
Functional Apolipoprotein A-I mutant proteins, having one or more cysteine substitutions and polynucleotides encoding same, can be used to modulate paraoxonase's arylesterase activity. These ApoA-I mutant proteins can be used as therapeutic agents to combat cardiovascular disease, atherosclerosis, acute phase response and other inflammatory related diseases. The invention also includes modifications and optimizations of the ApoA-I nucleotide sequence for purposes of increasing protein expression and optimization.
Robart, Aaron R; O'Connor, Catherine M; Collins, Kathleen
2010-03-01
Telomerase adds simple-sequence repeats to chromosome 3' ends to compensate for the loss of repeats with each round of genome replication. To accomplish this de novo DNA synthesis, telomerase uses a template within its integral RNA component. In addition to providing the template, the telomerase RNA subunit (TER) also harbors nontemplate motifs that contribute to the specialized telomerase catalytic cycle of reiterative repeat synthesis. Most nontemplate TER motifs function through linkage with the template, but in ciliate and vertebrate telomerases, a stem-loop motif binds telomerase reverse transcriptase (TERT) and reconstitutes full activity of the minimal recombinant TERT+TER RNP, even when physically separated from the template. Here, we resolve the functional requirements for this motif of ciliate TER in physiological RNP context using the Tetrahymena thermophila p65-TER-TERT core RNP reconstituted in vitro and the holoenzyme reconstituted in vivo. Contrary to expectation based on assays of the minimal recombinant RNP, we find that none of a panel of individual loop IV nucleotide substitutions impacts the profile of telomerase product synthesis when reconstituted as physiological core RNP or holoenzyme RNP. However, loop IV nucleotide substitutions do variably reduce assembly of TERT with the p65-TER complex in vitro and reduce the accumulation and stability of telomerase RNP in endogenous holoenzyme context. Our results point to a unifying model of a conformational activation role for this TER motif in the telomerase RNP enzyme.
Interactive computer programs for the graphic analysis of nucleotide sequence data.
Luckow, V A; Littlewood, R K; Rownd, R H
1984-01-01
A group of interactive computer programs have been developed which aid in the collection and graphical analysis of nucleotide and protein sequence data. The programs perform the following basic functions: a) enter, edit, list, and rearrange sequence data; b) permit automatic entry of nucleotide sequence data directly from an autoradiograph into the computer; c) search for restriction sites or other specified patterns and plot a linear or circular restriction map, or print their locations; d) plot base composition; e) analyze homology between sequences by plotting a two-dimensional graphic matrix; and f) aid in plotting predicted secondary structures of RNA molecules. PMID:6546437
Profiling of Sugar Nucleotides.
Rejzek, Martin; Hill, Lionel; Hems, Edward S; Kuhaudomlarp, Sakonwan; Wagstaff, Ben A; Field, Robert A
2017-01-01
Sugar nucleotides are essential building blocks for the glycobiology of all living organisms. Detailed information on the types of sugar nucleotides present in a particular cell and how they change as a function of metabolic, developmental, or disease status is vital. The extraction, identification, and quantification of sugar nucleotides in a given sample present formidable challenges. In this chapter, currently used techniques for sugar nucleotide extraction from cells, separation from complex biological matrices, and detection by optical and mass spectrometry methods are discussed. © 2017 Elsevier Inc. All rights reserved.
Code of Federal Regulations, 2014 CFR
2014-07-01
... naphthalenyl-substituted azonaphthol chromium complex. 721.981 Section 721.981 Protection of Environment...-substituted naphthalenyl-substituted azonaphthol chromium complex. (a) Chemical substance and significant new... naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex (PMN P-93-1631) is subject to...
Code of Federal Regulations, 2013 CFR
2013-07-01
... naphthalenyl-substituted azonaphthol chromium complex. 721.981 Section 721.981 Protection of Environment...-substituted naphthalenyl-substituted azonaphthol chromium complex. (a) Chemical substance and significant new... naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex (PMN P-93-1631) is subject to...
Code of Federal Regulations, 2012 CFR
2012-07-01
... naphthalenyl-substituted azonaphthol chromium complex. 721.981 Section 721.981 Protection of Environment...-substituted naphthalenyl-substituted azonaphthol chromium complex. (a) Chemical substance and significant new... naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex (PMN P-93-1631) is subject to...
Code of Federal Regulations, 2011 CFR
2011-07-01
... naphthalenyl-substituted azonaphthol chromium complex. 721.981 Section 721.981 Protection of Environment...-substituted naphthalenyl-substituted azonaphthol chromium complex. (a) Chemical substance and significant new... naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex (PMN P-93-1631) is subject to...
Vacuum ultraviolet photoionization of carbohydrates and nucleotides
NASA Astrophysics Data System (ADS)
Shin, Joong-Won; Bernstein, Elliot R.
2014-01-01
Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5'-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C-C and C-O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.
Vacuum ultraviolet photoionization of carbohydrates and nucleotides.
Shin, Joong-Won; Bernstein, Elliot R
2014-01-28
Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5(')-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C-C and C-O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.
Vacuum ultraviolet photoionization of carbohydrates and nucleotides
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shin, Joong-Won, E-mail: jshin@govst.edu; Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872; Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu
Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate,more » rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.« less
pH profile of the adsorption of nucleotides onto montmorillonite. I - Selected homoionic clays
NASA Technical Reports Server (NTRS)
Lawless, J. G.; Church, F. M.; Mazzurco, J.; Banin, A.; Huff, R.; Kao, J.; Cook, A.; Lowe, T.; Orenberg, J. B.; Edelson, E.
1985-01-01
The effect of pH and adsorbed ions on the adsorption of purine and pyrimidine nucleotides on montmorillonite clay was studied experimentally. The specific nucleotides examined were: 5 prime-AMP; 3-prime AMP; and 5 prime-CMP. The pH of the clay samples was adjusted to various levels in the 2-12 pH range using microliter volumes of concentrated acid (1N HCl) and base (1NHNaOH). It was found that preferential adsorption among nulceotides was dependent on the pH level and on the characteristics of the substituted metal cation and anion exchange mechanisms. Below pH 4, adsorption was attributed to cation and anion exchange mechanisms. Above pH 4, however, adsorption was attributed to the complexation mechanisms occurring between the metal cations in the clay exchange site and in the biomolecule. The possible role of homoionic clays in the concentration mechanisms of biomonomers in the prebiotic environment is discussed.
Remoroza, C; Buchholt, H C; Gruppen, H; Schols, H A
2014-01-30
Enzymatic fingerprinting was applied to sugar beet pectins (SBPs) modified by either plant or fungal pectin methyl esterases and alkali catalyzed de-esterification to reveal the ester distributions over the pectin backbone. A simultaneous pectin lyase (PL) treatment to the commonly used endo-polygalacturonase (endo-PG) degradation showed to be effective in degrading both high and low methylesterified and/or acetylated homogalaturonan regions of SBP simultaneously. Using LC-HILIC-MS/ELSD, we studied in detail all the diagnostic oligomers present, enabling us to discriminate between differently prepared sugar beet pectins having various levels of methylesterification and acetylation. Furthermore, distinction between commercially extracted and de-esterified sugar beet pectin having different patterns of substitution was achieved by using novel descriptive pectin parameters. In addition to DBabs approach for nonmethylesterified sequences degradable by endo-PG, the "degree of hydrolysis" (DHPG) representing all partially saturated methylesterified and/or acetylated galacturonic acid (GalA) moieties was introduced as a new parameter. Consequently, the description DHPL has been introduced to quantify all esterified unsaturated GalA oligomers. Copyright © 2013 Elsevier Ltd. All rights reserved.
Thermodynamics of RNA duplexes modified with unlocked nucleic acid nucleotides
Pasternak, Anna; Wengel, Jesper
2010-01-01
Thermodynamics provides insights into the influence of modified nucleotide residues on stability of nucleic acids and is crucial for designing duplexes with given properties. In this article, we introduce detailed thermodynamic analysis of RNA duplexes modified with unlocked nucleic acid (UNA) nucleotide residues. We investigate UNA single substitutions as well as model mismatch and dangling end effects. UNA residues placed in a central position makes RNA duplex structure less favourable by 4.0–6.6 kcal/mol. Slight destabilization, by ∼0.5–1.5 kcal/mol, is observed for 5′- or 3′-terminal UNA residues. Furthermore, thermodynamic effects caused by UNA residues are extremely additive with ΔG°37 conformity up to 98%. Direct mismatches involving UNA residues decrease the thermodynamic stability less than unmodified mismatches in RNA duplexes. Additionally, the presence of UNA residues adjacent to unpaired RNA residues reduces mismatch discrimination. Thermodynamic analysis of UNA 5′- and 3′-dangling ends revealed that stacking interactions of UNA residues are always less favourable than that of RNA residues. Finally, circular dichroism spectra imply no changes in overall A-form structure of UNA–RNA/RNA duplexes relative to the unmodified RNA duplexes. PMID:20562222
Antinociceptive effect of purine nucleotides.
Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R
1996-10-01
The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.
Can cannabis be considered a substitute medication for alcohol?
Subbaraman, Meenakshi Sabina
2014-01-01
Substituting cannabis for alcohol may reduce drinking and related problems among alcohol-dependent individuals. Some even recommend prescribing medical cannabis to individuals attempting to reduce drinking. The primary aim of this review is to assess whether cannabis satisfies the seven previously published criteria for substitute medications for alcohol [e.g. 'reduces alcohol-related harms'; 'is safer in overdose than alcohol'; 'should offer significant health economic benefits'; see Chick and Nutt ((2012) Substitution therapy for alcoholism: time for a reappraisal? J Psychopharmacol 26:205-12)]. Literature review. All criteria appear either satisfied or partially satisfied, though studies relying on medical cannabis patients may be limited by selection bias and/or retrospective designs. Individual-level factors, such as severity of alcohol problems, may also moderate substitution. There is no clear pattern of outcomes related to cannabis substitution. Most importantly, the recommendation to prescribe alcohol-dependent individuals cannabis to help reduce drinking is premature. Future studies should use longitudinal data to better understand the consequences of cannabis substitution.
Labeled nucleotide phosphate (NP) probes
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2009-02-03
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Baron, Eric P; Lucas, Philippe; Eades, Joshua; Hogue, Olivia
2018-05-24
Medicinal cannabis registries typically report pain as the most common reason for use. It would be clinically useful to identify patterns of cannabis treatment in migraine and headache, as compared to arthritis and chronic pain, and to analyze preferred cannabis strains, biochemical profiles, and prescription medication substitutions with cannabis. Via electronic survey in medicinal cannabis patients with headache, arthritis, and chronic pain, demographics and patterns of cannabis use including methods, frequency, quantity, preferred strains, cannabinoid and terpene profiles, and prescription substitutions were recorded. Cannabis use for migraine among headache patients was assessed via the ID Migraine™ questionnaire, a validated screen used to predict the probability of migraine. Of 2032 patients, 21 illnesses were treated with cannabis. Pain syndromes accounted for 42.4% (n = 861) overall; chronic pain 29.4% (n = 598;), arthritis 9.3% (n = 188), and headache 3.7% (n = 75;). Across all 21 illnesses, headache was a symptom treated with cannabis in 24.9% (n = 505). These patients were given the ID Migraine™ questionnaire, with 68% (n = 343) giving 3 "Yes" responses, 20% (n = 102) giving 2 "Yes" responses (97% and 93% probability of migraine, respectively). Therefore, 88% (n = 445) of headache patients were treating probable migraine with cannabis. Hybrid strains were most preferred across all pain subtypes, with "OG Shark" the most preferred strain in the ID Migraine™ and headache groups. Many pain patients substituted prescription medications with cannabis (41.2-59.5%), most commonly opiates/opioids (40.5-72.8%). Prescription substitution in headache patients included opiates/opioids (43.4%), anti-depressant/anti-anxiety (39%), NSAIDs (21%), triptans (8.1%), anti-convulsants (7.7%), muscle relaxers (7%), ergots (0.4%). Chronic pain was the most common reason for cannabis use, consistent with most registries. The majority of headache
Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.
Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donormore » ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.« less
Genomic patterns of nucleotide diversity in divergent populations of U.S. weedy rice
2010-01-01
Background Weedy rice (red rice), a conspecific weed of cultivated rice (Oryza sativa L.), is a significant problem throughout the world and an emerging threat in regions where it was previously absent. Despite belonging to the same species complex as domesticated rice and its wild relatives, the evolutionary origins of weedy rice remain unclear. We use genome-wide patterns of single nucleotide polymorphism (SNP) variation in a broad geographic sample of weedy, domesticated, and wild Oryza samples to infer the origin and demographic processes influencing U.S. weedy rice evolution. Results We find greater population structure than has been previously reported for U.S. weedy rice, and that the multiple, genetically divergent populations have separate origins. The two main U.S. weedy rice populations share genetic backgrounds with cultivated O. sativa varietal groups not grown commercially in the U.S., suggesting weed origins from domesticated ancestors. Hybridization between weedy groups and between weedy rice and local crops has also led to the evolution of distinct U.S. weedy rice populations. Demographic simulations indicate differences among the main weedy groups in the impact of bottlenecks on their establishment in the U.S., and in the timing of divergence from their cultivated relatives. Conclusions Unlike prior research, we did not find unambiguous evidence for U.S. weedy rice originating via hybridization between cultivated and wild Oryza species. Our results demonstrate the potential for weedy life-histories to evolve directly from within domesticated lineages. The diverse origins of U.S. weedy rice populations demonstrate the multiplicity of evolutionary forces that can influence the emergence of weeds from a single species complex. PMID:20550656
Li, Jinqian; Feng, Shengjun; Liu, Xi; Guo, Mingzhe; Chen, Mingxiao; Chen, Yiyi; Rong, Liang; Xia, Jinyu; Zhou, Yuanping; Zhong, Jin; Li, Yi-Ping
2018-05-01
Genotype 1b strain Con1 represents an important reference in the study of hepatitis C virus (HCV). Here, we aimed to develop an advanced infectious Con1 recombinant. We found that previously identified mutations A1226G/F1464L/A1672S/Q1773H permitted culture adaption of Con1 Core-NS5A (C-5A) recombinant containing 5'UTR and NS5B-3'UTR from JFH1 (genotype 2a), thus acquired additional mutations L725H/F886L/D2415G. C-5A containing all seven mutations (C-5A_7m) replicated efficiently in Huh7.5 and Huh7.5.1 cells and had an increased infectivity in SEC14L2-expressing Huh7.5.1 cells. Incorporation of Con1 NS5B was deleterious to C-5A_7m, however Con1 5'UTR was permissive but attenuated the virus. Nucleotides G1, A4, and G35 primarily accounted for the viral attenuation without affecting RNA translation. C-5A_7m was inhibited dose-dependently by simeprevir and daclatasvir, and substitutions at A4, A29, A34, and G35 conferred resistance to miR-122 antagonism. The novel Con1 5'UTR-NS5A recombinant, adaptive mutations, and critical nucleotides described here will facilitate future studies of HCV culture systems and virus-host interaction. Copyright © 2018 Elsevier Inc. All rights reserved.
Nucleotide cleaving agents and method
Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.
2000-01-01
The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.
Nonneutral mitochondrial DNA variation in humans and chimpanzees
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nachman, M.W.; Aquadro, C.F.; Brown, W.M.
1996-03-01
We sequenced the NADH dehydrogenase subunit 3 (ND3) gene from a sample of 61 humans, five common chimpanzees, and one gorilla to test whether patterns of mitochondrial DNA (mtDNA) variation are consistent with a neutral model of molecular evolution. Within humans and within chimpanzees, the ratio of replacement to silent nucleotide substitutions was higher than observed in comparisons between species, contrary to neutral expectations. To test the generality of this result, we reanalyzed published human RFLP data from the entire mitochondrial genome. Gains of restriction sites relative to a known human mtDNA sequence were used to infer unambiguous nucleotide substitutions.more » We also compared the complete mtDNA sequences of three humans. Both the RFLP data and the sequence data reveal a higher ratio of replacement to silent nucleotide substitutions within humans than is seen between species. This pattern is observed at most or all human mitochondrial genes and is inconsistent with a strictly neutral model. These data suggest that many mitochondrial protein polymorphisms are slightly deleterious, consistent with studies of human mitochondrial diseases. 59 refs., 2 figs., 8 tabs.« less
Hohl, Michael; Hürlimann, Lea M; Böhm, Simon; Schöppe, Jendrik; Grütter, Markus G; Bordignon, Enrica; Seeger, Markus A
2014-07-29
ATP binding cassette (ABC) transporters mediate vital transport processes in every living cell. ATP hydrolysis, which fuels transport, displays positive cooperativity in numerous ABC transporters. In particular, heterodimeric ABC exporters exhibit pronounced allosteric coupling between a catalytically impaired degenerate site, where nucleotides bind tightly, and a consensus site, at which ATP is hydrolyzed in every transport cycle. Whereas the functional phenomenon of cooperativity is well described, its structural basis remains poorly understood. Here, we present the apo structure of the heterodimeric ABC exporter TM287/288 and compare it to the previously solved structure with adenosine 5'-(β,γ-imido)triphosphate (AMP-PNP) bound at the degenerate site. In contrast to other ABC exporter structures, the nucleotide binding domains (NBDs) of TM287/288 remain in molecular contact even in the absence of nucleotides, and the arrangement of the transmembrane domains (TMDs) is not influenced by AMP-PNP binding, a notion confirmed by double electron-electron resonance (DEER) measurements. Nucleotide binding at the degenerate site results in structural rearrangements, which are transmitted to the consensus site via two D-loops located at the NBD interface. These loops owe their name from a highly conserved aspartate and are directly connected to the catalytically important Walker B motif. The D-loop at the degenerate site ties the NBDs together even in the absence of nucleotides and substitution of its aspartate by alanine is well-tolerated. By contrast, the D-loop of the consensus site is flexible and the aspartate to alanine mutation and conformational restriction by cross-linking strongly reduces ATP hydrolysis and substrate transport.
Parrish, R Ryley; Day, Jeremy J; Lubin, Farah D
2012-07-01
DNA methylation is an epigenetic modification that is essential for the development and mature function of the central nervous system. Due to the relevance of this modification to the transcriptional control of gene expression, it is often necessary to examine changes in DNA methylation patterns with both gene and single-nucleotide resolution. Here, we describe an in-depth basic protocol for direct bisulfite sequencing of DNA isolated from brain tissue, which will permit direct assessment of methylation status at individual genes as well as individual cytosine molecules/nucleotides within a genomic region. This method yields analysis of DNA methylation patterns that is robust, accurate, and reproducible, thereby allowing insights into the role of alterations in DNA methylation in brain tissue.
Yanagi, Kumiko; Kaname, Tadashi; Wakui, Keiko; Hashimoto, Ohiko; Fukushima, Yoshimitsu; Naritomi, Kenji
2012-01-01
Mutations in the X-linked genes neuroligin 3 (NLGN3) and neuroligin 4X (NLGN4X) were first implicated in the pathogenesis of X-linked autism in Swedish families. However, reports of mutations in these genes in autism spectrum disorder (ASD) patients from various ethnic backgrounds present conflicting results regarding the etiology of ASD, possibly because of genetic heterogeneity and/or differences in their ethnic background. Additional mutation screening study on another ethnic background could help to clarify the relevance of the genes to ASD. We scanned the entire coding regions of NLGN3 and NLGN4X in 62 Japanese patients with ASD by polymerase chain reaction-high-resolution melting curve and direct sequencing analyses. Four synonymous substitutions, one in NLGN3 and three in NLGN4X, were identified in four of the 62 patients. These substitutions were not present in 278 control X-chromosomes from unrelated Japanese individuals and were not registered in the database of Single Nucleotide Polymorphisms build 132 or in the Japanese Single Nucleotide Polymorphisms database, indicating that they were novel and specific to ASD. Though further analysis is necessary to determine the physiological and clinical importance of such substitutions, the possibility of the relevance of both synonymous and nonsynonymous substitutions with the etiology of ASD should be considered.
Yanagi, Kumiko; Kaname, Tadashi; Wakui, Keiko; Hashimoto, Ohiko; Fukushima, Yoshimitsu; Naritomi, Kenji
2012-01-01
Mutations in the X-linked genes neuroligin 3 (NLGN3) and neuroligin 4X (NLGN4X) were first implicated in the pathogenesis of X-linked autism in Swedish families. However, reports of mutations in these genes in autism spectrum disorder (ASD) patients from various ethnic backgrounds present conflicting results regarding the etiology of ASD, possibly because of genetic heterogeneity and/or differences in their ethnic background. Additional mutation screening study on another ethnic background could help to clarify the relevance of the genes to ASD. We scanned the entire coding regions of NLGN3 and NLGN4X in 62 Japanese patients with ASD by polymerase chain reaction-high-resolution melting curve and direct sequencing analyses. Four synonymous substitutions, one in NLGN3 and three in NLGN4X, were identified in four of the 62 patients. These substitutions were not present in 278 control X-chromosomes from unrelated Japanese individuals and were not registered in the database of Single Nucleotide Polymorphisms build 132 or in the Japanese Single Nucleotide Polymorphisms database, indicating that they were novel and specific to ASD. Though further analysis is necessary to determine the physiological and clinical importance of such substitutions, the possibility of the relevance of both synonymous and nonsynonymous substitutions with the etiology of ASD should be considered. PMID:22934180
Code of Federal Regulations, 2010 CFR
2010-07-01
... ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES OF CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.981 Substituted naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex. (a) Chemical substance and significant new...
Can Cannabis be Considered a Substitute Medication for Alcohol?
Subbaraman, Meenakshi Sabina
2014-01-01
Aims: Substituting cannabis for alcohol may reduce drinking and related problems among alcohol-dependent individuals. Some even recommend prescribing medical cannabis to individuals attempting to reduce drinking. The primary aim of this review is to assess whether cannabis satisfies the seven previously published criteria for substitute medications for alcohol [e.g. ‘reduces alcohol-related harms’; ‘is safer in overdose than alcohol’; ‘should offer significant health economic benefits’; see Chick and Nutt ((2012) Substitution therapy for alcoholism: time for a reappraisal? J Psychopharmacol 26:205–12)]. Methods: Literature review. Results: All criteria appear either satisfied or partially satisfied, though studies relying on medical cannabis patients may be limited by selection bias and/or retrospective designs. Individual-level factors, such as severity of alcohol problems, may also moderate substitution. Conclusions: There is no clear pattern of outcomes related to cannabis substitution. Most importantly, the recommendation to prescribe alcohol-dependent individuals cannabis to help reduce drinking is premature. Future studies should use longitudinal data to better understand the consequences of cannabis substitution. PMID:24402247
Nucleotide diversity at two phytochrome loci along a latitudinal cline in Pinus sylvestris.
García-Gil, M R; Mikkonen, M; Savolainen, O
2003-05-01
Forest tree species provide many examples of well-studied adaptive differentiation, where the search for the underlying genes might be possible. In earlier studies and in our common conditions in a greenhouse, northern populations set bud earlier than southern ones. A difference in latitude of origin of one degree corresponded to a change of 1.4 days in number of days to terminal bud set of seedlings. Earlier physiological and ecological genetics work in conifers and other plants have suggested that such variation could be governed by phytochromes. Nucleotide variation was examined at two phytochrome loci (PHYP and PHYO, homologues of the Arabidopsis thaliana PHYB and PHYA, respectively) in three populations: northern Finland, southern Finland and northern Spain. In our samples of 12-15 sequences (2980 and 1156 base pairs at the two loci) we found very low nonsynonymous variation; pi was 0.0003 and 0.0002 at PHYP and PHYO loci, respectively. There was no functional differentiation between populations at the photosensory domains of either locus. The overall silent variation was also low, only 0.0024 for the PHYP locus. The low estimates of silent variation are consistent with the estimated low synonymous substitution rates between Pinus sylvestris and Picea abies at the PHYO locus. Despite the low level of nucleotide variation, haplotypic diversity was relatively high (0.42 and 0.41 for fragments of 1156 nucleotides) at the two loci.
Asymmetry in Object Substitution Masking Occurs Relative to the Direction of Spatial Attention Shift
ERIC Educational Resources Information Center
Hirose, Nobuyuki; Osaka, Naoyuki
2010-01-01
A sparse mask that persists beyond the duration of a target can reduce its visibility, a phenomenon called "object substitution masking". Y. Jiang and M. M. Chun (2001a) found an asymmetric pattern of substitution masking such that a mask on the peripheral side of the target caused stronger substitution masking than on the central side.…
Kondo, Jiro; Westhof, Eric
2011-10-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.
Jiang, Bo; Li, Ying; Tu, Man-Su; Wang, Shu-Liang; Tu, Shu-Jiang; Li, Guigen
2012-01-01
New three-component domino reaction providing divergent approaches to multi-functionalized fused pyrroles with different substituted patterns have been established (40 examples). The direct C(sp3)–N bond formation was achieved through intermolecular allylic amination in a one-pot operation; and N-arylation of amines was realized by varying N-amino acid enaminones. The reaction is easy to perform simply by mixing three common reactants in acetic acid under microwave heating. The reaction proceeds at fast rates and can be finished within 30 min, which makes workup convenient to give good chemical yields. PMID:22852549
Kinetic Basis of Nucleotide Selection Employed by a Protein Template-Dependent DNA Polymerase†
Brown, Jessica A.; Fowler, Jason D.; Suo, Zucai
2010-01-01
Rev1, a Y-family DNA polymerase, contributes to spontaneous and DNA damage-induced mutagenic events. In this paper, we have employed pre-steady state kinetic methodology to establish a kinetic basis for nucleotide selection by human Rev1, a unique nucleotidyl transferase that uses a protein template-directed mechanism to preferentially instruct dCTP incorporation. This work demonstrated that the high incorporation efficiency of dCTP is dependent on both substrates: an incoming dCTP and a templating base dG. The extremely low base substitution fidelity of human Rev1 (100 to 10-5) was due to the preferred misincorporation of dCTP with templating bases dA, dT, and dC over correct dNTPs. Using non-natural nucleotide analogs, we showed that hydrogen bonding interactions between residue R357 of human Rev1 and an incoming dNTP are not essential for DNA synthesis. Lastly, human Rev1 discriminates between ribonucleotides and deoxyribonucleotides mainly by reducing the rate of incorporation, and the sugar selectivity of human Rev1 is sensitive to both the size and orientation of the 2′-substituent of a ribonucleotide. PMID:20518555
Kochanowski, N; Blanchard, F; Cacan, R; Chirat, F; Guedon, E; Marc, A; Goergen, J-L
2006-01-15
Analysis of intracellular nucleotide and nucleotide sugar contents is essential in studying protein glycosylation of mammalian cells. Nucleotides and nucleotide sugars are the donor substrates of glycosyltransferases, and nucleotides are involved in cellular energy metabolism and its regulation. A sensitive and reproducible ion-pair reverse-phase high-performance liquid chromatography (RP-HPLC) method has been developed, allowing the direct and simultaneous detection and quantification of some essential nucleotides and nucleotide sugars. After a perchloric acid extraction, 13 molecules (8 nucleotides and 5 nucleotide sugars) were separated, including activated sugars such as UDP-glucose, UDP-galactose, GDP-mannose, UDP-N-acetylglucosamine, and UDP-N-acetylgalactosamine. To validate the analytical parameters, the reproducibility, linearity of calibration curves, detection limits, and recovery were evaluated for standard mixtures and cell extracts. The developed method is capable of resolving picomolar quantities of nucleotides and nucleotide sugars in a single chromatographic run. The HPLC method was then applied to quantify intracellular levels of nucleotides and nucleotide sugars of Chinese hamster ovary (CHO) cells cultivated in a bioreactor batch process. Evolutions of the titers of nucleotides and nucleotide sugars during the batch process are discussed.
Montes-Pérez, Rubén C; García, Adán W Echeverría; Castro, Jorge Zavala; Gamboa, Militza G Alfaro
2006-09-01
The objective of this work was to estimate the nucleotidic variation between two groups of tepezcuintles (Agouti paca) from the states of Campeche and Quintana Roo, Mexico and within members of each group. Blood samples were collected from eleven A. paca kept in captivity. DNA from leukocytic cells was used for Ramdom Amplification of DNA Polimorphism (RAPD). The primers three 5'-d(GTAGACCCGT)- 3' and six 5'-d(CCCGTCAGCA)- 3' were selected from de Amersham kit (Ready.To.Go. RAPD Analysis Beads, Amersham Pharmacia Biotech), because they produced an adequate number of bands. The electrophoretic pattern of bands obtained was analyzed using software for phylogenetic analysis based on the UPGMA method, to estimate the units of nucleotidic variation. The phylogenetic tree obtained with primer three reveals a dicotomic grouping between the animals from both states in the Yucatan Peninsula showing a divergent value of 1.983 nucleotides per hundred. Animals from Quintana Roo show a grouping with primer six; an additional grouping was observed with animals from Campeche. Nucleotidic variation between both groups was 2.118 nucleotides per hundred. The nucleotidic variation for the two primers within the groups from both states, showed fluctuating values from 0.46 to 1.68 nucleotides per hundred, which indicates that nucleotidic variation between the two groups of animals is around two nucleotides per hundred and, within the groups, less than 1.7 nucleotides per hundred.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.
Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions
NASA Astrophysics Data System (ADS)
Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Boudreaux, M K; Schmutz, S M; French, P S
2007-11-01
Simmental thrombopathia is an inherited platelet disorder that closely resembles the platelet disorders described in Basset Hounds and Eskimo Spitz dogs. Recently, two different mutations in the gene encoding calcium diacylglycerol guanine nucleotide exchange factor I (CalDAG-GEFI) were described to be associated with the Basset Hound and Spitz thrombopathia disorders, and a third distinct mutation was identified in CalDAG-GEFI in thrombopathic Landseers of European Continental Type. The gene encoding CalDAG-GEFI was sequenced using DNA obtained from normal cattle and from a thrombopathic calf studied in Canada. The affected calf was found to have a nucleotide change (c.701 T>C), which would result in the substitution of a proline for a leucine within structurally conserved region two (SCR2) of the catalytic domain of the protein. This change is likely responsible for the thrombopathic phenotype observed in Simmental cattle and underscores the critical nature of this signal transduction protein in platelets.
Nucleotide-dependent conformational states of actin
Pfaendtner, Jim; Branduardi, Davide; Parrinello, Michele; Pollard, Thomas D.; Voth, Gregory A.
2009-01-01
The influence of the state of the bound nucleotide (ATP, ADP-Pi, or ADP) on the conformational free-energy landscape of actin is investigated. Nucleotide-dependent folding of the DNase-I binding (DB) loop in monomeric actin and the actin trimer is carried out using all-atom molecular dynamics (MD) calculations accelerated with a multiscale implementation of the metadynamics algorithm. Additionally, an investigation of the opening and closing of the actin nucleotide binding cleft is performed. Nucleotide-dependent free-energy profiles for all of these conformational changes are calculated within the framework of metadynamics. We find that in ADP-bound monomer, the folded and unfolded states of the DB loop have similar relative free-energy. This result helps explain the experimental difficulty in obtaining an ordered crystal structure for this region of monomeric actin. However, we find that in the ADP-bound actin trimer, the folded DB loop is stable and in a free-energy minimum. It is also demonstrated that the nucleotide binding cleft favors a closed conformation for the bound nucleotide in the ATP and ADP-Pi states, whereas the ADP state favors an open confirmation, both in the monomer and trimer. These results suggest a mechanism of allosteric interactions between the nucleotide binding cleft and the DB loop. This behavior is confirmed by an additional simulation that shows the folding free-energy as a function of the nucleotide cleft width, which demonstrates that the barrier for folding changes significantly depending on the value of the cleft width. PMID:19620726
Bohl, Casey E; Wu, Zengru; Chen, Jiyun; Mohler, Michael L; Yang, Jun; Hwang, Dong Jin; Mustafa, Suni; Miller, Duane D; Bell, Charles E; Dalton, James T
2008-10-15
Selective androgen receptor modulators (SARMs) are essentially prostate sparing androgens, which provide therapeutic potential in osteoporosis, male hormone replacement, and muscle wasting. Herein we report crystal structures of the androgen receptor (AR) ligand-binding domain (LBD) complexed to a series of potent synthetic nonsteroidal SARMs with a substituted pendant arene referred to as the B-ring. We found that hydrophilic B-ring para-substituted analogs exhibit an additional region of hydrogen bonding not seen with steroidal compounds and that multiple halogen substitutions affect the B-ring conformation and aromatic interactions with Trp741. This information elucidates interactions important for high AR binding affinity and provides new insight for structure-based drug design.
Peeters, Elien; Hooyberghs, Geert; Robijns, Stijn; Waldrant, Kai; De Weerdt, Ami; Delattin, Nicolas; Liebens, Veerle; Kucharíková, Soňa; Tournu, Hélène; Verstraeten, Natalie; Dovgan, Barbara; Girandon, Lenart; Fröhlich, Mirjam; De Brucker, Katrijn; Michiels, Jan; Cammue, Bruno P. A.; Thevissen, Karin; Vanderleyden, Jozef; Van der Eycken, Erik
2016-01-01
We previously synthesized several series of compounds, based on the 5-aryl-2-aminoimidazole scaffold, that showed activity preventing the formation of Salmonella enterica serovar Typhimurium and Pseudomonas aeruginosa biofilms. Here, we further studied the activity spectrum of a number of the most active N1- and 2N-substituted 5-aryl-2-aminoimidazoles against a broad panel of biofilms formed by monospecies and mixed species of bacteria and fungi. An N1-substituted compound showed very strong activity against the biofilms formed by Gram-negative and Gram-positive bacteria and the fungus Candida albicans but was previously shown to be toxic against various eukaryotic cell lines. In contrast, 2N-substituted compounds were nontoxic and active against biofilms formed by Gram-negative bacteria and C. albicans but had reduced activity against biofilms formed by Gram-positive bacteria. In an attempt to develop nontoxic compounds with potent activity against biofilms formed by Gram-positive bacteria for application in antibiofilm coatings for medical implants, we synthesized novel compounds with substituents at both the N1 and 2N positions and tested these compounds for antibiofilm activity and toxicity. Interestingly, most of these N1-,2N-disubstituted 5-aryl-2-aminoimidazoles showed very strong activity against biofilms formed by Gram-positive bacteria and C. albicans in various setups with biofilms formed by monospecies and mixed species but lost activity against biofilms formed by Gram-negative bacteria. In light of application of these compounds as anti-infective coatings on orthopedic implants, toxicity against two bone cell lines and the functionality of these cells were tested. The N1-,2N-disubstituted 5-aryl-2-aminoimidazoles in general did not affect the viability of bone cells and even induced calcium deposition. This indicates that modulating the substitution pattern on positions N1 and 2N of the 5-aryl-2-aminoimidazole scaffold allows fine-tuning of both the
Bellucci, Elisa; Bitocchi, Elena; Ferrarini, Alberto; Benazzo, Andrea; Biagetti, Eleonora; Klie, Sebastian; Minio, Andrea; Rau, Domenico; Rodriguez, Monica; Panziera, Alex; Venturini, Luca; Attene, Giovanna; Albertini, Emidio; Jackson, Scott A.; Nanni, Laura; Fernie, Alisdair R.; Nikoloski, Zoran; Bertorelle, Giorgio; Delledonne, Massimo; Papa, Roberto
2014-01-01
Using RNA sequencing technology and de novo transcriptome assembly, we compared representative sets of wild and domesticated accessions of common bean (Phaseolus vulgaris) from Mesoamerica. RNA was extracted at the first true-leaf stage, and de novo assembly was used to develop a reference transcriptome; the final data set consists of ∼190,000 single nucleotide polymorphisms from 27,243 contigs in expressed genomic regions. A drastic reduction in nucleotide diversity (∼60%) is evident for the domesticated form, compared with the wild form, and almost 50% of the contigs that are polymorphic were brought to fixation by domestication. In parallel, the effects of domestication decreased the diversity of gene expression (18%). While the coexpression networks for the wild and domesticated accessions demonstrate similar seminal network properties, they show distinct community structures that are enriched for different molecular functions. After simulating the demographic dynamics during domestication, we found that 9% of the genes were actively selected during domestication. We also show that selection induced a further reduction in the diversity of gene expression (26%) and was associated with 5-fold enrichment of differentially expressed genes. While there is substantial evidence of positive selection associated with domestication, in a few cases, this selection has increased the nucleotide diversity in the domesticated pool at target loci associated with abiotic stress responses, flowering time, and morphology. PMID:24850850
USDA-ARS?s Scientific Manuscript database
High-density single nucleotide polymorphism (SNP) genotyping chips are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships among individuals in populations and studying marker-trait associations in mapping experiments. We developed a genotyping array includ...
Wei, Qing; La, David; Kihara, Daisuke
2017-01-01
Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .
Rick, M E; Krizek, D M
1996-04-01
A patient with type 2N ("Normandy" variant) von Willebrand's disease is described. Her von Willebrand factor level was borderline low, while her factor VIII was markedly decreased to 7%. Her plasma von Willebrand factor demonstrated a decreased ability to complex with factor VIII in vitro, binding less than 10% when compared to normal plasma von Willebrand factor. The factor VIII released into the circulation after the patient received DDAVP had a shortened survival in vivo. Nucleotide sequence analysis revealed a T-to-A transition at nucleotide 2451 on both alleles. This transition results in a substitution of Gln for His at amino acid 54 in the mature subunit of von Willebrand factor.
Weak Negative and Positive Selection and the Drift Load at Splice Sites
Denisov, Stepan V.; Bazykin, Georgii A.; Sutormin, Roman; Favorov, Alexander V.; Mironov, Andrey A.; Gelfand, Mikhail S.; Kondrashov, Alexey S.
2014-01-01
Splice sites (SSs) are short sequences that are crucial for proper mRNA splicing in eukaryotic cells, and therefore can be expected to be shaped by strong selection. Nevertheless, in mammals and in other intron-rich organisms, many of the SSs often involve nonconsensus (Nc), rather than consensus (Cn), nucleotides, and beyond the two critical nucleotides, the SSs are not perfectly conserved between species. Here, we compare the SS sequences between primates, and between Drosophila fruit flies, to reveal the pattern of selection acting at SSs. Cn-to-Nc substitutions are less frequent, and Nc-to-Cn substitutions are more frequent, than neutrally expected, indicating, respectively, negative and positive selection. This selection is relatively weak (1 < |4Nes| < 4), and has a similar efficiency in primates and in Drosophila. Within some nucleotide positions, the positive selection in favor of Nc-to-Cn substitutions is weaker than the negative selection maintaining already established Cn nucleotides; this difference is due to site-specific negative selection favoring current Nc nucleotides. In general, however, the strength of negative selection protecting the Cn alleles is similar in magnitude to the strength of positive selection favoring replacement of Nc alleles, as expected under the simple nearly neutral turnover. In summary, although a fraction of the Nc nucleotides within SSs is maintained by selection, the abundance of deleterious nucleotides in this class suggests a substantial genome-wide drift load. PMID:24966225
Lin, C S; Sun, Y L; Liu, C Y; Yang, P C; Chang, L C; Cheng, I C; Mao, S J; Huang, M C
1999-08-05
The complete nucleotide sequence of the pig (Sus scrofa) mitochondrial genome, containing 16613bp, is presented in this report. The genome is not a specific length because of the presence of the variable numbers of tandem repeats, 5'-CGTGCGTACA in the displacement loop (D-loop). Genes responsible for 12S and 16S rRNAs, 22 tRNAs, and 13 protein-coding regions are found. The genome carries very few intergenic nucleotides with several instances of overlap between protein-coding or tRNA genes, except in the D-loop region. For evaluating the possible evolutionary relationships between Artiodactyla and Cetacea, the nucleotide substitutions and amino acid sequences of 13 protein-coding genes were aligned by pairwise comparisons of the pig, cow, and fin whale. By comparing these sequences, we suggest that there is a closer relationship between the pig and cow than that between either of these species and fin whale. In addition, the accumulation of transversions and gaps in pig 12S and 16S rRNA genes was compared with that in other eutherian species, including cow, fin whale, human, horse, and harbor seal. The results also reveal a close phylogenetic relationship between pig and cow, as compared to fin whale and others. Thus, according to the sequence differences of mitochondrial rRNA genes in eutherian species, the evolutionary separation of pig and cow occurred about 53-60 million years ago.
Nucleotide Salvage Deficiencies, DNA Damage and Neurodegeneration
Fasullo, Michael; Endres, Lauren
2015-01-01
Nucleotide balance is critically important not only in replicating cells but also in quiescent cells. This is especially true in the nervous system, where there is a high demand for adenosine triphosphate (ATP) produced from mitochondria. Mitochondria are particularly prone to oxidative stress-associated DNA damage because nucleotide imbalance can lead to mitochondrial depletion due to low replication fidelity. Failure to maintain nucleotide balance due to genetic defects can result in infantile death; however there is great variability in clinical presentation for particular diseases. This review compares genetic diseases that result from defects in specific nucleotide salvage enzymes and a signaling kinase that activates nucleotide salvage after DNA damage exposure. These diseases include Lesch-Nyhan syndrome, mitochondrial depletion syndromes, and ataxia telangiectasia. Although treatment options are available to palliate symptoms of these diseases, there is no cure. The conclusions drawn from this review include the critical role of guanine nucleotides in preventing neurodegeneration, the limitations of animals as disease models, and the need to further understand nucleotide imbalances in treatment regimens. Such knowledge will hopefully guide future studies into clinical therapies for genetic diseases. PMID:25923076
Evolving nucleotide binding surfaces
NASA Technical Reports Server (NTRS)
Kieber-Emmons, T.; Rein, R.
1981-01-01
An analysis is presented of the stability and nature of binding of a nucleotide to several known dehydrogenases. The employed approach includes calculation of hydrophobic stabilization of the binding motif and its intermolecular interaction with the ligand. The evolutionary changes of the binding motif are studied by calculating the Euclidean deviation of the respective dehydrogenases. Attention is given to the possible structural elements involved in the origin of nucleotide recognition by non-coded primordial polypeptides.
Dass, J Febin Prabhu; Sudandiradoss, C
2012-07-15
5-HT (5-Hydroxy-tryptamine) or serotonin receptors are found both in central and peripheral nervous system as well as in non-neuronal tissues. In the animal and human nervous system, serotonin produces various functional effects through a variety of membrane bound receptors. In this study, we focus on 5-HT receptor family from different mammals and examined the factors that account for codon and nucleotide usage variation. A total of 110 homologous coding sequences from 11 different mammalian species were analyzed using relative synonymous codon usage (RSCU), correspondence analysis (COA) and hierarchical cluster analysis together with nucleotide base usage frequency of chemically similar amino acid codons. The mean effective number of codon (ENc) value of 37.06 for 5-HT(6) shows very high codon bias within the family and may be due to high selective translational efficiency. The COA and Spearman's rank correlation reveals that the nucleotide compositional mutation bias as the major factors influencing the codon usage in serotonin receptor genes. The hierarchical cluster analysis suggests that gene function is another dominant factor that affects the codon usage bias, while species is a minor factor. Nucleotide base usage was reported using Goldman, Engelman, Stietz (GES) scale reveals the presence of high uracil (>45%) content at functionally important hydrophobic regions. Our in silico approach will certainly help for further investigations on critical inference on evolution, structure, function and gene expression aspects of 5-HT receptors family which are potential antipsychotic drug targets. Copyright © 2012 Elsevier B.V. All rights reserved.
Duke, Adrian M; Steele, Derek S
1998-01-01
The effect of caffeine and adenine nucleotides on the sarcoplasmic reticulum (SR) Ca2+ release mechanism was investigated in permeabilized frog skeletal muscle fibres. Caffeine was rapidly applied and the resulting release of Ca2+ from the SR detected using fura-2 fluorescence. Decreasing the [ATP] from 5 to 0.1 mm reduced the caffeine-induced Ca2+ transient by 89 ± 1.4 % (mean ± s.e.m., n = 16), while SR Ca2+ uptake was unaffected.The dependence of caffeine-induced Ca2+ release on cytosolic [ATP] was used to study the relative ability of other structurally related compounds to substitute for, or compete with, ATP at the adenine nucleotide binding site. It was found that AMP, ADP and the non-hydrolysable analogue adenylyl imidodiphosphate (AMP-PNP) partially substituted for ATP, although none was as potent in facilitating the Ca2+-releasing action of caffeine.Adenosine reversibly inhibited caffeine-induced Ca2+ release, without affecting SR Ca2+ uptake. Five millimolar adenosine markedly reduced the amplitude of the caffeine-induced Ca2+ transient by 64 ± 4 % (mean ± s.e.m., n = 11). The degree of inhibition was dependent upon the cytosolic [ATP], suggesting that adenosine may act as a competitive antagonist at the adenine nucleotide binding site.These data show that (i) the sensitivity of the in situ SR Ca2+ channel to caffeine activation is strongly dependent upon the cytosolic [ATP], (ii) the number of phosphates attached to the 5′ carbon of the ribose ring influences the efficacy of the ligand, and (iii) removal of a single phosphate group transforms AMP from a partial agonist, to adenosine, which acts as a competitive antagonist under these conditions. PMID:9782158
Duke, A M; Steele, D S
1998-11-15
1. The effect of caffeine and adenine nucleotides on the sarcoplasmic reticulum (SR) Ca2+ release mechanism was investigated in permeabilized frog skeletal muscle fibres. Caffeine was rapidly applied and the resulting release of Ca2+ from the SR detected using fura-2 fluorescence. Decreasing the [ATP] from 5 to 0.1 mM reduced the caffeine-induced Ca2+ transient by 89 +/- 1.4% (mean +/- s.e.m., n = 16), while SR Ca2+ uptake was unaffected. 2. The dependence of caffeine-induced Ca2+ release on cytosolic [ATP] was used to study the relative ability of other structurally related compounds to substitute for, or compete with, ATP at the adenine nucleotide binding site. It was found that AMP, ADP and the non-hydrolysable analogue adenylyl imidodiphosphate (AMP-PNP) partially substituted for ATP, although none was as potent in facilitating the Ca2+-releasing action of caffeine. 3. Adenosine reversibly inhibited caffeine-induced Ca2+ release, without affecting SR Ca2+ uptake. Five millimolar adenosine markedly reduced the amplitude of the caffeine-induced Ca2+ transient by 64 +/- 4% (mean +/- s.e.m., n = 11). The degree of inhibition was dependent upon the cytosolic [ATP], suggesting that adenosine may act as a competitive antagonist at the adenine nucleotide binding site. 4. These data show that (i) the sensitivity of the in situ SR Ca2+ channel to caffeine activation is strongly dependent upon the cytosolic [ATP], (ii) the number of phosphates attached to the 5' carbon of the ribose ring influences the efficacy of the ligand, and (iii) removal of a single phosphate group transforms AMP from a partial agonist, to adenosine, which acts as a competitive antagonist under these conditions.
... Substitutes Share Print Sugar substitutes are chemical or plant-based substances used to sweeten or enhance the ... made with saccharin. Stevia sweeteners Stevia is a plant-based sugar substitute that has no calories. The ...
Advances in targeting cyclic nucleotide phosphodiesterases
Maurice, Donald H.; Ke, Hengming; Ahmad, Faiyaz; Wang, Yousheng; Chung, Jay; Manganiello, Vincent C.
2014-01-01
Cyclic nucleotide phosphodiesterases (PDEs) catalyse the hydrolysis of cyclic AMP and cyclic GMP, thereby regulating the intracellular concentrations of these cyclic nucleotides, their signalling pathways and, consequently, myriad biological responses in health and disease. Currently, a small number of PDE inhibitors are used clinically for treating the pathophysiological dysregulation of cyclic nucleotide signalling in several disorders, including erectile dysfunction, pulmonary hypertension, acute refractory cardiac failure, intermittent claudication and chronic obstructive pulmonary disease. However, pharmaceutical interest in PDEs has been reignited by the increasing understanding of the roles of individual PDEs in regulating the subcellular compartmentalization of specific cyclic nucleotide signalling pathways, by the structure-based design of novel specific inhibitors and by the development of more sophisticated strategies to target individual PDE variants. PMID:24687066
Generation time, life history and the substitution rate of neutral mutations.
Lehtonen, Jussi; Lanfear, Robert
2014-11-01
Our understanding of molecular evolution is hampered by a lack of quantitative predictions about how life-history (LH) traits should correlate with substitution rates. Comparative studies have shown that neutral substitution rates vary substantially between species, and evidence shows that much of this diversity is associated with variation in LH traits. However, while these studies often agree, some unexplained and contradictory results have emerged. Explaining these results is difficult without a clear theoretical understanding of the problem. In this study, we derive predictions for the relationships between LH traits and substitution rates in iteroparous species by using demographic theory to relate commonly measured life-history traits to genetic generation time, and by implication to neutral substitution rates. This provides some surprisingly simple explanations for otherwise confusing patterns, such as the association between fecundity and substitution rates. The same framework can be applied to more complex life histories if full life-tables are available. © 2014 The Author(s) Published by the Royal Society. All rights reserved.
Structural basis of reverse nucleotide polymerization
Nakamura, Akiyoshi; Nemoto, Taiki; Heinemann, Ilka U.; Yamashita, Keitaro; Sonoda, Tomoyo; Komoda, Keisuke; Tanaka, Isao; Söll, Dieter; Yao, Min
2013-01-01
Nucleotide polymerization proceeds in the forward (5′-3′) direction. This tenet of the central dogma of molecular biology is found in diverse processes including transcription, reverse transcription, DNA replication, and even in lagging strand synthesis where reverse polymerization (3′-5′) would present a “simpler” solution. Interestingly, reverse (3′-5′) nucleotide addition is catalyzed by the tRNA maturation enzyme tRNAHis guanylyltransferase, a structural homolog of canonical forward polymerases. We present a Candida albicans tRNAHis guanylyltransferase-tRNAHis complex structure that reveals the structural basis of reverse polymerization. The directionality of nucleotide polymerization is determined by the orientation of approach of the nucleotide substrate. The tRNA substrate enters the enzyme’s active site from the opposite direction (180° flip) compared with similar nucleotide substrates of canonical 5′-3′ polymerases, and the finger domains are on opposing sides of the core palm domain. Structural, biochemical, and phylogenetic data indicate that reverse polymerization appeared early in evolution and resembles a mirror image of the forward process. PMID:24324136
Yang, G; Liu, X G; Qiu, B S
2000-07-01
The complete nucleotides of two Chinese tobacco mosaic virus (TMV) isolates, TMV-Cv (vulgare strain) and TMV-N14 (an attenuated virus originated from a tomato strain), were determined from their respective full-length infectious cDNA clones and compared with published TMV sequences. The genome structure of TMV-Cv contained 6395 nucleotides, in which four functional open reading frames (ORF), coding for replicase (126 kD/183 kD), movement protein (MP, 30 kD) and coat protein (CP, 17.6 kD) respectively, could be recognized. TMV-N14 contained 6384 nucleotides in its genome. In contrast to TMV-Cv, five functional ORFs encoding the replicase 98.5 kD/126 kD/183 kD, MP(27 kD) and CP(17.6 kD), respectively, were detected in the TMV-N14 genome. TMV-Cv is 99% homologous to a Korean TMV isolate belonging to the vulgare strain at the nucleotide level. TMV-N14 is 99% homologous to a highly virulent Japanese isolate TMV-L (tomato strain) at the nucleotide level. In TMV-N14, one opal nulation (UGA) occurred in the replicase gene and one ochre nutation (UAA) in the MP gene. The former mutation created a potential, additional ORF within the replicase gene, the latter reduced the size of the MP to 27 kD. In addition, there were also 13 amino acid substitutions in the replicase gene of TMV-N14 when compared to that of TMV-L. Collectively, these changes may have significant implications in the attenuation of the virulence of TMV-N14.
Phosphorylation of XPB helicase regulates TFIIH nucleotide excision repair activity
Coin, Frédéric; Auriol, Jérome; Tapias, Angel; Clivio, Pascale; Vermeulen, Wim; Egly, Jean-Marc
2004-01-01
Nucleotide excision repair (NER) removes damage from DNA in a tightly regulated multiprotein process. The xeroderma pigmentosum group B (XPB) helicase subunit of TFIIH functions in NER and transcription. The serine 751 (S751) residue of XPB was found to be phosphorylated in vivo. This phosphorylation inhibits NER and the microinjection of a phosphomimicking XPB-S751E mutant is unable to correct the NER defect of XP-B cells. Conversely, XPB-S751 dephosphorylation or its substitution with alanine (S751A) restores NER both in vivo and in vitro. Surprisingly, phospho/dephosphorylation of S751 spares TFIIH-dependent transcription. Finally, the phosphorylation of XPB-S751 does not impair the TFIIH unwinding of the DNA around the lesion, but rather prevents the 5′ incision triggered by the ERCC1-XPF endonuclease. These data support an additional role for XPB in promoting the incision of the damaged fragment and reveal a point of NER regulation on TFIIH without interference in its transcription activity. PMID:15549133
DOE Office of Scientific and Technical Information (OSTI.GOV)
Modi, K. B.; Saija, K. G.; Sharma, P. U.
2016-05-06
Polycrystalline samples of Cr{sup 3+} - substituted yttrium iron garnet (Y{sub 3}Fe{sub 5}O{sub 12}) system with general chemical formula, Y{sub 3}Fe{sub 5-x}Cr{sub x}O{sub 12}, x = 0.0, 0.2, 0.4 and 0.6 were synthesized by double sintering ceramic technique and characterized by X-ray powder diffractometry. The Rietveld fitted X-ray diffraction patterns analysis revealed mono phase formation for x = 0.0 - 0.4 compositions while x = 0.6 composition possesses mixed phase character. The observed substitution limit has been discussed in the light of ionic size of substituent, electrostatic energy, electronic configuration and synthesis parameters. These observations strongly suggest that the electronicmore » configuration of Cr{sup 3+}, which is favorable to the formation of d2sp3 (octahedral) type bonds, must be important. In the case of Cr{sup 3+}, the substitution does not appear to proceed well for x much greater than 0.5, this limitation probably is a consequence of the strong preference of a smaller ion Cr{sup 3+}, for a larger octahedral site which quickly leads to a condition not comparable with the requirement of the structure. The distribution of cations, mean ionic radii and theoretical lattice constant values have been determined.« less
de Keyzer, Jeanine; Steel, Gregor J.; Hale, Sarah J.; Humphries, Daniel; Stirling, Colin J.
2009-01-01
Protein translocation and folding in the endoplasmic reticulum of Saccharomyces cerevisiae involves two distinct Hsp70 chaperones, Lhs1p and Kar2p. Both proteins have the characteristic domain structure of the Hsp70 family consisting of a conserved N-terminal nucleotide binding domain and a C-terminal substrate binding domain. Kar2p is a canonical Hsp70 whose substrate binding activity is regulated by cochaperones that promote either ATP hydrolysis or nucleotide exchange. Lhs1p is a member of the Grp170/Lhs1p subfamily of Hsp70s and was previously shown to function as a nucleotide exchange factor (NEF) for Kar2p. Here we show that in addition to this NEF activity, Lhs1p can function as a holdase that prevents protein aggregation in vitro. Analysis of the nucleotide requirement of these functions demonstrates that nucleotide binding to Lhs1p stimulates the interaction with Kar2p and is essential for NEF activity. In contrast, Lhs1p holdase activity is nucleotide-independent and unaffected by mutations that interfere with ATP binding and NEF activity. In vivo, these mutants show severe protein translocation defects and are unable to support growth despite the presence of a second Kar2p-specific NEF, Sil1p. Thus, Lhs1p-dependent nucleotide exchange activity is vital for ER protein biogenesis in vivo. PMID:19759005
2010-01-01
We examined the analysis of nucleotides and nucleotide sugars by chromatography on porous graphitic carbon with mass spectrometric detection, a method that evades contamination of the MS instrument with ion pairing reagent. At first, adenosine triphosphate (ATP) and other triphosphate nucleotides exhibited very poor chromatographic behavior on new columns and could hardly be eluted from columns previously cleaned with trifluoroacetic acid. Satisfactory performance of both new and older columns could, however, be achieved by treatment with reducing agent and, unexpectedly, hydrochloric acid. Over 40 nucleotides could be detected in cell extracts including many isobaric compounds such as ATP, deoxyguanosine diphosphate (dGTP), and phospho-adenosine-5′-phosphosulfate or 3′,5′-cyclic adenosine 5'-monophosphate (AMP) and its much more abundant isomer 2′,3′-cylic AMP. A fast sample preparation procedure based on solid-phase extraction on carbon allowed detection of very short-lived analytes such as cytidine 5'-monophosphate (CMP)-2-keto-deoxy-octulosonic acid. In animal cells and plant tissues, about 35 nucleotide sugars were detected, among them rarely considered metabolites such as uridine 5'-diphosphate (UDP)-l-arabinopyranose, UDP-l-arabinofuranose, guanosine 5'-diphosphate (GDP)-l-galactofuranose, UDP-l-rhamnose, and adenosine diphosphate (ADP)-sugars. Surprisingly, UDP-arabinopyranose was also found in Chinese hamster ovary (CHO) cells. Due to the unique structural selectivity of graphitic carbon, the method described herein distinguishes more nucleotides and nucleotide sugars than previously reported approaches. PMID:21043458
Aguadé, M
2001-01-01
The FAH1 and F3H genes encode ferulate-5-hydroxylase and flavanone-3-hydroxylase, which are enzymes in the pathways leading to the synthesis of sinapic acid esters and flavonoids, respectively. Nucleotide variation at these genes was surveyed by sequencing a sample of 20 worldwide Arabidopsis thaliana ecotypes and one Arabidopsis lyrata spp. petraea stock. In contrast with most previously studied genes, the percentage of singletons was rather low in both the FAH1 and the F3H gene regions. There was, therefore, no footprint of a recent species expansion in the pattern of nucleotide variation in these regions. In both FAH1 and F3H, nucleotide variation was structured into two major highly differentiated haplotypes. In both genes, there was a peak of silent polymorphism in the 5' part of the coding region without a parallel increase in silent divergence. In FAH1, the peak was centered at the beginning of the second exon. In F3H, nucleotide diversity was highest at the beginning of the gene. The observed pattern of variation in both FAH1 and F3H, although suggestive of balancing selection, was compatible with a neutral model with no recombination.
Effect of lattice strain on structural and magnetic properties of Ca substituted barium hexaferrite
NASA Astrophysics Data System (ADS)
Kumar, Sunil; Supriya, Sweety; Pandey, Rabichandra; Pradhan, Lagen Kumar; Singh, Rakesh Kumar; Kar, Manoranjan
2018-07-01
The calcium (Ca2+) substituted M-type barium hexaferrite (Ba1-xCaxFe12O19) for Ca2+ (x = 0.00, 0.025, 0.050, 0.075, 0.100, 0.150, and 0.200) have been synthesized by the citrate sol-gel method. The X-ray diffraction (XRD) patterns with Rietveld refinement reveal the formation of hexagonal crystal structure with P63/mmc space group. The lattice parameters a = b and c decrease, whereas lattice strain found to increase with the increase in Ca concentration in the samples. The analysis of Raman spectra well supports the XRD patterns analysis. The average particle size is obtained from the FE-SEM (Field Emission Scanning Electron Microscopy) micrographs and these are similar to that of crystallite size obtained from the XRD pattern analysis. The saturation magnetization and magnetocrystalline anisotropy have been obtained by employing the "Law of Approach (LA) to Saturation magnetization" technique at room temperature. The saturation magnetization and magnetocrystalline anisotropy constant are maximum for 5% Ca substitution in barium hexaferrite. It could be due to lattice strain mediated magnetism. However, these magnetic properties decrease for more than the 5% Ca substitution in barium hexaferrite. It could be due to decrease of magnetic exchange interaction (Fe-O-Fe) in the sample. A correlation between magnetic interaction and lattice strain has been observed in Ca2+ substituted M-type barium hexaferrite.
Battilana, Juri; Emanuelli, Francesco; Gambino, Giorgio; Gribaudo, Ivana; Gasperi, Flavia; Boss, Paul K.; Grando, Maria Stella
2011-01-01
Grape berries of Muscat cultivars (Vitis vinifera L.) contain high levels of monoterpenols and exhibit a distinct aroma related to this composition of volatiles. A structural gene of the plastidial methyl-erythritol-phosphate (MEP) pathway, 1-deoxy-D-xylulose 5-phosphate synthase (VvDXS), was recently suggested as a candidate gene for this trait, having been co-localized with a major quantitative trait locus for linalool, nerol, and geraniol concentrations in berries. In addition, a structured association study discovered a putative causal single nucleotide polymorphism (SNP) responsible for the substitution of a lysine with an asparagine at position 284 of the VvDXS protein, and this SNP was significantly associated with Muscat-flavoured varieties. The significance of this nucleotide difference was investigated by comparing the monoterpene profiles with the expression of VvDXS alleles throughout berry development in Moscato Bianco, a cultivar heterozygous for the SNP mutation. Although correlation was detected between the VvDXS transcript profile and the accumulation of free monoterpenol odorants, the modulation of VvDXS expression during berry development appears to be independent of nucleotide variation in the coding sequence. In order to assess how the non-synonymous mutation may enhance Muscat flavour, an in vitro characterization of enzyme isoforms was performed followed by in vivo overexpression of each VvDXS allele in tobacco. The results showed that the amino acid non-neutral substitution influences the enzyme kinetics by increasing the catalytic efficiency and also dramatically affects monoterpene levels in transgenic lines. These findings confirm a functional effect of the VvDXS gene polymorphism and may pave the way for metabolic engineering of terpenoid contents in grapevine. PMID:21868399
Accounting for product substitution in the analysis of food taxes targeting obesity.
Miao, Zhen; Beghin, John C; Jensen, Helen H
2013-11-01
We extend the existing literature on food taxes targeting obesity. We systematically incorporate the implicit substitution between added sugars and solid fats into a comprehensive food demand system and evaluate the effect of taxes on sugars and fats. The approach conditions how food and obesity taxes affect total calorie intake. The proposed methodology accounts for the ability of consumers to substitute leaner low-fat and low-sugar items for rich food items within the same food group. We calibrate this demand system approach using recent food intake data and existing estimates of price and income elasticities of demand. The demand system accounts for both the within-food group substitution and the substitution across these groups. Simulations of taxes on added sugars and solid fat show that the tax impact on consumption patterns is understated and the induced welfare loss is overstated when not allowing for the substitution possibilities within food groups. Copyright © 2012 John Wiley & Sons, Ltd.
ZHANG, Zhihe; HOU, Rong; LAN, Jingchao; WANG, Hairui; KUROKAWA, Hiroyuki; TAKATSU, Zenta; KOBAYASHI, Toyokazu; KOIE, Hiroshi; KAMATA, Hiroshi; KANAYAMA, Kiichi; WATANABE, Toshi
2016-01-01
The first milk substitute for giant panda cubs was developed in 1988 based on limited data about giant panda breast milk and that of certain types of bear. Mixtures of other formulas have also been fed to cubs at some facilities. However, they are not of sufficient nutritional quality for promoting growth in panda cubs. Here, we report analysis of giant panda breast milk and propose new milk substitutes for cubs, which were developed based on the results of our analysis. The Chengdu Research Base of Giant Panda Breeding obtained breast milk samples from three giant pandas. Up to 30 ml of breast milk were collected from each mother by hand. Then, the milk samples were frozen and sent to Nihon University. The levels of protein, fat, carbohydrates, ash, moisture, vitamins, minerals, total amino acids, fatty acids, lactose and other carbohydrates in the milk were analyzed. The breast milk samples exhibited the following nutritional values: protein: 6.6–8.5%, fat: 6.9–16.4%, carbohydrates: 2.5–9.1%, ash: 0.9–1.0% and moisture: 67–83%. We designed two kinds of milk substitutes based on the data obtained and the nutritional requirements of dogs, cats and rodents. The nutritional composition of the milk substitutes for the first and second stages was as follows: protein: 38 and 26%, fat: 40 and 40%, carbohydrates: 13 and 25%, ash: 6 and 6% and moisture: 3 and 3%, respectively. In addition, the substitutes contained vitamins, minerals, taurine, docosahexaenoic acid, lactoferrin, nucleotides and other nutrients. PMID:26781707
Jeong, Hyun-Jeong; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Kim, Bo-Sook; Rho, Jung-Rae; Yoo, Mi-Hyun; Jeong, Byung-Hoon; Kim, Yong-Sun
2007-01-01
Polymorphisms of the prion protein gene (PRNP) have been detected in several cervid species. In order to confirm the genetic variations, this study examined the DNA sequences of the PRNP obtained from 33 captive sika deer (Cervus nippon laiouanus) in Korea. A total of three single-nucleotide polymorphisms (SNPs) at codons 100, 136 and 226 in the PRNP of the sika deer were identified. The polymorphic site located at codon 100 has not been reported. The SNPs detected at codons 100 and 226 induced amino acid substitutions. The SNP at codon 136 was a silent mutation that does not induce any amino acid change. The genotype and allele frequencies were determined for each of the SNPs. PMID:17679779
Pereira, Caroline S; Silveira, Rodrigo L; Dupree, Paul; Skaf, Munir S
2017-04-10
Lignocellulosic biomass is mainly constituted by cellulose, hemicellulose, and lignin and represents an important resource for the sustainable production of biofuels and green chemistry materials. Xylans, a common hemicellulose, interact with cellulose and often exhibit various side chain substitutions including acetate, (4-O-methyl) glucuronic acid, and arabinose. Recent studies have shown that the distribution of xylan substitutions is not random, but follows patterns that are dependent on the plant taxonomic family and cell wall type. Here, we use molecular dynamics simulations to investigate the role of substitutions on xylan interactions with the hydrophilic cellulose face, using the recently discovered xylan decoration pattern of the conifer gymnosperms as a model. The results show that α-1,2-linked substitutions stabilize the binding of single xylan chains independently of the nature of the substitution and that Ca 2+ ions can mediate cross-links between glucuronic acid substitutions of two neighboring xylan chains, thus stabilizing binding. At high temperature, xylans move from the hydrophilic to the hydrophobic cellulose surface and are also stabilized by Ca 2+ cross-links. Our results help to explain the role of substitutions on xylan-cellulose interactions, and improve our understanding of the plant cell wall architecture and the fundamentals of biomass pretreatments.
Phosphate-Modified Nucleotides for Monitoring Enzyme Activity.
Ermert, Susanne; Marx, Andreas; Hacker, Stephan M
2017-04-01
Nucleotides modified at the terminal phosphate position have been proven to be interesting entities to study the activity of a variety of different protein classes. In this chapter, we present various types of modifications that were attached as reporter molecules to the phosphate chain of nucleotides and briefly describe the chemical reactions that are frequently used to synthesize them. Furthermore, we discuss a variety of applications of these molecules. Kinase activity, for instance, was studied by transfer of a phosphate modified with a reporter group to the target proteins. This allows not only studying the activity of kinases, but also identifying their target proteins. Moreover, kinases can also be directly labeled with a reporter at a conserved lysine using acyl-phosphate probes. Another important application for phosphate-modified nucleotides is the study of RNA and DNA polymerases. In this context, single-molecule sequencing is made possible using detection in zero-mode waveguides, nanopores or by a Förster resonance energy transfer (FRET)-based mechanism between the polymerase and a fluorophore-labeled nucleotide. Additionally, fluorogenic nucleotides that utilize an intramolecular interaction between a fluorophore and the nucleobase or an intramolecular FRET effect have been successfully developed to study a variety of different enzymes. Finally, also some novel techniques applying electron paramagnetic resonance (EPR)-based detection of nucleotide cleavage or the detection of the cleavage of fluorophosphates are discussed. Taken together, nucleotides modified at the terminal phosphate position have been applied to study the activity of a large diversity of proteins and are valuable tools to enhance the knowledge of biological systems.
Nucleic acid analysis using terminal-phosphate-labeled nucleotides
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2008-04-22
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Poly(oxyalkylenediyl),.alpha... Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic... identified generically as poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted...
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Poly(oxyalkylenediyl),.alpha... Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic... identified generically as poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted...
Code of Federal Regulations, 2014 CFR
2014-07-01
... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Poly(oxyalkylenediyl),.alpha... Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic... identified generically as poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted...
Code of Federal Regulations, 2012 CFR
2012-07-01
... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Poly(oxyalkylenediyl),.alpha... Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic... identified generically as poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted...
Base-By-Base: single nucleotide-level analysis of whole viral genome alignments.
Brodie, Ryan; Smith, Alex J; Roper, Rachel L; Tcherepanov, Vasily; Upton, Chris
2004-07-14
With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes) is not feasible without new bioinformatics tools. A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1) rapidly identify and correct alignment errors in large, multiple genome alignments; and 2) generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs) to retrieve detailed annotation information about the aligned genomes or use information from text files. Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Willing, M.; Deschenes, S.
We have identified a G to A substitution in the 5{prime} donor splice site of intron 18 of one COL1A1 allele in two unrelated families with osteogenesis imperfecta (OI) type I. A third OI type I family has a G to A substitution at the identical position in intron 48 of one COL1A1 allele. Both mutations abolish normal splicing and lead to reduced steady-state levels of mRNA from the mutant COL1A1 allele. The intron 18 mutation leads to both exon 18 skipping in the mRNA and to utilization of a single alternative splice site near the 3{prime} end of exonmore » 18. The latter results in deletion of the last 8 nucleotides of exon 18 from the mRNA, a shift in the translational reading-frame, and the creation of a premature termination codon in exon 19. Of the potential alternative 5{prime} splice sites in exon 18 and intron 18, the one utilized has a surrounding nucleotide sequence which most closely resembles that of the natural splice site. Although a G to A mutation was detected at the identical position in intron 48 of one COL1A1 allele in another OI type I family, nine complex alternative splicing patterns were identified by sequence analysis of cDNA clones derived from fibroblast mRNA from this cell strain. All result in partial or complete skipping of exon 48, with in-frame deletions of portions of exons 47 and/or 49. The different patterns of RNA splicing were not explained by their sequence homology with naturally occuring 5{prime} splice sites, but rather by recombination between highly homologous exon sequences, suggesting that we may not have identified the major splicing alternative(s) in this cell strain. Both G to A mutations result in decreased production of type I collagen, the common biochemical correlate of OI type I.« less
No variation and low synonymous substitution rates in coral mtDNA despite high nuclear variation
Hellberg, Michael E
2006-01-01
Background The mitochondrial DNA (mtDNA) of most animals evolves more rapidly than nuclear DNA, and often shows higher levels of intraspecific polymorphism and population subdivision. The mtDNA of anthozoans (corals, sea fans, and their kin), by contrast, appears to evolve slowly. Slow mtDNA evolution has been reported for several anthozoans, however this slow pace has been difficult to put in phylogenetic context without parallel surveys of nuclear variation or calibrated rates of synonymous substitution that could permit quantitative rate comparisons across taxa. Here, I survey variation in the coding region of a mitochondrial gene from a coral species (Balanophyllia elegans) known to possess high levels of nuclear gene variation, and estimate synonymous rates of mtDNA substitution by comparison to another coral (Tubastrea coccinea). Results The mtDNA surveyed (630 bp of cytochrome oxidase subunit I) was invariant among individuals sampled from 18 populations spanning 3000 km of the range of B. elegans, despite high levels of variation and population subdivision for allozymes over these same populations. The synonymous substitution rate between B. elegans and T. coccinea (0.05%/site/106 years) is similar to that in most plants, but 50–100 times lower than rates typical for most animals. In addition, while substitutions to mtDNA in most animals exhibit a strong bias toward transitions, mtDNA from these corals does not. Conclusion Slow rates of mitochondrial nucleotide substitution result in low levels of intraspecific mtDNA variation in corals, even when nuclear loci vary. Slow mtDNA evolution appears to be the basal condition among eukaryotes. mtDNA substitution rates switch from slow to fast abruptly and unidirectionally. This switch may stem from the loss of just one or a few mitochondrion-specific DNA repair or replication genes. PMID:16542456
Nucleotide sequences encoding a thermostable alkaline protease
Wilson, David B.; Lao, Guifang
1998-01-01
Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.
Simple, heart-smart substitutions
Coronary artery disease - heart smart substitutions; Atherosclerosis - heart smart substitutions; Cholesterol - heart smart substitutions; Coronary heart disease - heart smart substitutions; Healthy diet - heart ...
Auditory Sensory Substitution is Intuitive and Automatic with Texture Stimuli
Stiles, Noelle R. B.; Shimojo, Shinsuke
2015-01-01
Millions of people are blind worldwide. Sensory substitution (SS) devices (e.g., vOICe) can assist the blind by encoding a video stream into a sound pattern, recruiting visual brain areas for auditory analysis via crossmodal interactions and plasticity. SS devices often require extensive training to attain limited functionality. In contrast to conventional attention-intensive SS training that starts with visual primitives (e.g., geometrical shapes), we argue that sensory substitution can be engaged efficiently by using stimuli (such as textures) associated with intrinsic crossmodal mappings. Crossmodal mappings link images with sounds and tactile patterns. We show that intuitive SS sounds can be matched to the correct images by naive sighted participants just as well as by intensively-trained participants. This result indicates that existing crossmodal interactions and amodal sensory cortical processing may be as important in the interpretation of patterns by SS as crossmodal plasticity (e.g., the strengthening of existing connections or the formation of new ones), especially at the earlier stages of SS usage. An SS training procedure based on crossmodal mappings could both considerably improve participant performance and shorten training times, thereby enabling SS devices to significantly expand blind capabilities. PMID:26490260
Nucleotide sequences encoding a thermostable alkaline protease
Wilson, D.B.; Lao, G.
1998-01-06
Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.
Structural Basis for Nucleotide Exchange in Heterotrimeric G Proteins
Dror, Ron O.; Mildorf, Thomas J.; Hilger, Daniel; Manglik, Aashish; Borhani, David W.; Arlow, Daniel H.; Philippsen, Ansgar; Villanueva, Nicolas; Yang, Zhongyu; Lerch, Michael T.; Hubbell, Wayne L.; Kobilka, Brian K.; Sunahara, Roger K.; Shaw, David E.
2016-01-01
G protein–coupled receptors (GPCRs) relay diverse extracellular signals into cells by catalyzing nucleotide release from heterotrimeric G proteins, but the mechanism underlying this quintessential molecular signaling event has remained unclear. Here we use atomic-level simulations to elucidate the nucleotide-release mechanism. We find that the G protein α subunit Ras and helical domains—previously observed to separate widely upon receptor binding to expose the nucleotide-binding site—separate spontaneously and frequently even in the absence of a receptor. Domain separation is necessary but not sufficient for rapid nucleotide release. Rather, receptors catalyze nucleotide release by favoring an internal structural rearrangement of the Ras domain that weakens its nucleotide affinity. We use double electron-electron resonance spectroscopy and protein engineering to confirm predictions of our computationally determined mechanism. PMID:26089515
Applications of adenine nucleotide measurements in oceanography
NASA Technical Reports Server (NTRS)
Holm-Hansen, O.; Hodson, R.; Azam, F.
1975-01-01
The methodology involved in nucleotide measurements is outlined, along with data to support the premise that ATP concentrations in microbial cells can be extrapolated to biomass parameters. ATP concentrations in microorganisms and nucleotide analyses are studied.
How Do Substitute Teachers Substitute? An Empirical Study of Substitute-Teacher Labor Supply
ERIC Educational Resources Information Center
Gershenson, Seth
2012-01-01
This paper examines the daily labor supply of a potentially important, but often overlooked, source of instruction in U.S. public schools: substitute teachers. I estimate a sequential binary-choice model of substitute teachers' job-offer acceptance decisions using data on job offers made by a randomized automated calling system. Importantly, this…
Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms.
Zhang, Wei; Qi, Weihong; Albert, Thomas J; Motiwala, Alifiya S; Alland, David; Hyytia-Trees, Eija K; Ribot, Efrain M; Fields, Patricia I; Whittam, Thomas S; Swaminathan, Bala
2006-06-01
Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7x10(-9) per site per year), we estimate that the most recent common ancestor of the contemporary beta-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens.
Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms
Zhang, Wei; Qi, Weihong; Albert, Thomas J.; Motiwala, Alifiya S.; Alland, David; Hyytia-Trees, Eija K.; Ribot, Efrain M.; Fields, Patricia I.; Whittam, Thomas S.; Swaminathan, Bala
2006-01-01
Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7 × 10−9 per site per year), we estimate that the most recent common ancestor of the contemporary β-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens. PMID:16606700
Photoinitiator Nucleotide for Quantifying Nucleic Acid Hybridization
Johnson, Leah M.; Hansen, Ryan R.; Urban, Milan; Kuchta, Robert D.; Bowman, Christopher N.
2010-01-01
This first report of a photoinitiator-nucleotide conjugate demonstrates a novel approach for sensitive, rapid and visual detection of DNA hybridization events. This approach holds potential for various DNA labeling schemes and for applications benefiting from selective DNA-based polymerization initiators. Here, we demonstrate covalent, enzymatic incorporation of an eosin-photoinitiator 2′-deoxyuridine-5′-triphosphate (EITC-dUTP) conjugate into surface-immobilized DNA hybrids. Subsequent radical chain photoinitiation from these sites using an acrylamide/bis-acrylamide formulation yields a dynamic detection range between 500pM and 50nM of DNA target. Increasing EITC-nucleotide surface densities leads to an increase in surface-based polymer film heights until achieving a film height plateau of 280nm ±20nm at 610 ±70 EITC-nucleotides/μm2. Film heights of 10–20 nm were obtained from eosin surface densities of approximately 20 EITC-nucleotides/μm2 while below the detection limit of ~10 EITC-nucleotides/μm2, no detectable films were formed. This unique threshold behavior is utilized for instrument-free, visual quantification of target DNA concentration ranges. PMID:20337438
SV40 host-substituted variants: a new look at the monkey DNA inserts and recombinant junctions.
Singer, Maxine; Winocour, Ernest
2011-04-10
The available monkey genomic data banks were examined in order to determine the chromosomal locations of the host DNA inserts in 8 host-substituted SV40 variant DNAs. Five of the 8 variants contained more than one linked monkey DNA insert per tandem repeat unit and in all cases but one, the 19 monkey DNA inserts in the 8 variants mapped to different locations in the monkey genome. The 50 parental DNAs (32 monkey and 18 SV40 DNA segments) which spanned the crossover and flanking regions that participated in monkey/monkey and monkey/SV40 recombinations were characterized by substantial levels of microhomology of up to 8 nucleotides in length; the parental DNAs also exhibited direct and inverted repeats at or adjacent to the crossover sequences. We discuss how the host-substituted SV40 variants arose and the nature of the recombination mechanisms involved. Copyright © 2011 Elsevier Inc. All rights reserved.
Substitution and the USDA Forest Service log export restrictions.
Gary R. Lindell
1980-01-01
With some exceptions, the substitution of national forest timber for exported private timber is forbidden by regulations. Certain firms may use a limited amount of national forest timber as replacement for exported private timber, however, in accordance with their pattern of purchases and exports from 1971 through 1973. About 359 million board feet of national forest...
Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong
2017-03-01
Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.
Di Pietro, M; Schnider, A; Ptak, R
2011-10-01
Patients with peripheral dysgraphia due to impairment at the allographic level produce writing errors that affect the letter-form and are characterized by case confusions or the failure to write in a specific case or style (e.g., cursive). We studied the writing errors of a patient with pure peripheral dysgraphia who had entirely intact oral spelling, but produced many well-formed letter errors in written spelling. The comparison of uppercase print and lowercase cursive spelling revealed an uncommon pattern: while most uppercase errors were case substitutions (e.g., A - a), almost all lowercase errors were letter substitutions (e.g., n - r). Analyses of the relationship between target letters and substitution errors showed that errors were neither influenced by consonant-vowel status nor by letter frequency, though word length affected error frequency in lowercase writing. Moreover, while graphomotor similarity did not predict either the occurrence of uppercase or lowercase errors, visuospatial similarity was a significant predictor of lowercase errors. These results suggest that lowercase representations of cursive letter-forms are based on a description of entire letters (visuospatial features) and are not - as previously found for uppercase letters - specified in terms of strokes (graphomotor features). Copyright © 2010 Elsevier Srl. All rights reserved.
Seasonal changes of nucleotides in mussel (Mytilus galloprovincialis) mantle tissue.
Blanco, S L; Suárez, M P; San Juan, F
2006-03-01
Seasonal variations of nucleotides in Mytilus galloprovincialis mantle tissue were analyzed. Separation and quantification was achieved by reversed-phase high-performance liquid chromatography. Total nucleotides show a pronounced seasonal variation with maximum and minimum values in autumn and spring, respectively. Adenine nucleotides accounted for the major part in spring and summer, guanosine and cytidine nucleotides in winter; uridine nucleotides were relatively constant throughout the year. Their inverse variation suggests inter-conversion among them and the maintenance of the potential cell energy in winter by other triphosphate nucleotides different from ATP. These results reflect environmental and nutritional conditions, and also the reserves and gametogenic cycles taking place in M. galloprovincialis mantle tissue.
Podda, Maria Vittoria; Grassi, Claudio
2014-07-01
Cyclic nucleotides play fundamental roles in the central nervous system (CNS) under both physiological and pathological conditions. The impact of cAMP and cGMP signaling on neuronal and glial cell functions has been thoroughly characterized. Most of their effects have been related to cyclic nucleotide-dependent protein kinase activity. However, cyclic nucleotide-gated (CNG) channels, first described as key mediators of sensory transduction in retinal and olfactory receptors, have been receiving increasing attention as possible targets of cyclic nucleotides in the CNS. In the last 15 years, consistent evidence has emerged for their expression in neurons and astrocytes of the rodent brain. Far less is known, however, about the functional role of CNG channels in these cells, although several of their features, such as Ca(2+) permeability and prolonged activation in the presence of cyclic nucleotides, make them ideal candidates for mediators of physiological functions in the CNS. Here, we review literature suggesting the involvement of CNG channels in a number of CNS cellular functions (e.g., regulation of membrane potential, neuronal excitability, and neurotransmitter release) as well as in more complex phenomena, like brain plasticity, adult neurogenesis, and pain sensitivity. The emerging picture is that functional and dysfunctional cyclic nucleotide signaling in the CNS has to be reconsidered including CNG channels among possible targets. However, concerted efforts and multidisciplinary approaches are still needed to get more in-depth knowledge in this field.
Code of Federal Regulations, 2010 CFR
2010-07-01
... substituted benezenesulfonic acid reaction product with naphthalenesulfonato azo substituted phenyl azo... substituted triazine amino substituted benezenesulfonic acid reaction product with naphthalenesulfonato azo... substituted triazine amino substituted benezenesulfonic acid reaction product with naphthalenesulfonato azo...
Code of Federal Regulations, 2011 CFR
2011-07-01
... substituted benezenesulfonic acid reaction product with naphthalenesulfonato azo substituted phenyl azo... substituted triazine amino substituted benezenesulfonic acid reaction product with naphthalenesulfonato azo... substituted triazine amino substituted benezenesulfonic acid reaction product with naphthalenesulfonato azo...
Structure of a eukaryotic cyclic nucleotide-gated channel
Li, Minghui; Zhou, Xiaoyuan; Wang, Shu; Michailidis, Ioannis; Gong, Ye; Su, Deyuan; Li, Huan; Li, Xueming; Yang, Jian
2018-01-01
Summary Cyclic nucleotide-gated (CNG) channels are essential for vision and olfaction. They belong to the voltage-gated ion channel superfamily but their activities are controlled by intracellular cyclic nucleotides instead of transmembrane voltage. Here we report a 3.5 Å-resolution single-particle electron cryomicroscopy structure of a CNG channel from C. elegans in the cGMP-bound open state. The channel has an unusual voltage-sensor-like domain (VSLD), accounting for its deficient voltage dependence. A C-terminal linker connecting S6 and the cyclic nucleotide-binding domain interacts directly with both the VSLD and pore domain, forming a gating ring that couples conformational changes triggered by cyclic nucleotide binding to the gate. The selectivity filter is lined by the carboxylate side chains of a functionally important glutamate and three rings of backbone carbonyls. This structure provides a new framework for understanding mechanisms of ion permeation, gating and channelopathy of CNG channels and cyclic nucleotide modulation of related channels. PMID:28099415
Energy efficiency trade-offs drive nucleotide usage in transcribed regions
Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.
2016-01-01
Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217
Space can substitute for time in predicting climate-change effects on biodiversity
Blois, Jessica L.; Williams, John W.; Fitzpatrick, Matthew C.; Jackson, Stephen T.; Ferrier, Simon
2013-01-01
“Space-for-time” substitution is widely used in biodiversity modeling to infer past or future trajectories of ecological systems from contemporary spatial patterns. However, the foundational assumption—that drivers of spatial gradients of species composition also drive temporal changes in diversity—rarely is tested. Here, we empirically test the space-for-time assumption by constructing orthogonal datasets of compositional turnover of plant taxa and climatic dissimilarity through time and across space from Late Quaternary pollen records in eastern North America, then modeling climate-driven compositional turnover. Predictions relying on space-for-time substitution were ∼72% as accurate as “time-for-time” predictions. However, space-for-time substitution performed poorly during the Holocene when temporal variation in climate was small relative to spatial variation and required subsampling to match the extent of spatial and temporal climatic gradients. Despite this caution, our results generally support the judicious use of space-for-time substitution in modeling community responses to climate change.
Space can substitute for time in predicting climate-change effects on biodiversity.
Blois, Jessica L; Williams, John W; Fitzpatrick, Matthew C; Jackson, Stephen T; Ferrier, Simon
2013-06-04
"Space-for-time" substitution is widely used in biodiversity modeling to infer past or future trajectories of ecological systems from contemporary spatial patterns. However, the foundational assumption--that drivers of spatial gradients of species composition also drive temporal changes in diversity--rarely is tested. Here, we empirically test the space-for-time assumption by constructing orthogonal datasets of compositional turnover of plant taxa and climatic dissimilarity through time and across space from Late Quaternary pollen records in eastern North America, then modeling climate-driven compositional turnover. Predictions relying on space-for-time substitution were ∼72% as accurate as "time-for-time" predictions. However, space-for-time substitution performed poorly during the Holocene when temporal variation in climate was small relative to spatial variation and required subsampling to match the extent of spatial and temporal climatic gradients. Despite this caution, our results generally support the judicious use of space-for-time substitution in modeling community responses to climate change.
Functional analysis of regulatory single-nucleotide polymorphisms.
Pampín, Sandra; Rodríguez-Rey, José C
2007-04-01
The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.
Dye, Natalie A; Pincus, Zachary; Fisher, Isabelle C; Shapiro, Lucy; Theriot, Julie A
2011-07-01
The maintenance of cell shape in Caulobacter crescentus requires the essential gene mreB, which encodes a member of the actin superfamily and the target of the antibiotic, A22. We isolated 35 unique A22-resistant Caulobacter strains with single amino acid substitutions near the nucleotide binding site of MreB. Mutations that alter cell curvature and mislocalize the intermediate filament crescentin cluster on the back surface of MreB's structure. Another subset have variable cell widths, with wide cell bodies and actively growing thin extensions of the cell poles that concentrate fluorescent MreB. We found that the extent to which MreB localization is perturbed is linearly correlated with the development of pointed cell poles and variable cell widths. Further, we find that a mutation to glycine of two conserved aspartic acid residues that are important for nucleotide hydrolysis in other members of the actin superfamily abolishes robust midcell recruitment of MreB but supports a normal rate of growth. These mutant strains provide novel insight into how MreB's protein structure, subcellular localization, and activity contribute to its function in bacterial cell shape. © 2011 Blackwell Publishing Ltd.
Dye, Natalie A; Pincus, Zachary; Fisher, Isabelle C; Shapiro, Lucy; Theriot, Julie A
2011-01-01
Summary The maintenance of cell shape in Caulobacter crescentus requires the essential gene mreB, which encodes a member of the actin superfamily and the target of the antibiotic, A22. We isolated 35 unique A22-resistant Caulobacter strains with single amino acid substitutions near the nucleotide binding site of MreB. Mutations that alter cell curvature and mislocalize the intermediate filament crescentin cluster on the back surface of MreB's structure. Another subset have variable cell widths, with wide cell bodies and actively growing thin extensions of the cell poles that concentrate fluorescent MreB. We found that the extent to which MreB localization is perturbed is linearly correlated with the development of pointed cell poles and variable cell widths. Further, we find that a mutation to glycine of two conserved aspartic acid residues that are important for nucleotide hydrolysis in other members of the actin superfamily abolishes robust midcell recruitment of MreB but supports a normal rate of growth. These mutant strains provide novel insight into how MreB's protein structure, subcellular localization, and activity contribute to its function in bacterial cell shape. PMID:21564339
Weng, Mao-Lun; Blazier, John C; Govindu, Madhumita; Jansen, Robert K
2014-03-01
Geraniaceae plastid genomes are highly rearranged, and each of the four genera already sequenced in the family has a distinct genome organization. This study reports plastid genome sequences of six additional species, Francoa sonchifolia, Melianthus villosus, and Viviania marifolia from Geraniales, and Pelargonium alternans, California macrophylla, and Hypseocharis bilobata from Geraniaceae. These genome sequences, combined with previously published species, provide sufficient taxon sampling to reconstruct the ancestral plastid genome organization of Geraniaceae and the rearrangements unique to each genus. The ancestral plastid genome of Geraniaceae has a 4 kb inversion and a reduced, Pelargonium-like small single copy region. Our ancestral genome reconstruction suggests that a few minor rearrangements occurred in the stem branch of Geraniaceae followed by independent rearrangements in each genus. The genomic comparison demonstrates that a series of inverted repeat boundary shifts and inversions played a major role in shaping genome organization in the family. The distribution of repeats is strongly associated with breakpoints in the rearranged genomes, and the proportion and the number of large repeats (>20 bp and >60 bp) are significantly correlated with the degree of genome rearrangements. Increases in the degree of plastid genome rearrangements are correlated with the acceleration in nonsynonymous substitution rates (dN) but not with synonymous substitution rates (dS). Possible mechanisms that might contribute to this correlation, including DNA repair system and selection, are discussed.
Williams, W Robert
2011-01-01
Purine nucleotides play a central role in signal transduction events initiated at the cell membrane. The NO-cGMP-cGK pathway, in particular, mediates events involving NOS and some classes of K(+) ion channel. The aim of this study is to investigate relative molecular similarity within the ligands binding to NOS, K(ATP), BK(Ca) channels and regulatory nucleotides. Minimum energy conformers of the ligand structures were superimposed and fitted to L-arginine and the nucleotides of adenine and guanine using a computational program. Distinctive patterns were evident in the fitting of NOS isoform antagonists to L-arginine. K(ATP) channel openers and antagonists superimposed on the glycosidic linkage and imidazole ring of the purine nucleotides, and guanidinium and ribose groups of GTP in the case of glibenclamide. The fits of BK(Ca) channel openers and antagonists to cGMP were characterized by the linear dimensions of their structures; distances between terminal oxy groups in respect of dexamethasone and aldosterone. The findings provide structural evidence for the functional interaction between K(+) channel openers/antagonists and the regulatory nucleotides. Use of the purine nucleotide template systematizes the considerable heterogeneity evident within the structures of ligands operating on K(+) ion channels. © 2010 The Author. JPP © 2010 Royal Pharmaceutical Society.
Osborne, Colin S.; Leitner, Ingrid; Favre, Bertrand; Ryder, Neil S.
2005-01-01
There has only been one clinically confirmed case of terbinafine resistance in dermatophytes, where six sequential Trichophyton rubrum isolates from the same patient were found to be resistant to terbinafine and cross-resistant to other squalene epoxidase (SE) inhibitors. Microsomal SE activity from these resistant isolates was insensitive to terbinafine, suggesting a target-based mechanism of resistance (B. Favre, M. Ghannoum, and N. S. Ryder, Med. Mycol. 42:525-529, 2004). In this study, we have characterized at the molecular level the cause of the resistant phenotype of these clinical isolates. Cloning and sequencing of the SE gene and cDNA from T. rubrum revealed the presence of an intron in the gene and an open reading frame encoding a protein of 489 residues, with an equivalent similarity (57%) to both yeast and mammalian SEs. The nucleotide sequences of SE from two terbinafine-susceptible strains were identical whereas those of terbinafine-resistant strains, serially isolated from the same patient, each contained the same single missense introducing the amino acid substitution L393F. Introduction of the corresponding substitution in the Candida albicans SE gene (L398F) and expression of this gene in Saccharomyces cerevisiae conferred a resistant phenotype to the transformants when compared to those expressing the wild-type sequence. Terbinafine resistance in these T. rubrum clinical isolates appears to be due to a single amino acid substitution in SE. PMID:15980358
Curtiss, W C; Vournakis, J N
1984-01-01
Eukaryotic 5S rRNA sequences from 34 diverse species were compared by the following method: (1) The sequences were aligned; (2) the positions of substitutions were located by comparison of all possible pairs of sequences; (3) the substitution sites were mapped to an assumed general base pairing model; and (4) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. An analysis of the sequence and structure variability in each region of the molecule is presented. It was found that the degree of base substitution varies over a wide range, from absolute conservation to occurrence of over 90% of the possible observable substitutions. The substitutions are located primarily in stem regions of the 5S rRNA secondary structure. More than 88% of the substitutions in helical regions maintain base pairing. The disruptive substitutions are primarily located at the edges of helical regions, resulting in shortening of the helical regions and lengthening of the adjacent nonpaired regions. Base stacking patterns determined by the R-Y model are mapped onto the general secondary structure. Intrastrand and interstrand stacking could stabilize alternative coaxial structures and limit the conformational flexibility of nonpaired regions. Two short contiguous regions are 100% conserved in all species. This may reflect evolutionary constraints imposed at the DNA level by the requirement for binding of a 5S gene transcription initiation factor during gene expression.
Regulation of Ion Channels by Pyridine Nucleotides
Kilfoil, Peter J.; Tipparaju, Srinivas M.; Barski, Oleg A.; Bhatnagar, Aruni
2014-01-01
Recent research suggests that in addition to their role as soluble electron carriers, pyridine nucleotides [NAD(P)(H)] also regulate ion transport mechanisms. This mode of regulation seems to have been conserved through evolution. Several bacterial ion–transporting proteins or their auxiliary subunits possess nucleotide-binding domains. In eukaryotes, the Kv1 and Kv4 channels interact with pyridine nucleotide–binding β-subunits that belong to the aldo-keto reductase superfamily. Binding of NADP+ to Kvβ removes N-type inactivation of Kv currents, whereas NADPH stabilizes channel inactivation. Pyridine nucleotides also regulate Slo channels by interacting with their cytosolic regulator of potassium conductance domains that show high sequence homology to the bacterial TrkA family of K+ transporters. These nucleotides also have been shown to modify the activity of the plasma membrane KATP channels, the cystic fibrosis transmembrane conductance regulator, the transient receptor potential M2 channel, and the intracellular ryanodine receptor calcium release channels. In addition, pyridine nucleotides also modulate the voltage-gated sodium channel by supporting the activity of its ancillary subunit—the glycerol-3-phosphate dehydrogenase-like protein. Moreover, the NADP+ metabolite, NAADP+, regulates intracellular calcium homeostasis via the 2-pore channel, ryanodine receptor, or transient receptor potential M2 channels. Regulation of ion channels by pyridine nucleotides may be required for integrating cell ion transport to energetics and for sensing oxygen levels or metabolite availability. This mechanism also may be an important component of hypoxic pulmonary vasoconstriction, memory, and circadian rhythms, and disruption of this regulatory axis may be linked to dysregulation of calcium homeostasis and cardiac arrhythmias. PMID:23410881
Sheng, Zizhang; Schramm, Chaim A; Kong, Rui; Mullikin, James C; Mascola, John R; Kwong, Peter D; Shapiro, Lawrence
2017-01-01
Somatic hypermutation (SHM) plays a critical role in the maturation of antibodies, optimizing recognition initiated by recombination of V(D)J genes. Previous studies have shown that the propensity to mutate is modulated by the context of surrounding nucleotides and that SHM machinery generates biased substitutions. To investigate the intrinsic mutation frequency and substitution bias of SHMs at the amino acid level, we analyzed functional human antibody repertoires and developed mGSSP (method for gene-specific substitution profile), a method to construct amino acid substitution profiles from next-generation sequencing-determined B cell transcripts. We demonstrated that these gene-specific substitution profiles (GSSPs) are unique to each V gene and highly consistent between donors. We also showed that the GSSPs constructed from functional antibody repertoires are highly similar to those constructed from antibody sequences amplified from non-productively rearranged passenger alleles, which do not undergo functional selection. This suggests the types and frequencies, or mutational space, of a majority of amino acid changes sampled by the SHM machinery to be well captured by GSSPs. We further observed the rates of mutational exchange between some amino acids to be both asymmetric and context dependent and to correlate weakly with their biochemical properties. GSSPs provide an improved, position-dependent alternative to standard substitution matrices, and can be utilized to developing software for accurately modeling the SHM process. GSSPs can also be used for predicting the amino acid mutational space available for antigen-driven selection and for understanding factors modulating the maturation pathways of antibody lineages in a gene-specific context. The mGSSP method can be used to build, compare, and plot GSSPs; we report the GSSPs constructed for 69 common human V genes (DOI: 10.6084/m9.figshare.3511083) and provide high-resolution logo plots for each (DOI: 10
Zhang, Jin; Ruhlman, Tracey A.; Sabir, Jamal S. M.; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K.
2016-01-01
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear–plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. PMID:26893456
Amino acid substitutions in random mutagenesis libraries: lessons from analyzing 3000 mutations.
Zhao, Jing; Frauenkron-Machedjou, Victorine Josiane; Kardashliev, Tsvetan; Ruff, Anna Joëlle; Zhu, Leilei; Bocola, Marco; Schwaneberg, Ulrich
2017-04-01
The quality of amino acid substitution patterns in random mutagenesis libraries is decisive for the success in directed evolution campaigns. In this manuscript, we provide a detailed analysis of the amino acid substitutions by analyzing 3000 mutations of three random mutagenesis libraries (1000 mutations each; epPCR with a low-mutation and a high-mutation frequency and SeSaM-Tv P/P) employing lipase A from Bacillus subtilis (bsla). A comparison of the obtained numbers of beneficial variants in the mentioned three random mutagenesis libraries with a site saturation mutagenesis (SSM) (covering the natural diversity at each amino acid position of BSLA) concludes the diversity analysis. Seventy-six percent of the SeSaM-Tv P/P-generated substitutions yield chemically different amino acid substitutions compared to 64% (epPCR-low) and 69% (epPCR-high). Unique substitutions from one amino acid to others are termed distinct amino acid substitutions. In the SeSaM-Tv P/P library, 35% of all theoretical distinct amino acid substitutions were found in the 1000 mutation library compared to 25% (epPCR-low) and 26% (epPCR-high). Thirty-six percent of distinct amino acid substitutions found in SeSaM-Tv P/P were unobtainable by epPCR-low. Comparison with the SSM library showed that epPCR-low covers 15%, epPCR-high 18%, and SeSaM-Tv P/P 21% of obtainable beneficial amino acid positions. In essence, this study provides first insights on the quality of epPCR and SeSaM-Tv P/P libraries in terms of amino acid substitutions, their chemical differences, and the number of obtainable beneficial amino acid positions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zoghbi, M. E.; Altenberg, G. A.
The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less
Khan, A S
1984-01-01
The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Copper complex of (substituted... Copper complex of (substituted sulfonaphthyl azo substituted phenyl) disulfonaphthyl azo, amine salt... substances identified generically as copper complex of (substituted sulfonaphthyl azo substituted phenyl...
NASA Technical Reports Server (NTRS)
Kawamura, K.; Ferris, J. P.
1999-01-01
The montmorillonite clay catalyzed condensation of activated monocleotides to oligomers of RNA is a possible first step in the formation of the proposed RNA world. The rate constants for the condensation of the phosphorimidazolide of adenosine were measured previously and these studies have been extended to the phosphorimidazolides of inosine and uridine in the present work to determine of substitution of neutral heterocycles for the basic adenine ring changes the reaction rate or regioselectivity. The oligomerization reactions of the 5'-phosphoromidazolides of uridine (ImpU) and inosine (ImpI) on montmorillonite yield oligo(U)s and oligo(I)s as long as heptamers. The rate constants for oligonucleotide formation were determined by measuring the rates of formation of the oligomers by HPLC. Both the apparent rate constants in the reaction mixture and the rate constants on the clay surface were calculated using the partition coefficients of the oligomers between the aqueous and clay phases. The rate constants for trimer formation are much greater than those dimer synthesis but there was little difference in the rate constants for the formation of trimers and higher oligomers. The overall rates of oligomerization of the phosphorimidazolides of purine and pyrimidine nucleosides in the presence of montmorillonite clay are the same suggesting that RNA formed on the primitive Earth could have contained a variety of heterocyclic bases. The rate constants for oligomerization of pyrimidine nucleotides on the clay surface are significantly higher than those of purine nucleotides since the pyrimidine nucleotides bind less strongly to the clay than do the purine nucleotides. The differences in the binding is probably due to Van der Waals interactions between the purine bases and the clay surface. Differences in the basicity of the heterocyclic ring in the nucleotide have little effect on the oligomerization process.
Frank, Steven A.
2010-01-01
We typically observe large-scale outcomes that arise from the interactions of many hidden, small-scale processes. Examples include age of disease onset, rates of amino acid substitutions, and composition of ecological communities. The macroscopic patterns in each problem often vary around a characteristic shape that can be generated by neutral processes. A neutral generative model assumes that each microscopic process follows unbiased or random stochastic fluctuations: random connections of network nodes; amino acid substitutions with no effect on fitness; species that arise or disappear from communities randomly. These neutral generative models often match common patterns of nature. In this paper, I present the theoretical background by which we can understand why these neutral generative models are so successful. I show where the classic patterns come from, such as the Poisson pattern, the normal or Gaussian pattern, and many others. Each classic pattern was often discovered by a simple neutral generative model. The neutral patterns share a special characteristic: they describe the patterns of nature that follow from simple constraints on information. For example, any aggregation of processes that preserves information only about the mean and variance attracts to the Gaussian pattern; any aggregation that preserves information only about the mean attracts to the exponential pattern; any aggregation that preserves information only about the geometric mean attracts to the power law pattern. I present a simple and consistent informational framework of the common patterns of nature based on the method of maximum entropy. This framework shows that each neutral generative model is a special case that helps to discover a particular set of informational constraints; those informational constraints define a much wider domain of non-neutral generative processes that attract to the same neutral pattern. PMID:19538344
Cyclic nucleotide content of tobacco BY-2 cells.
Richards, Helen; Das, Swadipa; Smith, Christopher J; Pereira, Louisa; Geisbrecht, Alan; Devitt, Nicola J; Games, David E; van Geyschem, Jan; Gareth Brenton, A; Newton, Russell P
2002-11-01
The cyclic nucleotide content of cultured tobacco bright yellow-2 (BY-2) cells was determined, after freeze-killing, perchlorate extraction and sequential chromatography, by radioimmunoassay. The identities of the putative cyclic nucleotides, adenosine 3',5'-cyclic monophosphate (cyclic AMP), guanosine 3',5'-cyclic monophosphate (cyclic GMP) and cytidine 3',5'-cyclic monophosphate (cyclic CMP) were unambiguously confirmed by tandem mass spectrometry. The potential of BY-2 cell cultures as a model system for future investigations of cyclic nucleotide function in higher plants is discussed.
Li, Yunlang; Schlick, Tamar
2013-01-01
Incorporating the cognate instead of non-cognate substrates is crucial for DNA polymerase function. Here we analyze molecular dynamics simulations of DNA polymerase μ (pol μ) bound to different non-cognate incoming nucleotides including A:dCTP, A:dGTP, A(syn):dGTP, A:dATP, A(syn):dATP, T:dCTP, and T:dGTP to study the structure-function relationships involved with aberrant base pairs in the conformational pathway; while a pol μ complex with the A:dTTP base pair is available, no solved non-cognate structures are available. We observe distinct differences of the non-cognate systems compared to the cognate system. Specifically, the motions of active-site residue His329 and Asp330 distort the active site, and Trp436, Gln440, Glu443 and Arg444 tend to tighten the nucleotide-binding pocket when non-cognate nucleotides are bound; the latter effect may further lead to an altered electrostatic potential within the active site. That most of these “gate-keeper” residues are located farther apart from the upstream primer in pol μ, compared to other X family members, also suggests an interesting relation to pol μ's ability to incorporate nucleotides when the upstream primer is not paired. By examining the correlated motions within pol μ complexes, we also observe different patterns of correlations between non-cognate systems and the cognate system, especially decreased interactions between the incoming nucleotides and the nucleotide-binding pocket. Altered correlated motions in non-cognate systems agree with our recently proposed hybrid conformational selection/induced-fit models. Taken together, our studies propose the following order for difficulty of non-cognate system insertions by pol μ: T:dGTPnucleotide insertions, with the exception of A:dGTP, which may be more sensitive to the template sequence. The structures and conformational aspects
Marcombe, Sébastien; Paris, Margot; Paupy, Christophe; Bringuier, Charline; Yebakima, André; Chandre, Fabrice; David, Jean-Philippe; Corbel, Vincent; Despres, Laurence
2013-01-01
Effective vector control is currently challenged worldwide by the evolution of resistance to all classes of chemical insecticides in mosquitoes. In Martinique, populations of the dengue vector Aedes aegypti have been intensively treated with temephos and deltamethrin insecticides over the last fifty years, resulting in heterogeneous levels of resistance across the island. Resistance spreading depends on standing genetic variation, selection intensity and gene flow among populations. To determine gene flow intensity, we first investigated neutral patterns of genetic variability in sixteen populations representative of the many environments found in Martinique and experiencing various levels of insecticide pressure, using 6 microsatellites. Allelic richness was lower in populations resistant to deltamethrin, and consanguinity was higher in populations resistant to temephos, consistent with a negative effect of insecticide pressure on neutral genetic diversity. The global genetic differentiation was low, suggesting high gene flow among populations, but significant structure was found, with a pattern of isolation-by-distance at the global scale. Then, we investigated adaptive patterns of divergence in six out of the 16 populations using 319 single nucleotide polymorphisms (SNPs). Five SNP outliers displaying levels of genetic differentiation out of neutral expectations were detected, including the kdr-V1016I mutation in the voltage-gated sodium channel gene. Association tests revealed a total of seven SNPs associated with deltamethrin resistance. Six other SNPs were associated with temephos resistance, including two non-synonymous substitutions in an alkaline phosphatase and in a sulfotransferase respectively. Altogether, both neutral and adaptive patterns of genetic variation in mosquito populations appear to be largely driven by insecticide pressure in Martinique.
Nucleotide binding properties of bovine brain uncoating ATPase.
Gao, B; Emoto, Y; Greene, L; Eisenberg, E
1993-04-25
Many functions of the 70-kDa heat-shock proteins (hsp70s) appear to be regulated by bound nucleotide. In this study we examined the nucleotide binding properties of purified bovine brain uncoating ATPase, one of the constitutively expressed members of the hsp70 family. We found that uncoating ATPase purified by ATP-agarose column chromatography retained one ADP molecule bound per enzyme molecule which could not be removed by extensive dialysis. Since this bound ADP exchanged rapidly with free ADP or ATP, the inability to remove the bound nucleotide was not due to slow dissociation but rather to strong binding of the nucleotide to the uncoating ATPase. In confirmation of this view, equilibrium dialysis experiments suggested that the dissociation constants for both ADP and ATP were less than 0.1 microM. Schmid et al. (Schmid, S. L., Braell, W. A., and Rothman, J. E. (1985) J. Biol. Chem 260, 10057-10062) suggested that the uncoating ATPase had two sites for bound nucleotide, one specific for ATP and one binding both ATP and ATP analogues but not ADP. In contrast, we found that enzyme with bound ADP did not bind further adenosine 5'-(beta,gamma-imino)triphosphate or dATP, nor did more than one ATP molecule bind per enzyme even in 200 microM free ATP. These results strongly suggest that the enzyme has only one binding site for nucleotide. During steady-state ATP hydrolysis, 85% of the bound nucleotide at this site was determined to be ATP and 15% ADP; this is consistent with the rate of ADP release determined in the exchange experiments noted above, where ADP release was found to be six times faster than the overall rate of ATP hydrolysis.
Wiesendanger, M; Kneitz, B; Edelmann, W; Scharff, M D
2000-02-07
Although the primary function of the DNA mismatch repair (MMR) system is to identify and correct base mismatches that have been erroneously introduced during DNA replication, recent studies have further implicated several MMR components in somatic hypermutation of immunoglobulin (Ig) genes. We studied the immune response in mice deficient in MutS homologue (MSH)3 and MSH6, two mutually exclusive partners of MSH2 that have not been examined previously for their role in Ig hypermutation. In Msh6(-)/- and Msh3(-)/-/Msh6(-)/- mice, base substitutions are preferentially targeted to G and C nucleotides and to an RGYW hot spot, as has been shown previously in Msh2(-)/- mice. In contrast, Msh3(-)/- mice show no differences from their littermate controls. These findings indicate that the MSH2-MSH6 heterodimer, but not the MSH2-MSH3 complex, is responsible for modulating Ig hypermutation.
Zimic, Mirko; Sheen, Patricia; Quiliano, Miguel; Gutierrez, Andrés; Gilman, Robert H.
2010-01-01
Resistance to pyrazinamide in Mycobacterium tuberculosis is usually associated with a reduction of pyrazinamidase activity caused by mutations in pncA, the pyrazinamidase coding gene. Pyrazinamidase is a hydrolase that converts pyrazinamide, the antituberculous drug against the latent stage, to the active compound, pyrazinoic acid. To better understand the relationship between pncA mutations and pyrazinamide-resistance, it is necessary to analyze the distribution of pncA mutations from pyrazinamide resistant strains. We determined the distribution of Peruvian and globally reported pncA missense mutations from M. tuberculosis clinical isolates resistant to pyrazinamide. The distributions of the single amino acid substitutions were compared at the secondary-structure-domains level. The distribution of the Peruvian mutations followed a similar pattern as the mutations reported globally. A consensus clustering of mutations was observed in hot-spot regions located in the metal coordination site and to a lesser extent in the active site of the enzyme. The data was not able to reject the null hypothesis that both distributions are similar, suggesting that pncA mutations associated to pyrazinamide resistance in M. tuberculosis, follow a conserved pattern responsible to impair the pyrazinamidase activity. PMID:19963078
Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi
2010-11-19
Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg(2+) and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction.
The EMBL nucleotide sequence database
Stoesser, Guenter; Baker, Wendy; van den Broek, Alexandra; Camon, Evelyn; Garcia-Pastor, Maria; Kanz, Carola; Kulikova, Tamara; Lombard, Vincent; Lopez, Rodrigo; Parkinson, Helen; Redaschi, Nicole; Sterk, Peter; Stoehr, Peter; Tuli, Mary Ann
2001-01-01
The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/) is maintained at the European Bioinformatics Institute (EBI) in an international collaboration with the DNA Data Bank of Japan (DDBJ) and GenBank at the NCBI (USA). Data is exchanged amongst the collaborating databases on a daily basis. The major contributors to the EMBL database are individual authors and genome project groups. Webin is the preferred web-based submission system for individual submitters, whilst automatic procedures allow incorporation of sequence data from large-scale genome sequencing centres and from the European Patent Office (EPO). Database releases are produced quarterly. Network services allow free access to the most up-to-date data collection via ftp, email and World Wide Web interfaces. EBI’s Sequence Retrieval System (SRS), a network browser for databanks in molecular biology, integrates and links the main nucleotide and protein databases plus many specialized databases. For sequence similarity searching a variety of tools (e.g. Blitz, Fasta, BLAST) are available which allow external users to compare their own sequences against the latest data in the EMBL Nucleotide Sequence Database and SWISS-PROT. PMID:11125039
Kumar, Rajnish; Mishra, Bharat Kumar; Lahiri, Tapobrata; Kumar, Gautam; Kumar, Nilesh; Gupta, Rahul; Pal, Manoj Kumar
2017-06-01
Online retrieval of the homologous nucleotide sequences through existing alignment techniques is a common practice against the given database of sequences. The salient point of these techniques is their dependence on local alignment techniques and scoring matrices the reliability of which is limited by computational complexity and accuracy. Toward this direction, this work offers a novel way for numerical representation of genes which can further help in dividing the data space into smaller partitions helping formation of a search tree. In this context, this paper introduces a 36-dimensional Periodicity Count Value (PCV) which is representative of a particular nucleotide sequence and created through adaptation from the concept of stochastic model of Kolekar et al. (American Institute of Physics 1298:307-312, 2010. doi: 10.1063/1.3516320 ). The PCV construct uses information on physicochemical properties of nucleotides and their positional distribution pattern within a gene. It is observed that PCV representation of gene reduces computational cost in the calculation of distances between a pair of genes while being consistent with the existing methods. The validity of PCV-based method was further tested through their use in molecular phylogeny constructs in comparison with that using existing sequence alignment methods.
Bacterial nucleotide-based second messengers.
Pesavento, Christina; Hengge, Regine
2009-04-01
In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.
2012-01-01
Background Water stress limits plant survival and production in many parts of the world. Identification of genes and alleles responding to water stress conditions is important in breeding plants better adapted to drought. Currently there are no studies examining the transcriptome wide gene and allelic expression patterns under water stress conditions. We used RNA sequencing (RNA-seq) to identify the candidate genes and alleles and to explore the evolutionary signatures of selection. Results We studied the effect of water stress on gene expression in Eucalyptus camaldulensis seedlings derived from three natural populations. We used reference-guided transcriptome mapping to study gene expression. Several genes showed differential expression between control and stress conditions. Gene ontology (GO) enrichment tests revealed up-regulation of 140 stress-related gene categories and down-regulation of 35 metabolic and cell wall organisation gene categories. More than 190,000 single nucleotide polymorphisms (SNPs) were detected and 2737 of these showed differential allelic expression. Allelic expression of 52% of these variants was correlated with differential gene expression. Signatures of selection patterns were studied by estimating the proportion of nonsynonymous to synonymous substitution rates (Ka/Ks). The average Ka/Ks ratio among the 13,719 genes was 0.39 indicating that most of the genes are under purifying selection. Among the positively selected genes (Ka/Ks > 1.5) apoptosis and cell death categories were enriched. Of the 287 positively selected genes, ninety genes showed differential expression and 27 SNPs from 17 positively selected genes showed differential allelic expression between treatments. Conclusions Correlation of allelic expression of several SNPs with total gene expression indicates that these variants may be the cis-acting variants or in linkage disequilibrium with such variants. Enrichment of apoptosis and cell death gene categories among the
Huang, Xiaoyu; Li, Desheng; Wang, Jiwen; Huang, Yan; Han, Chunchun; Zhang, Guiquan; Huang, Zhi; Wu, Honglin; Wei, Ming; Wang, Guosong; Hu, Haiping; Deng, Tao; He, Tao; Zhou, Yingming; Song, Shixian; Luo, Bo; Zhang, Heming
2013-11-01
The different SSCP patterns of the follicle stimulating hormone beta (FSHβ) gene amplified by three pairs of primers were sequenced. Comparisons among the three nucleotide sequences of three genotypes indicated that three base substitutions (A213T, A91G, and A89C) were detected in FSHβ gene, which A213T substitution led to one amino acids mutation (Lys > Met), and the other two substitutions were synonymous mutations. The AA, AB and BB genotypes patterns obtained by FSHβ primer1 had evident relation with the litter traits, but the SSCP genotypes patterns obtained by FSHβ primer2 and primer3 had no evident relation with the litter traits in giant panda. The giant panda with AA and AB genotype had the largest litter size and multiparity rate compared with the BB genotypes (P < 0.05). We speculated that the giant pandas with the A allele have better litter traits than those with the B allele.
NASA Technical Reports Server (NTRS)
Kanavarioti, A.; Rosenbach, M. T.
1991-01-01
Phosphoimidazolide-activated derivatives of guanosine and cytidine 5'-monophosphates, henceforth called ImpN's, exhibit enhanced rates of degradation in the presence of aqueous inorganic phosphate in the range 4.0 < or = pH < or = 8.6. This degradation is been attributed to (i) nucleophilic substitution of the imidazolide and (ii) catalysis of the P-N bond hydrolysis by phosphate. The first reaction results in the formation of nucleoside 5'-diphosphate and the second in nucleoside 5'-monophosphate. Analysis of the observed rates as well as the product ratios as a function of pH and phosphate concentration allow distinction between various mechanistic possibilities. The results show that both H2PO4- and HPO4(2-) participate in both hydrolysis and nucleophilic substitution. Statistically corrected biomolecular rate constants indicate that the dianion is 4 times more effective as a general base than the monoanion, and 8 times more effective as nucleophile. The low Bronsted value beta = 0.15 calculated for these phosphate species, presumed to act as general bases in facilitating water attack, is consistent with the fact that catalysis of the hydrolysis of the P-N bond in ImpN's has not been detected before. The beta nuc = 0.35 calculated for water, H2PO4-, HPO4(2-), and hydroxide acting as nucleophiles indicates a more associative transition state for nucleotidyl (O2POR- with R = nucleoside) transfers than that observed for phosphoryl (PO3(2-)) transfers (beta nuc = 0.25). With respect to the stability/reactivity of ImpN's under prebiotic conditions, our study shows that these materials would not suffer additional degradation due to inorganic phosphate, assuming the concentrations of phosphate, Pi, on prebiotic Earth were similar to those in the present oceans ([Pi] approximately 2.25 micromoles).
Pattern of mathematic representation ability in magnetic electricity problem
NASA Astrophysics Data System (ADS)
Hau, R. R. H.; Marwoto, P.; Putra, N. M. D.
2018-03-01
The mathematic representation ability in solving magnetic electricity problem gives information about the way students understand magnetic electricity. Students have varied mathematic representation pattern ability in solving magnetic electricity problem. This study aims to determine the pattern of students' mathematic representation ability in solving magnet electrical problems.The research method used is qualitative. The subject of this study is the fourth semester students of UNNES Physics Education Study Program. The data collection is done by giving a description test that refers to the test of mathematical representation ability and interview about field line topic and Gauss law. The result of data analysis of student's mathematical representation ability in solving magnet electric problem is categorized into high, medium and low category. The ability of mathematical representations in the high category tends to use a pattern of making known and asked symbols, writing equations, using quantities of physics, substituting quantities into equations, performing calculations and final answers. The ability of mathematical representation in the medium category tends to use several patterns of writing the known symbols, writing equations, using quantities of physics, substituting quantities into equations, performing calculations and final answers. The ability of mathematical representations in the low category tends to use several patterns of making known symbols, writing equations, substituting quantities into equations, performing calculations and final answer.
Ritchey, Eric R.; Bongini, Rachel E.; Code, Kimberly A.; Zelinka, Christopher; Petersen-Jones, Simon; Fischer, Andy J.
2010-01-01
Guanine nucleotide-binding protein β3 (GNB3) is an isoform of the β subunit of the heterotrimeric G protein second messenger complex that is commonly associated with transmembrane receptors. The presence of GNB3 in photoreceptors, and possibly bipolar cells, has been confirmed in murine, bovine and primate retinas (Lee et al., 1992, Peng et al., 1992, Huang et al., 2003). Studies have indicated that a mutation in the GNB3 gene causes progressive retinopathy and globe enlargement (RGE) in chickens. The goals of this study were to 1) examine the expression pattern of GNB3 in wild-type and RGE mutant chickens, 2) characterize the types of bipolar cells that express GNB3 and 3) examine whether the expression of GNB3 in the retina is conserved across vertebrate species. We find that chickens homozygous for the RGE allele completely lack GNB3 protein. We find that the pattern of expression of GNB3 in the retina is highly conserved across vertebrate species, including teleost fish (Carassius auratus), frogs (Xenopus laevis), chickens (Gallus domesticus), mice (Mus musculata), guinea pigs (Cavia porcellus), dogs (Canis familiaris) and non-human primates (Macaca fasicularis). Regardless of the species, we find that GNB3 is expressed by Islet1-positive cone ON-bipolar cells and by cone photoreceptors. In some vertebrates, GNB3-immunoreactivity was observed in both rod and cone photoreceptors. A protein-protein alignment of GNB3 across different vertebrates, from fish to humans, indicates a high degree (>92%) of sequence conservation. Given that analogous types of retinal neurons express GNB3 in different species, we propose that the functions and the mechanisms that regulate the expression of GNB3 are highly conserved. PMID:20538044
Panwar, Bharat; Raghava, Gajendra P S
2015-04-01
The RNA-protein interactions play a diverse role in the cells, thus identification of RNA-protein interface is essential for the biologist to understand their function. In the past, several methods have been developed for predicting RNA interacting residues in proteins, but limited efforts have been made for the identification of protein-interacting nucleotides in RNAs. In order to discriminate protein-interacting and non-interacting nucleotides, we used various classifiers (NaiveBayes, NaiveBayesMultinomial, BayesNet, ComplementNaiveBayes, MultilayerPerceptron, J48, SMO, RandomForest, SMO and SVM(light)) for prediction model development using various features and achieved highest 83.92% sensitivity, 84.82 specificity, 84.62% accuracy and 0.62 Matthew's correlation coefficient by SVM(light) based models. We observed that certain tri-nucleotides like ACA, ACC, AGA, CAC, CCA, GAG, UGA, and UUU preferred in protein-interaction. All the models have been developed using a non-redundant dataset and are evaluated using five-fold cross validation technique. A web-server called RNApin has been developed for the scientific community (http://crdd.osdd.net/raghava/rnapin/). Copyright © 2015 Elsevier Inc. All rights reserved.
Wang, Jing; Street, Nathaniel R.; Scofield, Douglas G.; Ingvarsson, Pär K.
2016-01-01
A central aim of evolutionary genomics is to identify the relative roles that various evolutionary forces have played in generating and shaping genetic variation within and among species. Here we use whole-genome resequencing data to characterize and compare genome-wide patterns of nucleotide polymorphism, site frequency spectrum, and population-scaled recombination rates in three species of Populus: Populus tremula, P. tremuloides, and P. trichocarpa. We find that P. tremuloides has the highest level of genome-wide variation, skewed allele frequencies, and population-scaled recombination rates, whereas P. trichocarpa harbors the lowest. Our findings highlight multiple lines of evidence suggesting that natural selection, due to both purifying and positive selection, has widely shaped patterns of nucleotide polymorphism at linked neutral sites in all three species. Differences in effective population sizes and rates of recombination largely explain the disparate magnitudes and signatures of linked selection that we observe among species. The present work provides the first phylogenetic comparative study on a genome-wide scale in forest trees. This information will also improve our ability to understand how various evolutionary forces have interacted to influence genome evolution among related species. PMID:26721855
Wang, Jing; Street, Nathaniel R; Scofield, Douglas G; Ingvarsson, Pär K
2016-03-01
A central aim of evolutionary genomics is to identify the relative roles that various evolutionary forces have played in generating and shaping genetic variation within and among species. Here we use whole-genome resequencing data to characterize and compare genome-wide patterns of nucleotide polymorphism, site frequency spectrum, and population-scaled recombination rates in three species of Populus: Populus tremula, P. tremuloides, and P. trichocarpa. We find that P. tremuloides has the highest level of genome-wide variation, skewed allele frequencies, and population-scaled recombination rates, whereas P. trichocarpa harbors the lowest. Our findings highlight multiple lines of evidence suggesting that natural selection, due to both purifying and positive selection, has widely shaped patterns of nucleotide polymorphism at linked neutral sites in all three species. Differences in effective population sizes and rates of recombination largely explain the disparate magnitudes and signatures of linked selection that we observe among species. The present work provides the first phylogenetic comparative study on a genome-wide scale in forest trees. This information will also improve our ability to understand how various evolutionary forces have interacted to influence genome evolution among related species. Copyright © 2016 by the Genetics Society of America.
Nguyen Van, Tai; Hospital, Audrey; Lionne, Corinne; Jordheim, Lars P; Dumontet, Charles; Périgaud, Christian; Chaloin, Laurent
2016-01-01
Summary A series of seventeen β-hydroxyphosphonate ribonucleoside analogues containing 4-substituted-1,2,3-triazoles was synthesized and fully characterized. Such compounds were designed as potential inhibitors of the cytosolic 5’-nucleotidase II (cN-II), an enzyme involved in the regulation of purine nucleotide pools. NMR and molecular modelling studies showed that a few derivatives adopted similar structural features to IMP or GMP. Five derivatives were identified as modest inhibitors with 53 to 64% of cN-II inhibition at 1 mM. PMID:27559400
Huang, C.; Chien, M.S.; Landolt, M.L.; Batts, W.; Winton, J.
1996-01-01
Twelve neutralizing monoclonal antibodies (MAbs) against the fish rhabdovirus, infectious haematopoietic necrosis virus (IHNV), were used to select 20 MAb escape mutants. The nucleotide sequence of the entire glycoprotein (G) gene was determined for six mutants representing differing cross-neutralization patterns and each had a single nucleotide change leading to a single amino acid substitution within one of three regions of the protein. These data were used to design nested PCR primers to amplify portions of the G gene of the 14 remaining mutants. When the PCR products from these mutants were sequenced, they also had single nucleotide substitutions coding for amino acid substitutions at the same, or nearby, locations. Of the 20 mutants for which all or part of the glycoprotein gene was sequenced, two MAbs selected mutants with substitutions at amino acids 230-231 (antigenic site I) and the remaining MAbs selected mutants with substitutions at amino acids 272-276 (antigenic site II). Two MAbs that selected mutants mapping to amino acids 272-276, selected other mutants that mapped to amino acids 78-81, raising the possibility that this portion of the N terminus of the protein was part of a discontinuous epitope defining antigenic site II. CLUSTAL alignment of the glycoproteins of rabies virus, vesicular stomatitis virus and IHNV revealed similarities in the location of the neutralizing epitopes and a high degree of conservation among cysteine residues, indicating that the glycoproteins of three different genera of animal rhabdoviruses may share a similar three-dimensional structure in spite of extensive sequence divergence.
Substitution and addition reactions of •OH with p-substituted-phenols
NASA Astrophysics Data System (ADS)
Albarrán, Guadalupe; Galicia-Jiménez, Eduardo; Mendoza, Edith; Schuler, Robert H.
2017-04-01
The directing effect of a hydroxyl group on the substitution and addition reactions of •OH to the substituted and free positions in aromatic rings of p-substituted-phenols were studied in aqueous solutions containing either K3Fe(CN)6 as an oxidant of the substituted hydroxycyclohexadienyl radical initially formed or using ascorbic acid. The results showed that the attack of the •OH to the substituted position (ipso position) was followed by elimination of the substituent producing hydroquinone. The addition reaction of the •OH to the free position on the ring produced 4-substituent-catechol and 4-substituent-resorcinol derivatives. Identification and quantification of the radiolytic products were carried out using high performance liquid chromatography. The results of the yields are given for the p-halogen-phenols (p-X-Ph) p-F-Ph, p-Cl-Ph, p-Br-Ph and p-I-Ph. Other compounds, p-nitro-Ph, p-OH-benzoic acid, p-OH-benzonitrile, p-OH-benzaldehyde, p-OH-anisole and p-OH-benzyl alcohol (represented as p-Z-Ph), were only studied using K3Fe(CN)6 as the oxidant. The results show that the p-X-Ph are attacked by the •OH at the ipso position to the halogen in the proportion 1:0.53:0.46:0.11 for F>Cl>Br>I. The •OH attacked at the ipso position to the p-Z-Phs through a substitution reaction, which depended on the substituent group. Thus, the strongly deactivating groups produced less hydroquinone, indicating less substitution reaction than the strongly activating groups.
USDA-ARS?s Scientific Manuscript database
Resistance to synthetic pyrethroids (SP) in the cattle tick Rhipicephalus (Boophilus) microplus is widespread throughout its distribution area. Three single nucleotide substitutions identified in the Domains II and III of the sodium channel gene of R. (B.) microplus are known to be associated with t...
Simultaneous determination of nucleotide sugars with ion-pair reversed-phase HPLC.
Nakajima, Kazuki; Kitazume, Shinobu; Angata, Takashi; Fujinawa, Reiko; Ohtsubo, Kazuaki; Miyoshi, Eiji; Taniguchi, Naoyuki
2010-07-01
Nucleotide sugars are important in determining cell surface glycoprotein glycosylation, which can modulate cellular properties such as growth and arrest. We have developed a conventional HPLC method for simultaneous determination of nucleotide sugars. A mixture of nucleotide sugars (CMP-NeuAc, UDP-Gal, UDP-Glc, UDP-GalNAc, UDP-GlcNAc, GDP-Man, GDP-Fuc and UDP-GlcUA) and relevant nucleotides were perfectly separated in an optimized ion-pair reversed-phase mode using Inertsil ODS-4 and ODS-3 columns. The newly developed method enabled us to determine the nucleotide sugars in cellular extracts from 1 x 10(6) cells in a single run. We applied this method to characterize nucleotide sugar levels in breast and pancreatic cancer cell lines and revealed that the abundance of UDP-GlcNAc, UDP-GalNAc, UDP-GlcUA and GDP-Fuc were a cell-type-specific feature. To determine the physiological significance of changes in nucleotide sugar levels, we analyzed their changes by glucose deprivation and found that the determination of nucleotide sugar levels provided us with valuable information with respect to studying the overview of cellular glycosylation status.
Zahurancik, Walter J.; Klein, Seth J.; Suo, Zucai
2014-01-01
Most eukaryotic DNA replication is performed by A- and B-family DNA polymerases which possess a faithful polymerase activity that preferentially incorporates correct over incorrect nucleotides. Additionally, many replicative polymerases have an efficient 3′→5′ exonuclease activity that excises misincorporated nucleotides. Together, these activities contribute to overall low polymerase error frequency (one error per 106–108 incorporations) and support faithful eukaryotic genome replication. Eukaryotic DNA polymerase ϵ (Polϵ) is one of three main replicative DNA polymerases for nuclear genomic replication and is responsible for leading strand synthesis. Here, we employed pre-steady-state kinetic methods and determined the overall fidelity of human Polϵ (hPolϵ) by measuring the individual contributions of its polymerase and 3′→5′ exonuclease activities. The polymerase activity of hPolϵ has a high base substitution fidelity (10−4–10−7) resulting from large decreases in both nucleotide incorporation rate constants and ground-state binding affinities for incorrect relative to correct nucleotides. The 3′→5′ exonuclease activity of hPolϵ further enhances polymerization fidelity by an unprecedented 3.5 × 102 to 1.2 × 104-fold. The resulting overall fidelity of hPolϵ (10−6–10−11) justifies hPolϵ to be a primary enzyme to replicate human nuclear genome (0.1–1.0 error per round). Consistently, somatic mutations in hPolϵ, which decrease its exonuclease activity, are connected with mutator phenotypes and cancer formation. PMID:25414327
Covezzi, A; Orbelli Biroli, A; Tessore, F; Forni, A; Marinotto, D; Biagini, P; Di Carlo, G; Pizzotti, M
2016-10-18
Two novel green β-substituted Zn II -porphyrins, G1 and G2, based on a 4D-π-1A type substitution pattern have been synthesized. Their enhanced push-pull character, by reduction of H-L energy gaps, promotes broadening and red-shifting of absorption bands. The effective synthetic pathway and the remarkable spectroscopic properties make G2 ideal for BIPV application.
Matthes, G; Strunk, S; Siems, W; Grune, T
1993-06-01
Posttransfusional changes of preserved red blood cells can influence the oxygen equilibrium curve which is mainly affected by the concentration of erythrocyte 2,3-diphosphoglycerate (DPG). The regeneration kinetics of DPG and nucleotides (ATP, ADP, AMP, GTP, GDP) was determined over a period of 0-48 h in surgically treated patients following transfusion of DPG-depleted packed red cells stored for 14 days in CPD-SAGM. 3 h after transfusion the DPG levels raised up to 40% of the patients' prior DPG concentrations. Complete regeneration of the DPG concentrations occurred 36-48 h after transfusion. Changes in the nucleotide pattern indicate, after a temporary decrease of ATP and GTP levels (after 10-30 min) and an activation phase (after 3-12 h), the full regeneration of these parameters 24-48 h after transfusion. The regeneration kinetics of DPG should be taken into consideration for transfusions with blood units stored for more than 14 days, especially in patients with reduced compensatory mechanisms (coronary and cerebral scleroses, pacemaker, etc.) and large transfusion volumes.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Butyl acrylate, polymer with... acrylate, polymer with substituted methyl styrene, methyl methacrylate, and substituted silane. (a... butyl acrylate, polymer with substituted methyl styrene, methyl methacrylate, and substituted silane...
Code of Federal Regulations, 2014 CFR
2014-07-01
... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Butyl acrylate, polymer with... acrylate, polymer with substituted methyl styrene, methyl methacrylate, and substituted silane. (a... butyl acrylate, polymer with substituted methyl styrene, methyl methacrylate, and substituted silane...
Code of Federal Regulations, 2013 CFR
2013-07-01
... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Butyl acrylate, polymer with... acrylate, polymer with substituted methyl styrene, methyl methacrylate, and substituted silane. (a... butyl acrylate, polymer with substituted methyl styrene, methyl methacrylate, and substituted silane...
Code of Federal Regulations, 2012 CFR
2012-07-01
... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Butyl acrylate, polymer with... acrylate, polymer with substituted methyl styrene, methyl methacrylate, and substituted silane. (a... butyl acrylate, polymer with substituted methyl styrene, methyl methacrylate, and substituted silane...
Cyclic nucleotide binding proteins in the Arabidopsis thaliana and Oryza sativa genomes
Bridges, Dave; Fraser, Marie E; Moorhead, Greg BG
2005-01-01
Background Cyclic nucleotides are ubiquitous intracellular messengers. Until recently, the roles of cyclic nucleotides in plant cells have proven difficult to uncover. With an understanding of the protein domains which can bind cyclic nucleotides (CNB and GAF domains) we scanned the completed genomes of the higher plants Arabidopsis thaliana (mustard weed) and Oryza sativa (rice) for the effectors of these signalling molecules. Results Our analysis found that several ion channels and a class of thioesterases constitute the possible cyclic nucleotide binding proteins in plants. Contrary to some reports, we found no biochemical or bioinformatic evidence for a plant cyclic nucleotide regulated protein kinase, suggesting that cyclic nucleotide functions in plants have evolved differently than in mammals. Conclusion This paper provides a molecular framework for the discussion of cyclic nucleotide function in plants, and resolves a longstanding debate about the presence of a cyclic nucleotide dependent kinase in plants. PMID:15644130
Al-Qahtani, Ahmed Ali; Mubin, Muhammad; Dela Cruz, Damian M; Althawadi, Sahar Isa; Ul Rehman, Muhammad Shah Nawaz; Bohol, Marie Fe F; Al-Ahdal, Mohammed N
2017-01-30
In early 2009, a novel influenza A (H1N1) virus appeared in Mexico and rapidly disseminated worldwide. Little is known about the phylogeny and evolutionary dynamics of the H1N1 strain found in Saudi Arabia. Nucleotide sequencing and bioinformatics analyses were used to study molecular variation between the virus isolates. In this report, 72 hemagglutinin (HA) and 45 neuraminidase (NA) H1N1 virus gene sequences, isolated in 2009 from various regions of Saudi Arabia, were analyzed. Genetic characterization indicated that viruses from two different clades, 6 and 7, were circulating in the region, with clade 7, the most widely circulating H1N1 clade globally in 2009, being predominant. Sequence analysis of the HA and NA genes revealed a high degree of sequence identity with the corresponding genes from viruses circulating in the South East Asia region and with the A/California/7/2009 strain. New mutations in the HA gene of pandemic H1N1 (pH1N1) viruses, that could alter viral fitness, were identified. Relaxed-clock and Bayesian Skyline Plot analyses, based on the isolates used in this study and closely related globally representative strains, indicated marginally higher substitution rates than the type strain (5.14×10-3 and 4.18×10-3 substitutions/nucleotide/year in the HA and NA genes, respectively). The Saudi isolates were antigenically homogeneous and closely related to the prototype vaccine strain A/California/7/2009. The antigenic site of the HA gene had acquired novel mutations in some isolates, making continued monitoring of these viruses vital for the identification of potentially highly virulent and drug resistant variants.
Enzymatic Incorporation of Modified Purine Nucleotides in DNA.
Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet
2017-12-14
A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Kim, Jeong-Hee
2006-04-01
This paper was conducted to examine the effects of transformational leadership behaviors, within the substitutes for leadership model (Kerr & Jermier, 1978). Data was collected from 181 staff nurses in 3 general hospitals, with self-reporting questionnaires (MLQ developed by Bass, rd-SLS developed by Podsakoff, et al., and MSQ developed by Weiss, et al.). Descriptive statistics, factor analysis, Cronbach's alpha and moderated regression analysis were used. 1) The transformational leader behaviors and substitutes for leadership each had correlations with job satisfaction. 2) The total amount of variance accounted for by the substitutes for leadership was substantially greater than by the transformational leadership behaviors. 3) Few of the substitutes variables moderated the relationships between the transformational leader behaviors and job satisfaction in a manner consistent with that specified by Howell, Dorfman, and Kerr (1986). The finding of this study suggest that leaders need to have a better understanding of those contextual variables that influence job satisfaction. Thus future research should focus attention on the moderating effects of substitutes, as well as the things that leaders can do to influence them. In addition, it may be good to examine the effects of substitutes on other criterion variables.
A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms
Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.
2003-01-01
A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708
Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide
NASA Astrophysics Data System (ADS)
Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; Shock, David D.; Kim, Taejin; Schlick, Tamar; Wilson, Samuel H.
2015-01-01
Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2'-deoxyguanosine, which is found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate Escherichia coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerases discriminate between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities, nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine and 8-oxo-dGTP(syn) uses its Hoogsteen edge to base pair with adenine. Here we use time-lapse crystallography to follow 8-oxo-dGTP insertion opposite adenine or cytosine with human pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen-bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxo-dGTP uses charge modulation during insertion that can lead to a blocked DNA repair intermediate.
Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K
2016-02-17
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Nucleophilic Aromatic Substitution.
ERIC Educational Resources Information Center
Avila, Walter B.; And Others
1990-01-01
Described is a microscale organic chemistry experiment which demonstrates one feasible route in preparing ortho-substituted benzoic acids and provides an example of nucleophilic aromatic substitution chemistry. Experimental procedures and instructor notes for this activity are provided. (CW)
Whelan, Nathan V; Halanych, Kenneth M
2017-03-01
As phylogenetic datasets have increased in size, site-heterogeneous substitution models such as CAT-F81 and CAT-GTR have been advocated in favor of other models because they purportedly suppress long-branch attraction (LBA). These models are two of the most commonly used models in phylogenomics, and they have been applied to a variety of taxa, ranging from Drosophila to land plants. However, many arguments in favor of CAT models have been based on tenuous assumptions about the true phylogeny, rather than rigorous testing with known trees via simulation. Moreover, CAT models have not been compared to other approaches for handling substitutional heterogeneity such as data partitioning with site-homogeneous substitution models. We simulated amino acid sequence datasets with substitutional heterogeneity on a variety of tree shapes including those susceptible to LBA. Data were analyzed with both CAT models and partitioning to explore model performance; in total over 670,000 CPU hours were used, of which over 97% was spent running analyses with CAT models. In many cases, all models recovered branching patterns that were identical to the known tree. However, CAT-F81 consistently performed worse than other models in inferring the correct branching patterns, and both CAT models often overestimated substitutional heterogeneity. Additionally, reanalysis of two empirical metazoan datasets supports the notion that CAT-F81 tends to recover less accurate trees than data partitioning and CAT-GTR. Given these results, we conclude that partitioning and CAT-GTR perform similarly in recovering accurate branching patterns. However, computation time can be orders of magnitude less for data partitioning, with commonly used implementations of CAT-GTR often failing to reach completion in a reasonable time frame (i.e., for Bayesian analyses to converge). Practices such as removing constant sites and parsimony uninformative characters, or using CAT-F81 when CAT-GTR is deemed too
40 CFR 721.1555 - Substituted phenyl azo substituted benzenediazonium salt.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Substituted phenyl azo substituted benzenediazonium salt. 721.1555 Section 721.1555 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES OF CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances §...
Methodologies in Creating Skin Substitutes
Nicholas, Mathew N; Jeschke, Marc G; Amini-Nik, Saeid
2016-01-01
The creation of skin substitutes has significantly decreased morbidity and mortality of skin wounds. Although there are still a number of disadvantages of currently available skin substitutes, there has been a significant decline in research advances over the past several years in improving these skin substitutes. Clinically most skin substitutes used are acellular and do not use growth factors to assist wound healing, key areas of potential in this field of research. This article discusses the five necessary attributes of an ideal skin substitute. It comprehensively discusses the three major basic components of currently available skin substitutes: scaffold materials, growth factors, and cells, comparing and contrasting what has been used so far. It then examines a variety of techniques in how to incorporate these basic components together to act as a guide for further research in the field to create cellular skin substitutes with clinically better results. PMID:27154041
Teusch, L; Scherbaum, N; Böhme, H; Bender, S; Eschmann-Mehl, G; Gastpar, M
1995-05-01
Little is known about sexual dysfunctions associated with psychiatric disorders and psychopharmacological treatment. In the present study schizophrenic patients (n = 45, mostly under neuroleptic treatment), neurotic patients (n = 50, mostly treated without medication), methadone-substituted opiate addicts (n = 37), and normal controls (n = 41) were included. They were interviewed with the aid of a sex-differentiated semistructured questionnaire on sexual function. All the methadone-substituted opiate addicts and nearly all the schizophrenic patients suffered from dysfunctions in at least one criterion. The three clinical groups differed significantly from the controls in sexual interest, emotional arousal, physiological arousal (erectile function/vaginal lubrication), performance (ejaculatory function/vaginism, dyspareunia), and orgasm satisfaction. Characteristic patterns of dysfunction were found in the male patients. The schizophrenic patients had significantly more dysfunctions of interest, physiological arousal, performance, and orgasm than the controls. Emotional arousal, erectile and ejaculatory functions, and orgasm satisfaction were impaired more frequently in the male schizophrenics than in the neurotic patients. Reduced sexual interest, emotional arousal, and orgasm satisfaction were reported more frequently by the methadone-substituted opiate addicts than by the neurotic men. Emotional arousal was even more frequently reduced than in the schizophrenic men. There was no correlation between sexual dysfunction and particular neuroleptics or neuroleptic or methadone dosage. The results are compared with the literature and suggestions made for further investigations.
Substitution determination of Fmoc‐substituted resins at different wavelengths
Kley, Markus; Bächle, Dirk; Loidl, Günther; Meier, Thomas; Samson, Daniel
2017-01-01
In solid‐phase peptide synthesis, the nominal batch size is calculated using the starting resin substitution and the mass of the starting resin. The starting resin substitution constitutes the basis for the calculation of a whole set of important process parameters, such as the number of amino acid derivative equivalents. For Fmoc‐substituted resins, substitution determination is often performed by suspending the Fmoc‐protected starting resin in 20% (v/v) piperidine in DMF to generate the dibenzofulvene–piperidine adduct that is quantified by ultraviolet–visible spectroscopy. The spectrometric measurement is performed at the maximum absorption wavelength of the dibenzofulvene–piperidine adduct, that is, at 301.0 nm. The recorded absorption value, the resin weight and the volume are entered into an equation derived from Lambert–Beer's law, together with the substance‐specific molar absorption coefficient at 301.0 nm, in order to calculate the nominal substitution. To our knowledge, molar absorption coefficients between 7100 l mol−1 cm−1 and 8100 l mol−1 cm−1 have been reported for the dibenzofulvene–piperidine adduct at 301.0 nm. Depending on the applied value, the nominal batch size may differ up to 14%. In this publication, a determination of the molar absorption coefficients at 301.0 and 289.8 nm is reported. Furthermore, proof is given that by measuring the absorption at 289.8 nm the impact of wavelength accuracy is reduced. © 2017 The Authors Journal of Peptide Science published by European Peptide Society and John Wiley & Sons Ltd. PMID:28635051
Kostrzewska, E.
1976-01-01
With the development of modern methods of surgery, anaesthesia, and pre- and postoperative care the requirement for blood substitutes is continuously increasing. We present a review of the different blood substitutes which are already in clinical use or in an advanced stage of experimental investigation for possible practical administration. Our own clinical experience with dextrans and experimental studies on stroma-free haemoglobin and hydroxyethyl starch solutions are described. PMID:57736
Jin, Zhinan; Johnson, Kenneth A.
2011-01-01
A nucleotide-induced change in DNA polymerase structure governs the kinetics of polymerization by high fidelity DNA polymerases. Mutation of a GAG hinge (G542A/G544A) in T7 DNA polymerase resulted in a 1000-fold slower rate of conformational change, which then limited the rate of correct nucleotide incorporation. Rates of misincorporation were comparable to that seen for wild-type enzyme so that the net effect of the mutation was a large decrease in fidelity. We demonstrate that a presumably modest change from glycine to alanine 20 Å from the active site can severely restrict the flexibility of the enzyme structure needed to recognize and incorporate correct substrates with high specificity. These results emphasize the importance of the substrate-induced conformational change in governing nucleotide selectivity by accelerating the incorporation of correct base pairs but not mismatches. PMID:20978284
Helal, Soheir F; Gomaa, Howayda E; Thabet, Eman H; Younan, Mariam A; Helmy, Neveen A
2014-01-01
Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (-1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (-1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (-1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects.
Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide
Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; ...
2014-11-17
Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2’-deoxyguanosine found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate E. coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerase discriminates between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities,more » nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine (Cy) and 8-oxodGTP(syn) utilizes its Hoogsteen edge to base pair with adenine (Ad). Here in this paper we utilized time-lapse crystallography to follow 8-oxo-dGTP insertion opposite Ad or Cy with human DNA pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxodGTP utilizes charge modulation during insertion that can lead to a blocked DNA repair intermediate.« less
Cyclic nucleotide gated channels 7 and 8 are essential for male reproductive fertility.
Tunc-Ozdemir, Meral; Rato, Claudia; Brown, Elizabeth; Rogers, Stephanie; Mooneyham, Amanda; Frietsch, Sabine; Myers, Candace T; Poulsen, Lisbeth Rosager; Malhó, Rui; Harper, Jeffrey F
2013-01-01
The Arabidopsis thaliana genome contains 20 CNGCs, which are proposed to encode cyclic nucleotide gated, non-selective, Ca²⁺-permeable ion channels. CNGC7 and CNGC8 are the two most similar with 74% protein sequence identity, and both genes are preferentially expressed in pollen. Two independent loss-of-function T-DNA insertions were identified for both genes and used to generate plant lines in which only one of the two alleles was segregating (e.g., cngc7-1+/-/cngc8-2-/- and cngc7-3-/-/cngc8-1+/-). While normal pollen transmission was observed for single gene mutations, pollen harboring mutations in both cngc7 and 8 were found to be male sterile (transmission efficiency reduced by more than 3000-fold). Pollen grains harboring T-DNA disruptions of both cngc7 and 8 displayed a high frequency of bursting when germinated in vitro. The male sterile defect could be rescued through pollen expression of a CNGC7 or 8 transgene including a CNGC7 with an N-terminal GFP-tag. However, rescue efficiencies were reduced ∼10-fold when the CNGC7 or 8 included an F to W substitution (F589W and F624W, respectively) at the junction between the putative cyclic nucleotide binding-site and the calmodulin binding-site, identifying this junction as important for proper functioning of a plant CNGC. Using confocal microscopy, GFP-CNGC7 was found to preferentially localize to the plasma membrane at the flanks of the growing tip. Together these results indicate that CNGC7 and 8 are at least partially redundant and provide an essential function at the initiation of pollen tube tip growth.
Hypermutation in shark immunoglobulin light chain genes results in contiguous substitutions.
Lee, Susan S; Tranchina, Daniel; Ohta, Yuko; Flajnik, Martin F; Hsu, Ellen
2002-04-01
Among 631 substitutions present in 90 nurse shark immunoglobulin light chain somatic mutants, 338 constitute 2-4 bp stretches of adjacent changes. An absence of mutations in perinatal sequences and the bias for one mutating V gene in adults suggest that the diversification is antigen dependent. The substitutions shared no patterns, and the absence of donor sequences, including from family members, supports the idea that most changes arose from nontemplated mutation. The tandem mutations as a group are distinguished by consistently fewer transition changes and an A bias. We suggest this is one of several pathways of hypermutation diversifying shark antigen-receptor genes--point mutations, tandem mutations, and mutations with a G-C preference--that coevolved with or preceded gene rearrangement.
Ashley, Neil; Adams, Susan; Slama, Abdelhamid; Zeviani, Massimo; Suomalainen, Anu; Andreu, Antonio L; Naviaux, Robert K; Poulton, Joanna
2007-06-15
Defects in mtDNA maintenance range from fatal multisystem childhood diseases, such as Alpers syndrome, to milder diseases in adults, including mtDNA depletion syndromes (MDS) and familial progressive external ophthalmoplegia (AdPEO). Most are associated with defects in genes involved in mitochondrial deoxynucleotide metabolism or utilization, such as mutations in thymidine kinase 2 (TK2) as well as the mtDNA replicative helicase, Twinkle and gamma polymerase (POLG). We have developed an in vitro system to measure incorporation of radiolabelled dNTPs into mitochondria of saponin permeabilized cells. We used this to compare the rates of mtDNA synthesis in cells from 12 patients with diseases of mtDNA maintenance. We observed reduced incorporation of exogenous alpha (32)P-dTTP in fibroblasts from a patient with Alpers syndrome associated with the A467T substitution in POLG, a patient with dGK mutations, and a patient with mtDNA depletion of unknown origin compared to controls. However, incorporation of alpha (32)P-dTTP relative to either cell doubling time or alpha (32)P-dCTP incorporation was increased in patients with thymidine kinase deficiency or PEO as the result of TWINKLE mutations compared with controls. The specific activity of newly synthesized mtDNA depends on the size of the endogenous pool diluting the exogenous labelled nucleotide. Our result is consistent with a deficiency in the intramitochondrial pool of dTTP relative to dCTP in cells from patients with TK2 deficiency and TWINKLE mutations. Such DNA precursor asymmetry could cause pausing of the replication complex and hence exacerbate the propensity for age-related mtDNA mutations. Because deviations from the normal concentrations of dNTPs are known to be mutagenic, we suggest that intramitochondrial nucleotide imbalance could underlie the multiple mtDNA mutations observed in these patients.
Hashimoto, Y; Tanimoto, K; Ozawa, Y; Murata, T; Ike, Y
2000-04-15
The vancomycin-resistant enterococci GV1, GV2 and GV3, which were isolated from droppings from broiler farms in Japan have been characterized as VanA-type VRE, which express high-level vancomycin resistance (256 or 512 microg ml(-1), MIC) and low-level teicoplanin resistance (1 or 2 microg ml(-1), MIC). The vancomycin resistances were encoded on plasmids. The vancomycin resistance conjugative plasmid pMG2 was isolated from the GV2 strain. The VanA determinant of pMG2 showed the same genetic organization as that of the VanA genes encoded on the representative transposon Tn1546, which comprises vanRSHAXYZ. The nucleotide sequences of all the genes, except the gene related to the vanS gene on Tn1546, were completely identical to the genes encoded on Tn1546. Three amino acid substitutions in the N-terminal region of the deduced VanS were detected in the nucleotide sequence of vanS encoded on pMG2. There were also three amino acid substitutions in the vanS gene of the GV1 and GV3 strains in the same positions as in the vanS gene of pMG2. Vancomycin induced the increased teicoplanin resistance in these strains.
Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W.; Disney, Matthew D.
2011-01-01
RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5′CUG/3′GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures are disclosed of a model DM1 triplet repeating construct, 5′r(UUGGGC(CUG)3GUCC)2, refined to 2.20 Å and 1.52 Å resolution. Here, differences in orientation of the 5′ dangling UU end between the two structures induce changes in the backbone groove width, which reveals that non-canonical 1×1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 Å structure, CUGa, the 5′UU forms one hydrogen-bonded pairs with a 5′UU of a neighboring helix in the unit cell to form a pseudo-infinite helix. The central 1×1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1×1 nucleotide UU internal loops each form a one hydrogen-bonded pair. In the 1.52 Å structure, CUGb, the 5′ UU dangling end is tucked into the major groove of the duplex. While the canonical paired bases show no change in base pairing, in CUGb the terminal 1×1 nucleotide UU internal loops form now two hydrogen-bonded pairs. Thus, the shift in major groove induced by the 5′UU dangling end alters non-canonical base patterns. Collectively, these structures indicate that 1×1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands. PMID:21988728
Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W; Disney, Matthew D
2011-11-15
RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[UUGGGC(CUG)(3)GUCC](2), refined to 2.20 and 1.52 Å resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 × 1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 Å structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 × 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 × 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 Å structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 × 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 × 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Amit; Park, HaJeung; Fang, Pengfei
2012-03-27
RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[{und UU}GGGC(C{und U}G){sub 3}GUCC]{sub 2}, refined to 2.20 and 1.52 {angstrom} resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 x 1 nucleotide UU internal loops can display an ensemble of pairing conformations.more » In the 2.20 {angstrom} structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 x 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 x 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 {angstrom} structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 x 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 x 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.« less
Dasan, Y. K.; Guan, B. H.; Zahari, M. H.; Chuan, L. K.
2017-01-01
Lanthanum substituted Ni-Zn ferrite nanoparticles (Ni0.5Zn0.5LaxFe1-xO4; 0.00 ≤x≤ 1.00) synthesized by sol-gel method were presented. X-ray diffraction patterns reveal the typical single phase spinel cubic ferrite structure, with the traces of secondary phase for lanthanum substituted nanocrystals. In addition, the structural analysis also demonstrates that the average crystallite size varied in the range of 21–25 nm. FTIR spectra present the two prominent absorption bands in the range of 400 to 600 cm-1 which are the fingerprint region of all ferrites. Surface morphology of both substituted and unsubstituted Ni-Zn ferrite nanoparticle samples was studied using FESEM technique and it indicates a significant increase in the size of spherical shaped particles with La3+ substitution. Magnetic properties of all samples were analyzed using vibrating sample magnetometer (VSM). The results revealed that saturation magnetization (Ms) and coercivity (Hc) of La3+ substituted samples has decreased as compared to the Ni-Zn ferrite samples. Hence, the observed results affirm that the lanthanum ion substitution has greatly influenced the structural, morphology and magnetic properties of Ni-Zn ferrite nanoparticles. PMID:28081257
Dasan, Y K; Guan, B H; Zahari, M H; Chuan, L K
2017-01-01
Lanthanum substituted Ni-Zn ferrite nanoparticles (Ni0.5Zn0.5LaxFe1-xO4; 0.00 ≤x≤ 1.00) synthesized by sol-gel method were presented. X-ray diffraction patterns reveal the typical single phase spinel cubic ferrite structure, with the traces of secondary phase for lanthanum substituted nanocrystals. In addition, the structural analysis also demonstrates that the average crystallite size varied in the range of 21-25 nm. FTIR spectra present the two prominent absorption bands in the range of 400 to 600 cm-1 which are the fingerprint region of all ferrites. Surface morphology of both substituted and unsubstituted Ni-Zn ferrite nanoparticle samples was studied using FESEM technique and it indicates a significant increase in the size of spherical shaped particles with La3+ substitution. Magnetic properties of all samples were analyzed using vibrating sample magnetometer (VSM). The results revealed that saturation magnetization (Ms) and coercivity (Hc) of La3+ substituted samples has decreased as compared to the Ni-Zn ferrite samples. Hence, the observed results affirm that the lanthanum ion substitution has greatly influenced the structural, morphology and magnetic properties of Ni-Zn ferrite nanoparticles.
Lam, Angela M.; Espiritu, Christine; Bansal, Shalini; Micolochick Steuer, Holly M.; Zennou, Veronique; Otto, Michael J.; Furman, Phillip A.
2011-01-01
PSI-352938, a cyclic phosphate nucleotide, and PSI-353661, a phosphoramidate nucleotide, are prodrugs of β-d-2′-deoxy-2′-α-fluoro-2′-β-C-methylguanosine-5′-monophosphate. Both compounds are metabolized to the same active 5′-triphosphate, PSI-352666, which serves as an alternative substrate inhibitor of the NS5B RNA-dependent RNA polymerase during HCV replication. PSI-352938 and PSI-353661 retained full activity against replicons containing the S282T substitution, which confers resistance to certain 2′-substituted nucleoside/nucleotide analogs. PSI-352666 was also similarly active against both wild-type and S282T NS5B polymerases. In order to identify mutations that confer resistance to these compounds, in vitro selection studies were performed using HCV replicon cells. While no resistant genotype 1a or 1b replicons could be selected, cells containing genotype 2a JFH-1 replicons cultured in the presence of PSI-352938 or PSI-353661 developed resistance to both compounds. Sequencing of the NS5B region identified a number of amino acid changes, including S15G, R222Q, C223Y/H, L320I, and V321I. Phenotypic evaluation of these mutations indicated that single amino acid changes were not sufficient to significantly reduce the activity of PSI-352938 and PSI-353661. Instead, a combination of three amino acid changes, S15G/C223H/V321I, was required to confer a high level of resistance. No cross-resistance exists between the 2′-F-2′-C-methylguanosine prodrugs and other classes of HCV inhibitors, including 2′-modified nucleoside/-tide analogs such as PSI-6130, PSI-7977, INX-08189, and IDX-184. Finally, we determined that in genotype 1b replicons, the C223Y/H mutation failed to support replication, and although the A15G/C223H/V321I triple mutation did confer resistance to PSI-352938 and PSI-353661, this mutant replicated at only about 10% efficiency compared to the wild type. PMID:21957306
Sounds of silence: synonymous nucleotides as a key to biological regulation and complexity
Shabalina, Svetlana A.; Spiridonov, Nikolay A.; Kashina, Anna
2013-01-01
Messenger RNA is a key component of an intricate regulatory network of its own. It accommodates numerous nucleotide signals that overlap protein coding sequences and are responsible for multiple levels of regulation and generation of biological complexity. A wealth of structural and regulatory information, which mRNA carries in addition to the encoded amino acid sequence, raises the question of how these signals and overlapping codes are delineated along non-synonymous and synonymous positions in protein coding regions, especially in eukaryotes. Silent or synonymous codon positions, which do not determine amino acid sequences of the encoded proteins, define mRNA secondary structure and stability and affect the rate of translation, folding and post-translational modifications of nascent polypeptides. The RNA level selection is acting on synonymous sites in both prokaryotes and eukaryotes and is more common than previously thought. Selection pressure on the coding gene regions follows three-nucleotide periodic pattern of nucleotide base-pairing in mRNA, which is imposed by the genetic code. Synonymous positions of the coding regions have a higher level of hybridization potential relative to non-synonymous positions, and are multifunctional in their regulatory and structural roles. Recent experimental evidence and analysis of mRNA structure and interspecies conservation suggest that there is an evolutionary tradeoff between selective pressure acting at the RNA and protein levels. Here we provide a comprehensive overview of the studies that define the role of silent positions in regulating RNA structure and processing that exert downstream effects on proteins and their functions. PMID:23293005
CodonLogo: a sequence logo-based viewer for codon patterns.
Sharma, Virag; Murphy, David P; Provan, Gregory; Baranov, Pavel V
2012-07-15
Conserved patterns across a multiple sequence alignment can be visualized by generating sequence logos. Sequence logos show each column in the alignment as stacks of symbol(s) where the height of a stack is proportional to its informational content, whereas the height of each symbol within the stack is proportional to its frequency in the column. Sequence logos use symbols of either nucleotide or amino acid alphabets. However, certain regulatory signals in messenger RNA (mRNA) act as combinations of codons. Yet no tool is available for visualization of conserved codon patterns. We present the first application which allows visualization of conserved regions in a multiple sequence alignment in the context of codons. CodonLogo is based on WebLogo3 and uses the same heuristics but treats codons as inseparable units of a 64-letter alphabet. CodonLogo can discriminate patterns of codon conservation from patterns of nucleotide conservation that appear indistinguishable in standard sequence logos. The CodonLogo source code and its implementation (in a local version of the Galaxy Browser) are available at http://recode.ucc.ie/CodonLogo and through the Galaxy Tool Shed at http://toolshed.g2.bx.psu.edu/.
Substitution determination of Fmoc-substituted resins at different wavelengths.
Eissler, Stefan; Kley, Markus; Bächle, Dirk; Loidl, Günther; Meier, Thomas; Samson, Daniel
2017-10-01
In solid-phase peptide synthesis, the nominal batch size is calculated using the starting resin substitution and the mass of the starting resin. The starting resin substitution constitutes the basis for the calculation of a whole set of important process parameters, such as the number of amino acid derivative equivalents. For Fmoc-substituted resins, substitution determination is often performed by suspending the Fmoc-protected starting resin in 20% (v/v) piperidine in DMF to generate the dibenzofulvene-piperidine adduct that is quantified by ultraviolet-visible spectroscopy. The spectrometric measurement is performed at the maximum absorption wavelength of the dibenzofulvene-piperidine adduct, that is, at 301.0 nm. The recorded absorption value, the resin weight and the volume are entered into an equation derived from Lambert-Beer's law, together with the substance-specific molar absorption coefficient at 301.0 nm, in order to calculate the nominal substitution. To our knowledge, molar absorption coefficients between 7100 l mol -1 cm -1 and 8100 l mol -1 cm -1 have been reported for the dibenzofulvene-piperidine adduct at 301.0 nm. Depending on the applied value, the nominal batch size may differ up to 14%. In this publication, a determination of the molar absorption coefficients at 301.0 and 289.8 nm is reported. Furthermore, proof is given that by measuring the absorption at 289.8 nm the impact of wavelength accuracy is reduced. © 2017 The Authors Journal of Peptide Science published by European Peptide Society and John Wiley & Sons Ltd. © 2017 The Authors Journal of Peptide Science published by European Peptide Society and John Wiley & Sons Ltd.
High-throughput discovery of rare human nucleotide polymorphisms by Ecotilling
Till, Bradley J.; Zerr, Troy; Bowers, Elisabeth; Greene, Elizabeth A.; Comai, Luca; Henikoff, Steven
2006-01-01
Human individuals differ from one another at only ∼0.1% of nucleotide positions, but these single nucleotide differences account for most heritable phenotypic variation. Large-scale efforts to discover and genotype human variation have been limited to common polymorphisms. However, these efforts overlook rare nucleotide changes that may contribute to phenotypic diversity and genetic disorders, including cancer. Thus, there is an increasing need for high-throughput methods to robustly detect rare nucleotide differences. Toward this end, we have adapted the mismatch discovery method known as Ecotilling for the discovery of human single nucleotide polymorphisms. To increase throughput and reduce costs, we developed a universal primer strategy and implemented algorithms for automated band detection. Ecotilling was validated by screening 90 human DNA samples for nucleotide changes in 5 gene targets and by comparing results to public resequencing data. To increase throughput for discovery of rare alleles, we pooled samples 8-fold and found Ecotilling to be efficient relative to resequencing, with a false negative rate of 5% and a false discovery rate of 4%. We identified 28 new rare alleles, including some that are predicted to damage protein function. The detection of rare damaging mutations has implications for models of human disease. PMID:16893952
Marq, Jean-Baptiste; Kolakofsky, Daniel; Garcin, Dominique
2010-06-11
Arenavirus and bunyavirus RNA genomes are unusual in that they are found in circular nucleocapsids, presumably due to the annealing of their complementary terminal sequences. Moreover, arenavirus genome synthesis initiates with GTP at position +2 of the template rather than at the precise 3' end (position +1). After formation of a dinucleotide, 5' pppGpC(OH) is then realigned on the template before this primer is extended. The net result of this "prime and realign" mechanism of genome initiation is that 5' pppG is found as an unpaired 5' nucleotide when the complementary genome ends anneal to form a double-stranded (dsRNA) panhandle. Using 5' pppRNA made in vitro and purified so that all dsRNA side products are absent, we have determined that both this 5' nucleotide overhang, as well as mismatches within the dsRNA (as found in some arenavirus genomes), clearly reduce the ability of these model dsRNAs to induce interferon upon transfection into cells. The presence of this unpaired 5' ppp-nucleotide is thus another way that some viruses appear to use to avoid detection by cytoplasmic pattern recognition receptors.
Halbfinger, E; Major, D T; Ritzmann, M; Ubl, J; Reiser, G; Boyer, J L; Harden, K T; Fischer, B
1999-12-30
The remarkably high potencies of 2-thioether-adenine nucleotides regarding the activation of the P2Y(1)-receptor (P2Y(1)-R) in turkey erythrocyte membranes represent some of the largest substitution-promoted increases in potencies over that of a natural receptor ligand. This paper describes the investigation regarding the origin of the high potency of these P2Y(1)-R ligands over that of ATP. For this study, an integrated approach was employed combining the synthesis of new ATP analogues, their biochemical evaluation, and their SAR analysis involving NMR experiments and theoretical calculations. These experiments and calculations were performed to elucidate the conformation and to evaluate the electronic nature of the investigated P2Y(1)-R ligands. ATP analogues synthesized included derivatives where C2 or C8 positions were substituted with electron-donating groups such as ethers, thioethers, or amines. The compounds were tested for their potency to induce P2Y(1)-R-mediated activation of phospholipase C in turkey erythrocytes and Ca(2+) response in rat astrocytes. 8-Substituted ATP and AMP derivatives had little or no effect on phospholipase C or on calcium levels, whereas the corresponding 2-substituted ATP analogues potently increased the levels of inositol phosphates and ¿Ca(2+)(i). AMP analogues were ineffective except for 2-butylthio-AMP which induced a small Ca(2+) response. P2Y(1)-R activity of these compounds was demonstrated by testing these ligands also on NG108-15 neuroblastoma x glioma hybrid cells. NMR data together with theoretical calculations imply that steric, rather than electronic, effects play a major role in ligand binding to the P2Y(1)-R. Hydrophobic interactions and H-bonds of the C2 substituent appear to be important determinants of a P2Y(1)-R ligand affinity.
Reducing nontemplated 3' nucleotide addition to polynucleotide transcripts
Kao, C. Cheng
2000-01-01
Non-template 3' nucleotide addition to a transcript is reduced by transcribing a transcript from a template comprising an ultimate and/or penultimate 5' ribose having a C'2 substituent such as methoxy, which reduces non-template 3' nucleotide addition to the transcript. The methods are shown to be applicable to a wide variety of polymerases, including Taq, T7 RNA polymerase, etc.
Profile of nucleosides and nucleotides in donkey's milk.
Vincenzetti, Silvia; Pucciarelli, Stefania; Nucci, Chiara; Polzonetti, Valeria; Cammertoni, Natalina; Polidori, Paolo
2014-01-01
Nucleotides play a crucial role to cellular functions; they can be obtained from the diet or through the nucleotide salvage pathway, however, in particular situations (occurring mainly in newborns) the metabolic demand of nucleotides exceeds the capacity of their synthesis. These molecules, are receiving attention from a nutraceutical point of view because of their potential direct role in regulating metabolism and infant body condition. Donkey's milk may be considered a good replacer for cow's milk in feeding children with severe Ig-E mediated cow's milk protein allergy, due to its high similarity with human milk. In this study, the presence of cytidine, uridine, CMP, UMP, guanosine, and adenosine, involved in numerous biochemical and physiological activities, were detected for the first time through a RP-HPLC method.
Compositions and methods for detecting single nucleotide polymorphisms
Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.
2016-11-22
Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.
Evolution of Nucleotide Punctuation Marks: From Structural to Linear Signals.
El Houmami, Nawal; Seligmann, Hervé
2017-01-01
We present an evolutionary hypothesis assuming that signals marking nucleotide synthesis (DNA replication and RNA transcription) evolved from multi- to unidimensional structures, and were carried over from transcription to translation. This evolutionary scenario presumes that signals combining secondary and primary nucleotide structures are evolutionary transitions. Mitochondrial replication initiation fits this scenario. Some observations reported in the literature corroborate that several signals for nucleotide synthesis function in translation, and vice versa. (a) Polymerase-induced frameshift mutations occur preferentially at translational termination signals (nucleotide deletion is interpreted as termination of nucleotide polymerization, paralleling the role of stop codons in translation). (b) Stem-loop hairpin presence/absence modulates codon-amino acid assignments, showing that translational signals sometimes combine primary and secondary nucleotide structures (here codon and stem-loop). (c) Homopolymer nucleotide triplets (AAA, CCC, GGG, TTT) cause transcriptional and ribosomal frameshifts. Here we find in recently described human mitochondrial RNAs that systematically lack mono-, dinucleotides after each trinucleotide (delRNAs) that delRNA triplets include 2x more homopolymers than mitogenome regions not covered by delRNA. Further analyses of delRNAs show that the natural circular code X (a little-known group of 20 translational signals enabling ribosomal frame retrieval consisting of 20 codons {AAC, AAT, ACC, ATC, ATT, CAG, CTC, CTG, GAA, GAC, GAG, GAT, GCC, GGC, GGT, GTA, GTC, GTT, TAC, TTC} universally overrepresented in coding versus other frames of gene sequences), regulates frameshift in transcription and translation. This dual transcription and translation role confirms for X the hypothesis that translational signals were carried over from transcriptional signals.
Gumbs, Pearl D; Verschuren, W M Monique; Souverein, Patrick C; Mantel-Teeuwisse, Aukje K; de Wit, G Ardine; de Boer, Anthonius; Klungel, Olaf H
2007-11-01
To assess the potential annual savings due to generic and therapeutic substitution of statin therapy for the general Dutch population, taking the patients medical history into account. We conducted a population-based costing study using the PHARMO Record Linkage System (RLS). PHARMO RLS contains drug dispensing records from a representative sample of pharmacies located in more than 50 regions in the Netherlands. We selected all statin users in the database since 2003. The cost-savings of generic substitution of statin therapy for all simvastatin and pravastatin users, and of therapeutic substitution of statin therapy for other statin users were calculated. Substituting current users and new users of statins were considered separately. Therapeutic substitution was based on the medical history of the individual patient. Patients were only substituted if there was an appropriate substitute available. The appropriateness of substitution was based on drug-drug interactions between statins and possible comedication and the availability of an equipotent alternative. Substituting (generic and therapeutic) statin therapy for all current users would lead to potential annual savings of approximately 87 million euros. Substituting (generic and therapeutic) all starters on statin therapy would lead to potential annual savings of around 51 million euros. In the case of generic substitution only, the potential annual savings for all current simvastatin and pravastatin users would be 2.4 million euros and for the new users about 1.8 million euros. From an economic point of view, society could gain a lot from substituting statin therapy, especially from therapeutic substitution.
ERIC Educational Resources Information Center
Jones, Kevin R.
1999-01-01
This news brief presents information on managing substitute teaching. The information is based on issues discussed at a summit meeting which included public school administrators and personnel directors from around the nation. The main topics of concern focused around four core components related to the management of substitute teaching:…
Molecular evolution of the leptin exon 3 in some species of the family Canidae.
Chmurzynska, Agata; Zajac, Magdalena; Switonski, Marek
2003-01-01
The structure of the leptin gene seems to be well conserved. The polymorphism of this gene in four species belonging to the Canidae family (the dog (Canis familiaris)--16 different breeds, the Chinese racoon dog (Nyctereutes procyonoides procyonoides), the red fox (Vulpes vulpes) and the arctic fox (Alopex lagopus)) were studied with the use of single strand conformation polymorphism (SSCP), restriction fragment length polymorphism (RFLP) and DNA sequencing techniques. For exon 2, all species presented the same SSCP pattern, while in exon 3 some differences were found. DNA sequencing of exon 3 revealed the presence of six nucleotide substitutions, differentiating the studied species. Three of them cause amino acid substitutions as well. For all dog breeds studied, SSCP patterns were identical.
Molecular evolution of the leptin exon 3 in some species of the family Canidae
Chmurzynska, Agata; Zajac, Magdalena; Switonski, Marek
2003-01-01
The structure of the leptin gene seems to be well conserved. The polymorphism of this gene in four species belonging to the Canidae family (the dog (Canis familiaris) – 16 different breeds, the Chinese racoon dog (Nyctereutes procyonoides procyonoides), the red fox (Vulpes vulpes) and the arctic fox (Alopex lagopus)) were studied with the use of single strand conformation polymorphism (SSCP), restriction fragment length polymorphism (RFLP) and DNA sequencing techniques. For exon 2, all species presented the same SSCP pattern, while in exon 3 some differences were found. DNA sequencing of exon 3 revealed the presence of six nucleotide substitutions, differentiating the studied species. Three of them cause amino acid substitutions as well. For all dog breeds studied, SSCP patterns were identical. PMID:12939206
DOE Office of Scientific and Technical Information (OSTI.GOV)
Doerk, T.; Wulbrand, U.; Tuemmler, B.
1993-03-01
Single cases of the four novel splice site mutations 1525[minus]1 G [r arrow] A (intron 9), 3601[minus]2 A [r arrow] G (intron 18), 3850[minus]3 T [r arrow] G (intron 19), and 4374+1 G [r arrow] T (intron 23) were detected in the CFTR gene of cystic fibrosis patients of Indo-Iranian, Turkish, Polish, and Germany descent. The nucleotide substitutions at the +1, [minus]1, and [minus]2 positions all destroy splice sites and lead to severe disease alleles associated with features typical of gastrointestinal and pulmonary cystic fibrosis disease. The 3850[minus]3 T-to-G change was discovered in a very mildly affected 33-year-old [Delta]F508 compoundmore » heterozygote, suggesting that the T-to-G transversion at the less conserved [minus]3 position of the acceptor splice site may retain some wildtype function. 13 refs., 1 fig., 2 tabs.« less
Cytokinin nucleotides contents in sexual buds of Douglas-fir
DOE Office of Scientific and Technical Information (OSTI.GOV)
Imbault, N.; Doumas, P.; Bonnet-Masimbert, N.
1989-04-01
Cytokinin nucleotides were extracted from male and female buds of Pseudotsuga menxiesii by 10 % perchloric acid. They were prepurified on cation exchanger columns (CBA, Amersham) and then separated by two HPLC systems. The first one (Partisil 10 SAX, 10{mu}m, Wathman) separates the mono-, di- and tri-phosphates groups which were collected. The second one (Ultraspher, 5 {mu}m, Beckman) separates the cytokinin nucleotides inside each group. After separation, cytokinin nucleotides were assayed by radioimmunoassay with anti ribosyl zeatin (RZ) and anti isopentenyladenosine (iPA) antibodies. The analysis showed in the monophosphate (mono-P) group one immunoreactant peak in RZ fraction which co-chromatographied withmore » RZ-5{prime}-mono-P and two peaks in the iPA fraction. One of them co-chromatographied with iPA-5{prime}-mono-P. In the diphosphate group, there were three peaks which reacted with anti RZ antibodies and one with anti iPA antibodies. The nucleotides obtained after the first HPLC system, were hydrolysed by a 5{prime}-nucleotidase showed compounds co-chromatographing with RZ and iPA. We did not observe any qualitative differences between the male and female buds. This is the first evidence of cytokinin nucleotides in tissue from woody plants.« less
Root, D. D.; Reisler, E.
1992-01-01
Recent publication of the atomic structure of G-actin (Kabsch, W., Mannherz, H. G., Suck, D., Pai, E. F., & Holmes, K. C., 1990, Nature 347, 37-44) raises questions about how the conformation of actin changes upon its polymerization. In this work, the effects of various quenchers of etheno-nucleotides bound to G- and F-actin were examined in order to assess polymerization-related changes in the nucleotide phosphate site. The Mg(2+)-induced polymerization of actin quenched the fluorescence of the etheno-nucleotides by approximately 20% simultaneously with the increase in light scattering by actin. A conformational change at the nucleotide binding site was also indicated by greater accessibility of F-actin than G-actin to positively, negatively, and neutrally charged collisional quenchers. The difference in accessibility between G- and F-actin was greatest for I-, indicating that the environment of the etheno group is more positively charged in the polymerized form of actin. Based on calculations of the change in electric potential of the environment of the etheno group, specific polymerization-related movements of charged residues in the atomic structure of G-actin are suggested. The binding of S-1 to epsilon-ATP-G-actin increased the accessibility of the etheno group to I- even over that in Mg(2+)-polymerized actin. The quenching of the etheno group by nitromethane was, however, unaffected by the binding of S-1 to actin. Thus, the binding of S-1 induces conformational changes in the cleft region of actin that are different from those caused by Mg2+ polymerization of actin.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1304380
Nucleotide excision repair by dual incisions in plants.
Canturk, Fazile; Karaman, Muhammet; Selby, Christopher P; Kemp, Michael G; Kulaksiz-Erkmen, Gulnihal; Hu, Jinchuan; Li, Wentao; Lindsey-Boltz, Laura A; Sancar, Aziz
2016-04-26
Plants use light for photosynthesis and for various signaling purposes. The UV wavelengths in sunlight also introduce DNA damage in the form of cyclobutane pyrimidine dimers (CPDs) and pyrimidine (6-4) pyrimidone photoproducts [(6-4)PPs] that must be repaired for the survival of the plant. Genome sequencing has revealed the presence of genes for both CPD and (6-4)PP photolyases, as well as genes for nucleotide excision repair in plants, such as Arabidopsis and rice. Plant photolyases have been purified, characterized, and have been shown to play an important role in plant survival. In contrast, even though nucleotide excision repair gene homologs have been found in plants, the mechanism of nucleotide excision repair has not been investigated. Here we used the in vivo excision repair assay developed in our laboratory to demonstrate that Arabidopsis removes CPDs and (6-4)PPs by a dual-incision mechanism that is essentially identical to the mechanism of dual incisions in humans and other eukaryotes, in which oligonucleotides with a mean length of 26-27 nucleotides are removed by incising ∼20 phosphodiester bonds 5' and 5 phosphodiester bonds 3' to the photoproduct.
VarDetect: a nucleotide sequence variation exploratory tool
Ngamphiw, Chumpol; Kulawonganunchai, Supasak; Assawamakin, Anunchai; Jenwitheesuk, Ekachai; Tongsima, Sissades
2008-01-01
Background Single nucleotide polymorphisms (SNPs) are the most commonly studied units of genetic variation. The discovery of such variation may help to identify causative gene mutations in monogenic diseases and SNPs associated with predisposing genes in complex diseases. Accurate detection of SNPs requires software that can correctly interpret chromatogram signals to nucleotides. Results We present VarDetect, a stand-alone nucleotide variation exploratory tool that automatically detects nucleotide variation from fluorescence based chromatogram traces. Accurate SNP base-calling is achieved using pre-calculated peak content ratios, and is enhanced by rules which account for common sequence reading artifacts. The proposed software tool is benchmarked against four other well-known SNP discovery software tools (PolyPhred, novoSNP, Genalys and Mutation Surveyor) using fluorescence based chromatograms from 15 human genes. These chromatograms were obtained from sequencing 16 two-pooled DNA samples; a total of 32 individual DNA samples. In this comparison of automatic SNP detection tools, VarDetect achieved the highest detection efficiency. Availability VarDetect is compatible with most major operating systems such as Microsoft Windows, Linux, and Mac OSX. The current version of VarDetect is freely available at . PMID:19091032
DNA Nucleotides Detection via capacitance properties of Graphene
NASA Astrophysics Data System (ADS)
Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash
2016-05-01
In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.
Villahermosa, Desirée; Christensen, Olaf; Knapp, Karen; Fleck, Oliver
2017-01-01
Defective mismatch repair (MMR) in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6), which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1), which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3) recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes. PMID:28341698
Villahermosa, Desirée; Christensen, Olaf; Knapp, Karen; Fleck, Oliver
2017-05-05
Defective mismatch repair (MMR) in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6), which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1), which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3) recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade + reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2 FEN1 Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe , but contributes to DNA repeat stability in MMR-independent processes. Copyright © 2017 Villahermosa et al.
Chromium and Tantalum Site Substitution Patterns in Ni3Al (L1(sub 2))gamma(prime)- Precipitates
NASA Technical Reports Server (NTRS)
Booth-Morrison, Christopher; Mao, Zugang; Seidman, David N.; Noebe, Ronald D.
2008-01-01
The site substitution behavior of Cr and Ta in the Ni3Al (Ll2)-type gamma'-precipitates of a Ni-Al-Cr-Ta alloy is investigated by atom-probe tomography (APT) and first-principles calculations. Measurements of the gamma'-phase composition by APT suggest that Al, Cr, and Ta share the Al sublattice sites of the gamma'-precipitates. The calculated substitutional energies of the solute atoms at the Ni and Al sublattice sites indicate that Ta has a strong preference for the Al sites, while Cr has a weak Al site preference. Furthermore, Ta is shown to replace Cr at the Al sublattice sites of the gamma'-precipitates, altering the elemental phase partitioning behavior of the Ni-Al-Cr-Ta alloy.
Helal, Soheir F.; Gomaa, Howayda E.; Thabet, Eman H.; Younan, Mariam A.; Helmy, Neveen A.
2014-01-01
Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (−1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (−1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (−1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). CONCLUSION No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects. PMID:24833945
Single Nucleotide Polymorphism Analysis of European Archaeological M. leprae DNA
Watson, Claire L.; Lockwood, Diana N. J.
2009-01-01
Background Leprosy was common in Europe eight to twelve centuries ago but molecular confirmation of this has been lacking. We have extracted M. leprae ancient DNA (aDNA) from medieval bones and single nucleotide polymorphism (SNP) typed the DNA, this provides insight into the pattern of leprosy transmission in Europe and may assist in the understanding of M. leprae evolution. Methods and Findings Skeletons have been exhumed from 3 European countries (the United Kingdom, Denmark and Croatia) and are dated around the medieval period (476 to 1350 A.D.). we tested for the presence of 3 previously identified single nucleotide polymorphisms (SNPs) in 10 aDNA extractions. M. leprae aDNA was extracted from 6 of the 10 bone samples. SNP analysis of these 6 extractions were compared to previously analysed European SNP data using the same PCR assays and were found to be the same. Testing for the presence of SNPs in M. leprae DNA extracted from ancient bone samples is a novel approach to analysing European M. leprae DNA and the findings concur with the previously published data that European M. leprae strains fall in to one group (SNP group 3). Conclusions These findings support the suggestion that the M. leprae genome is extremely stable and show that archaeological M. leprae DNA can be analysed to gain detailed information about the genotypic make-up of European leprosy, which may assist in the understanding of leprosy transmission worldwide. PMID:19847306
Relationship between Al content and substitution mechanism of Al-bearing anhydrous bridgmanites
NASA Astrophysics Data System (ADS)
Noda, M.; Inoue, T.; Kakizawa, S.
2017-12-01
It is considered that two substitution mechanisms, Tschermak substitution and oxygen vacancy substitution, exist in MgSiO3 bridgmanite for the incorporation of Al in anhydrous condition. Kubo and Akaogi (2000) has conducted the phase equilibrium experiment in the system MgSiO3-Al2O3, and established the phase diagram up to 28 GPa. However the careful observation in the bridgmanite shows that the chemical compositions are slightly deviated from Tschermak substitution join. The same tendency can be also observed in the run products by Irifune et al. (1996). This result indicates that pure Tschermak substitution bridgmanite cannot be stable even in the MgSiO3-Al2O3 join experiment. However, the previous studies used powder samples as the starting materials, so the absorbed water may affect the results. Therefore, we tried to conduct the experiment in the join MgSiO3-Al2O3 in extremely anhydrous condition to clarify whether the pure Tschermak substitution bridgmanite can be stable or not. In addition, we also examined the stability of oxygen vacancy bridgmanite in the extremely anhydrous condition for the comparison. The high pressure synthesis experiments were conducted at 28 GPa and 1600-1700° for 1hour using a Kawai-type multi-anvil apparatus. Four different Al content samples were prepared as the starting materials along the ideal substitution line of Tschermak (Al=0.025, 0.05, 0.1, 0.15 mol) and oxygen-vacancy (Al=0.025, 0.05, 0.075, 0.1 mol) substitutions, respectively (when total cation of 2). The glass rods were used as the starting materials to eliminate the absorbed water on the sample surface. The chemical compositions of the synthesized bridgmanite could not be measured by EPMA because of small grain size less than submicron. Therefore the chemical compositions were estimated from the result of the XRD pattern by subtracting the amount of the other phases. The estimated chemical compositions of Tschermak substitution bridgmanites were consistent with the
Lacome, Mathieu; Piscione, Julien; Hager, Jean-Philippe; Carling, Christopher
2016-09-01
To investigate the patterns and performance of substitutions in 18 international 15-a-side men's rugby union matches. A semiautomatic computerized time-motion system compiled 750 performance observations for 375 players (422 forwards, 328 backs). Running and technical-performance measures included total distance run, high-intensity running (>18.0 km/h), number of individual ball possessions and passes, percentage of passes completed, and number of attempted and percentage of successful tackles. A total of 184 substitutions (85.2%) were attributed to tactical and 32 (14.8%) to injury purposes respectively. The mean period for non-injury-purpose substitutions in backs (17.7%) occurred between 70 and 75 min, while forward substitutions peaked equally between 50-55 and 60-65 min (16.4%). Substitutes generally demonstrated improved running performance compared with both starter players who completed games and players whom they replaced (small differences, ES -0.2 to 0.5) in both forwards and backs over their entire time played. There was also a trend for better running performance in forward and back substitutes over their first 10 min of play compared with the final 10 min for replaced players (small to moderate differences, ES 0.3-0.6). Finally, running performance in both forward and back substitutes was generally lower (ES -0.1 to 0.3, unclear or small differences) over their entire 2nd-half time played compared with their first 10 min of play. The impact of substitutes on technical performance was generally considered unclear. This information provides practitioners with practical data relating to the physical and technical contributions of substitutions that subsequently could enable optimization of their impact on match play.
Neutron diffraction studies on cobalt substituted BiFeO3
NASA Astrophysics Data System (ADS)
Ray, J.; Biswal, A. K.; Acharya, S.; Babu, P. D.; Siruguri, V.; Vishwakarma, P. N.
2013-02-01
A dilute concentration of single phase Cobalt substituted Bismuth ferrite, BiFe1-XCoXO3; (x=0, 0.02) is prepared by sol-gel auto combustion method. Room temperature neutron diffraction patterns show no change in the crystal and magnetic structure upon cobalt doping. The calculation of magnetic moments shows 3.848 μB for Fe+ and 2.85 μB for Co3+. The cobalt is found to be in intermediate spin state.
14 CFR 1260.55 - Reports substitution.
Code of Federal Regulations, 2013 CFR
2013-01-01
... AGREEMENTS General Special Conditions § 1260.55 Reports substitution. Reports Substitution October 2000 Technical Reports may be substituted for the required Performance Reports. The title page of such reports... 14 Aeronautics and Space 5 2013-01-01 2013-01-01 false Reports substitution. 1260.55 Section 1260...
14 CFR 1260.55 - Reports substitution.
Code of Federal Regulations, 2010 CFR
2010-01-01
... AGREEMENTS General Special Conditions § 1260.55 Reports substitution. Reports Substitution October 2000 Technical Reports may be substituted for the required Performance Reports. The title page of such reports... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Reports substitution. 1260.55 Section 1260...
14 CFR 1260.55 - Reports substitution.
Code of Federal Regulations, 2011 CFR
2011-01-01
... AGREEMENTS General Special Conditions § 1260.55 Reports substitution. Reports Substitution October 2000 Technical Reports may be substituted for the required Performance Reports. The title page of such reports... 14 Aeronautics and Space 5 2011-01-01 2010-01-01 true Reports substitution. 1260.55 Section 1260...
14 CFR 1260.55 - Reports substitution.
Code of Federal Regulations, 2012 CFR
2012-01-01
... AGREEMENTS General Special Conditions § 1260.55 Reports substitution. Reports Substitution October 2000 Technical Reports may be substituted for the required Performance Reports. The title page of such reports... 14 Aeronautics and Space 5 2012-01-01 2012-01-01 false Reports substitution. 1260.55 Section 1260...
Helsel, D.R.
2006-01-01
The most commonly used method in environmental chemistry to deal with values below detection limits is to substitute a fraction of the detection limit for each nondetect. Two decades of research has shown that this fabrication of values produces poor estimates of statistics, and commonly obscures patterns and trends in the data. Papers using substitution may conclude that significant differences, correlations, and regression relationships do not exist, when in fact they do. The reverse may also be true. Fortunately, good alternative methods for dealing with nondetects already exist, and are summarized here with references to original sources. Substituting values for nondetects should be used rarely, and should generally be considered unacceptable in scientific research. There are better ways.
DNA Nucleotide Sequence Restricted by the RI Endonuclease
Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.
1972-01-01
The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974
Updating Our View of Organelle Genome Nucleotide Landscape
Smith, David Roy
2012-01-01
Organelle genomes show remarkable variation in architecture and coding content, yet their nucleotide composition is relatively unvarying across the eukaryotic domain, with most having a high adenine and thymine (AT) content. Recent studies, however, have uncovered guanine and cytosine (GC)-rich mitochondrial and plastid genomes. These sequences come from a small but eclectic list of species, including certain green plants and animals. Here, I review GC-rich organelle DNAs and the insights they have provided into the evolution of nucleotide landscape. I emphasize that GC-biased mitochondrial and plastid DNAs are more widespread than once thought, sometimes occurring together in the same species, and suggest that the forces biasing their nucleotide content can differ both among and within lineages, and may be associated with specific genome architectural features and life history traits. PMID:22973299
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
Shinbrot, Eve; Henninger, Erin E.; Weinhold, Nils; Covington, Kyle R.; Göksenin, A. Yasemin; Schultz, Nikolaus; Chao, Hsu; Doddapaneni, HarshaVardhan; Muzny, Donna M.; Gibbs, Richard A.; Sander, Chris; Pursell, Zachary F.
2014-01-01
Tumors with somatic mutations in the proofreading exonuclease domain of DNA polymerase epsilon (POLE-exo*) exhibit a novel mutator phenotype, with markedly elevated TCT→TAT and TCG→TTG mutations and overall mutation frequencies often exceeding 100 mutations/Mb. Here, we identify POLE-exo* tumors in numerous cancers and classify them into two groups, A and B, according to their mutational properties. Group A mutants are found only in POLE, whereas Group B mutants are found in POLE and POLD1 and appear to be nonfunctional. In Group A, cell-free polymerase assays confirm that mutations in the exonuclease domain result in high mutation frequencies with a preference for C→A mutation. We describe the patterns of amino acid substitutions caused by POLE-exo* and compare them to other tumor types. The nucleotide preference of POLE-exo* leads to increased frequencies of recurrent nonsense mutations in key tumor suppressors such as TP53, ATM, and PIK3R1. We further demonstrate that strand-specific mutation patterns arise from some of these POLE-exo* mutants during genome duplication. This is the first direct proof of leading strand-specific replication by human POLE, which has only been demonstrated in yeast so far. Taken together, the extremely high mutation frequency and strand specificity of mutations provide a unique identifier of eukaryotic origins of replication. PMID:25228659
Purdue, P E; Lumb, M J; Allsop, J; Minatogawa, Y; Danpure, C J
1992-05-01
We have synthesized and sequenced alanine:glyoxylate aminotransferase (AGT; HGMW-approved symbol for the gene--AGXT) cDNA from the liver of a primary hyperoxaluria type 1 (PH1) patient who had normal levels of hepatic peroxisomal immunoreactive AGT protein, but no AGT catalytic activity. This revealed the presence of a single point mutation (G----A at cDNA nucleotide 367), which is predicted to cause a glycine-to-glutamate substitution at residue 82 of the AGT protein. This mutation is located in exon 2 of the AGT gene and leads to the loss of an AvaI restriction site. Exon 2-specific PCR followed by AvaI digestion showed that this patient was homozygous for this mutation. In addition, three other PH1 patients, one related to and two unrelated to, but with enzymological phenotype similar to that of the first patient, were also shown to be homozygous for the mutation. However, one other phenotypically similar PH1 patient was shown to lack this mutation. The mechanism by which the glycine-to-glutamate substitution at residue 82 causes loss of catalytic activity remains to be resolved. However, the protein sequence in this region is highly conserved between different mammals, and the substitution at residue 82 is predicted to cause significant local structural alterations.
Loreni, F; Ruberti, I; Bozzoni, I; Pierandrei-Amaldi, P; Amaldi, F
1985-01-01
Ribosomal protein L1 is encoded by two genes in Xenopus laevis. The comparison of two cDNA sequences shows that the two L1 gene copies (L1a and L1b) have diverged in many silent sites and very few substitution sites; moreover a small duplication occurred at the very end of the coding region of the L1b gene which thus codes for a product five amino acids longer than that coded by L1a. Quantitatively the divergence between the two L1 genes confirms that a whole genome duplication took place in Xenopus laevis approximately 30 million years ago. A genomic fragment containing one of the two L1 gene copies (L1a), with its nine introns and flanking regions, has been completely sequenced. The 5' end of this gene has been mapped within a 20-pyridimine stretch as already found for other vertebrate ribosomal protein genes. Four of the nine introns have a 60-nucleotide sequence with 80% homology; within this region some boxes, one of which is 16 nucleotides long, are 100% homologous among the four introns. This feature of L1a gene introns is interesting since we have previously shown that the activity of this gene is regulated at a post-transcriptional level and it involves the block of the normal splicing of some intron sequences. Images Fig. 3. Fig. 5. PMID:3841512
Fixed-Gap Tunnel Junction for Reading DNA Nucleotides
2015-01-01
Previous measurements of the electronic conductance of DNA nucleotides or amino acids have used tunnel junctions in which the gap is mechanically adjusted, such as scanning tunneling microscopes or mechanically controllable break junctions. Fixed-junction devices have, at best, detected the passage of whole DNA molecules without yielding chemical information. Here, we report on a layered tunnel junction in which the tunnel gap is defined by a dielectric layer, deposited by atomic layer deposition. Reactive ion etching is used to drill a hole through the layers so that the tunnel junction can be exposed to molecules in solution. When the metal electrodes are functionalized with recognition molecules that capture DNA nucleotides via hydrogen bonds, the identities of the individual nucleotides are revealed by characteristic features of the fluctuating tunnel current associated with single-molecule binding events. PMID:25380505
Electrical detection and quantification of single and mixed DNA nucleotides in suspension
NASA Astrophysics Data System (ADS)
Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah
2016-09-01
High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.
Structural, electrical and magnetic study of Nd-Ni substituted W-type Hexaferrite
NASA Astrophysics Data System (ADS)
Khan, Imran; Sadiq, Imran; Ali, Irshad; Rana, Mazhar-Ud-Din; Najam-Ul-Haq, Muhammad; Shah, Afzal; Shakir, Imran; Naeem Ashiq, Muhammad
2016-01-01
A series of Nd-Ni substituted W-type hexaferrites with composition Sr1-xNdxCo2NiyFe16-yO27 (where x=0.0, 0.025, 0.050, 0.075, 0.1 and y=0.0, 0.25, 0.50, 0.75, 1) has been prepared by the chemical co-precipitation method. The effect of rare earth Nd substitution at strontium site while Ni at iron site on microstructure, electrical and magnetic properties has been investigated. All the XRD patterns of the synthesized materials show single W-type hexagonal phase without any other intermediate phases. SEM images show that the particles are homogeneous and hexagonal platelet-like shape. DC electrical resistivity measurements were carried out in temperature range of 298-673 K showing metal-to-semiconductor transition when doped with Nd-Ni. The magnetic properties such as saturation magnetization, remanence, squareness ratio and coercivity were calculated from hysteresis loops and were observed to increase with the increase in Nd-Ni concentration up to a certain substitution level which is beneficial for high density recording media.
Li, Xiaoze; Johansson, Cecilia; Cardoso Palacios, Carlos; Mossberg, Anki; Dhanjal, Soniya; Bergvall, Monika; Schwartz, Stefan
2013-01-01
The most commonly used 3′-splice site on the human papillomavirus type 16 (HPV-16) genome named SA3358 is used to produce HPV-16 early mRNAs encoding E4, E5, E6 and E7, and late mRNAs encoding L1 and L2. We have previously shown that SA3358 is suboptimal and is totally dependent on a downstream splicing enhancer containingmultiple potential ASF/SF2 binding sites. Here weshow that only one of the predicted ASF/SF2 sites accounts for the majority of the enhancer activity. We demonstrate that single nucleotide substitutions in this predicted ASF/SF2 site impair enhancer function and that this correlates with less efficient binding to ASF/SF2 in vitro. We provide evidence that HPV-16 mRNAs that arespliced to SA3358 interact with ASF/SF2 in living cells. In addition,mutational inactivation of the ASF/SF2 site weakened the enhancer at SA3358 in episomal forms of the HPV-16 genome, indicating that the enhancer is active in the context of the full HPV-16 genome.This resulted in induction of HPV-16 late gene expression as a result of competition from late splice site SA5639. Furthermore, inactivation of the ASF/SF2 site of the SA3358 splicing enhancer reduced the ability of E6- and E7-encoding HPV-16 plasmids to increase the life span of primary keratinocytes in vitro, demonstrating arequirement for an intact splicing enhancer of SA3358 forefficient production of the E6 and E7 mRNAs. These results link the strength of the HPV-16 SA3358 splicing enhancer to expression of E6 and E7 and to the pathogenic properties of HPV-16. PMID:24039800
Ito, M; Mori, Y; Oiso, Y; Saito, H
1991-01-01
To elucidate the molecular mechanism of familial central diabetes insipidus (FDI), we sequenced the arginine vasopressin-neurophysin II (AVP-NPII) gene in 2 patients belonging to a pedigree that is consistent with an autosomal dominant mode of inheritance. 10 patients with idiopathic central diabetes insipidus (IDI) and 5 normals were also studied. The AVP-NPII gene, locating on chromosome 20, consists of three exons that encode putative signal peptide, AVP, NPII, and glycoprotein. Using polymerase chain reaction, fragments including the promoter region and all coding regions were amplified from genomic DNA and subjected to direct sequencing. Sequences of 10 patients with IDI were identical with those of normals, while in 2 patients with FDI, a single base substitution was detected in one of two alleles of the AVP-NPII gene, indicating they were heterozygotes for this mutation. It was a G----A transition at nucleotide position 1859 in the second exon, resulting in a substitution of Gly for Ser at amino acid position 57 in the NPII moiety. It was speculated that the mutated AVP-NPII precursor or the mutated NPII molecule, through their conformational changes, might be responsible for AVP deficiency. Images PMID:1840604
Nucleotide Intermediates in the Biosynthesis of Heteropolymeric Polysaccharides
Strominger, Jack L.
1964-01-01
The role of nucleotides as “carriers” of small molecules for biosynthetic reactions is discussed. Following this introduction, the particular problem of nucleotide intermediates in chondroitin sulfate synthesis is presented. The egg shell of the hen contains a form of chondroitin sulfate and particular emphasis is placed on the biosynthesis of sulfated polysaccharides in the hen oviduct, which has been studied in the author's laboratory. ImagesFigure 16Figure 19 PMID:14104074
Nucleotide sequences specific to Brucella and methods for the detection of Brucella
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L
Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
[Association between single-nucleotide polymorphisms in the IRAK-4 gene and allergic rhinitis].
Zhang, Yuan; Xi, Lin; Zhao, Yan-ming; Zhao, Li-ping; Zhang, Luo
2012-06-01
To investigate the genetic association pattern between single-nucleotide polymorphisms (SNP) in the interleukin-1 receptor-associated kinase 4 (IRAK-4) gene and allergic rhinitis (AR). A population of 379 patients with the diagnosis of AR and 333 healthy controls who lived in Beijing region was recruited. A total of 8 reprehensive marker SNP which were in IRAK-4 gene region were selected according to the Beijing people database from Hapmap website. The individual genotyping was performed by MassARRAY platform. SPSS 13.0 software was used for statistic analysis. Subgroup analysis for the presence of different allergen sensitivities displayed associations only in the house dust mite-allergic cohorts (rs3794262: P = 0.0034, OR = 1.7388; rs4251481: P = 0.0023, OR = 2.6593), but not in subjects who were allergic to pollens as well as mix allergens. The potential genetic contribution of the IRAK-4 gene to AR demonstrated an allergen-dependant association pattern in Chinese population.
A movie of the RNA polymerase nucleotide addition cycle.
Brueckner, Florian; Ortiz, Julio; Cramer, Patrick
2009-06-01
During gene transcription, RNA polymerase (Pol) passes through repetitive cycles of adding a nucleotide to the growing mRNA chain. Here we obtained a movie of the nucleotide addition cycle by combining structural information on different functional states of the Pol II elongation complex (EC). The movie illustrates the two-step loading of the nucleoside triphosphate (NTP) substrate, closure of the active site for catalytic nucleotide incorporation, and the presumed two-step translocation of DNA and RNA, which is accompanied by coordinated conformational changes in the polymerase bridge helix and trigger loop. The movie facilitates teaching and a mechanistic analysis of transcription and can be downloaded from http://www.lmb.uni-muenchen.de/cramer/pr-materials.
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G
2008-04-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.
2008-01-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283
The substitutability of reinforcers.
Green, Leonard; Freed, Debra E
1993-07-01
Substitutability is a construct borrowed from microeconomics that describes a continuum of possible interactions among the reinforcers in a given situation. Highly substitutable reinforcers, which occupy one end of the continuum, are readily traded for each other due to their functional similarity. Complementary reinforcers, at the other end of the continuum, tend to be consumed jointly in fairly rigid proportion, and therefore cannot be traded for one another except to achieve that proportion. At the center of the continuum are reinforcers that are independent with respect to each other; consumption of one has no influence on consumption of another. Psychological research and analyses in terms of substitutability employ standard operant conditioning paradigms in which humans and nonhumans choose between alternative reinforcers. The range of reinforcer interactions found in these studies is more readily accommodated and predicted when behavior-analytic models of choice consider issues of substitutability. New insights are gained into such areas as eating and drinking, electrical brain stimulation, temporal separation of choice alternatives, behavior therapy, drug use, and addictions. Moreover, the generalized matching law (Baum, 1974) gains greater explanatory power and comprehensiveness when measures of substitutability are included.
The substitutability of reinforcers
Green, Leonard; Freed, Debra E.
1993-01-01
Substitutability is a construct borrowed from microeconomics that describes a continuum of possible interactions among the reinforcers in a given situation. Highly substitutable reinforcers, which occupy one end of the continuum, are readily traded for each other due to their functional similarity. Complementary reinforcers, at the other end of the continuum, tend to be consumed jointly in fairly rigid proportion, and therefore cannot be traded for one another except to achieve that proportion. At the center of the continuum are reinforcers that are independent with respect to each other; consumption of one has no influence on consumption of another. Psychological research and analyses in terms of substitutability employ standard operant conditioning paradigms in which humans and nonhumans choose between alternative reinforcers. The range of reinforcer interactions found in these studies is more readily accommodated and predicted when behavior-analytic models of choice consider issues of substitutability. New insights are gained into such areas as eating and drinking, electrical brain stimulation, temporal separation of choice alternatives, behavior therapy, drug use, and addictions. Moreover, the generalized matching law (Baum, 1974) gains greater explanatory power and comprehensiveness when measures of substitutability are included. PMID:16812696
NASA Astrophysics Data System (ADS)
Mishra, Vinod Kumar
2017-09-01
In this paper we develop an inventory model, to determine the optimal ordering quantities, for a set of two substitutable deteriorating items. In this inventory model the inventory level of both items depleted due to demands and deterioration and when an item is out of stock, its demands are partially fulfilled by the other item and all unsatisfied demand is lost. Each substituted item incurs a cost of substitution and the demands and deterioration is considered to be deterministic and constant. Items are order jointly in each ordering cycle, to take the advantages of joint replenishment. The problem is formulated and a solution procedure is developed to determine the optimal ordering quantities that minimize the total inventory cost. We provide an extensive numerical and sensitivity analysis to illustrate the effect of different parameter on the model. The key observation on the basis of numerical analysis, there is substantial improvement in the optimal total cost of the inventory model with substitution over without substitution.
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...
Statistical Physics of Complex Substitutive Systems
NASA Astrophysics Data System (ADS)
Jin, Qing
Diffusion processes are central to human interactions. Despite extensive studies that span multiple disciplines, our knowledge is limited to spreading processes in non-substitutive systems. Yet, a considerable number of ideas, products, and behaviors spread by substitution; to adopt a new one, agents must give up an existing one. This captures the spread of scientific constructs--forcing scientists to choose, for example, a deterministic or probabilistic worldview, as well as the adoption of durable items, such as mobile phones, cars, or homes. In this dissertation, I develop a statistical physics framework to describe, quantify, and understand substitutive systems. By empirically exploring three collected high-resolution datasets pertaining to such systems, I build a mechanistic model describing substitutions, which not only analytically predicts the universal macroscopic phenomenon discovered in the collected datasets, but also accurately captures the trajectories of individual items in a complex substitutive system, demonstrating a high degree of regularity and universality in substitutive systems. I also discuss the origins and insights of the parameters in the substitution model and possible generalization form of the mathematical framework. The systematical study of substitutive systems presented in this dissertation could potentially guide the understanding and prediction of all spreading phenomena driven by substitutions, from electric cars to scientific paradigms, and from renewable energy to new healthy habits.
Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.
Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O
1987-06-01
The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.
Yasukochi, Yoshiki; Satta, Yoko
2014-05-02
An extraordinary diversity of amino acid sequences in the peptide-binding region (PBR) of human leukocyte antigen [HLA; human major histocompatibility complex (MHC)] molecules has been maintained by balancing selection. The process of accumulation of amino acid diversity in the PBR for six HLA genes (HLA-A, B, C, DRB1, DQB1, and DPB1) shows that the number of amino acid substitutions in the PBR among alleles does not linearly correlate with the divergence time of alleles at the six HLA loci. At these loci, some pairs of alleles show significantly less nonsynonymous substitutions at the PBR than expected from the divergence time. The same phenomenon was observed not only in the HLA but also in the rat MHC. To identify the cause for this, DRB1 sequences, a representative case of a typical nonlinear pattern of substitutions, were examined. When the amino acid substitutions in the PBR were placed with maximum parsimony on a maximum likelihood tree based on the non-PBR substitutions, heterogeneous rates of nonsynonymous substitutions in the PBR were observed on several branches. A computer simulation supported the hypothesis that allelic pairs with low PBR substitution rates were responsible for the stagnation of accumulation of PBR nonsynonymous substitutions. From these observations, we conclude that the nonsynonymous substitution rate at the PBR sites is not constant among the allelic lineages. The deceleration of the rate may be caused by the coexistence of certain pathogens for a substantially long time during HLA evolution. Copyright © 2014 Yasukochi and Satta.
Li, M-H; Tiirikka, T; Kantanen, J
2014-01-01
In sheep, coat colour (and pattern) is one of the important traits of great biological, economic and social importance. However, the genetics of sheep coat colour has not yet been fully clarified. We conducted a genome-wide association study of sheep coat colours by genotyping 47 303 single-nucleotide polymorphisms (SNPs) in the Finnsheep population in Finland. We identified 35 SNPs associated with all the coat colours studied, which cover genomic regions encompassing three known pigmentation genes (TYRP1, ASIP and MITF) in sheep. Eighteen of these associations were confirmed in further tests between white versus non-white individuals, but none of the 35 associations were significant in the analysis of only non-white colours. Across the tests, the s66432.1 in ASIP showed significant association (P=4.2 × 10−11 for all the colours; P=2.3 × 10−11 for white versus non-white colours) with the variation in coat colours and strong linkage disequilibrium with other significant variants surrounding the ASIP gene. The signals detected around the ASIP gene were explained by differences in white versus non-white alleles. Further, a genome scan for selection for white coat pigmentation identified a strong and striking selection signal spanning ASIP. Our study identified the main candidate gene for the coat colour variation between white and non-white as ASIP, an autosomal gene that has been directly implicated in the pathway regulating melanogenesis. Together with ASIP, the two other newly identified genes (TYRP1 and MITF) in the Finnsheep, bordering associated SNPs, represent a new resource for enriching sheep coat-colour genetics and breeding. PMID:24022497
Dietary nucleotides and early growth in formula-fed infants: a randomized controlled trial.
Singhal, Atul; Kennedy, Kathy; Lanigan, J; Clough, Helen; Jenkins, Wendy; Elias-Jones, Alun; Stephenson, Terrence; Dudek, Peter; Lucas, Alan
2010-10-01
Dietary nucleotides are nonprotein nitrogenous compounds that are found in high concentrations in breast milk and are thought to be conditionally essential nutrients in infancy. A high nucleotide intake has been suggested to explain some of the benefits of breastfeeding compared with formula feeding and to promote infant growth. However, relatively few large-scale randomized trials have tested this hypothesis in healthy infants. We tested the hypothesis that nucleotide supplementation of formula benefits early infant growth. Occipitofrontal head circumference, weight, and length were assessed in infants who were randomly assigned to groups fed nucleotide-supplemented (31 mg/L; n=100) or control formula without nucleotide supplementation (n=100) from birth to the age of 20 weeks, and in infants who were breastfed (reference group; n=101). Infants fed with nucleotide-supplemented formula had greater occipitofrontal head circumference at ages 8, 16, and 20 weeks than infants fed control formula (mean difference in z scores at 8 weeks: 0.4 [95% confidence interval: 0.1-0.7]; P=.006) even after adjustment for potential confounding factors (P=.002). Weight at 8 weeks and the increase in both occipitofrontal head circumference and weight from birth to 8 weeks were also greater in infants fed nucleotide-supplemented formula than in those fed control formula. Our data support the hypothesis that nucleotide supplementation leads to increased weight gain and head growth in formula-fed infants. Therefore, nucleotides could be conditionally essential for optimal infant growth in some formula-fed populations. Additional research is needed to test the hypothesis that the benefits of nucleotide supplementation for early head growth, a critical period for brain growth, have advantages for long-term cognitive development.
Erhardt, Georg; Shuiep, El Tahir Salih; Lisson, Maria; Weimann, Christina; Wang, Zhaoxin; El Zubeir, Ibtisam El Yas Mohamed; Pauciullo, Alfredo
2016-06-01
Milk samples of 193 camels (Camelus dromedarius) from different regions of Sudan were screened for casein variability by isoelectric focusing. Kappa-casein and beta-casein were monomorphic, whereas three protein patterns named αs1-casein A, C, and D were identified. The major allele A revealed frequencies of 0.79 (Lahaoi), 0.75 (Shanbali), 0.90 (Arabi Khali), and 0.88 (Arabi Gharbawi) in the different ecotypes. CSN1S1*C shows a single G > T nucleotide substitution in the exon 5, leading to a non-synonymous amino acid exchange (p.Glu30 > Asp30) in comparison to CSN1S1*A and D. At cDNA level, no further single nucleotide polymorphisms could be identified in CSN1S1* A, C, and D, whereas the variants CSN1S1*A and CSN1S1*C are characterized by missing of exon 18 compared to the already described CSN1S1*B, as consequence of DNA insertion of 11 bp at intron 17 which alter the pre-mRNA spliceosome machinery. A polymerase chain-restriction fragment length polymorphism method (PCR-RFLP) was established to type for G > T nucleotide substitution at genomic DNA level. The occurrence and differences of IgE-binding epitopes and bioactive peptides between αs1-casein A, C, and D after digestion were analyzed in silico. The amino acid substitutions and deletion affected the arising peptide pattern and thus modifications between IgE-binding epitopes and bioactive peptides of the variants were found. The allergenic potential of these different peptides will be investigated by microarray immunoassay using sera from milk-sensitized individuals, as it was already demonstrated for bovine αs1-casein variants.
Hasebe, Chitomi; Osaki, Yukio; Joko, Kouji; Yagisawa, Hitoshi; Sakita, Shinya; Okushin, Hiroaki; Satou, Takashi; Hisai, Hiroyuki; Abe, Takehiko; Tsuji, Keiji; Tamada, Takashi; Kobashi, Haruhiko; Mitsuda, Akeri; Ide, Yasushi; Ogawa, Chikara; Tsuruta, Syotaro; Takaguchi, Kouichi; Murakawa, Miyako; Asahina, Yasuhiro; Enomoto, Nobuyuki; Izumi, Namiki
2016-01-01
Backgrounds & Aims We aimed to clarify the characteristics of resistance-associated substitutions (RASs) after treatment failure with NS5A inhibitor, daclatasvir (DCV) in combination with NS3/4A inhibitor, asunaprevir (ASV), in patients with chronic hepatitis C virus genotype 1b infection. Methods This is a nationwide multicenter study conducted by the Japanese Red Cross Liver Study Group. The sera were obtained from 68 patients with virological failure after 24 weeks of DCV/ASV treatment. RASs in NS5A and NS3 were determined by population sequencing. Results The frequency of signature RASs at position D168 of NS3 was 68%, and at positions L31 and Y93 of NS5A was 79 and 76%, respectively. The frequency of dual signature RASs in NS5A (L31-RAS and Y93-RAS) was 63%. RASs at L28, R30, P32, Q54, P58, and A92 in addition to dual signature RAS were detected in 5, 5, 1, 22, 2, and 0 patients, respectively. In total, triple, quadruple, and quintuple RASs in combination with dual signature RAS were detected in 35, 10, and 1.5% patients, respectively. These RASs were detected in patients without baseline RASs or who prematurely discontinued therapy. Co-existence of D168 RAS in NS3 and L31 and/or Y93 RAS in NS5A was observed in 62% of patients. Conclusion Treatment-emergent RASs after failure with DCV/ASV combination therapy are highly complex in more than 50% of the patients. The identification of complex RAS patterns, which may indicate high levels of resistance to NS5A inhibitors, highlights the need for RAS sequencing when considering re-treatment with regimens including NS5A inhibitors. PMID:27776192
Khrustaleva, A M; Gritsenko, O F; Klovach, N V
2013-11-01
The genetic polymorphism of 45 single-nucleotide polymorphism loci was examined in the four largest wild populations of sockeye salmon Oncorhynchusnerka from drainages of the Asian coast of the Pacific Ocean (Eastern and Western Kamchatka). It was demonstrated that sockeye salmon from the Palana River were considerably different from all other populations examined. The most probable explanation of the observed differences is the suggestion on possible demographic events in the history of this population associated with the decrease in its effective number. To study the origin, colonization patterns, and evolution of Asian sockeye salmon, as well as to resolve some of the applied tasks, like population assignment and genetic identification, a differentiation approach to SNP-marker selection was suggested. Adaptively important loci that evolve under the pressure of balancing (stabilizing) selection were identified, thanks to which the number of loci that provide the baseline classification error rates in the population assignment tests was reduced to 30. It was demonstrated that SNPs located in the MHC2 and GPH genes were affected by diversifying selection. Procedures for selecting single-nucleotide polymorphisms for phylogenetic studies of Asian sockeye salmon were suggested. Using principal-component analysis, 17 loci that adequately reproduce genetic differentiation within arid among the regions of the origin of Kamchatka sockeye salmon, were selected.
Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa
2013-06-01
Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and
Biologic and synthetic skin substitutes: An overview
Halim, Ahmad Sukari; Khoo, Teng Lye; Mohd. Yussof, Shah Jumaat
2010-01-01
The current trend of burn wound care has shifted to more holistic approach of improvement in the long-term form and function of the healed burn wounds and quality of life. This has demanded the emergence of various skin substitutes in the management of acute burn injury as well as post burn reconstructions. Skin substitutes have important roles in the treatment of deep dermal and full thickness wounds of various aetiologies. At present, there is no ideal substitute in the market. Skin substitutes can be divided into two main classes, namely, biological and synthetic substitutes. The biological skin substitutes have a more intact extracellular matrix structure, while the synthetic skin substitutes can be synthesised on demand and can be modulated for specific purposes. Each class has its advantages and disadvantages. The biological skin substitutes may allow the construction of a more natural new dermis and allow excellent re-epithelialisation characteristics due to the presence of a basement membrane. Synthetic skin substitutes demonstrate the advantages of increase control over scaffold composition. The ultimate goal is to achieve an ideal skin substitute that provides an effective and scar-free wound healing. PMID:21321652
Simvastatin-lnduced nocturnal leg pain disappears with pravastatin substitution.
Stojaković, Natasa; Igić, Rajko
2013-01-01
Statins have similar side effects that do not always occur at the same rate among the various statins. We present a case of simvastatin-induced muscle toxicity that disappeared when pravastatin was substituted for the original drug. A 74-year-old male, a nonsmoker, complained of severe nocturnal leg cramps. The patient also complained that similar painful cramping occurred when he walked rapidly or jogged. Because some components of his lipid panel exceeded the'desirable' range, and as he had a history of myocardial infarction, his family physician prescribed simvastatin (40 mg/day). The patient had taken this medication for the past eight years. The painful nocturnal episodes started two years ago and affected either one or the other leg. Four months ago we discontinued his simvastatin and prescribed pravastatin (80 mg/day). At a follow-up visit six weeks later, the patient reported that his leg pains at night and the pain experienced after brisk walking had disappeared. Four months after the substitution of pravastatin for simvastatin, the patient reported that his complete lack of symptoms had continued. These painful muscle cramps were probably caused by an inadequate vascular supply to the calf and foot muscles. Perhaps a combination of advanced age and atherosclerotic changes created a predisposition for the simvastatin-induced leg cramps. Pravastatin differs from simvastatin in several ways.l It is not metabolized by cytochrome P450 (CYP) 3A4 oxidases, and thus is not influenced by CYP 3A4 inhibitors like simvastatin. Also, simvastatin is associated with single-nucleotide polymorphisms located within the SLCO1B1 gene on the chromosome 12 and established myopathy, while pravastatin lacks this association. These differences may contribute to increased tolerance to pravastatin in this particular case.
Rodrigue, Nicolas; Lartillot, Nicolas
2017-01-01
Codon substitution models have traditionally attempted to uncover signatures of adaptation within protein-coding genes by contrasting the rates of synonymous and non-synonymous substitutions. Another modeling approach, known as the mutation-selection framework, attempts to explicitly account for selective patterns at the amino acid level, with some approaches allowing for heterogeneity in these patterns across codon sites. Under such a model, substitutions at a given position occur at the neutral or nearly neutral rate when they are synonymous, or when they correspond to replacements between amino acids of similar fitness; substitutions from high to low (low to high) fitness amino acids have comparatively low (high) rates. Here, we study the use of such a mutation-selection framework as a null model for the detection of adaptation. Following previous works in this direction, we include a deviation parameter that has the effect of capturing the surplus, or deficit, in non-synonymous rates, relative to what would be expected under a mutation-selection modeling framework that includes a Dirichlet process approach to account for across-codon-site variation in amino acid fitness profiles. We use simulations, along with a few real data sets, to study the behavior of the approach, and find it to have good power with a low false-positive rate. Altogether, we emphasize the potential of recent mutation-selection models in the detection of adaptation, calling for further model refinements as well as large-scale applications. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Nutrient intake disparities in the US: modeling the effect of food substitutions.
Conrad, Zach; Johnson, LuAnn K; Roemmich, James N; Juan, WenYen; Jahns, Lisa
2018-05-17
Diet quality among federal food assistance program participants remains low, and little research has assessed the diet quality of food insecure non-participants. Further research is needed to assess the extent to which food substitutions can improve the nutritional status of these vulnerable populations. Substituting egg dishes for other commonly consumed dishes at certain eating occasions may be an effective strategy for improving the daily nutrient intake among these groups. Eggs are rich in many important nutrients, and are low-cost and part of a wide range of cultural food menus, which are important considerations for low-income and ethnically diverse populations. To help guide the focus of targeted nutrition interventions and education campaigns for vulnerable populations, the present work begins by 1) estimating the prevalence of nutrient inadequacy among these groups, and then models the effect of consuming egg dishes instead of commonly consumed dishes at each eating occasion on 2) the prevalence of nutrient inadequacy, and 3) the mean intake of nutrients. Dietary data from 34,741 adults ≥ 20 y were acquired from the National Health and Nutrition Examination Survey, 2001-2014. Diet pattern modeling was used to substitute commonly consumed egg dishes for commonly consumed main dishes at breakfast, lunch, and dinner. National Cancer Institute usual intake methods were used to estimate the prevalence of inadequate intake of 31 nutrients pre- and post-substitution, and a novel index was used to estimate change in intake of all nutrients collectively. Substituting eggs for commonly consumed main dishes at lunch or dinner did not change total daily nutrient intake for each group (P > 0.05), but decreased the prevalence of vitamin D inadequacy by 1-4 percentage points (P < 0.01). Substituting eggs for commonly consumed foods at breakfast increased the prevalence of folate inadequacy by 8-12 percentage points among each group (P < 0.01). When making
Structural and magnetic behavior of (Ni, Cu) substituted Nd0.67Sr0.33MnO3 perovskite compounds
NASA Astrophysics Data System (ADS)
Arun, B.; Sudakshina, B.; Akshay, V. R.; Chandrasekhar, K. Devi; Yang, H. D.; Vasundhara, M.
2018-05-01
Structural and magnetic phase transition of Ni and Cu substituted Nd0.67Sr0.33MnO3 perovskite compounds have been investigated. The Rietveld refinement of X-ray powder diffraction patterns confirms that both compounds have crystallized into an orthorhombic structure with Pbnm space group same as that of Nd0.67Sr0.33MnO3 compound. X-ray absorption spectra studies completely ruled out the possibility of existence of any impurities. Both compounds do not obey the Curie-Weiss law indicates the presence of some ferromagnetic clusters within the paramagnetic matrix. Ni substituted compound shows a lower value of TC and Cu substituted compound shows a higher value of TC than that of the parent. Non-saturating tendency of magnetization is more prominently seen in the case of Cu substituted compound, indicating an increase in the AFM component.
Free amino acids and 5'-nucleotides in Finnish forest mushrooms.
Manninen, Hanna; Rotola-Pukkila, Minna; Aisala, Heikki; Hopia, Anu; Laaksonen, Timo
2018-05-01
Edible mushrooms are valued because of their umami taste and good nutritional values. Free amino acids, 5'-nucleotides and nucleosides were analyzed from four Nordic forest mushroom species (Lactarius camphoratus, Boletus edulis, Cantharellus cibarius, Craterellus tubaeformis) using high precision liquid chromatography analysis. To our knowledge, these taste components were studied for the first time from Craterellus tubaeformis and Lactarius camphoratus. The focus was on the umami amino acids and 5'-nucleotides. The free amino acid and 5'-nucleotide/nucleoside contents of studied species differed from each other. In all studied samples, umami amino acids were among five major free amino acids. The highest concentration of umami amino acids was on L. camphoratus whereas B. edulis had the highest content of sweet amino acids and C. cibarius had the highest content of bitter amino acids. The content of umami enhancing 5'-nucleotides were low in all studied species. Copyright © 2017 Elsevier Ltd. All rights reserved.
Patterns of homoeologous gene expression shown by RNA sequencing in hexaploid bread wheat
2014-01-01
Background Bread wheat (Triticum aestivum) has a large, complex and hexaploid genome consisting of A, B and D homoeologous chromosome sets. Therefore each wheat gene potentially exists as a trio of A, B and D homoeoloci, each of which may contribute differentially to wheat phenotypes. We describe a novel approach combining wheat cytogenetic resources (chromosome substitution ‘nullisomic-tetrasomic’ lines) with next generation deep sequencing of gene transcripts (RNA-Seq), to directly and accurately identify homoeologue-specific single nucleotide variants and quantify the relative contribution of individual homoeoloci to gene expression. Results We discover, based on a sample comprising ~5-10% of the total wheat gene content, that at least 45% of wheat genes are expressed from all three distinct homoeoloci. Most of these genes show strikingly biased expression patterns in which expression is dominated by a single homoeolocus. The remaining ~55% of wheat genes are expressed from either one or two homoeoloci only, through a combination of extensive transcriptional silencing and homoeolocus loss. Conclusions We conclude that wheat is tending towards functional diploidy, through a variety of mechanisms causing single homoeoloci to become the predominant source of gene transcripts. This discovery has profound consequences for wheat breeding and our understanding of wheat evolution. PMID:24726045
Generic substitution of antiepileptic drugs.
Sander, Josemir W; Ryvlin, Philippe; Stefan, Hermann; Booth, Daniel R; Bauer, Jürgen
2010-12-01
Substitution of antiepileptic drugs with generic formulations may affect individual people, as well as healthcare systems. Analyses of large medical claims databases suggest that generic substitution of antiepileptic drugs is associated with increased morbidity and greater use of healthcare resources. While a single brand-to-generic switch may be associated with a slight increase in overall medical costs, multiple switches may be associated with higher costs, perhaps because different generic agents are not required to be bioequivalent to each other. Generic substitution also affects the individual: along with the possible increased risk of seizures or adverse events, inconsistency of supply may make the medication appear unfamiliar, thus discouraging adherence. Importantly, substitution is often carried out at the dispensing level, without the knowledge or consent of physicians and affected individuals. Therefore, regulatory and professional bodies advocate that substitution should not be carried out without specific counseling of the individual by healthcare professionals on the details and implications of the change.
Explicit Substitutions and All That
NASA Technical Reports Server (NTRS)
Ayala-Rincon, Mauricio; Munoz, Cesar
2000-01-01
Explicit substitution calculi are extensions of the lambda-calculus where the substitution mechanism is internalized into the theory. This feature makes them suitable for implementation and theoretical study of logic-based tools such as strongly typed programming languages and proof assistant systems. In this paper we explore new developments on two of the most successful styles of explicit substitution calculi: the lambda sigma- and lambda S(e)-calculi.
Explicit Substitutions and All That
NASA Technical Reports Server (NTRS)
Ayala-Rincon, Mauricio; Munoz, Cesar; Busnell, Dennis M. (Technical Monitor)
2000-01-01
Explicit substitution calculi are extensions of the Lambda-calculus where the substitution mechanism is internalized into the theory. This feature makes them suitable for implementation and theoretical study of logic-based tools such as strongly typed programming languages and proof assistant systems. In this paper we explore new developments on two of the most successful styles of explicit substitution calculi: the lambda(sigma)- and lambda(s(e))-calculi.
Why does trigonometric substitution work?
NASA Astrophysics Data System (ADS)
Cunningham, Daniel W.
2018-05-01
Modern calculus textbooks carefully illustrate how to perform integration by trigonometric substitution. Unfortunately, most of these books do not adequately justify this powerful technique of integration. In this article, we present an accessible proof that establishes the validity of integration by trigonometric substitution. The proof offers calculus instructors a simple argument that can be used to show their students that trigonometric substitution is a valid technique of integration.
First quadruple-glycine bridging mono-lanthanide-substituted borotungstate hybrids.
Liu, Jiancai; Yu, Jing; Han, Qing; Wen, Yue; Chen, Lijuan; Zhao, Junwei
2016-10-18
A class of novel organic-inorganic hybrid lanthanide (Ln)-substituted Keggin-type borotungstates K 4 Na 4 H 4 [Ln 2 (gly) 4 (α-BW 11 O 39 ) 2 ]·23H 2 O [Ln = Ce 3+ (1), Pr 3+ (2), Nd 3+ (3), Sm 3+ (4), Eu 3+ (5), Tm 3+ (6); gly = glycine] have been synthesized from the reaction of K 8 [BW 11 O 39 H]·13H 2 O, NaAc·6H 2 O and Ln(NO 3 ) 3 ·6H 2 O by employing gly ligands as structure-stabilizing agents in the conventional aqueous solution system and structurally characterized by elemental analyses, IR spectroscopy, thermogravimetric (TG) analyses, powder X-ray diffraction (PXRD) and single-crystal X-ray diffraction. The common prominent structural feature of isomorphic 1-6 is that all of them consist of two mono-Ln-substituted Keggin [Ln(α-BW 11 O 39 )] 6- fragments linked by four gly ligands, furnishing an intriguing dimeric assembly of the quadruple-gly-connective mono-Ln-substituted borotungstate, in which each carboxylic oxygen atom from gly ligands is bound to Ln 3+ cations in the μ 2 -O or μ 3 -O mode. To the best of our knowledge, 1-6 represent the first examples of inorganic-organic hybrid Ln-substituted borotungstates functionalized by quadruple amino acid bridges. The solid-state photoluminescence properties of 3-5 have been determined at ambient temperature and the photoluminescence emission spectra exhibit the characteristic emission bands derived from Ln 3+ centers. The thermostability of 1-6 has been studied and the thermal decomposition procedure of 3 has been comprehensively investigated with the assistance of variable-temperature PXRD patterns and variable-temperature IR spectra. Furthermore, magnetic susceptibility measurements of 1, 2 and 4 have been conducted.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Xinsheng, E-mail: xzhang@iavi.org; Molecular and Cellular Biology Program, State University of New York, Brooklyn, NY; Wallace, Olivia L.
Serum was analyzed from 146 healthy adult volunteers in eastern Africa to evaluate measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb) prevalence and potency. MV plaque reduction neutralization test (PRNT) results indicated that all sera were positive for MV nAbs. Furthermore, the 50% neutralizing dose (ND50) for the majority of sera corresponded to antibody titers induced by MV vaccination. CDV nAbs titers were low and generally were detected in sera with high MV nAb titers. A mutant CDV was generated that was less sensitive to neutralization by human serum. The mutant virus genome had 10 nucleotide substitutions,more » which coded for single amino acid substitutions in the fusion (F) and hemagglutinin (H) glycoproteins and two substitutions in the large polymerase (L) protein. The H substitution occurred in a conserved region involved in receptor interactions among morbilliviruses, implying that this region is a target for cross-reactive neutralizing antibodies. - Highlights: • Screened 146 serum samples for measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb). • MV nAb is prevalent in the sera. • CDV neutralizing activity is generally low or absent and when detected it is present in sera with high MV nAb titers. • A neutralization-resistant CDV mutant was isolated using human serum selection. • A mutation was identified in the receptor-binding region of CDV hemagglutinin protein that confers the neutralization resistance.« less
Badiuzzaman, Pierre; McLaughlin, Eoin; McCauley, Darren
2017-12-01
While the sustainability of resource depletion is a longstanding environmental concern, wider attention has recently been given to growing water scarcity and groundwater depletion. This study seeks to test the substitutability assumption embedded in weak sustainability indicators using a case study of Californian water supply. The volume of groundwater depletion is used as a proxy for unsustainable water consumption, and defined by synthesising existing research estimates into low, medium and high depletion baselines. These are compared against projected water supply increases from ocean desalination and water recycling by 2035, to determine whether new, drought-proof water sources can substitute for currently unsustainable groundwater consumption. Results show that the maximum projected supply of new water, 2.47 million acre-feet per year (MAF/yr), is sufficient to meet low depletion estimates of 2.02 MAF/yr, but fails to come near the high depletion estimate of 3.44 MAF/yr. This does not necessarily indicate physical limitations of substitutability, but more so socio-economic limitations influenced by high comparative costs. By including capacities in demand-substitutability via urban water conservation, maximum predicted capacities reach 5.57 MAF/yr, indicating wide room for substitution. Based on these results, investment in social and institutional capital is an important factor to enhance demand-side substitutability of water and other natural resources, which has been somewhat neglected by the literature on the substitutability of natural resources. Copyright © 2017 Elsevier Ltd. All rights reserved.
ERIC Educational Resources Information Center
Russo, Alexander
2001-01-01
School leaders are trying pay incentives, consortia, and temp firms to assuage their need for qualified substitute teachers. Five coping strategies include making the job more attractive, increasing the candidate pool, hiring some permanent subs, using automated calling systems, and examining systemic issues. Substitutes are unionizing in some…
Some parameters relevant to affinity chromatography on immobilized nucleotides
Lowe, C. R.; Harvey, M. J.; Craven, D. B.; Dean, P. D. G.
1973-01-01
1. The suitability of cellulose and Sepharose as supports for affinity chromatography of two groups of cofactor-linked enzymes, dehydrogenases and kinases, was examined. Sepharose was found to be superior. 2. The selective capacities of the columns were measured by frontal analysis and are discussed in relation to the nucleotide contents. 3. The effect of various concentrations of enzyme and of non-specific protein on the performance of the affinity columns, and the effects of equilibration time, flow rate, sample volume and dilution of the nucleotide were examined. 4. The effect of interposing polymethylene and polyglycine extension arms between the matrix backbone and the nucleotide was investigated for several cofactor-dependent enzymes. Maximum binding was observed with an extension arm 0.8–1nm long. PMID:4354739
Guilfoyle, Amy P; Deshpande, Chandrika N; Schenk, Gerhard; Maher, Megan J; Jormakka, Mika
2014-12-12
GDP release from GTPases is usually extremely slow and is in general assisted by external factors, such as association with guanine exchange factors or membrane-embedded GPCRs (G protein-coupled receptors), which accelerate the release of GDP by several orders of magnitude. Intrinsic factors can also play a significant role; a single amino acid substitution in one of the guanine nucleotide recognition motifs, G5, results in a drastically altered GDP release rate, indicating that the sequence composition of this motif plays an important role in spontaneous GDP release. In the present study, we used the GTPase domain from EcNFeoB (Escherichia coli FeoB) as a model and applied biochemical and structural approaches to evaluate the role of all the individual residues in the G5 loop. Our study confirms that several of the residues in the G5 motif have an important role in the intrinsic affinity and release of GDP. In particular, a T151A mutant (third residue of the G5 loop) leads to a reduced nucleotide affinity and provokes a drastically accelerated dissociation of GDP.
Patterson, D G; Todd, G D; Turner, W E; Maggio, V; Alexander, L R; Needham, L L
1994-01-01
We have measured non-ortho-substituted (coplanar) polychlorinated biphenyl (PCB) levels as well as polychlorinated dibenzo-p-dioxin (PCDD) and polychlorinated dibenzofuran (PCDF) levels in human adipose tissue and serum collected in Atlanta, Georgia. The results show that the concentrations of the coplanar PCBs can be more than an order of magnitude higher than the concentrations of 2,3,7,8-tetrachlorodibenzo-p-dioxin. Our measurements in pooled serum collected in 1982, 1988, and 1989 show a decrease in coplanar PCB levels from 1982 to 1989. We found that the pattern of relative amounts of coplanar PCBs in adipose tissue varied greatly from person to person unlike the PCDD and PCDF patterns, which were more nearly the same. Age was significantly correlated with the concentrations of 2,3,7,8-TCDD,3,3'4,4'-PCB, 3,3',4,4',5-PCB, and 3,3'4,4',5,5'-PCB in adipose tissue. We also measured levels of the mono- and di-ortho chlorine-substituted PCBs in human serum. The levels for some of these PCB congeners were three orders of magnitude higher than the coplanar PCBs, PCDDs, and PCDFs. We used the international toxicity equivalency factors (TEFs) for PCDDs and PCDFs and the TEFs proposed by Safe for PCBs to calculate the 2,3,7,8-TCDD equivalents. Four PCBs (3,3',4,4',5-; 2,3',4,4',5-;2,3,3',4,4'-;2,3,3',4,4',5-) make a larger contribution than 2,3,7,8-TCDD, while four other PCBs (3,3',4,4'5,5'-; 2,2',3,4,4',5'-;2,2',4,4',5,5'-;2,2',3,4,4',5,5'-) make nearly the same contribution as 2,3,7,8-TCDD. The mono-ortho-chlorine-substituted 2,3',4,4',5-PCB, however, is the major contributor to the total 2,3,7,8-TCDD equivalents in general population samples from the United States, Sweden, and Japan.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8187709
Brillouin function characteristics for La-Co substituted barium hexaferrites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Chuanjian, E-mail: wcjuestc2005@gmail.com, E-mail: ksun@uestc.edu.cn; Yu, Zhong; Sun, Ke, E-mail: wcjuestc2005@gmail.com, E-mail: ksun@uestc.edu.cn
2015-09-14
La-Co substituted barium hexaferrites with the chemical formula of Ba{sub 1−x}La{sub x}Fe{sub 12−x}Co{sub x}O{sub 19} (x = 0.0, 0.1, 0.3, and 0.5), prepared by a conventional ceramic method, were systematically investigated by Raman spectra, X-ray photoelectron spectroscopy, Rietveld refinement of X-ray diffraction patterns, and vibrating sample magnetometer. The result manifests that all the compounds are crystallized in magnetoplumbite hexagonal structure. Trivalent cobalt ions prevailingly occupy the 2a, 4f{sub 1}, and 12k sites. According to Néel model of collinear-spin ferrimagnetism, the molecular-field coefficients ω{sub bf2}, ω{sub kf1}, ω{sub af1}, ω{sub kf2}, and ω{sub bk} of La-Co substituted barium hexaferrites have been calculated usingmore » the nonlinear fitting method, and the magnetic moment of five sublattices (2a, 2b, 4f{sub 1}, 4f{sub 2}, and 12k) versus temperature T has been also investigated. The fitting results are coincided well with the experimental data. Moreover, with the increase of La-Co substitution amount x, the molecular-field coefficients ω{sub bf2} and ω{sub af1} decrease constantly, while the molecular-field coefficients ω{sub kf1}, ω{sub kf2}, and ω{sub bk} show a slight change.« less
40 CFR 721.4420 - Substituted hydroxylamine.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Substituted hydroxylamine. 721.4420... Substances § 721.4420 Substituted hydroxylamine. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as substituted hydroxylamine (PMN P-84-492) is...
14 CFR § 1260.55 - Reports substitution.
Code of Federal Regulations, 2014 CFR
2014-01-01
... AGREEMENTS General Special Conditions § 1260.55 Reports substitution. Reports Substitution October 2000 Technical Reports may be substituted for the required Performance Reports. The title page of such reports... 14 Aeronautics and Space 5 2014-01-01 2014-01-01 false Reports substitution. § 1260.55 Section Â...
Stephen K. Swallow; David N. Wear
1993-01-01
Forestry models often ignore spatial relationships between forest stands. This paper isolates the effects of stand interactions in muitiple-use forestry through a straightforward extension of the single-stand model. Effects of stand interactions decompose into wealth and substitution effects and may cause time-varying patterns of resource use for a forest...
Permanent Teacher Preparation for Substitute Teachers.
ERIC Educational Resources Information Center
Hardman, Steve; Tippetts, Zachary
2001-01-01
Presents information about what should be communicated to substitute teachers and why it is important, focusing on the substitute teacher's role, classroom management tools, curriculum management, and preparing students for the substitute teacher by creating bridges that will help minimize the sense of separation students feel when they have a…
Meiler, Arno; Klinger, Claudia; Kaufmann, Michael
2012-09-08
The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Velhal, Ninad B.; Patil, Narayan D.; Puri, Vijaya R., E-mail: vijayapuri1@gmail.com
2015-09-15
Nickel substituted cobalt ferrite nanoparticles with composition Co{sub 1−x}Ni{sub x}Fe{sub 2}O{sub 4} (0.0 ≤ x ≤ 1.0) was synthesized using simple, low temperature auto combustion method. The X-ray diffraction patterns reveal the formation of cubic phase spinel structure. The crystallite size varies from 30-44 nm with the nickel content. Porous and agglomerated morphology of the bulk sample was displayed in the scanning electron microscopy. Micro Raman spectroscopy reveals continuous shift of E{sub g} and E{sub g}(2) stokes line up to 0.8 Ni substitution. The dispersion behavior of the dielectric constant with frequency and the semicircle nature of the impedance spectramore » show the cobalt nickel ferrite to have high resistance. The ferromagnetic nature is observed in all the samples, however, the maximum saturation magnetization was achieved by the 0.4 Ni substituted cobalt ferrite, which is up to the 92.87 emu/gm at 30K.« less
Cloete, Ruben; Akurugu, Wisdom A; Werely, Cedric J; van Helden, Paul D; Christoffels, Alan
2017-08-01
The human arylamine N-acetyltransferase 1 (NAT1) enzyme plays a vital role in determining the duration of action of amine-containing drugs such as para-aminobenzoic acid (PABA) by influencing the balance between detoxification and metabolic activation of these drugs. Recently, four novel single nucleotide polymorphisms (SNPs) were identified within a South African mixed ancestry population. Modeling the effects of these SNPs within the structural protein was done to assess possible structure and function changes in the enzyme. The use of molecular dynamics simulations and stability predictions indicated less thermodynamically stable protein structures containing E264K and V231G, while the N245I change showed a stabilizing effect. Coincidently the N245I change displayed a similar free energy landscape profile to the known R64W amino acid substitution (slow acetylator), while the R242M displayed a similar profile to the published variant, I263V (proposed fast acetylator), and the wild type protein structure. Similarly, principal component analysis indicated that two amino acid substitutions (E264K and V231G) occupied less conformational clusters of folded states as compared to the WT and were found to be destabilizing (may affect protein function). However, two of the four novel SNPs that result in amino acid changes: (V231G and N245I) were predicted by both SIFT and POLYPHEN-2 algorithms to affect NAT1 protein function, while two other SNPs that result in R242M and E264K substitutions showed contradictory results based on SIFT and POLYPHEN-2 analysis. In conclusion, the structural methods were able to verify that two non-synonymous substitutions (E264K and V231G) can destabilize the protein structure, and are in agreement with mCSM predictions, and should therefore be experimentally tested for NAT1 activity. These findings could inform a strategy of incorporating genotypic data (i.e., functional SNP alleles) with phenotypic information (slow or fast acetylator) to
A robust methodology to subclassify pseudokinases based on their nucleotide-binding properties
Murphy, James M.; Zhang, Qingwei; Young, Samuel N.; Reese, Michael L.; Bailey, Fiona P.; Eyers, Patrick A.; Ungureanu, Daniela; Hammaren, Henrik; Silvennoinen, Olli; Varghese, Leila N.; Chen, Kelan; Tripaydonis, Anne; Jura, Natalia; Fukuda, Koichi; Qin, Jun; Nimchuk, Zachary; Mudgett, Mary Beth; Elowe, Sabine; Gee, Christine L.; Liu, Ling; Daly, Roger J.; Manning, Gerard; Babon, Jeffrey J.; Lucet, Isabelle S.
2017-01-01
Protein kinase-like domains that lack conserved residues known to catalyse phosphoryl transfer, termed pseudokinases, have emerged as important signalling domains across all kingdoms of life. Although predicted to function principally as catalysis-independent protein-interaction modules, several pseudokinase domains have been attributed unexpected catalytic functions, often amid controversy. We established a thermal-shift assay as a benchmark technique to define the nucleotide-binding properties of kinase-like domains. Unlike in vitro kinase assays, this assay is insensitive to the presence of minor quantities of contaminating kinases that may otherwise lead to incorrect attribution of catalytic functions to pseudokinases. We demonstrated the utility of this method by classifying 31 diverse pseudokinase domains into four groups: devoid of detectable nucleotide or cation binding; cation-independent nucleotide binding; cation binding; and nucleotide binding enhanced by cations. Whereas nine pseudokinases bound ATP in a divalent cation-dependent manner, over half of those examined did not detectably bind nucleotides, illustrating that pseudokinase domains predominantly function as non-catalytic protein-interaction modules within signalling networks and that only a small subset is potentially catalytically active. We propose that henceforth the thermal-shift assay be adopted as the standard technique for establishing the nucleotide-binding and catalytic potential of kinase-like domains. PMID:24107129
Organization of Nucleotides in Different Environments and the Formation of Pre-Polymers
NASA Astrophysics Data System (ADS)
Himbert, Sebastian; Chapman, Mindy; Deamer, David W.; Rheinstädter, Maikel C.
2016-08-01
RNA is a linear polymer of nucleotides linked by a ribose-phosphate backbone. Polymerization of nucleotides occurs in a condensation reaction in which phosphodiester bonds are formed. However, in the absence of enzymes and metabolism there has been no obvious way for RNA-like molecules to be produced and then encapsulated in cellular compartments. We investigated 5‧-adenosine monophosphate (AMP) and 5‧-uridine monophosphate (UMP) molecules confined in multi-lamellar phospholipid bilayers, nanoscopic films, ammonium chloride salt crystals and Montmorillonite clay, previously proposed to promote polymerization. X-ray diffraction was used to determine whether such conditions imposed a degree of order on the nucleotides. Two nucleotide signals were observed in all matrices, one corresponding to a nearest neighbour distance of 4.6 Å attributed to nucleotides that form a disordered, glassy structure. A second, smaller distance of 3.4 Å agrees well with the distance between stacked base pairs in the RNA backbone, and was assigned to the formation of pre-polymers, i.e., the organization of nucleotides into stacks of about 10 monomers. Such ordering can provide conditions that promote the nonenzymatic polymerization of RNA strands under prebiotic conditions. Experiments were modeled by Monte-Carlo simulations, which provide details of the molecular structure of these pre-polymers.
n-Nucleotide circular codes in graph theory.
Fimmel, Elena; Michel, Christian J; Strüngmann, Lutz
2016-03-13
The circular code theory proposes that genes are constituted of two trinucleotide codes: the classical genetic code with 61 trinucleotides for coding the 20 amino acids (except the three stop codons {TAA,TAG,TGA}) and a circular code based on 20 trinucleotides for retrieving, maintaining and synchronizing the reading frame. It relies on two main results: the identification of a maximal C(3) self-complementary trinucleotide circular code X in genes of bacteria, eukaryotes, plasmids and viruses (Michel 2015 J. Theor. Biol. 380, 156-177. (doi:10.1016/j.jtbi.2015.04.009); Arquès & Michel 1996 J. Theor. Biol. 182, 45-58. (doi:10.1006/jtbi.1996.0142)) and the finding of X circular code motifs in tRNAs and rRNAs, in particular in the ribosome decoding centre (Michel 2012 Comput. Biol. Chem. 37, 24-37. (doi:10.1016/j.compbiolchem.2011.10.002); El Soufi & Michel 2014 Comput. Biol. Chem. 52, 9-17. (doi:10.1016/j.compbiolchem.2014.08.001)). The univerally conserved nucleotides A1492 and A1493 and the conserved nucleotide G530 are included in X circular code motifs. Recently, dinucleotide circular codes were also investigated (Michel & Pirillo 2013 ISRN Biomath. 2013, 538631. (doi:10.1155/2013/538631); Fimmel et al. 2015 J. Theor. Biol. 386, 159-165. (doi:10.1016/j.jtbi.2015.08.034)). As the genetic motifs of different lengths are ubiquitous in genes and genomes, we introduce a new approach based on graph theory to study in full generality n-nucleotide circular codes X, i.e. of length 2 (dinucleotide), 3 (trinucleotide), 4 (tetranucleotide), etc. Indeed, we prove that an n-nucleotide code X is circular if and only if the corresponding graph [Formula: see text] is acyclic. Moreover, the maximal length of a path in [Formula: see text] corresponds to the window of nucleotides in a sequence for detecting the correct reading frame. Finally, the graph theory of tournaments is applied to the study of dinucleotide circular codes. It has full equivalence between the combinatorics
Wu, Eugene Y.; Beese, Lorena S.
2011-01-01
To achieve accurate DNA synthesis, DNA polymerases must rapidly sample and discriminate against incorrect nucleotides. Here we report the crystal structure of a high fidelity DNA polymerase I bound to DNA primer-template caught in the act of binding a mismatched (dG:dTTP) nucleoside triphosphate. The polymerase adopts a conformation in between the previously established “open” and “closed” states. In this “ajar” conformation, the template base has moved into the insertion site but misaligns an incorrect nucleotide relative to the primer terminus. The displacement of a conserved active site tyrosine in the insertion site by the template base is accommodated by a distinctive kink in the polymerase O helix, resulting in a partially open ternary complex. We suggest that the ajar conformation allows the template to probe incoming nucleotides for complementarity before closure of the enzyme around the substrate. Based on solution fluorescence, kinetics, and crystallographic analyses of wild-type and mutant polymerases reported here, we present a three-state reaction pathway in which nucleotides either pass through this intermediate conformation to the closed conformation and catalysis or are misaligned within the intermediate, leading to destabilization of the closed conformation. PMID:21454515
Substitutes for School Nurses in Illinois
ERIC Educational Resources Information Center
Vollinger, Linda Jeno; Bergren, Martha Dewey; Belmonte-Mann, Frances
2011-01-01
The purpose of this descriptive study was to explore utilization of nurse substitutes in the school setting in Illinois. The literature described personnel who staff the school health office in the absence of the school nurse and the barriers to obtaining nurse substitutes. There were no empirical studies conducted on school nurse substitutes in…
Eckert, Andrew J; Wegrzyn, Jill L; Pande, Barnaly; Jermstad, Kathleen D; Lee, Jennifer M; Liechty, John D; Tearse, Brandon R; Krutovsky, Konstantin V; Neale, David B
2009-09-01
Forest trees exhibit remarkable adaptations to their environments. The genetic basis for phenotypic adaptation to climatic gradients has been established through a long history of common garden, provenance, and genecological studies. The identities of genes underlying these traits, however, have remained elusive and thus so have the patterns of adaptive molecular diversity in forest tree genomes. Here, we report an analysis of diversity and divergence for a set of 121 cold-hardiness candidate genes in coastal Douglas fir (Pseudotsuga menziesii var. menziesii). Application of several different tests for neutrality, including those that incorporated demographic models, revealed signatures of selection consistent with selective sweeps at three to eight loci, depending upon the severity of a bottleneck event and the method used to detect selection. Given the high levels of recombination, these candidate genes are likely to be closely linked to the target of selection if not the genes themselves. Putative homologs in Arabidopsis act primarily to stabilize the plasma membrane and protect against denaturation of proteins at freezing temperatures. These results indicate that surveys of nucleotide diversity and divergence, when framed within the context of further association mapping experiments, will come full circle with respect to their utility in the dissection of complex phenotypic traits into their genetic components.
Hatoum-Aslan, Asma; Samai, Poulami; Maniv, Inbal; Jiang, Wenyan; Marraffini, Luciano A
2013-09-27
Small RNAs undergo maturation events that precisely determine the length and structure required for their function. CRISPRs (clustered regularly interspaced short palindromic repeats) encode small RNAs (crRNAs) that together with CRISPR-associated (cas) genes constitute a sequence-specific prokaryotic immune system for anti-viral and anti-plasmid defense. crRNAs are subject to multiple processing events during their biogenesis, and little is known about the mechanism of the final maturation step. We show that in the Staphylococcus epidermidis type III CRISPR-Cas system, mature crRNAs are measured in a Cas10·Csm ribonucleoprotein complex to yield discrete lengths that differ by 6-nucleotide increments. We looked for mutants that impact this crRNA size pattern and found that an alanine substitution of a conserved aspartate residue of Csm3 eliminates the 6-nucleotide increments in the length of crRNAs. In vitro, recombinant Csm3 binds RNA molecules at multiple sites, producing gel-shift patterns that suggest that each protein binds 6 nucleotides of substrate. In vivo, changes in the levels of Csm3 modulate the crRNA size distribution without disrupting the 6-nucleotide periodicity. Our data support a model in which multiple Csm3 molecules within the Cas10·Csm complex bind the crRNA with a 6-nucleotide periodicity to function as a ruler that measures the extent of crRNA maturation.
Hatoum-Aslan, Asma; Samai, Poulami; Maniv, Inbal; Jiang, Wenyan; Marraffini, Luciano A.
2013-01-01
Small RNAs undergo maturation events that precisely determine the length and structure required for their function. CRISPRs (clustered regularly interspaced short palindromic repeats) encode small RNAs (crRNAs) that together with CRISPR-associated (cas) genes constitute a sequence-specific prokaryotic immune system for anti-viral and anti-plasmid defense. crRNAs are subject to multiple processing events during their biogenesis, and little is known about the mechanism of the final maturation step. We show that in the Staphylococcus epidermidis type III CRISPR-Cas system, mature crRNAs are measured in a Cas10·Csm ribonucleoprotein complex to yield discrete lengths that differ by 6-nucleotide increments. We looked for mutants that impact this crRNA size pattern and found that an alanine substitution of a conserved aspartate residue of Csm3 eliminates the 6-nucleotide increments in the length of crRNAs. In vitro, recombinant Csm3 binds RNA molecules at multiple sites, producing gel-shift patterns that suggest that each protein binds 6 nucleotides of substrate. In vivo, changes in the levels of Csm3 modulate the crRNA size distribution without disrupting the 6-nucleotide periodicity. Our data support a model in which multiple Csm3 molecules within the Cas10·Csm complex bind the crRNA with a 6-nucleotide periodicity to function as a ruler that measures the extent of crRNA maturation. PMID:23935102
Lagrutta, Armando; Zeng, Haoyu; Imredy, John; Balasubramanian, Bharathi; Dech, Spencer; Lis, Edward; Wang, Jixin; Zhai, Jin; DeGeorge, Joseph; Sannajust, Frederick
2016-10-01
Several clinical cases of severe bradyarrhythmias have been reported upon co-administration of the Hepatitis-C NS5B Nucleotide Polymerase Inhibitor (HCV-NI) direct-acting antiviral agent, sofosbuvir (SOF), and the Class-III anti-arrhythmic amiodarone (AMIO). We model the cardiac drug-drug interaction (DDI) between AMIO and SOF, and between AMIO and a closely-related SOF analog, MNI-1 (Merck Nucleotide Inhibitor #1), in functional assays of human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs), to provide mechanistic insights into recently reported clinical cases. AMIO co-applied with SOF or MNI-1 increased beating rate or field potential (FP) rate and decreased impedance (IMP) and Ca(2+) transient amplitudes in hiPSC-CM syncytia. This action resembled that of Ca(2+) channel blockers (CCBs) in the model, but CCBs did not substitute for AMIO in the DDI. AMIO analog dronedarone (DRON) did not substitute for, but competed with AMIO in the DDI. Ryanodine and thapsigargin, decreasing intracellular Ca(2+) stores, and SEA-0400, a Na(+)/Ca(2+) exchanger-1 (NCX1) inhibitor, partially antagonized or suppressed DDI effects. Other agents affecting FP rate only exerted additive or subtractive effects, commensurate with their individual effects. We also describe an interaction between AMIO and MNI-1 on Cav1.2 ion channels in an over-expressing HEK-293 cell line. MNI-1 enhanced Cav1.2 channel inhibition by AMIO, but did not affect inhibition of Cav1.2 by DRON, verapamil, nifedipine, or diltiazem. Our data in hiPSC-CMs indicate that HCV-NI agents such as SOF and MNI-1 interact with key intracellular Ca(2+)-handling mechanisms. Additional study in a Cav1.2 HEK-293 cell-line suggests that HCV-NIs potentiate the inhibitory action of AMIO on L-type Ca(2+) channels. Copyright © 2016 Elsevier Inc. All rights reserved.
Application of DNA Machineries for the Barcode Patterned Detection of Genes or Proteins.
Zhou, Zhixin; Luo, Guofeng; Wulf, Verena; Willner, Itamar
2018-06-05
The study introduces an analytical platform for the detection of genes or aptamer-ligand complexes by nucleic acid barcode patterns generated by DNA machineries. The DNA machineries consist of nucleic acid scaffolds that include specific recognition sites for the different genes or aptamer-ligand analytes. The binding of the analytes to the scaffolds initiate, in the presence of the nucleotide mixture, a cyclic polymerization/nicking machinery that yields displaced strands of variable lengths. The electrophoretic separation of the resulting strands provides barcode patterns for the specific detection of the different analytes. Mixtures of DNA machineries that yield, upon sensing of different genes (or aptamer ligands), one-, two-, or three-band barcode patterns are described. The combination of nucleic acid scaffolds acting, in the presence of polymerase/nicking enzyme and nucleotide mixture, as DNA machineries, that generate multiband barcode patterns provide an analytical platform for the detection of an individual gene out of many possible genes. The diversity of genes (or other analytes) that can be analyzed by the DNA machineries and the barcode patterned imaging is given by the Pascal's triangle. As a proof-of-concept, the detection of one of six genes, that is, TP53, Werner syndrome, Tay-Sachs normal gene, BRCA1, Tay-Sachs mutant gene, and cystic fibrosis disorder gene by six two-band barcode patterns is demonstrated. The advantages and limitations of the detection of analytes by polymerase/nicking DNA machineries that yield barcode patterns as imaging readout signals are discussed.
Code of Federal Regulations, 2010 CFR
2010-07-01
... Use Conditions Substitutes Application Substitute Decision Conditions Comments Electronics Cleaning w.... Electronics cleaning w/CFC-113 Dibromomethane Unacceptable High ODP; other alternatives exist. Electronics...
Ethynyl and substituted ethynyl-terminated polysulfones
NASA Technical Reports Server (NTRS)
Hergenrother, P. M. (Inventor)
1986-01-01
Ethynyl and substituted ethynyl-terminated polysulfones and their synthesis are disclosed. These polysulfones are thermally cured to induce cross-linking and chain extension, producing a polymer system with improved solvent resistance and use temperatures. Also disclosed are substituted 4-ethynylbenzoyl chlorides as precursors to the substituted ethynyl-terminated polysulfones and a process for preparing the same.
NASA Astrophysics Data System (ADS)
Nong, N. V.; Yanagiya, S.; Monica, S.; Pryds, N.; Ohtaki, M.
2011-05-01
The effects of Ga substitution on the Co-site on the high-temperature thermoelectric properties and microstructure are investigated for the misfitlayered Ca3Co4O9 and the complex perovskite-related Sr3RECo4O10.5 (RE = rare earth) cobalt-based oxides. For both systems, substitution of Ga for Co results in a simultaneous increase in the Seebeck coefficient ( S) and the electrical conductivity ( σ), and the influence is more significant in the high temperature region. The power factor ( S 2 σ) is thereby remarkably improved by Ga substitution, particularly at high temperatures. Texture factor calculations using x-ray diffraction pattern data for pressed and powder samples reveal that the Ga-doped samples are highly textured. Microstructure observed by scanning electron microscopy shows very well-crystallized grains for the samples with Ga substitution for Co. Among the Ga-doped samples, Ca3Co3.95Ga0.05O9 shows the best ZT value of 0.45 at 1200 K, which is about 87.5% higher than the nondoped one, a considerable improvement.
Ishikawa, Sohta A; Inagaki, Yuji; Hashimoto, Tetsuo
2012-01-01
In phylogenetic analyses of nucleotide sequences, 'homogeneous' substitution models, which assume the stationarity of base composition across a tree, are widely used, albeit individual sequences may bear distinctive base frequencies. In the worst-case scenario, a homogeneous model-based analysis can yield an artifactual union of two distantly related sequences that achieved similar base frequencies in parallel. Such potential difficulty can be countered by two approaches, 'RY-coding' and 'non-homogeneous' models. The former approach converts four bases into purine and pyrimidine to normalize base frequencies across a tree, while the heterogeneity in base frequency is explicitly incorporated in the latter approach. The two approaches have been applied to real-world sequence data; however, their basic properties have not been fully examined by pioneering simulation studies. Here, we assessed the performances of the maximum-likelihood analyses incorporating RY-coding and a non-homogeneous model (RY-coding and non-homogeneous analyses) on simulated data with parallel convergence to similar base composition. Both RY-coding and non-homogeneous analyses showed superior performances compared with homogeneous model-based analyses. Curiously, the performance of RY-coding analysis appeared to be significantly affected by a setting of the substitution process for sequence simulation relative to that of non-homogeneous analysis. The performance of a non-homogeneous analysis was also validated by analyzing a real-world sequence data set with significant base heterogeneity.
Database of amino acid-nucleotide contacts in contacts in DNA-homeodomain protein
NASA Astrophysics Data System (ADS)
Grokhlina, T. I.; Zrelov, P. V.; Ivanov, V. V.; Polozov, R. V.; Chirgadze, Yu. N.; Sivozhelezov, V. S.
2013-09-01
The analysis of amino acid-nucleotide contacts in interfaces of the protein-DNA complexes, intended to find consistencies in the protein-DNA recognition, is a complex problem that requires an analysis of the physicochemical characteristics of these contacts and the positions of the participating amino acids and nucleotides in the chains of the protein and the DNA, respectively, as well as conservatism of these contacts. Thus, those heterogeneous data should be systematized. For this purpose we have developed a database of amino acid-nucleotide contacts ANTPC (Amino acid Nucleotide Type Position Conservation) following the archetypal example of the proteins in the homeodomain family. We show that it can be used to compare and classify the interfaces of the protein-DNA complexes.
Lucas, Philippe; Walsh, Zach; Crosby, Kim; Callaway, Robert; Belle-Isle, Lynne; Kay, Robert; Capler, Rielle; Holtzman, Susan
2016-05-01
Recent years have witnessed increased attention to how cannabis use impacts the use of other psychoactive substances. The present study examines the use of cannabis as a substitute for alcohol, illicit substances and prescription drugs among 473 adults who use cannabis for therapeutic purposes. The Cannabis Access for Medical Purposes Survey is a 414-question cross-sectional survey that was available to Canadian medical cannabis patients online and by hard copy in 2011 and 2012 to gather information on patient demographics, medical conditions and symptoms, patterns of medical cannabis use, cannabis substitution and barriers to access to medical cannabis. Substituting cannabis for one or more of alcohol, illicit drugs or prescription drugs was reported by 87% (n = 410) of respondents, with 80.3% reporting substitution for prescription drugs, 51.7% for alcohol, and 32.6% for illicit substances. Respondents who reported substituting cannabis for prescription drugs were more likely to report difficulty affording sufficient quantities of cannabis, and patients under 40 years of age were more likely to substitute cannabis for all three classes of substance than older patients. The finding that cannabis was substituted for all three classes of substances suggests that the medical use of cannabis may play a harm reduction role in the context of use of these substances, and may have implications for abstinence-based substance use treatment approaches. Further research should seek to differentiate between biomedical substitution for prescription pharmaceuticals and psychoactive drug substitution, and to elucidate the mechanisms behind both. [Lucas P, Walsh Z, Crosby K, Callaway R, Belle-Isle L, Kay B, Capler R, Holtzman S. Substituting cannabis for prescription drugs, alcohol, and other substances among medical cannabis patients: The impact of contextual factors. Drug Alcohol Rev 2016;35:326-333]. © 2015 Australasian Professional Society on Alcohol and other Drugs.
Prokaryotic Nucleotide Composition Is Shaped by Both Phylogeny and the Environment
Reichenberger, Erin R.; Rosen, Gail; Hershberg, Uri; ...
2015-04-09
Here, the causes of the great variation in nucleotide composition of prokaryotic genomes have long been disputed. Here, we use extensive metagenomic and whole-genome data to demonstrate that both phylogeny and the environment shape prokaryotic nucleotide content. We show that across environments, various phyla are characterized by different mean guanine and cytosine (GC) values as well as by the extent of variation on that mean value. At the same time, we show that GC-content varies greatly as a function of environment, in a manner that cannot be entirely explained by disparities in phylogenetic composition. We find environmentally driven differences inmore » nucleotide content not only between highly diverged environments (e.g., soil, vs. aquatic vs. human gut) but also within a single type of environment. More specifically, we demonstrate that some human guts are associated with a microbiome that is consistently more GC-rich across phyla, whereas others are associated with a more AT-rich microbiome. These differences appear to be driven both by variations in phylogenetic composition and by environmental differences—which are independent of these phylogenetic composition differences. Combined, our results demonstrate that both phylogeny and the environment significantly affect nucleotide composition and that the environmental differences affecting nucleotide composition are far subtler than previously appreciated.« less
Hays, S J; Rice, M J; Ortwine, D F; Johnson, G; Schwarz, R D; Boyd, D K; Copeland, L F; Vartanian, M G; Boxer, P A
1994-10-01
Thirty-two aryl-substituted 2-benzothiazolamines have been tested for their ability to modulate sodium flux in rat cortical slices. A QSAR analysis, applied to these derivatives, showed a trend toward increasing potency as sodium flux inhibitors with increasing lipophilicity, decreasing size, and increasing electron withdrawal of the benzo ring substituents. Additionally, 4- or 5-substitution of the benzo ring was found to decrease potency. The combination of increased lipophilicity, small size, and electron withdrawal severely limited which groups were tolerated on the benzo ring, thus suggesting that the optimal substitution patterns have been prepared within this series. Nine of these compounds were potent inhibitors of veratridine-induced sodium flux (NaFl). These nine compounds also proved to be anticonvulsant in the maximal electroshock (MES) assay. Fourteen additional 2-benzothiazolamines demonstrated activity in the MES screen, yet exhibited no activity in the NaFl assay. These derivatives may be interacting at the sodium channel in a manner not discernible by the flux paradigm, or they may be acting by an alternative mechanism in vivo.
Getting it Right: How DNA Polymerases Select the Right Nucleotide.
Ludmann, Samra; Marx, Andreas
2016-01-01
All living organisms are defined by their genetic code encrypted in their DNA. DNA polymerases are the enzymes that are responsible for all DNA syntheses occurring in nature. For DNA replication, repair and recombination these enzymes have to read the parental DNA and recognize the complementary nucleotide out of a pool of four structurally similar deoxynucleotide triphosphates (dNTPs) for a given template. The selection of the nucleotide is in accordance with the Watson-Crick rule. In this process the accuracy of DNA synthesis is crucial for the maintenance of the genome stability. However, to spur evolution a certain degree of freedom must be allowed. This brief review highlights the mechanistic basis for selecting the right nucleotide by DNA polymerases.
Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.
Le Gall, O; Candresse, T; Brault, V; Dunez, J
1989-01-01
The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein. PMID:2798128
Katz, Lee S.; Sharma, Nitya V.; Harcourt, Brian H.; Thomas, Jennifer Dolan; Wang, Xin; Mayer, Leonard W.; Jordan, I. King
2011-01-01
Neisseria meningitidis is one of the main agents of bacterial meningitis, causing substantial morbidity and mortality worldwide. However, most of the time N. meningitidis is carried as a commensal not associated with invasive disease. The genomic basis of the difference between disease-associated and carried isolates of N. meningitidis may provide critical insight into mechanisms of virulence, yet it has remained elusive. Here, we have taken a comparative genomics approach to interrogate the difference between disease-associated and carried isolates of N. meningitidis at the level of individual nucleotide variations (i.e., single nucleotide polymorphisms [SNPs]). We aligned complete genome sequences of 8 disease-associated and 4 carried isolates of N. meningitidis to search for SNPs that show mutually exclusive patterns of variation between the two groups. We found 63 SNPs that distinguish the 8 disease-associated genomes from the 4 carried genomes of N. meningitidis, which is far more than can be expected by chance alone given the level of nucleotide variation among the genomes. The putative list of SNPs that discriminate between disease-associated and carriage genomes may be expected to change with increased sampling or changes in the identities of the isolates being compared. Nevertheless, we show that these discriminating SNPs are more likely to reflect phenotypic differences than shared evolutionary history. Discriminating SNPs were mapped to genes, and the functions of the genes were evaluated for possible connections to virulence mechanisms. A number of overrepresented functional categories related to virulence were uncovered among SNP-associated genes, including genes related to the category “symbiosis, encompassing mutualism through parasitism.” PMID:21622743
Costa, Valerio; Federico, Antonio; Pollastro, Carla; Ziviello, Carmela; Cataldi, Simona; Formisano, Pietro; Ciccodicola, Alfredo
2016-01-01
Type 2 diabetes (T2D) is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9) or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG). However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP), currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing. PMID:27347941
Ethynyl and substituted ethynyl-terminated polysulfones
NASA Technical Reports Server (NTRS)
Hergenrother, P. M. (Inventor)
1984-01-01
Ethynyl and substituted ethynyl-terminated polysulfones and a process for preparing the same are disclosed. These polysulfones are thermally cured to induce cross-linking and chain extension, producing a polymer system with improved solvent resistance and use temperature. Also disclosed are substituted 4-ethynylbenzoyl chlorides as precursors to the substituted ethynyl-terminated polysulfones and a process for preparing the same.
Sin(x)**2 + cos(x)**2 = 1. [programming identities using comparative combinatorial substitutions
NASA Technical Reports Server (NTRS)
Stoutemyer, D. R.
1977-01-01
Attempts to achieve tasteful automatic employment of the identities sin sq x + cos sq x = 1 and cos sq h x -sin sq h x = 1 in a manner which truly minimizes the complexity of the resulting expression are described. The disappointments of trigonometric reduction, trigonometric expansion, pattern matching, Poisson series, and Demoivre's theorem are related. The advantages of using the method of comparative combinatorial substitutions are illustrated.
NASA Astrophysics Data System (ADS)
Kyriacou, Andreas
The effect of Fe substitution on the crystal structure of hydroxyapatite (HAp) is studied by applying simultaneous Rietveld refinements of powder x-ray and neutron diffraction patterns. Fe is one of the trace elements replacing Ca in HAp, which is the major mineral phase in bones and teeth. The morphology and magnetic properties of the Fe-HAp system are also studied by transmission electron microscopy and magnetization measurements. Samples of Ca(5-x)Fex(PO4)3OH with 0 ≤ x ≤ 0.3 were prepared. Single phase HAp was identified in x-ray diffraction patterns (XRD) of samples with x < 0.1 inferring that the solubility limits are less than 0.1. Hematite (alpha-Fe2O3) is identified as a secondary phase for higher Fe content. The refined parameters show that Fe is incorporated in the HAp structure by replacing Ca in the two crystallographic sites with a preference at the Ca2 site. This preference explains the small effect of the Fe substitution on the lattice constants of HAp. The overall decrease of the lattice constants is explained by the ionic size difference of Ca and Fe. The increasing trend of the a-lattice constant with x in the Fe substituted samples is attributed to a lattice relaxation caused by the substitution of the 4- and 6-fold Fe at the 7- and 9-fold Ca1 and Ca2 sites. This Ca local geometry reduction is indicated by a slight increase of the Ca1-O3 and Ca2-O1 bond lengths. Above the solubility limit x = 0.05, the Fe is partitioned in and out of the HAp structure with increasing nominal Fe content x. The excess Fe is oxidized to hematite. The TEM analysis and magnetic measurements support the results of the simultaneous Rietveld refinements. The TEM images show no significant effect on the morphology and size of the HAp particles upon Fe incorporation. The particles are either spheres or short rods of dimensions 20--60 nm. Hematite particles are imaged in the samples with x exceeding the solubility limit. These particles are spheres, about 15 nm in
Hershkovitz, Eli; Arafat, Maram; Loewenthal, Neta; Haim, Alon; Parvari, Ruti
2015-09-01
The nicotinamide nucleotide transhydrogenase (NNT) enzyme is the main generator of nicotinamide adenine dinucleotide phosphate-oxidase in the mitochondrion. Mutations of the NNT gene have been recently implicated in familial glucocorticoid deficiency. We describe the long-term clinical course of a NNT-deficient 20-year-old patient with combined adrenal failure who had developed a testicular adrenal rest tumor and precocious puberty. The patient's medical records were reviewed. Whole-exome sequencing was performed on DNA obtained from the patient and family members. The patient experienced Addisonian crisis at 10 months of age. Enlarged testicular volume and precocious puberty, accompanied by increased testosterone levels, were noted at 6 years. Testicular biopsy revealed a adrenal rest tumor, which regressed after intensification of glucocorticoid treatment. Genetic studies disclosed a c.1163A>C, p.Tyr388Ser substitution on the NNT gene. This mutation is predicted to be damaging to NNT function. We demonstrated for the first time that the clinical spectrum of NNT deficiency may consist of mineralocorticoid deficiency and testicular involvement as well.
Vγ9Vδ2 T cell activation by strongly agonistic nucleotidic phosphoantigens.
Moulin, Morgane; Alguacil, Javier; Gu, Siyi; Mehtougui, Asmaa; Adams, Erin J; Peyrottes, Suzanne; Champagne, Eric
2017-12-01
Human Vγ9Vδ2 T cells can sense through their TCR tumor cells producing the weak endogenous phosphorylated antigen isopentenyl pyrophosphate (IPP), or bacterially infected cells producing the strong agonist hydroxyl dimethylallyl pyrophosphate (HDMAPP). The recognition of the phosphoantigen is dependent on its binding to the intracellular B30.2 domain of butyrophilin BTN3A1. Most studies have focused on pyrophosphate phosphoantigens. As triphosphate nucleotide derivatives are naturally co-produced with IPP and HDMAPP, we analyzed their specific properties using synthetic nucleotides derived from HDMAPP. The adenylated, thymidylated and uridylated triphosphate derivatives were found to activate directly Vγ9Vδ2 cell lines as efficiently as HDMAPP in the absence of accessory cells. These antigens were inherently resistant to terminal phosphatases, but apyrase, when added during a direct stimulation of Vγ9Vδ2 cells, abrogated their stimulating activity, indicating that their activity required transformation into strong pyrophosphate agonists by a nucleotide pyrophosphatase activity which is present in serum. Tumor cells can be sensitized with nucleotide phosphoantigens in the presence of apyrase to become stimulatory, showing that this can occur before their hydrolysis into pyrophosphates. Whereas tumors sensitized with HDMAPP rapidly lost their stimulatory activity, sensitization with nucleotide derivatives, in particular with the thymidine derivative, induced long-lasting stimulating ability. Using isothermal titration calorimetry, binding of some nucleotide derivatives to BTN3A1 intracellular domain was found to occur with an affinity similar to that of IPP, but much lower than that of HDMAPP. Thus, nucleotide phosphoantigens are precursors of pyrophosphate antigens which can deliver strong agonists intracellularly resulting in prolonged and strengthened activity.
Nutrient-substituted hydroxyapatites: synthesis and characterization
NASA Technical Reports Server (NTRS)
Golden, D. C.; Ming, D. W.
1999-01-01
Incorporation of Mg, S, and plant-essential micronutrients into the structure of synthetic hydroxyapatite (HA) may be advantageous for closed-loop systems, such as will be required on Lunar and Martian outposts, because these apatites can be used as slow-release fertilizers. Our objective was to synthesize HA with Ca, P, Mg, S, Fe, Cu, Mn, Zn, Mo, B, and Cl incorporated into the structure, i.e., nutrient-substituted apatites. Hydroxyapatite, carbonate hydroxyapatite (CHA), nutrient-substituted hydroxyapatite (NHA), and nutrient-substituted carbonate hydroxyapatite (NCHA) were synthesized by precipitating from solution. Chemical and mineralogical analysis of precipitated samples indicated a considerable fraction of the added cations were incorporated into HA, without mineral impurities. Particle size of the HA was in the 1 to 40 nm range, and decreased with increased substitution of nutrient elements. The particle shape of HA was elongated in the c-direction in unsubstituted HA and NHA but more spherical in CHA and NCHA. The substitution of cations and anions in the HA structure was confirmed by the decrease of the d[002] spacing of HA with substitution of ions with an ionic radius less than that of Ca or P. The DTPA-extractable Cu ranged from 8 to 8429 mg kg-1, Zn ranged from 57 to 1279 mg kg-1, Fe from 211 to 2573 mg kg-1, and Mn from 190 to 1719 mg kg-1, depending on the substitution level of each element in HA. Nutrient-substituted HA has the potential to be used as a slow-release fertilizer to supply micronutrients, S, and Mg in addition to Ca and P.
Adsorption of nucleotides onto Fe-Mg-Al rich swelling clays
NASA Astrophysics Data System (ADS)
Feuillie, Cécile; Daniel, Isabelle; Michot, Laurent J.; Pedreira-Segade, Ulysse
2013-11-01
Mineral surfaces may have played a role in the origin of the first biopolymers, by concentrating organic monomers from a dilute ocean. Swelling clays provide a high surface area for the concentration of prebiotic monomers, and have therefore been the subject of numerous investigations. In that context, montmorillonite, the most abundant swelling clay in modern environments, has been extensively studied with regard to adsorption and polymerization of nucleic acids. However, montmorillonite was probably rather marginal on the primitive ocean floor compared to iron-magnesium rich phyllosilicates such as nontronite that results from the hydrothermal alteration of a mafic or ultramafic oceanic crust. In the present paper, we study the adsorption of nucleotides on montmorillonite and nontronite, at various pH and ionic strength conditions plausible for Archean sea-water. A thorough characterization of the mineral surfaces shows that nucleotide adsorb mainly on the edge faces of the smectites by ligand exchange between the phosphate groups of the nucleotides and the -OH groups from the edge sites over a wide pH range (4-10). Nontronite is more reactive than montmorillonite. At low pH, additional ion exchange may play a role as the nucleotides become positively charged.
Synthesis of substituted pyrazines
Pagoria, Philip F.; Zhang, Mao Xi
2016-10-04
A method for synthesizing a pyrazine-containing material according to one embodiment includes contacting an iminodiacetonitrile derivative with a base and a reagent selected from a group consisting of hydroxylamine, a hydroxylamine salt, an aliphatic primary amine, a secondary amine, an aryl-substituted alkylamine a heteroaryl-substituted alkyl amine, an alcohol, an alkanolamine and an aryl alcoholamine. Additional methods and several reaction products are presented. ##STR00001##
Modeling competitive substitution in a polyelectrolyte complex
DOE Office of Scientific and Technical Information (OSTI.GOV)
Peng, B.; Muthukumar, M., E-mail: muthu@polysci.umass.edu
2015-12-28
We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longermore » than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution.« less
Multiple heteroatom substitution to graphene nanoribbon
Meyer, Ernst
2018-01-01
Substituting heteroatoms into nanostructured graphene elements, such as graphene nanoribbons, offers the possibility for atomic engineering of electronic properties. To characterize these substitutions, functionalized atomic force microscopy (AFM)—a tool to directly resolve chemical structures—is one of the most promising tools, yet the chemical analysis of heteroatoms has been rarely performed. We synthesized multiple heteroatom-substituted graphene nanoribbons and showed that AFM can directly resolve elemental differences and can be correlated to the van der Waals radii, as well as the modulated local electron density caused by the substitution. This elemental-sensitive measurement takes an important step in the analysis of functionalized two-dimensional carbon materials. PMID:29662955
Ueyama, Hisao; Li, Yao-Hua; Fu, Gui-Lian; Lertrit, Patcharee; Atchaneeyasakul, La-ongsri; Oda, Sanae; Tanabe, Shoko; Nishida, Yasuhiro; Yamade, Shinichi; Ohkubo, Iwao
2003-01-01
We studied 247 Japanese males with congenital deutan color-vision deficiency and found that 37 subjects (15.0%) had a normal genotype of a single red gene followed by a green gene(s). Two of them had missense mutations in the green gene(s), but the other 35 subjects had no mutations in either the exons or their flanking introns. However, 32 of the 35 subjects, including all 8 subjects with pigment-color defect, a special category of deuteranomaly, had a nucleotide substitution, A−71C, in the promoter of a green gene at the second position in the red/green visual-pigment gene array. Although the −71C substitution was also present in color-normal Japanese males at a frequency of 24.3%, it was never at the second position but always found further downstream. The substitution was found in 19.4% of Chinese males and 7.7% of Thai males but rarely in Caucasians or African Americans. These results suggest that the A−71C substitution in the green gene at the second position is closely associated with deutan color-vision deficiency. In Japanese and presumably other Asian populations further downstream genes with −71C comprise a reservoir of the visual-pigment genes that cause deutan color-vision deficiency by unequal crossing over between the intergenic regions. PMID:12626747
RNA structural constraints in the evolution of the influenza A virus genome NP segment
Gultyaev, Alexander P; Tsyganov-Bodounov, Anton; Spronken, Monique IJ; van der Kooij, Sander; Fouchier, Ron AM; Olsthoorn, René CL
2014-01-01
Conserved RNA secondary structures were predicted in the nucleoprotein (NP) segment of the influenza A virus genome using comparative sequence and structure analysis. A number of structural elements exhibiting nucleotide covariations were identified over the whole segment length, including protein-coding regions. Calculations of mutual information values at the paired nucleotide positions demonstrate that these structures impose considerable constraints on the virus genome evolution. Functional importance of a pseudoknot structure, predicted in the NP packaging signal region, was confirmed by plaque assays of the mutant viruses with disrupted structure and those with restored folding using compensatory substitutions. Possible functions of the conserved RNA folding patterns in the influenza A virus genome are discussed. PMID:25180940
Ling, Kai-Shu; Harris, Karen R; Meyer, Jenelle D F; Levi, Amnon; Guner, Nihat; Wehner, Todd C; Bendahmane, Abdelhafid; Havey, Michael J
2009-12-01
Zucchini yellow mosaic virus (ZYMV) is one of the most economically important potyviruses infecting cucurbit crops worldwide. Using a candidate gene approach, we cloned and sequenced eIF4E and eIF(iso)4E gene segments in watermelon. Analysis of the nucleotide sequences between the ZYMV-resistant watermelon plant introduction PI 595203 (Citrullus lanatus var. lanatus) and the ZYMV-susceptible watermelon cultivar 'New Hampshire Midget' ('NHM') showed the presence of single nucleotide polymorphisms (SNPs). Initial analysis of the identified SNPs in association studies indicated that SNPs in the eIF4E, but not eIF(iso)4E, were closely associated to the phenotype of ZYMV-resistance in 70 F(2) and 114 BC(1R) progenies. Subsequently, we focused our efforts in obtaining the entire genomic sequence of watermelon eIF4E. Three SNPs were identified between PI 595203 and NHM. One of the SNPs (A241C) was in exon 1 and the other two SNPs (C309A and T554G) were in the first intron of the gene. SNP241 which resulted in an amino acid substitution (proline to threonine) was shown to be located in the critical cap recognition and binding area, similar to that of several plant species resistance to potyviruses. Analysis of a cleaved amplified polymorphism sequence (CAPS) marker derived from this SNP in F(2) and BC(1R) populations demonstrated a cosegregation between the CAPS-2 marker and their ZYMV resistance or susceptibility phenotype. When we investigated whether such SNP mutation in the eIF4E was also conserved in several other PIs of C. lanatus var. citroides, we identified a different SNP (A171G) resulting in another amino acid substitution (D71G) from four ZYMV-resistant C. lanatus var. citroides (PI 244018, PI 482261, PI 482299, and PI 482322). Additional CAPS markers were also identified. Availability of all these CAPS markers will enable marker-aided breeding of watermelon for ZYMV resistance.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome
Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274
Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis
McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX
2009-02-24
Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
Mechanism of nucleotide sensing in group II chaperonins.
Pereira, Jose H; Ralston, Corie Y; Douglas, Nicholai R; Kumar, Ramya; Lopez, Tom; McAndrew, Ryan P; Knee, Kelly M; King, Jonathan A; Frydman, Judith; Adams, Paul D
2012-02-01
Group II chaperonins mediate protein folding in an ATP-dependent manner in eukaryotes and archaea. The binding of ATP and subsequent hydrolysis promotes the closure of the multi-subunit rings where protein folding occurs. The mechanism by which local changes in the nucleotide-binding site are communicated between individual subunits is unknown. The crystal structure of the archaeal chaperonin from Methanococcus maripaludis in several nucleotides bound states reveals the local conformational changes associated with ATP hydrolysis. Residue Lys-161, which is extremely conserved among group II chaperonins, forms interactions with the γ-phosphate of ATP but shows a different orientation in the presence of ADP. The loss of the ATP γ-phosphate interaction with Lys-161 in the ADP state promotes a significant rearrangement of a loop consisting of residues 160-169. We propose that Lys-161 functions as an ATP sensor and that 160-169 constitutes a nucleotide-sensing loop (NSL) that monitors the presence of the γ-phosphate. Functional analysis using NSL mutants shows a significant decrease in ATPase activity, suggesting that the NSL is involved in timing of the protein folding cycle.
NASA Technical Reports Server (NTRS)
Kim, Myoung K.; Jeon, Jae-Heung; Fujita, Masayuki; Davin, Laurence B.; Lewis, Norman G.
2002-01-01
The isolation and characterization of a multigene family of the first class of dirigent proteins (namely that mainly involved in 8-8' coupling leading to (+)-pinoresinol in this case) is reported, this comprising of nine western red cedar (Thuja plicata) DIRIGENT genes (DIR1-9) of 72-99.5% identity to each other. Their corresponding cDNA clones had coding regions for 180-183 amino acids with each having a predicted molecular mass of ca. 20 kDa including the signal peptide. Real time-PCR established that the DIRIGENT isovariants were differentially expressed during growth and development of T. plicata (P < 0.05). The phylogenetic relationships and the rates and patterns of nucleotide substitution suggest that the DIRIGENT gene may have evolved via paralogous expansion at an early stage of vascular plant diversification. Thereafter, western red cedar paralogues have maintained an high homogeneity presumably via a concerted evolutionary mode. This, in turn, is assumed to be the driving force for the differential formation of 8-8'-linked pinoresinol derived (poly)lignans in the needles, stems, bark and branches, as well as for massive accumulation of 8-8'-linked plicatic acid-derived (poly)lignans in heartwood.
The Single Nucleotide Polymorphism Consortium
NASA Technical Reports Server (NTRS)
Morgan, Michael
2003-01-01
I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2014 CFR
2014-07-01
...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2013 CFR
2013-07-01
...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2012 CFR
2012-07-01
...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...
Segawa, Hiroki; T Iwata, Yuko; Yamamuro, Tadashi; Kuwayama, Kenji; Tsujikawa, Kenji; Kanamori, Tatsuyuki; Inoue, Hiroyuki
2017-03-01
Chromatographic differentiation of the ring-substituted regioisomers of amphetamine (AMP) and methamphetamine (MA) was performed by supercritical fluid chromatography (SFC). The behaviour of the retention against the changes of column temperature and co-solvent proportion was studied. The obtained information facilitated the optimization of the each regioisomer. As a result, 2-, 3-, and 4-ring-substituted analogues of AMP and MA with methyl, methoxy, fluoro, chloro, and bromo groups were separated, generally within 6 min. In addition, we found that the separation pattern of the examined regioisomers was classified into two, which depended on the electron donating/withdrawing effect of the substituent. Our results indicate that SFC could be used in forensic drug analysis for fast, reliable identification of structurally similar drugs of abuse. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Doubly 15N-substituted diazenylium: THz laboratory spectra and fractionation models
NASA Astrophysics Data System (ADS)
Dore, L.; Bizzocchi, L.; Wirström, E. S.; Degli Esposti, C.; Tamassia, F.; Charnley, S. B.
2017-07-01
Context. Isotopic fractionation in dense molecular cores has been suggested as a possible origin of large 14N/15N ratio variations in solar system materials. While chemical models can explain some observed variations with different fractionation patterns for molecules with -NH or -CN functional groups, they fail to reproduce the observed ratios in diazenylium (N2H+). Aims: Observations of doubly 15N-substituted species could provide important constraints and insights for theoretical chemical models of isotopic fractionation. However, spectroscopic data are very scarce. Methods: The rotational spectra of the fully 15N-substituted isopologues of the diazenylium ion, 15N2H+ and 15N2D+, have been investigated in the laboratory well into the THz region by using a source-modulation microwave spectrometer equipped with a negative glow discharge cell. An extended chemical reaction network has been used to estimate what ranges of 15N fractionation in doubly 15N-substituted species could be expected in the interstellar medium (ISM). Results: For each isotopologue of the H- and D-containing pair, nine rotational transitions were accurately measured in the frequency region 88 GHz-1.2 THz. The analysis of the spectrum provided very precise rest frequencies at millimeter and sub-millimeter wavelengths, useful for the radioastronomical identification of the rotational lines of 15N2H+ and 15N2D+ in the ISM.
Prokaryotic nucleotide composition is shaped by both phylogeny and the environment.
Reichenberger, Erin R; Rosen, Gail; Hershberg, Uri; Hershberg, Ruth
2015-04-09
The causes of the great variation in nucleotide composition of prokaryotic genomes have long been disputed. Here, we use extensive metagenomic and whole-genome data to demonstrate that both phylogeny and the environment shape prokaryotic nucleotide content. We show that across environments, various phyla are characterized by different mean guanine and cytosine (GC) values as well as by the extent of variation on that mean value. At the same time, we show that GC-content varies greatly as a function of environment, in a manner that cannot be entirely explained by disparities in phylogenetic composition. We find environmentally driven differences in nucleotide content not only between highly diverged environments (e.g., soil, vs. aquatic vs. human gut) but also within a single type of environment. More specifically, we demonstrate that some human guts are associated with a microbiome that is consistently more GC-rich across phyla, whereas others are associated with a more AT-rich microbiome. These differences appear to be driven both by variations in phylogenetic composition and by environmental differences-which are independent of these phylogenetic composition differences. Combined, our results demonstrate that both phylogeny and the environment significantly affect nucleotide composition and that the environmental differences affecting nucleotide composition are far subtler than previously appreciated. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Vernon, Robert M; Chong, P Andrew; Lin, Hong; Yang, Zhengrong; Zhou, Qingxian; Aleksandrov, Andrei A; Dawson, Jennifer E; Riordan, John R; Brouillette, Christie G; Thibodeau, Patrick H; Forman-Kay, Julie D
2017-08-25
Characterization of the second nucleotide-binding domain (NBD2) of the cystic fibrosis transmembrane conductance regulator (CFTR) has lagged behind research into the NBD1 domain, in part because NBD1 contains the F508del mutation, which is the dominant cause of cystic fibrosis. Research on NBD2 has also been hampered by the overall instability of the domain and the difficulty of producing reagents. Nonetheless, multiple disease-causing mutations reside in NBD2, and the domain is critical for CFTR function, because channel gating involves NBD1/NBD2 dimerization, and NBD2 contains the catalytically active ATPase site in CFTR. Recognizing the paucity of structural and biophysical data on NBD2, here we have defined a bioinformatics-based method for manually identifying stabilizing substitutions in NBD2, and we used an iterative process of screening single substitutions against thermal melting points to both produce minimally mutated stable constructs and individually characterize mutations. We present a range of stable constructs with minimal mutations to help inform further research on NBD2. We have used this stabilized background to study the effects of NBD2 mutations identified in cystic fibrosis (CF) patients, demonstrating that mutants such as N1303K and G1349D are characterized by lower stability, as shown previously for some NBD1 mutations, suggesting a potential role for NBD2 instability in the pathology of CF. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Das, A.; De, S.; Chatterjee, S.
2016-05-06
Tb and Co substituted bismuth ferrite nanoparticles (NPs) with chemical composition Bi{sub 1-x}Tb{sub x}Fe{sub 1-y}Co{sub y}O{sub 3} (x = 0, 0.05; y = 0, 0.05) have been synthesized by a sol-gel method and characterized by x-ray diffraction (XRD), Mossbauer spectroscopy, dc magnetization and electric polarization measurements. The aim of the present work is to improve ferroelectric properties of BiFeO{sub 3} by substitution of Tb{sup 3+} ions in Bi{sup 3+} site and magnetic properties by substitution of Co{sup 2+} in Fe{sup 3+} site. The XRD patterns of all prepared samples show formation of the desired phase along with a small amountmore » of impurity. Room temperature Mossbauer spectroscopic studies reveal that all samples are in magnetically ordered state. Magnetic hysteresis loops of all samples indicate a significant enhancement of magnetic moment and coercivity whereas electric polarization measurements at room temperature reveal an improvement of ferroelectric properties in the co-substituted sample.« less
Substitution in recreation choice behavior
George L. Peterson; Daniel J. Stynes; Donald H. Rosenthal; John F. Dwyer
1985-01-01
This review discusses concepts and theories of substitution in recreation choice. It brings together the literature of recreation research, psychology, geography, economics, and transportation. Parallel and complementary developments need integration into an improved theory of substitution. Recreation decision behavior is characterized as a nested or sequential choice...
Why Does Trigonometric Substitution Work?
ERIC Educational Resources Information Center
Cunningham, Daniel W.
2018-01-01
Modern calculus textbooks carefully illustrate how to perform integration by trigonometric substitution. Unfortunately, most of these books do not adequately justify this powerful technique of integration. In this article, we present an accessible proof that establishes the validity of integration by trigonometric substitution. The proof offers…
Tatarenkov, Andrey; Ayala, Francisco J
2007-08-01
We studied nucleotide sequence variation at the gene coding for dopa decarboxylase (Ddc) in seven populations of Drosophila melanogaster. Strength and pattern of linkage disequilibrium are somewhat distinct in the extensively sampled Spanish and Raleigh populations. In the Spanish population, a few sites are in strong positive association, whereas a large number of sites in the Raleigh population are associated nonrandomly but the association is not strong. Linkage disequilibrium analysis shows presence of two groups of haplotypes in the populations, each of which is fairly diverged, suggesting epistasis or inversion polymorphism. There is evidence of two forms of natural selection acting on Ddc. The McDonald-Kreitman test indicates a deficit of fixed amino acid differences between D. melanogaster and D. simulans, which may be due to negative selection. An excess of derived alleles at high frequency, significant according to the H-test, is consistent with the effect of hitchhiking. The hitchhiking may have been caused by directional selection downstream of the locus studied, as suggested by a gradual decrease of the polymorphism-to-divergence ratio. Altogether, the Ddc locus exhibits a complicated pattern of variation apparently due to several evolutionary forces. Such a complex pattern may be a result of an unusually high density of functionally important genes.
He, Wei; Herrick, Ildiko R; Atesin, Tulay A; Caruana, Patrick A; Kellenberger, Colleen A; Frontier, Alison J
2008-01-23
The impact of dienone substitution on the Nazarov cyclization has been examined in detail. Substrates bearing different substituents at each of four positions on the dienone backbone were systematically probed in order to identify trends leading to higher reactivity and better selectivity. Desymmetrization of the pentadienyl cation and oxyallyl cation intermediates through placement of polarizing groups at both the C-2 and C-4 positions was found to be particularly effective. These modifications allowed cyclizations to occur in the presence of catalytic amounts of mild Lewis acids. It was also found that stereoconvergent cyclization of mixtures of E and Z isomers of alkylidene beta-ketoesters occurred via an efficient isomerization process that occurred under the reaction conditions.
Gritsun, T S; Frolova, T V; Pogodina, V V; Lashkevich, V A; Venugopal, K; Gould, E A
1993-02-01
A strain of tick-borne encephalitis virus known as Vasilchenko (Vs) exhibits relatively low virulence characteristics in monkeys, Syrian hamsters and humans. The gene encoding the envelope glycoprotein of this virus was cloned and sequenced. Alignment of the sequence with those of other known tick-borne flaviviruses and identification of the recognised amino acid genetic marker EHLPTA confirmed its identity as a member of the TBE complex. However, Vs virus was distinguishable from eastern and western tick-borne serotypes by the presence of the sequence AQQ at amino acid positions 232-234 and also by the presence of other specific amino acid substitutions which may be genetic markers for these viruses and could determine their pathogenetic characteristics. When compared with other tick-borne flaviviruses, Vs virus had 12 unique amino acid substitutions including an additional potential glycosylation site at position (315-317). The Vs virus strain shared closest nucleotide and amino acid homology (84.5% and 95.5% respectively) with western and far eastern strains of tick-borne encephalitis virus. Comparison with the far eastern serotype of tick-borne encephalitis virus, by cross-immunoelectrophoresis of Vs virions and PAGE analysis of the extracted virion proteins, revealed differences in surface charge and virus stability that may account for the different virulence characteristics of Vs virus. These results support and enlarge upon previous data obtained from molecular and serological analysis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnson, Grant E.; Olivares, Astrid M.; Hill, David E.
2015-01-01
We present a systematic study of the effect of the number of methyl (Me) and cyclohexyl (Cy) functional groups in monodentate phosphine ligands on the solution-phase synthesis of ligated sub-nanometer gold clusters and their gas-phase fragmentation pathways. Small mixed ligand cationic gold clusters were synthesized using ligand exchange reactions between pre-formed triphenylphosphine ligated (PPh3) gold clusters and monodentate Me- and Cy-substituted ligands in solution and characterized using electrospray ionization mass spectrometry (ESI-MS) and collision-induced dissociation (CID) experiments. Under the same experimental conditions, larger gold-PPh3 clusters undergo efficient exchange of unsubstituted PPh3 ligands for singly Me- and Cy-substituted PPh2Me and PPh2Cymore » ligands. The efficiency of ligand exchange decreases with an increasing number of Me or Cy groups in the substituted phosphine ligands. CID experiments performed for a series of ligand-exchanged gold clusters indicate that loss of a neutral Me-substituted ligand is preferred over loss of a neutral PPh¬3 ligand while the opposite trend is observed for Cy-substituted ligands. The branching ratio of the competing ligand loss channels is strongly correlated with the electron donating ability of the phosphorous lone pair as determined by the relative proton affinity of the ligand. The results indicate that the relative ligand binding energies increase in the order PMe3 < PPhMe2 < PPh2Me < PPh3< PPh2Cy < PPhCy2< PCy3. Furthermore, the difference in relative ligand binding energies increases with the number of substituted PPh3-mMem or PPh3-mCym ligands (L) exchanged onto each cluster. This study provides the first experimental determination of the relative binding energies of ligated gold clusters containing differently substituted monophosphine ligands, which are important to controlling their synthesis and reactivity in solution. The results also indicate that ligand substitution is an important
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Butyl acrylate, polymer with... NEW USES OF CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.6920 Butyl... butyl acrylate, polymer with substituted methyl styrene, methyl methacrylate, and substituted silane...
Peng, Tao; Huang, Bingzhen; Sun, Yao; Lu, Yongbo; Bonewald, Lynda; Chen, Shuo; Butler, William T; Feng, Jerry Q; D'Souza, Rena N; Qin, Chunlin
2009-01-01
Dentin matrix protein 1 (DMP1) is present in the extracellular matrix (ECM) of dentin and bone as processed NH(2)- and COOH-terminal fragments, resulting from proteolytic cleavage at the NH(2) termini of 4 aspartic acid residues during rat DMP1 processing. One cleavage site residue, Asp(181) (corresponding to Asp(197) of mouse DMP1), and its flanking region are highly conserved across species. We speculate that cleavage at the NH(2) terminus of Asp(197) of mouse DMP1 represents an initial, first-step scission in the whole cascade of proteolytic processing. To test if Asp(197) is critical for initiating the proteolytic processing of mouse DMP1, we substituted Asp(197) with Ala(197) by mutating the corresponding nucleotides of mouse cDNA that encode this amino acid residue. This mutant DMP1 cDNA was cloned into a pcDNA3.1 vector. Data from transfection experiments indicated that this single substitution blocked the proteolytic processing of mouse DMP1 in HEK-293 cells, indicating that cleavage at the NH(2) terminus of Asp(197) is essential for exposing other cleavage sites for the conversion of DMP1 to its fragments. The NH(2)-terminal fragment of DMP1 occurs as a proteoglycan form (DMP1-PG) that contains a glycosaminoglycan (GAG) chain. Previously, we showed that a GAG chain is linked to Ser(74) in rat DMP1 (Ser(89) in mouse DMP1). To confirm that mouse DMP1-PG possesses a single GAG chain attached to Ser(89), we substituted Ser(89) by Gly(89). Data from transfection analysis indicated that this substitution completely prevented formation of the GAG-containing form, confirming that DMP1-PG contains a single GAG chain attached to Ser(89) in mouse DMP1. Copyright 2008 S. Karger AG, Basel.
Statistical analysis of nucleotide sequences of the hemagglutinin gene of human influenza A viruses.
Ina, Y; Gojobori, T
1994-01-01
To examine whether positive selection operates on the hemagglutinin 1 (HA1) gene of human influenza A viruses (H1 subtype), 21 nucleotide sequences of the HA1 gene were statistically analyzed. The nucleotide sequences were divided into antigenic and nonantigenic sites. The nucleotide diversities for antigenic and nonantigenic sites of the HA1 gene were computed at synonymous and nonsynonymous sites separately. For nonantigenic sites, the nucleotide diversities were larger at synonymous sites than at nonsynonymous sites. This is consistent with the neutral theory of molecular evolution. For antigenic sites, however, the nucleotide diversities at nonsynonymous sites were larger than those at synonymous sites. These results suggest that positive selection operates on antigenic sites of the HA1 gene of human influenza A viruses (H1 subtype). PMID:8078892
McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA
2007-02-06
Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA
2009-02-24
Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.
Dunn, Joshua G; Weissman, Jonathan S
2016-11-22
Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Copper complex of (substituted sulfonaphthyl azo substituted phenyl) disulfonaphthyl azo, amine salt (generic). 721.2577 Section 721.2577 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES OF CHEMICAL SUBSTANCES...
Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis.
Pisithkul, Tippapha; Jacobson, Tyler B; O'Brien, Thomas J; Stevenson, David M; Amador-Noguez, Daniel
2015-09-01
An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using (13)C-labeled sugars and [(15)N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. Copyright © 2015, Pisithkul et al.
Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis
Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; Stevenson, David M.
2015-01-01
An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. PMID:26070680
Phenolic amides are potent inhibitors of De Novo nucleotide biosynthesis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.
An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposuremore » leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [ 15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. Furthermore, the results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals.« less
Phenolic amides are potent inhibitors of De Novo nucleotide biosynthesis
Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; ...
2015-06-12
An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposuremore » leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [ 15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. Furthermore, the results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals.« less
Phosphorothioate backbone modifications of nucleotide-based drugs are potent platelet activators
Flierl, Ulrike; Nero, Tracy L.; Lim, Bock; Arthur, Jane F.; Yao, Yu; Jung, Stephanie M.; Gitz, Eelo; Pollitt, Alice Y.; Zaldivia, Maria T.K.; Jandrot-Perrus, Martine; Schäfer, Andreas; Nieswandt, Bernhard; Andrews, Robert K.; Parker, Michael W.; Gardiner, Elizabeth E.
2015-01-01
Nucleotide-based drug candidates such as antisense oligonucleotides, aptamers, immunoreceptor-activating nucleotides, or (anti)microRNAs hold great therapeutic promise for many human diseases. Phosphorothioate (PS) backbone modification of nucleotide-based drugs is common practice to protect these promising drug candidates from rapid degradation by plasma and intracellular nucleases. Effects of the changes in physicochemical properties associated with PS modification on platelets have not been elucidated so far. Here we report the unexpected binding of PS-modified oligonucleotides to platelets eliciting strong platelet activation, signaling, reactive oxygen species generation, adhesion, spreading, aggregation, and thrombus formation in vitro and in vivo. Mechanistically, the platelet-specific receptor glycoprotein VI (GPVI) mediates these platelet-activating effects. Notably, platelets from GPVI function–deficient patients do not exhibit binding of PS-modified oligonucleotides, and platelet activation is fully abolished. Our data demonstrate a novel, unexpected, PS backbone–dependent, platelet-activating effect of nucleotide-based drug candidates mediated by GPVI. This unforeseen effect should be considered in the ongoing development programs for the broad range of upcoming and promising DNA/RNA therapeutics. PMID:25646267
Liu, Hai-Chuan; Zhang, Xin-Hao; Wu, Yun-Dong; Yang, Shihe
2005-03-07
Complexes of fluorinated benzenes (o-C6H4-nF2+n) and Mg*+ are subjected to ultraviolet photodissociation (260-340 nm), producing efficiently benzyne radical cations (C6H4-nFn*+) besides Mg*+ and MgF+. We show that the consecutive dissociation of C6H4-nFn*+ follows the [C4(+) + C2] pattern exclusively for n < or = 2 after the parent complexes absorb one or two photons. However, the dissociation pattern is switched to [C5(+) + C1] and [C1 + C5] for n > or = 3. In particular, upon two-photon absorption at 340 nm by the complexes of Mg*+ (C6HF5) (1) and Mg*+ (C6F6) (2), photoproducts of CF+, C5H+, and C5HF*+ from C6HF3*+ and CF+, C5F+, C5F2*+, and C5F3+ from C6F4*+ are detected, respectively. Theoretical calculations are used to explain the switching of the dissociation patterns induced by the fluorine substitutions. It was found that the formation of C5+ + C1 is energetically more favorable than that of C4(+) + C2 from C6HF3*+ and C6F4*+ and of C1(+) + C5. Except for C5H2F(+) + CF, all the channels of [C5(+) + C1] and [C1(+) + C5] are energetically less favorable than those of [C4(+) + C2] from C6H3F*+ and C6H2F2*+. In most cases, the calculated results agree well with the experimental observations.
Semiconducting behavior of substitutionally doped bilayer graphene
NASA Astrophysics Data System (ADS)
Mousavi, Hamze; Khodadadi, Jabbar; Grabowski, Marek
2018-02-01
In the framework of the Green's functions approach, random tight-binding model and using the coherent potential approximation, electronic characteristics of the bilayer graphene are investigated by exploring various forms of substitutional doping of a single or both layers of the system by either boron and (or) nitrogen atoms. The results for displacement of the Fermi level resemble the behavior of acceptor or donor doping in a conventional semiconductor, dependent on the impurity type and concentration. The particular pattern of doping of just one layer with one impurity type is most efficient for opening a gap within the energy bands which could be tuned directly by impurity concentration. Doping both layers at the same time, each with one impurity type, leads to an anomaly whereby the gap decreases with increasing impurity concentration.
40 CFR 721.320 - Acrylamide-substituted epoxy.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Acrylamide-substituted epoxy. 721.320... Substances § 721.320 Acrylamide-substituted epoxy. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as acrylamide-substituted epoxy (PMN P-92-660...
40 CFR 721.320 - Acrylamide-substituted epoxy.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Acrylamide-substituted epoxy. 721.320... Substances § 721.320 Acrylamide-substituted epoxy. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as acrylamide-substituted epoxy (PMN P-92-660...
40 CFR 721.320 - Acrylamide-substituted epoxy.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Acrylamide-substituted epoxy. 721.320... Substances § 721.320 Acrylamide-substituted epoxy. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as acrylamide-substituted epoxy (PMN P-92-660...
40 CFR 721.320 - Acrylamide-substituted epoxy.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Acrylamide-substituted epoxy. 721.320... Substances § 721.320 Acrylamide-substituted epoxy. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as acrylamide-substituted epoxy (PMN P-92-660...
40 CFR 721.320 - Acrylamide-substituted epoxy.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Acrylamide-substituted epoxy. 721.320... Substances § 721.320 Acrylamide-substituted epoxy. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as acrylamide-substituted epoxy (PMN P-92-660...
Establishing a Child Care Substitute Caregiver System.
ERIC Educational Resources Information Center
Love, Lynne
Substitute caregivers are needed by day care centers in every state. Indeed, some areas are experiencing severe shortages of applicants for child care positions and short-term substitute work. This article describes problems encountered in current substitute caregiver systems and suggests ways of dealing with such problems. Specifically discussed…
Regulatory single nucleotide polymorphisms (rSNPs) at the promoters 1A and 1B of the human APC gene.
Matveeva, Marina Yu; Kashina, Elena V; Reshetnikov, Vasily V; Bryzgalov, Leonid O; Antontseva, Elena V; Bondar, Natalia P; Merkulova, Tatiana I
2016-12-22
Germline mutations in the coding sequence of the tumour suppressor APC gene give rise to familial adenomatous polyposis (which leads to colorectal cancer) and are associated with many other oncopathologies. The loss of APC function because of deletion of putative promoter 1A or 1B also results in the development of colorectal cancer. Since the regions of promoters 1A and 1B contain many single nucleotide polymorphisms (SNPs), the aim of this study was to perform functional analysis of some of these SNPs by means of an electrophoretic mobility shift assay (EMSA) and a luciferase reporter assay. First, it was shown that both putative promoters of APC (1A and 1B) drive transcription in an in vitro reporter experiment. From eleven randomly selected SNPs of promoter 1A and four SNPs of promoter 1B, nine and two respectively showed differential patterns of binding of nuclear proteins to oligonucleotide probes corresponding to alternative alleles. The luciferase reporter assay showed that among the six SNPs tested, the rs75612255 C allele and rs113017087 C allele in promoter 1A as well as the rs138386816 T allele and rs115658307 T allele in promoter 1B significantly increased luciferase activity in the human erythromyeloblastoid leukaemia cell line K562. In human colorectal cancer HCT-116 cells, none of the substitutions under study had any effect, with the exception of minor allele G of rs79896135 in promoter 1B. This allele significantly decreased the luciferase reporter's activity CONCLUSION: Our results indicate that many SNPs in APC promoters 1A and 1B are functionally relevant and that allele G of rs79896135 may be associated with the predisposition to colorectal cancer.
12 CFR 229.52 - Substitute check warranties.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Substitute check warranties. 229.52 Section 229.52 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE..., presents, or returns a substitute check (or a paper or electronic representation of a substitute check) for...
12 CFR 229.52 - Substitute check warranties.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 12 Banks and Banking 3 2011-01-01 2011-01-01 false Substitute check warranties. 229.52 Section 229.52 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE..., presents, or returns a substitute check (or a paper or electronic representation of a substitute check) for...
40 CFR 203.5 - Suitable substitute decision.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Suitable substitute decision. 203.5... PROGRAMS LOW-NOISE-EMISSION PRODUCTS § 203.5 Suitable substitute decision. (a) If the Administrator... decide whether such product is a suitable substitute for any class or model or product being purchased by...
Zinc and Carbonate Co-Substituted Nano-Hydroxyapatite
NASA Astrophysics Data System (ADS)
Girija, E. K.; Kumar, G. Suresh; Thamizhavel, A.
2011-07-01
Synthesis of Zn or CO32- substituted nano-hydroxyapatite (HA) and its physico-chemical properties have been well documented. However, the effects of the simultaneous substitution of Zn and CO32- in nano-HA have not been reported. In the present study, Zn and CO32- substitutions in nano HA independently and concurrently have been done by wet precipitation method and characterized by XRD and FT-IR for its phase purity and chemical homogeneity. Further modulations of the bioactivity and thermal stability of HA due to the substitutions have been studied.
Ha, Wai Y; Reid, David G; Kam, Wan L; Lau, Yuk Y; Sham, Wing C; Tam, Silvia Y K; Sin, Della W M; Mok, Chuen S
2011-05-25
Abalones ( Haliotis species) are a popular delicacy and commonly preserved in dried form either whole or in slices or small pieces for consumption in Asian countries. Driven by the huge profit from trading abalones, dishonest traders may substitute other molluscan species for processed abalone, of which the morphological characteristics are frequently lost in the processed form. For protection of consumer rights and law enforcement against fraud, there is a need for an effective methodology to differentiate between fake and genuine abalone. This paper describes a method (validated according to the international forensic guidelines provided by SWGDAM) for the identification of fake abalone species using forensically informative nucleotide sequence (FINS) analysis. A study of the local market revealed that many claimed "abalone slice" samples on sale are not genuine. The fake abalone samples were found to be either volutids of the genus Cymbium (93%) or the muricid Concholepas concholepas (7%). This is the first report of Cymbium species being used for the preparation and sale as "abalone" in dried sliced form in Hong Kong.
Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing
Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric
2017-01-01
AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457
The binding of glucose and nucleotides to hexokinase from Saccharomyces cerevisiae.
Woolfitt, A R; Kellett, G L; Hoggett, J G
1988-01-29
The binding of glucose, ADP and AdoPP[NH]P, to the native PII dimer and PII monomer and the proteolytically-modified SII monomer of hexokinase (ATP:D-hexose 6-phosphotransferase, EC 2.7.1.1) from Saccharomyces cerevisiae was monitored at pH 6.7 by the concomitant quenching of protein fluorescence. The data were analysed in terms of Qmax, the maximal quenching of fluorescence at saturating concentrations of ligand, and [L]0.5, the concentration of ligand at half-maximal quenching. No changes in fluorescence were observed with free enzyme and nucleotide alone. In the presence of saturating levels of glucose, Qmax induced by nucleotide was between 2 and 7%, and [L]0.5 was between 0.12 and 0.56 mM, depending on the nucleotide and enzyme species. Qmax induced by glucose alone was between 22 and 25%, while [L]0.5 was approx. 0.4 mM for either of the monomeric hexokinase forms and 3.4 for PII dimer. In the presence of 6 mM ADP or 2 mM AdoPP[NH]P, Qmax for glucose was increased by up to 4% and [L]0.5 was diminished 3-fold for hexokinase PII monomer, 6-fold for SII monomer, and 15-fold for PII dimer. The results are interpreted in terms of nucleotide-induced conformational change of hexokinase in the presence of glucose and synergistic binding interactions between glucose and nucleotide.
16 CFR 18.3 - Substitution of products.
Code of Federal Regulations, 2010 CFR
2010-01-01
... supply has been exhausted; and (2) The products substituted are of similar variety and of equal or... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Substitution of products. 18.3 Section 18.3... § 18.3 Substitution of products. With respect to industry products offered for sale by an industry...
Investigation of Cr substitution in Co ferrite (CoCrxFe2-xO4) using Mossbauer spectroscopy
NASA Astrophysics Data System (ADS)
Krieble, K.; Lo, C. C. H.; Melikhov, Y.; Snyder, J. E.
2006-04-01
Substitution of other metals for Fe in cobalt ferrite has been proposed as a method to tailor the magnetic and magnetoelastic properties for sensor and actuator applications [H. Zheng et al., Science 303, 661 (2004)]. However, to understand the effect of Cr substitution, one needs atomic-level information on the local environments and interactions of the transition-metal ions. In this study, Mossbauer spectroscopy was used to investigate the local environments of the Fe atoms in these materials. A series of five powder samples with compositions CoCrxFe2-xO4 (x=0.0 to 0.8) was investigated using transmission geometry. Results show two distinct six-line hyperfine patterns, indicating Fe in A and B spinel sites. Increasing Cr concentration is seen to decrease the hyperfine field strength for both A and B sites, as well as increasing the width of those distributions. Results for Cr substitution show generally similar behavior to a prior study using Mn; however, Cr substitution has more pronounced effects: the hyperfine fields decrease and distribution widths increase at greater rates for Cr substitution, and the differences between A and B site behavior are more pronounced. Results are consistent with a model in which Cr has an even stronger B-site preference than Mn, and displaces more of the Co from the B to the A sites.
Code of Federal Regulations, 2010 CFR
2010-07-01
... ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES OF CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.267 N-[2-[(substituted dinitrophenyl)azo]diallylamino-4- substituted phenyl] acetamide (generic name). (a) Chemical substance and...
Determinants of generic drug substitution in Switzerland.
Decollogny, Anne; Eggli, Yves; Halfon, Patricia; Lufkin, Thomas M
2011-01-26
Since generic drugs have the same therapeutic effect as the original formulation but at generally lower costs, their use should be more heavily promoted. However, a considerable number of barriers to their wider use have been observed in many countries. The present study examines the influence of patients, physicians and certain characteristics of the generics' market on generic substitution in Switzerland. We used reimbursement claims' data submitted to a large health insurer by insured individuals living in one of Switzerland's three linguistic regions during 2003. All dispensed drugs studied here were substitutable. The outcome (use of a generic or not) was modelled by logistic regression, adjusted for patients' characteristics (gender, age, treatment complexity, substitution groups) and with several variables describing reimbursement incentives (deductible, co-payments) and the generics' market (prices, packaging, co-branded original, number of available generics, etc.). The overall generics' substitution rate for 173,212 dispensed prescriptions was 31%, though this varied considerably across cantons. Poor health status (older patients, complex treatments) was associated with lower generic use. Higher rates were associated with higher out-of-pocket costs, greater price differences between the original and the generic, and with the number of generics on the market, while reformulation and repackaging were associated with lower rates. The substitution rate was 13% lower among hospital physicians. The adoption of the prescribing practices of the canton with the highest substitution rate would increase substitution in other cantons to as much as 26%. Patient health status explained a part of the reluctance to substitute an original formulation by a generic. Economic incentives were efficient, but with a moderate global effect. The huge interregional differences indicated that prescribing behaviours and beliefs are probably the main determinant of generic
Eastwood, Heather; Xia, Fang; Lo, Mei-Chu; Zhou, Jing; Jordan, John B; McCarter, John; Barnhart, Wesley W; Gahm, Kyung-Hyun
2015-11-10
Analysis of nucleotide sugars, nucleoside di- and triphosphates and sugar-phosphates is an essential step in the process of understanding enzymatic pathways. A facile and rapid separation method was developed to analyze these compounds present in an enzymatic reaction mixture utilized to produce nucleotide sugars. The Primesep SB column explored in this study utilizes hydrophobic interactions as well as electrostatic interactions with the phosphoric portion of the nucleotide sugars. Ammonium formate buffer was selected due to its compatibility with mass spectrometry. Negative ion mode mass spectrometry was adopted for detection of the sugar phosphate (fucose-1-phophate), as the compound is not amenable to UV detection. Various mobile phase conditions such as pH, buffer concentration and organic modifier were explored. The semi-preparative separation method was developed to prepare 30mg of the nucleotide sugar. (19)F NMR was utilized to determine purity of the purified fluorinated nucleotide sugar. The collected nucleotide sugar was found to be 99% pure. Published by Elsevier B.V.
Hydroxyapatite substituted by transition metals: experiment and theory.
Zilm, M E; Chen, L; Sharma, V; McDannald, A; Jain, M; Ramprasad, R; Wei, M
2016-06-28
Bioceramics are versatile materials for hard tissue engineering. Hydroxyapatite (HA) is a widely studied biomaterial for bone grafting and tissue engineering applications. The crystal structure of HA allows for a wide range of substitutions, which allows for tailoring materials properties. Transition metals and lanthanides are of interest since substitution in HA can result in magnetic properties. In this study, experimental results were compared to theoretical calculations of HA substituted with a transition metal. Calculation of a 10 atomic percent substitution of a transition metal ion Mn(2+), Fe(2+), and Co(2+) substituted HA samples lead to magnetic moments of 5, 4, and 3 Bohr magnetons, respectively. Hydroxyapatite substituted by transition metals (MHA) was fabricated through an ion exchange procedure and characterized with X-ray diffraction, Fourier transform infra-red spectroscopy (FTIR), X-ray photoelectron spectroscopy, and vibrating sample magnetometer, and results were compared to theoretical calculations. All the substitutions resulted in phase-pure M(2+)HA with lattice parameters and FTIR spectra in good agreement with calculations. Magnetic measurements revealed that the substitution of Mn(2+) has the greatest effect on the magnetic properties of HA followed by the substitution of Fe(2+) and then Co(2+). The present work underlines the power of synergistic theoretical-experimental work in guiding the rational design of materials.
Tan, Ene-Choo; Li, Haixia
2006-07-19
Most of the studies on single nucleotide variations are on substitutions rather than insertions/deletions. In this study, we examined the distribution and characteristics of single nucleotide insertions/deletions (SNindels), using data available from dbSNP for all the human chromosomes. There are almost 300,000 SNindels in the database, of which only 0.8% are validated. They occur at the frequency of 0.887 per 10 kb on average for the whole genome, or approximately 1 for every 11,274 bp. More than half occur in regions with mononucleotide repeats the longest of which is 47 bases. Overall the mononucleotide repeats involving C and G are much shorter than those for A and T. About 12% are surrounded by palindromes. There is general correlation between chromosome size and total number for each chromosome. Inter-chromosomal variation in density ranges from 0.6 to 21.7 per kilobase. The overall spectrum shows very high proportion of SNindel of types -/A and -/T at over 81%. The proportion of -/A and -/T SNindels for each chromosome is correlated to its AT content. Less than half of the SNindels are within or near known genes and even fewer (<0.183%) in coding regions, and more than 1.4% of -/C and -/G are in coding compared to 0.2% for -/A and -/T types. SNindels of -/A and -/T types make up 80% of those found within untranslated regions but less than 40% of those within coding regions. A separate analysis using the subset of 2324 validated SNindels showed slightly less AT bias of 74%, SNindels not within mononucleotide repeats showed even less AT bias at 58%. Density of validated SNindels is 0.007/10 kb overall and 90% are found within or near genes. Among all chromosomes, Y has the lowest numbers and densities for all SNindels, validated SNindels, and SNindels not within repeats.
Study on Base Management Pattern of Food Producing Enterprise
NASA Astrophysics Data System (ADS)
Zhang, Weibin
When the food producing enterprises often comply with food safety regulations and industry management system passively, we need to consider can they transform their production and business pattern in order to avoid the food safety incidents completely? The answer is yes. The food producing enterprises can develop to the two directions of material planting and products in circulation through base management pattern substituting for the original operation pattern of in-plant processing and outside sales. The food producing enterprises should establish coordination and safe supervision mechanisms in order to achieve the management objectives of unified production, controllable risks and scale magnitude.
Synthesis, salvage, and catabolism of uridine nucleotides in boron-deficient squash roots.
Lovatt, C J; Albert, L S; Tremblay, G C
1981-12-01
Previous work has provided evidence that plants may require boron to maintain adequate levels of pyrimidine nucleotides, suggesting that the state of boron deficiency may actually be one of pyrimidine starvation. Since the availability of pyrimidine nucleotides is influenced by their rates of synthesis, salvage, and catabolism, we compared these activities in the terminal 3 centimeters of roots excised from boron-deficient and -sufficient squash plants (Cucurbita pepo L.). Transferring 5-day-old squash plants to a boron-deficient nutrient solution resulted in cessation of root elongation within 18 hours. However, withholding boron for up to 30 hours did not result in either impaired de novo pyrimidine biosynthesis or a change in the sensitivity of the de novo pathway to regulation by end product inhibition. Boron deprivation had no significant effect on pyrimidine salvage or catabolism. These results provide evidence that boron-deficient plants are not starved for uridine nucleotides collectively. Whether a particular pyrimidine nucleotide or derivative is limiting during boron deprivation remains to be examined.
Regulation of Endothelial Barrier Function by Cyclic Nucleotides: The Role of Phosphodiesterases
Surapisitchat, James
2014-01-01
The endothelium plays an important role in maintaining normal vascular function. Endothelial barrier dysfunction leading to increased permeability and vascular leakage is associated with several pathological conditions such as edema and sepsis. Thus, the development of drugs that improve endothelial barrier function is an active area of research. In this chapter, the current knowledge concerning the signaling pathways regulating endothelial barrier function is discussed with a focus on cyclic nucleotide second messengers (cAMP and cGMP) and cyclic nucleotide phosphodiesterases (PDEs). Both cAMP and cGMP have been shown to have differential effects on endothelial permeability in part due to the various effector molecules, crosstalk, and compartmentalization of cyclic nucleotide signaling. PDEs, by controlling the amplitude, duration, and localization of cyclic nucleotides, have been shown to play a critical role in regulating endothelial barrier function. Thus, PDEs are attractive drug targets for the treatment of disease states involving endothelial barrier dysfunction. PMID:21695641
Regulation of endothelial barrier function by cyclic nucleotides: the role of phosphodiesterases.
Surapisitchat, James; Beavo, Joseph A
2011-01-01
The endothelium plays an important role in maintaining normal vascular function. Endothelial barrier dysfunction leading to increased permeability and vascular leakage is associated with several pathological conditions such as edema and sepsis. Thus, the development of drugs that improve endothelial barrier function is an active area of research. In this chapter, the current knowledge concerning the signaling pathways regulating endothelial barrier function is discussed with a focus on cyclic nucleotide second messengers (cAMP and cGMP) and cyclic nucleotide phosphodiesterases (PDEs). Both cAMP and cGMP have been shown to have differential effects on endothelial permeability in part due to the various effector molecules, crosstalk, and compartmentalization of cyclic nucleotide signaling. PDEs, by controlling the amplitude, duration, and localization of cyclic nucleotides, have been shown to play a critical role in regulating endothelial barrier function. Thus, PDEs are attractive drug targets for the treatment of disease states involving endothelial barrier dysfunction.
Schultz, Eric P.; Vasquez, Ernesto E.; Scott, William G.
2014-01-01
The hammerhead ribozyme catalyzes RNA cleavage via acid–base catalysis. Whether it does so by general acid–base catalysis, in which the RNA itself donates and abstracts protons in the transition state, as is typically assumed, or by specific acid–base catalysis, in which the RNA plays a structural role and proton transfer is mediated by active-site water molecules, is unknown. Previous biochemical and crystallographic experiments implicate an invariant purine in the active site, G12, as the general base. However, G12 may play a structural role consistent with specific base catalysis. To better understand the role of G12 in the mechanism of hammerhead catalysis, a 2.2 Å resolution crystal structure of a hammerhead ribozyme from Schistosoma mansoni with a purine substituted for G12 in the active site of the ribozyme was obtained. Comparison of this structure (PDB entry 3zd4), in which A12 is substituted for G, with three previously determined structures that now serve as important experimental controls, allows the identification of structural perturbations that are owing to the purine substitution itself. Kinetic measurements for G12 purine-substituted schistosomal hammerheads confirm a previously observed dependence of rate on the pK a of the substituted purine; in both cases inosine, which is similar to G in pK a and hydrogen-bonding properties, is unexpectedly inactive. Structural comparisons indicate that this may primarily be owing to the lack of the exocyclic 2-amino group in the G12A and G12I substitutions and its structural effect upon both the nucleotide base and phosphate of A9. The latter involves the perturbation of a previously identified and well characterized metal ion-binding site known to be catalytically important in both minimal and full-length hammerhead ribozyme sequences. The results permit it to be suggested that G12 plays an important role in stabilizing the active-site structure. This result, although not inconsistent with the
Schultz, Eric P; Vasquez, Ernesto E; Scott, William G
2014-09-01
The hammerhead ribozyme catalyzes RNA cleavage via acid-base catalysis. Whether it does so by general acid-base catalysis, in which the RNA itself donates and abstracts protons in the transition state, as is typically assumed, or by specific acid-base catalysis, in which the RNA plays a structural role and proton transfer is mediated by active-site water molecules, is unknown. Previous biochemical and crystallographic experiments implicate an invariant purine in the active site, G12, as the general base. However, G12 may play a structural role consistent with specific base catalysis. To better understand the role of G12 in the mechanism of hammerhead catalysis, a 2.2 Å resolution crystal structure of a hammerhead ribozyme from Schistosoma mansoni with a purine substituted for G12 in the active site of the ribozyme was obtained. Comparison of this structure (PDB entry 3zd4), in which A12 is substituted for G, with three previously determined structures that now serve as important experimental controls, allows the identification of structural perturbations that are owing to the purine substitution itself. Kinetic measurements for G12 purine-substituted schistosomal hammerheads confirm a previously observed dependence of rate on the pK(a) of the substituted purine; in both cases inosine, which is similar to G in pK(a) and hydrogen-bonding properties, is unexpectedly inactive. Structural comparisons indicate that this may primarily be owing to the lack of the exocyclic 2-amino group in the G12A and G12I substitutions and its structural effect upon both the nucleotide base and phosphate of A9. The latter involves the perturbation of a previously identified and well characterized metal ion-binding site known to be catalytically important in both minimal and full-length hammerhead ribozyme sequences. The results permit it to be suggested that G12 plays an important role in stabilizing the active-site structure. This result, although not inconsistent with the potential
Dehalogenation of aromatics by nucleophilic aromatic substitution.
Sadowsky, Daniel; McNeill, Kristopher; Cramer, Christopher J
2014-09-16
Nucleophilic aromatic substitution has been implicated as a mechanism for both the biotic and abiotic hydrodehalogenation of aromatics. Two mechanisms for the aqueous dehalogenation of aromatics involving nucleophilic aromatic substitution with hydride as a nucleophile are investigated using a validated density functional and continuum solvation protocol. For chlorinated and brominated aromatics, nucleophilic addition ortho to carbon-halogen bonds via an anionic intermediate is predicted to be the preferred mechanism in the majority of cases, while concerted substitution is predicted to be preferred for most fluorinated aromatics. Nucleophilic aromatic substitution reactions with the hydroxide and hydrosulfide anions as nucleophiles are also investigated and compared.
Padilla, Jennifer E; Liu, Wenyan; Seeman, Nadrian C
2012-06-01
We introduce a hierarchical self assembly algorithm that produces the quasiperiodic patterns found in the Robinson tilings and suggest a practical implementation of this algorithm using DNA origami tiles. We modify the abstract Tile Assembly Model, (aTAM), to include active signaling and glue activation in response to signals to coordinate the hierarchical assembly of Robinson patterns of arbitrary size from a small set of tiles according to the tile substitution algorithm that generates them. Enabling coordinated hierarchical assembly in the aTAM makes possible the efficient encoding of the recursive process of tile substitution.
[Delegation yes, substitution no!].
Schroeder, A
2014-08-01
The aging of society leads on the one hand to increasing case numbers and on the other hand to a reduction in the number of physicians available for patient treatment. The delegation and substitution of medical duties as a tried and tested method is increasingly being recommended in order to compensate for the lack of physicians. The Berufsverband der Deutschen Urologen (BDU, Professional Association of German Urologists) supports the guiding principle of the Bundesärztekammer (Federal Medical Council) of "delegation yes, substitution no" and rejects a substitution of medical duties by non-medical academic health personnel. Against the background of the demographic changes, the increasing need for treatment and the current deficiency of junior physicians, a more extensive inclusion of well-qualified and experienced non-medical personnel by the delegation of medically responsible duties (medical scope of practice) can be an appropriate measure to maintain a good medical service in practices, hospitals and nursing homes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bobak, D.A.; Nightingale, M.S.; Murtagh, J.J.
1989-08-01
ADP-ribosylation factors (ARFs) are small guanine nucleotide-binding proteins that enhance the enzymatic activities of cholera toxin. Two ARF cDNAs, ARF1 and ARF3, were cloned from a human cerebellum library. Based on deduced amino acid sequences and patterns of hybridization of cDNA and oligonucleotide probes with mammalian brain poly(A){sup +} RNA, human ARF1 is the homologue of bovine ARF1. Human ARF3, which differs from bovine ARF1 and bovine ARF2, appears to represent a newly identified third type of ARF. Hybridization patterns of human ARF cDNA and clone-specific oligonucleotides with poly(A){sup +} RNA are consistent with the presence of at least two,more » and perhaps four, separate ARF messages in human brain. In vitro translation of ARF1, ARF2, and ARF3 produced proteins that behaved, by SDS/PAGE, similar to a purified soluble brain ARF. Deduced amino acid sequences of human ARF1 and ARF3 contain regions, similar to those in other G proteins, that are believed to be involved in GTP binding and hydrolysis. ARFS also exhibit a modest degree of homology with a bovine phospholipase C. The observations reported here support the conclusion that the ARFs are members of a multigene family of small guanine nucleotide-binding proteins. Definition of the regulation of ARF mRNAs and of function(s) of recombinant ARF proteins will aid in the elucidation of the physiologic role(s) of ARFs.« less
2012-01-01
Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836
Energy prices and substitution in United States manufacturing plants
NASA Astrophysics Data System (ADS)
Grim, Cheryl
Persistent regional disparities in electricity prices, growth in wholesale power markets, and recent deregulation attempts have intensified interest in the performance of the U.S. electric power industry, while skyrocketing fuel prices have brought renewed interest in the effect of changes in prices of all energy types on the U.S. economy. This dissertation examines energy prices and substitution between energy types in U.S. manufacturing. I use a newly constructed database that includes information on purchased electricity and electricity expenditures for more than 48,000 plants per year and additional data on the utilities that supply electricity to study the distribution of electricity prices paid by U.S. manufacturing plants from 1963 to 2000. I find a large compression in the dispersion of electricity prices from 1963 to 1978 due primarily to a decrease in quantity discounts for large electricity purchasers. I also find that spatial dispersion in retail electricity prices among states, counties and utility service territories is large, rises over time for smaller purchasers, and does not diminish as wholesale power markets expand in the 1990s. In addition, I examine energy type consumption patterns, prices, and substitution in U.S. manufacturing plants. I develop a plant-level dataset for 1998 with data on consumption and expenditures on energy and non-energy production inputs, output, and other plant characteristics. I find energy type consumption patterns vary widely across manufacturing plants. Further, I find a large amount of dispersion across plants in the prices paid for electricity, oil, natural gas, and coal. These high levels of dispersion are accounted for by the plant's location, industry, and purchase quantity. Finally, I present estimates of own- and cross-price elasticities of demand for both the energy and non-energy production inputs.
Tamir, Orly; Halkin, Hillel; Shemer, Joshua
2006-09-01
The rapidly rising health care expenditures, attributed mainly to the high cost of prescription drugs, have led governments around the world to look to generics as a means of containing costs in the pharmaceutical market. Generic drugs provide a less expensive alternative to brand name drugs due to the elimination of the need to perform lengthy and costly clinical trials, as required for innovative drugs. Essentially, generic substitution of drugs may be performed only after showing unequivocally that the generic formulation is identical in its active ingredients, strength, and route of administration as its innovative counterpart, and that they are bioequivalent to each other. Although the two are in essence the same, generic substitution is occasionally a controversial matter.
Structural, magnetic, and Mössbauer spectroscopy of Cu substituted M-type hexaferrites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Awadallah, Ahmad, E-mail: ahmadmoh@yahoo.co; Mahmood, Sami H., E-mail: s.mahmood@ju.edu.jo; Maswadeh, Yazan, E-mail: nawabra251@gmail.com
2016-02-15
Highlights: • Single BaM hexaferrite structural phases with Cu substations were prepared. • The magnetocrystalline anisotropy decreased with Cu substitution. • The coercivity was significantly modified while the magnetization remained high. • Hexaferrites with 0.2–0.4 Cu possess properties suitable for magnetic recording. • Ionic distributions from structural refinement agreed with Mössbauer spectroscopy. - Abstract: BaFe{sub 12−x}Cu{sub x}O{sub 19} hexaferrites were prepared using ball milling and sintering at 1100 °C. Refinement of the X-ray diffraction patterns was carried out to determine the structural parameters and the ionic distribution over the crystallographic sites. The preferential site occupation and valence state of Cumore » was consistent with the results obtained from the analysis of Mössbauer spectra. Further, the magnetic parameters of the samples were discussed in light of the structural and Mössbauer analyses. The magnetic phase transition temperature was found to decrease with the level of Cu substitution, in accordance with the reduction of the superexchange interactions. Further, the magnetic softening of the hexaferrite and the significant reduction in magnetocrystalline anisotropy with Cu substitution was consistent with the ionic distribution in the lattice. This study clearly demonstrated the feasibility of using a simple method to fabricate hexaferrites with a modified coercivity, while maintain the saturation magnetization high enough for practical applications.« less
Improved treatment of nucleosides and nucleotides in the OPLS-AA force field
NASA Astrophysics Data System (ADS)
Robertson, Michael J.; Tirado-Rives, Julian; Jorgensen, William L.
2017-09-01
DFT calculations have been used to develop improved descriptions of the torsional energetics for nucleosides and nucleotides in the OPLS-AA force field. Scans of nucleotide dihedral angles (γ, χ, and β) and methyl phosphates provided the bases for the new torsional parameters. In addition, the angle-bending parameters of phosphodiesters and ribose were updated, and adjustments were made to existing carbohydrate torsions to better capture the sugar puckering landscape of ribose. MD simulations of nucleosides with the new parameters demonstrate a significant improvement in the ribose sugar puckering and χ angle distributions. Additionally, energy-minimization of protein-nucleotide crystal structures with the new parameters produced accurate poses.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 40 Protection of Environment 32 2013-07-01 2013-07-01 false 1,4-Butanediol, polymer with... Substances § 721.10626 1,4-Butanediol, polymer with substituted alkane and substituted methylene... subject to reporting. (1) The chemical substance identified generically as 1,4-butanediol, polymer with...
Cuomo, Francesca; Mosca, Monica; Murgia, Sergio; Avino, Pasquale; Ceglie, Andrea; Lopez, Francesco
2013-11-15
In this work, the interaction of nucleotide-monophosphates (NMPs) with unilamellar liposomes made of 1,2-Dioleoyl-3-Trimethylammonium-Propane (DOTAP) and 1,2-Dioleoyl-sn-Glycero-3-Phosphoethanolamine (DOPE) was investigated. Here, we demonstrate how adsorption is affected by the type of nucleotide-monophosphate. Dynamic light scattering (DLS) results revealed, for each NMP, that a distinguishable concentration exists at which a significant growth of the aggregates occurs. Adenosine 5'-monophosphate (AMP) and guanosine 5'-monophosphate (GMP) have shown a higher propensity to induce liposome aggregation process and in particular GMP appears to be the most effective. From ζ-potential experiments we found that liposomes loaded with purine based nucleotides (AMP and GMP) are able to decrease the ζ-potential values to a greater extent in comparison with the pyrimidine based nucleotides thimydine 5'-monophosphate (TMP) and uridine 5'-monophosphate (UMP). Moreover, a careful analysis of nucleotide-liposome interactions revealed that nucleotides have different capacity to induce the formation of nucleotide-liposome complexes, and purine based nucleotides have higher affinities with lipid membranes. On the whole, the data emphasize that the mechanisms driving the interactions between liposomes and NMPs are also influenced by the existence of hydrophobic forces. Copyright © 2013 Elsevier Inc. All rights reserved.
The possible role of human milk nucleotides as sleep inducers.
Sánchez, Cristina L; Cubero, Javier; Sánchez, Javier; Chanclón, Belén; Rivero, Montserrat; Rodríguez, Ana B; Barriga, Carmen
2009-02-01
Breast-milk contains a potent mixture of diverse components, such as the non-protein nitrogen fraction which includes nucleotides, whose variation in levels is evident throughout lactation. In addition, these substances play an important role in sleep homeostasis. In the present study, human milk samples were analyzed using a capillary electrophoresis system. The rhythmicity of each nucleotide was studied by cosinor analysis. It was found that the nucleotides 5'AMP, 5'GMP, 5'CMP, and 5'IMP have significant (P < 0.05) circadian rhythms, the acrophases of the first two being during the night, and of the latter two during the day. While 5'UMP did not show a clear circadian rhythm, there was an increase in its levels at night. In conclusion, the rise in nocturnal levels of 5'AMP, 5'GMP, and 5'UMP could be involved in inducing the 'hypnotic' action of breast-milk at night in the infant.
Scale-free effect of substitution networks
NASA Astrophysics Data System (ADS)
Li, Ziyu; Yu, Zhouyu; Xi, Lifeng
2018-02-01
In this paper, we construct the growing networks in terms of substitution rule. Roughly speaking, we replace edges of different colors with different initial graphs. Then the evolving networks are constructed. We obtained the free-scale effect of our substitution networks.
Interaction between macrocyclic nickel complexes and the nucleotides GMP, AMP and ApG.
Liu, Yangzhong; Sletten, Einar
2003-01-15
Reactions between the nucleotides GMP, AMP and ApG and the complexes Ni(tren), Ni(cyclam) and NiCR in aqueous solution have been monitored by (1)H, (15)N NMR and UV spectroscopy. The three nickel complexes display different properties in reactions with nucleotides. Ni(tren) which has a pseudo-octahedral coordination geometry was shown to bind to all three nucleotides. Ni(cyclam) and NiCR, both with four nitrogen atoms in a square planar arrangement are not able to bind to nucleotides efficiently because of steric hindrance. Oxidation of Ni(cyclam) by KHSO(5) to produce trivalent Ni(III)(cyclam) improves the coordination capacity, while oxidation of NiCR does not produce a similar effect. The nucleotides interact with trivalent nickel complexes to different extent. Ni(III)CR is seen to oxidize GMP gradually but does not affect AMP significantly. Ni(III)(cyclam), on the other hand, does not oxidize either GMP or AMP at the 1:1 concentration of oxidant used. This result is probably due to the lower redox potential of Ni(cyclam). ApG binds less efficiently to the Ni complexes but is easier oxidized than the mononucleotides.
Genetics and Genomics of Longitudinal Lung Function Patterns in Individuals with Asthma
Yates, Katherine P.; Zhou, Xiaobo; Guo, Feng; Sternberg, Alice L.; Van Natta, Mark L.; Wise, Robert A.; Szefler, Stanley J.; Sharma, Sunita; Kho, Alvin T.; Cho, Michael H.; Croteau-Chonka, Damien C.; Castaldi, Peter J.; Jain, Gaurav; Sanyal, Amartya; Zhan, Ye; Lajoie, Bryan R.; Dekker, Job; Stamatoyannopoulos, John; Covar, Ronina A.; Zeiger, Robert S.; Adkinson, N. Franklin; Williams, Paul V.; Kelly, H. William; Grasemann, Hartmut; Vonk, Judith M.; Koppelman, Gerard H.; Postma, Dirkje S.; Raby, Benjamin A.; Houston, Isaac; Lu, Quan; Fuhlbrigge, Anne L.; Tantisira, Kelan G.; Silverman, Edwin K.; Tonascia, James; Strunk, Robert C.; Weiss, Scott T.
2016-01-01
Rationale: Patterns of longitudinal lung function growth and decline in childhood asthma have been shown to be important in determining risk for future respiratory ailments including chronic airway obstruction and chronic obstructive pulmonary disease. Objectives: To determine the genetic underpinnings of lung function patterns in subjects with childhood asthma. Methods: We performed a genome-wide association study of 581 non-Hispanic white individuals with asthma that were previously classified by patterns of lung function growth and decline (normal growth, normal growth with early decline, reduced growth, and reduced growth with early decline). The strongest association was also measured in two additional cohorts: a small asthma cohort and a large chronic obstructive pulmonary disease metaanalysis cohort. Interaction between the genomic region encompassing the most strongly associated single-nucleotide polymorphism and nearby genes was assessed by two chromosome conformation capture assays. Measurements and Main Results: An intergenic single-nucleotide polymorphism (rs4445257) on chromosome 8 was strongly associated with the normal growth with early decline pattern compared with all other pattern groups (P = 6.7 × 10−9; odds ratio, 2.8; 95% confidence interval, 2.0–4.0); replication analysis suggested this variant had opposite effects in normal growth with early decline and reduced growth with early decline pattern groups. Chromosome conformation capture experiments indicated a chromatin interaction between rs4445257 and the promoter of the distal CSMD3 gene. Conclusions: Early decline in lung function after normal growth is associated with a genetic polymorphism that may also protect against early decline in reduced growth groups. Clinical trial registered with www.clinicaltrials.gov (NCT00000575). PMID:27367781
Stephens, E B; Mukherjee, S; Sahni, M; Zhuge, W; Raghavan, R; Singh, D K; Leung, K; Atkinson, B; Li, Z; Joag, S V; Liu, Z Q; Narayan, O
1997-05-12
We have examined both the sequence changes in the LTR, gag, vif, vpr, vpx, tat, rev, vpu, env, and nef genes and the cell tropism of a cell-free stock of chimeric simian-human immunodeficiency virus (SHIV) isolated from the cerebrospinal fluid of a pig-tailed macaque (PNb) that developed AIDS. This virus (SHIVKU-1) is highly pathogenic when inoculated into other macaques. DNA sequence analysis of PCR-amplified products revealed a total of 5 nucleotide changes in the LTR while vif had 2 consensus amino acid changes. The gag, vif, and vpx had no consensus amino acid substitutions, whereas vpr had 1 consensus substitution. The tat and rev genes of the HXB2 region of SHIVKU-1 had 2 and 1 consensus amino acid changes, respectively. The vpu gene of the HXB2 region of SHIV, which originally had an ACG at the beginning of the gene, reverted to an initiation ATG codon and in addition contained a consensus amino acid substitution at position 69 of this protein. As expected, the majority of the nucleotide substitutions were found in the env and nef genes. Thirteen and 5 amino acid changes were predicted for the corresponding Env and Nef proteins, respectively. In addition, one-third of the env gene clones isolated from the SHIVKU-1 stock had a 5-amino-acid deletion in the V4 region. Using three independent assays, we determined that the changes in the SHIVKU-1 were associated with an increase in the efficiency of replication in macrophages. The strikingly few consensus changes in the virus suggest that conversion of this virus to one capable of causing AIDS in pig-tailed macaques was associated with relatively few changes in the viral envelope and/or accessory genes. These results will provide the basis for the development of a pathogenic, molecular clone of SHIV capable of causing AIDS in pig-tailed macaques.
Ghosh, Supratim; Mallick, Sumana; Das, Upasana; Verma, Ajay; Pal, Uttam; Chatterjee, Sabyasachi; Nandy, Abhishek; Saha, Krishna D; Maiti, Nakul Chandra; Baishya, Bikash; Suresh Kumar, G; Gmeiner, William H
2018-03-01
We report, based on biophysical studies and molecular mechanical calculations that curcumin binds DNA hairpin in the minor groove adjacent to the loop region forming a stable complex. UV-Vis and fluorescence spectroscopy indicated interaction of curcumin with DNA hairpin. In this novel binding motif, two ɣ H of curcumin heptadiene chain are closely positioned to the A 16 -H8 and A 17 -H8, while G 12 -H8 is located in the close proximity of curcumin α H. Molecular dynamics (MD) simulations suggest, the complex is stabilized by noncovalent forces including; π-π stacking, H-bonding and hydrophobic interactions. Nuclear magnetic resonance (NMR) spectroscopy in combination with molecular dynamics simulations indicated curcumin is bound in the minor groove, while circular dichroism (CD) spectra suggested minute enhancement in base stacking and a little change in DNA helicity, without significant conformational change of DNA hairpin structure. The DNA:curcumin complex formed with FdU nucleotides rather than Thymidine, demonstrated enhanced cytotoxicity towards oral cancer cells relative to the only FdU substituted hairpin. Fluorescence co-localization demonstrated stability of the complex in biologically relevant conditions, including its cellular uptake. Acridine orange/EtBr staining further confirmed the enhanced cytotoxic effects of the complex, suggesting apoptosis as mode of cell death. Thus, curcumin can be noncovalently complexed to small DNA hairpin for cellular delivery and the complex showed increased cytotoxicity in combination with FdU nucleotides, demonstrating its potential for advanced cancer therapy. Copyright © 2017 Elsevier B.V. All rights reserved.
Hu, Jianping; Hu, Ziheng; Zhang, Yan; Gou, Xiaojun; Mu, Ying; Wang, Lirong; Xie, Xiang-Qun
2017-01-01
Nucleotide excision repair (NER) is a pivotal life process for repairing DNA nucleotide mismatch caused by chemicals, metal ions, radiation, and other factors. As the initiation step of NER, the xeroderma pigmentosum complementation group A protein (XPA) recognizes damaged DNA molecules, and recruits the replication protein A (RPA), another important player in the NER process. The stability of the Zn2+-chelated Zn-finger domain of XPA center core portion (i.e., XPA98–210) is the foundation of its biological functionality, while the displacement of the Zn2+ by toxic metal ions (such as Ni2+, a known human carcinogen and allergen) may impair the effectiveness of NER and hence elevate the chance of carcinogenesis. In this study, we first calculated the force field parameters for the bonded model in the metal center of the XPA98–210 system, showing that the calculated results, including charges, bonds, angles etc., are congruent with previously reported results measured by spectrometry experiments and quantum chemistry computation. Then, comparative molecular dynamics simulations using these parameters revealed the changes in the conformation and motion mode of XPA98–210 Zn-finger after the substitution of Zn2+ by Ni2+. The results showed that Ni2+ dramatically disrupted the relative positions of the four Cys residues in the Zn-finger structure, forcing them to collapse from a tetrahedron into an almost planar structure. Finally, we acquired the binding mode of XPA98–210 with its ligands RPA70N and DNA based on molecular docking and structural alignment. We found that XPA98–210’s Zn-finger domain primarily binds to a V-shaped cleft in RPA70N, while the cationic band in its C-terminal subdomain participates in the recognition of damaged DNA. In addition, this article sheds light on the multi-component interaction pattern among XPA, DNA, and other NER-related proteins (i.e., RPA70N, RPA70A, RPA70B, RPA70C, RPA32, and RPA14) based on previously reported
Källman, Thomas; De Mita, Stéphane; Larsson, Hanna; Gyllenstrand, Niclas; Heuertz, Myriam; Parducci, Laura; Suyama, Yoshihisa; Lagercrantz, Ulf; Lascoux, Martin
2014-01-01
The ability of plants to track seasonal changes is largely dependent on genes assigned to the photoperiod pathway, and variation in those genes is thereby important for adaptation to local day length conditions. Extensive physiological data in several temperate conifer species suggest that populations are adapted to local light conditions, but data on the genes underlying this adaptation are more limited. Here we present nucleotide diversity data from 19 genes putatively involved in photoperiodic response in Norway spruce (Picea abies). Based on similarity to model plants the genes were grouped into three categories according to their presumed position in the photoperiod pathway: photoreceptors, circadian clock genes, and downstream targets. An HKA (Hudson, Kreitman and Aquade) test showed a significant excess of diversity at photoreceptor genes, but no departure from neutrality at circadian genes and downstream targets. Departures from neutrality were also tested with Tajima's D and Fay and Wu's H statistics under three demographic scenarios: the standard neutral model, a population expansion model, and a more complex population split model. Only one gene, the circadian clock gene PaPRR3 with a highly positive Tajima's D value, deviates significantly from all tested demographic scenarios. As the PaPRR3 gene harbours multiple non-synonymous variants it appears as an excellent candidate gene for control of photoperiod response in Norway spruce. PMID:24810273
Källman, Thomas; De Mita, Stéphane; Larsson, Hanna; Gyllenstrand, Niclas; Heuertz, Myriam; Parducci, Laura; Suyama, Yoshihisa; Lagercrantz, Ulf; Lascoux, Martin
2014-01-01
The ability of plants to track seasonal changes is largely dependent on genes assigned to the photoperiod pathway, and variation in those genes is thereby important for adaptation to local day length conditions. Extensive physiological data in several temperate conifer species suggest that populations are adapted to local light conditions, but data on the genes underlying this adaptation are more limited. Here we present nucleotide diversity data from 19 genes putatively involved in photoperiodic response in Norway spruce (Picea abies). Based on similarity to model plants the genes were grouped into three categories according to their presumed position in the photoperiod pathway: photoreceptors, circadian clock genes, and downstream targets. An HKA (Hudson, Kreitman and Aquade) test showed a significant excess of diversity at photoreceptor genes, but no departure from neutrality at circadian genes and downstream targets. Departures from neutrality were also tested with Tajima's D and Fay and Wu's H statistics under three demographic scenarios: the standard neutral model, a population expansion model, and a more complex population split model. Only one gene, the circadian clock gene PaPRR3 with a highly positive Tajima's D value, deviates significantly from all tested demographic scenarios. As the PaPRR3 gene harbours multiple non-synonymous variants it appears as an excellent candidate gene for control of photoperiod response in Norway spruce.
Nucleotide sequencing and identification of some wild mushrooms.
Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari
2013-01-01
The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.
40 CFR 721.4365 - Substituted ethoxylated hydrocarbon (generic).
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Substituted ethoxylated hydrocarbon... Specific Chemical Substances § 721.4365 Substituted ethoxylated hydrocarbon (generic). (a) Chemical... as Substituted ethoxylated hydrocarbon (PMN P-99-0313) is subject to reporting under this section for...
40 CFR 721.4365 - Substituted ethoxylated hydrocarbon (generic).
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Substituted ethoxylated hydrocarbon... Specific Chemical Substances § 721.4365 Substituted ethoxylated hydrocarbon (generic). (a) Chemical... as Substituted ethoxylated hydrocarbon (PMN P-99-0313) is subject to reporting under this section for...
40 CFR 721.9573 - Substituted perfluoroalkyl sulfonamide (generic).
Code of Federal Regulations, 2014 CFR
2014-07-01
... as a substituted perfluoroalkyl sulfonamide (PMN P-98-645) is subject to reporting under this section... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Substituted perfluoroalkyl sulfonamide... Specific Chemical Substances § 721.9573 Substituted perfluoroalkyl sulfonamide (generic). (a) Chemical...
40 CFR 721.9573 - Substituted perfluoroalkyl sulfonamide (generic).
Code of Federal Regulations, 2013 CFR
2013-07-01
... as a substituted perfluoroalkyl sulfonamide (PMN P-98-645) is subject to reporting under this section... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Substituted perfluoroalkyl sulfonamide... Specific Chemical Substances § 721.9573 Substituted perfluoroalkyl sulfonamide (generic). (a) Chemical...
40 CFR 721.9573 - Substituted perfluoroalkyl sulfonamide (generic).
Code of Federal Regulations, 2010 CFR
2010-07-01
... as a substituted perfluoroalkyl sulfonamide (PMN P-98-645) is subject to reporting under this section... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Substituted perfluoroalkyl sulfonamide... Specific Chemical Substances § 721.9573 Substituted perfluoroalkyl sulfonamide (generic). (a) Chemical...
40 CFR 721.9573 - Substituted perfluoroalkyl sulfonamide (generic).
Code of Federal Regulations, 2011 CFR
2011-07-01
... as a substituted perfluoroalkyl sulfonamide (PMN P-98-645) is subject to reporting under this section... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Substituted perfluoroalkyl sulfonamide... Specific Chemical Substances § 721.9573 Substituted perfluoroalkyl sulfonamide (generic). (a) Chemical...
40 CFR 721.9573 - Substituted perfluoroalkyl sulfonamide (generic).
Code of Federal Regulations, 2012 CFR
2012-07-01
... as a substituted perfluoroalkyl sulfonamide (PMN P-98-645) is subject to reporting under this section... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Substituted perfluoroalkyl sulfonamide... Specific Chemical Substances § 721.9573 Substituted perfluoroalkyl sulfonamide (generic). (a) Chemical...
Jung, In Young; Boettiger, David; Wong, Wing Wai; Lee, Man Po; Kiertiburanakul, Sasisopin; Chaiwarith, Romanee; Avihingsanon, Anchalee; Tanuma, Junko; Kumarasamy, Nagalingeswaran; Kamarulzaman, Adeeba; Zhang, Fujie; Kantipong, Pacharee; Ng, Oon Tek; Sim, Benedict Lim Heng; Law, Matthew; Ross, Jeremy; Choi, Jun Yong
2017-12-01
Although substitutions of antiretroviral regimen are generally safe, most data on substitutions are based on results from clinical trials. The objective of this study was to evaluate the treatment outcomes of substituting antiretroviral regimen in virologically suppressed HIV-infected patients in non-clinical trial settings in Asian countries. The study population consisted of HIV-infected patients enrolled in the TREAT Asia HIV Observational Database (TAHOD). Individuals were included in this analysis if they started combination antiretroviral treatment (cART) after 2002, were being treated at a centre that documented a median rate of viral load monitoring ≥0.8 tests/patient/year among TAHOD enrolees, and experienced a minor or major treatment substitution while on virally suppressive cART. The primary endpoint to evaluate outcomes was clinical or virological failure (VF), followed by an ART class change. Clinical failure was defined as death or an AIDS diagnosis. VF was defined as confirmed viral load measurements ≥400 copies/mL followed by an ART class change within six months. Minor regimen substitutions were defined as within-class changes and major regimen substitutions were defined as changes to a drug class. The patterns of substitutions and rate of clinical or VF after substitutions were analyzed. Of 3994 adults who started ART after 2002, 3119 (78.1%) had at least one period of virological suppression. Among these, 1170 (37.5%) underwent a minor regimen substitution, and 296 (9.5%) underwent a major regimen substitution during suppression. The rates of clinical or VF were 1.48/100 person years (95% CI 1.14 to 1.91) in the minor substitution group, 2.85/100 person years (95% CI 1.88 to 4.33) in the major substitution group and 2.53/100 person years (95% CI 2.20 to 2.92) among patients that did not undergo a treatment substitution. The rate of clinical or VF was low in both major and minor substitution groups, showing that regimen substitution is
Tada, Tatsuya; Suzuki, Koutaro; Sakurai, Yu; Kubo, Masanori; Okada, Hironao; Itoh, Toshihiro; Tsukamoto, Kenji
2011-01-01
To explore the genetic basis of the pathogenesis and adaptation of avian influenza viruses (AIVs) to chickens, the A/duck/Yokohama/aq10/2003 (H5N1) (DkYK10) virus was passaged five times in the brains of chickens. The brain-passaged DkYK10-B5 caused quick death of chickens through rapid and efficient replication in tissues, accompanied by severe apoptosis. Genome sequence comparison of two viruses identified a single amino acid substitution at position 109 in NP from isoleucine to threonine (NP I109T). By analyzing viruses constructed by the reverse-genetic method, we established that the NP I109T substitution also contributed to increased viral replication and polymerase activity in chicken embryo fibroblasts, but not in duck embryo fibroblasts. Real-time RT-PCR analysis demonstrated that the NP I109T substitution enhances mRNA synthesis quickly and then cRNA and viral RNA (vRNA) synthesis slowly. Next, to determine the mechanism underlying the appearance of the NP I109T substitution during passages, four H5N1 highly pathogenic AIVs (HPAIVs) were passaged in the lungs and brains of chicken embryos. Single-nucleotide polymorphism analysis, together with a database search, suggests that the NP I109T mutation would be induced frequently during replication of HPAIVs in brains, but not in lungs. These results demonstrate that the amino acid at position 109 in NP enhances viral RNA synthesis and the pathogenicity of highly pathogenic avian influenza viruses in chickens and that the NP mutation emerges quickly during replication of the viruses in chicken brains. PMID:21795332
Competition Among Near-Substitutable Systems
2012-09-01
the context of the dominant “Weapon System Franchise ” model of competition for major defense acquisition programs (MDAPs). Competition between near...leading to the award of a franchise . AoAs or other cost-effectiveness analyses can be pivotal in bringing attention to near-substitute systems. However...dominant ?Weapon System Franchise ? model of competition for major defense acquisition programs (MDAPs). Competition between near-substitutes can occur
NASA Astrophysics Data System (ADS)
Stotesbury, Theresa E.
The research and development of synthetic blood substitutes is a reported need within the forensic community. This work contributes to the growing body of knowledge in bloodstain pattern analysis by offering a materials science approach to designing, producing and testing synthetic forensic blood substitutes. A key deliverable from this research is the creation of a robust silicon-based material using the solution-gelation technique that has been validated for controlled passive drip and spatter simulation. The work investigates the physical properties (viscosity, surface tension and density) of forensic blood substitute formulations and describes the similarity in the spreading dynamics of the optimized material to whole human blood. It then explores how blood and other fluids behave in impact simulation using high-speed video analysis and supports the use of the optimized material for spatter simulation. Finally, the work highlights the practical value of the material as an educational tool for both basic and advanced bloodstain experimentation and training.
OmpF, a nucleotide-sensing nanoprobe, computational evaluation of single channel activities
NASA Astrophysics Data System (ADS)
Abdolvahab, R. H.; Mobasheri, H.; Nikouee, A.; Ejtehadi, M. R.
2016-09-01
The results of highthroughput practical single channel experiments should be formulated and validated by signal analysis approaches to increase the recognition precision of translocating molecules. For this purpose, the activities of the single nano-pore forming protein, OmpF, in the presence of nucleotides were recorded in real time by the voltage clamp technique and used as a means for nucleotide recognition. The results were analyzed based on the permutation entropy of current Time Series (TS), fractality, autocorrelation, structure function, spectral density, and peak fraction to recognize each nucleotide, based on its signature effect on the conductance, gating frequency and voltage sensitivity of channel at different concentrations and membrane potentials. The amplitude and frequency of ion current fluctuation increased in the presence of Adenine more than Cytosine and Thymine in milli-molar (0.5 mM) concentrations. The variance of the current TS at various applied voltages showed a non-monotonic trend whose initial increasing slope in the presence of Thymine changed to a decreasing one in the second phase and was different from that of Adenine and Cytosine; e.g., by increasing the voltage from 40 to 140 mV in the 0.5 mM concentration of Adenine or Cytosine, the variance decreased by one third while for the case of Thymine it was doubled. Moreover, according to the structure function of TS, the fractality of current TS differed as a function of varying membrane potentials (pd) and nucleotide concentrations. Accordingly, the calculated permutation entropy of the TS, validated the biophysical approach defined for the recognition of different nucleotides at various concentrations, pd's and polarities. Thus, the promising outcomes of the combined experimental and theoretical methodologies presented here can be implemented as a complementary means in pore-based nucleotide recognition approaches.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Carbon black, 4-[(17-substituted-3,6,9... CONTROL ACT SIGNIFICANT NEW USES OF CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.10080 Carbon black, 4-[(17-substituted-3,6,9,12,15-pentaazaheptadec-1-yl) substituted...
NASA Astrophysics Data System (ADS)
Nomura, Kiyoshi; Suzuki, Shigeyo; Mizunuma, Tomoya; Koike, Yuya; Okazawa, Atsushi
2017-11-01
Magnetic properties of perovskite oxides, SrSn1- x Fe x O3- δ ( x ≤ 0.15), substituted with nonmagnetic Ca and Ti ions were studied. XRD patterns showed the orthorhombic structure (close to tetragonal) of (Sr1- y Ca y )(Sn1- x Fe x )O3- δ and Sr(Sn1- x- y Fe x Ti y )O3- δ . The cell volumes decreased with the increase of Ca and Ti doping rates. Although Ti-substituted Sr(Sn, Fe)O3- δ showed small saturation magnetizations as compared with non-Ti substituted one, the magnetization increased a little with Ti doping rates up to 15%. On the other hand, all Ca-substituted Sr(Sn, Fe)O3- δ showed larger saturation magnetization than non-Ca substituted one. Two doublets of Fe3+ and a doublet of Fe4+ were observed in Mössbauer spectra of Ca-substituted Sr(Sn, Fe)O3- δ with weak ferromagnetism, and two sextets of high spin Fe3+ were additionally observed in Mössbauer spectra of Ca-doped Sr(Sn, Fe)O3- δ with relatively strong ferromagnetism. When Sr(Sn, Fe)O3- δ were further codoped with Ca and Ti ions, they showed the stable and enhanced ferromagnetic properties. It is considered that magnetic polarons among high spin Fe3+ species are overlapped by shrinking or deforming the crystal structure of perovskite oxides. That is the magnetism induced by a chemical pressure of perovskite oxides.
40 CFR 721.3565 - Ethylenediamine, substituted, sodium salt.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Ethylenediamine, substituted, sodium... Specific Chemical Substances § 721.3565 Ethylenediamine, substituted, sodium salt. (a) Chemical substance... ethylenediamine, substituted, sodium salt (PMN P-97-328) is subject to reporting under this section for the...
40 CFR 721.3565 - Ethylenediamine, substituted, sodium salt.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Ethylenediamine, substituted, sodium... Specific Chemical Substances § 721.3565 Ethylenediamine, substituted, sodium salt. (a) Chemical substance... ethylenediamine, substituted, sodium salt (PMN P-97-328) is subject to reporting under this section for the...