Sample records for nucleotides

  1. Intracellular nucleotide and nucleotide sugar contents of cultured CHO cells determined by a fast, sensitive, and high-resolution ion-pair RP-HPLC.

    PubMed

    Kochanowski, N; Blanchard, F; Cacan, R; Chirat, F; Guedon, E; Marc, A; Goergen, J-L

    2006-01-15

    Analysis of intracellular nucleotide and nucleotide sugar contents is essential in studying protein glycosylation of mammalian cells. Nucleotides and nucleotide sugars are the donor substrates of glycosyltransferases, and nucleotides are involved in cellular energy metabolism and its regulation. A sensitive and reproducible ion-pair reverse-phase high-performance liquid chromatography (RP-HPLC) method has been developed, allowing the direct and simultaneous detection and quantification of some essential nucleotides and nucleotide sugars. After a perchloric acid extraction, 13 molecules (8 nucleotides and 5 nucleotide sugars) were separated, including activated sugars such as UDP-glucose, UDP-galactose, GDP-mannose, UDP-N-acetylglucosamine, and UDP-N-acetylgalactosamine. To validate the analytical parameters, the reproducibility, linearity of calibration curves, detection limits, and recovery were evaluated for standard mixtures and cell extracts. The developed method is capable of resolving picomolar quantities of nucleotides and nucleotide sugars in a single chromatographic run. The HPLC method was then applied to quantify intracellular levels of nucleotides and nucleotide sugars of Chinese hamster ovary (CHO) cells cultivated in a bioreactor batch process. Evolutions of the titers of nucleotides and nucleotide sugars during the batch process are discussed.

  2. Combined hairpin-antisense compositions and methods for modulating expression

    DOEpatents

    Shanklin, John; Nguyen, Tam

    2014-08-05

    A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

  3. Combined hairpin-antisense compositions and methods for modulating expression

    DOEpatents

    Shanklin, John; Nguyen, Tam Huu

    2015-11-24

    A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

  4. Cyclic nucleotide binding proteins in the Arabidopsis thaliana and Oryza sativa genomes

    PubMed Central

    Bridges, Dave; Fraser, Marie E; Moorhead, Greg BG

    2005-01-01

    Background Cyclic nucleotides are ubiquitous intracellular messengers. Until recently, the roles of cyclic nucleotides in plant cells have proven difficult to uncover. With an understanding of the protein domains which can bind cyclic nucleotides (CNB and GAF domains) we scanned the completed genomes of the higher plants Arabidopsis thaliana (mustard weed) and Oryza sativa (rice) for the effectors of these signalling molecules. Results Our analysis found that several ion channels and a class of thioesterases constitute the possible cyclic nucleotide binding proteins in plants. Contrary to some reports, we found no biochemical or bioinformatic evidence for a plant cyclic nucleotide regulated protein kinase, suggesting that cyclic nucleotide functions in plants have evolved differently than in mammals. Conclusion This paper provides a molecular framework for the discussion of cyclic nucleotide function in plants, and resolves a longstanding debate about the presence of a cyclic nucleotide dependent kinase in plants. PMID:15644130

  5. 37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

  6. 37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

  7. Energy efficiency trade-offs drive nucleotide usage in transcribed regions

    PubMed Central

    Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.

    2016-01-01

    Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217

  8. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

    PubMed

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  9. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    NASA Astrophysics Data System (ADS)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  10. Seasonal changes of nucleotides in mussel (Mytilus galloprovincialis) mantle tissue.

    PubMed

    Blanco, S L; Suárez, M P; San Juan, F

    2006-03-01

    Seasonal variations of nucleotides in Mytilus galloprovincialis mantle tissue were analyzed. Separation and quantification was achieved by reversed-phase high-performance liquid chromatography. Total nucleotides show a pronounced seasonal variation with maximum and minimum values in autumn and spring, respectively. Adenine nucleotides accounted for the major part in spring and summer, guanosine and cytidine nucleotides in winter; uridine nucleotides were relatively constant throughout the year. Their inverse variation suggests inter-conversion among them and the maintenance of the potential cell energy in winter by other triphosphate nucleotides different from ATP. These results reflect environmental and nutritional conditions, and also the reserves and gametogenic cycles taking place in M. galloprovincialis mantle tissue.

  11. Simultaneous determination of nucleotide sugars with ion-pair reversed-phase HPLC.

    PubMed

    Nakajima, Kazuki; Kitazume, Shinobu; Angata, Takashi; Fujinawa, Reiko; Ohtsubo, Kazuaki; Miyoshi, Eiji; Taniguchi, Naoyuki

    2010-07-01

    Nucleotide sugars are important in determining cell surface glycoprotein glycosylation, which can modulate cellular properties such as growth and arrest. We have developed a conventional HPLC method for simultaneous determination of nucleotide sugars. A mixture of nucleotide sugars (CMP-NeuAc, UDP-Gal, UDP-Glc, UDP-GalNAc, UDP-GlcNAc, GDP-Man, GDP-Fuc and UDP-GlcUA) and relevant nucleotides were perfectly separated in an optimized ion-pair reversed-phase mode using Inertsil ODS-4 and ODS-3 columns. The newly developed method enabled us to determine the nucleotide sugars in cellular extracts from 1 x 10(6) cells in a single run. We applied this method to characterize nucleotide sugar levels in breast and pancreatic cancer cell lines and revealed that the abundance of UDP-GlcNAc, UDP-GalNAc, UDP-GlcUA and GDP-Fuc were a cell-type-specific feature. To determine the physiological significance of changes in nucleotide sugar levels, we analyzed their changes by glucose deprivation and found that the determination of nucleotide sugar levels provided us with valuable information with respect to studying the overview of cellular glycosylation status.

  12. Acid-soluble nucleotides of pinto bean leaves at different stages of development.

    PubMed

    Weinstein, L H; McCune, D C; Mancini, J F; van Leuken, P

    1969-11-01

    Acid-soluble nucleotides of unifoliate leaves of Pinto bean plants (Phaseolus vulgaris L.) were determined at young, mature, and senescent stages of development. At least 25 components could be distinguished on the basis of inorganic phosphorus determinations and 37 or more fractions on the basis of (32)P labeling, with adenosine di- and triphosphates accounting for 60% of the total moles of nucleotide. The total nucleotide P and inorganic P, on a fresh weight basis, decreased about 44% between each stage of leaf development, but decrements in the levels of individual nucleotides varied from this over-all pattern.Minor changes in the relative abundance of the individual nucleotides accompanied aging although the percentage of purine-containing nucleotides decreased with age. Total (32)P activity per leaf in the nucleotide pool increased about 3-fold between the young and mature leaves and decreased slightly as leaves became senescent. In general, the specific activities of the nucleotides increased with increased age and adenosine-, guanosine-, uridine-, and cytidine triphosphates and adenosine diphosphate accounted for approximately 90% of the total activity. The changes in the relative sizes and energy status of the nucleotide pools were not so obvious as the changes in other metabolites that have been reported to accompany aging in leaf tissue.

  13. [Nucleotidic variations of two captive groups of tepezcuintle, Agouti paca (Rodentia: Agoutidae), from two sites in Yucatan, Mexico].

    PubMed

    Montes-Pérez, Rubén C; García, Adán W Echeverría; Castro, Jorge Zavala; Gamboa, Militza G Alfaro

    2006-09-01

    The objective of this work was to estimate the nucleotidic variation between two groups of tepezcuintles (Agouti paca) from the states of Campeche and Quintana Roo, Mexico and within members of each group. Blood samples were collected from eleven A. paca kept in captivity. DNA from leukocytic cells was used for Ramdom Amplification of DNA Polimorphism (RAPD). The primers three 5'-d(GTAGACCCGT)- 3' and six 5'-d(CCCGTCAGCA)- 3' were selected from de Amersham kit (Ready.To.Go. RAPD Analysis Beads, Amersham Pharmacia Biotech), because they produced an adequate number of bands. The electrophoretic pattern of bands obtained was analyzed using software for phylogenetic analysis based on the UPGMA method, to estimate the units of nucleotidic variation. The phylogenetic tree obtained with primer three reveals a dicotomic grouping between the animals from both states in the Yucatan Peninsula showing a divergent value of 1.983 nucleotides per hundred. Animals from Quintana Roo show a grouping with primer six; an additional grouping was observed with animals from Campeche. Nucleotidic variation between both groups was 2.118 nucleotides per hundred. The nucleotidic variation for the two primers within the groups from both states, showed fluctuating values from 0.46 to 1.68 nucleotides per hundred, which indicates that nucleotidic variation between the two groups of animals is around two nucleotides per hundred and, within the groups, less than 1.7 nucleotides per hundred.

  14. Structural Basis for Nucleotide Exchange in Heterotrimeric G Proteins

    PubMed Central

    Dror, Ron O.; Mildorf, Thomas J.; Hilger, Daniel; Manglik, Aashish; Borhani, David W.; Arlow, Daniel H.; Philippsen, Ansgar; Villanueva, Nicolas; Yang, Zhongyu; Lerch, Michael T.; Hubbell, Wayne L.; Kobilka, Brian K.; Sunahara, Roger K.; Shaw, David E.

    2016-01-01

    G protein–coupled receptors (GPCRs) relay diverse extracellular signals into cells by catalyzing nucleotide release from heterotrimeric G proteins, but the mechanism underlying this quintessential molecular signaling event has remained unclear. Here we use atomic-level simulations to elucidate the nucleotide-release mechanism. We find that the G protein α subunit Ras and helical domains—previously observed to separate widely upon receptor binding to expose the nucleotide-binding site—separate spontaneously and frequently even in the absence of a receptor. Domain separation is necessary but not sufficient for rapid nucleotide release. Rather, receptors catalyze nucleotide release by favoring an internal structural rearrangement of the Ras domain that weakens its nucleotide affinity. We use double electron-electron resonance spectroscopy and protein engineering to confirm predictions of our computationally determined mechanism. PMID:26089515

  15. Profiling of Sugar Nucleotides.

    PubMed

    Rejzek, Martin; Hill, Lionel; Hems, Edward S; Kuhaudomlarp, Sakonwan; Wagstaff, Ben A; Field, Robert A

    2017-01-01

    Sugar nucleotides are essential building blocks for the glycobiology of all living organisms. Detailed information on the types of sugar nucleotides present in a particular cell and how they change as a function of metabolic, developmental, or disease status is vital. The extraction, identification, and quantification of sugar nucleotides in a given sample present formidable challenges. In this chapter, currently used techniques for sugar nucleotide extraction from cells, separation from complex biological matrices, and detection by optical and mass spectrometry methods are discussed. © 2017 Elsevier Inc. All rights reserved.

  16. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    NASA Astrophysics Data System (ADS)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

    2016-09-01

    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  17. Antinociceptive effect of purine nucleotides.

    PubMed

    Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R

    1996-10-01

    The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.

  18. Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis

    DOEpatents

    McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX

    2009-02-24

    Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  19. Nucleotide cleaving agents and method

    DOEpatents

    Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.

    2000-01-01

    The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

  20. Nucleotide sequences specific to Brucella and methods for the detection of Brucella

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L

    Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  1. Nucleotide Salvage Deficiencies, DNA Damage and Neurodegeneration

    PubMed Central

    Fasullo, Michael; Endres, Lauren

    2015-01-01

    Nucleotide balance is critically important not only in replicating cells but also in quiescent cells. This is especially true in the nervous system, where there is a high demand for adenosine triphosphate (ATP) produced from mitochondria. Mitochondria are particularly prone to oxidative stress-associated DNA damage because nucleotide imbalance can lead to mitochondrial depletion due to low replication fidelity. Failure to maintain nucleotide balance due to genetic defects can result in infantile death; however there is great variability in clinical presentation for particular diseases. This review compares genetic diseases that result from defects in specific nucleotide salvage enzymes and a signaling kinase that activates nucleotide salvage after DNA damage exposure. These diseases include Lesch-Nyhan syndrome, mitochondrial depletion syndromes, and ataxia telangiectasia. Although treatment options are available to palliate symptoms of these diseases, there is no cure. The conclusions drawn from this review include the critical role of guanine nucleotides in preventing neurodegeneration, the limitations of animals as disease models, and the need to further understand nucleotide imbalances in treatment regimens. Such knowledge will hopefully guide future studies into clinical therapies for genetic diseases. PMID:25923076

  2. The maize stripe virus major noncapsid protein messenger RNA transcripts contain heterogeneous leader sequences at their 5' termini.

    PubMed

    Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W

    1993-12-01

    Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.

  3. A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

    PubMed Central

    Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

    2003-01-01

    A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

  4. Evidence for the role of hydrophobic forces on the interactions of nucleotide-monophosphates with cationic liposomes.

    PubMed

    Cuomo, Francesca; Mosca, Monica; Murgia, Sergio; Avino, Pasquale; Ceglie, Andrea; Lopez, Francesco

    2013-11-15

    In this work, the interaction of nucleotide-monophosphates (NMPs) with unilamellar liposomes made of 1,2-Dioleoyl-3-Trimethylammonium-Propane (DOTAP) and 1,2-Dioleoyl-sn-Glycero-3-Phosphoethanolamine (DOPE) was investigated. Here, we demonstrate how adsorption is affected by the type of nucleotide-monophosphate. Dynamic light scattering (DLS) results revealed, for each NMP, that a distinguishable concentration exists at which a significant growth of the aggregates occurs. Adenosine 5'-monophosphate (AMP) and guanosine 5'-monophosphate (GMP) have shown a higher propensity to induce liposome aggregation process and in particular GMP appears to be the most effective. From ζ-potential experiments we found that liposomes loaded with purine based nucleotides (AMP and GMP) are able to decrease the ζ-potential values to a greater extent in comparison with the pyrimidine based nucleotides thimydine 5'-monophosphate (TMP) and uridine 5'-monophosphate (UMP). Moreover, a careful analysis of nucleotide-liposome interactions revealed that nucleotides have different capacity to induce the formation of nucleotide-liposome complexes, and purine based nucleotides have higher affinities with lipid membranes. On the whole, the data emphasize that the mechanisms driving the interactions between liposomes and NMPs are also influenced by the existence of hydrophobic forces. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    PubMed

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  6. Dietary nucleotides and early growth in formula-fed infants: a randomized controlled trial.

    PubMed

    Singhal, Atul; Kennedy, Kathy; Lanigan, J; Clough, Helen; Jenkins, Wendy; Elias-Jones, Alun; Stephenson, Terrence; Dudek, Peter; Lucas, Alan

    2010-10-01

    Dietary nucleotides are nonprotein nitrogenous compounds that are found in high concentrations in breast milk and are thought to be conditionally essential nutrients in infancy. A high nucleotide intake has been suggested to explain some of the benefits of breastfeeding compared with formula feeding and to promote infant growth. However, relatively few large-scale randomized trials have tested this hypothesis in healthy infants. We tested the hypothesis that nucleotide supplementation of formula benefits early infant growth. Occipitofrontal head circumference, weight, and length were assessed in infants who were randomly assigned to groups fed nucleotide-supplemented (31 mg/L; n=100) or control formula without nucleotide supplementation (n=100) from birth to the age of 20 weeks, and in infants who were breastfed (reference group; n=101). Infants fed with nucleotide-supplemented formula had greater occipitofrontal head circumference at ages 8, 16, and 20 weeks than infants fed control formula (mean difference in z scores at 8 weeks: 0.4 [95% confidence interval: 0.1-0.7]; P=.006) even after adjustment for potential confounding factors (P=.002). Weight at 8 weeks and the increase in both occipitofrontal head circumference and weight from birth to 8 weeks were also greater in infants fed nucleotide-supplemented formula than in those fed control formula. Our data support the hypothesis that nucleotide supplementation leads to increased weight gain and head growth in formula-fed infants. Therefore, nucleotides could be conditionally essential for optimal infant growth in some formula-fed populations. Additional research is needed to test the hypothesis that the benefits of nucleotide supplementation for early head growth, a critical period for brain growth, have advantages for long-term cognitive development.

  7. Polymerization of non-complementary RNA: systematic symmetric nucleotide exchanges mainly involving uracil produce mitochondrial RNA transcripts coding for cryptic overlapping genes.

    PubMed

    Seligmann, Hervé

    2013-03-01

    Usual DNA→RNA transcription exchanges T→U. Assuming different systematic symmetric nucleotide exchanges during translation, some GenBank RNAs match exactly human mitochondrial sequences (exchange rules listed in decreasing transcript frequencies): C↔U, A↔U, A↔U+C↔G (two nucleotide pairs exchanged), G↔U, A↔G, C↔G, none for A↔C, A↔G+C↔U, and A↔C+G↔U. Most unusual transcripts involve exchanging uracil. Independent measures of rates of rare replicational enzymatic DNA nucleotide misinsertions predict frequencies of RNA transcripts systematically exchanging the corresponding misinserted nucleotides. Exchange transcripts self-hybridize less than other gene regions, self-hybridization increases with length, suggesting endoribonuclease-limited elongation. Blast detects stop codon depleted putative protein coding overlapping genes within exchange-transcribed mitochondrial genes. These align with existing GenBank proteins (mainly metazoan origins, prokaryotic and viral origins underrepresented). These GenBank proteins frequently interact with RNA/DNA, are membrane transporters, or are typical of mitochondrial metabolism. Nucleotide exchange transcript frequencies increase with overlapping gene densities and stop densities, indicating finely tuned counterbalancing regulation of expression of systematic symmetric nucleotide exchange-encrypted proteins. Such expression necessitates combined activities of suppressor tRNAs matching stops, and nucleotide exchange transcription. Two independent properties confirm predicted exchanged overlap coding genes: discrepancy of third codon nucleotide contents from replicational deamination gradients, and codon usage according to circular code predictions. Predictions from both properties converge, especially for frequent nucleotide exchange types. Nucleotide exchanging transcription apparently increases coding densities of protein coding genes without lengthening genomes, revealing unsuspected functional DNA coding potential. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  8. 37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

  9. 37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

  10. 37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

  11. Systematic asymmetric nucleotide exchanges produce human mitochondrial RNAs cryptically encoding for overlapping protein coding genes.

    PubMed

    Seligmann, Hervé

    2013-05-07

    GenBank's EST database includes RNAs matching exactly human mitochondrial sequences assuming systematic asymmetric nucleotide exchange-transcription along exchange rules: A→G→C→U/T→A (12 ESTs), A→U/T→C→G→A (4 ESTs), C→G→U/T→C (3 ESTs), and A→C→G→U/T→A (1 EST), no RNAs correspond to other potential asymmetric exchange rules. Hypothetical polypeptides translated from nucleotide-exchanged human mitochondrial protein coding genes align with numerous GenBank proteins, predicted secondary structures resemble their putative GenBank homologue's. Two independent methods designed to detect overlapping genes (one based on nucleotide contents analyses in relation to replicative deamination gradients at third codon positions, and circular code analyses of codon contents based on frame redundancy), confirm nucleotide-exchange-encrypted overlapping genes. Methods converge on which genes are most probably active, and which not, and this for the various exchange rules. Mean EST lengths produced by different nucleotide exchanges are proportional to (a) extents that various bioinformatics analyses confirm the protein coding status of putative overlapping genes; (b) known kinetic chemistry parameters of the corresponding nucleotide substitutions by the human mitochondrial DNA polymerase gamma (nucleotide DNA misinsertion rates); (c) stop codon densities in predicted overlapping genes (stop codon readthrough and exchanging polymerization regulate gene expression by counterbalancing each other). Numerous rarely expressed proteins seem encoded within regular mitochondrial genes through asymmetric nucleotide exchange, avoiding lengthening genomes. Intersecting evidence between several independent approaches confirms the working hypothesis status of gene encryption by systematic nucleotide exchanges. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Labeled nucleotide phosphate (NP) probes

    DOEpatents

    Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

    2009-02-03

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  13. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    PubMed

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  14. Binding of nucleotides by T4 DNA ligase and T4 RNA ligase: optical absorbance and fluorescence studies.

    PubMed Central

    Cherepanov, A V; de Vries, S

    2001-01-01

    The interaction of nucleotides with T4 DNA and RNA ligases has been characterized using ultraviolet visible (UV-VIS) absorbance and fluorescence spectroscopy. Both enzymes bind nucleotides with the K(d) between 0.1 and 20 microM. Nucleotide binding results in a decrease of absorbance at 260 nm due to pi-stacking with an aromatic residue, possibly phenylalanine, and causes red-shifting of the absorbance maximum due to hydrogen bonding with the exocyclic amino group. T4 DNA ligase is shown to have, besides the catalytic ATP binding site, another noncovalent nucleotide binding site. ATP bound there alters the pi-stacking of the nucleotide in the catalytic site, increasing its optical extinction. The K(d) for the noncovalent site is approximately 1000-fold higher than for the catalytic site. Nucleotides quench the protein fluorescence showing that a tryptophan residue is located in the active site of the ligase. The decrease of absorbance around 298 nm suggests that the hydrogen bonding interactions of this tryptophan residue are weakened in the ligase-nucleotide complex. The excitation/emission properties of T4 RNA ligase indicate that its ATP binding pocket is in contact with solvent, which is excluded upon binding of the nucleotide. Overall, the spectroscopic analysis reveals important similarities between T4 ligases and related nucleotidyltransferases, despite the low sequence similarity. PMID:11721015

  15. Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

    DOEpatents

    McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

    2007-02-06

    Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  16. Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

    DOEpatents

    McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

    2009-02-24

    Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  17. 37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

  18. Detecting and Removing Ascertainment Bias in Microsatellites from the HGDP-CEPH Panel

    PubMed Central

    Eriksson, Anders; Manica, Andrea

    2011-01-01

    Although ascertainment bias in single nucleotide polymorphisms is a well-known problem, it is generally accepted that microsatellites have mutation rates too high for bias to be a concern. Here, we analyze in detail the large set of microsatellites typed for the Human Genetic Diversity Panel (HGDP)-CEPH panel. We develop a novel framework based on rarefaction to compare heterozygosity across markers with different mutation rates. We find that, whereas di- and tri-nucleotides show similar patterns of within- and between-population heterozygosity, tetra-nucleotides are inconsistent with the other two motifs. In addition, di- and tri-nucleotides are consistent with 16 unbiased tetra-nucleotide markers, whereas the HPGP-CEPH tetra-nucleotides are significantly different. This discrepancy is due to the HGDP-CEPH tetra-nucleotides being too homogeneous across Eurasia, even after their slower mutation rate is taken into account by rarefying the other markers. The most likely explanation for this pattern is ascertainment bias. We strongly advocate the exclusion of tetra-nucleotides from future population genetics analysis of this dataset, and we argue that other microsatellite datasets should be investigated for the presence of bias using the approach outlined in this article. PMID:22384358

  19. The C-terminal Helix of Pseudomonas aeruginosa Elongation Factor Ts Tunes EF-Tu Dynamics to Modulate Nucleotide Exchange.

    PubMed

    De Laurentiis, Evelina Ines; Mercier, Evan; Wieden, Hans-Joachim

    2016-10-28

    Little is known about the conservation of critical kinetic parameters and the mechanistic strategies of elongation factor (EF) Ts-catalyzed nucleotide exchange in EF-Tu in bacteria and particularly in clinically relevant pathogens. EF-Tu from the clinically relevant pathogen Pseudomonas aeruginosa shares over 84% sequence identity with the corresponding elongation factor from Escherichia coli Interestingly, the functionally closely linked EF-Ts only shares 55% sequence identity. To identify any differences in the nucleotide binding properties, as well as in the EF-Ts-mediated nucleotide exchange reaction, we performed a comparative rapid kinetics and mutagenesis analysis of the nucleotide exchange mechanism for both the E. coli and P. aeruginosa systems, identifying helix 13 of EF-Ts as a previously unnoticed regulatory element in the nucleotide exchange mechanism with species-specific elements. Our findings support the base side-first entry of the nucleotide into the binding pocket of the EF-Tu·EF-Ts binary complex, followed by displacement of helix 13 and rapid binding of the phosphate side of the nucleotide, ultimately leading to the release of EF-Ts. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

    DOEpatents

    Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

    1999-01-19

    The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

  1. Development of a nucleotide sugar purification method using a mixed mode column & mass spectrometry detection.

    PubMed

    Eastwood, Heather; Xia, Fang; Lo, Mei-Chu; Zhou, Jing; Jordan, John B; McCarter, John; Barnhart, Wesley W; Gahm, Kyung-Hyun

    2015-11-10

    Analysis of nucleotide sugars, nucleoside di- and triphosphates and sugar-phosphates is an essential step in the process of understanding enzymatic pathways. A facile and rapid separation method was developed to analyze these compounds present in an enzymatic reaction mixture utilized to produce nucleotide sugars. The Primesep SB column explored in this study utilizes hydrophobic interactions as well as electrostatic interactions with the phosphoric portion of the nucleotide sugars. Ammonium formate buffer was selected due to its compatibility with mass spectrometry. Negative ion mode mass spectrometry was adopted for detection of the sugar phosphate (fucose-1-phophate), as the compound is not amenable to UV detection. Various mobile phase conditions such as pH, buffer concentration and organic modifier were explored. The semi-preparative separation method was developed to prepare 30mg of the nucleotide sugar. (19)F NMR was utilized to determine purity of the purified fluorinated nucleotide sugar. The collected nucleotide sugar was found to be 99% pure. Published by Elsevier B.V.

  2. Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.

    PubMed

    Faragher, S G; Meek, A D; Rice, C M; Dalgarno, L

    1988-04-01

    The nucleotide sequence of the genomic RNA of a mouse-avirulent strain of Ross River virus, RRV NB5092 (isolated in 1969), has been determined and the corresponding sequence for the prototype mouse-virulent strain, RRV T48 (isolated in 1959), has been completed. The RRV NB5092 genome is approximately 11,674 nucleotides in length, compared with 11,853 nucleotides for RRV T48. RRV NB5092 and RRV T48 have the same genome organization. For both viruses an untranslated region of 80 nucleotides at the 5' end of the genome is followed by a 7440-nucleotide open reading frame which is interrupted after 5586 nucleotides by a single opal termination codon. By homology with other alphaviruses, the 5586-nucleotide open reading frame encodes the nonstructural proteins nsP1, nsP2, and nsP3; a fourth nonstructural protein, nsP4, is produced by read-through of the opal codon. The RRV nonstructural proteins show strong homology with the corresponding proteins of Sindbis virus and Semliki Forest virus in terms of size, net charge, and hydropathy characteristics. However, homology is not uniform between or within the proteins; nsP1, nsP2, and nsP4 contain extended domains which are highly conserved between alphaviruses, while the C-terminal region of nsP3 shows little conservation in sequence or length between alphaviruses. An untranslated "junction" region of 44 nucleotides (for RRV NB5092) or 47 nucleotides (for RRV T48) separates the nonstructural and structural protein coding regions. The structural proteins (capsid-E3-E2-6K-E1) are translated from an open reading frame of 3762 nucleotides which is followed by a 3'-untranslated region of approximately 348 nucleotides (for RRV NB5092) or 524 nucleotides (for RRV T48). Excluding deletions and insertions, the genomes of RRV NB5092 and RRV T48 differ at 284 nucleotides, representing a sequence divergence of 2.38%. Sequence deletions or insertions were found only in the noncoding regions and include a 173-nucleotide deletion in the 3'-untranslated region of RRV NB5092, compared with RRV T48. In the coding regions, most of the nucleotide differences are silent; there are 36 amino acid differences in the nonstructural proteins and 12 in the structural proteins. The distribution of amino acid differences between the two RRV strains correlates with the location of domains which are poorly conserved in sequence between alphaviruses. The possible role of amino acid differences in envelope glycoproteins E1 and E2 in determining the different antigenic and biological properties of RRV NB5092 and RRV T48 is discussed.

  3. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    PubMed

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  4. Nucleic acid analysis using terminal-phosphate-labeled nucleotides

    DOEpatents

    Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

    2008-04-22

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  5. Statistical analysis of nucleotide sequences of the hemagglutinin gene of human influenza A viruses.

    PubMed Central

    Ina, Y; Gojobori, T

    1994-01-01

    To examine whether positive selection operates on the hemagglutinin 1 (HA1) gene of human influenza A viruses (H1 subtype), 21 nucleotide sequences of the HA1 gene were statistically analyzed. The nucleotide sequences were divided into antigenic and nonantigenic sites. The nucleotide diversities for antigenic and nonantigenic sites of the HA1 gene were computed at synonymous and nonsynonymous sites separately. For nonantigenic sites, the nucleotide diversities were larger at synonymous sites than at nonsynonymous sites. This is consistent with the neutral theory of molecular evolution. For antigenic sites, however, the nucleotide diversities at nonsynonymous sites were larger than those at synonymous sites. These results suggest that positive selection operates on antigenic sites of the HA1 gene of human influenza A viruses (H1 subtype). PMID:8078892

  6. Nucleotide-dependent conformational states of actin

    PubMed Central

    Pfaendtner, Jim; Branduardi, Davide; Parrinello, Michele; Pollard, Thomas D.; Voth, Gregory A.

    2009-01-01

    The influence of the state of the bound nucleotide (ATP, ADP-Pi, or ADP) on the conformational free-energy landscape of actin is investigated. Nucleotide-dependent folding of the DNase-I binding (DB) loop in monomeric actin and the actin trimer is carried out using all-atom molecular dynamics (MD) calculations accelerated with a multiscale implementation of the metadynamics algorithm. Additionally, an investigation of the opening and closing of the actin nucleotide binding cleft is performed. Nucleotide-dependent free-energy profiles for all of these conformational changes are calculated within the framework of metadynamics. We find that in ADP-bound monomer, the folded and unfolded states of the DB loop have similar relative free-energy. This result helps explain the experimental difficulty in obtaining an ordered crystal structure for this region of monomeric actin. However, we find that in the ADP-bound actin trimer, the folded DB loop is stable and in a free-energy minimum. It is also demonstrated that the nucleotide binding cleft favors a closed conformation for the bound nucleotide in the ATP and ADP-Pi states, whereas the ADP state favors an open confirmation, both in the monomer and trimer. These results suggest a mechanism of allosteric interactions between the nucleotide binding cleft and the DB loop. This behavior is confirmed by an additional simulation that shows the folding free-energy as a function of the nucleotide cleft width, which demonstrates that the barrier for folding changes significantly depending on the value of the cleft width. PMID:19620726

  7. Nucleotide Binding by Lhs1p Is Essential for Its Nucleotide Exchange Activity and for Function in Vivo*

    PubMed Central

    de Keyzer, Jeanine; Steel, Gregor J.; Hale, Sarah J.; Humphries, Daniel; Stirling, Colin J.

    2009-01-01

    Protein translocation and folding in the endoplasmic reticulum of Saccharomyces cerevisiae involves two distinct Hsp70 chaperones, Lhs1p and Kar2p. Both proteins have the characteristic domain structure of the Hsp70 family consisting of a conserved N-terminal nucleotide binding domain and a C-terminal substrate binding domain. Kar2p is a canonical Hsp70 whose substrate binding activity is regulated by cochaperones that promote either ATP hydrolysis or nucleotide exchange. Lhs1p is a member of the Grp170/Lhs1p subfamily of Hsp70s and was previously shown to function as a nucleotide exchange factor (NEF) for Kar2p. Here we show that in addition to this NEF activity, Lhs1p can function as a holdase that prevents protein aggregation in vitro. Analysis of the nucleotide requirement of these functions demonstrates that nucleotide binding to Lhs1p stimulates the interaction with Kar2p and is essential for NEF activity. In contrast, Lhs1p holdase activity is nucleotide-independent and unaffected by mutations that interfere with ATP binding and NEF activity. In vivo, these mutants show severe protein translocation defects and are unable to support growth despite the presence of a second Kar2p-specific NEF, Sil1p. Thus, Lhs1p-dependent nucleotide exchange activity is vital for ER protein biogenesis in vivo. PMID:19759005

  8. Nucleotide and Nucleotide Sugar Analysis by Liquid Chromatography-Electrospray Ionization-Mass Spectrometry on Surface-Conditioned Porous Graphitic Carbon

    PubMed Central

    2010-01-01

    We examined the analysis of nucleotides and nucleotide sugars by chromatography on porous graphitic carbon with mass spectrometric detection, a method that evades contamination of the MS instrument with ion pairing reagent. At first, adenosine triphosphate (ATP) and other triphosphate nucleotides exhibited very poor chromatographic behavior on new columns and could hardly be eluted from columns previously cleaned with trifluoroacetic acid. Satisfactory performance of both new and older columns could, however, be achieved by treatment with reducing agent and, unexpectedly, hydrochloric acid. Over 40 nucleotides could be detected in cell extracts including many isobaric compounds such as ATP, deoxyguanosine diphosphate (dGTP), and phospho-adenosine-5′-phosphosulfate or 3′,5′-cyclic adenosine 5'-monophosphate (AMP) and its much more abundant isomer 2′,3′-cylic AMP. A fast sample preparation procedure based on solid-phase extraction on carbon allowed detection of very short-lived analytes such as cytidine 5'-monophosphate (CMP)-2-keto-deoxy-octulosonic acid. In animal cells and plant tissues, about 35 nucleotide sugars were detected, among them rarely considered metabolites such as uridine 5'-diphosphate (UDP)-l-arabinopyranose, UDP-l-arabinofuranose, guanosine 5'-diphosphate (GDP)-l-galactofuranose, UDP-l-rhamnose, and adenosine diphosphate (ADP)-sugars. Surprisingly, UDP-arabinopyranose was also found in Chinese hamster ovary (CHO) cells. Due to the unique structural selectivity of graphitic carbon, the method described herein distinguishes more nucleotides and nucleotide sugars than previously reported approaches. PMID:21043458

  9. Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70.

    PubMed Central

    Hunt, C; Morimoto, R I

    1985-01-01

    We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075

  10. Applications of adenine nucleotide measurements in oceanography

    NASA Technical Reports Server (NTRS)

    Holm-Hansen, O.; Hodson, R.; Azam, F.

    1975-01-01

    The methodology involved in nucleotide measurements is outlined, along with data to support the premise that ATP concentrations in microbial cells can be extrapolated to biomass parameters. ATP concentrations in microorganisms and nucleotide analyses are studied.

  11. Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

    PubMed

    Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

    2004-01-01

    Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

  12. Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

    PubMed

    Levis, R; Schlesinger, S; Huang, H V

    1990-04-01

    Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.

  13. Probing the nucleotide binding domain of the osmoregulator EnvZ using fluorescent nucleotide derivatives.

    PubMed

    Plesniak, Leigh; Horiuchi, Yuki; Sem, Daniel; Meinenger, David; Stiles, Linda; Shaffer, Jennifer; Jennings, Patricia A; Adams, Joseph A

    2002-11-26

    EnvZ is a histidine protein kinase important for osmoregulation in bacteria. While structural data are available for this enzyme, the nucleotide binding pocket is not well characterized. The ATP binding domain (EnvZB) was expressed, and its ability to bind nucleotide derivatives was assessed using equilbrium and stopped-flow fluorescence spectroscopy. The fluorescence emission of the trinitrophenyl derivatives, TNP-ATP and TNP-ADP, increase upon binding to EnvZB. The fluorescence enhancements were quantitatively abolished in the presence of excess ADP, indicating that the fluorescent probes occupy the nucleotide binding pocket. Both TNP-ATP and TNP-ADP bind to EnvZB with high affinity (K(d) = 2-3 microM). The TNP moiety attached to the ribose ring does not impede access of the fluorescent nucleotide into the binding pocket. The association rate constant for TNP-ADP is 7 microM(-1) s(-1), a value consistent with those for natural nucleotides and the eucaryotic protein kinases. Using competition experiments, it was found that ATP and ADP bind 30- and 150-fold more poorly, respectively, than the corresponding TNP-derivatized forms. Surprisingly, the physiological metal Mg(2+) is not required for ADP binding and only enhances ATP affinity by 3-fold. Although portions of the nucleotide pocket are disordered, the recombinant enzyme is highly stable, unfolding only at temperatures in excess of 70 degrees C. The unusually high affinity of the TNP derivatives compared to the natural nucleotides suggests that hydrophobic substitutions on the ribose ring enforce an altered binding mode that may be exploited for drug design strategies.

  14. Composition for nucleic acid sequencing

    DOEpatents

    Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

    2008-08-26

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  15. Method for sequencing nucleic acid molecules

    DOEpatents

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2006-06-06

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  16. Method for sequencing nucleic acid molecules

    DOEpatents

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2006-05-30

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  17. Effect of the nucleotides surrounding the start codon on the translation of foot-and-mouth disease virus RNA.

    PubMed

    Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R

    2016-06-01

    As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.

  18. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    NASA Astrophysics Data System (ADS)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  19. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, David B.; Lao, Guifang

    1998-01-01

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

  20. The emergence and evolution of life in a "fatty acid world" based on quantum mechanics.

    PubMed

    Tamulis, Arvydas; Grigalavicius, Mantas

    2011-02-01

    Quantum mechanical based electron correlation interactions among molecules are the source of the weak hydrogen and Van der Waals bonds that are critical to the self-assembly of artificial fatty acid micelles. Life on Earth or elsewhere could have emerged in the form of self-reproducing photoactive fatty acid micelles, which gradually evolved into nucleotide-containing micelles due to the enhanced ability of nucleotide-coupled sensitizer molecules to absorb visible light. Comparison of the calculated absorption spectra of micelles with and without nucleotides confirmed this idea and supports the idea of the emergence and evolution of nucleotides in minimal cells of a so-called Fatty Acid World. Furthermore, the nucleotide-caused wavelength shift and broadening of the absorption pattern potentially gives these molecules an additional valuable role, other than a purely genetic one in the early stages of the development of life. From the information theory point of view, the nucleotide sequences in such micelles carry positional information providing better electron transport along the nucleotide-sensitizer chain and, in addition, providing complimentary copies of that information for the next generation. Nucleotide sequences, which in the first period of evolution of fatty acid molecules were useful just for better absorbance of the light in the longer wavelength region, later in the PNA or RNA World, took on the role of genetic information storage.

  1. Genetics Home Reference: TK2-related mitochondrial DNA depletion syndrome, myopathic form

    MedlinePlus

    ... mtDNA. Specifically, this enzyme plays a role in recycling mtDNA building blocks (nucleotides) so that errors in ... kinase 2. A decrease in enzyme activity impairs recycling of mtDNA nucleotides, causing a shortage of nucleotides ...

  2. Molecular recognition of nucleotides in micelles and the development and expansion of a chemistry outreach program

    NASA Astrophysics Data System (ADS)

    Schechinger, Linda Sue

    I. To investigate the delivery of nucleotide-based drugs, we are studying molecular recognition of nucleotide derivatives in environments that are similar to cell membranes. The Nowick group previously discovered that membrane-like surfactant micelles tetradecyltrimethylammonium bromide (TTAB) micelle facilitate molecular of adenosine monophosphate (AMP) recognition. The micelles bind nucleotides by means of electrostatic interactions and hydrogen bonding. We observed binding by following 1H NMR chemical shift changes of unique hexylthymine protons upon addition of AMP. Cationic micelles are required for binding. In surfactant-free or sodium dodecylsulfate solutions, no hydrogen bonding is observed. These observations suggest that the cationic surfactant headgroups bind the nucleotide phosphate group, while the intramicellar base binds the nucleotide base. The micellar system was optimized to enhance binding and selectivity for adenosine nucleotides. The selectivity for adenosine and the number of phosphate groups attached to the adenosine were both investigated. Addition of cytidine, guanidine, or uridine monophosphates, results in no significant downfield shifting of the NH resonance. Selectivity for the phosphate is limited, since adenosine mono-, di-, and triphosphates all have similar binding constants. We successfully achieved molecular recognition of adenosine nucleotides in micellar environments. There is significant difference in the binding interactions between the adenosine nucleotides and three other natural nucleotides. II. The UCI Chemistry Outreach Program (UCICOP) addresses the declining interest of the nations youth for science. UCICOP brings fun and exciting chemistry experiments to local high schools, to remind students that science is fun and has many practical uses. Volunteer students and alumni of UCI perform the demonstrations using scripts and material provided by UCICOP. The preparation of scripts and materials is done by two coordinators. These coordinators organize the program and provide continuity to the program. The success of UCICOP can be measured by the high praise and gratitude expressed by the teachers, students and volunteers.

  3. High-throughput discovery of rare human nucleotide polymorphisms by Ecotilling

    PubMed Central

    Till, Bradley J.; Zerr, Troy; Bowers, Elisabeth; Greene, Elizabeth A.; Comai, Luca; Henikoff, Steven

    2006-01-01

    Human individuals differ from one another at only ∼0.1% of nucleotide positions, but these single nucleotide differences account for most heritable phenotypic variation. Large-scale efforts to discover and genotype human variation have been limited to common polymorphisms. However, these efforts overlook rare nucleotide changes that may contribute to phenotypic diversity and genetic disorders, including cancer. Thus, there is an increasing need for high-throughput methods to robustly detect rare nucleotide differences. Toward this end, we have adapted the mismatch discovery method known as Ecotilling for the discovery of human single nucleotide polymorphisms. To increase throughput and reduce costs, we developed a universal primer strategy and implemented algorithms for automated band detection. Ecotilling was validated by screening 90 human DNA samples for nucleotide changes in 5 gene targets and by comparing results to public resequencing data. To increase throughput for discovery of rare alleles, we pooled samples 8-fold and found Ecotilling to be efficient relative to resequencing, with a false negative rate of 5% and a false discovery rate of 4%. We identified 28 new rare alleles, including some that are predicted to damage protein function. The detection of rare damaging mutations has implications for models of human disease. PMID:16893952

  4. On fuzzy semantic similarity measure for DNA coding.

    PubMed

    Ahmad, Muneer; Jung, Low Tang; Bhuiyan, Md Al-Amin

    2016-02-01

    A coding measure scheme numerically translates the DNA sequence to a time domain signal for protein coding regions identification. A number of coding measure schemes based on numerology, geometry, fixed mapping, statistical characteristics and chemical attributes of nucleotides have been proposed in recent decades. Such coding measure schemes lack the biologically meaningful aspects of nucleotide data and hence do not significantly discriminate coding regions from non-coding regions. This paper presents a novel fuzzy semantic similarity measure (FSSM) coding scheme centering on FSSM codons׳ clustering and genetic code context of nucleotides. Certain natural characteristics of nucleotides i.e. appearance as a unique combination of triplets, preserving special structure and occurrence, and ability to own and share density distributions in codons have been exploited in FSSM. The nucleotides׳ fuzzy behaviors, semantic similarities and defuzzification based on the center of gravity of nucleotides revealed a strong correlation between nucleotides in codons. The proposed FSSM coding scheme attains a significant enhancement in coding regions identification i.e. 36-133% as compared to other existing coding measure schemes tested over more than 250 benchmarked and randomly taken DNA datasets of different organisms. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Cyclic nucleotide content of tobacco BY-2 cells.

    PubMed

    Richards, Helen; Das, Swadipa; Smith, Christopher J; Pereira, Louisa; Geisbrecht, Alan; Devitt, Nicola J; Games, David E; van Geyschem, Jan; Gareth Brenton, A; Newton, Russell P

    2002-11-01

    The cyclic nucleotide content of cultured tobacco bright yellow-2 (BY-2) cells was determined, after freeze-killing, perchlorate extraction and sequential chromatography, by radioimmunoassay. The identities of the putative cyclic nucleotides, adenosine 3',5'-cyclic monophosphate (cyclic AMP), guanosine 3',5'-cyclic monophosphate (cyclic GMP) and cytidine 3',5'-cyclic monophosphate (cyclic CMP) were unambiguously confirmed by tandem mass spectrometry. The potential of BY-2 cell cultures as a model system for future investigations of cyclic nucleotide function in higher plants is discussed.

  6. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, D.B.; Lao, G.

    1998-01-06

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

  7. Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

    PubMed Central

    Levis, R; Schlesinger, S; Huang, H V

    1990-01-01

    Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651

  8. Comparative genomic analyses reveal a vast, novel network of nucleotide-centric systems in biological conflicts, immunity and signaling

    PubMed Central

    Burroughs, A. Maxwell; Zhang, Dapeng; Schäffer, Daniel E.; Iyer, Lakshminarayan M.; Aravind, L.

    2015-01-01

    Cyclic di- and linear oligo-nucleotide signals activate defenses against invasive nucleic acids in animal immunity; however, their evolutionary antecedents are poorly understood. Using comparative genomics, sequence and structure analysis, we uncovered a vast network of systems defined by conserved prokaryotic gene-neighborhoods, which encode enzymes generating such nucleotides or alternatively processing them to yield potential signaling molecules. The nucleotide-generating enzymes include several clades of the DNA-polymerase β-like superfamily (including Vibrio cholerae DncV), a minimal version of the CRISPR polymerase and DisA-like cyclic-di-AMP synthetases. Nucleotide-binding/processing domains include TIR domains and members of a superfamily prototyped by Smf/DprA proteins and base (cytokinin)-releasing LOG enzymes. They are combined in conserved gene-neighborhoods with genes for a plethora of protein superfamilies, which we predict to function as nucleotide-sensors and effectors targeting nucleic acids, proteins or membranes (pore-forming agents). These systems are sometimes combined with other biological conflict-systems such as restriction-modification and CRISPR/Cas. Interestingly, several are coupled in mutually exclusive neighborhoods with either a prokaryotic ubiquitin-system or a HORMA domain-PCH2-like AAA+ ATPase dyad. The latter are potential precursors of equivalent proteins in eukaryotic chromosome dynamics. Further, components from these nucleotide-centric systems have been utilized in several other systems including a novel diversity-generating system with a reverse transcriptase. We also found the Smf/DprA/LOG domain from these systems to be recruited as a predicted nucleotide-binding domain in eukaryotic TRPM channels. These findings point to evolutionary and mechanistic links, which bring together CRISPR/Cas, animal interferon-induced immunity, and several other systems that combine nucleic-acid-sensing and nucleotide-dependent signaling. PMID:26590262

  9. Evidence for the absence of the terminal adenine nucleotide at the amino acid-acceptor end of transfer ribonucleic acid in non-lactating bovine mammary gland and its inhibitory effect on the aminoacylation of rat liver transfer ribonucleic acid

    PubMed Central

    Herrington, M. D.; Hawtrey, A. O.

    1970-01-01

    1. tRNA isolated from non-lactating bovine mammary gland competitively inhibits the formation of aminoacyl-tRNA in the rat liver system. 2. Non-lactating bovine mammary gland tRNA and twice-pyrophosphorolysed rat liver tRNA are unable to accept amino acids in a reaction catalysed by aminoacyl-tRNA synthetases from either rat liver or bovine mammary gland. Deacylated rat liver tRNA can however be aminoacylated in the presence of either enzyme. 3. Bovine mammary gland tRNA lacks the terminal adenine nucleotide at the 3′-terminus amino acid acceptor end, which can be replaced by incubation in the presence of rat liver nucleotide-incorporating enzyme, ATP and CTP. 4. The enzymically modified bovine tRNA (tRNApCpCpA) can bind labelled amino acids to form aminoacyl-tRNA, which can then transfer its labelled amino acids to growing polypeptide chains on ribosomes. 5. Molecules of rat liver tRNA or bovine mammary gland tRNA that lack the terminal adenine nucleotide or the terminal cytosine and adenine nucleotides inhibit the aminoacylation of normal rat liver tRNA to varying degrees. tRNA molecules lacking the terminal −pCpCpA nucleotide sequence exhibit the major inhibitory effect. 6. The enzyme fraction from bovine mammary gland corresponding to that containing the nucleotide-incorporating enzyme in rat liver is unable to catalyse the incorporation of cytosine and adenine nucleotides in pyrophosphorolysed rat liver tRNA and deacylated bovine tRNA. This fraction also markedly inhibits the action of the rat liver nucleotide-incorporating enzyme. PMID:5435687

  10. Interaction centres of pyrimidine nucleotides: cytidine-5'-diphosphate (CDP) and cytidine-5'-triphosphate (CTP) in their reactions with tetramines and Cu(II) ions.

    PubMed

    Gasowska, A

    2005-08-01

    The interactions between pyrimidine nucleotides: cytidine-5'-diphosphate (CDP) and cytidine-5'-triphosphate (CTP) and Cu(II) ions, spermine (Spm) and 1,11-diamino-4,8-diazaundecane (3,3,3-tet) have been studied. The composition and stability constants of the complexes formed have been determined by means of the potentiometric method, while the centres of interactions in the ligands have been identified by the spectral methods (UV-Vis, Ultraviolet and Visible spectroscopy; EPR, electron spin resonance; NMR). In the systems without metal, formation of the molecular complexes nucleotide-polyamine with the interaction centres at the endocyclic nitrogen atom of purine ring N3, the oxygen atoms of the phosphate group from the nucleotide and protonated nitrogen atoms of the polyamine have been detected. Significant differences have been found in the metallation between the systems with Spm and with 3,3,3-tet. In the systems with spermine, mainly protonated species are formed with the phosphate group of the nucleotide and deprotonated nitrogen atoms of the polyamine making the coordination centres, while the donor nitrogen atom of the nucleotide N3 is involved in the intramolecular interligand interactions, additionally stabilising the complex. In the systems with 3,3,3-tet, the MLL' type species are formed in which the oxygen atoms of the phosphate group and nitrogen atoms of the polyamine are involved in metallation, whereas the N3 atom from the pyrimidine ring of the nucleotide is located outside the inner coordination sphere of copper ion. The main centre of Cu(II) interaction in the nucleotide, both in the system with Spm and 3,3,3-tet is the phosphate group of the nucleotide.

  11. Pre-steady-state Kinetic Analysis of a Family D DNA Polymerase from Thermococcus sp. 9°N Reveals Mechanisms for Archaeal Genomic Replication and Maintenance*

    PubMed Central

    Schermerhorn, Kelly M.; Gardner, Andrew F.

    2015-01-01

    Family D DNA polymerases (polDs) have been implicated as the major replicative polymerase in archaea, excluding the Crenarchaeota branch, and bear little sequence homology to other DNA polymerase families. Here we report a detailed kinetic analysis of nucleotide incorporation and exonuclease activity for a Family D DNA polymerase from Thermococcus sp. 9°N. Pre-steady-state single-turnover nucleotide incorporation assays were performed to obtain the kinetic parameters, kpol and Kd, for correct nucleotide incorporation, incorrect nucleotide incorporation, and ribonucleotide incorporation by exonuclease-deficient polD. Correct nucleotide incorporation kinetics revealed a relatively slow maximal rate of polymerization (kpol ∼2.5 s−1) and especially tight nucleotide binding (Kd(dNTP) ∼1.7 μm), compared with DNA polymerases from Families A, B, C, X, and Y. Furthermore, pre-steady-state nucleotide incorporation assays revealed that polD prevents the incorporation of incorrect nucleotides and ribonucleotides primarily through reduced nucleotide binding affinity. Pre-steady-state single-turnover assays on wild-type 9°N polD were used to examine 3′-5′ exonuclease hydrolysis activity in the presence of Mg2+ and Mn2+. Interestingly, substituting Mn2+ for Mg2+ accelerated hydrolysis rates >40-fold (kexo ≥110 s−1 versus ≥2.5 s−1). Preference for Mn2+ over Mg2+ in exonuclease hydrolysis activity is a property unique to the polD family. The kinetic assays performed in this work provide critical insight into the mechanisms that polD employs to accurately and efficiently replicate the archaeal genome. Furthermore, despite the unique properties of polD, this work suggests that a conserved polymerase kinetic pathway is present in all known DNA polymerase families. PMID:26160179

  12. Roles of PDE1 in Pathological Cardiac Remodeling and Dysfunction.

    PubMed

    Chen, Si; Knight, Walter E; Yan, Chen

    2018-04-23

    Pathological cardiac hypertrophy and dysfunction is a response to various stress stimuli and can result in reduced cardiac output and heart failure. Cyclic nucleotide signaling regulates several cardiac functions including contractility, remodeling, and fibrosis. Cyclic nucleotide phosphodiesterases (PDEs), by catalyzing the hydrolysis of cyclic nucleotides, are critical in the homeostasis of intracellular cyclic nucleotide signaling and hold great therapeutic potential as drug targets. Recent studies have revealed that the inhibition of the PDE family member PDE1 plays a protective role in pathological cardiac remodeling and dysfunction by the modulation of distinct cyclic nucleotide signaling pathways. This review summarizes recent key findings regarding the roles of PDE1 in the cardiac system that can lead to a better understanding of its therapeutic potential.

  13. Database of amino acid-nucleotide contacts in contacts in DNA-homeodomain protein

    NASA Astrophysics Data System (ADS)

    Grokhlina, T. I.; Zrelov, P. V.; Ivanov, V. V.; Polozov, R. V.; Chirgadze, Yu. N.; Sivozhelezov, V. S.

    2013-09-01

    The analysis of amino acid-nucleotide contacts in interfaces of the protein-DNA complexes, intended to find consistencies in the protein-DNA recognition, is a complex problem that requires an analysis of the physicochemical characteristics of these contacts and the positions of the participating amino acids and nucleotides in the chains of the protein and the DNA, respectively, as well as conservatism of these contacts. Thus, those heterogeneous data should be systematized. For this purpose we have developed a database of amino acid-nucleotide contacts ANTPC (Amino acid Nucleotide Type Position Conservation) following the archetypal example of the proteins in the homeodomain family. We show that it can be used to compare and classify the interfaces of the protein-DNA complexes.

  14. Advances in targeting cyclic nucleotide phosphodiesterases

    PubMed Central

    Maurice, Donald H.; Ke, Hengming; Ahmad, Faiyaz; Wang, Yousheng; Chung, Jay; Manganiello, Vincent C.

    2014-01-01

    Cyclic nucleotide phosphodiesterases (PDEs) catalyse the hydrolysis of cyclic AMP and cyclic GMP, thereby regulating the intracellular concentrations of these cyclic nucleotides, their signalling pathways and, consequently, myriad biological responses in health and disease. Currently, a small number of PDE inhibitors are used clinically for treating the pathophysiological dysregulation of cyclic nucleotide signalling in several disorders, including erectile dysfunction, pulmonary hypertension, acute refractory cardiac failure, intermittent claudication and chronic obstructive pulmonary disease. However, pharmaceutical interest in PDEs has been reignited by the increasing understanding of the roles of individual PDEs in regulating the subcellular compartmentalization of specific cyclic nucleotide signalling pathways, by the structure-based design of novel specific inhibitors and by the development of more sophisticated strategies to target individual PDE variants. PMID:24687066

  15. Divergent prebiotic synthesis of pyrimidine and 8-oxo-purine ribonucleotides

    NASA Astrophysics Data System (ADS)

    Stairs, Shaun; Nikmal, Arif; Bučar, Dejan-Krešimir; Zheng, Shao-Liang; Szostak, Jack W.; Powner, Matthew W.

    2017-05-01

    Understanding prebiotic nucleotide synthesis is a long standing challenge thought to be essential to elucidating the origins of life on Earth. Recently, remarkable progress has been made, but to date all proposed syntheses account separately for the pyrimidine and purine ribonucleotides; no divergent synthesis from common precursors has been proposed. Moreover, the prebiotic syntheses of pyrimidine and purine nucleotides that have been demonstrated operate under mutually incompatible conditions. Here, we tackle this mutual incompatibility by recognizing that the 8-oxo-purines share an underlying generational parity with the pyrimidine nucleotides. We present a divergent synthesis of pyrimidine and 8-oxo-purine nucleotides starting from a common prebiotic precursor that yields the β-ribo-stereochemistry found in the sugar phosphate backbone of biological nucleic acids. The generational relationship between pyrimidine and 8-oxo-purine nucleotides suggests that 8-oxo-purine ribonucleotides may have played a key role in primordial nucleic acids prior to the emergence of the canonical nucleotides of biology.

  16. Nucleobase and nucleoside transport and integration into plant metabolism

    PubMed Central

    Girke, Christopher; Daumann, Manuel; Niopek-Witz, Sandra; Möhlmann, Torsten

    2014-01-01

    Nucleotide metabolism is an essential process in all living organisms. Besides newly synthesized nucleotides, the recycling (salvage) of partially degraded nucleotides, i.e., nucleosides and nucleobases serves to keep the homeostasis of the nucleotide pool. Both types of metabolites are substrates of at least six families of transport proteins in Arabidopsis thaliana (Arabidopsis) with a total of 49 members. In the last years several members of such transport proteins have been analyzed allowing to present a more detailed picture of nucleoside and nucleobase transport and the physiological function of these processes. Besides functioning in nucleotide metabolism it turned out that individual members of the before named transporters exhibit the capacity to transport a wide range of different substrates including vitamins and phytohormones. The aim of this review is to summarize the current knowledge on nucleobase and nucleoside transport processes in plants and integrate this into nucleotide metabolism in general. Thereby, we will focus on those proteins which have been characterized at the biochemical level. PMID:25250038

  17. Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

    PubMed

    Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

    2013-06-01

    Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

  18. CNG and HCN channels: two peas, one pod.

    PubMed

    Craven, Kimberley B; Zagotta, William N

    2006-01-01

    Cyclic nucleotide-activated ion channels play a fundamental role in a variety of physiological processes. By opening in response to intracellular cyclic nucleotides, they translate changes in concentrations of signaling molecules to changes in membrane potential. These channels belong to two families: the cyclic nucleotide-gated (CNG) channels and the hyperpolarization-activated cyclic nucleotide-modulated (HCN) channels. The two families exhibit high sequence similarity and belong to the superfamily of voltage-gated potassium channels. Whereas HCN channels are activated by voltage and CNG channels are virtually voltage independent, both channels are activated by cyclic nucleotide binding. Furthermore, the channels are thought to have similar channel structures, leading to similar mechanisms of activation by cyclic nucleotides. However, although these channels are structurally and behaviorally similar, they have evolved to perform distinct physiological functions. This review describes the physiological roles and biophysical behavior of CNG and HCN channels. We focus on how similarities in structure and activation mechanisms result in common biophysical models, allowing CNG and HCN channels to be viewed as a single genre.

  19. Structure of a eukaryotic cyclic nucleotide-gated channel

    PubMed Central

    Li, Minghui; Zhou, Xiaoyuan; Wang, Shu; Michailidis, Ioannis; Gong, Ye; Su, Deyuan; Li, Huan; Li, Xueming; Yang, Jian

    2018-01-01

    Summary Cyclic nucleotide-gated (CNG) channels are essential for vision and olfaction. They belong to the voltage-gated ion channel superfamily but their activities are controlled by intracellular cyclic nucleotides instead of transmembrane voltage. Here we report a 3.5 Å-resolution single-particle electron cryomicroscopy structure of a CNG channel from C. elegans in the cGMP-bound open state. The channel has an unusual voltage-sensor-like domain (VSLD), accounting for its deficient voltage dependence. A C-terminal linker connecting S6 and the cyclic nucleotide-binding domain interacts directly with both the VSLD and pore domain, forming a gating ring that couples conformational changes triggered by cyclic nucleotide binding to the gate. The selectivity filter is lined by the carboxylate side chains of a functionally important glutamate and three rings of backbone carbonyls. This structure provides a new framework for understanding mechanisms of ion permeation, gating and channelopathy of CNG channels and cyclic nucleotide modulation of related channels. PMID:28099415

  20. Evaluation of Brewer's spent yeast to produce flavor enhancer nucleotides: influence of serial repitching.

    PubMed

    Vieira, Elsa; Brandão, Tiago; Ferreira, Isabel M P L V O

    2013-09-18

    The present work evaluates the influence of serial yeast repitching on nucleotide composition of brewer's spent yeast extracts produced without addition of exogenous enzymes. Two procedures for disrupting cell walls were compared, and the conditions for low-cost and efficient RNA hydrolysis were selected. A HILIC methodology was validated for the quantification of nucleotides and nucleosides in yeast extracts. Thirty-seven samples of brewer's spent yeast ( Saccharomyces pastorianus ) organized according to the number of serial repitchings were analyzed. Nucleotides accounted for 71.1-88.2% of the RNA products; 2'AMP was the most abundant (ranging between 0.08 and 2.89 g/100 g dry yeast). 5'GMP content ranged between 0.082 and 0.907 g/100 g dry yeast. The sum of 5'GMP, 5'IMP, and 5'AMP represented between 25 and 32% of total nucleotides. This works highlights for the first time that although serial repitching influences the content of monophosphate nucleotides and nucleosides, the profiles of these RNA hydrolysis products are not affected.

  1. Electron microscopic visualization of sites of nascent DNA synthesis by streptavidin-gold binding to biotinylated nucleotides incorporated in vivo

    PubMed Central

    1988-01-01

    Biotinylated nucleotides (bio-11-dCTP, bio-11-dUTP, and bio-7-dATP) were microinjected into unfertilized and fertilized Xenopus laevis eggs. The amounts introduced were comparable to in vivo deoxy- nucleoside triphosphate pools. At various times after microinjection, DNA was extracted from eggs or embryos and subjected to electrophoresis on agarose gels. Newly synthesized biotinylated DNA was analyzed by Southern transfer and visualized using either the BluGENE or Detek-hrp streptavidin-based nucleic acid detection systems. Quantitation of the amount of biotinylated DNA observed at various times showed that the microinjected biotinylated nucleotides were efficiently incorporated in vivo, both into replicating endogenous chromosomal DNA and into replicating microinjected exogenous plasmid DNA. At least one biotinylated nucleotide could be incorporated in vivo for every eight nucleotides of DNA synthesized. Control experiments also showed that heavily biotinylated DNA was not subjected to detectable DNA repair during early embryogenesis (for at least 5 h after activation of the eggs). The incorporated biotinylated nucleotides were visualized by electron microscopy by using streptavidin-colloidal gold or streptavidin-ferritin conjugates to bind specifically to the biotin groups projecting from the newly replicated DNA. The incorporated biotinylated nucleotides were thus made visible as electron-dense spots on the underlying DNA molecules. Biotinylated nucleotides separated by 20-50 bases could be resolved. We conclude that nascent DNA synthesized in vivo in Xenopus laevis eggs can be visualized efficiently and specifically using the techniques described. PMID:3392102

  2. New perspectives in cyclic nucleotide-mediated functions in the CNS: the emerging role of cyclic nucleotide-gated (CNG) channels.

    PubMed

    Podda, Maria Vittoria; Grassi, Claudio

    2014-07-01

    Cyclic nucleotides play fundamental roles in the central nervous system (CNS) under both physiological and pathological conditions. The impact of cAMP and cGMP signaling on neuronal and glial cell functions has been thoroughly characterized. Most of their effects have been related to cyclic nucleotide-dependent protein kinase activity. However, cyclic nucleotide-gated (CNG) channels, first described as key mediators of sensory transduction in retinal and olfactory receptors, have been receiving increasing attention as possible targets of cyclic nucleotides in the CNS. In the last 15 years, consistent evidence has emerged for their expression in neurons and astrocytes of the rodent brain. Far less is known, however, about the functional role of CNG channels in these cells, although several of their features, such as Ca(2+) permeability and prolonged activation in the presence of cyclic nucleotides, make them ideal candidates for mediators of physiological functions in the CNS. Here, we review literature suggesting the involvement of CNG channels in a number of CNS cellular functions (e.g., regulation of membrane potential, neuronal excitability, and neurotransmitter release) as well as in more complex phenomena, like brain plasticity, adult neurogenesis, and pain sensitivity. The emerging picture is that functional and dysfunctional cyclic nucleotide signaling in the CNS has to be reconsidered including CNG channels among possible targets. However, concerted efforts and multidisciplinary approaches are still needed to get more in-depth knowledge in this field.

  3. Synthesis and evaluations of an acid-cleavable, fluorescently labeled nucleotide as a reversible terminator for DNA sequencing.

    PubMed

    Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng

    2016-02-11

    An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.

  4. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

    USDA-ARS?s Scientific Manuscript database

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  5. 77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-29

    ... DEPARTMENT OF COMMERCE Patent and Trademark Office Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request... Patent applications that contain nucleotide and/or amino acid sequence disclosures must include a copy of...

  6. Nucleoside phosphorylation in amide solutions

    NASA Technical Reports Server (NTRS)

    Schoffstall, A. M.; Kokko, B.

    1978-01-01

    The paper deals with phosphorylation in possible prebiotic nonaqueous solvents. To this end, phosphorylation of nucleosides using inorganic phosphates in amide solutions is studied at room and elevated temperatures. Reaction proceeds most readily in formamide and N-methylformamide. Products obtained at elevated temperature are nucleotides, nucleoside 2',3'-cyclic phosphates, and when the phosphate concentration is high, nucleoside diphosphates. At room temperature, adenosine afforded a mixture of nucleotides, but none of the cyclic nucleotide. Conditions leading to the highest relative percentage of cyclic nucleotide involve the use of low concentrations of phosphate and an excess of nucleoside.

  7. A robust methodology to subclassify pseudokinases based on their nucleotide-binding properties

    PubMed Central

    Murphy, James M.; Zhang, Qingwei; Young, Samuel N.; Reese, Michael L.; Bailey, Fiona P.; Eyers, Patrick A.; Ungureanu, Daniela; Hammaren, Henrik; Silvennoinen, Olli; Varghese, Leila N.; Chen, Kelan; Tripaydonis, Anne; Jura, Natalia; Fukuda, Koichi; Qin, Jun; Nimchuk, Zachary; Mudgett, Mary Beth; Elowe, Sabine; Gee, Christine L.; Liu, Ling; Daly, Roger J.; Manning, Gerard; Babon, Jeffrey J.; Lucet, Isabelle S.

    2017-01-01

    Protein kinase-like domains that lack conserved residues known to catalyse phosphoryl transfer, termed pseudokinases, have emerged as important signalling domains across all kingdoms of life. Although predicted to function principally as catalysis-independent protein-interaction modules, several pseudokinase domains have been attributed unexpected catalytic functions, often amid controversy. We established a thermal-shift assay as a benchmark technique to define the nucleotide-binding properties of kinase-like domains. Unlike in vitro kinase assays, this assay is insensitive to the presence of minor quantities of contaminating kinases that may otherwise lead to incorrect attribution of catalytic functions to pseudokinases. We demonstrated the utility of this method by classifying 31 diverse pseudokinase domains into four groups: devoid of detectable nucleotide or cation binding; cation-independent nucleotide binding; cation binding; and nucleotide binding enhanced by cations. Whereas nine pseudokinases bound ATP in a divalent cation-dependent manner, over half of those examined did not detectably bind nucleotides, illustrating that pseudokinase domains predominantly function as non-catalytic protein-interaction modules within signalling networks and that only a small subset is potentially catalytically active. We propose that henceforth the thermal-shift assay be adopted as the standard technique for establishing the nucleotide-binding and catalytic potential of kinase-like domains. PMID:24107129

  8. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zoghbi, M. E.; Altenberg, G. A.

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less

  9. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    PubMed Central

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  10. Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout

    USGS Publications Warehouse

    Rasmussen, C.; Purcell, M.K.; Gregg, J.L.; LaPatra, S.E.; Winton, J.R.; Hershberger, P.K.

    2010-01-01

    The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of ~740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

  11. Organization of Nucleotides in Different Environments and the Formation of Pre-Polymers

    NASA Astrophysics Data System (ADS)

    Himbert, Sebastian; Chapman, Mindy; Deamer, David W.; Rheinstädter, Maikel C.

    2016-08-01

    RNA is a linear polymer of nucleotides linked by a ribose-phosphate backbone. Polymerization of nucleotides occurs in a condensation reaction in which phosphodiester bonds are formed. However, in the absence of enzymes and metabolism there has been no obvious way for RNA-like molecules to be produced and then encapsulated in cellular compartments. We investigated 5‧-adenosine monophosphate (AMP) and 5‧-uridine monophosphate (UMP) molecules confined in multi-lamellar phospholipid bilayers, nanoscopic films, ammonium chloride salt crystals and Montmorillonite clay, previously proposed to promote polymerization. X-ray diffraction was used to determine whether such conditions imposed a degree of order on the nucleotides. Two nucleotide signals were observed in all matrices, one corresponding to a nearest neighbour distance of 4.6 Å attributed to nucleotides that form a disordered, glassy structure. A second, smaller distance of 3.4 Å agrees well with the distance between stacked base pairs in the RNA backbone, and was assigned to the formation of pre-polymers, i.e., the organization of nucleotides into stacks of about 10 monomers. Such ordering can provide conditions that promote the nonenzymatic polymerization of RNA strands under prebiotic conditions. Experiments were modeled by Monte-Carlo simulations, which provide details of the molecular structure of these pre-polymers.

  12. The waiting time problem in a model hominin population.

    PubMed

    Sanford, John; Brewer, Wesley; Smith, Franzine; Baumgardner, John

    2015-09-17

    Functional information is normally communicated using specific, context-dependent strings of symbolic characters. This is true within the human realm (texts and computer programs), and also within the biological realm (nucleic acids and proteins). In biology, strings of nucleotides encode much of the information within living cells. How do such information-bearing nucleotide strings arise and become established? This paper uses comprehensive numerical simulation to understand what types of nucleotide strings can realistically be established via the mutation/selection process, given a reasonable timeframe. The program Mendel's Accountant realistically simulates the mutation/selection process, and was modified so that a starting string of nucleotides could be specified, and a corresponding target string of nucleotides could be specified. We simulated a classic pre-human hominin population of at least 10,000 individuals, with a generation time of 20 years, and with very strong selection (50% selective elimination). Random point mutations were generated within the starting string. Whenever an instance of the target string arose, all individuals carrying the target string were assigned a specified reproductive advantage. When natural selection had successfully amplified an instance of the target string to the point of fixation, the experiment was halted, and the waiting time statistics were tabulated. Using this methodology we tested the effect of mutation rate, string length, fitness benefit, and population size on waiting time to fixation. Biologically realistic numerical simulations revealed that a population of this type required inordinately long waiting times to establish even the shortest nucleotide strings. To establish a string of two nucleotides required on average 84 million years. To establish a string of five nucleotides required on average 2 billion years. We found that waiting times were reduced by higher mutation rates, stronger fitness benefits, and larger population sizes. However, even using the most generous feasible parameters settings, the waiting time required to establish any specific nucleotide string within this type of population was consistently prohibitive. We show that the waiting time problem is a significant constraint on the macroevolution of the classic hominin population. Routine establishment of specific beneficial strings of two or more nucleotides becomes very problematic.

  13. Structural Dynamics as a Contributor to Error-prone Replication by an RNA-dependent RNA Polymerase*

    PubMed Central

    Moustafa, Ibrahim M.; Korboukh, Victoria K.; Arnold, Jamie J.; Smidansky, Eric D.; Marcotte, Laura L.; Gohara, David W.; Yang, Xiaorong; Sánchez-Farrán, María Antonieta; Filman, David; Maranas, Janna K.; Boehr, David D.; Hogle, James M.; Colina, Coray M.; Cameron, Craig E.

    2014-01-01

    RNA viruses encoding high- or low-fidelity RNA-dependent RNA polymerases (RdRp) are attenuated. The ability to predict residues of the RdRp required for faithful incorporation of nucleotides represents an essential step in any pipeline intended to exploit perturbed fidelity as the basis for rational design of vaccine candidates. We used x-ray crystallography, molecular dynamics simulations, NMR spectroscopy, and pre-steady-state kinetics to compare a mutator (H273R) RdRp from poliovirus to the wild-type (WT) enzyme. We show that the nucleotide-binding site toggles between the nucleotide binding-occluded and nucleotide binding-competent states. The conformational dynamics between these states were enhanced by binding to primed template RNA. For the WT, the occluded conformation was favored; for H273R, the competent conformation was favored. The resonance for Met-187 in our NMR spectra reported on the ability of the enzyme to check the correctness of the bound nucleotide. Kinetic experiments were consistent with the conformational dynamics contributing to the established pre-incorporation conformational change and fidelity checkpoint. For H273R, residues comprising the active site spent more time in the catalytically competent conformation and were more positively correlated than the WT. We propose that by linking the equilibrium between the binding-occluded and binding-competent conformations of the nucleotide-binding pocket and other active-site dynamics to the correctness of the bound nucleotide, faithful nucleotide incorporation is achieved. These studies underscore the need to apply multiple biophysical and biochemical approaches to the elucidation of the physical basis for polymerase fidelity. PMID:25378410

  14. Analysis of cytokinin nucleotides in coconut (Cocos nucifera L.) water using capillary zone electrophoresis-tandem mass spectrometry after solid-phase extraction.

    PubMed

    Ge, Liya; Yong, Jean Wan Hong; Tan, Swee Ngin; Yang, Xin Hao; Ong, Eng Shi

    2006-11-10

    A method based on solid-phase extraction (SPE) and capillary zone electrophoresis-tandem mass spectrometry (CZE-MS/MS) is described for the separation and determination of six cytokinin nucleotides in coconut water. The best CZE separation for the six cytokinin nucleotide standards was achieved using a 25 mM ammonium formate/formic acid buffer (pH 3.8) and 2% (v/v) methanol with an applied gradient separation voltage (25 kV for 32 min, and then a linear gradient to 30 kV in 5 min, finally 30 kV to the end of separation) in less than 60 min. MS/MS with multiple reaction monitoring (MRM) detection was carried out to obtain sufficient selectivity and sensitivity for the cytokinin nucleotides. The combined use of on-line sample stacking and CZE-MS/MS achieved limits of detection (LODs) in the range of 0.06-0.19 microM for the six cytokinin nucleotides at a signal-to-noise ratio of 3. Furthermore, a novel dual-step SPE procedure was developed for the pre-concentration and purification of cytokinin nucleotides using Oasis HLB and Oasis MAX cartridges. The recoveries of the cytokinin nucleotides after the dual-step SPE were in the range of 44-71%. The combination of off-line SPE, on-line sample stacking and CZE-MS/MS approach was successfully applied to screen for endogenous cytokinin nucleotides present in coconut water sample. trans-Zeatin riboside-5'-monophosphate (ZMP) was detected and quantified in coconut water by CZE-MS/MS after SPE and on-line sample stacking.

  15. Evolution of Nucleotide Punctuation Marks: From Structural to Linear Signals.

    PubMed

    El Houmami, Nawal; Seligmann, Hervé

    2017-01-01

    We present an evolutionary hypothesis assuming that signals marking nucleotide synthesis (DNA replication and RNA transcription) evolved from multi- to unidimensional structures, and were carried over from transcription to translation. This evolutionary scenario presumes that signals combining secondary and primary nucleotide structures are evolutionary transitions. Mitochondrial replication initiation fits this scenario. Some observations reported in the literature corroborate that several signals for nucleotide synthesis function in translation, and vice versa. (a) Polymerase-induced frameshift mutations occur preferentially at translational termination signals (nucleotide deletion is interpreted as termination of nucleotide polymerization, paralleling the role of stop codons in translation). (b) Stem-loop hairpin presence/absence modulates codon-amino acid assignments, showing that translational signals sometimes combine primary and secondary nucleotide structures (here codon and stem-loop). (c) Homopolymer nucleotide triplets (AAA, CCC, GGG, TTT) cause transcriptional and ribosomal frameshifts. Here we find in recently described human mitochondrial RNAs that systematically lack mono-, dinucleotides after each trinucleotide (delRNAs) that delRNA triplets include 2x more homopolymers than mitogenome regions not covered by delRNA. Further analyses of delRNAs show that the natural circular code X (a little-known group of 20 translational signals enabling ribosomal frame retrieval consisting of 20 codons {AAC, AAT, ACC, ATC, ATT, CAG, CTC, CTG, GAA, GAC, GAG, GAT, GCC, GGC, GGT, GTA, GTC, GTT, TAC, TTC} universally overrepresented in coding versus other frames of gene sequences), regulates frameshift in transcription and translation. This dual transcription and translation role confirms for X the hypothesis that translational signals were carried over from transcriptional signals.

  16. Systematic analysis of enzymatic DNA polymerization using oligo-DNA templates and triphosphate analogs involving 2',4'-bridged nucleosides.

    PubMed

    Kuwahara, Masayasu; Obika, Satoshi; Nagashima, Jun-ichi; Ohta, Yuki; Suto, Yoshiyuki; Ozaki, Hiroaki; Sawai, Hiroaki; Imanishi, Takeshi

    2008-08-01

    In order to systematically analyze the effects of nucleoside modification of sugar moieties in DNA polymerase reactions, we synthesized 16 modified templates containing 2',4'-bridged nucleotides and three types of 2',4'-bridged nucleoside-5'-triphospates with different bridging structures. Among the five types of thermostable DNA polymerases used, Taq, Phusion HF, Vent(exo-), KOD Dash and KOD(exo-), the KOD Dash and KOD(exo-) DNA polymerases could smoothly read through the modified templates containing 2'-O,4'-C-methylene-linked nucleotides at intervals of a few nucleotides, even at standard enzyme concentrations for 5 min. Although the Vent(exo-) DNA polymerase also read through these modified templates, kinetic study indicates that the KOD(exo-) DNA polymerase was found to be far superior to the Vent(exo-) DNA polymerase in accurate incorporation of nucleotides. When either of the DNA polymerase was used, the presence of 2',4'-bridged nucleotides on a template strand substantially decreased the reaction rates of nucleotide incorporations. The modified templates containing sequences of seven successive 2',4'-bridged nucleotides could not be completely transcribed by any of the DNA polymerases used; yields of longer elongated products decreased in the order of steric bulkiness of the modified sugars. Successive incorporation of 2',4'-bridged nucleotides into extending strands using 2',4'-bridged nucleoside-5'-triphospates was much more difficult. These data indicate that the sugar modification would have a greater effect on the polymerase reaction when it is adjacent to the elongation terminus than when it is on the template as well, as in base modification.

  17. Phosphate-Modified Nucleotides for Monitoring Enzyme Activity.

    PubMed

    Ermert, Susanne; Marx, Andreas; Hacker, Stephan M

    2017-04-01

    Nucleotides modified at the terminal phosphate position have been proven to be interesting entities to study the activity of a variety of different protein classes. In this chapter, we present various types of modifications that were attached as reporter molecules to the phosphate chain of nucleotides and briefly describe the chemical reactions that are frequently used to synthesize them. Furthermore, we discuss a variety of applications of these molecules. Kinase activity, for instance, was studied by transfer of a phosphate modified with a reporter group to the target proteins. This allows not only studying the activity of kinases, but also identifying their target proteins. Moreover, kinases can also be directly labeled with a reporter at a conserved lysine using acyl-phosphate probes. Another important application for phosphate-modified nucleotides is the study of RNA and DNA polymerases. In this context, single-molecule sequencing is made possible using detection in zero-mode waveguides, nanopores or by a Förster resonance energy transfer (FRET)-based mechanism between the polymerase and a fluorophore-labeled nucleotide. Additionally, fluorogenic nucleotides that utilize an intramolecular interaction between a fluorophore and the nucleobase or an intramolecular FRET effect have been successfully developed to study a variety of different enzymes. Finally, also some novel techniques applying electron paramagnetic resonance (EPR)-based detection of nucleotide cleavage or the detection of the cleavage of fluorophosphates are discussed. Taken together, nucleotides modified at the terminal phosphate position have been applied to study the activity of a large diversity of proteins and are valuable tools to enhance the knowledge of biological systems.

  18. Complete nucleotide sequence and genome organization of a novel allexivirus from alfalfa (Medicago sativa)

    USDA-ARS?s Scientific Manuscript database

    A new species of the family Alphaflexiviridae provisionally named Alfalfa virus S (AVS) was diagnosed in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by Illumina NGS technology ...

  19. Nucleotide variation in genes invloved in wood formation in two pine species

    Treesearch

    David Pot; Lisa McMillan; Craig Echt; Gregoire Le Provost; Pauline Garnier-Gere; Sheree Cato; Christophe Plomion

    2005-01-01

    Nucleotide diversity in eight genes related to wood formation was investigated in two pine species, Pinus pinaster and P. radiata. The nucleotide diversity patterns observed and their properties were compared between the two species according to the specific characteristics of the samples analysed. A lower diversity was observed in P. radiata...

  20. Interstrand disulfide crosslinking of DNA bases supports a double nucleotide unpairing mechanism for flap endonucleases.

    PubMed

    Beddows, Amanda; Patel, Nikesh; Finger, L David; Atack, John M; Williams, David M; Grasby, Jane A

    2012-09-14

    Flap endonucleases (FENs) are proposed to select their target phosphate diester by unpairing the two terminal nucleotides of duplex. Interstrand disulfide crosslinks, introduced by oxidation of thiouracil and thioguanine bases, abolished the specificity of human FEN1 for hydrolysis one nucleotide into the 5'-duplex.

  1. 37 CFR 5.31-5.33 - [Reserved

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... from abandonment 1.135 Amino Acid Sequences. (See Nucleotide and/or Amino Acid Sequences) Appeal to... Appeals and Interference 41.47 Of rejection of an application 1.104(a) Nucleotide and/or Amino Acid...) Symbols for nucleotide and/or amino acid sequence data 1.822 T Tables in patent applications 1.58 Terminal...

  2. 2'-Bispyrene-modified 2'-O-methyl RNA probes as useful tools for the detection of RNA: synthesis, fluorescent properties, and duplex stability.

    PubMed

    Krasheninina, Olga A; Novopashina, Darya S; Lomzov, Alexander A; Venyaminova, Alya G

    2014-09-05

    The synthesis and properties two series of new 2'-O-methyl RNA probes, each containing a single insertion of a 2'-bispyrenylmethylphosphorodiamidate derivative of a nucleotide (U, C, A, and G), are described. As demonstrated by UV melting studies, the probes form stable complexes with model RNAs and DNAs. Significant increases (up to 21-fold) in pyrene excimer fluorescence intensity were observed upon binding of most of the probes with complementary RNAs, but not with DNAs. The fluorescence spectra are independent of the nature of the modified nucleotides. The nucleotides on the 5'-side of the modified nucleotide have no effect on the fluorescence spectra, whereas the natures of the two nucleotides on the 3'-side are important: CC, CG, and UC dinucleotide units on the 3'-side of the modified nucleotide provide the maximum increases in excimer fluorescence intensity. This study suggests that these 2'-bispyrene-labeled 2'-O-methyl RNA probes might be useful tools for detection of RNAs. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Computed Energetics of Nucleotides in Spatial Ribozyme Structures: An Accurate Identification of Functional Regions from Structure

    PubMed Central

    Torshin, Ivan Y.

    2004-01-01

    Ribozymes are functionally diverse RNA molecules with intrinsic catalytic activity. Multiple structural and biochemical studies are required to establish which nucleotide bases are involved in the catalysis. The relative energetic properties of the nucleotide bases have been analyzed in a set of the known ribozyme structures. It was found that many of the known catalytic nucleotides can be identified using only the structure without any additional biochemical data. The results of the calculations compare well with the available biochemical data on RNA stability. Extensive in silico mutagenesis suggests that most of the nucleotides in ribozymes stabilize the RNA. The calculations show that relative contribution of the catalytic bases to RNA stability observably differs from contributions of the noncatalytic bases. Distinction between the concepts of “relative stability” and “mutational stability” is suggested. As results of prediction for several models of ribozymes appear to be in agreement with the published data on the potential active site regions, the method can potentially be used for prediction of functional nucleotides from nucleic sequence. PMID:15105962

  4. Photoinitiator Nucleotide for Quantifying Nucleic Acid Hybridization

    PubMed Central

    Johnson, Leah M.; Hansen, Ryan R.; Urban, Milan; Kuchta, Robert D.; Bowman, Christopher N.

    2010-01-01

    This first report of a photoinitiator-nucleotide conjugate demonstrates a novel approach for sensitive, rapid and visual detection of DNA hybridization events. This approach holds potential for various DNA labeling schemes and for applications benefiting from selective DNA-based polymerization initiators. Here, we demonstrate covalent, enzymatic incorporation of an eosin-photoinitiator 2′-deoxyuridine-5′-triphosphate (EITC-dUTP) conjugate into surface-immobilized DNA hybrids. Subsequent radical chain photoinitiation from these sites using an acrylamide/bis-acrylamide formulation yields a dynamic detection range between 500pM and 50nM of DNA target. Increasing EITC-nucleotide surface densities leads to an increase in surface-based polymer film heights until achieving a film height plateau of 280nm ±20nm at 610 ±70 EITC-nucleotides/μm2. Film heights of 10–20 nm were obtained from eosin surface densities of approximately 20 EITC-nucleotides/μm2 while below the detection limit of ~10 EITC-nucleotides/μm2, no detectable films were formed. This unique threshold behavior is utilized for instrument-free, visual quantification of target DNA concentration ranges. PMID:20337438

  5. Structural basis of reverse nucleotide polymerization

    PubMed Central

    Nakamura, Akiyoshi; Nemoto, Taiki; Heinemann, Ilka U.; Yamashita, Keitaro; Sonoda, Tomoyo; Komoda, Keisuke; Tanaka, Isao; Söll, Dieter; Yao, Min

    2013-01-01

    Nucleotide polymerization proceeds in the forward (5′-3′) direction. This tenet of the central dogma of molecular biology is found in diverse processes including transcription, reverse transcription, DNA replication, and even in lagging strand synthesis where reverse polymerization (3′-5′) would present a “simpler” solution. Interestingly, reverse (3′-5′) nucleotide addition is catalyzed by the tRNA maturation enzyme tRNAHis guanylyltransferase, a structural homolog of canonical forward polymerases. We present a Candida albicans tRNAHis guanylyltransferase-tRNAHis complex structure that reveals the structural basis of reverse polymerization. The directionality of nucleotide polymerization is determined by the orientation of approach of the nucleotide substrate. The tRNA substrate enters the enzyme’s active site from the opposite direction (180° flip) compared with similar nucleotide substrates of canonical 5′-3′ polymerases, and the finger domains are on opposing sides of the core palm domain. Structural, biochemical, and phylogenetic data indicate that reverse polymerization appeared early in evolution and resembles a mirror image of the forward process. PMID:24324136

  6. GDP-bound and nucleotide-free intermediates of the guanine nucleotide exchange in the Rab5·Vps9 system.

    PubMed

    Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi

    2010-11-19

    Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg(2+) and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction.

  7. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    NASA Astrophysics Data System (ADS)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  8. A biological inspired fuzzy adaptive window median filter (FAWMF) for enhancing DNA signal processing.

    PubMed

    Ahmad, Muneer; Jung, Low Tan; Bhuiyan, Al-Amin

    2017-10-01

    Digital signal processing techniques commonly employ fixed length window filters to process the signal contents. DNA signals differ in characteristics from common digital signals since they carry nucleotides as contents. The nucleotides own genetic code context and fuzzy behaviors due to their special structure and order in DNA strand. Employing conventional fixed length window filters for DNA signal processing produce spectral leakage and hence results in signal noise. A biological context aware adaptive window filter is required to process the DNA signals. This paper introduces a biological inspired fuzzy adaptive window median filter (FAWMF) which computes the fuzzy membership strength of nucleotides in each slide of window and filters nucleotides based on median filtering with a combination of s-shaped and z-shaped filters. Since coding regions cause 3-base periodicity by an unbalanced nucleotides' distribution producing a relatively high bias for nucleotides' usage, such fundamental characteristic of nucleotides has been exploited in FAWMF to suppress the signal noise. Along with adaptive response of FAWMF, a strong correlation between median nucleotides and the Π shaped filter was observed which produced enhanced discrimination between coding and non-coding regions contrary to fixed length conventional window filters. The proposed FAWMF attains a significant enhancement in coding regions identification i.e. 40% to 125% as compared to other conventional window filters tested over more than 250 benchmarked and randomly taken DNA datasets of different organisms. This study proves that conventional fixed length window filters applied to DNA signals do not achieve significant results since the nucleotides carry genetic code context. The proposed FAWMF algorithm is adaptive and outperforms significantly to process DNA signal contents. The algorithm applied to variety of DNA datasets produced noteworthy discrimination between coding and non-coding regions contrary to fixed window length conventional filters. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Microenvironmental Effect of 2'-O-(1-Pyrenylmethyl)uridine Modified Fluorescent Oligonucleotide Probes on Sensitive and Selective Detection of Target RNA.

    PubMed

    Imincan, Gülnur; Pei, Fen; Yu, Lijia; Jin, Hongwei; Zhang, Liangren; Yang, Xiaoda; Zhang, Lihe; Tang, XinJing

    2016-04-19

    2'-O-(1-Pyrenylmethyl)uridine modified oligoribonucleotides provide highly sensitive pyrene fluorescent probes for detecting specific nucleotide mutation of RNA targets. To develop more stable and cost-effective oligonucleotide probes, we investigated the local microenvironmental effects of nearby nucleobases on pyrene fluorescence in duplexes of RNAs and 2'-O-(1-pyrenylmethyl)uridine modified oligonucleotides. By incorporation of deoxyribonucleotides, ribonucleotides, 2'-MeO-nucleotides and 2'-F-nucleotides at both sides of 2'-O-(1-pyrenylmethyl)uridine (U(p)) in oligodeoxynucleotide probes, we synthesized a series of pyrene modified oligonucleotide probes. Their pyrene fluorescence emission spectra indicated that only two proximal nucleotides have a substantial effect on the pyrene fluorescence properties of these oligonucleotide probes hybridized with target RNA with an order of fluorescence sensitivity of 2'-F-nucleotides > 2'-MeO-nucleotides > ribonucleotides ≫ deoxyribonucleotides. While based on circular dichroism spectra, overall helix conformations (either A- or B-form) of the duplexes have marginal effects on the sensitivity of the probes. Instead, the local substitution reflected the propensity of the nucleotide sugar ring to adopt North type conformation and, accordingly, shifted their helix geometry toward a more A-type like conformation in local microenvironments. Thus, higher enhancement of pyrene fluorescence emission favored local A-type helix structures and more polar and hydrophobic environments (F > MeO > OH at 2' substitution) of duplex minor grooves of probes with the target RNA. Further dynamic simulation revealed that local microenvironmental effect of 2'-F-nucleotides or ribonucleotides was enough for pyrene moiety to move out of nucleobases to the minor groove of duplexes; in addition, 2'-F-nucleotide had less effect on π-stack of pyrene-modified uridine with upstream and downstream nucleobases. The present oligonucleotide probes successfully distinguished target RNA from single-mutated RNA analyte during an in vitro assay of RNA synthesis.

  10. Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis

    PubMed Central

    Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai

    2010-01-01

    The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817

  11. [Positioning of mRNA 3' of the a site bound codon on the human 80S ribosome].

    PubMed

    Molotkov, M V; Graĭfer, D M; Demeshkina, N A; Repkova, M N; Ven'iaminova, A G; Karpova, G G

    2005-01-01

    Short mRNA analogues carrying a UUU triplet at the 5'-termini and a perfluorophenylazide group at either the N7 atom of the guanosine or the C5 atom of the uridine 3' of the triplet were applied to study positioning of mRNA 3' of the A site codon. Complexes of 80S ribosomes with the mRNA analogues were obtained in the presence of tRNAPhe that directed UUU codon to the P site and consequently provided placement of the nucleotide with cross-linker in positions +9 or +12 with respect to the first nucleotide of the P site bound codon. Both types mRNA analogues cross-linked to the 18S rRNA and 40S proteins under mild UV-irradiation. Cross-linking patterns in the complexes where modified nucleotides of the mRNA analogues were in position +7 were analyzed for comparison (cross-linking to the 18S rRNA in such complexes has been studied previously). The efficiency of cross-linking to the ribosomal components depended on the nature of the modified nucleotide in the mRNA analogue and its position on the ribosome, extent of cross-linking to the 18S rRNA being decreased drastically when the modified nucleotide was moved from position +7 to position +12. The nucleotides of 18S rRNA cross-linked to mRNA analogues were determined. Modified nucleotides in positions +9 and +12 cross-linked to the invariant dinucleotide A1824/A1825 and to variable A1823 in the 3'-minidomain of 18S rRNA as well as to protein S15. The same ribosomal components have been found earlier to cross-link to modified mRNA nucleotides in positions from +4 to +7. Besides, all mRNA analogues cross-linked to the invariant nucleotide c1698 in the 3'-minidomain and to and the conserved region 605-620 closing helix 18 in the 5'-domain.

  12. Relative similarity within purine nucleotide and ligand structures operating on nitric oxide synthetase, guanylyl cyclase and potassium (K ATP, BK Ca) channels.

    PubMed

    Williams, W Robert

    2011-01-01

    Purine nucleotides play a central role in signal transduction events initiated at the cell membrane. The NO-cGMP-cGK pathway, in particular, mediates events involving NOS and some classes of K(+) ion channel. The aim of this study is to investigate relative molecular similarity within the ligands binding to NOS, K(ATP), BK(Ca) channels and regulatory nucleotides. Minimum energy conformers of the ligand structures were superimposed and fitted to L-arginine and the nucleotides of adenine and guanine using a computational program. Distinctive patterns were evident in the fitting of NOS isoform antagonists to L-arginine. K(ATP) channel openers and antagonists superimposed on the glycosidic linkage and imidazole ring of the purine nucleotides, and guanidinium and ribose groups of GTP in the case of glibenclamide. The fits of BK(Ca) channel openers and antagonists to cGMP were characterized by the linear dimensions of their structures; distances between terminal oxy groups in respect of dexamethasone and aldosterone. The findings provide structural evidence for the functional interaction between K(+) channel openers/antagonists and the regulatory nucleotides. Use of the purine nucleotide template systematizes the considerable heterogeneity evident within the structures of ligands operating on K(+) ion channels. © 2010 The Author. JPP © 2010 Royal Pharmaceutical Society.

  13. Weak Negative and Positive Selection and the Drift Load at Splice Sites

    PubMed Central

    Denisov, Stepan V.; Bazykin, Georgii A.; Sutormin, Roman; Favorov, Alexander V.; Mironov, Andrey A.; Gelfand, Mikhail S.; Kondrashov, Alexey S.

    2014-01-01

    Splice sites (SSs) are short sequences that are crucial for proper mRNA splicing in eukaryotic cells, and therefore can be expected to be shaped by strong selection. Nevertheless, in mammals and in other intron-rich organisms, many of the SSs often involve nonconsensus (Nc), rather than consensus (Cn), nucleotides, and beyond the two critical nucleotides, the SSs are not perfectly conserved between species. Here, we compare the SS sequences between primates, and between Drosophila fruit flies, to reveal the pattern of selection acting at SSs. Cn-to-Nc substitutions are less frequent, and Nc-to-Cn substitutions are more frequent, than neutrally expected, indicating, respectively, negative and positive selection. This selection is relatively weak (1 < |4Nes| < 4), and has a similar efficiency in primates and in Drosophila. Within some nucleotide positions, the positive selection in favor of Nc-to-Cn substitutions is weaker than the negative selection maintaining already established Cn nucleotides; this difference is due to site-specific negative selection favoring current Nc nucleotides. In general, however, the strength of negative selection protecting the Cn alleles is similar in magnitude to the strength of positive selection favoring replacement of Nc alleles, as expected under the simple nearly neutral turnover. In summary, although a fraction of the Nc nucleotides within SSs is maintained by selection, the abundance of deleterious nucleotides in this class suggests a substantial genome-wide drift load. PMID:24966225

  14. Adenosine, but not guanosine, protects vaginal epithelial cells from Trichomonas vaginalis cytotoxicity.

    PubMed

    Menezes, Camila Braz; Frasson, Amanda Piccoli; Meirelles, Lucia Collares; Tasca, Tiana

    2017-02-01

    Trichomonas vaginalis causes the most common non-viral sexually transmitted disease worldwide. The cytoadherence and cytotoxicity upon the vaginal epithelial cells are crucial for the infection. Extracellular nucleotides are released during cell damage and, along with their nucleosides, can activate purinoceptors. The opposing effects of nucleotides versus nucleosides are regulated by ectonucleotidases. Herein we evaluated the hemolysis and cytolysis induced by T. vaginalis, as well as the extracellular nucleotide hydrolysis along with the effects mediated by nucleotides and nucleosides on cytotoxicity. In addition, the gene expression of purinoceptors in host cells was determined. The hemolysis and cytolysis exerted by all T. vaginalis isolates presented positive Pearson correlation. All T. vaginalis isolates were able to hydrolyze nucleotides, showing higher NTPDase than ecto-5'-nucleotidase activity. The most cytotoxic isolate, TV-LACM6, hydrolyzes ATP, GTP with more efficiency than AMP and GMP. The vaginal epithelial cell line (HMVII) expressed the genes for all subtypes of P1, P2X and P2Y receptors. Finally, when nucleotides and nucleosides were tested, the cytotoxic effect elicited by TV-LACM6 was increased with nucleotides. In contrast, the cytotoxicity was reversed by adenosine in presence of EHNA, but not by guanosine, contributing to the understanding of the purinergic signaling role on T. vaginalis cytotoxicity. Copyright © 2016 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  15. Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

    PubMed Central

    Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

    2010-01-01

    DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

  16. Cacao single-nucleotide polymorphism (SNP) markers: A discovery strategy to identify SNPs for genotyping, genetic mapping and genome wide association studies (GWAS)

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...

  17. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions.

    PubMed

    Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G

    2017-07-25

    We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected cells recover. Despite the importance of this process, the broader impact of bacterial nucleotides on the functioning of eukaryotic cells remains poorly defined. To address this, we genetically modified cells of the eukaryote Saccharomyces cerevisiae (baker's yeast) to produce three of these molecules (cdiAMP, cdiGMP, and ppGpp) and used the engineered strains as model systems to characterize the effects of the molecules on the cells. In addition to demonstrating that the nucleotides are each capable of adversely affecting yeast cell function and growth, we also identified the cellular functions important for mitigating the damage caused, suggesting possible modes of action. This study expands our understanding of the molecular interactions that can take place between bacterial and eukaryotic cells. Copyright © 2017 Hesketh et al.

  18. Trichomonas vaginalis NTPDase and ecto-5'-nucleotidase hydrolyze guanine nucleotides and increase extracellular guanosine levels under serum restriction.

    PubMed

    Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana

    2016-05-01

    Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final accumulation of the nucleoside. The transcript levels of the five TvNTPDases gene sequences were analyzed by qRT-PCR and the highest gene expressions were found for TvNTPDase 2 and 4. The extracellular guanosine uptake was observed as (13C)GTP nucleotide into parasite DNA and it was lower than that observed for adenosine, labeled as (13C)ATP. These findings indicate the T. vaginalis preference for adenosine uptake and the accumulation of guanosine in the extracellular milieu, corroborating with HPLC data. Our data demonstrate, for the first time, the cascade of guanine nucleotides in T. vaginalis and open possibilities on the study of guanine-related purines other than the classical intracellular activity of G proteins for signal transduction. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Cross Talk between Nucleotide Synthesis Pathways with Cellular Immunity in Constraining Hepatitis E Virus Replication

    PubMed Central

    Wang, Yijin; Wang, Wenshi; Xu, Lei; Zhou, Xinying; Shokrollahi, Ehsan; Felczak, Krzysztof; van der Laan, Luc J. W.; Pankiewicz, Krzysztof W.; Sprengers, Dave; Raat, Nicolaas J. H.; Metselaar, Herold J.; Peppelenbosch, Maikel P.

    2016-01-01

    Viruses are solely dependent on host cells to propagate; therefore, understanding virus-host interaction is important for antiviral drug development. Since de novo nucleotide biosynthesis is essentially required for both host cell metabolism and viral replication, specific catalytic enzymes of these pathways have been explored as potential antiviral targets. In this study, we investigated the role of different enzymatic cascades of nucleotide biosynthesis in hepatitis E virus (HEV) replication. By profiling various pharmacological inhibitors of nucleotide biosynthesis, we found that targeting the early steps of the purine biosynthesis pathway led to the enhancement of HEV replication, whereas targeting the later step resulted in potent antiviral activity via the depletion of purine nucleotide. Furthermore, the inhibition of the pyrimidine pathway resulted in potent anti-HEV activity. Interestingly, all of these inhibitors with anti-HEV activity concurrently triggered the induction of antiviral interferon-stimulated genes (ISGs). Although ISGs are commonly induced by interferons via the JAK-STAT pathway, their induction by nucleotide synthesis inhibitors is completely independent of this classical mechanism. In conclusion, this study revealed an unconventional novel mechanism of cross talk between nucleotide biosynthesis pathways and cellular antiviral immunity in constraining HEV infection. Targeting particular enzymes in nucleotide biosynthesis represents a viable option for antiviral drug development against HEV. HEV is the most common cause of acute viral hepatitis worldwide and is also associated with chronic hepatitis, especially in immunocompromised patients. Although often an acute and self-limiting infection in the general population, HEV can cause severe morbidity and mortality in certain patients, a problem compounded by the lack of FDA-approved anti-HEV medication available. In this study, we have investigated the role of the nucleotide synthesis pathway in HEV infection and its potential for antiviral drug development. We show that targeting the later but not the early steps of the purine synthesis pathway exerts strong anti-HEV activity. In particular, IMP dehydrogenase (IMPDH) is the most important anti-HEV target of this cascade. Importantly, the clinically used IMPDH inhibitors, including mycophenolic acid and ribavirin, have potent anti-HEV activity. Furthermore, targeting the pyrimidine synthesis pathway also exerts potent antiviral activity against HEV. Interestingly, antiviral effects of nucleotide synthesis pathway inhibitors appear to depend on the medication-induced transcription of antiviral interferon-stimulated genes. Thus, this study reveals an unconventional novel mechanism as to how nucleotide synthesis pathway inhibitors can counteract HEV replication. PMID:26926637

  20. Lack of effect of dietary nucleotide supplementation on erythrocyte 2,3-diphosphoglycerate concentration. A study on preterm neonates.

    PubMed

    Scopesi, Fabio; Canini, Silvana; Arioni, Cesare; Mazzella, Massimo; Gazzolo, Diego; Lantieri, Pasquale B; Bonacci, Wanda; Serra, Giovanni

    2006-06-01

    Recently we demonstrated an increased 2,3-diphosphoglycerate (2,3-DPG) erythrocyte concentration in rat pups subjected to nucleotide-enriched artificial feeding. The present study was carried out to test the hypothesis that a possible increase in 2,3-DPG concentration can also be obtained in human neonates who are fed nucleotide-enriched formula. Preterm neonates born or referred to the neonatal intensive care unit of the G. Gaslini Hospital, Genoa University, with a gestational age >30 weeks and <37 weeks were enrolled in our randomized trial. Recruitment took place within 48-72 hours from birth. Only newborns of mothers deciding not to breast-feed were eligible to be randomized for the supplemented group (FN) or non-supplemented group (RF). Breast-fed newborns were considered the control group (C). The study window (for supplementation and blood samples) was restricted to the first two weeks following birth (from the 2nd (t1) to the 16th (t2) day of life). At the end of our study, only 21 neonates were eligible for statistical analysis. The stimulating action of dietary nucleotides on 2,3-DPG concentration failed to be demonstrated; increases in 2,3-DPG concentration that were observed in newborns fed with nucleotide supplemented formula (FN) were comparable to those observed in newborns fed with regular formula (RF) and breast-fed newborns. The EC recommendation for the amount of nucleotides allowed in formula milk does not seem to be high enough to have positive effects on 2,3-DPG synthesis. Whether this possible 'pharmacological' effect can be achieved by a higher intake of ingested nucleotides and/or a change in the proportions of single nucleotides contained in milk formulas remain interesting end points to be elucidated.

  1. Association between Single Nucleotide Polymorphisms of the Major Histocompatibility Complex Class II Gene and Newcastle Disease Virus Titre and Body Weight in Leung Hang Khao Chickens

    PubMed Central

    Molee, A.; Kongroi, K.; Kuadsantia, P.; Poompramun, C.; Likitdecharote, B.

    2016-01-01

    The aim of the present study was to investigate the effect of single nucleotide polymorphisms in the major histocompatibility complex (MHC) class II gene on resistance to Newcastle disease virus and body weight of the Thai indigenous chicken, Leung Hang Khao (Gallus gallus domesticus). Blood samples were collected for single nucleotide polymorphism analysis from 485 chickens. Polymerase chain reaction sequencing was used to classify single nucleotide polymorphisms of class II MHC. Body weights were measured at the ages of 3, 4, 5, and 7 months. Titres of Newcastle disease virus at 2 weeks to 7 months were determined and the correlation between body weight and titre was analysed. The association between single nucleotide polymorphisms and body weight and titre were analysed by a generalized linear model. Seven single nucleotide polymorphisms were identified: C125T, A126T, C209G, C242T, A243T, C244T, and A254T. Significant correlations between log titre and body weight were found at 2 and 4 weeks. Associations between single nucleotide polymorphisms and titre were found for C209G and A254T, and between all single nucleotide polymorphisms (except A243T) and body weight. The results showed that class II MHC is associated with both titre of Newcastle disease virus and body weight in Leung Hang Khao chickens. This is of concern because improved growth traits are the main goal of breeding selection. Moreover, the results suggested that MHC has a pleiotropic effect on the titre and growth performance. This mechanism should be investigated in a future study. PMID:26732325

  2. Sweet taste transduction in hamster: sweeteners and cyclic nucleotides depolarize taste cells by reducing a K+ current.

    PubMed

    Cummings, T A; Daniels, C; Kinnamon, S C

    1996-03-01

    1. The gigaseal voltage-clamp technique was used to record responses of hamster taste receptor cells to synthetic sweeteners and cyclic nucleotides. Voltage-dependent currents and steady-state currents were monitored during bath exchanges of saccharin, two high-potency sweeteners, 8-chlorophenylthio-adenosine 3',5'-cyclic monophosphate (8cpt-cAMP), and dibutyryl-guanosine 3',5'-cyclic monophosphate (db-cGMP). 2. Of the 237 fungiform taste cells studied, only one in eight was sweet responsive. Outward currents, both voltage-dependent and resting, were reduced by all of the sweeteners tested in sweet-responsive taste cells, whereas these currents were unaffected by sweeteners in sweet-unresponsive taste cells. 3. In every sweet-responsive cell tested, 8cpt-cAMP and db-cGMP mimicked the response to the sweeteners, but neither nucleotide elicited responses in sweet-unresponsive cells. Thus there was a one-to-one correlation between sweet responsivity and cyclic nucleotide responsivity. 4. Sweet responses showed cross adaptation with cyclic nucleotide responses. This indicates that the same ion channel is modulated by sweeteners and cyclic nucleotides. 5. The sweetener- and cyclic nucleotide-blocked current had an apparent reversal potential of -50 mV, which was close to the potassium reversal potential in these experiments. In addition, there was no effect of sweeteners and cyclic nucleotides in the presence of the K+ channel blocker tetraethylammonium bromide (TEA). These data suggest that block of a resting, TEA-sensitive K+ current is the final common step leading to taste cell depolarization during sweet transduction. 6. These data, together with data from a previous study (Cummings et al. 1993), suggest that both synthetic sweeteners and sucrose utilize second-messenger pathways that block a resting K+ conductance to depolarize the taste cell membrane.

  3. Spontaneous nucleotide exchange in low molecular weight GTPases by fluorescently labeled γ-phosphate-linked GTP analogs

    PubMed Central

    Korlach, Jonas; Baird, Daniel W.; Heikal, Ahmed A.; Gee, Kyle R.; Hoffman, Gregory R.; Webb, Watt W.

    2004-01-01

    Regulated guanosine nucleotide exchange and hydrolysis constitute the fundamental activities of low molecular weight GTPases. We show that three guanosine 5′-triphosphate analogs with BODIPY fluorophores coupled via the gamma phosphate bind to the GTPases Cdc42, Rac1, RhoA, and Ras and displace guanosine 5′-diphosphate with high intrinsic exchange rates in the presence of Mg2+ ions, thereby acting as synthetic, low molecular weight guanine nucleotide exchange factors. The accompanying large fluorescence enhancements (as high as 12-fold), caused by a reduction in guanine quenching of the environmentally sensitive BODIPY dye fluorescence on protein binding, allow for real-time monitoring of this spontaneous nucleotide exchange in the visible spectrum with high signal-to-noise ratios. Binding affinities increased with longer aliphatic linkers connecting the nucleotide and BODIPY fluorophore and were in the 10–100 nM range. Steady-state and time-resolved fluorescence spectroscopy showed an inverse relationship between linker length and fluorescence enhancement factors and differences in protein-bound fluorophore mobilities, providing optimization criteria for future applications of such compounds as efficient elicitors and reporters of nucleotide exchange. EDTA markedly enhanced nucleotide exchange, enabling rapid loading of GTPases with these probes. Differences in active site geometries, in the absence of Mg2+, caused qualitatively different reporting of the bound state by the different analogs. The BODIPY analogs also prevented the interaction of Cdc42 with p21 activated kinase. Together, these results validate the use of these analogs as valuable tools for studying GTPase functions and for developing potent synthetic nucleotide exchange factors for this important class of signaling molecules. PMID:14973186

  4. Vγ9Vδ2 T cell activation by strongly agonistic nucleotidic phosphoantigens.

    PubMed

    Moulin, Morgane; Alguacil, Javier; Gu, Siyi; Mehtougui, Asmaa; Adams, Erin J; Peyrottes, Suzanne; Champagne, Eric

    2017-12-01

    Human Vγ9Vδ2 T cells can sense through their TCR tumor cells producing the weak endogenous phosphorylated antigen isopentenyl pyrophosphate (IPP), or bacterially infected cells producing the strong agonist hydroxyl dimethylallyl pyrophosphate (HDMAPP). The recognition of the phosphoantigen is dependent on its binding to the intracellular B30.2 domain of butyrophilin BTN3A1. Most studies have focused on pyrophosphate phosphoantigens. As triphosphate nucleotide derivatives are naturally co-produced with IPP and HDMAPP, we analyzed their specific properties using synthetic nucleotides derived from HDMAPP. The adenylated, thymidylated and uridylated triphosphate derivatives were found to activate directly Vγ9Vδ2 cell lines as efficiently as HDMAPP in the absence of accessory cells. These antigens were inherently resistant to terminal phosphatases, but apyrase, when added during a direct stimulation of Vγ9Vδ2 cells, abrogated their stimulating activity, indicating that their activity required transformation into strong pyrophosphate agonists by a nucleotide pyrophosphatase activity which is present in serum. Tumor cells can be sensitized with nucleotide phosphoantigens in the presence of apyrase to become stimulatory, showing that this can occur before their hydrolysis into pyrophosphates. Whereas tumors sensitized with HDMAPP rapidly lost their stimulatory activity, sensitization with nucleotide derivatives, in particular with the thymidine derivative, induced long-lasting stimulating ability. Using isothermal titration calorimetry, binding of some nucleotide derivatives to BTN3A1 intracellular domain was found to occur with an affinity similar to that of IPP, but much lower than that of HDMAPP. Thus, nucleotide phosphoantigens are precursors of pyrophosphate antigens which can deliver strong agonists intracellularly resulting in prolonged and strengthened activity.

  5. Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide

    DOE PAGES

    Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; ...

    2014-11-17

    Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2’-deoxyguanosine found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate E. coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerase discriminates between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities,more » nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine (Cy) and 8-oxodGTP(syn) utilizes its Hoogsteen edge to base pair with adenine (Ad). Here in this paper we utilized time-lapse crystallography to follow 8-oxo-dGTP insertion opposite Ad or Cy with human DNA pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxodGTP utilizes charge modulation during insertion that can lead to a blocked DNA repair intermediate.« less

  6. Intramolecular interactions in aminoacyl nucleotides: Implications regarding the origin of genetic coding and protein synthesis

    NASA Technical Reports Server (NTRS)

    Lacey, J. C., Jr.; Mullins, D. W., Jr.; Watkins, C. L.; Hall, L. M.

    1986-01-01

    Cellular organisms store information as sequences of nucleotides in double stranded DNA. This information is useless unless it can be converted into the active molecular species, protein. This is done in contemporary creatures first by transcription of one strand to give a complementary strand of mRNA. The sequence of nucleotides is then translated into a specific sequence of amino acids in a protein. Translation is made possible by a genetic coding system in which a sequence of three nucleotides codes for a specific amino acid. The origin and evolution of any chemical system can be understood through elucidation of the properties of the chemical entities which make up the system. There is an underlying logic to the coding system revealed by a correlation of the hydrophobicities of amino acids and their anticodonic nucleotides (i.e., the complement of the codon). Its importance lies in the fact that every amino acid going into protein synthesis must first be activated. This is universally accomplished with ATP. Past studies have concentrated on the chemistry of the adenylates, but more recently we have found, through the use of NMR, that we can observe intramolecular interactions even at low concentrations, between amino acid side chains and nucleotide base rings in these adenylates. The use of this type of compound thus affords a novel way of elucidating the manner in which amino acids and nucleotides interact with each other. In aqueous solution, when a hydrophobic amino acid is attached to the most hydrophobic nucleotide, AMP, a hydrophobic interaction takes place between the amino acid side chain and the adenine ring. The studies to be reported concern these hydrophobic interactions.

  7. Nucleotide binding properties of bovine brain uncoating ATPase.

    PubMed

    Gao, B; Emoto, Y; Greene, L; Eisenberg, E

    1993-04-25

    Many functions of the 70-kDa heat-shock proteins (hsp70s) appear to be regulated by bound nucleotide. In this study we examined the nucleotide binding properties of purified bovine brain uncoating ATPase, one of the constitutively expressed members of the hsp70 family. We found that uncoating ATPase purified by ATP-agarose column chromatography retained one ADP molecule bound per enzyme molecule which could not be removed by extensive dialysis. Since this bound ADP exchanged rapidly with free ADP or ATP, the inability to remove the bound nucleotide was not due to slow dissociation but rather to strong binding of the nucleotide to the uncoating ATPase. In confirmation of this view, equilibrium dialysis experiments suggested that the dissociation constants for both ADP and ATP were less than 0.1 microM. Schmid et al. (Schmid, S. L., Braell, W. A., and Rothman, J. E. (1985) J. Biol. Chem 260, 10057-10062) suggested that the uncoating ATPase had two sites for bound nucleotide, one specific for ATP and one binding both ATP and ATP analogues but not ADP. In contrast, we found that enzyme with bound ADP did not bind further adenosine 5'-(beta,gamma-imino)triphosphate or dATP, nor did more than one ATP molecule bind per enzyme even in 200 microM free ATP. These results strongly suggest that the enzyme has only one binding site for nucleotide. During steady-state ATP hydrolysis, 85% of the bound nucleotide at this site was determined to be ATP and 15% ADP; this is consistent with the rate of ADP release determined in the exchange experiments noted above, where ADP release was found to be six times faster than the overall rate of ATP hydrolysis.

  8. Molecular adaptability of nucleoside diphosphate kinase b from trypanosomatid parasites: stability, oligomerization and structural determinants of nucleotide binding.

    PubMed

    Souza, Tatiana A C B; Trindade, Daniel M; Tonoli, Celisa C C; Santos, Camila R; Ward, Richard J; Arni, Raghuvir K; Oliveira, Arthur H C; Murakami, Mário T

    2011-07-01

    Nucleoside diphosphate kinases play a crucial role in the purine-salvage pathway of trypanosomatid protozoa and have been found in the secretome of Leishmania sp., suggesting a function related to host-cell integrity for the benefit of the parasite. Due to their importance for housekeeping functions in the parasite and by prolonging the life of host cells in infection, they become an attractive target for drug discovery and design. In this work, we describe the first structural characterization of nucleoside diphosphate kinases b from trypanosomatid parasites (tNDKbs) providing insights into their oligomerization, stability and structural determinants for nucleotide binding. Crystallographic studies of LmNDKb when complexed with phosphate, AMP and ADP showed that the crucial hydrogen-bonding residues involved in the nucleotide interaction are fully conserved in tNDKbs. Depending on the nature of the ligand, the nucleotide-binding pocket undergoes conformational changes, which leads to different cavity volumes. SAXS experiments showed that tNDKbs, like other eukaryotic NDKs, form a hexamer in solution and their oligomeric state does not rely on the presence of nucleotides or mimetics. Fluorescence-based thermal-shift assays demonstrated slightly higher stability of tNDKbs compared to human NDKb (HsNDKb), which is in agreement with the fact that tNDKbs are secreted and subjected to variations of temperature in the host cells during infection and disease development. Moreover, tNDKbs were stabilized upon nucleotide binding, whereas HsNDKb was not influenced. Contrasts on the surface electrostatic potential around the nucleotide-binding pocket might be a determinant for nucleotide affinity and protein stability differentiation. All these together demonstrated the molecular adaptation of parasite NDKbs in order to exert their biological functions intra-parasite and when secreted by regulating ATP levels of host cells.

  9. Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide

    NASA Astrophysics Data System (ADS)

    Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; Shock, David D.; Kim, Taejin; Schlick, Tamar; Wilson, Samuel H.

    2015-01-01

    Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2'-deoxyguanosine, which is found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate Escherichia coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerases discriminate between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities, nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine and 8-oxo-dGTP(syn) uses its Hoogsteen edge to base pair with adenine. Here we use time-lapse crystallography to follow 8-oxo-dGTP insertion opposite adenine or cytosine with human pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen-bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxo-dGTP uses charge modulation during insertion that can lead to a blocked DNA repair intermediate.

  10. Enzymatic Incorporation of Modified Purine Nucleotides in DNA.

    PubMed

    Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet

    2017-12-14

    A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. The interaction of the Eco R1 restriction enzyme E.coli with nucleotides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hollis, Donald F.

    1979-11-01

    The Eco R1 restriction enzyme can be shown to be inhibited by nucleotides which correspond to any part of its known site of phosphodiesterase activity. A series of di-, tetra-, and hexa-nucleotide fragments were synthesized and their effect on the activity of the enzyme upon superhelical Co1 E1 DNA studied. The inhibition caused by the individual mononucleotides were also studied. In general all the nucleotide fragments showed some form of interaction with the enzyme system. Tetranucleotides were stronger inhibitors than dinucleotides, which in turn were stronger inhibitors than the mononucleotides. Within each category of inhibitors, those containing the phosphodiester bondmore » which is acted upon by the enzyme were the strongest inhibitors. Only those fragments which were consistent with the enzymes site of activity showed competitive inhibition kinetics. Nucleotides which do not fit within the site of phosphodiesterase activity show non-competitive inhibition kinetics.« less

  12. Nucleotide sequence analysis of the L gene of Newcastle disease virus: homologies with Sendai and vesicular stomatitis viruses.

    PubMed Central

    Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T

    1987-01-01

    The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486

  13. Regulation of Endothelial Barrier Function by Cyclic Nucleotides: The Role of Phosphodiesterases

    PubMed Central

    Surapisitchat, James

    2014-01-01

    The endothelium plays an important role in maintaining normal vascular function. Endothelial barrier dysfunction leading to increased permeability and vascular leakage is associated with several pathological conditions such as edema and sepsis. Thus, the development of drugs that improve endothelial barrier function is an active area of research. In this chapter, the current knowledge concerning the signaling pathways regulating endothelial barrier function is discussed with a focus on cyclic nucleotide second messengers (cAMP and cGMP) and cyclic nucleotide phosphodiesterases (PDEs). Both cAMP and cGMP have been shown to have differential effects on endothelial permeability in part due to the various effector molecules, crosstalk, and compartmentalization of cyclic nucleotide signaling. PDEs, by controlling the amplitude, duration, and localization of cyclic nucleotides, have been shown to play a critical role in regulating endothelial barrier function. Thus, PDEs are attractive drug targets for the treatment of disease states involving endothelial barrier dysfunction. PMID:21695641

  14. Regulation of endothelial barrier function by cyclic nucleotides: the role of phosphodiesterases.

    PubMed

    Surapisitchat, James; Beavo, Joseph A

    2011-01-01

    The endothelium plays an important role in maintaining normal vascular function. Endothelial barrier dysfunction leading to increased permeability and vascular leakage is associated with several pathological conditions such as edema and sepsis. Thus, the development of drugs that improve endothelial barrier function is an active area of research. In this chapter, the current knowledge concerning the signaling pathways regulating endothelial barrier function is discussed with a focus on cyclic nucleotide second messengers (cAMP and cGMP) and cyclic nucleotide phosphodiesterases (PDEs). Both cAMP and cGMP have been shown to have differential effects on endothelial permeability in part due to the various effector molecules, crosstalk, and compartmentalization of cyclic nucleotide signaling. PDEs, by controlling the amplitude, duration, and localization of cyclic nucleotides, have been shown to play a critical role in regulating endothelial barrier function. Thus, PDEs are attractive drug targets for the treatment of disease states involving endothelial barrier dysfunction.

  15. Role of a GAG Hinge in the Nucleotide-induced Conformational Change Governing Nucleotide Specificity by T7 DNA Polymerase*

    PubMed Central

    Jin, Zhinan; Johnson, Kenneth A.

    2011-01-01

    A nucleotide-induced change in DNA polymerase structure governs the kinetics of polymerization by high fidelity DNA polymerases. Mutation of a GAG hinge (G542A/G544A) in T7 DNA polymerase resulted in a 1000-fold slower rate of conformational change, which then limited the rate of correct nucleotide incorporation. Rates of misincorporation were comparable to that seen for wild-type enzyme so that the net effect of the mutation was a large decrease in fidelity. We demonstrate that a presumably modest change from glycine to alanine 20 Å from the active site can severely restrict the flexibility of the enzyme structure needed to recognize and incorporate correct substrates with high specificity. These results emphasize the importance of the substrate-induced conformational change in governing nucleotide selectivity by accelerating the incorporation of correct base pairs but not mismatches. PMID:20978284

  16. Free amino acids and 5'-nucleotides in Finnish forest mushrooms.

    PubMed

    Manninen, Hanna; Rotola-Pukkila, Minna; Aisala, Heikki; Hopia, Anu; Laaksonen, Timo

    2018-05-01

    Edible mushrooms are valued because of their umami taste and good nutritional values. Free amino acids, 5'-nucleotides and nucleosides were analyzed from four Nordic forest mushroom species (Lactarius camphoratus, Boletus edulis, Cantharellus cibarius, Craterellus tubaeformis) using high precision liquid chromatography analysis. To our knowledge, these taste components were studied for the first time from Craterellus tubaeformis and Lactarius camphoratus. The focus was on the umami amino acids and 5'-nucleotides. The free amino acid and 5'-nucleotide/nucleoside contents of studied species differed from each other. In all studied samples, umami amino acids were among five major free amino acids. The highest concentration of umami amino acids was on L. camphoratus whereas B. edulis had the highest content of sweet amino acids and C. cibarius had the highest content of bitter amino acids. The content of umami enhancing 5'-nucleotides were low in all studied species. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree.

    PubMed

    Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi

    2017-04-01

    Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

  18. Reducing nontemplated 3' nucleotide addition to polynucleotide transcripts

    DOEpatents

    Kao, C. Cheng

    2000-01-01

    Non-template 3' nucleotide addition to a transcript is reduced by transcribing a transcript from a template comprising an ultimate and/or penultimate 5' ribose having a C'2 substituent such as methoxy, which reduces non-template 3' nucleotide addition to the transcript. The methods are shown to be applicable to a wide variety of polymerases, including Taq, T7 RNA polymerase, etc.

  19. Nucleotide exchange and excision technology DNA shuffling and directed evolution.

    PubMed

    Speck, Janina; Stebel, Sabine C; Arndt, Katja M; Müller, Kristian M

    2011-01-01

    Remarkable success in optimizing complex properties within DNA and proteins has been achieved by directed evolution. In contrast to various random mutagenesis methods and high-throughput selection methods, the number of available DNA shuffling procedures is limited, and protocols are often difficult to adjust. The strength of the nucleotide exchange and excision technology (NExT) DNA shuffling described here is the robust, efficient, and easily controllable DNA fragmentation step based on random incorporation of the so-called 'exchange nucleotides' by PCR. The exchange nucleotides are removed enzymatically, followed by chemical cleavage of the DNA backbone. The oligonucleotide pool is reassembled into full-length genes by internal primer extension, and the recombined gene library is amplified by standard PCR. The technique has been demonstrated by shuffling a defined gene library of chloramphenicol acetyltransferase variants using uridine as fragmentation defining exchange nucleotide. Substituting 33% of the dTTP with dUTP in the incorporation PCR resulted in shuffled clones with an average parental fragment size of 86 bases and revealed a mutation rate of only 0.1%. Additionally, a computer program (NExTProg) has been developed that predicts the fragment size distribution depending on the relative amount of the exchange nucleotide.

  20. Effects of nutrition (herbivore vs carnivore) on energy charge and nucleotide composition in Hyas araneus larvae

    NASA Astrophysics Data System (ADS)

    Harms, J.

    1992-03-01

    Growth rate expressed as dry weight, elemetnal composition (C, N, H), protein content and nucleotide composition (ATP, ADP, AMP, CTP, GTP and UTP) as well as adenosine were measured in laboratory cultured Hyas araneus larvae fed two different diets. One group was fed freshly hatched Artemia sp. nauplii, the other the diatom Odontella (Biddulphia) sinensis. Growth rate was reduced in the O. sinensis-fed group, reaching 20 to 50% of the growth rate of Artemia-fed larvae. In all cases, some further development to the next instar occurred when larvae were fed O. sinensis, although at reduced levels compared to Artemia-fed larvae. The adenylic energy charge was quite similar for the two nutritional conditions tested and therefore does not reflect the reduced growth rate in O. sinensis-fed larvae. The individual nucleotide content was clearly reduced in O. sinensis-fed larvae, reflecting the nutritional conditions already during early developmental periods. These reduced amount of nucleotides in O. sinensis-fed larvae were most obvious when adenylic nucleotide contents were pooled. Pooled adenylic nucleotides were found to be correlated with the individual content of carbon and protein, showing significant differences at both nutritional conditions tested.

  1. Complete nucleotide sequences of the coat protein messenger RNAs of brome mosaic virus and cowpea chlorotic mottle virus.

    PubMed Central

    Dasgupta, R; Kaesberg, P

    1982-01-01

    The nucleotide sequences of the subgenomic coat protein messengers (RNA4's) of two related bromoviruses, brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV), have been determined by direct RNA and CDNA sequencing without cloning. BMV RNA4 is 876 b long including a 5' noncoding region of nine nucleotides and a 3' noncoding region of 300 nucleotides. CCMV RNA 4 is 824 b long, including a 5' noncoding region of 10 nucleotides and a 3' noncoding region of 244 nucleotides. The encoded coat proteins are similar in length (188 amino acids for BMV and 189 amino acids for CCMV) and display about 70% homology in their amino acid sequences. Length difference between the two RNAs is due mostly to a single deletion, in CCMV with respect to BMV, of about 57 b immediately following the coding region. Allowing for this deletion the RNAs are indicate that mutations leading to divergence were constrained in the coding region primarily by the requirement of maintaining a favorable coat protein structure and in the 3' noncoding region primarily by the requirement of maintaining a favorable RNA spatial configuration. PMID:6895941

  2. Interaction between macrocyclic nickel complexes and the nucleotides GMP, AMP and ApG.

    PubMed

    Liu, Yangzhong; Sletten, Einar

    2003-01-15

    Reactions between the nucleotides GMP, AMP and ApG and the complexes Ni(tren), Ni(cyclam) and NiCR in aqueous solution have been monitored by (1)H, (15)N NMR and UV spectroscopy. The three nickel complexes display different properties in reactions with nucleotides. Ni(tren) which has a pseudo-octahedral coordination geometry was shown to bind to all three nucleotides. Ni(cyclam) and NiCR, both with four nitrogen atoms in a square planar arrangement are not able to bind to nucleotides efficiently because of steric hindrance. Oxidation of Ni(cyclam) by KHSO(5) to produce trivalent Ni(III)(cyclam) improves the coordination capacity, while oxidation of NiCR does not produce a similar effect. The nucleotides interact with trivalent nickel complexes to different extent. Ni(III)CR is seen to oxidize GMP gradually but does not affect AMP significantly. Ni(III)(cyclam), on the other hand, does not oxidize either GMP or AMP at the 1:1 concentration of oxidant used. This result is probably due to the lower redox potential of Ni(cyclam). ApG binds less efficiently to the Ni complexes but is easier oxidized than the mononucleotides.

  3. Functional analysis of regulatory single-nucleotide polymorphisms.

    PubMed

    Pampín, Sandra; Rodríguez-Rey, José C

    2007-04-01

    The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.

  4. Biosynthesis of nucleotide sugars by a promiscuous UDP-sugar pyrophosphorylase from Arabidopsis thaliana (AtUSP).

    PubMed

    Liu, Jun; Zou, Yang; Guan, Wanyi; Zhai, Yafei; Xue, Mengyang; Jin, Lan; Zhao, Xueer; Dong, Junkai; Wang, Wenjun; Shen, Jie; Wang, Peng George; Chen, Min

    2013-07-01

    Nucleotide sugars are activated forms of monosaccharides and key intermediates of carbohydrate metabolism in all organisms. The availability of structurally diverse nucleotide sugars is particularly important for the characterization of glycosyltransferases. Given that limited methods are available for preparation of nucleotide sugars, especially their useful non-natural derivatives, we introduced herein an efficient one-step three-enzyme catalytic system for the synthesis of nucleotide sugars from monosaccharides. In this study, a promiscuous UDP-sugar pyrophosphorylase (USP) from Arabidopsis thaliana (AtUSP) was used with a galactokinase from Streptococcus pneumoniae TIGR4 (SpGalK) and an inorganic pyrophosphatase (PPase) to effectively synthesize four UDP-sugars. AtUSP has better tolerance for C4-derivatives of Gal-1-P compared to UDP-glucose pyrophosphorylase from S. pneumoniae TIGR4 (SpGalU). Besides, the nucleotide substrate specificity and kinetic parameters of AtUSP were systematically studied. AtUSP exhibited considerable activity toward UTP, dUTP and dTTP, the yield of which was 87%, 85% and 84%, respectively. These results provide abundant information for better understanding of the relationship between substrate specificity and structural features of AtUSP. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Nucleotide sequence analysis of the 3' terminal region of a wasabi strain of crucifer tobamovirus genomic RNA: subgrouping of crucifer tobamoviruses.

    PubMed

    Shimamoto, I; Sonoda, S; Vazquez, P; Minaka, N; Nishiguchi, M

    1998-01-01

    The 3' terminal 2378 nucleotides of a wasabi strain of crucifer tobamovirus (CTMV-W) infectious to crucifer plants was determined. This includes the 3' non-coding region of 235 nucleotides, coat protein (CP) gene (468 nucleotides), movement protein (MP) gene (798 nucleotides) and C-terminal partial readthrough portion of 180 K protein gene (940 nucleotides). Comparison of the sequence with homologous regions of thirteen other tobamovirus genomes showed that it had much higher identity to those of four other crucifer tobamoviruses, 85.2% to cr-TMV and turnip vein-clearing virus (TVCV), 87.4% to oilseed rape mosaic virus (ORMV) and 87.1% to TMV-Cg, than to those of other tobamoviruses. Thus CTMV-W was most similar to ORMV and TMV-Cg in sequence, but only marginally so, whereas the location and size of its MP gene was the same as cr-TMV amd TVCV. These results, together with other analyses, show that CTMV-W is a new crucifer tobamovirus, that the five crucifer tobamoviruses can be classified into two subgroups based on MP gene organization, and that the rate of sequence change is not the same in all lineages.

  6. Dietary nitrogen alters codon bias and genome composition in parasitic microorganisms.

    PubMed

    Seward, Emily A; Kelly, Steven

    2016-11-15

    Genomes are composed of long strings of nucleotide monomers (A, C, G and T) that are either scavenged from the organism's environment or built from metabolic precursors. The biosynthesis of each nucleotide differs in atomic requirements with different nucleotides requiring different quantities of nitrogen atoms. However, the impact of the relative availability of dietary nitrogen on genome composition and codon bias is poorly understood. Here we show that differential nitrogen availability, due to differences in environment and dietary inputs, is a major determinant of genome nucleotide composition and synonymous codon use in both bacterial and eukaryotic microorganisms. Specifically, low nitrogen availability species use nucleotides that require fewer nitrogen atoms to encode the same genes compared to high nitrogen availability species. Furthermore, we provide a novel selection-mutation framework for the evaluation of the impact of metabolism on gene sequence evolution and show that it is possible to predict the metabolic inputs of related organisms from an analysis of the raw nucleotide sequence of their genes. Taken together, these results reveal a previously hidden relationship between cellular metabolism and genome evolution and provide new insight into how genome sequence evolution can be influenced by adaptation to different diets and environments.

  7. Parsimony and Model-Based Analyses of Indels in Avian Nuclear Genes Reveal Congruent and Incongruent Phylogenetic Signals

    PubMed Central

    Yuri, Tamaki; Kimball, Rebecca T.; Harshman, John; Bowie, Rauri C. K.; Braun, Michael J.; Chojnowski, Jena L.; Han, Kin-Lan; Hackett, Shannon J.; Huddleston, Christopher J.; Moore, William S.; Reddy, Sushma; Sheldon, Frederick H.; Steadman, David W.; Witt, Christopher C.; Braun, Edward L.

    2013-01-01

    Insertion/deletion (indel) mutations, which are represented by gaps in multiple sequence alignments, have been used to examine phylogenetic hypotheses for some time. However, most analyses combine gap data with the nucleotide sequences in which they are embedded, probably because most phylogenetic datasets include few gap characters. Here, we report analyses of 12,030 gap characters from an alignment of avian nuclear genes using maximum parsimony (MP) and a simple maximum likelihood (ML) framework. Both trees were similar, and they exhibited almost all of the strongly supported relationships in the nucleotide tree, although neither gap tree supported many relationships that have proven difficult to recover in previous studies. Moreover, independent lines of evidence typically corroborated the nucleotide topology instead of the gap topology when they disagreed, although the number of conflicting nodes with high bootstrap support was limited. Filtering to remove short indels did not substantially reduce homoplasy or reduce conflict. Combined analyses of nucleotides and gaps resulted in the nucleotide topology, but with increased support, suggesting that gap data may prove most useful when analyzed in combination with nucleotide substitutions. PMID:24832669

  8. C-Terminal β9-Strand of the Cyclic Nucleotide-Binding Homology Domain Stabilizes Activated States of Kv11.1 Channels

    PubMed Central

    Ng, Chai Ann; Ke, Ying; Perry, Matthew D.; Tan, Peter S.; Hill, Adam P.; Vandenberg, Jamie I.

    2013-01-01

    Kv11.1 potassium channels are important for regulation of the normal rhythm of the heartbeat. Reduced activity of Kv11.1 channels causes long QT syndrome type 2, a disorder that increases the risk of cardiac arrhythmias and sudden cardiac arrest. Kv11.1 channels are members of the KCNH subfamily of voltage-gated K+ channels. However, they also share many similarities with the cyclic nucleotide gated ion channel family, including having a cyclic nucleotide-binding homology (cNBH) domain. Kv11.1 channels, however, are not directly regulated by cyclic nucleotides. Recently, crystal structures of the cNBH domain from mEAG and zELK channels, both members of the KCNH family of voltage-gated potassium channels, revealed that a C-terminal β9-strand in the cNBH domain occupied the putative cyclic nucleotide-binding site thereby precluding binding of cyclic nucleotides. Here we show that mutations to residues in the β9-strand affect the stability of the open state relative to the closed state of Kv11.1 channels. We also show that disrupting the structure of the β9-strand reduces the stability of the inactivated state relative to the open state. Clinical mutations located in this β9-strand result in reduced trafficking efficiency, which suggests that binding of the C-terminal β9-strand to the putative cyclic nucleotide-binding pocket is also important for assembly and trafficking of Kv11.1 channels. PMID:24204727

  9. One-step nucleotide-programmed growth of porous upconversion nanoparticles: application to cell labeling and drug delivery

    NASA Astrophysics Data System (ADS)

    Zhou, Li; Li, Zhenhua; Liu, Zhen; Yin, Meili; Ren, Jinsong; Qu, Xiaogang

    2014-01-01

    A simple and ``green'' strategy has been reported for the first time to fabricate upconversion nanoparticles (UCNPs) by utilizing nucleotides as bio-templates. The influence of the functionalities present on the nucleotide on the production of nanoparticles was investigated in detail. Through the effects of nucleotides, the obtained nanoparticles possessed a porous structure. The use of the as-prepared UCNPs for cell imaging, drug delivery and versatile therapy applications were demonstrated. In view of the bright up-conversion luminescence as well as the excellent biocompatibility, and the good colloidal stability of the as-prepared UCNPs, we envision that our synthesis protocol might advance both the fields of UCNPs and biomolecule-based nanotechnology for future studies.A simple and ``green'' strategy has been reported for the first time to fabricate upconversion nanoparticles (UCNPs) by utilizing nucleotides as bio-templates. The influence of the functionalities present on the nucleotide on the production of nanoparticles was investigated in detail. Through the effects of nucleotides, the obtained nanoparticles possessed a porous structure. The use of the as-prepared UCNPs for cell imaging, drug delivery and versatile therapy applications were demonstrated. In view of the bright up-conversion luminescence as well as the excellent biocompatibility, and the good colloidal stability of the as-prepared UCNPs, we envision that our synthesis protocol might advance both the fields of UCNPs and biomolecule-based nanotechnology for future studies. Electronic supplementary information (ESI) available: Supporting figures. See DOI: 10.1039/c3nr04255c

  10. Single Color Multiplexed ddPCR Copy Number Measurements and Single Nucleotide Variant Genotyping.

    PubMed

    Wood-Bouwens, Christina M; Ji, Hanlee P

    2018-01-01

    Droplet digital PCR (ddPCR) allows for accurate quantification of genetic events such as copy number variation and single nucleotide variants. Probe-based assays represent the current "gold-standard" for detection and quantification of these genetic events. Here, we introduce a cost-effective single color ddPCR assay that allows for single genome resolution quantification of copy number and single nucleotide variation.

  11. Synthesis of Purine Nucleoside and Nucleotide Analogs as Antiparasitic Agents.

    DTIC Science & Technology

    1979-09-01

    was to conduct studies on the synthesis of purine nucleoside and nucleotide analogs as anti- parasitic agents. The primary target compounds were 5...antiparasitic agents. - Jaffe has proposed that the susceptibility of pathogenic helminths and protozoa to fraudulent purine, in contrast to pyrimidine...8217-substituted derivatives are thus designed to inhibit nucleoside and nucleotide kinases as well as other parasitic enzymes. Mammalian cells, onthe

  12. Increased rate of adenine incorporation into adenine nucleotide pool in erythrocytes of patients with chronic renal failure.

    PubMed

    Marlewski, M; Smolenski, R T; Szolkiewicz, M; Aleksandrowicz, Z; Rutkowski, B; Swierczynski, J

    2000-11-01

    Elevated purine nucleotide pool (mainly ATP) in erythrocytes of patients with chronic renal failure (CRF) is a known phenomenon, however the mechanism responsible for this abnormality is far from being clear. We hypothesize that the increased rate of adenine incorporation into adenine nucleotide pool is responsible for the elevated level of ATP in uremic erythrocytes. In chronically uremic patients we evaluated using HPLC technique: (a) plasma adenine concentration; (b) the rate of adenine incorporation into adenine nucleotide pool in uremic erythrocytes. Additionally, the effect of higher than physiological phosphate concentration (2.4 mM) and lower than physiological pH (7.1) on adenine incorporation into erythrocytes adenine nucleotide pool was investigated. Healthy volunteers with normal renal function served as control. The concentration of adenine in plasma of CRF patients was found to be significantly higher than in plasma of healthy subjects. In contrast, adenosine concentration was similar both in healthy humans and in CRF patients. In isolated erythrocytes of uremic patients (incubated in the medium pH 7.4, containing 1.2 mM inorganic phosphate) adenine was incorporated into adenine nucleotide pool at a rate approximately 2-fold higher than in erythrocytes from healthy subjects. The rate of adenosine incorporation into adenine nucleotide pool was similar in erythrocytes of both studied groups. Incubation of erythrocytes obtained from healthy subjects in the medium pH 7.4, containing 2.4 mM inorganic phosphate, caused the increase of adenine incorporation into adenine nucleotide pool by about 60%. Incubation of the cells in the pH 7.1 buffer containing 2. 4 mM inorganic phosphate increased the rate of adenine incorporation into adenylate approximately 2-fold as compared to erythrocytes incubated in the medium pH 7.4 containing 1.2 mM inorganic phosphate. Erythrocytes obtained from uremic patients and incubated in the pH 7.1 medium containing 2.4 mM phosphate incorporated adenine into adenine nucleotide pool at a rate similar to erythrocytes incubated in the medium pH 7.4 containing 1.2 mM phosphate. Erythrocytes obtained from either healthy subjects or from patients with CRF and incubated in the presence of higher than physiological concentration of inorganic phosphate (2.4 mM) and lower than physiological pH (7. 1) did not exhibit any increase in the rate of adenisine incorporation into adenine nucleotide pool. These results suggest that the increased rate of adenine incorporation into adenine nucleotide pool could be partially responsible for the increased concentration of ATP in uremic erythrocytes. Copyright 2000 S. Karger AG, Basel

  13. Improved treatment of nucleosides and nucleotides in the OPLS-AA force field

    NASA Astrophysics Data System (ADS)

    Robertson, Michael J.; Tirado-Rives, Julian; Jorgensen, William L.

    2017-09-01

    DFT calculations have been used to develop improved descriptions of the torsional energetics for nucleosides and nucleotides in the OPLS-AA force field. Scans of nucleotide dihedral angles (γ, χ, and β) and methyl phosphates provided the bases for the new torsional parameters. In addition, the angle-bending parameters of phosphodiesters and ribose were updated, and adjustments were made to existing carbohydrate torsions to better capture the sugar puckering landscape of ribose. MD simulations of nucleosides with the new parameters demonstrate a significant improvement in the ribose sugar puckering and χ angle distributions. Additionally, energy-minimization of protein-nucleotide crystal structures with the new parameters produced accurate poses.

  14. A novel genome signature based on inter-nucleotide distances profiles for visualization of metagenomic data

    NASA Astrophysics Data System (ADS)

    Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo

    2017-09-01

    There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.

  15. A movie of the RNA polymerase nucleotide addition cycle.

    PubMed

    Brueckner, Florian; Ortiz, Julio; Cramer, Patrick

    2009-06-01

    During gene transcription, RNA polymerase (Pol) passes through repetitive cycles of adding a nucleotide to the growing mRNA chain. Here we obtained a movie of the nucleotide addition cycle by combining structural information on different functional states of the Pol II elongation complex (EC). The movie illustrates the two-step loading of the nucleoside triphosphate (NTP) substrate, closure of the active site for catalytic nucleotide incorporation, and the presumed two-step translocation of DNA and RNA, which is accompanied by coordinated conformational changes in the polymerase bridge helix and trigger loop. The movie facilitates teaching and a mechanistic analysis of transcription and can be downloaded from http://www.lmb.uni-muenchen.de/cramer/pr-materials.

  16. Expanded Genetic Codes in Next Generation Sequencing Enable Decontamination and Mitochondrial Enrichment

    PubMed Central

    McKernan, Kevin J.; Spangler, Jessica; Zhang, Lei; Tadigotla, Vasisht; McLaughlin, Stephen; Warner, Jason; Zare, Amir; Boles, Richard G.

    2014-01-01

    We have developed a PCR method, coined Déjà vu PCR, that utilizes six nucleotides in PCR with two methyl specific restriction enzymes that respectively digest these additional nucleotides. Use of this enzyme-and-nucleotide combination enables what we term a “DNA diode”, where DNA can advance in a laboratory in only one direction and cannot feedback into upstream assays. Here we describe aspects of this method that enable consecutive amplification with the introduction of a 5th and 6th base while simultaneously providing methylation dependent mitochondrial DNA enrichment. These additional nucleotides enable a novel DNA decontamination technique that generates ephemeral and easy to decontaminate DNA. PMID:24788618

  17. Development of a method for the analysis of nucleotides from the mantle tissue of the mussel Mytilus galloprovincialis.

    PubMed

    Blanco López, S L; Moal, J; San Juan Serrano, F

    2000-09-01

    Reversed-phase HPLC was applied to obtain a sensitive and efficient means for quantitating nucleotides in the mussel Mytilus galloprovincialis. We obtained a good separation of adenylic, guanylic, uridylic and cytidylic nucleotides. Adenine nucleotides play a critical role in the regulation and integration of cellular metabolism; particularly in the mantle tissue in the mussel, they are involved in the regulation of the enzyme glycogen phosphorylase, a key enzyme in the transfer of bioenergetic reserves (glycogen) to gametogenic development; it is of great importance to have a measure of the concentrations in vivo during the reproductive cycle of the organism. Different elution conditions were tested: isocratic versus step gradient elution, different mobile phase pH and the type and proportion of ion-pairing agent added to the mobile phase. The best method was selected and the separation and accurate determination of adenine, citidine, guanine and uridine nucleotides was accomplished within a 20-min run, with UV-Vis detection (254 nm).

  18. Synthesis, salvage, and catabolism of uridine nucleotides in boron-deficient squash roots.

    PubMed

    Lovatt, C J; Albert, L S; Tremblay, G C

    1981-12-01

    Previous work has provided evidence that plants may require boron to maintain adequate levels of pyrimidine nucleotides, suggesting that the state of boron deficiency may actually be one of pyrimidine starvation. Since the availability of pyrimidine nucleotides is influenced by their rates of synthesis, salvage, and catabolism, we compared these activities in the terminal 3 centimeters of roots excised from boron-deficient and -sufficient squash plants (Cucurbita pepo L.). Transferring 5-day-old squash plants to a boron-deficient nutrient solution resulted in cessation of root elongation within 18 hours. However, withholding boron for up to 30 hours did not result in either impaired de novo pyrimidine biosynthesis or a change in the sensitivity of the de novo pathway to regulation by end product inhibition. Boron deprivation had no significant effect on pyrimidine salvage or catabolism. These results provide evidence that boron-deficient plants are not starved for uridine nucleotides collectively. Whether a particular pyrimidine nucleotide or derivative is limiting during boron deprivation remains to be examined.

  19. Inactivation of the first nucleotide-binding fold of the sulfonylurea receptor, and familial persistent hyperinsulinemic hypoglycemia of infancy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thomas, P.M.; Wohllk, N.; Huang, E.

    1996-09-01

    Familial persistent hyperinsulinemic hypoglycemia of infancy is a disorder of glucose homeostasis and is characterized by unregulated insulin secretion and profound hypoglycemia. Loss-of-function mutations in the second nucleotide-binding fold of the sulfonylurea receptor, a subunit of the pancreatic-islet {beta}-cell ATP-dependent potassium channel, has been demonstrated to be causative for persistent hyperinsulinemic hypoglycemia of infancy. We now describe three additional mutations in the first nucleotide-binding fold of the sulfonylurea-receptor gene. One point mutation disrupts the highly conserved Walker A motif of the first nucleotide-binding-fold region. The other two mutations occur in noncoding sequences required for RNA processing and are predicted tomore » disrupt the normal splicing pathway of the sulfonylurea-receptor mRNA precursor. These data suggest that both nucleotide-binding-fold regions of the sulfortylurea receptor are required for normal regulation of {beta}-cell ATP-dependent potassium channel activity and insulin secretion. 32 refs., 4 figs., 1 tab.« less

  20. Dietary nucleotides prevent decrease in cellular immunity in ground-based microgravity analog

    NASA Technical Reports Server (NTRS)

    Yamauchi, Keiko; Hales, Nathan W.; Robinson, Sandra M.; Niehoff, Michael L.; Ramesh, Vani; Pellis, Neal R.; Kulkarni, Anil D.

    2002-01-01

    Microgravity and stress of spaceflights result in immune dysfunction. The role of nutrition, especially nucleotide supplementation, has become an area of intensive research and significant interest in immunomodulation for maintenance of cellular immune responses. The studies presented here evaluate the plausibility of administering nucleotides to obviate immune dysfunction in an Earth-based in vivo analog of microgravity as studied in anti-orthostatic tail suspension (AOS) of mice. Mice were divided into three housing groups: group, isolation, and AOS. Mice were fed either control chow diet (CD), or RNA-, adenine-, or uracil-supplemented CD for the 1-wk duration of the experiments. In AOS mice, supplemental nucleotides significantly increased in vivo lymph node proliferation and ex vivo lymphoproliferation response to alloantigen and mitogens, respectively, and interleukin-2 and interferon-gamma production. A lower corticosterone level was observed in uracil-supplemented CD compared with CD. These results suggest that exogenous nucleotide supplementation, especially uracil, of normal diet is beneficial in the maintenance and restoration of the immune response during the microgravity analog conditions.

  1. Error correction and diversity analysis of population mixtures determined by NGS

    PubMed Central

    Burroughs, Nigel J.; Evans, David J.; Ryabov, Eugene V.

    2014-01-01

    The impetus for this work was the need to analyse nucleotide diversity in a viral mix taken from honeybees. The paper has two findings. First, a method for correction of next generation sequencing error in the distribution of nucleotides at a site is developed. Second, a package of methods for assessment of nucleotide diversity is assembled. The error correction method is statistically based and works at the level of the nucleotide distribution rather than the level of individual nucleotides. The method relies on an error model and a sample of known viral genotypes that is used for model calibration. A compendium of existing and new diversity analysis tools is also presented, allowing hypotheses about diversity and mean diversity to be tested and associated confidence intervals to be calculated. The methods are illustrated using honeybee viral samples. Software in both Excel and Matlab and a guide are available at http://www2.warwick.ac.uk/fac/sci/systemsbiology/research/software/, the Warwick University Systems Biology Centre software download site. PMID:25405074

  2. Two nucleotide binding sites modulate ( sup 3 H) glyburide binding to rat cortex membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Johnson, D.E.; Gopalakrishnan, M.; Triggle, D.J.

    1991-03-11

    The effects of nucleotides on the binding of the ATP-dependent K{sup +}-channel antagonist ({sup 3}H)glyburide (GLB) to rat cortex membranes were examined. Nucleotide triphosphates (NTPs) and nucleotide diphosphate (NDPs) inhibited the binding of GLB. This effect was dependent on the presence of dithiothreitol (DTT). Inhibition of binding by NTPs, with the exception of ATP{gamma}S, was dependent on the presence of Mg{sup 2+}. GLB binding showed a biphasic response to ADP: up to 3 mM, ADP inhibited binding, and above this concentration GLB binding increased rapidly, and was restored to normal levels by 10 mM ADP. In the presence of Mg{supmore » 2+}, ADP did not stimulate binding. Saturation analysis in the presence of Mg{sup 2+} and increasing concentrations of ADP showed that ADP results primarily in a change of the B{sub max} for GLB binding. The differential effects of NTPS and NDPs indicate that two nucleotide binding sites regulate GLB binding.« less

  3. Fatty Acids Change the Conformation of Uncoupling Protein 1 (UCP1)*

    PubMed Central

    Divakaruni, Ajit S.; Humphrey, Dickon M.; Brand, Martin D.

    2012-01-01

    UCP1 catalyzes proton leak across the mitochondrial inner membrane to disengage substrate oxidation from ATP production. It is well established that UCP1 is activated by fatty acids and inhibited by purine nucleotides, but precisely how this regulation occurs remains unsettled. Although fatty acids can competitively overcome nucleotide inhibition in functional assays, fatty acids have little effect on purine nucleotide binding. Here, we present the first demonstration that fatty acids induce a conformational change in UCP1. Palmitate dramatically changed the binding kinetics of 2′/3′-O-(N-methylanthraniloyl)-GDP, a fluorescently labeled nucleotide analog, for UCP1. Furthermore, palmitate accelerated the rate of enzymatic proteolysis of UCP1. The altered kinetics of both processes indicate that fatty acids change the conformation of UCP1, reconciling the apparent discrepancy between existing functional and ligand binding data. Our results provide a framework for how fatty acids and nucleotides compete to regulate the activity of UCP1. PMID:22952235

  4. Evolving nucleotide binding surfaces

    NASA Technical Reports Server (NTRS)

    Kieber-Emmons, T.; Rein, R.

    1981-01-01

    An analysis is presented of the stability and nature of binding of a nucleotide to several known dehydrogenases. The employed approach includes calculation of hydrophobic stabilization of the binding motif and its intermolecular interaction with the ligand. The evolutionary changes of the binding motif are studied by calculating the Euclidean deviation of the respective dehydrogenases. Attention is given to the possible structural elements involved in the origin of nucleotide recognition by non-coded primordial polypeptides.

  5. Plant nitrogen regulatory P-PII genes

    DOEpatents

    Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

    2001-01-01

    The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the

  6. Analysis of plant nucleotide sugars by hydrophilic interaction liquid chromatography and tandem mass spectrometry.

    PubMed

    Ito, Jun; Herter, Thomas; Baidoo, Edward E K; Lao, Jeemeng; Vega-Sánchez, Miguel E; Michelle Smith-Moritz, A; Adams, Paul D; Keasling, Jay D; Usadel, Björn; Petzold, Christopher J; Heazlewood, Joshua L

    2014-03-01

    Understanding the intricate metabolic processes involved in plant cell wall biosynthesis is limited by difficulties in performing sensitive quantification of many involved compounds. Hydrophilic interaction liquid chromatography is a useful technique for the analysis of hydrophilic metabolites from complex biological extracts and forms the basis of this method to quantify plant cell wall precursors. A zwitterionic silica-based stationary phase has been used to separate hydrophilic nucleotide sugars involved in cell wall biosynthesis from milligram amounts of leaf tissue. A tandem mass spectrometry operating in selected reaction monitoring mode was used to quantify nucleotide sugars. This method was highly repeatable and quantified 12 nucleotide sugars at low femtomole quantities, with linear responses up to four orders of magnitude to several 100pmol. The method was also successfully applied to the analysis of purified leaf extracts from two model plant species with variations in their cell wall sugar compositions and indicated significant differences in the levels of 6 out of 12 nucleotide sugars. The plant nucleotide sugar extraction procedure was demonstrated to have good recovery rates with minimal matrix effects. The approach results in a significant improvement in sensitivity when applied to plant samples over currently employed techniques. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. pyr RNA binding to the Bacillus caldolyticus PyrR attenuation protein. Characterization and regulation by uridine and guanosine nucleotides

    PubMed Central

    Jørgensen, Casper Møller; Fields, Christopher J.; Chander, Preethi; Watt, Desmond; Burgner, John W.; Smith, Janet L.; Switzer, Robert L.

    2011-01-01

    Summary The PyrR protein regulates expression of pyrimidine biosynthetic (pyr) genes in many bacteria. PyrR binds to specific sites in the 5’ leader RNA of target operons and favors attenuation of transcription. Filter binding and gel mobility assays were used to characterize the binding of PyrR from Bacillus caldolyticus to RNA sequences (binding loops) from the three attenuation regions of the B. caldolyticus pyr operon. Binding of PyrR to the three binding loops and modulation of RNA binding by nucleotides was similar for all three RNAs. Apparent dissociation constants at 0° C ranged from 0.13 to 0.87 nM in the absence of effectors; dissociation constants were decreased by 3 to 12 fold by uridine nucleotides and increased by 40 to 200 fold by guanosine nucleotides. The binding data suggest that pyr operon expression is regulated by the ratio of intracellular uridine nucleotides to guanosine nucleotides; the effects of nucleoside addition to the growth medium on aspartate transcarbamylase (pyrB) levels in B. subtilis cells in vivo supported this conclusion. Analytical ultracentrifugation established that RNA binds to dimeric PyrR, even though the tetrameric form of unbound PyrR predominates in solution at the concentrations studied. PMID:18190533

  8. Comprehensive thermodynamic analysis of 3′ double-nucleotide overhangs neighboring Watson–Crick terminal base pairs

    PubMed Central

    O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.

    2006-01-01

    Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533

  9. Molecular Mechanism of Processive 3' to 5' RNA Translocation in the Active Subunit of the RNA Exosome Complex.

    PubMed

    Vuković, Lela; Chipot, Christophe; Makino, Debora L; Conti, Elena; Schulten, Klaus

    2016-03-30

    Recent experimental studies revealed structural details of 3' to 5' degradation of RNA molecules, performed by the exosome complex. ssRNA is channeled through its multisubunit ring-like core into the active site tunnel of its key exonuclease subunit Rrp44, which acts both as an enzyme and a motor. Even in isolation, Rrp44 can pull and sequentially cleave RNA nucleotides, one at a time, without any external energy input and release a final 3-5 nucleotide long product. Using molecular dynamics simulations, we identify the main factors that control these processes. Our free energy calculations reveal that RNA transfer from solution into the active site of Rrp44 is highly favorable, but dependent on the length of the RNA strand. While RNA strands formed by 5 nucleotides or more correspond to a decreasing free energy along the translocation coordinate toward the cleavage site, a 4-nucleotide RNA experiences a free energy barrier along the same direction, potentially leading to incomplete cleavage of ssRNA and the release of short (3-5) nucleotide products. We provide new insight into how Rrp44 catalyzes a localized enzymatic reaction and performs an action distributed over several RNA nucleotides, leading eventually to the translocation of whole RNA segments into the position suitable for cleavage.

  10. Cytokinin nucleotides contents in sexual buds of Douglas-fir

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Imbault, N.; Doumas, P.; Bonnet-Masimbert, N.

    1989-04-01

    Cytokinin nucleotides were extracted from male and female buds of Pseudotsuga menxiesii by 10 % perchloric acid. They were prepurified on cation exchanger columns (CBA, Amersham) and then separated by two HPLC systems. The first one (Partisil 10 SAX, 10{mu}m, Wathman) separates the mono-, di- and tri-phosphates groups which were collected. The second one (Ultraspher, 5 {mu}m, Beckman) separates the cytokinin nucleotides inside each group. After separation, cytokinin nucleotides were assayed by radioimmunoassay with anti ribosyl zeatin (RZ) and anti isopentenyladenosine (iPA) antibodies. The analysis showed in the monophosphate (mono-P) group one immunoreactant peak in RZ fraction which co-chromatographied withmore » RZ-5{prime}-mono-P and two peaks in the iPA fraction. One of them co-chromatographied with iPA-5{prime}-mono-P. In the diphosphate group, there were three peaks which reacted with anti RZ antibodies and one with anti iPA antibodies. The nucleotides obtained after the first HPLC system, were hydrolysed by a 5{prime}-nucleotidase showed compounds co-chromatographing with RZ and iPA. We did not observe any qualitative differences between the male and female buds. This is the first evidence of cytokinin nucleotides in tissue from woody plants.« less

  11. In What Ways Do Synthetic Nucleotides and Natural Base Lesions Alter the Structural Stability of G-Quadruplex Nucleic Acids?

    PubMed Central

    2017-01-01

    Synthetic analogs of natural nucleotides have long been utilized for structural studies of canonical and noncanonical nucleic acids, including the extensively investigated polymorphic G-quadruplexes (GQs). Dependence on the sequence and nucleotide modifications of the folding landscape of GQs has been reviewed by several recent studies. Here, an overview is compiled on the thermodynamic stability of the modified GQ folds and on how the stereochemical preferences of more than 70 synthetic and natural derivatives of nucleotides substituting for natural ones determine the stability as well as the conformation. Groups of nucleotide analogs only stabilize or only destabilize the GQ, while the majority of analogs alter the GQ stability in both ways. This depends on the preferred syn or anti N-glycosidic linkage of the modified building blocks, the position of substitution, and the folding architecture of the native GQ. Natural base lesions and epigenetic modifications of GQs explored so far also stabilize or destabilize the GQ assemblies. Learning the effect of synthetic nucleotide analogs on the stability of GQs can assist in engineering a required stable GQ topology, and exploring the in vitro action of the single and clustered natural base damage on GQ architectures may provide indications for the cellular events. PMID:29181193

  12. Prokaryotic Nucleotide Composition Is Shaped by Both Phylogeny and the Environment

    DOE PAGES

    Reichenberger, Erin R.; Rosen, Gail; Hershberg, Uri; ...

    2015-04-09

    Here, the causes of the great variation in nucleotide composition of prokaryotic genomes have long been disputed. Here, we use extensive metagenomic and whole-genome data to demonstrate that both phylogeny and the environment shape prokaryotic nucleotide content. We show that across environments, various phyla are characterized by different mean guanine and cytosine (GC) values as well as by the extent of variation on that mean value. At the same time, we show that GC-content varies greatly as a function of environment, in a manner that cannot be entirely explained by disparities in phylogenetic composition. We find environmentally driven differences inmore » nucleotide content not only between highly diverged environments (e.g., soil, vs. aquatic vs. human gut) but also within a single type of environment. More specifically, we demonstrate that some human guts are associated with a microbiome that is consistently more GC-rich across phyla, whereas others are associated with a more AT-rich microbiome. These differences appear to be driven both by variations in phylogenetic composition and by environmental differences—which are independent of these phylogenetic composition differences. Combined, our results demonstrate that both phylogeny and the environment significantly affect nucleotide composition and that the environmental differences affecting nucleotide composition are far subtler than previously appreciated.« less

  13. A novel dimerization interface of cyclic nucleotide binding domain, which is disrupted in presence of cAMP: implications for CNG channels gating.

    PubMed

    Gushchin, Ivan Y; Gordeliy, Valentin I; Grudinin, Sergei

    2012-09-01

    Cyclic nucleotide binding domain (CNBD) is a ubiquitous domain of effector proteins involved in signalling cascades of prokaryota and eukaryota. CNBD activation by cyclic nucleotide monophosphate (cNMP) is studied well in the case of several proteins. However, this knowledge is hardly applicable to cNMP-modulated cation channels. Despite the availability of CNBD crystal structures of bacterial cyclic nucleotide-gated (CNG) and mammalian hyperpolarization-activated cyclic nucleotide-modulated (HCN) channels in presence and absence of the cNMP, the full understanding of CNBD conformational changes during activation is lacking. Here, we describe a novel CNBD dimerization interface found in crystal structures of bacterial CNG channel MlotiK1 and mammalian cAMP-activated guanine nucleotide-exchange factor Epac2. Molecular dynamics simulations show that the found interface is stable on the studied timescale of 100 ns, in contrast to the dimerization interface, reported previously. Comparisons with cN-bound structures of CNBD show that the dimerization is incompatible with cAMP binding. Thus, the cAMP-dependent monomerization of CNBD may be an alternative mechanism of the cAMP sensing. Based on these findings, we propose a model of the bacterial CNG channel modulation by cAMP.

  14. The Structure of a High Fidelity DNA Polymerase Bound to a Mismatched Nucleotide Reveals an “Ajar” Intermediate Conformation in the Nucleotide Selection Mechanism*

    PubMed Central

    Wu, Eugene Y.; Beese, Lorena S.

    2011-01-01

    To achieve accurate DNA synthesis, DNA polymerases must rapidly sample and discriminate against incorrect nucleotides. Here we report the crystal structure of a high fidelity DNA polymerase I bound to DNA primer-template caught in the act of binding a mismatched (dG:dTTP) nucleoside triphosphate. The polymerase adopts a conformation in between the previously established “open” and “closed” states. In this “ajar” conformation, the template base has moved into the insertion site but misaligns an incorrect nucleotide relative to the primer terminus. The displacement of a conserved active site tyrosine in the insertion site by the template base is accommodated by a distinctive kink in the polymerase O helix, resulting in a partially open ternary complex. We suggest that the ajar conformation allows the template to probe incoming nucleotides for complementarity before closure of the enzyme around the substrate. Based on solution fluorescence, kinetics, and crystallographic analyses of wild-type and mutant polymerases reported here, we present a three-state reaction pathway in which nucleotides either pass through this intermediate conformation to the closed conformation and catalysis or are misaligned within the intermediate, leading to destabilization of the closed conformation. PMID:21454515

  15. Detecting associated single-nucleotide polymorphisms on the X chromosome in case control genome-wide association studies.

    PubMed

    Chen, Zhongxue; Ng, Hon Keung Tony; Li, Jing; Liu, Qingzhong; Huang, Hanwen

    2017-04-01

    In the past decade, hundreds of genome-wide association studies have been conducted to detect the significant single-nucleotide polymorphisms that are associated with certain diseases. However, most of the data from the X chromosome were not analyzed and only a few significant associated single-nucleotide polymorphisms from the X chromosome have been identified from genome-wide association studies. This is mainly due to the lack of powerful statistical tests. In this paper, we propose a novel statistical approach that combines the information of single-nucleotide polymorphisms on the X chromosome from both males and females in an efficient way. The proposed approach avoids the need of making strong assumptions about the underlying genetic models. Our proposed statistical test is a robust method that only makes the assumption that the risk allele is the same for both females and males if the single-nucleotide polymorphism is associated with the disease for both genders. Through simulation study and a real data application, we show that the proposed procedure is robust and have excellent performance compared to existing methods. We expect that many more associated single-nucleotide polymorphisms on the X chromosome will be identified if the proposed approach is applied to current available genome-wide association studies data.

  16. Switching Cyclic Nucleotide-Selective Activation of Cyclic Adenosine Monophosphate-Dependent Protein Kinase Holoenzyme Reveals Distinct Roles of Tandem Cyclic Nucleotide-Binding Domains.

    PubMed

    He, Daniel; Lorenz, Robin; Kim, Choel; Herberg, Friedrich W; Lim, Chinten James

    2017-12-15

    The cyclic adenosine monophosphate (cAMP)- and cyclic guanosine monophosphate (cGMP)-dependent protein kinases (PKA and PKG) are key effectors of cyclic nucleotide signaling. Both share structural features that include tandem cyclic nucleotide-binding (CNB) domains, CNB-A and CNB-B, yet their functions are separated through preferential activation by either cAMP or cGMP. Based on structural studies and modeling, key CNB contact residues have been identified for both kinases. In this study, we explored the requirements for conversion of PKA activation from cAMP-dependent to cGMP-dependent. The consequences of the residue substitutions T192R/A212T within CNB-A or G316R/A336T within CNB-B of PKA-RIα on cyclic nucleotide binding and holoenzyme activation were assessed in vitro using purified recombinant proteins, and ex vivo using RIα-deficient mouse embryonic fibroblasts genetically reconstituted with wild-type or mutant PKA-RIα. In vitro, a loss of binding and activation selectivity was observed when residues in either one of the CNB domains were mutated, while mutations in both CNB domains resulted in a complete switch of selectivity from cAMP to cGMP. The switch in selectivity was also recapitulated ex vivo, confirming their functional roles in cells. Our results highlight the importance of key cyclic nucleotide contacts within each CNB domain and suggest that these domains may have evolved from an ancestral gene product to yield two distinct cyclic nucleotide-dependent protein kinases.

  17. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

    PubMed

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

    2014-06-01

    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  18. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions

    PubMed Central

    Vergnano, Marta; Wan, Chris

    2017-01-01

    ABSTRACT We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. PMID:28743817

  19. Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9*

    PubMed Central

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-01-01

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al3+ to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. PMID:25028514

  20. Cytosolic nucleotides block and regulate the Arabidopsis vacuolar anion channel AtALMT9.

    PubMed

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-09-12

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al(3+) to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. A substrate radical intermediate in the reaction between ribonucleotide reductase from Escherichia coli and 2'-azido-2'-deoxynucleoside diphosphates.

    PubMed

    Sjöberg, B M; Gräslund, A; Eckstein, F

    1983-07-10

    The B2 subunit of ribonucleotide reductase from Escherichia coli contains a tyrosine radical which is essential for enzyme activity. In the reaction between ribonucleotide reductase and the substrate analogue 2'-azido-2'-deoxycytidine 5'-diphosphate a new transient radical is formed. The EPR characteristics of this new radical species are consistent with a localization of the unpaired electron at the sugar moiety of the nucleotide. The radical shows hyperfine couplings to a hydrogen and a nitrogen nucleus, the latter probably being part of the azide substituent. The formation of the nucleotide radical in this suicidal reaction is concomitant with the decay of the tyrosine radical of the B2 subunit. Kinetic data argue for a first (pseudosecond) order decay of the B2 radical via generation of the nucleotide radical followed by a slower first order decay of the nucleotide radical. End products in the reaction are cytosine and radical-free protein B2. In the reaction between bacteriophage T4 ribonucleotide reductase and 2'-azido-2'-deoxycytidine 5'-diphosphate an identical nucleotide radical is formed. The present results are consistent with the hypothesis that the appearance and structure of the transient radical mimic stages in the normal reaction pathway of ribonucleotide reductase, postulated to proceed via 3'-hydrogen abstraction and cation radical formation of the substrate nucleotide (Stubbe, J., and Ackles, D. (1980) J. Biol. Chem. 255, 8027-8030). The nucleotide radical described here might be equivalent to such a cation radical intermediate.

  2. Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

    PubMed Central

    Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

    1982-01-01

    The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

  3. UrQt: an efficient software for the Unsupervised Quality trimming of NGS data.

    PubMed

    Modolo, Laurent; Lerat, Emmanuelle

    2015-04-29

    Quality control is a necessary step of any Next Generation Sequencing analysis. Although customary, this step still requires manual interventions to empirically choose tuning parameters according to various quality statistics. Moreover, current quality control procedures that provide a "good quality" data set, are not optimal and discard many informative nucleotides. To address these drawbacks, we present a new quality control method, implemented in UrQt software, for Unsupervised Quality trimming of Next Generation Sequencing reads. Our trimming procedure relies on a well-defined probabilistic framework to detect the best segmentation between two segments of unreliable nucleotides, framing a segment of informative nucleotides. Our software only requires one user-friendly parameter to define the minimal quality threshold (phred score) to consider a nucleotide to be informative, which is independent of both the experiment and the quality of the data. This procedure is implemented in C++ in an efficient and parallelized software with a low memory footprint. We tested the performances of UrQt compared to the best-known trimming programs, on seven RNA and DNA sequencing experiments and demonstrated its optimality in the resulting tradeoff between the number of trimmed nucleotides and the quality objective. By finding the best segmentation to delimit a segment of good quality nucleotides, UrQt greatly increases the number of reads and of nucleotides that can be retained for a given quality objective. UrQt source files, binary executables for different operating systems and documentation are freely available (under the GPLv3) at the following address: https://lbbe.univ-lyon1.fr/-UrQt-.html .

  4. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

    PubMed Central

    Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

    2016-01-01

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  5. Regulation of Ion Channels by Pyridine Nucleotides

    PubMed Central

    Kilfoil, Peter J.; Tipparaju, Srinivas M.; Barski, Oleg A.; Bhatnagar, Aruni

    2014-01-01

    Recent research suggests that in addition to their role as soluble electron carriers, pyridine nucleotides [NAD(P)(H)] also regulate ion transport mechanisms. This mode of regulation seems to have been conserved through evolution. Several bacterial ion–transporting proteins or their auxiliary subunits possess nucleotide-binding domains. In eukaryotes, the Kv1 and Kv4 channels interact with pyridine nucleotide–binding β-subunits that belong to the aldo-keto reductase superfamily. Binding of NADP+ to Kvβ removes N-type inactivation of Kv currents, whereas NADPH stabilizes channel inactivation. Pyridine nucleotides also regulate Slo channels by interacting with their cytosolic regulator of potassium conductance domains that show high sequence homology to the bacterial TrkA family of K+ transporters. These nucleotides also have been shown to modify the activity of the plasma membrane KATP channels, the cystic fibrosis transmembrane conductance regulator, the transient receptor potential M2 channel, and the intracellular ryanodine receptor calcium release channels. In addition, pyridine nucleotides also modulate the voltage-gated sodium channel by supporting the activity of its ancillary subunit—the glycerol-3-phosphate dehydrogenase-like protein. Moreover, the NADP+ metabolite, NAADP+, regulates intracellular calcium homeostasis via the 2-pore channel, ryanodine receptor, or transient receptor potential M2 channels. Regulation of ion channels by pyridine nucleotides may be required for integrating cell ion transport to energetics and for sensing oxygen levels or metabolite availability. This mechanism also may be an important component of hypoxic pulmonary vasoconstriction, memory, and circadian rhythms, and disruption of this regulatory axis may be linked to dysregulation of calcium homeostasis and cardiac arrhythmias. PMID:23410881

  6. Enhancing a Pathway-Genome Database (PGDB) to capture subcellular localization of metabolites and enzymes: the nucleotide-sugar biosynthetic pathways of Populus trichocarpa.

    PubMed

    Nag, Ambarish; Karpinets, Tatiana V; Chang, Christopher H; Bar-Peled, Maor

    2012-01-01

    Understanding how cellular metabolism works and is regulated requires that the underlying biochemical pathways be adequately represented and integrated with large metabolomic data sets to establish a robust network model. Genetically engineering energy crops to be less recalcitrant to saccharification requires detailed knowledge of plant polysaccharide structures and a thorough understanding of the metabolic pathways involved in forming and regulating cell-wall synthesis. Nucleotide-sugars are building blocks for synthesis of cell wall polysaccharides. The biosynthesis of nucleotide-sugars is catalyzed by a multitude of enzymes that reside in different subcellular organelles, and precise representation of these pathways requires accurate capture of this biological compartmentalization. The lack of simple localization cues in genomic sequence data and annotations however leads to missing compartmentalization information for eukaryotes in automatically generated databases, such as the Pathway-Genome Databases (PGDBs) of the SRI Pathway Tools software that drives much biochemical knowledge representation on the internet. In this report, we provide an informal mechanism using the existing Pathway Tools framework to integrate protein and metabolite sub-cellular localization data with the existing representation of the nucleotide-sugar metabolic pathways in a prototype PGDB for Populus trichocarpa. The enhanced pathway representations have been successfully used to map SNP abundance data to individual nucleotide-sugar biosynthetic genes in the PGDB. The manually curated pathway representations are more conducive to the construction of a computational platform that will allow the simulation of natural and engineered nucleotide-sugar precursor fluxes into specific recalcitrant polysaccharide(s). Database URL: The curated Populus PGDB is available in the BESC public portal at http://cricket.ornl.gov/cgi-bin/beocyc_home.cgi and the nucleotide-sugar biosynthetic pathways can be directly accessed at http://cricket.ornl.gov:1555/PTR/new-image?object=SUGAR-NUCLEOTIDES.

  7. Genetic polymorphisms in ESR1 and ESR2 genes, and risk of hypospadias in a multiethnic study population.

    PubMed

    Choudhry, Shweta; Baskin, Laurence S; Lammer, Edward J; Witte, John S; Dasgupta, Sudeshna; Ma, Chen; Surampalli, Abhilasha; Shen, Joel; Shaw, Gary M; Carmichael, Suzan L

    2015-05-01

    Estrogenic endocrine disruptors acting via estrogen receptors α (ESR1) and β (ESR2) have been implicated in the etiology of hypospadias, a common congenital malformation of the male external genitalia. We determined the association of single nucleotide polymorphisms in ESR1 and ESR2 genes with hypospadias in a racially/ethnically diverse study population of California births. We investigated the relationship between hypospadias and 108 ESR1 and 36 ESR2 single nucleotide polymorphisms in 647 cases and 877 population based nonmalformed controls among infants born in selected California counties from 1990 to 2003. Subgroup analyses were performed by race/ethnicity (nonHispanic white and Hispanic subjects) and by hypospadias severity (mild to moderate and severe). Odds ratios for 33 of the 108 ESR1 single nucleotide polymorphisms had p values less than 0.05 (p = 0.05 to 0.007) for risk of hypospadias. However, none of the 36 ESR2 single nucleotide polymorphisms was significantly associated. In stratified analyses the association results were consistent by disease severity but different sets of single nucleotide polymorphisms were significantly associated with hypospadias in nonHispanic white and Hispanic subjects. Due to high linkage disequilibrium across the single nucleotide polymorphisms, haplotype analyses were conducted and identified 6 haplotype blocks in ESR1 gene that had haplotypes significantly associated with an increased risk of hypospadias (OR 1.3 to 1.8, p = 0.04 to 0.00001). Similar to single nucleotide polymorphism analysis, different ESR1 haplotypes were associated with risk of hypospadias in nonHispanic white and Hispanic subjects. No significant haplotype association was observed for ESR2. The data provide evidence that ESR1 single nucleotide polymorphisms and haplotypes influence the risk of hypospadias in white and Hispanic subjects, and warrant further examination in other study populations. Copyright © 2015 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  8. Enhancing a Pathway-Genome Database (PGDB) to capture subcellular localization of metabolites and enzymes: the nucleotide-sugar biosynthetic pathways of Populus trichocarpa

    PubMed Central

    Nag, Ambarish; Karpinets, Tatiana V.; Chang, Christopher H.; Bar-Peled, Maor

    2012-01-01

    Understanding how cellular metabolism works and is regulated requires that the underlying biochemical pathways be adequately represented and integrated with large metabolomic data sets to establish a robust network model. Genetically engineering energy crops to be less recalcitrant to saccharification requires detailed knowledge of plant polysaccharide structures and a thorough understanding of the metabolic pathways involved in forming and regulating cell-wall synthesis. Nucleotide-sugars are building blocks for synthesis of cell wall polysaccharides. The biosynthesis of nucleotide-sugars is catalyzed by a multitude of enzymes that reside in different subcellular organelles, and precise representation of these pathways requires accurate capture of this biological compartmentalization. The lack of simple localization cues in genomic sequence data and annotations however leads to missing compartmentalization information for eukaryotes in automatically generated databases, such as the Pathway-Genome Databases (PGDBs) of the SRI Pathway Tools software that drives much biochemical knowledge representation on the internet. In this report, we provide an informal mechanism using the existing Pathway Tools framework to integrate protein and metabolite sub-cellular localization data with the existing representation of the nucleotide-sugar metabolic pathways in a prototype PGDB for Populus trichocarpa. The enhanced pathway representations have been successfully used to map SNP abundance data to individual nucleotide-sugar biosynthetic genes in the PGDB. The manually curated pathway representations are more conducive to the construction of a computational platform that will allow the simulation of natural and engineered nucleotide-sugar precursor fluxes into specific recalcitrant polysaccharide(s). Database URL: The curated Populus PGDB is available in the BESC public portal at http://cricket.ornl.gov/cgi-bin/beocyc_home.cgi and the nucleotide-sugar biosynthetic pathways can be directly accessed at http://cricket.ornl.gov:1555/PTR/new-image?object=SUGAR-NUCLEOTIDES. PMID:22465851

  9. Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

    PubMed Central

    Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

    2011-01-01

    DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

  10. Variation in the Nucleotide Sequence of Cottontail Rabbit Papillomavirus a and b Subtypes Affects Wart Regression and Malignant Transformation and Level of Viral Replication in Domestic Rabbits

    PubMed Central

    Salmon, Jérôme; Nonnenmacher, Mathieu; Cazé, Sandrine; Flamant, Patricia; Croissant, Odile; Orth, Gérard; Breitburd, Françoise

    2000-01-01

    We previously reported the partial characterization of two cottontail rabbit papillomavirus (CRPV) subtypes with strikingly divergent E6 and E7 oncoproteins. We report now the complete nucleotide sequences of these subtypes, referred to as CRPVa4 (7,868 nucleotides) and CRPVb (7,867 nucleotides). The CRPVa4 and CRPVb genomes differed at 238 (3%) nucleotide positions, whereas CRPVa4 and the prototype CRPV differed by only 5 nucleotides. The most variable region (7% nucleotide divergence) included the long regulatory region (LRR) and the E6 and E7 genes. A mutation in the stop codon resulted in an 8-amino-acid-longer CRPVb E4 protein, and a nucleotide deletion reduced the coding capacity of the E5 gene from 101 to 25 amino acids. In domestic rabbits homozygous for a specific haplotype of the DRA and DQA genes of the major histocompatibility complex, warts induced by CRPVb DNA or a chimeric genome containing the CRPVb LRR/E6/E7 region showed an early regression, whereas warts induced by CRPVa4 or a chimeric genome containing the CRPVa4 LRR/E6/E7 region persisted and evolved into carcinomas. In contrast, most CRPVa, CRPVb, and chimeric CRPV DNA-induced warts showed no early regression in rabbits homozygous for another DRA-DQA haplotype. Little, if any, viral replication is usually observed in domestic rabbit warts. When warts induced by CRPVa and CRPVb virions and DNA were compared, the number of cells positive for viral DNA or capsid antigens was found to be greater by 1 order of magnitude for specimens induced by CRPVb. Thus, both sequence variation in the LRR/E6/E7 region and the genetic constitution of the host influence the expression of the oncogenic potential of CRPV. Furthermore, intratype variation may overcome to some extent the host restriction of CRPV replication in domestic rabbits. PMID:11044121

  11. Formation of tamoxifen-DNA adducts in multiple organs of adult female cynomolgus monkeys dosed with tamoxifen for 30 days.

    PubMed

    Schild, Laura J; Divi, Rao L; Beland, Frederick A; Churchwell, Mona I; Doerge, Daniel R; Gamboa da Costa, Gonçalo; Marques, M Matilde; Poirier, Miriam C

    2003-09-15

    The use of the antiestrogen tamoxifen (TAM) is associated with an increase in endometrial cancer. TAM-induced endometrial carcinogenesis may proceed through a genotoxin-mediated pathway, although the detection of endometrial TAM-DNA adducts in exposed women is still controversial. In this study, a monkey model has been used to investigate the question of TAM-DNA adduct formation in primates. Two methods have been used to determine TAM-DNA adducts: a TAM-DNA chemiluminescence immunoassay (TAM-DNA CIA), using an antiserum that has specificity for (E)-alpha-(deoxyguanosin-N(2)-yl)-tamoxifen (dG-TAM) and (E)-alpha-(deoxyguanosin-N(2)-yl)-N-desmethyltamoxifen (dG-desmethyl-TAM) and electrospray ionization tandem mass spectrometry (ES-MS/MS) coupled with on-line sample preparation and high-performance liquid chromatography (HPLC). Mature (19 year old) cynomolgus monkeys were given either vehicle control (n = 1) or TAM (n = 3) twice daily for a total dose of 2 mg of TAM/kg body weight (bw)/day for 30 days by naso-gastric intubation. Tissues were harvested, and DNA was isolated from uterus, ovary, liver, brain cortex, and kidney. By TAM-DNA CIA, values for uterine TAM-DNA adducts in two monkeys were 0.9 and 1.7 adducts/10(8) nucleotides, whereas values for ovarian TAM-DNA adducts in the same animals were 0.4 and 0.5 adducts/10(8) nucleotides. Liver, brain cortex, and kidney DNA samples from the three exposed monkeys had TAM-DNA levels of 2.1-4.2 adducts/10(8) nucleotides, 0.4-5.0 adducts/10(8) nucleotides, and 0.7-2.1 adducts/10(8) nucleotides, respectively. By HPLC-ES-MS/MS, the levels of TAM-DNA adducts detected in all tissues were comparable with those observed by TAM-DNA CIA. Thus, values for uterine TAM-DNA adducts ranged from 0.5 to 1.4 adducts/10(8) nucleotides, whereas values for ovarian TAM-DNA adducts, measurable in two monkeys, were 0.2 and 0.3 adducts/10(8) nucleotides. Liver DNA contained the highest TAM-DNA adduct levels (7.0-11.1 adducts/10(8) nucleotides), whereas brain cortex DNA contained lower adduct levels (0.6-4.8 adducts/10(8) nucleotides) and the lowest levels were measured in the kidney (0.2-0.4 adducts/10(8) nucleotides). This study indicates that cynomolgus monkeys are capable of metabolizing TAM to genotoxic intermediates that form TAM-DNA adducts in multiple tissues.

  12. 40 CFR 174.3 - Definitions.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

  13. 40 CFR 174.3 - Definitions.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

  14. 40 CFR 174.3 - Definitions.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

  15. 40 CFR 174.3 - Definitions.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

  16. 40 CFR 174.3 - Definitions.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

  17. Nucleotide Intermediates in the Biosynthesis of Heteropolymeric Polysaccharides

    PubMed Central

    Strominger, Jack L.

    1964-01-01

    The role of nucleotides as “carriers” of small molecules for biosynthetic reactions is discussed. Following this introduction, the particular problem of nucleotide intermediates in chondroitin sulfate synthesis is presented. The egg shell of the hen contains a form of chondroitin sulfate and particular emphasis is placed on the biosynthesis of sulfated polysaccharides in the hen oviduct, which has been studied in the author's laboratory. ImagesFigure 16Figure 19 PMID:14104074

  18. Conservation of the structure and organization of lupin mitochondrial nad3 and rps12 genes.

    PubMed

    Rurek, M; Oczkowski, M; Augustyniak, H

    1998-01-01

    A high level of the nucleotide sequence conservation of mitochondrial nad3 and rps12 genes was found in four lupin species. The only differences concern three nucleotides in the Lupinus albus rps12 gene and three nucleotides insertion in the L. mutabilis spacer. Northern blot analysis as well as RT-PCR confirmed cotranscription of the L. luteus genes because the transcripts detected were long enough.

  19. The complete nucleotide sequence of the glnALG operon of Escherichia coli K12.

    PubMed Central

    Miranda-Ríos, J; Sánchez-Pescador, R; Urdea, M; Covarrubias, A A

    1987-01-01

    The nucleotide sequence of the E. coli glnALG operon has been determined. The glnL (ntrB) and glnG (ntrC) genes present a high homology, at the nucleotide and aminoacid levels, with the corresponding genes of Klebsiella pneumoniae. The predicted aminoacid sequence for glutamine synthetase allowed us to locate some of the enzyme domains. The structure of this operon is discussed. PMID:2882477

  20. Uncovering drug-responsive regulatory elements

    PubMed Central

    Luizon, Marcelo R; Ahituv, Nadav

    2015-01-01

    Nucleotide changes in gene regulatory elements can have a major effect on interindividual differences in drug response. For example, by reviewing all published pharmacogenomic genome-wide association studies, we show here that 96.4% of the associated single nucleotide polymorphisms reside in noncoding regions. We discuss how sequencing technologies are improving our ability to identify drug response-associated regulatory elements genome-wide and to annotate nucleotide variants within them. We highlight specific examples of how nucleotide changes in these elements can affect drug response and illustrate the techniques used to find them and functionally characterize them. Finally, we also discuss challenges in the field of drug-responsive regulatory elements that need to be considered in order to translate these findings into the clinic. PMID:26555224

  1. Binding constants of phenylalanine for the four mononucleotides

    NASA Technical Reports Server (NTRS)

    Khaled, M. A.; Mullins, D. W., Jr.; Lacey, J. C., Jr.

    1984-01-01

    Earlier work has shown that several properties of amino acids correlate directly with properties of their anticodonic nucleotides. Furthermore, in precipitation studies with thermal proteinoids and homopolyribonucleotides, an anticodonic preference was displayed between Lys-rich, Pro-rich and Gly-rich thermal proteinoids and their anticodonic polyribonucleotides. However, Phe-rich thermal proteinoid displayed a preference for its codonic nucleotide, poly U. This inconsistency seemed to be explained by a folding in of the hydrophobic residues of Phe causing the proteinoid to appear more hydrophilic. The present work used nuclear magnetic resonance techniques to resolve a limited question: to which of the four nucleotides does Phe bind most strongly? The results show quite clearly that Phe binds most strongly to its anticodonic nucleotide, AMP.

  2. The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

    PubMed

    Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

    1982-11-11

    The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

  3. Getting it Right: How DNA Polymerases Select the Right Nucleotide.

    PubMed

    Ludmann, Samra; Marx, Andreas

    2016-01-01

    All living organisms are defined by their genetic code encrypted in their DNA. DNA polymerases are the enzymes that are responsible for all DNA syntheses occurring in nature. For DNA replication, repair and recombination these enzymes have to read the parental DNA and recognize the complementary nucleotide out of a pool of four structurally similar deoxynucleotide triphosphates (dNTPs) for a given template. The selection of the nucleotide is in accordance with the Watson-Crick rule. In this process the accuracy of DNA synthesis is crucial for the maintenance of the genome stability. However, to spur evolution a certain degree of freedom must be allowed. This brief review highlights the mechanistic basis for selecting the right nucleotide by DNA polymerases.

  4. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    PubMed Central

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein. PMID:2798128

  5. Profile of nucleosides and nucleotides in donkey's milk.

    PubMed

    Vincenzetti, Silvia; Pucciarelli, Stefania; Nucci, Chiara; Polzonetti, Valeria; Cammertoni, Natalina; Polidori, Paolo

    2014-01-01

    Nucleotides play a crucial role to cellular functions; they can be obtained from the diet or through the nucleotide salvage pathway, however, in particular situations (occurring mainly in newborns) the metabolic demand of nucleotides exceeds the capacity of their synthesis. These molecules, are receiving attention from a nutraceutical point of view because of their potential direct role in regulating metabolism and infant body condition. Donkey's milk may be considered a good replacer for cow's milk in feeding children with severe Ig-E mediated cow's milk protein allergy, due to its high similarity with human milk. In this study, the presence of cytidine, uridine, CMP, UMP, guanosine, and adenosine, involved in numerous biochemical and physiological activities, were detected for the first time through a RP-HPLC method.

  6. Compositions and methods for detecting single nucleotide polymorphisms

    DOEpatents

    Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

    2016-11-22

    Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

  7. A novel representation of the conformational structure of transfer RNAs. Correlation of the folding patterns of the polynucleotide chain with the base sequence and the nucleotide backbone torsions.

    PubMed Central

    Srinivasan, A R; Yathindra, N

    1977-01-01

    A novel description of the conformational characteristics of all the individual nucleotides and the phosphodiesters in tRNAs is presented in the form of a circular plot. This representation furnishes information of the base sequence with the folding patterns of the polynucleotide chain as one traverses along the circumference and with the individual nucleotide and phosphodiester linkage torsions along the radii. The circular plot obtained for yeast tRNAPhe strikingly distinguishes the helical and the loop regions. The variation of the different nucleotide torsions along the entire chain length and their effect on the secondary helical and tertiary loop regions become readily apparent. PMID:339206

  8. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    PubMed

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the Klenow fragment, and the lesser role of shape selection in insertion by pol eta due to its more open and less constrained active site.

  9. Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

    PubMed Central

    Khan, A S

    1984-01-01

    The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

  10. Lack of Association Between Toll-like Receptor 2 Polymorphisms (R753Q and A-16934T) and Atopic Dermatitis in Children from Thrace Region of Turkey

    PubMed Central

    Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi

    2017-01-01

    Background: Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. Aims: To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Study Design: Case-control study. Methods: The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Results: Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. Conclusion: The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients. PMID:28443596

  11. Lack of Association Between Toll-like Receptor 2 Polymorphisms (R753Q and A-16934T) and Atopic Dermatitis in Children from Thrace Region of Turkey.

    PubMed

    Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi

    2017-05-05

    Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Case-control study. The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients.

  12. Greater numbers of nucleotide substitutions are introduced into the genomic RNA of bovine viral diarrhea virus during acute infections of pregnant cattle than of non-pregnant cattle.

    PubMed

    Neill, John D; Newcomer, Benjamin W; Marley, Shonda D; Ridpath, Julia F; Givens, M Daniel

    2012-08-06

    Bovine viral diarrhea virus (BVDV) strains circulating in livestock herds show significant sequence variation. Conventional wisdom states that most sequence variation arises during acute infections in response to immune or other environmental pressures. A recent study showed that more nucleotide changes were introduced into the BVDV genomic RNA during the establishment of a single fetal persistent infection than following a series of acute infections of naïve cattle. However, it was not known if nucleotide changes were introduce when the virus crossed the placenta and infected the fetus or during the acute infection of the dam. The sequence of the open reading frame (ORF) from viruses isolated from four acutely infected pregnant heifers following exposure to persistently infected (PI) calves was compared to the sequences of the virus from the progenitor PI calf and the virus from the resulting progeny PI calf to determine when genetic change was introduced. This was compared to genetic change found in viruses isolated from a pregnant PI cow and its PI calf, and in three viruses isolated from acutely infected, non-pregnant cattle exposed to PI calves. Most genetic changes previously identified between the progenitor and progeny PI viruses were in place in the acute phase viruses isolated from the dams six days post-exposure to the progenitor PI calf. Additionally, each progeny PI virus had two to three unique nucleotide substitutions that were introduced in crossing the placenta and infection of the fetus. The nucleotide sequence of two acute phase viruses isolated from steers exposed to PI calves revealed that six and seven nucleotide changes were introduced during the acute infection. The sequence of the BVDV-2 virus isolated from an acute infection of a PI calf (BVDV-1a) co-housed with a BVDV-2 PI calf had ten nucleotides that were different from the progenitor PI virus. Finally, twenty nucleotide changes were identified in the PI virus of a calf born to a PI dam. These results demonstrate that nucleotide changes are introduced into the BVDV infecting pregnant cattle at rates of 2.3 to 8 fold higher then during the acute infection of non-pregnant animals.

  13. Mechanism for verification of mismatched and homoduplex DNAs by nucleotides-bound MutS analyzed by molecular dynamics simulations.

    PubMed

    Ishida, Hisashi; Matsumoto, Atsushi

    2016-09-01

    In order to understand how MutS recognizes mismatched DNA and induces the reaction of DNA repair using ATP, the dynamics of the complexes of MutS (bound to the ADP and ATP nucleotides, or not) and DNA (with mismatched and matched base-pairs) were investigated using molecular dynamics simulations. As for DNA, the structure of the base-pairs of the homoduplex DNA which interacted with the DNA recognition site of MutS was intermittently disturbed, indicating that the homoduplex DNA was unstable. As for MutS, the disordered loops in the ATPase domains, which are considered to be necessary for the induction of DNA repair, were close to (away from) the nucleotide-binding sites in the ATPase domains when the nucleotides were (not) bound to MutS. This indicates that the ATPase domains changed their structural stability upon ATP binding using the disordered loop. Conformational analysis by principal component analysis showed that the nucleotide binding changed modes which have structurally solid ATPase domains and the large bending motion of the DNA from higher to lower frequencies. In the MutS-mismatched DNA complex bound to two nucleotides, the bending motion of the DNA at low frequency modes may play a role in triggering the formation of the sliding clamp for the following DNA-repair reaction step. Moreover, MM-PBSA/GBSA showed that the MutS-homoduplex DNA complex bound to two nucleotides was unstable because of the unfavorable interactions between MutS and DNA. This would trigger the ATP hydrolysis or separation of MutS and DNA to continue searching for mismatch base-pairs. Proteins 2016; 84:1287-1303. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  14. Nucleotide, c-di-GMP, c-di-AMP, cGMP, cAMP, (p)ppGpp signaling in bacteria and implications in pathogenesis.

    PubMed

    Kalia, Dimpy; Merey, Gökçe; Nakayama, Shizuka; Zheng, Yue; Zhou, Jie; Luo, Yiling; Guo, Min; Roembke, Benjamin T; Sintim, Herman O

    2013-01-07

    For an organism to survive, it must be able to sense its environment and regulate physiological processes accordingly. Understanding how bacteria integrate signals from various environmental factors and quorum sensing autoinducers to regulate the metabolism of various nucleotide second messengers c-di-GMP, c-di-AMP, cGMP, cAMP and ppGpp, which control several key processes required for adaptation is key for efforts to develop agents to curb bacterial infections. In this review, we provide an update of nucleotide signaling in bacteria and show how these signals intersect or integrate to regulate the bacterial phenotype. The intracellular concentrations of nucleotide second messengers in bacteria are regulated by synthases and phosphodiesterases and a significant number of these metabolism enzymes had been biochemically characterized but it is only in the last few years that the effector proteins and RNA riboswitches, which regulate bacterial physiology upon binding to nucleotides, have been identified and characterized by biochemical and structural methods. C-di-GMP, in particular, has attracted immense interest because it is found in many bacteria and regulate both biofilm formation and virulence factors production. In this review, we discuss how the activities of various c-di-GMP effector proteins and riboswitches are modulated upon c-di-GMP binding. Using V. cholerae, E. coli and B. subtilis as models, we discuss how both environmental factors and quorum sensing autoinducers regulate the metabolism and/or processing of nucleotide second messengers. The chemical syntheses of the various nucleotide second messengers and the use of analogs thereof as antibiofilm or immune modulators are also discussed.

  15. A three-nucleotide helix I is sufficient for full activity of a hammerhead ribozyme: advantages of an asymmetric design.

    PubMed Central

    Tabler, M; Homann, M; Tzortzakaki, S; Sczakiel, G

    1994-01-01

    Trans-cleaving hammerhead ribozymes with long target-specific antisense sequences flanking the catalytic domain share some features with conventional antisense RNA and are therefore termed 'catalytic antisense RNAs'. Sequences 5' to the catalytic domain form helix I and sequences 3' to it form helix III when complexed with the target RNA. A catalytic antisense RNA of more than 400 nucleotides, and specific for the human immunodeficiency virus type 1 (HIV-1), was systematically truncated within the arm that constituted originally a helix I of 128 base pairs. The resulting ribozymes formed helices I of 13, 8, 5, 3, 2, 1 and 0 nucleotides, respectively, and a helix III of about 280 nucleotides. When their in vitro cleavage activity was compared with the original catalytic antisense RNA, it was found that a helix I of as little as three nucleotides was sufficient for full endonucleolytic activity. The catalytically active constructs inhibited HIV-1 replication about four-fold more effectively than the inactive ones when tested in human cells. A conventional hammerhead ribozyme having helices of just 8 nucleotides on either side failed to cleave the target RNA in vitro when tested under the conditions for catalytic antisense RNA. Cleavage activity could only be detected after heat-treatment of the ribozyme substrate mixture which indicates that hammerhead ribozymes with short arms do not associate as efficiently to the target RNA as catalytic antisense RNA. The requirement of just a three-nucleotide helix I allows simple PCR-based generation strategies for asymmetric hammerhead ribozymes. Advantages of an asymmetric design will be discussed. Images PMID:7937118

  16. Effects of nucleotide supplementation in milk replacer on small intestinal absorptive capacity in dairy calves.

    PubMed

    Kehoe, S I; Heinrichs, A J; Baumrucker, C R; Greger, D L

    2008-07-01

    Milk replacer was supplemented with nucleotides and fed to dairy calves from birth through weaning to examine the potential for enhancing recovery of small intestinal function after enteric infection. Three treatments of 23 calves each were fed milk replacer (10% body weight/d) supplemented with no nucleotides (C), purified nucleotides (N), or nucleotides from an extract of Saccharomyces cerevisiae (S). Average daily gain, health scores, fecal dry matter, and fecal bacteria were monitored, and blood was analyzed for packed cell volume, glucose, blood urea nitrogen (BUN), and creatinine. Calves were monitored twice daily for fecal score, and 48 h after increased fecal fluidity was recorded, intestinal function was evaluated by measuring absorption of orally administered xylose (0.5 g/kg of body weight). Packed cell volume of blood was greater for treatment N for wk 2 and 5 compared with other treatment groups. Four calves per treatment were killed, and intestinal tissue was evaluated for morphology, enzyme activities, and nucleoside transporter mRNA expression. Treatment S calves had increased abundance of nucleoside transporter mRNA, numerically longer villi, and lower alkaline phosphatase than other groups. Growth measurements and plasma concentrations of glucose, BUN, creatinine, and IgG were not different between treatments; however, BUN-to-creatinine ratio was higher for treatment N, possibly indicating decreased kidney function. There were also no treatment effects on fecal dry matter and fecal bacteria population. However, N-treated calves had the highest detrimental and lowest beneficial bacteria overall, indicating an unfavorable intestinal environment. Supplementation of purified nucleotides did not improve intestinal morphology or function and resulted in higher fecal water loss and calf dehydration. Supplementation of nucleotides derived from yeast tended to increase calf intestinal function, provide a more beneficial intestinal environment, and improve intestinal morphology.

  17. OmpF, a nucleotide-sensing nanoprobe, computational evaluation of single channel activities

    NASA Astrophysics Data System (ADS)

    Abdolvahab, R. H.; Mobasheri, H.; Nikouee, A.; Ejtehadi, M. R.

    2016-09-01

    The results of highthroughput practical single channel experiments should be formulated and validated by signal analysis approaches to increase the recognition precision of translocating molecules. For this purpose, the activities of the single nano-pore forming protein, OmpF, in the presence of nucleotides were recorded in real time by the voltage clamp technique and used as a means for nucleotide recognition. The results were analyzed based on the permutation entropy of current Time Series (TS), fractality, autocorrelation, structure function, spectral density, and peak fraction to recognize each nucleotide, based on its signature effect on the conductance, gating frequency and voltage sensitivity of channel at different concentrations and membrane potentials. The amplitude and frequency of ion current fluctuation increased in the presence of Adenine more than Cytosine and Thymine in milli-molar (0.5 mM) concentrations. The variance of the current TS at various applied voltages showed a non-monotonic trend whose initial increasing slope in the presence of Thymine changed to a decreasing one in the second phase and was different from that of Adenine and Cytosine; e.g., by increasing the voltage from 40 to 140 mV in the 0.5 mM concentration of Adenine or Cytosine, the variance decreased by one third while for the case of Thymine it was doubled. Moreover, according to the structure function of TS, the fractality of current TS differed as a function of varying membrane potentials (pd) and nucleotide concentrations. Accordingly, the calculated permutation entropy of the TS, validated the biophysical approach defined for the recognition of different nucleotides at various concentrations, pd's and polarities. Thus, the promising outcomes of the combined experimental and theoretical methodologies presented here can be implemented as a complementary means in pore-based nucleotide recognition approaches.

  18. Extracellular nucleotides potentiate the cytosolic Ca2+, but not cyclic adenosine 3', 5'-monophosphate response to parathyroid hormone in rat osteoblastic cells.

    PubMed

    Kaplan, A D; Reimer, W J; Feldman, R D; Dixon, S J

    1995-04-01

    Binding to PTH to its cell surface receptor activates both adenylyl cyclase and phospholipase-C, leading to elevation of cytosolic cAMP and free Ca2+. We have shown previously that extracellular nucleotides interact with P2U and P2Y subtypes of purinoceptor on osteoblastic cells, both linked to Ca2+ mobilization. In the present study, we investigated possible interactions between nucleotide and PTH signaling pathways in osteoblastic cells. The cytosolic free Ca2+ concentration ([Ca2+]i) of UMR-106 osteoblastic cells was monitored by fluorescence spectrophotometry. PTH (0.01-1 microM; bovine 1-84 or human 1-34) induced a small transient elevation of [Ca2+]i, lasting less than 1 min. A number of nucleotides, including ATP, UTP, and UDP, induced transient elevation of [Ca2+]i and potentiated the subsequent Ca2+ response to PTH. Of the nucleotides tested, UDP was the most effective at potentiating the PTH-induced Ca2+ transient. Treatment of cells with UDP (100 microM for 2.5 min), but not inorganic phosphate or uridine, reversibly potentiated the Ca2+ response to PTH (0.1 microM) by 11 +/- 2-fold (mean +/- SEM; n = 39). In contrast, UDP did not affect the cAMP response to PTH, indicating a selective action on Ca2+ signaling. Potentiation of the Ca2+ signal was still observed in the absence of extracellular Ca2+, establishing that nucleotides enhance PTH-induced release of Ca2+ from intracellular stores. Studies using selective purinoceptor agonists suggest that potentiation of PTH signaling is mediated by the P2U receptor subtype. In vivo, nucleotides released during trauma or inflammation may modulate PTH-induced Ca2+ signaling in osteoblasts.

  19. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    PubMed

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  20. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

    PubMed Central

    Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

  1. Improved prediction of biochemical recurrence after radical prostatectomy by genetic polymorphisms.

    PubMed

    Morote, Juan; Del Amo, Jokin; Borque, Angel; Ars, Elisabet; Hernández, Carlos; Herranz, Felipe; Arruza, Antonio; Llarena, Roberto; Planas, Jacques; Viso, María J; Palou, Joan; Raventós, Carles X; Tejedor, Diego; Artieda, Marta; Simón, Laureano; Martínez, Antonio; Rioja, Luis A

    2010-08-01

    Single nucleotide polymorphisms are inherited genetic variations that can predispose or protect individuals against clinical events. We hypothesized that single nucleotide polymorphism profiling may improve the prediction of biochemical recurrence after radical prostatectomy. We performed a retrospective, multi-institutional study of 703 patients treated with radical prostatectomy for clinically localized prostate cancer who had at least 5 years of followup after surgery. All patients were genotyped for 83 prostate cancer related single nucleotide polymorphisms using a low density oligonucleotide microarray. Baseline clinicopathological variables and single nucleotide polymorphisms were analyzed to predict biochemical recurrence within 5 years using stepwise logistic regression. Discrimination was measured by ROC curve AUC, specificity, sensitivity, predictive values, net reclassification improvement and integrated discrimination index. The overall biochemical recurrence rate was 35%. The model with the best fit combined 8 covariates, including the 5 clinicopathological variables prostate specific antigen, Gleason score, pathological stage, lymph node involvement and margin status, and 3 single nucleotide polymorphisms at the KLK2, SULT1A1 and TLR4 genes. Model predictive power was defined by 80% positive predictive value, 74% negative predictive value and an AUC of 0.78. The model based on clinicopathological variables plus single nucleotide polymorphisms showed significant improvement over the model without single nucleotide polymorphisms, as indicated by 23.3% net reclassification improvement (p = 0.003), integrated discrimination index (p <0.001) and likelihood ratio test (p <0.001). Internal validation proved model robustness (bootstrap corrected AUC 0.78, range 0.74 to 0.82). The calibration plot showed close agreement between biochemical recurrence observed and predicted probabilities. Predicting biochemical recurrence after radical prostatectomy based on clinicopathological data can be significantly improved by including patient genetic information. Copyright (c) 2010 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  2. Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

    PubMed Central

    Villahermosa, Desirée; Christensen, Olaf; Knapp, Karen; Fleck, Oliver

    2017-01-01

    Defective mismatch repair (MMR) in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6), which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1), which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3) recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes. PMID:28341698

  3. Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats.

    PubMed

    Villahermosa, Desirée; Christensen, Olaf; Knapp, Karen; Fleck, Oliver

    2017-05-05

    Defective mismatch repair (MMR) in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6), which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1), which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3) recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade + reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2 FEN1 Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe , but contributes to DNA repeat stability in MMR-independent processes. Copyright © 2017 Villahermosa et al.

  4. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    PubMed

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily adapted to novel NGS assays. Examples, tutorials, and extensive documentation can be found at https://plastid.readthedocs.io .

  5. Engineering Nucleotide Specificity of Succinyl-CoA Synthetase in Blastocystis: The Emerging Role of Gatekeeper Residues.

    PubMed

    Vashisht, Kapil; Verma, Sonia; Gupta, Sunita; Lynn, Andrew M; Dixit, Rajnikant; Mishra, Neelima; Valecha, Neena; Hamblin, Karleigh A; Maytum, Robin; Pandey, Kailash C; van der Giezen, Mark

    2017-01-24

    Charged, solvent-exposed residues at the entrance to the substrate binding site (gatekeeper residues) produce electrostatic dipole interactions with approaching substrates, and control their access by a novel mechanism called "electrostatic gatekeeper effect". This proof-of-concept study demonstrates that the nucleotide specificity can be engineered by altering the electrostatic properties of the gatekeeper residues outside the binding site. Using Blastocystis succinyl-CoA synthetase (SCS, EC 6.2.1.5), we demonstrated that the gatekeeper mutant (ED) resulted in ATP-specific SCS to show high GTP specificity. Moreover, nucleotide binding site mutant (LF) had no effect on GTP specificity and remained ATP-specific. However, via combination of the gatekeeper mutant with the nucleotide binding site mutant (ED+LF), a complete reversal of nucleotide specificity was obtained with GTP, but no detectable activity was obtained with ATP. This striking result of the combined mutant (ED+LF) was due to two changes; negatively charged gatekeeper residues (ED) favored GTP access, and nucleotide binding site residues (LF) altered ATP binding, which was consistent with the hypothesis of the "electrostatic gatekeeper effect". These results were further supported by molecular modeling and simulation studies. Hence, it is imperative to extend the strategy of the gatekeeper effect in a different range of crucial enzymes (synthetases, kinases, and transferases) to engineer substrate specificity for various industrial applications and substrate-based drug design.

  6. Rapid incorporation kinetics and improved fidelity of a novel class of 3'-OH unblocked reversible terminators.

    PubMed

    Gardner, Andrew F; Wang, Jinchun; Wu, Weidong; Karouby, Jennifer; Li, Hong; Stupi, Brian P; Jack, William E; Hersh, Megan N; Metzker, Michael L

    2012-08-01

    Recent developments of unique nucleotide probes have expanded our understanding of DNA polymerase function, providing many benefits to techniques involving next-generation sequencing (NGS) technologies. The cyclic reversible termination (CRT) method depends on efficient base-selective incorporation of reversible terminators by DNA polymerases. Most terminators are designed with 3'-O-blocking groups but are incorporated with low efficiency and fidelity. We have developed a novel class of 3'-OH unblocked nucleotides, called Lightning Terminators™, which have a terminating 2-nitrobenzyl moiety attached to hydroxymethylated nucleobases. A key structural feature of this photocleavable group displays a 'molecular tuning' effect with respect to single-base termination and improved nucleotide fidelity. Using Therminator DNA polymerase, we demonstrate that these 3'-OH unblocked terminators exhibit superior enzymatic performance compared to two other reversible terminators, 3'-O-amino-TTP and 3'-O-azidomethyl-TTP. Lightning Terminators show maximum incorporation rates (k(pol)) that range from 35 to 45 nt/s, comparable to the fastest NGS chemistries, yet with catalytic efficiencies (k(pol)/K(D)) comparable to natural nucleotides. Pre-steady-state kinetic studies of thymidine analogs revealed that the major determinant for improved nucleotide selectivity is a significant reduction in k(pol) by >1000-fold over TTP misincorporation. These studies highlight the importance of structure-function relationships of modified nucleotides in dictating polymerase performance.

  7. Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

    PubMed Central

    Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

    2016-01-01

    Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

  8. Prokaryotic nucleotide composition is shaped by both phylogeny and the environment.

    PubMed

    Reichenberger, Erin R; Rosen, Gail; Hershberg, Uri; Hershberg, Ruth

    2015-04-09

    The causes of the great variation in nucleotide composition of prokaryotic genomes have long been disputed. Here, we use extensive metagenomic and whole-genome data to demonstrate that both phylogeny and the environment shape prokaryotic nucleotide content. We show that across environments, various phyla are characterized by different mean guanine and cytosine (GC) values as well as by the extent of variation on that mean value. At the same time, we show that GC-content varies greatly as a function of environment, in a manner that cannot be entirely explained by disparities in phylogenetic composition. We find environmentally driven differences in nucleotide content not only between highly diverged environments (e.g., soil, vs. aquatic vs. human gut) but also within a single type of environment. More specifically, we demonstrate that some human guts are associated with a microbiome that is consistently more GC-rich across phyla, whereas others are associated with a more AT-rich microbiome. These differences appear to be driven both by variations in phylogenetic composition and by environmental differences-which are independent of these phylogenetic composition differences. Combined, our results demonstrate that both phylogeny and the environment significantly affect nucleotide composition and that the environmental differences affecting nucleotide composition are far subtler than previously appreciated. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. Structure-Function Model for Kissing Loop Interactions That Initiate Dimerization of Ty1 RNA

    PubMed Central

    Gamache, Eric R.; Doh, Jung H.; Ritz, Justin; Laederach, Alain; Bellaousov, Stanislav; Mathews, David H.; Curcio, M. Joan

    2017-01-01

    The genomic RNA of the retrotransposon Ty1 is packaged as a dimer into virus-like particles. The 5′ terminus of Ty1 RNA harbors cis-acting sequences required for translation initiation, packaging and initiation of reverse transcription (TIPIRT). To identify RNA motifs involved in dimerization and packaging, a structural model of the TIPIRT domain in vitro was developed from single-nucleotide resolution RNA structural data. In general agreement with previous models, the first 326 nucleotides of Ty1 RNA form a pseudoknot with a 7-bp stem (S1), a 1-nucleotide interhelical loop and an 8-bp stem (S2) that delineate two long, structured loops. Nucleotide substitutions that disrupt either pseudoknot stem greatly reduced helper-Ty1-mediated retrotransposition of a mini-Ty1, but only mutations in S2 destabilized mini-Ty1 RNA in cis and helper-Ty1 RNA in trans. Nested in different loops of the pseudoknot are two hairpins with complementary 7-nucleotide motifs at their apices. Nucleotide substitutions in either motif also reduced retrotransposition and destabilized mini- and helper-Ty1 RNA. Compensatory mutations that restore base-pairing in the S2 stem or between the hairpins rescued retrotransposition and RNA stability in cis and trans. These data inform a model whereby a Ty1 RNA kissing complex with two intermolecular kissing-loop interactions initiates dimerization and packaging. PMID:28445416

  10. The ribokinases of Arabidopsis thaliana and Saccharomyces cerevisiae are required for ribose recycling from nucleotide catabolism, which in plants is not essential to survive prolonged dark stress.

    PubMed

    Schroeder, Rebekka Y; Zhu, Anting; Eubel, Holger; Dahncke, Kathleen; Witte, Claus-Peter

    2018-01-01

    Nucleotide catabolism in Arabidopsis thaliana and Saccharomyces cerevisiae leads to the release of ribose, which requires phosphorylation to ribose-5-phosphate mediated by ribokinase (RBSK). We aimed to characterize RBSK in plants and yeast, to quantify the contribution of plant nucleotide catabolism to the ribose pool, and to investigate whether ribose carbon contributes to dark stress survival of plants. We performed a phylogenetic analysis and determined the kinetic constants of plant-expressed Arabidopsis and yeast RBSKs. Using mass spectrometry, several metabolites were quantified in AtRBSK mutants and double mutants with genes of nucleoside catabolism. Additionally, the dark stress performance of several nucleotide metabolism mutants and rbsk was compared. The plant PfkB family of sugar kinases forms nine major clades likely representing distinct biochemical functions, one of them RBSK. Nucleotide catabolism is the dominant ribose source in plant metabolism and is highly induced by dark stress. However, rbsk cannot be discerned from the wild type in dark stress. Interestingly, the accumulation of guanosine in a guanosine deaminase mutant strongly enhances dark stress symptoms. Although nucleotide catabolism contributes to carbon mobilization upon darkness and is the dominant source of ribose, the contribution appears to be of minor importance for dark stress survival. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  11. Length requirements for tRNA-specific enzymes and cleavage specificity at the 3' end of turnip yellow mosaic virus RNA.

    PubMed Central

    Joshi, S; Chapeville, F; Haenni, A L

    1982-01-01

    This paper describes the minimum length of the turnip yellow mosaic virus (TYMV) RNA necessary to fulfill the tRNA-like properties of the viral RNA: 50 to 75 nucleotides and 86 nucleotides from the 3' end of TYMV RNA are sufficient for adenylation and valylation respectively by the Escherichia coli system. The size of the tRNA-like fragments obtained in vitro in the presence of an E. coli, a reticulocyte or a chinese cabbage leaf extract has also been determined. Among the major fragments liberated from the 3' end of TYMV RNA by the three systems are fragments of 117 and 112 nucleotides. In addition, the E. coli extract liberates fragments of 139 and 61 nucleotides, and the reticulocyte lysate fragments of 109, 94, 84, 73 and 46 nucleotides. The cleavage of the viral RNA by several systems in vitro to yield RNA fragments encompassing the tRNA-like sequence suggests that such fragments might also be liberated in vivo. Images PMID:6176943

  12. [Meta-analysis on relationship between single nucleotide polymorphism of rs2231142 in ABCG2 gene and gout in East Asian population].

    PubMed

    Wu, Lei; He, Yao; Zhang, Di

    2015-11-01

    To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.

  13. A nucleotide substitution responsible for the tawny coat color mutation carried by the MSKR inbred strain of mice.

    PubMed

    Wada, A; Kunieda, T; Nishimura, M; Kakizoe-Ishida, Y; Watanabe, N; Ohkawa, K; Tsudzuki, M

    2005-01-01

    "Tawny" is an autosomal recessive coat color mutation found in a wild population of Mus musculus molossinus. The inbred strain MSKR carries the mutation. The causative gene Mc1r(taw) of the tawny phenotype is the second recessive allele at the melanocortin 1 receptor locus and is dominant to the first recessive allele, "recessive yellow" (Mc1r(e)). The Mc1r(taw) gene has six nucleotide substitutions, and its forecasted transcript has three amino acid substitutions (i.e., V101A, V216A, W252C). Though the nucleotide substitutions leading to V101A and V216A exist in various mouse strains, the nucleotide substitution leading to W252C exists in only tawny-colored mice. Thus this substitution is considered to be responsible for the expression of the tawny coat color. The frequency of the allele having this nucleotide substitution was 9.21% in the wild M. m. molossinus population inhabiting Sakai City, Osaka Prefecture, Japan, where the ancestral mice of the MSKR strain were captured.

  14. Nucleotide excision repair by dual incisions in plants.

    PubMed

    Canturk, Fazile; Karaman, Muhammet; Selby, Christopher P; Kemp, Michael G; Kulaksiz-Erkmen, Gulnihal; Hu, Jinchuan; Li, Wentao; Lindsey-Boltz, Laura A; Sancar, Aziz

    2016-04-26

    Plants use light for photosynthesis and for various signaling purposes. The UV wavelengths in sunlight also introduce DNA damage in the form of cyclobutane pyrimidine dimers (CPDs) and pyrimidine (6-4) pyrimidone photoproducts [(6-4)PPs] that must be repaired for the survival of the plant. Genome sequencing has revealed the presence of genes for both CPD and (6-4)PP photolyases, as well as genes for nucleotide excision repair in plants, such as Arabidopsis and rice. Plant photolyases have been purified, characterized, and have been shown to play an important role in plant survival. In contrast, even though nucleotide excision repair gene homologs have been found in plants, the mechanism of nucleotide excision repair has not been investigated. Here we used the in vivo excision repair assay developed in our laboratory to demonstrate that Arabidopsis removes CPDs and (6-4)PPs by a dual-incision mechanism that is essentially identical to the mechanism of dual incisions in humans and other eukaryotes, in which oligonucleotides with a mean length of 26-27 nucleotides are removed by incising ∼20 phosphodiester bonds 5' and 5 phosphodiester bonds 3' to the photoproduct.

  15. Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poat, J.A.; Cripps, H.E.; Iversen, L.L.

    1988-05-01

    Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

  16. A fluorimetric readout reporting the kinetics of nucleotide-induced human ribonucleotide reductase oligomerization.

    PubMed

    Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A; Aye, Yimon

    2014-11-24

    Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typically trigger α-dimerization. Currently, both knowledge of and tools to interrogate the oligomeric assembly pathway of RNR in any species in real time are lacking. We therefore developed a fluorimetric assay that reliably reports on oligomeric state changes of α with high sensitivity. The oligomerization-directed fluorescence quenching of hRNR-α, covalently labeled with two fluorophores, allows for direct readout of hRNR dimeric and hexameric states. We applied the newly developed platform to reveal the timescales of α self-assembly, driven by the feedback regulator dATP. This information is currently unavailable, despite the pharmaceutical relevance of hRNR oligomeric regulation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Origin of the polymorphism of the involucrin gene in Asians.

    PubMed Central

    Djian, P; Delhomme, B; Green, H

    1995-01-01

    The involucrin gene, encoding a protein of the terminally differentiated keratinocyte, is polymorphic in the human. There is polymorphism of marker nucleotides a two positions in the coding region, and there are over eight polymorphic forms based on the number and kind of 10-codon tandem repeats in that part of the coding region most recently added in the human lineage. The involucrin alleles of Caucasians and Africans differ in both nucleotides and repeat patterns. We show that the involucrin alleles of East Asians (Chinese and Japanese) can be divided into two populations according to whether they possess the two marker nucleotides typical of Africans or Caucasians. The Asian population bearing Caucasian-type marker nucleotides has repeat patterns similar to those of Caucasians, whereas Asians bearing African-type marker nucleotides have repeat patterns that resemble those of Africans more than those of Caucasians. The existence of two populations of East Asian involucrin alleles gives support for the existence of a Eurasian stem lineage from which Caucasians and a part of the Asian population originated. PMID:7762559

  18. Mumps Hoshino and Torii vaccine strains were distinguished from circulating wild strains.

    PubMed

    Sawada, Akihito; Yamaji, Yoshiaki; Nakayama, Tetsuo

    2013-06-01

    Aseptic meningitis and acute parotitis have been observed after mumps vaccination. Mumps outbreaks have been reported in Japan because of low vaccine coverage, and molecular differentiation is required to determine whether these cases are vaccine associated. RT-nested PCR was performed in the small hydrophobic gene region, and viruses were differentiated by restriction fragment length polymorphism assay. A total of 584 nucleotides were amplified. The PCR product of the Hoshino strain was cut into two fragments (313 and 271 nucleotides) by MfeI; that of the Torii strain was digested with EcoT22I, resulting in 332- and 252-nucleotide fragments. Both strains were genotype B and had an XbaI site, resulting in two fragments: 299 and 285 nucleotides. Current circulating wild types were cut only by XbaI or MfeI. However, the MfeI site of the wild types was different from that of the Hoshino strain, resulting in 451- and 133-nucleotide fragments. Using three restriction enzymes, two mumps vaccine strains were distinguished from wild types, and this separation was applied to the identification of vaccine-related adverse events.

  19. Purine metabolism in Toxoplasma gondii

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krug, E.C.; Marr, J.J.; Berens, R.L.

    1989-06-25

    We have studied the incorporation and interconversion of purines into nucleotides by freshly isolated Toxoplasma gondii. They did not synthesize nucleotides from formate, glycine, or serine. The purine bases hypoxanthine, xanthine, guanine, and adenine were incorporated at 9.2, 6.2, 5.1, and 4.3 pmol/10(7) cells/h, respectively. The purine nucleosides adenosine, inosine, guanosine, and xanthosine were incorporated at 110, 9.0, 2.7, and 0.3 pmol/10(7) cells/h, respectively. Guanine, xanthine, and their respective nucleosides labeled only guanine nucleotides. Inosine, hypoxanthine, and adenine labeled both adenine and guanine nucleotide pools at nearly equal ratios. Adenosine kinase was greater than 10-fold more active than the nextmore » most active enzyme in vitro. This is consistent with the metabolic data in vivo. No other nucleoside kinase or phosphotransferase activities were found. Phosphorylase activities were detected for guanosine and inosine; no other cleavage activities were detected. Deaminases were found for adenine and guanine. Phosphoribosyltransferase activities were detected for all four purine nucleobases. Interconversion occurs only in the direction of adenine to guanine nucleotides.« less

  20. CNTNAP2 Is Significantly Associated With Speech Sound Disorder in the Chinese Han Population.

    PubMed

    Zhao, Yun-Jing; Wang, Yue-Ping; Yang, Wen-Zhu; Sun, Hong-Wei; Ma, Hong-Wei; Zhao, Ya-Ru

    2015-11-01

    Speech sound disorder is the most common communication disorder. Some investigations support the possibility that the CNTNAP2 gene might be involved in the pathogenesis of speech-related diseases. To investigate single-nucleotide polymorphisms in the CNTNAP2 gene, 300 unrelated speech sound disorder patients and 200 normal controls were included in the study. Five single-nucleotide polymorphisms were amplified and directly sequenced. Significant differences were found in the genotype (P = .0003) and allele (P = .0056) frequencies of rs2538976 between patients and controls. The excess frequency of the A allele in the patient group remained significant after Bonferroni correction (P = .0280). A significant haplotype association with rs2710102T/+rs17236239A/+2538976A/+2710117A (P = 4.10e-006) was identified. A neighboring single-nucleotide polymorphism, rs10608123, was found in complete linkage disequilibrium with rs2538976, and the genotypes exactly corresponded to each other. The authors propose that these CNTNAP2 variants increase the susceptibility to speech sound disorder. The single-nucleotide polymorphisms rs10608123 and rs2538976 may merge into one single-nucleotide polymorphism. © The Author(s) 2015.

  1. DNA Nucleotides Detection via capacitance properties of Graphene

    NASA Astrophysics Data System (ADS)

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

    2016-05-01

    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  2. Statistical properties of the Jukes-Holmquist method of estimating the number of nucleotide substitutions: reply to Holmquist and Conroy's criticism.

    PubMed

    Nei, M; Tateno, Y

    1981-01-01

    Conducting computer simulations, Nei and Tateno (1978) have shown that Jukes and Holmquist's (1972) method of estimating the number of nucleotide substitutions tends to give an overestimate and the estimate obtained has a large variance. Holmquist and Conroy (1980) repeated some parts of our simulation and claim that the overestimation of nucleotide substitutions in our paper occurred mainly because we used selected data. Examination of Holmquist and Conroy's simulation indicates that their results are essentially the same as ours when the Jukes-Holmquist method is used, but since they used a different method of computation their estimates of nucleotide substitutions differed substantially from ours. Another problem in Holmquist and Conroy's Letter is that they confused the expected number of nucleotide substitution with the number in a sample. This confusion has resulted in a number of unnecessary arguments. They also criticized our X2 measure, but this criticism is apparently due to a misunderstanding of the assumptions of our method and a failure to use our method in the way we described. We believe that our earlier conclusions remain unchanged.

  3. Defining the mRNA recognition signature of a bacterial toxin protein

    DOE PAGES

    Schureck, Marc A.; Dunkle, Jack A.; Maehigashi, Tatsuya; ...

    2015-10-27

    Bacteria contain multiple type II toxins that selectively degrade mRNAs bound to the ribosome to regulate translation and growth and facilitate survival during the stringent response. Ribosome-dependent toxins recognize a variety of three-nucleotide codons within the aminoacyl (A) site, but how these endonucleases achieve substrate specificity remains poorly understood. In this paper, we identify the critical features for how the host inhibition of growth B (HigB) toxin recognizes each of the three A-site nucleotides for cleavage. X-ray crystal structures of HigB bound to two different codons on the ribosome illustrate how HigB uses a microbial RNase-like nucleotide recognition loop tomore » recognize either cytosine or adenosine at the second A-site position. Strikingly, a single HigB residue and 16S rRNA residue C1054 form an adenosine-specific pocket at the third A-site nucleotide, in contrast to how tRNAs decode mRNA. Finally, our results demonstrate that the most important determinant for mRNA cleavage by ribosome-dependent toxins is interaction with the third A-site nucleotide.« less

  4. Phosphorothioate backbone modifications of nucleotide-based drugs are potent platelet activators

    PubMed Central

    Flierl, Ulrike; Nero, Tracy L.; Lim, Bock; Arthur, Jane F.; Yao, Yu; Jung, Stephanie M.; Gitz, Eelo; Pollitt, Alice Y.; Zaldivia, Maria T.K.; Jandrot-Perrus, Martine; Schäfer, Andreas; Nieswandt, Bernhard; Andrews, Robert K.; Parker, Michael W.; Gardiner, Elizabeth E.

    2015-01-01

    Nucleotide-based drug candidates such as antisense oligonucleotides, aptamers, immunoreceptor-activating nucleotides, or (anti)microRNAs hold great therapeutic promise for many human diseases. Phosphorothioate (PS) backbone modification of nucleotide-based drugs is common practice to protect these promising drug candidates from rapid degradation by plasma and intracellular nucleases. Effects of the changes in physicochemical properties associated with PS modification on platelets have not been elucidated so far. Here we report the unexpected binding of PS-modified oligonucleotides to platelets eliciting strong platelet activation, signaling, reactive oxygen species generation, adhesion, spreading, aggregation, and thrombus formation in vitro and in vivo. Mechanistically, the platelet-specific receptor glycoprotein VI (GPVI) mediates these platelet-activating effects. Notably, platelets from GPVI function–deficient patients do not exhibit binding of PS-modified oligonucleotides, and platelet activation is fully abolished. Our data demonstrate a novel, unexpected, PS backbone–dependent, platelet-activating effect of nucleotide-based drug candidates mediated by GPVI. This unforeseen effect should be considered in the ongoing development programs for the broad range of upcoming and promising DNA/RNA therapeutics. PMID:25646267

  5. Defining the mRNA recognition signature of a bacterial toxin protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schureck, Marc A.; Dunkle, Jack A.; Maehigashi, Tatsuya

    Bacteria contain multiple type II toxins that selectively degrade mRNAs bound to the ribosome to regulate translation and growth and facilitate survival during the stringent response. Ribosome-dependent toxins recognize a variety of three-nucleotide codons within the aminoacyl (A) site, but how these endonucleases achieve substrate specificity remains poorly understood. In this paper, we identify the critical features for how the host inhibition of growth B (HigB) toxin recognizes each of the three A-site nucleotides for cleavage. X-ray crystal structures of HigB bound to two different codons on the ribosome illustrate how HigB uses a microbial RNase-like nucleotide recognition loop tomore » recognize either cytosine or adenosine at the second A-site position. Strikingly, a single HigB residue and 16S rRNA residue C1054 form an adenosine-specific pocket at the third A-site nucleotide, in contrast to how tRNAs decode mRNA. Finally, our results demonstrate that the most important determinant for mRNA cleavage by ribosome-dependent toxins is interaction with the third A-site nucleotide.« less

  6. The Arabidopsis Golgi-localized GDP-L-fucose transporter is required for plant development

    DOE PAGES

    Rautengarten, Carsten; Ebert, Berit; Liu, Lifeng; ...

    2016-07-06

    Nucleotide sugar transport across Golgi membranes is essential for the luminal biosynthesis of glycan structures. Here we identify GDP-fucose transporter 1 (GFT1), an Arabidopsis nucleotide sugar transporter that translocates GDP-L-fucose into the Golgi lumen. Using proteo-liposome-based transport assays, we show that GFT preferentially transports GDP-L-fucose over other nucleotide sugars in vitro, while GFT1-silenced plants are almost devoid of L-fucose in cell wall-derived xyloglucan and rhamnogalacturonan II. Furthermore, these lines display reduced L-fucose content in N-glycan structures accompanied by severe developmental growth defects. We conclude that GFT1 is the major nucleotide sugar transporter for import of GDP-L-fucose into the Golgi andmore » is required for proper plant growth and development.« less

  7. The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

    PubMed Central

    Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

    1982-01-01

    The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%). PMID:6891053

  8. The Arabidopsis Golgi-localized GDP-L-fucose transporter is required for plant development

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rautengarten, Carsten; Ebert, Berit; Liu, Lifeng

    Nucleotide sugar transport across Golgi membranes is essential for the luminal biosynthesis of glycan structures. Here we identify GDP-fucose transporter 1 (GFT1), an Arabidopsis nucleotide sugar transporter that translocates GDP-L-fucose into the Golgi lumen. Using proteo-liposome-based transport assays, we show that GFT preferentially transports GDP-L-fucose over other nucleotide sugars in vitro, while GFT1-silenced plants are almost devoid of L-fucose in cell wall-derived xyloglucan and rhamnogalacturonan II. Furthermore, these lines display reduced L-fucose content in N-glycan structures accompanied by severe developmental growth defects. We conclude that GFT1 is the major nucleotide sugar transporter for import of GDP-L-fucose into the Golgi andmore » is required for proper plant growth and development.« less

  9. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  10. Updating Our View of Organelle Genome Nucleotide Landscape

    PubMed Central

    Smith, David Roy

    2012-01-01

    Organelle genomes show remarkable variation in architecture and coding content, yet their nucleotide composition is relatively unvarying across the eukaryotic domain, with most having a high adenine and thymine (AT) content. Recent studies, however, have uncovered guanine and cytosine (GC)-rich mitochondrial and plastid genomes. These sequences come from a small but eclectic list of species, including certain green plants and animals. Here, I review GC-rich organelle DNAs and the insights they have provided into the evolution of nucleotide landscape. I emphasize that GC-biased mitochondrial and plastid DNAs are more widespread than once thought, sometimes occurring together in the same species, and suggest that the forces biasing their nucleotide content can differ both among and within lineages, and may be associated with specific genome architectural features and life history traits. PMID:22973299

  11. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    PubMed Central

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

    1972-01-01

    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  12. Some parameters relevant to affinity chromatography on immobilized nucleotides

    PubMed Central

    Lowe, C. R.; Harvey, M. J.; Craven, D. B.; Dean, P. D. G.

    1973-01-01

    1. The suitability of cellulose and Sepharose as supports for affinity chromatography of two groups of cofactor-linked enzymes, dehydrogenases and kinases, was examined. Sepharose was found to be superior. 2. The selective capacities of the columns were measured by frontal analysis and are discussed in relation to the nucleotide contents. 3. The effect of various concentrations of enzyme and of non-specific protein on the performance of the affinity columns, and the effects of equilibration time, flow rate, sample volume and dilution of the nucleotide were examined. 4. The effect of interposing polymethylene and polyglycine extension arms between the matrix backbone and the nucleotide was investigated for several cofactor-dependent enzymes. Maximum binding was observed with an extension arm 0.8–1nm long. PMID:4354739

  13. The Arabidopsis Golgi-localized GDP-L-fucose transporter is required for plant development

    PubMed Central

    Rautengarten, Carsten; Ebert, Berit; Liu, Lifeng; Stonebloom, Solomon; Smith-Moritz, Andreia M.; Pauly, Markus; Orellana, Ariel; Scheller, Henrik Vibe; Heazlewood, Joshua L.

    2016-01-01

    Nucleotide sugar transport across Golgi membranes is essential for the luminal biosynthesis of glycan structures. Here we identify GDP-fucose transporter 1 (GFT1), an Arabidopsis nucleotide sugar transporter that translocates GDP-L-fucose into the Golgi lumen. Using proteo-liposome-based transport assays, we show that GFT preferentially transports GDP-L-fucose over other nucleotide sugars in vitro, while GFT1-silenced plants are almost devoid of L-fucose in cell wall-derived xyloglucan and rhamnogalacturonan II. Furthermore, these lines display reduced L-fucose content in N-glycan structures accompanied by severe developmental growth defects. We conclude that GFT1 is the major nucleotide sugar transporter for import of GDP-L-fucose into the Golgi and is required for proper plant growth and development. PMID:27381418

  14. The Arabidopsis Golgi-localized GDP-L-fucose transporter is required for plant development.

    PubMed

    Rautengarten, Carsten; Ebert, Berit; Liu, Lifeng; Stonebloom, Solomon; Smith-Moritz, Andreia M; Pauly, Markus; Orellana, Ariel; Scheller, Henrik Vibe; Heazlewood, Joshua L

    2016-07-06

    Nucleotide sugar transport across Golgi membranes is essential for the luminal biosynthesis of glycan structures. Here we identify GDP-fucose transporter 1 (GFT1), an Arabidopsis nucleotide sugar transporter that translocates GDP-L-fucose into the Golgi lumen. Using proteo-liposome-based transport assays, we show that GFT preferentially transports GDP-L-fucose over other nucleotide sugars in vitro, while GFT1-silenced plants are almost devoid of L-fucose in cell wall-derived xyloglucan and rhamnogalacturonan II. Furthermore, these lines display reduced L-fucose content in N-glycan structures accompanied by severe developmental growth defects. We conclude that GFT1 is the major nucleotide sugar transporter for import of GDP-L-fucose into the Golgi and is required for proper plant growth and development.

  15. The association of single-nucleotide polymorphisms in the oxytocin receptor and G protein-coupled receptor kinase 6 (GRK6) genes with oxytocin dosing requirements and labor outcomes.

    PubMed

    Grotegut, Chad A; Ngan, Emily; Garrett, Melanie E; Miranda, Marie Lynn; Ashley-Koch, Allison E; Swamy, Geeta K

    2017-09-01

    Oxytocin is a potent uterotonic agent that is widely used for induction and augmentation of labor. Oxytocin has a narrow therapeutic index and the optimal dosing for any individual woman varies widely. The objective of this study was to determine whether genetic variation in the oxytocin receptor (OXTR) or in the gene encoding G protein-coupled receptor kinase 6 (GRK6), which regulates desensitization of the oxytocin receptor, could explain variation in oxytocin dosing and labor outcomes among women being induced near term. Pregnant women with a singleton gestation residing in Durham County, NC, were prospectively enrolled as part of the Healthy Pregnancy, Healthy Baby cohort study. Those women undergoing an induction of labor at 36 weeks or greater were genotyped for 18 haplotype-tagging single-nucleotide polymorphisms in OXTR and 7 haplotype-tagging single-nucleotide polymorphisms in GRK6 using TaqMan assays. Linear regression was used to examine the relationship between maternal genotype and maximal oxytocin infusion rate, total oxytocin dose received, and duration of labor. Logistic regression was used to test for the association of maternal genotype with mode of delivery. For each outcome, backward selection techniques were utilized to control for important confounding variables and additive genetic models were used. Race/ethnicity was included in all models because of differences in allele frequencies across populations, and Bonferroni correction for multiple testing was used. DNA was available from 482 women undergoing induction of labor at 36 weeks or greater. Eighteen haplotype-tagging single-nucleotide polymorphisms within OXTR and 7 haplotype-tagging single-nucleotide polymorphisms within GRK6 were examined. Five single-nucleotide polymorphisms in OXTR showed nominal significance with maximal infusion rate of oxytocin, and two single-nucleotide polymorphisms in OXTR were associated with total oxytocin dose received. One single-nucleotide polymorphism in OXTR and two single-nucleotide polymorphisms in GRK6 were associated with duration of labor, one of which met the multiple testing threshold (P = .0014, rs2731664 [GRK6], mean duration of labor, 17.7 hours vs 20.2 hours vs 23.5 hours for AA, AC, and CC genotypes, respectively). Three single-nucleotide polymorphisms, two in OXTR and one in GRK6, showed nominal significance with mode of delivery. Genetic variation in OXTR and GRK6 is associated with the amount of oxytocin required as well as the duration of labor and risk for cesarean delivery among women undergoing induction of labor near term. With further research, pharmacogenomic approaches may potentially be utilized to develop personalized treatment to improve safety and efficacy outcomes among women undergoing induction of labor. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. 3'-End labeling of nucleic acids by a polymerase ribozyme.

    PubMed

    Samanta, Biswajit; Horning, David P; Joyce, Gerald F

    2018-06-13

    A polymerase ribozyme can be used to label the 3' end of RNA or DNA molecules by incorporating a variety of functionalized nucleotide analogs. Guided by a complementary template, the ribozyme adds a single nucleotide that may contain a fluorophore, biotin, azide or alkyne moiety, thus enabling the detection and/or capture of selectively labeled materials. Employing a variety of commercially available nucleotide analogs, efficient labeling was demonstrated for model RNAs and DNAs, human microRNAs and natural tRNA.

  17. Role of Rad23 and Dsk2 in Nucleotide Excision Repair and Spindle Pole Body Duplication

    DTIC Science & Technology

    2006-03-01

    AD Award Number: W81XWH-05-1-0310 TITLE: Role of Rad23 and Dsk2 in Nucleotide Excision Repair and Spindle Pole Body Duplication PRINCIPAL...Feb 2006 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Role of Rad23 and Dsk2 in Nucleotide Excision Repair and Spindle Pole Body Duplication Sb. GRANT...Degradation, Cell Cycle, Spindle Pole Body 16. SECURITY CLASSIFICATION OF: 17. LIMITATION 18. NUMBER 19a. NAME OF RESPONSIBLE PERSON OF ABSTRACT OF

  18. Switchgrass ubiquitin promoter (PVUBI2) and uses thereof

    DOEpatents

    Stewart, C. Neal; Mann, David George James

    2013-12-10

    The subject application provides polynucleotides, compositions thereof and methods for regulating gene expression in a plant. Polynucleotides disclosed herein comprise novel sequences for a promoter isolated from Panicum virgatum (switchgrass) that initiates transcription of an operably linked nucleotide sequence. Thus, various embodiments of the invention comprise the nucleotide sequence of SEQ ID NO: 2 or fragments thereof comprising nucleotides 1 to 692 of SEQ ID NO: 2 that are capable of driving the expression of an operably linked nucleic acid sequence.

  19. Resistance to Nucleotide Excision Repair of Bulky Guanine Adducts Opposite Abasic Sites in DNA Duplexes and Relationships between Structure and Function

    PubMed Central

    Liu, Zhi; Ding, Shuang; Kropachev, Konstantin; Lei, Jia; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

    2015-01-01

    The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N 2-dG adducts) in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue—DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of nucleotide excision repair or base excision repair mechanisms. PMID:26340000

  20. Effects of transcriptional start site sequence and position on nucleotide-sensitive selection of alternative start sites at the pyrC promoter in Escherichia coli.

    PubMed Central

    Liu, J; Turnbough, C L

    1994-01-01

    In Escherichia coli, expression of the pyrC gene is regulated primarily by a translational control mechanism based on nucleotide-sensitive selection of transcriptional start sites at the pyrC promoter. When intracellular levels of CTP are high, pyrC transcripts are initiated predominantly with CTP at a site 7 bases downstream of the Pribnow box. These transcripts form a stable hairpin at their 5' ends that blocks ribosome binding. When the CTP level is low and the GTP level is high, conditions found in pyrimidine-limited cells, transcripts are initiated primarily with GTP at a site 9 bases downstream of the Pribnow box. These shorter transcripts are unable to form a hairpin at their 5' ends and are readily translated. In this study, we examined the effects of nucleotide sequence and position on the selection of transcriptional start sites at the pyrC promoter. We characterized promoter mutations that systematically alter the sequence at position 7 or 9 downstream of the Pribnow box or vary the spacing between the Pribnow box and wild-type transcriptional initiation region. The results reveal preferences for particular initiating nucleotides (ATP > or = GTP > UTP >> CTP) and for starting positions downstream of the Pribnow box (7 >> 6 and 8 > 9 > 10). The results indicate that optimal nucleotide-sensitive start site switching at the wild-type pyrC promoter is the result of competition between the preferred start site (position 7) that uses the poorest initiating nucleotide (CTP) and a weak start site (position 9) that uses a good initiating nucleotide (GTP). The sequence of the pyrC promoter also minimizes the synthesis of untranslatable transcripts and provides for maximum stability of the regulatory transcript hairpin. In addition, the results show that the effects of the mutations on pyrC expression and regulation are consistent with the current model for translational control. Possible effects of preferences for initiating nucleotides and start sites on the expression and regulation of other genes are discussed. Images PMID:7910603

  1. Nucleotides released by apoptotic cells act as a find-me signal to promote phagocytic clearance.

    PubMed

    Elliott, Michael R; Chekeni, Faraaz B; Trampont, Paul C; Lazarowski, Eduardo R; Kadl, Alexandra; Walk, Scott F; Park, Daeho; Woodson, Robin I; Ostankovich, Marina; Sharma, Poonam; Lysiak, Jeffrey J; Harden, T Kendall; Leitinger, Norbert; Ravichandran, Kodi S

    2009-09-10

    Phagocytic removal of apoptotic cells occurs efficiently in vivo such that even in tissues with significant apoptosis, very few apoptotic cells are detectable. This is thought to be due to the release of 'find-me' signals by apoptotic cells that recruit motile phagocytes such as monocytes, macrophages and dendritic cells, leading to the prompt clearance of the dying cells. However, the identity and in vivo relevance of such find-me signals are not well understood. Here, through several lines of evidence, we identify extracellular nucleotides as a critical apoptotic cell find-me signal. We demonstrate the caspase-dependent release of ATP and UTP (in equimolar quantities) during the early stages of apoptosis by primary thymocytes and cell lines. Purified nucleotides at these concentrations were sufficient to induce monocyte recruitment comparable to that of apoptotic cell supernatants. Enzymatic removal of ATP and UTP (by apyrase or the expression of ectopic CD39) abrogated the ability of apoptotic cell supernatants to recruit monocytes in vitro and in vivo. We then identified the ATP/UTP receptor P2Y(2) as a critical sensor of nucleotides released by apoptotic cells using RNA interference-mediated depletion studies in monocytes, and macrophages from P2Y(2)-null mice. The relevance of nucleotides in apoptotic cell clearance in vivo was revealed by two approaches. First, in a murine air-pouch model, apoptotic cell supernatants induced a threefold greater recruitment of monocytes and macrophages than supernatants from healthy cells did; this recruitment was abolished by depletion of nucleotides and was significantly decreased in P2Y(2)(-/-) (also known as P2ry2(-/-)) mice. Second, clearance of apoptotic thymocytes was significantly impaired by either depletion of nucleotides or interference with P2Y receptor function (by pharmacological inhibition or in P2Y(2)(-/-) mice). These results identify nucleotides as a critical find-me cue released by apoptotic cells to promote P2Y(2)-dependent recruitment of phagocytes, and provide evidence for a clear relationship between a find-me signal and efficient corpse clearance in vivo.

  2. Molecular characterization of the virulent infectious hematopoietic necrosis virus (IHNV) strain 220-90

    PubMed Central

    2010-01-01

    Background Infectious hematopoietic necrosis virus (IHNV) is the type species of the genus Novirhabdovirus, within the family Rhabdoviridae, infecting several species of wild and hatchery reared salmonids. Similar to other rhabdoviruses, IHNV has a linear single-stranded, negative-sense RNA genome of approximately 11,000 nucleotides. The IHNV genome encodes six genes; the nucleocapsid, phosphoprotein, matrix protein, glycoprotein, non-virion protein and polymerase protein genes, respectively. This study describes molecular characterization of the virulent IHNV strain 220-90, belonging to the M genogroup, and its phylogenetic relationships with available sequences of IHNV isolates worldwide. Results The complete genomic sequence of IHNV strain 220-90 was determined from the DNA of six overlapping clones obtained by RT-PCR amplification of genomic RNA. The complete genome sequence of 220-90 comprises 11,133 nucleotides (GenBank GQ413939) with the gene order of 3'-N-P-M-G-NV-L-5'. These genes are separated by conserved gene junctions, with di-nucleotide gene spacers. An additional uracil nucleotide was found at the end of the 5'-trailer region, which was not reported before in other IHNV strains. The first 15 of the 16 nucleotides at the 3'- and 5'-termini of the genome are complementary, and the first 4 nucleotides at 3'-ends of the IHNV are identical to other novirhadoviruses. Sequence homology and phylogenetic analysis of the glycoprotein genes show that 220-90 strain is 97% identical to most of the IHNV strains. Comparison of the virulent 220-90 genomic sequences with less virulent WRAC isolate shows more than 300 nucleotides changes in the genome, which doesn't allow one to speculate putative residues involved in the virulence of IHNV. Conclusion We have molecularly characterized one of the well studied IHNV isolates, 220-90 of genogroup M, which is virulent for rainbow trout, and compared phylogenetic relationship with North American and other strains. Determination of the complete nucleotide sequence is essential for future studies on pathogenesis of IHNV using a reverse genetics approach and developing efficient control strategies. PMID:20085652

  3. “Gate-keeper” Residues and Active-Site Rearrangements in DNA Polymerase μ Help Discriminate Non-cognate Nucleotides

    PubMed Central

    Li, Yunlang; Schlick, Tamar

    2013-01-01

    Incorporating the cognate instead of non-cognate substrates is crucial for DNA polymerase function. Here we analyze molecular dynamics simulations of DNA polymerase μ (pol μ) bound to different non-cognate incoming nucleotides including A:dCTP, A:dGTP, A(syn):dGTP, A:dATP, A(syn):dATP, T:dCTP, and T:dGTP to study the structure-function relationships involved with aberrant base pairs in the conformational pathway; while a pol μ complex with the A:dTTP base pair is available, no solved non-cognate structures are available. We observe distinct differences of the non-cognate systems compared to the cognate system. Specifically, the motions of active-site residue His329 and Asp330 distort the active site, and Trp436, Gln440, Glu443 and Arg444 tend to tighten the nucleotide-binding pocket when non-cognate nucleotides are bound; the latter effect may further lead to an altered electrostatic potential within the active site. That most of these “gate-keeper” residues are located farther apart from the upstream primer in pol μ, compared to other X family members, also suggests an interesting relation to pol μ's ability to incorporate nucleotides when the upstream primer is not paired. By examining the correlated motions within pol μ complexes, we also observe different patterns of correlations between non-cognate systems and the cognate system, especially decreased interactions between the incoming nucleotides and the nucleotide-binding pocket. Altered correlated motions in non-cognate systems agree with our recently proposed hybrid conformational selection/induced-fit models. Taken together, our studies propose the following order for difficulty of non-cognate system insertions by pol μ: T:dGTP

  4. 37 CFR 41.37 - Appeal brief.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... limitation is described in the specification as filed. If there is a drawing or amino acid or nucleotide material sequence, and at least one limitation is illustrated in a drawing or amino acid or nucleotide...

  5. 37 CFR 41.37 - Appeal brief.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... limitation is described in the specification as filed. If there is a drawing or amino acid or nucleotide material sequence, and at least one limitation is illustrated in a drawing or amino acid or nucleotide...

  6. Fixed-Gap Tunnel Junction for Reading DNA Nucleotides

    PubMed Central

    2015-01-01

    Previous measurements of the electronic conductance of DNA nucleotides or amino acids have used tunnel junctions in which the gap is mechanically adjusted, such as scanning tunneling microscopes or mechanically controllable break junctions. Fixed-junction devices have, at best, detected the passage of whole DNA molecules without yielding chemical information. Here, we report on a layered tunnel junction in which the tunnel gap is defined by a dielectric layer, deposited by atomic layer deposition. Reactive ion etching is used to drill a hole through the layers so that the tunnel junction can be exposed to molecules in solution. When the metal electrodes are functionalized with recognition molecules that capture DNA nucleotides via hydrogen bonds, the identities of the individual nucleotides are revealed by characteristic features of the fluctuating tunnel current associated with single-molecule binding events. PMID:25380505

  7. DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.

    PubMed

    Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P

    2008-06-01

    In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.

  8. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    PubMed

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  9. Regulation of PRPP and nucleoside tri and tetraphosphate pools in Escherichia coli under conditions of nitrogen starvation.

    PubMed Central

    Villadsen, I S; Michelsen, O

    1977-01-01

    The ribonucleoside triphosphate, deoxyribonucleoside triphosphate, 3' -diphosphate guanosine 5' -diphosphate (ppGpp), and 5-phosphoribosyl 1-pyrophosphate (PRPP) pools in Escherichia coli B were determined by thin-layer chromatography during changing conditions to ammonium starvation. The intracellular concentrations of all nucleotides were found to change in a well-defined order several minutes before andy observed change in the optical density of the culture. The levels of purine nucleoside triphosphates (adenosine 5' -triphosphate [CTP], dCTP) and uridine nucleotides (uridine 5' -triphosphate, deoxythymidine 5'-triphosphate). The deoxyribonucleotides thus behaved as the ribonucleotides. The levels of ppGpp increased 11-fold after the decrease in uridine nucleotides, when the accumulation of stable ribonucleic acid (RNA) stopped. The level of the nucleotide pool did not stabilize until 30 min after the change in optical density. The pool of dGTP dropped concomitantly with the pool of CTP. The nucleotide precursor PRPP exhibited a transient increase, wtih maximum value of four times the exponential levels at the onset of starvation. Apparently the cell adjusts early to starvation by reducing either the phosphorylating activity or the nucleotide biosynthetic activity. As in other downshift systems, the accumulation of stable RNA stopped before the break in optical density and before the stop in protein accumulation. Cell divisions were quite insensitive to the control mechanisms operating on RNA and protein accumulation under ammonium starvation, since the cells continued to divide for 21 min without any net accumulation of RNA. Images PMID:323222

  10. The transport and metabolism of the uridine mononucleotides by rat jejunum in vitro.

    PubMed Central

    Bronk, J R; Hastewell, J G

    1989-01-01

    1. Both uridine 3'-monophosphate (3'-UMP) and uridine 5'-monophosphate (5'-UMP) when perfused through the lumen of isolated rat jejunum gave rise to uracil as the only transported pyrimidine appearing in the serosal medium; neither the nucleotide nor the nucleoside could be detected in the serosal fluid. 2. There was a low level of the nucleoside, uridine, in the luminal fluid after the nucleotide had passed through the jejunal segment. Luminal nucleoside appearance was more marked from the 3' form of the nucleotide. 3. The hydrolysis of the nucleotides to the nucleoside form occurred via a brush-border membrane enzyme, which had the same maximal velocity (Vmax) for the two nucleotides (699 +/- 35 and 747 +/- 10 nmol min-1 (mg protein)-1 for 3'-UMP and 5'-UMP, respectively) but a different Michaelis constant (Km) so that 3'-UMP (Km = 58 +/- 3 microM) hydrolysis is favoured over 5'-UMP hydrolysis (Km = 108 +/- microM) at lower concentrations. 4. At 0.05 mM, luminal 3'-UMP gave rise to a higher rate of serosal uracil appearance than luminal 5'-UMP, but at higher luminal concentrations (0.1-0.2 mM) the rate of serosal uracil appearance was the same from both nucleotides. 5. The transmural transport of uracil from the uridine mononucleotides is discussed with reference to the metabolism and compartmentalization of the small intestine responsible for the appearance of the free pyrimidine in the serosal fluid. PMID:2778724

  11. Characterization of complexes of nucleoside-5'-phosphorothioate analogues with zinc ions.

    PubMed

    Sayer, Alon Haim; Itzhakov, Yehudit; Stern, Noa; Nadel, Yael; Fischer, Bilha

    2013-10-07

    On the basis of the high affinity of Zn(2+) to sulfur and imidazole, we targeted nucleotides such as GDP-β-S, ADP-β-S, and AP3(β-S)A, as potential biocompatible Zn(2+)-chelators. The thiophosphate moiety enhanced the stability of the Zn(2+)-nucleotide complex by about 0.7 log units. ATP-α,β-CH2-γ-S formed the most stable Zn(2+)-complex studied here, log K 6.50, being ~0.8 and ~1.1 log units more stable than ATP-γ-S-Zn(2+) and ATP-Zn(2+) complexes, and was the major species, 84%, under physiological pH. Guanine nucleotides Zn(2+) complexes were more stable by 0.3-0.4 log units than the corresponding adenine nucleotide complexes. Likewise, AP3(β-S)A-zinc complex was ~0.5 log units more stable than AP3A complex. (1)H- and (31)P NMR monitored Zn(2+) titration showed that Zn(2+) coordinates with the purine nucleotide N7-nitrogen atom, the terminal phosphate, and the adjacent phosphate. In conclusion, replacement of a terminal phosphate by a thiophosphate group resulted in decrease of the acidity of the phosphate moiety by approximately one log unit, and increase of stability of Zn(2+)-complexes of the latter analogues by up to 0.7 log units. A terminal phosphorothioate contributed more to the stability of nucleotide-Zn(2+) complexes than a bridging phosphorothioate.

  12. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  13. The binding of glucose and nucleotides to hexokinase from Saccharomyces cerevisiae.

    PubMed

    Woolfitt, A R; Kellett, G L; Hoggett, J G

    1988-01-29

    The binding of glucose, ADP and AdoPP[NH]P, to the native PII dimer and PII monomer and the proteolytically-modified SII monomer of hexokinase (ATP:D-hexose 6-phosphotransferase, EC 2.7.1.1) from Saccharomyces cerevisiae was monitored at pH 6.7 by the concomitant quenching of protein fluorescence. The data were analysed in terms of Qmax, the maximal quenching of fluorescence at saturating concentrations of ligand, and [L]0.5, the concentration of ligand at half-maximal quenching. No changes in fluorescence were observed with free enzyme and nucleotide alone. In the presence of saturating levels of glucose, Qmax induced by nucleotide was between 2 and 7%, and [L]0.5 was between 0.12 and 0.56 mM, depending on the nucleotide and enzyme species. Qmax induced by glucose alone was between 22 and 25%, while [L]0.5 was approx. 0.4 mM for either of the monomeric hexokinase forms and 3.4 for PII dimer. In the presence of 6 mM ADP or 2 mM AdoPP[NH]P, Qmax for glucose was increased by up to 4% and [L]0.5 was diminished 3-fold for hexokinase PII monomer, 6-fold for SII monomer, and 15-fold for PII dimer. The results are interpreted in terms of nucleotide-induced conformational change of hexokinase in the presence of glucose and synergistic binding interactions between glucose and nucleotide.

  14. Human papillomavirus type 18 variant lineages in United States populations characterized by sequence analysis of LCR-E6, E2, and L1 regions.

    PubMed

    Arias-Pulido, Hugo; Peyton, Cheri L; Torrez-Martínez, Norah; Anderson, D Nelson; Wheeler, Cosette M

    2005-07-20

    While HPV 16 variant lineages have been well characterized, the knowledge about HPV 18 variants is limited. In this study, HPV 18 nucleotide variations in the E2 hinge region were characterized by sequence analysis in 47 control and 51 tumor specimens. Fifty of these specimens were randomly selected for sequencing of an LCR-E6 segment and 20 samples representative of LCR-E6 and E2 sequence variants were examined across the L1 region. A total of 2770 nucleotides per HPV 18 variant genome were considered in this study. HPV 18 variant nucleotides were linked among all gene segments analyzed and grouped into three main branches: Asian-American (AA), European (E), and African (Af). These three branches were equally distributed among controls and cases and when stratified by Hispanic and non-Hispanic ethnicities. Among invasive cervical cancer cases, no significant differences in the three HPV variant branches were observed among ethnic groups or when stratified by histopathology (squamous vs. adenocarcinoma). The Af branch showed the greatest nucleotide variability when compared to the HPV 18 reference sequence and was more closely related to HPV 45 than either AA or E branches. Our data also characterize nucleotide and amino acid variations in the L1 capsid gene among HPV 18 variants, which may be relevant to vaccine strategies and subsequent studies of naturally occurring HPV 18 variants. Several novel HPV 18 nucleotide variations were identified in this study.

  15. Solution structure of an ATP-binding RNA aptamer reveals a novel fold.

    PubMed Central

    Dieckmann, T; Suzuki, E; Nakamura, G K; Feigon, J

    1996-01-01

    In vitro selection has been used to isolate several RNA aptamers that bind specifically to biological cofactors. A well-characterized example in the ATP-binding RNA aptamer family, which contains a conserved 11-base loop opposite a bulged G and flanked by regions of double-stranded RNA. The nucleotides in the consensus sequence provide a binding pocket for ATP (or AMP), which binds with a Kd in the micromolar range. Here we present the three-dimensional solution structure of a 36-nucleotide ATP-binding RNA aptamer complexed with AMP, determined from NMR-derived distance and dihedral angle restraints. The conserved loop and bulged G form a novel compact, folded structure around the AMP. The backbone tracing of the loop nucleotides can be described by a Greek zeta (zeta). Consecutive loop nucleotides G, A, A form a U-turn at the bottom of the zeta, and interact with the AMP to form a structure similar to a GNRA tetraloop, with AMP standing in for the final A. Two asymmetric G. G base pairs close the stems flanking the internal loop. Mutated aptamers support the existence of the tertiary interactions within the consensus nucleotides and with the AMP found in the calculated structures. PMID:8756406

  16. Affinity of yeast nucleotide excision repair factor 2, consisting of the Rad4 and Rad23 proteins, for ultraviolet damaged DNA.

    PubMed

    Guzder, S N; Sung, P; Prakash, L; Prakash, S

    1998-11-20

    Saccharomyces cerevisiae Rad4 and Rad23 proteins are required for the nucleotide excision repair of UV light-damaged DNA. Previous studies have indicated that these two DNA repair proteins are associated in a tight complex, which we refer to as nucleotide excision repair factor 2 (NEF2). In a reconstituted nucleotide excision repair reaction, incision of UV-damaged DNA is dependent on NEF2, indicating a role of NEF2 in an early step of the repair process. NEF2 does not, however, possess an enzymatic activity, and its function in the damage-specific incision reaction has not yet been defined. Here we use a DNA mobility shift assay to demonstrate that NEF2 binds specifically to UV-damaged DNA. Elimination of cyclobutane pyrimidine dimers from the UV-damaged DNA by enzymatic photoreactivation has little effect on the affinity of NEF2 for the DNA, suggesting that NEF2 recognizes the 6-(1, 2)-dihydro-2-oxo-4-pyrimidinyl)-5-methyl-2,4-(1H,3H)-pyrimidinedione photoproducts in the damaged DNA. These results highlight the intricacy of the DNA damage-demarcation reaction during nucleotide excision repair in eukaryotes.

  17. VarDetect: a nucleotide sequence variation exploratory tool

    PubMed Central

    Ngamphiw, Chumpol; Kulawonganunchai, Supasak; Assawamakin, Anunchai; Jenwitheesuk, Ekachai; Tongsima, Sissades

    2008-01-01

    Background Single nucleotide polymorphisms (SNPs) are the most commonly studied units of genetic variation. The discovery of such variation may help to identify causative gene mutations in monogenic diseases and SNPs associated with predisposing genes in complex diseases. Accurate detection of SNPs requires software that can correctly interpret chromatogram signals to nucleotides. Results We present VarDetect, a stand-alone nucleotide variation exploratory tool that automatically detects nucleotide variation from fluorescence based chromatogram traces. Accurate SNP base-calling is achieved using pre-calculated peak content ratios, and is enhanced by rules which account for common sequence reading artifacts. The proposed software tool is benchmarked against four other well-known SNP discovery software tools (PolyPhred, novoSNP, Genalys and Mutation Surveyor) using fluorescence based chromatograms from 15 human genes. These chromatograms were obtained from sequencing 16 two-pooled DNA samples; a total of 32 individual DNA samples. In this comparison of automatic SNP detection tools, VarDetect achieved the highest detection efficiency. Availability VarDetect is compatible with most major operating systems such as Microsoft Windows, Linux, and Mac OSX. The current version of VarDetect is freely available at . PMID:19091032

  18. Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis.

    PubMed

    Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q

    2010-11-01

    Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

  19. Identification of the initiation site of poliovirus polyprotein synthesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dorner, A.J.; Dorner, L.F.; Larsen, G.R.

    1982-06-01

    The complete nucleotide sequence of poliovirus RNA has a long open reading frame capable of encoding the precursor polyprotein NCVPOO. The first AUG codon in this reading frame is located 743 nucleotides from the 5' end of the RNA and is preceded by eight AUG codons in all three reading frames. Because all proteins that map at the amino terminus of the polyprotein (P1-1a, VPO, and VP4) are blocked at their amino termini and previous studies of ribosome binding have been inconclusive, direct identification of the initiation site of protein synthesis was difficult. We separated and identified all of themore » tryptic peptides of capsid protein VP4 and correlated these peptides with the amino acid sequence predicted to follow the AUG codon at nucleotide 743. Our data indicate that VP4 begins with a blocked glycine that is encoded immediately after the AUG codon at nucleotide 743. An S1 nuclease analysis of poliovirus mRNA failed to reveal a splice in the 5' region. We concluded that synthesis of poliovirus polyprotein is initiated at nucleotide 743, the first AUG codon in the long open reading frame.« less

  20. Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

    PubMed Central

    Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

    1982-01-01

    We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

  1. Adsorption of nucleotides onto Fe-Mg-Al rich swelling clays

    NASA Astrophysics Data System (ADS)

    Feuillie, Cécile; Daniel, Isabelle; Michot, Laurent J.; Pedreira-Segade, Ulysse

    2013-11-01

    Mineral surfaces may have played a role in the origin of the first biopolymers, by concentrating organic monomers from a dilute ocean. Swelling clays provide a high surface area for the concentration of prebiotic monomers, and have therefore been the subject of numerous investigations. In that context, montmorillonite, the most abundant swelling clay in modern environments, has been extensively studied with regard to adsorption and polymerization of nucleic acids. However, montmorillonite was probably rather marginal on the primitive ocean floor compared to iron-magnesium rich phyllosilicates such as nontronite that results from the hydrothermal alteration of a mafic or ultramafic oceanic crust. In the present paper, we study the adsorption of nucleotides on montmorillonite and nontronite, at various pH and ionic strength conditions plausible for Archean sea-water. A thorough characterization of the mineral surfaces shows that nucleotide adsorb mainly on the edge faces of the smectites by ligand exchange between the phosphate groups of the nucleotides and the -OH groups from the edge sites over a wide pH range (4-10). Nontronite is more reactive than montmorillonite. At low pH, additional ion exchange may play a role as the nucleotides become positively charged.

  2. The inside and outside: topological issues in plant cell wall biosynthesis and the roles of nucleotide sugar transporters.

    PubMed

    Temple, Henry; Saez-Aguayo, Susana; Reyes, Francisca C; Orellana, Ariel

    2016-09-01

    The cell wall is a complex extracellular matrix composed primarily of polysaccharides. Noncellulosic polysaccharides, glycoproteins and proteoglycans are synthesized in the Golgi apparatus by glycosyltransferases (GTs), which use nucleotide sugars as donors to glycosylate nascent glycan and glycoprotein acceptors that are subsequently exported to the extracellular space. Many nucleotide sugars are synthesized in the cytosol, leading to a topological issue because the active sites of most GTs are located in the Golgi lumen. Nucleotide sugar transporters (NSTs) overcome this problem by translocating nucleoside diphosphate sugars from the cytosol into the lumen of the organelle. The structures of the cell wall components synthesized in the Golgi are diverse and complex; therefore, transporter activities are necessary so that the nucleotide sugars can provide substrates for the GTs. In this review, we describe the topology of reactions involved in polysaccharide biosynthesis in the Golgi and focus on the roles of NSTs as well as their impacts on cell wall structure when they are altered. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  3. Nucleotide sequence of a resistance breaking mutant of southern bean mosaic virus.

    PubMed

    Lee, L; Anderson, E J

    1998-01-01

    SBMV-S is a resistance-breaking mutant of an Arkansas isolate of the bean strain of southern bean mosaic virus (SBMV-BARK) that is able to move systemically in Phaseolus vulgaris cvs. Pinto and Great Northern, whereas the wild-type SBMV-BARK causes local necrotic lesions and is restricted to the inoculated leaves of these hosts. Sequence analysis of the 4136 nucleotide genomes of SBMV-BARK and SBMV-S revealed seven nucleotide differences, but only four deduced amino acid changes. A single amino acid change occurred in the C-terminal region of the putative RNA-dependent RNA polymerase and three differences were identified in the N-terminal portion of the virus coat protein. SBMV-BARK and SBMV-S were compared with other sobemoviruses and were found to contain a high level of nucleotide sequence identity (91.3%) to SBMV-B. Unlike SBMV-B however, SBMV-BARK and SBMV-S contained four putative overlapping open reading frames, making them more similar in genome organization to the cowpea strain, SBMV-C. The possibility exists that mutations or even errors, that resulted in mis-identification of open reading frames, occurred in previously published information on nucleotide sequence and genomic organization for SBMV-B.

  4. Normalization of Complete Genome Characteristics: Application to Evolution from Primitive Organisms to Homo sapiens.

    PubMed

    Sorimachi, Kenji; Okayasu, Teiji; Ohhira, Shuji

    2015-04-01

    Normalized nucleotide and amino acid contents of complete genome sequences can be visualized as radar charts. The shapes of these charts depict the characteristics of an organism's genome. The normalized values calculated from the genome sequence theoretically exclude experimental errors. Further, because normalization is independent of both target size and kind, this procedure is applicable not only to single genes but also to whole genomes, which consist of a huge number of different genes. In this review, we discuss the applications of the normalization of the nucleotide and predicted amino acid contents of complete genomes to the investigation of genome structure and to evolutionary research from primitive organisms to Homo sapiens. Some of the results could never have been obtained from the analysis of individual nucleotide or amino acid sequences but were revealed only after the normalization of nucleotide and amino acid contents was applied to genome research. The discovery that genome structure was homogeneous was obtained only after normalization methods were applied to the nucleotide or predicted amino acid contents of genome sequences. Normalization procedures are also applicable to evolutionary research. Thus, normalization of the contents of whole genomes is a useful procedure that can help to characterize organisms.

  5. Interactions of praseodymium and neodymium with nucleosides and nucleotides: absorption difference and comparative absorption spectral study.

    PubMed

    Misra, S N; Anjaiah, K; Joseph, G; Abdi, S H

    1992-02-01

    The interactions of praseodymium(III) and neodymium(III) with nucleosides and nucleotides have been studied in different stoichiometry in water and water-DMF mixtures by employing absorption difference and comparative absorption spectrophotometry. The 4f-4f bands were analysed by linear curve analysis followed by gaussian curve analysis, and various spectral parameters were computed, using partial and multiple regression method. The magnitude of changes in both energy interaction and intensity were used to explore the degree of outer and inner sphere coordination, incidence of covalency and the extent of metal 4f-orbital involvement in chemical bonding. Crystalline complexes of the type [Ln(nucleotide)2(H2O)2]- (where nucleotide--GMP or IMP) were characterized by IR, 1H NMR, 31P NMR data. These studies indicated that the binding of the nucleotide is through phosphate oxygen in a bidentate manner and the complexes undergo substantial ionisation in aqueous medium, thereby supporting the observed weak 4f-4f bands and lower values for nephelauxetic effect (1-beta), bonding (b) and covalency (delta) parameters derived from coulombic and spin orbit interaction parameters.

  6. The primary structure of the thymidine kinase gene of fish lymphocystis disease virus.

    PubMed

    Schnitzler, P; Handermann, M; Szépe, O; Darai, G

    1991-06-01

    The DNA nucleotide sequence of the thymidine kinase (TK) gene of fish lymphocystis disease virus (FLDV) which has been localized between the coordinates 0.678 to 0.688 of the viral genome was determined. The analysis of the DNA nucleotide sequence located between the recognition sites of HindIII (0.669 map unit; nucleotide position 1) and AccI (nucleotide position 2032) revealed the presence of an open reading frame of 954 bp on the lower strand of this region between nucleotide positions 1868 (ATG) and 915 (TAA). It encodes for a protein of 318 amino acid residues. The evolutionary relationships of the TK gene of FLDV to the other known TK genes was investigated using the method of progressive sequence alignment. These analyses revealed a high degree of diversity between the protein sequence of FLDV TK gene and the amino acid composition of other TKs tested. However, significant conservations were detected at several regions of amino acid residues of the FLDV TK protein when compared to the amino acid sequence of TKs of African swine fever virus, fowlpox virus, shope fibroma virus, and vaccinia virus and to the amino acid sequences of the cellular cytoplasmic TK of chicken, mouse, and man.

  7. Identification of protein-interacting nucleotides in a RNA sequence using composition profile of tri-nucleotides.

    PubMed

    Panwar, Bharat; Raghava, Gajendra P S

    2015-04-01

    The RNA-protein interactions play a diverse role in the cells, thus identification of RNA-protein interface is essential for the biologist to understand their function. In the past, several methods have been developed for predicting RNA interacting residues in proteins, but limited efforts have been made for the identification of protein-interacting nucleotides in RNAs. In order to discriminate protein-interacting and non-interacting nucleotides, we used various classifiers (NaiveBayes, NaiveBayesMultinomial, BayesNet, ComplementNaiveBayes, MultilayerPerceptron, J48, SMO, RandomForest, SMO and SVM(light)) for prediction model development using various features and achieved highest 83.92% sensitivity, 84.82 specificity, 84.62% accuracy and 0.62 Matthew's correlation coefficient by SVM(light) based models. We observed that certain tri-nucleotides like ACA, ACC, AGA, CAC, CCA, GAG, UGA, and UUU preferred in protein-interaction. All the models have been developed using a non-redundant dataset and are evaluated using five-fold cross validation technique. A web-server called RNApin has been developed for the scientific community (http://crdd.osdd.net/raghava/rnapin/). Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Selective fluorescence quenching of 2,3-diazabicyclo[2.2.2]oct-2-ene by nucleotides.

    PubMed

    Marquez, Cesar; Pischel, Uwe; Nau, Werner M

    2003-10-16

    [reaction: see text] The fluorescence quenching of 2,3-diazabicyclo[2.2.2]oct-2-ene (DBO) by nucleotides has been studied. The quenching mechanism was analyzed on the basis of deuterium isotope effects, tendencies for exciplex formation, and the quenching efficiency in the presence of a molecular container (cucurbit[7]uril). Exciplex-induced quenching appears to prevail for adenosine, cytidine, and uridine, while hydrogen abstraction becomes competitive for thymidine and guanosine. Compared to other fluorescent probes, DBO responds very selectively to the type of nucleotide.

  9. Associations between single nucleotide polymorphisms in multiple candidate genes and body weight in rabbits

    PubMed Central

    El-Sabrout, Karim; Aggag, Sarah A.

    2017-01-01

    Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458

  10. Sulfonylureas suppress the stimulatory action of Mg-nucleotides on Kir6.2/SUR1 but not Kir6.2/SUR2A KATP channels: a mechanistic study.

    PubMed

    Proks, Peter; de Wet, Heidi; Ashcroft, Frances M

    2014-11-01

    Sulfonylureas, which stimulate insulin secretion from pancreatic β-cells, are widely used to treat both type 2 diabetes and neonatal diabetes. These drugs mediate their effects by binding to the sulfonylurea receptor subunit (SUR) of the ATP-sensitive K(+) (KATP) channel and inducing channel closure. The mechanism of channel inhibition is unusually complex. First, sulfonylureas act as partial antagonists of channel activity, and second, their effect is modulated by MgADP. We analyzed the molecular basis of the interactions between the sulfonylurea gliclazide and Mg-nucleotides on β-cell and cardiac types of KATP channel (Kir6.2/SUR1 and Kir6.2/SUR2A, respectively) heterologously expressed in Xenopus laevis oocytes. The SUR2A-Y1206S mutation was used to confer gliclazide sensitivity on SUR2A. We found that both MgATP and MgADP increased gliclazide inhibition of Kir6.2/SUR1 channels and reduced inhibition of Kir6.2/SUR2A-Y1206S. The latter effect can be attributed to stabilization of the cardiac channel open state by Mg-nucleotides. Using a Kir6.2 mutation that renders the KATP channel insensitive to nucleotide inhibition (Kir6.2-G334D), we showed that gliclazide abolishes the stimulatory effects of MgADP and MgATP on β-cell KATP channels. Detailed analysis suggests that the drug both reduces nucleotide binding to SUR1 and impairs the efficacy with which nucleotide binding is translated into pore opening. Mutation of one (or both) of the Walker A lysines in the catalytic site of the nucleotide-binding domains of SUR1 may have a similar effect to gliclazide on MgADP binding and transduction, but it does not appear to impair MgATP binding. Our results have implications for the therapeutic use of sulfonylureas. © 2014 Proks et al.

  11. Antifungal polypeptides

    DOEpatents

    Altier, Daniel J.; Dahlbacka, Glen; Ellanskaya, legal representative, Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser; Ellanskaya, deceased, Irina

    2007-12-11

    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

  12. Antifungal polypeptides

    DOEpatents

    Altier, Daniel J.; Dahlbacka, Glen; Elleskaya, Irina; Ellanskaya, legal representative; Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

    2010-08-10

    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

  13. Antifungal polypeptides

    DOEpatents

    Altier, Daniel J [Waukee, IA; Dahlbacka, Glen [Oakland, CA; Elleskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, IA; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

    2011-04-12

    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

  14. Antifungal polypeptides

    DOEpatents

    Altier, Daniel J [Granger, IA; Dahlbacka, Glen [Oakland, CA; Ellanskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, TX; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

    2012-04-03

    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

  15. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    NASA Astrophysics Data System (ADS)

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.

    2015-11-01

    Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

  16. Mung bean nuclease: mode of action and specificity vs synthetic esters of 3′-nucleotides

    PubMed Central

    Kole, R.; Sierakowska, Halina; Szemplińska, Halina; Shugar, D.

    1974-01-01

    Mung bean nuclease hydrolyzes synthetic esters of 3′-nucleotides to nucleosides and phosphate esters; esters of 2′-nucleotides, and 2′→ 5′ internucleotide linkages, are resistant. Esters of ribonucleotides are cleaved at 100-fold the rate for deoxyribonucleotides, the increased rate being due to presence of the 2′-hydroxyl and not to differences in conformation. Introduction of a 5′-substituent leads to a 3-fold increase in rate. The rates of hydrolysis vary up to 10-fold with the nature of the base, in the order adenine > hypoxanthine > uracil; and up to 6-fold with the nature of the ester radical. This form of cleavage of esters of 3′-nucleotides is also characteristic for nuclease-3′-nucleotidase activities from potato tubers and wheat, suggesting that one type of enzyme is responsible for all these activities. PMID:10793750

  17. Abiogenic synthesis of nucleotides on the surface of small space bodies with high energy particles

    NASA Astrophysics Data System (ADS)

    Simakov, M. B.; Kuzicheva, E. A.; Antropov, A. E.; Dodonova, N. Ya

    Abiotic formation of such complex biochemical compounds as nucleotides and oligopeptides on the surface of interstellar and interplanetary dust particles (IDP) by cosmic radiation was examined. In order to study the formation of organic compounds on IDPs, solid films prepared from nucleososide and inorganic phosphate were irradiated with high energy protons. Irradiated products were analyzed with HPLC. The natural nucleotides were detected. The main products were 5' AMP (3.2%) and 2'3' cAMP (2.7%). The results were compared with others experiments on the action of ultraviolet radiation with different wavelengths, γ-radiation and heat on solid mixtures of biologically significant compounds. The experiment on abiogenic synthesis of nucleotides on board of space satellite "BION-11" was compared also. The present results suggest that a considerable amount of complex biochemical compounds formed in extraterrestrial environments could have been supplied to the primitive earth before the origin of life.

  18. cGMP and cyclic nucleotide-gated channels participate in mouse sperm capacitation.

    PubMed

    Cisneros-Mejorado, Abraham; Sánchez Herrera, Daniel P

    2012-01-20

    During capacitation of mammalian sperm intracellular [Ca(2+)] and cyclic nucleotides increase, suggesting that CNG channels play a role in the physiology of sperm. Here we study the effect of capacitation, 8Br-cAMP (8-bromoadenosine 3',5'-cyclic monophosphate) and 8Br-cGMP (8-bromoguanosine 3',5'-cyclic monophosphate) on the macroscopic ionic currents of mouse sperm, finding the existence of different populations of sperm, in terms of the recorded current and its response to cyclic nucleotides. Our results show that capacitation and cyclic nucleotides increase the ionic current, having a differential sensitivity to cGMP (cyclic guanosine monophosphate) and cAMP (cyclic adenosine monophosphate). Using a specific inhibitor we determine the contribution of CNG channels to macroscopic current and capacitation. Copyright © 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  19. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    PubMed

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  20. Genetic diversity and classification of Tibetan yak populations based on the mtDNA COIII gene.

    PubMed

    Song, Q Q; Chai, Z X; Xin, J W; Zhao, S J; Ji, Q M; Zhang, C F; Ma, Z J; Zhong, J C

    2015-03-13

    To determine the level of genetic diversity and phylogenetic relationships among Tibetan yak populations, the mitochondrial DNA cytochrome c oxidase subunit 3 (COIII) genes of 378 yak individuals from 16 populations were analyzed in this study. The results showed that the length of cytochrome c oxidase subunit 3 gene sequences was 781 bp, with nucleotide frequencies of 29.2, 29.4, 26.1, and 15.2% for T, C, A, and G, respectively. A total of 26 haplotypes were identified, with 69 polymorphic sites, including 11 parsimony-informative sites and 58 single-nucleotide polymorphism sites. No deletions/insertions were found in sequence comparison, indicating that nucleotide mutation types were transitions and transversions. Haplotype and nucleotide diversities were 0.562 and 0.00138, respectively, indicating a high level of genetic diversity in Tibetan yak populations. Phylogenetic relationship analysis indicated that Tibetan yak populations are divided into 2 groups.

  1. Direct activation of the olfactory cyclic nucleotide-gated channel through modification of sulfhydryl groups by NO compounds.

    PubMed

    Broillet, M C; Firestein, S

    1996-02-01

    The activation of a cyclic nucleotide-gated channel is the final step in sensory transduction in olfaction. Normally, this channel is opened by the intracellular cyclic nucleotide second messenger cAMP or cGMP. However, in single channel recordings we found that donors of nitric oxide, a putative intercellular messenger, could directly activate the native olfactory neuron channel. Its action was independent of the presence of the normal ligand and did not involve the cyclic nucleotide binding site, suggesting an alternate site on the molecule that is critical in channel gating. The biochemical pathway appears to utilize nitric oxide in one of its alternate redox states, the nitrosonium ion, transnitrosylating a free sulfhydryl group belonging to a cysteine residue tentatively identified as being in the region linking the S6 transmembrane domain to the ligand binding domain.

  2. Oxidized nucleotide insertion by pol β confounds ligation during base excision repair

    PubMed Central

    Çağlayan, Melike; Horton, Julie K.; Dai, Da-Peng; Stefanick, Donna F.; Wilson, Samuel H.

    2017-01-01

    Oxidative stress in cells can lead to accumulation of reactive oxygen species and oxidation of DNA precursors. Oxidized purine nucleotides can be inserted into DNA during replication and repair. The main pathway for correcting oxidized bases in DNA is base excision repair (BER), and in vertebrates DNA polymerase β (pol β) provides gap filling and tailoring functions. Here we report that the DNA ligation step of BER is compromised after pol β insertion of oxidized purine nucleotides into the BER intermediate in vitro. These results suggest the possibility that BER mediated toxic strand breaks are produced in cells under oxidative stress conditions. We observe enhanced cytotoxicity in oxidizing-agent treated pol β expressing mouse fibroblasts, suggesting formation of DNA strand breaks under these treatment conditions. Increased cytotoxicity following MTH1 knockout or treatment with MTH1 inhibitor suggests the oxidation of precursor nucleotides. PMID:28067232

  3. Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

    PubMed Central

    Hall, L; Laird, J E; Craig, R K

    1984-01-01

    Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

  4. The possible role of human milk nucleotides as sleep inducers.

    PubMed

    Sánchez, Cristina L; Cubero, Javier; Sánchez, Javier; Chanclón, Belén; Rivero, Montserrat; Rodríguez, Ana B; Barriga, Carmen

    2009-02-01

    Breast-milk contains a potent mixture of diverse components, such as the non-protein nitrogen fraction which includes nucleotides, whose variation in levels is evident throughout lactation. In addition, these substances play an important role in sleep homeostasis. In the present study, human milk samples were analyzed using a capillary electrophoresis system. The rhythmicity of each nucleotide was studied by cosinor analysis. It was found that the nucleotides 5'AMP, 5'GMP, 5'CMP, and 5'IMP have significant (P < 0.05) circadian rhythms, the acrophases of the first two being during the night, and of the latter two during the day. While 5'UMP did not show a clear circadian rhythm, there was an increase in its levels at night. In conclusion, the rise in nocturnal levels of 5'AMP, 5'GMP, and 5'UMP could be involved in inducing the 'hypnotic' action of breast-milk at night in the infant.

  5. Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

    PubMed Central

    Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

  6. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    PubMed

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  7. Regulation of Pyrimidine Biosynthesis in Intact Cells of Cucurbita pepo.

    PubMed

    Lovatt, C J; Albert, L S

    1979-10-01

    The occurrence of the complete orotic acid pathway for the biosynthesis de novo of pyrimidine nucleotides was demonstrated in the intact cells of roots excised from summer squash (Cucurbita pepo L. cv. Early Prolific Straightneck). Evidence that the biosynthesis of pyrimidine nucleotides proceeds via the orotate pathway in C. pepo included: (a) demonstration of the incorporation of [(14)C]NaHCO(3), [(14)C]carbamylaspartate, and [(14)C]orotic acid into uridine nucleotides; (b) the isolation of [(14)C]orotic acid when [(14)C]NaHCO(3) and [(14)C]carbamylaspartate were used as precursors; (c) the observation that 6-azauridine, a known inhibitor of the pathway, blocked the incorporation of early precursors into uridine nucleotides while causing a concomitant accumulation of orotic acid; and (d) demonstration of the activities of the component enzymes of the orotate pathway in assays employing cell-free extracts.Regulation of the activity of the orotate pathway by end product inhibition was demonstrated in the intact cells of excised roots by measuring the influence of added pyrimidine nucleosides on the incorporation of [(14)C]NaHCO(3) into uridine nucleotides. The addition of either uridine or cytidine inhibited the incorporation of [(14)C]NaHCO(3) into uridine nucleotides by about 80%. The observed inhibition was demonstrated to be readily reversible upon transfer of the roots to a nucleoside-free medium. Experiments employing various radiolabeled precursors indicated that one or both of the first two enzymes in the orotate pathway are the only site(s) of regulation of physiological importance.

  8. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis.

    PubMed

    Pisithkul, Tippapha; Jacobson, Tyler B; O'Brien, Thomas J; Stevenson, David M; Amador-Noguez, Daniel

    2015-09-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using (13)C-labeled sugars and [(15)N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. Copyright © 2015, Pisithkul et al.

  9. Structural insights into translational recoding by frameshift suppressor tRNASufJ

    PubMed Central

    Fagan, Crystal E.; Maehigashi, Tatsuya; Dunkle, Jack A.; Miles, Stacey J.

    2014-01-01

    The three-nucleotide mRNA reading frame is tightly regulated during translation to ensure accurate protein expression. Translation errors that lead to aberrant protein production can result from the uncoupled movement of the tRNA in either the 5′ or 3′ direction on mRNA. Here, we report the biochemical and structural characterization of +1 frameshift suppressor tRNASufJ, a tRNA known to decode four, instead of three, nucleotides. Frameshift suppressor tRNASufJ contains an insertion 5′ to its anticodon, expanding the anticodon loop from seven to eight nucleotides. Our results indicate that the expansion of the anticodon loop of either ASLSufJ or tRNASufJ does not affect its affinity for the A site of the ribosome. Structural analyses of both ASLSufJ and ASLThr bound to the Thermus thermophilus 70S ribosome demonstrate both ASLs decode in the zero frame. Although the anticodon loop residues 34–37 are superimposable with canonical seven-nucleotide ASLs, the single C31.5 insertion between nucleotides 31 and 32 in ASLSufJ imposes a conformational change of the anticodon stem, that repositions and tilts the ASL toward the back of the A site. Further modeling analyses reveal that this tilting would cause a distortion in full-length A-site tRNASufJ during tRNA selection and possibly impede gripping of the anticodon stem by 16S rRNA nucleotides in the P site. Together, these data implicate tRNA distortion as a major driver of noncanonical translation events such as frameshifting. PMID:25352689

  10. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis

    PubMed Central

    Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; Stevenson, David M.

    2015-01-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. PMID:26070680

  11. Brain purine metabolism and xanthine dehydrogenase/oxidase conversion in hyperammonemia are under control of NMDA receptors and nitric oxide.

    PubMed

    Kaminsky, Yury; Kosenko, Elena

    2009-10-19

    In hyperammonemia, a decrease in brain ATP can be a result of adenine nucleotide catabolism. Xanthine dehydrogenase (XD) and xanthine oxidase (XO) are the end steps in the purine catabolic pathway and directly involved in depletion of the adenylate pool in the cell. Besides, XD can easily be converted to XO to produce reactive oxygen species in the cell. In this study, the effects of acute ammonia intoxication in vivo on brain adenine nucleotide pool and xanthine and hypoxanthine, the end degradation products of adenine nucleotides, during the conversion of XD to XO were studied. Injection of rats with ammonium acetate was shown to lead to the dramatic decrease in the ATP level, adenine nucleotide pool size and adenylate energy charge and to the great increase in hypoxanthine and xanthine 11 min after the lethal dose indicating rapid degradation of adenylates. Conversion of XD to XO in hyperammonemic rat brain was evidenced by elevated XO/XD activity ratio. Injection of MK-801, a NMDA receptor blocker, prevented ammonia-induced catabolism of adenine nucleotides and conversion of XD to XO suggesting that in vivo these processes are mediated by activation of NMDA receptors. The in vitro dose-dependent effects of sodium nitroprusside, a NO donor, on XD and XO activities are indicative of the direct modification of the enzymes by nitric oxide. This is the first report evidencing the increase in brain xanthine and hypoxanthine levels and adenine nucleotide breakdown in acute ammonia intoxication and NMDA receptor-mediated prevention of these alterations.

  12. Phenolic amides are potent inhibitors of De Novo nucleotide biosynthesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposuremore » leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [ 15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. Furthermore, the results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals.« less

  13. Water-mediated protein-fluorophore interactions modulate the affinity of an ABC-ATPase/TNP-ADP complex.

    PubMed

    Oswald, Christine; Jenewein, Stefan; Smits, Sander H J; Holland, I Barry; Schmitt, Lutz

    2008-04-01

    TNP-modified nucleotides have been used extensively to study protein-nucleotide interactions. In the case of ABC-ATPases, application of these powerful tools has been greatly restricted due to the significantly higher affinity of the TNP-nucleotide for the corresponding ABC-ATPase in comparison to the non-modified nucleotides. To understand the molecular changes occurring upon binding of the TNP-nucleotide to an ABC-ATPase, we have determined the crystal structure of the TNP-ADP/HlyB-NBD complex at 1.6A resolution. Despite the higher affinity of TNP-ADP, no direct fluorophore-protein interactions were observed. Unexpectedly, only water-mediated interactions were detected between the TNP moiety and Tyr(477), that is engaged in pi-pi stacking with the adenine ring, as well as with two serine residues (Ser(504) and Ser(509)) of the Walker A motif. Interestingly, the side chains of these two serine residues adopt novel conformations that are not observed in the corresponding ADP structure. However, in the crystal structure of the S504A mutant, which binds TNP-ADP with similar affinity to the wild type enzyme, a novel TNP-water interaction compensates for the missing serine side chain. Since this water molecule is not present in the wild type enzyme, these results suggest that only water-mediated interactions provide a structural explanation for the increased affinity of TNP-nucleotides towards ABC-ATPases. However, our results also imply that in silico approaches such as docking or modeling cannot directly be applied to generate 'affinity-adopted' ADP- or ATP-analogs for ABC-ATPases.

  14. Genome-wide patterns of recombination, linkage disequilibrium and nucleotide diversity from pooled resequencing and single nucleotide polymorphism genotyping unlock the evolutionary history of Eucalyptus grandis.

    PubMed

    Silva-Junior, Orzenil B; Grattapaglia, Dario

    2015-11-01

    We used high-density single nucleotide polymorphism (SNP) data and whole-genome pooled resequencing to examine the landscape of population recombination (ρ) and nucleotide diversity (ϴw ), assess the extent of linkage disequilibrium (r(2) ) and build the highest density linkage maps for Eucalyptus. At the genome-wide level, linkage disequilibrium (LD) decayed within c. 4-6 kb, slower than previously reported from candidate gene studies, but showing considerable variation from absence to complete LD up to 50 kb. A sharp decrease in the estimate of ρ was seen when going from short to genome-wide inter-SNP distances, highlighting the dependence of this parameter on the scale of observation adopted. Recombination was correlated with nucleotide diversity, gene density and distance from the centromere, with hotspots of recombination enriched for genes involved in chemical reactions and pathways of the normal metabolic processes. The high nucleotide diversity (ϴw = 0.022) of E. grandis revealed that mutation is more important than recombination in shaping its genomic diversity (ρ/ϴw = 0.645). Chromosome-wide ancestral recombination graphs allowed us to date the split of E. grandis (1.7-4.8 million yr ago) and identify a scenario for the recent demographic history of the species. Our results have considerable practical importance to Genome Wide Association Studies (GWAS), while indicating bright prospects for genomic prediction of complex phenotypes in eucalypt breeding. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  15. Phenolic amides are potent inhibitors of De Novo nucleotide biosynthesis

    DOE PAGES

    Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; ...

    2015-06-12

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposuremore » leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [ 15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. Furthermore, the results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals.« less

  16. Exploring the Roles of Nucleobase Desolvation and Shape Complementarity during the Misreplication of O6-Methylguanine

    PubMed Central

    Chavarria, Delia; Ramos-Serrano, Andrea; Hirao, Ichiro; Berdis, Anthony J.

    2011-01-01

    O6-methylguanine is a miscoding DNA lesion arising from the alkylation of guanine. This report uses the bacteriophage T4 DNA polymerase as a model to probe the roles hydrogen-bonding interactions, shape/size, and nucleobase desolvation during the replication of this miscoding lesion. This was accomplished by using transient kinetic techniques to monitor the kinetic parameters for incorporating and extending natural and non-natural nucleotides. In general, the efficiency of nucleotide incorporation does not depend on the hydrogen-bonding potential of the incoming nucleotide. Instead, nucleobase hydrophobicity and shape complementarity appear to be the preeminent factors controlling nucleotide incorporation. In addition, shape complementarity plays a large role in controlling the extension of various mispairs containing O6-methylguanine. This is evident as the rate constants for extension correlate with proper interglycosyl distances and symmetry between the base angles of the formed mispair. Base pairs not conforming to an acceptable geometry within the polymerase’s active site are refractory to elongation and are processed via exonuclease proofreading. The collective data set encompassing nucleotide incorporation, extension, and excision is used to generate a model accounting for the mutagenic potential of O6-methylguanine observed in vivo. In addition, kinetic studies monitoring the incorporation and extension of non-natural nucleotides identified an analog that displays high selectivity for incorporation opposite O6-methylguanine compared to unmodified purines. The unusual selectivity of this analog for replicating damaged DNA provides a novel biochemical tool to study translesion DNA synthesis. PMID:21819995

  17. Pre-Steady State Kinetic Investigation of the Incorporation of Anti-Hepatitis B Nucleotide Analogs Catalyzed by Non-Canonical Human DNA Polymerases

    PubMed Central

    Brown, Jessica A.; Pack, Lindsey R.; Fowler, Jason D.; Suo, Zucai

    2011-01-01

    Antiviral nucleoside analogs have been developed to inhibit the enzymatic activities of the hepatitis B virus (HBV) polymerase, thereby preventing the replication and production of HBV. However, the usage of these analogs can be limited by drug toxicity because the 5′-triphosphates of these nucleoside analogs (nucleotide analogs) are potential substrates for human DNA polymerases to incorporate into host DNA. Although they are poor substrates for human replicative DNA polymerases, it remains to be established whether these nucleotide analogs are substrates for the recently discovered human X- and Y-family DNA polymerases. Using pre-steady state kinetic techniques, we have measured the substrate specificity values for human DNA polymerases β, λ, η, ι, κ, and Rev1 incorporating the active forms of the following anti-HBV nucleoside analogs approved for clinical use: adefovir, tenofovir, lamivudine, telbivudine, and entecavir. Compared to the incorporation of a natural nucleotide, most of the nucleotide analogs were incorporated less efficiently (2 to >122,000) by the six human DNA polymerases. In addition, the potential for entecavir and telbivudine, two drugs which possess a 3′-hydroxyl, to become embedded into human DNA was examined by primer extension and DNA ligation assays. These results suggested that telbivudine functions as a chain terminator while entecavir was efficiently extended by the six enzymes and was a substrate for human DNA ligase I. Our findings suggested that incorporation of anti-HBV nucleotide analogs catalyzed by human X- and Y-family polymerases may contribute to clinical toxicity. PMID:22132702

  18. Profiles of the biosynthesis and metabolism of pyridine nucleotides in potatoes (Solanum tuberosum L.).

    PubMed

    Katahira, Riko; Ashihara, Hiroshi

    2009-12-01

    As part of a research program on nucleotide metabolism in potato tubers (Solanum tuberosum L.), profiles of pyridine (nicotinamide) metabolism were examined based on the in situ metabolic fate of radio-labelled precursors and the in vitro activities of enzymes. In potato tubers, [(3)H]quinolinic acid, which is an intermediate of de novo pyridine nucleotide synthesis, and [(14)C]nicotinamide, a catabolite of NAD, were utilised for pyridine nucleotide synthesis. The in situ tracer experiments and in vitro enzyme assays suggest the operation of multiple pyridine nucleotide cycles. In addition to the previously proposed cycle consisting of seven metabolites, we found a new cycle that includes newly discovered nicotinamide riboside deaminase which is also functional in potato tubers. This cycle bypasses nicotinamide and nicotinic acid; it is NAD --> nicotinamide mononucleotide --> nicotinamide riboside --> nicotinic acid riboside --> nicotinic acid mononucleotide --> nicotinic acid adenine dinucleotide --> NAD. Degradation of the pyridine ring was extremely low in potato tubers. Nicotinic acid glucoside is formed from nicotinic acid in potato tubers. Comparative studies of [carboxyl-(14)C]nicotinic acid metabolism indicate that nicotinic acid is converted to nicotinic acid glucoside in all organs of potato plants. Trigonelline synthesis from [carboxyl-(14)C]nicotinic acid was also found. Conversion was greater in green parts of plants, such as leaves and stem, than in underground parts of potato plants. Nicotinic acid utilised for the biosynthesis of these conjugates seems to be derived not only from the pyridine nucleotide cycle, but also from the de novo synthesis of nicotinic acid mononucleotide.

  19. Interactions of 1,12-diamino-4,9-dioxadodecane (OSpm) and Cu(II) ions with pyrimidine and purine nucleotides: adenosine-5'-monophosphate (AMP) and cytidine-5'-monophosphate (CMP).

    PubMed

    Lomozik, L; Gasowska, A; Krzysko, G

    2006-11-01

    The interactions of Cu(II) ions with adenosine-5'-monophosphate (AMP), cytidine-5'-monophosphate (CMP) and 1,12-diamino-4,9-dioxadodecane (OSpm) were studied. A potentiometric method was applied to determine the composition and stability constants of complexes formed, while the mode of interactions was analysed by spectral methods (ultraviolet and visible spectroscopy (UV-Vis), electron paramagnetic resonance (EPR), (13)C NMR, (31)P NMR). In metal-free systems, molecular complexes nucleotide-polyamine (NMP)H(x)(OSpm) were formed. The endocyclic nitrogen atoms of the purine ring N(1), N(7), the nitrogen atom of the pyrimidine ring N(3), the oxygen atoms of the phosphate group of the nucleotide and the protonated nitrogen atoms of the polyamine were the reaction centres. The mode of interaction of the metal ion with OSpm and the nucleotides (AMP or CMP) in the coordination compounds was established. In the system Cu(II)/OSpm the dinuclear complex Cu(2)(OSpm) forms, while in the ternary systems Cu(II)/nucleotide/OSpm the species type MH(x)LL' and MLL' appear. In the MH(x)LL' type species, the main centres of copper (II) ion binding in the nucleotide are the phosphate groups. The protonated amino groups of OSpm are involved in non-covalent interaction with the nitrogen atoms N(1), N(7) or N(3) of the purine or pyrimidine ring, whereas at higher pH, deprotonated nitrogen atoms of polyamine are engaged in metallation in MLL' species.

  20. Kinetics of Interaction between ADP-ribosylation Factor-1 (Arf1) and the Sec7 Domain of Arno Guanine Nucleotide Exchange Factor, Modulation by Allosteric Factors, and the Uncompetitive Inhibitor Brefeldin A

    PubMed Central

    Rouhana, Jad; Padilla, André; Estaran, Sébastien; Bakari, Sana; Delbecq, Stephan; Boublik, Yvan; Chopineau, Joel; Pugnière, Martine; Chavanieu, Alain

    2013-01-01

    The GDP/GTP nucleotide exchange of Arf1 is catalyzed by nucleotide exchange factors (GEF), such as Arno, which act through their catalytic Sec7 domain. This exchange is a complex mechanism that undergoes conformational changes and intermediate complex species involving several allosteric partners such as nucleotides, Mg2+, and Sec7 domains. Using a surface plasmon resonance approach, we characterized the kinetic binding parameters for various intermediate complexes. We first confirmed that both GDP and GTP counteract equivalently to the free-nucleotide binary Arf1-Arno complex stability and revealed that Mg2+ potentiates by a factor of 2 the allosteric effect of GDP. Then we explored the uncompetitive inhibitory mechanism of brefeldin A (BFA) that conducts to an abortive pentameric Arf1-Mg2+-GDP-BFA-Sec7 complex. With BFA, the association rate of the abortive complex is drastically reduced by a factor of 42, and by contrast, the 15-fold decrease of the dissociation rate concurs to stabilize the pentameric complex. These specific kinetic signatures have allowed distinguishing the level and nature as well as the fate in real time of formed complexes according to experimental conditions. Thus, we showed that in the presence of GDP, the BFA-resistant Sec7 domain of Arno can also associate to form a pentameric complex, which suggests that the uncompetitive inhibition by BFA and the nucleotide allosteric effect combine to stabilize such abortive complex. PMID:23255605

  1. Molecular population genetics of inversion breakpoint regions in Drosophila pseudoobscura.

    PubMed

    Wallace, Andre G; Detweiler, Don; Schaeffer, Stephen W

    2013-07-08

    Paracentric inversions in populations can have a profound effect on the pattern and organization of nucleotide variability along a chromosome. Regions near inversion breakpoints are expected to have greater levels of differentiation because of reduced genetic exchange between different gene arrangements whereas central regions in the inverted segments are predicted to have lower levels of nucleotide differentiation due to greater levels of genetic flux among different karyotypes. We used the inversion polymorphism on the third chromosome of Drosophila pseudoobscura to test these predictions with an analysis of nucleotide diversity of 18 genetic markers near and away from inversion breakpoints. We tested hypotheses about how the presence of different chromosomal arrangements affects the pattern and organization of nucleotide variation. Overall, markers in the distal segment of the chromosome had greater levels of nucleotide heterozygosity than markers within the proximal segment of the chromosome. In addition, our results rejected the hypothesis that the breakpoints of derived inversions will have lower levels of nucleotide variability than breakpoints of ancestral inversions, even when strains with gene conversion events were removed. High levels of linkage disequilibrium were observed within all 11 breakpoint regions as well as between the ends of most proximal and distal breakpoints. The central region of the chromosome had the greatest levels of linkage disequilibrium compared with the proximal and distal regions because this is the region that experiences the highest level of recombination suppression. These data do not fully support the idea that genetic exchange is the sole force that influences genetic variation on inverted chromosomes.

  2. Biological nanopore MspA for DNA sequencing

    NASA Astrophysics Data System (ADS)

    Manrao, Elizabeth A.

    Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.

  3. Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

    PubMed

    Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

    2014-11-01

    As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  4. Attempts to increase inosinic acid in broiler meat by using feed additives.

    PubMed

    Wang, X F; Liu, G H; Cai, H Y; Chang, W H; Ma, J S; Zheng, A J; Zhang, S

    2014-11-01

    To explore regulation of inosinic acid content in chicken meat as a result of feed additives, 576 one-day-old male Arbor Acres broilers were randomly allotted into 8 dietary treatments including control, purine nucleotide (P), betaine (B), soybean isoflavone (S), purine nucleotide + betaine (PB), purine nucleotide + soybean isoflavone (PS), betaine +soybean isoflavone (BS), and purine nucleotide + betaine + soybean isoflavone (PBS) by a 2 × 2 × 2 factorial arrangement. At d 42 of age, broilers were slaughtered, and growth performance, carcass characteristics, inosinic acid content, and activities of enzyme closely related to inosinic acid metabolism of broilers were measured. The results revealed that these feed additives did not affect ADG and ADFI of the broilers (P > 0.05). However, supplementing purine nucleotides lowered feed/gain of broilers in PS and PBS groups (P < 0.05). There was a significant interaction on feed/gain of broilers between purine nucleotides and soybean isoflavone (P < 0.05). The abdominal fat percentages in groups B, S, BS, and PBS were lower than the control group, respectively (P < 0.05). The thigh muscle percentages of groups P and B were higher than that of group PB (P < 0.05). There were certain interactions on the percentage of thigh muscle (P = 0.05) and abdominal fat (P < 0.05) between P, B, and S groups. Compared with the control group, inosinic acid content in broiler breast meat was improved by using feed additives (P < 0.05). Supplementing purine nucleotides, betaine, soybean isoflavone, and their combinations increased alkaline phosphatase activity in breast meat of broilers (P < 0.05). Purine nucleotides improved the activity of adenosine deaminase, but decreased the activity of 5'-nucleotidase. Soybean isoflavone lowered the activity of alkaline phosphatase. There were no significant interactions on activities of creatine kinase, adenosine deaminase, alkaline phosphatase, and 5'-nucleotidase between these additives (P > 0.05). The umami rating of broiler breast meat increased in conjunction with supplementing these additives. In conclusion, supplementing standard feed with the additives investigated in this study could improve inosinic acid content in chicken meat by increasing synthase activity or inhibiting degradation enzyme activity without inferior growth performance and carcass quality. ©2014 Poultry Science Association Inc.

  5. Occurrence of the regulatory nucleotides ppGpp and pppGpp following induction of the stringent response in staphylococci.

    PubMed Central

    Cassels, R; Oliva, B; Knowles, D

    1995-01-01

    The stringent response in Escherichia coli and many other organisms is regulated by the nucleotides ppGpp and pppGpp. We show here for the first time that at least six staphylococcal species also synthesize ppGpp and pppGpp upon induction of the stringent response by mupirocin. Spots corresponding to ppGpp and pppGpp on thin-layer chromatograms suggest that pppGpp is the principal regulatory nucleotide synthesized by staphylococci in response to mupirocin, rather than ppGpp as in E. coli. PMID:7665499

  6. [Natural nucleotide polymorphism of the Srlk gene that determines salt stress tolerance in alfalfa (Medicago sativa L)].

    PubMed

    Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K

    2014-04-01

    Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.

  7. Responses of Adenine Nucleotides in Germinating Soybean Embryonic Axes to Exogenously Applied Adenine and Adenosine

    PubMed Central

    Anderson, James D.

    1977-01-01

    The ATP content of soybean (Glycine max [L.] Merr. cv. Kent) axes incubated for 3 hours in 1 mm solutions of adenine and adenosine increased over 100% and 75%, respectively, over axes incubated in water. The increase in ATP was primarily due to the conversion of these purines to nucleotides via the nucleotide salvage pathway. The ATP formed was in a metabolically active pool because label from adenine was incorporated into acid-insoluble material. Adenine also increased the levels of GTP, UTP, and CTP, but not to the extent of the ATP level. PMID:16660165

  8. The RNA-mediated, asymmetric ring regulatory mechanism of the transcription termination Rho helicase decrypted by time-resolved nucleotide analog interference probing (trNAIP).

    PubMed

    Soares, Emilie; Schwartz, Annie; Nollmann, Marcello; Margeat, Emmanuel; Boudvillain, Marc

    2014-08-01

    Rho is a ring-shaped, ATP-dependent RNA helicase/translocase that dissociates transcriptional complexes in bacteria. How RNA recognition is coupled to ATP hydrolysis and translocation in Rho is unclear. Here, we develop and use a new combinatorial approach, called time-resolved Nucleotide Analog Interference Probing (trNAIP), to unmask RNA molecular determinants of catalytic Rho function. We identify a regulatory step in the translocation cycle involving recruitment of the 2'-hydroxyl group of the incoming 3'-RNA nucleotide by a Rho subunit. We propose that this step arises from the intrinsic weakness of one of the subunit interfaces caused by asymmetric, split-ring arrangement of primary RNA tethers around the Rho hexamer. Translocation is at highest stake every seventh nucleotide when the weak interface engages the incoming 3'-RNA nucleotide or breaks, depending on RNA threading constraints in the Rho pore. This substrate-governed, 'test to run' iterative mechanism offers a new perspective on how a ring-translocase may function or be regulated. It also illustrates the interest and versatility of the new trNAIP methodology to unveil the molecular mechanisms of complex RNA-based systems. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Dietary nucleotide supplementation raises erythrocyte 2, 3-diphosphoglycerate concentration in neonatal rats.

    PubMed

    Scopesi, F; Verkeste, C M; Paola, D; Gazzolo, D; Pronzato, M A; Bruschettini, P L; Marinari, U M

    1999-03-01

    The present study was designed to test if dietary intake of nucleotides increases erythrocyte 2,3-diphosphoglycerate (2,3-DPG) in neonatal rats. To this end, rat pups were fed a nucleotide-supplemented formula (S, n = 14) from d 9 until d 16 after birth. The results were compared with those obtained from a group of breast-fed pups (C, n = 14) and a group of pups artificially fed with nucleotide-free formula (NS, n = 14). Neonatal weight, 2,3-DPG concentration, hematocrit (Hct) and hemoglobin concentration (Hb) were determined before the experiment (d 9) and after 7 d of treatment (d 16). In all groups, 2,3-DPG concentration was greater at d 16 than d 9, and the increase was greater in the S group than in the NS group. Alterations in neonatal weight, Hct and Hb concentration did not differ among the groups. On d 16 the 2, 3-DPG/Hb ratio, reflecting the affinity of hemoglobin for oxygen, was significantly higher in the C and S groups than in the NS group. We conclude that in neonatal rats, dietary nucleotides increase erythrocyte 2,3-DPG concentration. Studies need to be conducted in humans to assess the effect of this increase on both neonatal peripheral hemodynamics and metabolism in this species.

  10. Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

    PubMed Central

    Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

    2016-01-01

    Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

  11. Structural basis for modulation and agonist specificity of HCN pacemaker channels.

    PubMed

    Zagotta, William N; Olivier, Nelson B; Black, Kevin D; Young, Edgar C; Olson, Rich; Gouaux, Eric

    2003-09-11

    The family of hyperpolarization-activated, cyclic nucleotide-modulated (HCN) channels are crucial for a range of electrical signalling, including cardiac and neuronal pacemaker activity, setting resting membrane electrical properties and dendritic integration. These nonselective cation channels, underlying the I(f), I(h) and I(q) currents of heart and nerve cells, are activated by membrane hyperpolarization and modulated by the binding of cyclic nucleotides such as cAMP and cGMP. The cAMP-mediated enhancement of channel activity is largely responsible for the increase in heart rate caused by beta-adrenergic agonists. Here we have investigated the mechanism underlying this modulation by studying a carboxy-terminal fragment of HCN2 containing the cyclic nucleotide-binding domain (CNBD) and the C-linker region that connects the CNBD to the pore. X-ray crystallographic structures of this C-terminal fragment bound to cAMP or cGMP, together with equilibrium sedimentation analysis, identify a tetramerization domain and the mechanism for cyclic nucleotide specificity, and suggest a model for ligand-dependent channel modulation. On the basis of amino acid sequence similarity to HCN channels, the cyclic nucleotide-gated, and eag- and KAT1-related families of channels are probably related to HCN channels in structure and mechanism.

  12. Molecular detection of viral agents in free-ranging and captive neotropical felids in Brazil.

    PubMed

    Furtado, Mariana M; Taniwaki, Sueli A; de Barros, Iracema N; Brandão, Paulo E; Catão-Dias, José L; Cavalcanti, Sandra; Cullen, Laury; Filoni, Claudia; Jácomo, Anah T de Almeida; Jorge, Rodrigo S P; Silva, Nairléia Dos Santos; Silveira, Leandro; Ferreira Neto, José S

    2017-09-01

    We describe molecular testing for felid alphaherpesvirus 1 (FHV-1), carnivore protoparvovirus 1 (CPPV-1), feline calicivirus (FCV), alphacoronavirus 1 (feline coronavirus [FCoV]), feline leukemia virus (FeLV), feline immunodeficiency virus (FIV), and canine distemper virus (CDV) in whole blood samples of 109 free-ranging and 68 captive neotropical felids from Brazil. Samples from 2 jaguars ( Panthera onca) and 1 oncilla ( Leopardus tigrinus) were positive for FHV-1; 2 jaguars, 1 puma ( Puma concolor), and 1 jaguarundi ( Herpairulus yagouaroundi) tested positive for CPPV-1; and 1 puma was positive for FIV. Based on comparison of 103 nucleotides of the UL24-UL25 gene, the FHV-1 sequences were 99-100% similar to the FHV-1 strain of domestic cats. Nucleotide sequences of CPPV-1 were closely related to sequences detected in other wild carnivores, comparing 294 nucleotides of the VP1 gene. The FIV nucleotide sequence detected in the free-ranging puma, based on comparison of 444 nucleotides of the pol gene, grouped with other lentiviruses described in pumas, and had 82.4% identity with a free-ranging puma from Yellowstone Park and 79.5% with a captive puma from Brazil. Our data document the circulation of FHV-1, CPPV-1, and FIV in neotropical felids in Brazil.

  13. Glutamine 89 is a key residue in the allosteric modulation of human serine racemase activity by ATP.

    PubMed

    Canosa, Andrea V; Faggiano, Serena; Marchetti, Marialaura; Armao, Stefano; Bettati, Stefano; Bruno, Stefano; Percudani, Riccardo; Campanini, Barbara; Mozzarelli, Andrea

    2018-06-13

    Serine racemase (SR) catalyses two reactions: the reversible racemisation of L-serine and the irreversible dehydration of L- and D-serine to pyruvate and ammonia. SRs are evolutionarily related to serine dehydratases (SDH) and degradative threonine deaminases (TdcB). Most SRs and TdcBs - but not SDHs - are regulated by nucleotides. SR binds ATP cooperatively and the nucleotide allosterically stimulates the serine dehydratase activity of the enzyme. A H-bond network comprising five residues (T52, N86, Q89, E283 and N316) and water molecules connects the active site with the ATP-binding site. Conservation analysis points to Q89 as a key residue for the allosteric communication, since its mutation to either Met or Ala is linked to the loss of control of activity by nucleotides. We verified this hypothesis by introducing the Q89M and Q89A point mutations in the human SR sequence. The allosteric communication between the active site and the allosteric site in both mutants is almost completely abolished. Indeed, the stimulation of the dehydratase activity by ATP is severely diminished and the binding of the nucleotide is no more cooperative. Ancestral state reconstruction suggests that the allosteric control by nucleotides established early in SR evolution and has been maintained in most eukaryotic lineages.

  14. DNA sequence analysis of simian virus 40 mutants with deletions mapping in the leader region of the late viral mRNA's: mutants with deletions similar in size and position exhibit varied phenotypes.

    PubMed

    Barkan, A; Mertz, J E

    1981-02-01

    The nucleotide sequences of 10 viable yet partially defective deletion mutants of simian virus 40 were determined. The deletions mapped within, and, in many cases, 5' to, the predominant leader sequence of the late viral mRNA's. They ranged from 74 to 187 nucleotide pairs in length. Six of the mutants had lost the sequence that corresponds to the "cap" site (5' terminus) of the most abundant class of 16S mRNA's. One of these mutants had a deletion that extended 103 nucleotide pairs into the region preceding this primary cap site and, therefore, was missing many secondary cap sites as well. A seventh mutant lacked the entire major 16S leader sequence except for the first six nucleotides at its 5' end and the last nine at its 3' end. Although these mutants differed in the size and position of their deletions, we were unable to discover any simple correlations between their growth characteristics and their DNA sequences. This finding indicates that the secondary structures of the RNA transcripts may play a more important role than the exact nucleotide sequence of the RNAs in determining how they function within the cell.

  15. The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

    PubMed Central

    Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

    1982-01-01

    The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

  16. T box transcription antitermination riboswitch: Influence of nucleotide sequence and orientation on tRNA binding by the antiterminator element

    PubMed Central

    Fauzi, Hamid; Agyeman, Akwasi; Hines, Jennifer V.

    2008-01-01

    Many bacteria utilize riboswitch transcription regulation to monitor and appropriately respond to cellular levels of important metabolites or effector molecules. The T box transcription antitermination riboswitch responds to cognate uncharged tRNA by specifically stabilizing an antiterminator element in the 5′-untranslated mRNA leader region and precluding formation of a thermodynamically more stable terminator element. Stabilization occurs when the tRNA acceptor end base pairs with the first four nucleotides in the seven nucleotide bulge of the highly conserved antiterminator element. The significance of the conservation of the antiterminator bulge nucleotides that do not base pair with the tRNA is unknown, but they are required for optimal function. In vitro selection was used to determine if the isolated antiterminator bulge context alone dictates the mode in which the tRNA acceptor end binds the bulge nucleotides. No sequence conservation beyond complementarity was observed and the location was not constrained to the first four bases of the bulge. The results indicate that formation of a structure that recognizes the tRNA acceptor end in isolation is not the determinant driving force for the high phylogenetic sequence conservation observed within the antiterminator bulge. Additional factors or T box leader features more likely influenced the phylogenetic sequence conservation. PMID:19152843

  17. PCR/LDR/capillary electrophoresis for detection of single-nucleotide differences between fetal and maternal DNA in maternal plasma.

    PubMed

    Yi, Ping; Chen, Zhuqin; Zhao, Yan; Guo, Jianxin; Fu, Huabin; Zhou, Yuanguo; Yu, Lili; Li, Li

    2009-03-01

    The discovery of fetal DNA in maternal plasma has opened up an approach for noninvasive diagnosis. We have now assessed the possibility of detecting single-nucleotide differences between fetal and maternal DNA in maternal plasma by polymerase chain reaction (PCR)/ligase detection reaction((LDR)/capillary electrophoresis. PCR/LDR/capillary electrophoresis was applied to detect the genotype of c.454-397T>gene (ESR1) from experimental DNA models of maternal plasma at different sensitivity levels and 13 maternal plasma samples.alphaC in estrogen receptor. (1) Our results demonstrated that the technique could discriminate low abundance single-nucleotide mutation with a mutant/normal allele ratio up to 1:10 000. (2) Examination of ESR1 c.454-397T>C genotypes by using the method of restriction fragment length analysis was performed in 25 pregnant women, of whom 13 pregnant women had homozygous genotypes. The c.454-397T>C genotypes of paternally inherited fetal DNA in maternal plasma of these 13 women were detected by PCR/LDR/capillary electrophoresis, which were accordant with the results of umbilical cord blood. PCR/LDR/capillary electrophoresis has very high sensitivity to distinguish low abundance single nucleotide differences and can discriminate point mutations and single-nucleotide polymorphisms(SNPs) of paternally inherited fetal DNA in maternal plasma.

  18. Substrate-specifying determinants of the nucleotide pyrophosphatases/phosphodiesterases NPP1 and NPP2

    PubMed Central

    2004-01-01

    The nucleotide pyrophosphatases/phosphodiesterases NPP1 and NPP2/autotaxin are structurally related eukaryotic ecto-enzymes, but display a very different substrate specificity. NPP1 releases nucleoside 5′-monophosphates from various nucleotides, whereas NPP2 mainly functions as a lysophospholipase D. We have used a domain-swapping approach to map substrate-specifying determinants of NPP1 and NPP2. The catalytic domain of NPP1 fused to the N- and C-terminal domains of NPP2 was hyperactive as a nucleotide phosphodiesterase, but did not show any lysophospholipase D activity. In contrast, chimaeras of the catalytic domain of NPP2 and the N- and/or C-terminal domains of NPP1 were completely inactive. These data indicate that the catalytic domain as well as both extremities of NPP2 contain lysophospholipid-specifying sequences. Within the catalytic domain of NPP1 and NPP2, we have mapped residues close to the catalytic site that determine the activities towards nucleotides and lysophospholipids. We also show that the conserved Gly/Phe-Xaa-Gly-Xaa-Xaa-Gly (G/FXGXXG) motif near the catalytic site is required for metal binding, but is not involved in substrate-specification. Our data suggest that the distinct activities of NPP1 and NPP2 stem from multiple differences throughout the polypeptide chain. PMID:15096095

  19. Nucleotide sequence variation at two genes of the phenylpropanoid pathway, the FAH1 and F3H genes, in Arabidopsis thaliana.

    PubMed

    Aguadé, M

    2001-01-01

    The FAH1 and F3H genes encode ferulate-5-hydroxylase and flavanone-3-hydroxylase, which are enzymes in the pathways leading to the synthesis of sinapic acid esters and flavonoids, respectively. Nucleotide variation at these genes was surveyed by sequencing a sample of 20 worldwide Arabidopsis thaliana ecotypes and one Arabidopsis lyrata spp. petraea stock. In contrast with most previously studied genes, the percentage of singletons was rather low in both the FAH1 and the F3H gene regions. There was, therefore, no footprint of a recent species expansion in the pattern of nucleotide variation in these regions. In both FAH1 and F3H, nucleotide variation was structured into two major highly differentiated haplotypes. In both genes, there was a peak of silent polymorphism in the 5' part of the coding region without a parallel increase in silent divergence. In FAH1, the peak was centered at the beginning of the second exon. In F3H, nucleotide diversity was highest at the beginning of the gene. The observed pattern of variation in both FAH1 and F3H, although suggestive of balancing selection, was compatible with a neutral model with no recombination.

  20. Pyridine nucleotides in regulation of cell death and survival by redox and non-redox reactions.

    PubMed

    Novak Kujundžić, Renata; Žarković, Neven; Gall Trošelj, Koraljka

    2014-01-01

    Changes of the level and ratios of pyridine nucleotides determine metabolism- dependent cellular redox status and the activity of poly(ADP-ribose) polymerases (PARPs) and sirtuins, thereby influencing several processes closely related to cell survival and death. Pyridine nucleotides participate in numerous metabolic reactions whereby their net cellular level remains constant, but the ratios of NAD+/NADP+ and NADH/NADPH oscillate according to metabolic changes in response to diverse stress signals. In non-redox reactions, NAD+ is degraded and quickly, afterward, resynthesized in the NAD+ salvage pathway, unless overwhelming activation of PARP-1 consumes NAD+ to the point of no return, when the cell can no longer generate enough ATP to accommodate NAD+ resynthesis. The activity of PARP-1 is mandatory for the onset of cytoprotective autophagy on sublethal stress signals. It has become increasingly clear that redox status, largely influenced by the metabolism-dependent composition of the pyridine nucleotides pool, plays an important role in the synthesis of pro-apoptotic and anti-apoptotic sphingolipids. Awareness of the involvement of the prosurvival sphingolipid, sphingosine-1-phosphate, in transition from inflammation to malignant transformation has recently emerged. Here, the participation of pyridine nucleotides in redox and non-redox reactions, sphingolipid metabolism, and their role in cell fate decisions is reviewed.

  1. CryoEM structure of a prokaryotic cyclic nucleotide-gated ion channel

    PubMed Central

    James, Zachary M.; Borst, Andrew J.; Haitin, Yoni; Frenz, Brandon; DiMaio, Frank; Zagotta, William N.; Veesler, David

    2017-01-01

    Cyclic nucleotide-gated (CNG) and hyperpolarization-activated cyclic nucleotide-regulated (HCN) ion channels play crucial physiological roles in phototransduction, olfaction, and cardiac pace making. These channels are characterized by the presence of a carboxyl-terminal cyclic nucleotide-binding domain (CNBD) that connects to the channel pore via a C-linker domain. Although cyclic nucleotide binding has been shown to promote CNG and HCN channel opening, the precise mechanism underlying gating remains poorly understood. Here we used cryoEM to determine the structure of the intact LliK CNG channel isolated from Leptospira licerasiae—which shares sequence similarity to eukaryotic CNG and HCN channels—in the presence of a saturating concentration of cAMP. A short S4–S5 linker connects nearby voltage-sensing and pore domains to produce a non–domain-swapped transmembrane architecture, which appears to be a hallmark of this channel family. We also observe major conformational changes of the LliK C-linkers and CNBDs relative to the crystal structures of isolated C-linker/CNBD fragments and the cryoEM structures of related CNG, HCN, and KCNH channels. The conformation of our LliK structure may represent a functional state of this channel family not captured in previous studies. PMID:28396445

  2. Aspergillus and Penicillium identification using DNA sequences: Barcode or MLST?

    USDA-ARS?s Scientific Manuscript database

    Current methods in DNA technology can detect single nucleotide polymorphisms with measurable accuracy using several different approaches appropriate for different uses. If there are even single nucleotide differences that are invariant markers of the species, we can accomplish identification through...

  3. Structural basis for allosteric cross-talk between the asymmetric nucleotide binding sites of a heterodimeric ABC exporter.

    PubMed

    Hohl, Michael; Hürlimann, Lea M; Böhm, Simon; Schöppe, Jendrik; Grütter, Markus G; Bordignon, Enrica; Seeger, Markus A

    2014-07-29

    ATP binding cassette (ABC) transporters mediate vital transport processes in every living cell. ATP hydrolysis, which fuels transport, displays positive cooperativity in numerous ABC transporters. In particular, heterodimeric ABC exporters exhibit pronounced allosteric coupling between a catalytically impaired degenerate site, where nucleotides bind tightly, and a consensus site, at which ATP is hydrolyzed in every transport cycle. Whereas the functional phenomenon of cooperativity is well described, its structural basis remains poorly understood. Here, we present the apo structure of the heterodimeric ABC exporter TM287/288 and compare it to the previously solved structure with adenosine 5'-(β,γ-imido)triphosphate (AMP-PNP) bound at the degenerate site. In contrast to other ABC exporter structures, the nucleotide binding domains (NBDs) of TM287/288 remain in molecular contact even in the absence of nucleotides, and the arrangement of the transmembrane domains (TMDs) is not influenced by AMP-PNP binding, a notion confirmed by double electron-electron resonance (DEER) measurements. Nucleotide binding at the degenerate site results in structural rearrangements, which are transmitted to the consensus site via two D-loops located at the NBD interface. These loops owe their name from a highly conserved aspartate and are directly connected to the catalytically important Walker B motif. The D-loop at the degenerate site ties the NBDs together even in the absence of nucleotides and substitution of its aspartate by alanine is well-tolerated. By contrast, the D-loop of the consensus site is flexible and the aspartate to alanine mutation and conformational restriction by cross-linking strongly reduces ATP hydrolysis and substrate transport.

  4. The influence of specific neighboring bases on substitution bias in noncoding regions of the plant chloroplast genome.

    PubMed

    Morton, B R; Oberholzer, V M; Clegg, M T

    1997-09-01

    Substitutions occurring in noncoding sequences of the plant chloroplast genome violate the independence of sites that is assumed by substitution models in molecular evolution. The probability that a substitution at a site is a transversion, as opposed to a transition, increases significantly with increasing A + T content of the two adjacent nucleotides. In the present study, this dependency of substitutions on local context is examined further in a number of noncoding regions from the chloroplast genome of members of the grass family (Poaceae). Two features were examined; the influence of specific neighboring bases, as opposed to the general A + T content, on transversion proportion and an influence on substitutions by nucleotides other than the two immediately adjacent to the site of substitution. In both cases, a significant effect was found. In the case of specific nucleotides, transversion proportion is significantly higher at sites with a pyrimidine immediately 5' on either strand. Substitutions at sites of the type YNR, where N is the site of substitution, have the highest rate of transversion. This specific effect is secondary to the A + T content effect such that, in terms of proportion of substitutions that are transversions, the nucleotides are ranked T > A > C > G as to their effect when they are immediately 5' to the site of substitution. In the case of nucleotides other than the immediate neighbors, a significant influence on substitution dynamics is observed in the case where the two neighboring bases are both A and/or T. Thus, substitutions are primarily, but not exclusively, influenced by the composition of the two nucleotides that are immediately adjacent. These results indicate that the pattern of molecular evolution of the plant chloroplast genome is extremely complex as a result of a variety of inter-site dependencies.

  5. A Method to Determine 18O Kinetic Isotope Effects in the Hydrolysis of Nucleotide Triphosphates

    PubMed Central

    Du, Xinlin; Ferguson, Kurt; Sprang, Stephen R.

    2007-01-01

    A method to determine 18O kinetic isotope effects (KIE) in the hydrolysis of GTP is described that is generally applicable to reactions involving other nucleotide triphosphates. Internal competition, wherein the substrate of the reaction is a mixture of 18O-labeled and unlabeled nucleotides, is employed and the change in relative abundance of the two species in the course of the reaction is used to calculate KIE. The nucleotide labeled with 18O at sites of mechanistic interest also contains 13C at all carbon positions, while the 16O-nucleotide is depleted of 13C. The relative abundance of the labeled and unlabeled substrates or products is reflected in the carbon isotope ratio (13C/12C) in GTP or GDP, which is determined by use of a liquid chromatography-coupled isotope ratio mass spectrometer (LC-coupled IRMS). The LC is coupled to the IRMS by an Isolink™ interface (ThermoFinnigan). Carbon isotope ratios can be determined with accuracy and precision greater than 0.04%, and are consistent over an order of magnitude in sample amount. KIE values for Ras/NF1333-catalyzed hydrolysis of [β18O3,13C]GTP were determined by change in the isotope ratio of GTP or GDP or the ratio of the isotope ratio of GDP to that of GTP. KIE values computed in the three ways agree within 0.1%, although the method using the ratio of isotope ratios of GDP and GTP gives superior precision (< 0.1%). A single KIE measurement can be conducted in 25 minutes with less than 5 μg nucleotide reaction product. PMID:17963711

  6. Apyrase (Nucleoside Triphosphate-Diphosphohydrolase) and Extracellular Nucleotides Regulate Cotton Fiber Elongation in Cultured Ovules1[W][OA

    PubMed Central

    Clark, Greg; Torres, Jonathan; Finlayson, Scott; Guan, Xueying; Handley, Craig; Lee, Jinsuk; Kays, Julia E.; Chen, Z. Jeffery; Roux, Stanley J.

    2010-01-01

    Ectoapyrase enzymes remove the terminal phosphate from extracellular nucleoside tri- and diphosphates. In Arabidopsis (Arabidopsis thaliana), two ectoapyrases, AtAPY1 and AtAPY2, have been implicated as key modulators of growth. In fibers of cotton (Gossypium hirsutum), transcript levels for GhAPY1 and GhAPY2, two closely related ectoapyrases that have high sequence similarity to AtAPY1 and AtAPY2, are up-regulated when fibers enter their rapid growth phase. In an ovule culture system, fibers release ATP as they grow, and when their ectoapyrase activity is blocked by the addition of polyclonal anti-apyrase antibodies or by two different small molecule inhibitors, the medium ATP level rises and fiber growth is suppressed. High concentrations of the poorly hydrolyzable nucleotides ATPγS and ADPβS applied to the medium inhibit fiber growth, and low concentrations of them stimulate growth, but treatment with adenosine 5′-O-thiomonophosphate causes no change in the growth rate. Both the inhibition and stimulation of growth by applied nucleotides can be blocked by an antagonist that blocks purinoceptors in animal cells, and by adenosine. Treatment of cotton ovule cultures with ATPγS induces increased levels of ethylene, and two ethylene antagonists, aminovinylglycine and silver nitrate, block both the growth stimulatory and growth inhibitory effects of applied nucleotides. In addition, the ethylene precursor, 1-aminocyclopropane-1-carboxylic acid, lowers the concentration of nucleotide needed to promote fiber growth. These data indicate that ectoapyrases and extracellular nucleotides play a significant role in regulating cotton fiber growth and that ethylene is a likely downstream component of the signaling pathway. PMID:20018604

  7. Myotonic Dystrophy Type 1 RNA Crystal Structures Reveal Heterogeneous 1×1 Nucleotide UU Internal Loop Conformations⊥

    PubMed Central

    Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W.; Disney, Matthew D.

    2011-01-01

    RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5′CUG/3′GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures are disclosed of a model DM1 triplet repeating construct, 5′r(UUGGGC(CUG)3GUCC)2, refined to 2.20 Å and 1.52 Å resolution. Here, differences in orientation of the 5′ dangling UU end between the two structures induce changes in the backbone groove width, which reveals that non-canonical 1×1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 Å structure, CUGa, the 5′UU forms one hydrogen-bonded pairs with a 5′UU of a neighboring helix in the unit cell to form a pseudo-infinite helix. The central 1×1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1×1 nucleotide UU internal loops each form a one hydrogen-bonded pair. In the 1.52 Å structure, CUGb, the 5′ UU dangling end is tucked into the major groove of the duplex. While the canonical paired bases show no change in base pairing, in CUGb the terminal 1×1 nucleotide UU internal loops form now two hydrogen-bonded pairs. Thus, the shift in major groove induced by the 5′UU dangling end alters non-canonical base patterns. Collectively, these structures indicate that 1×1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands. PMID:21988728

  8. Myotonic dystrophy type 1 RNA crystal structures reveal heterogeneous 1 × 1 nucleotide UU internal loop conformations.

    PubMed

    Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W; Disney, Matthew D

    2011-11-15

    RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[UUGGGC(CUG)(3)GUCC](2), refined to 2.20 and 1.52 Å resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 × 1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 Å structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 × 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 × 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 Å structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 × 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 × 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.

  9. Myotonic Dystrophy Type 1 RNA Crystal Structures Reveal Heterogeneous 1 × 1 Nucleotide UU Internal Loop Conformations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumar, Amit; Park, HaJeung; Fang, Pengfei

    2012-03-27

    RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[{und UU}GGGC(C{und U}G){sub 3}GUCC]{sub 2}, refined to 2.20 and 1.52 {angstrom} resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 x 1 nucleotide UU internal loops can display an ensemble of pairing conformations.more » In the 2.20 {angstrom} structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 x 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 x 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 {angstrom} structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 x 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 x 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.« less

  10. Bitterness of the Non-nutritive Sweetener Acesulfame Potassium Varies With Polymorphisms in TAS2R9 and TAS2R31

    PubMed Central

    2013-01-01

    Demand for nonnutritive sweeteners continues to increase due to their ability to provide desirable sweetness with minimal calories. Acesulfame potassium and saccharin are well-studied nonnutritive sweeteners commonly found in food products. Some individuals report aversive sensations from these sweeteners, such as bitter and metallic side tastes. Recent advances in molecular genetics have provided insight into the cause of perceptual differences across people. For example, common alleles for the genes TAS2R9 and TAS2R38 explain variable response to the bitter drugs ofloxacin in vitro and propylthiouracil in vivo. Here, we wanted to determine whether differences in the bitterness of acesulfame potassium could be predicted by common polymorphisms (genetic variants) in bitter taste receptor genes (TAS2Rs). We genotyped participants (n = 108) for putatively functional single nucleotide polymorphisms in 5 TAS2Rs and asked them to rate the bitterness of 25 mM acesulfame potassium on a general labeled magnitude scale. Consistent with prior reports, we found 2 single nucleotide polymorphisms in TAS2R31 were associated with acesulfame potassium bitterness. However, TAS2R9 alleles also predicted additional variation in acesulfame potassium bitterness. Conversely, single nucleotide polymorphisms in TAS2R4, TAS2R38, and near TAS2R16 were not significant predictors. Using 1 single nucleotide polymorphism each from TAS2R9 and TAS2R31, we modeled the simultaneous influence of these single nucleotide polymorphisms on acesulfame potassium bitterness; together, these 2 single nucleotide polymorphisms explained 13.4% of the variance in perceived bitterness. These data suggest multiple polymorphisms within TAS2Rs contribute to the ability to perceive the bitterness from acesulfame potassium. PMID:23599216

  11. [Complete nucleotide sequences and genome structure of two Chinese tobacco mosaic virus isolates deduced from full-length infectious cDNA clones].

    PubMed

    Yang, G; Liu, X G; Qiu, B S

    2000-07-01

    The complete nucleotides of two Chinese tobacco mosaic virus (TMV) isolates, TMV-Cv (vulgare strain) and TMV-N14 (an attenuated virus originated from a tomato strain), were determined from their respective full-length infectious cDNA clones and compared with published TMV sequences. The genome structure of TMV-Cv contained 6395 nucleotides, in which four functional open reading frames (ORF), coding for replicase (126 kD/183 kD), movement protein (MP, 30 kD) and coat protein (CP, 17.6 kD) respectively, could be recognized. TMV-N14 contained 6384 nucleotides in its genome. In contrast to TMV-Cv, five functional ORFs encoding the replicase 98.5 kD/126 kD/183 kD, MP(27 kD) and CP(17.6 kD), respectively, were detected in the TMV-N14 genome. TMV-Cv is 99% homologous to a Korean TMV isolate belonging to the vulgare strain at the nucleotide level. TMV-N14 is 99% homologous to a highly virulent Japanese isolate TMV-L (tomato strain) at the nucleotide level. In TMV-N14, one opal nulation (UGA) occurred in the replicase gene and one ochre nutation (UAA) in the MP gene. The former mutation created a potential, additional ORF within the replicase gene, the latter reduced the size of the MP to 27 kD. In addition, there were also 13 amino acid substitutions in the replicase gene of TMV-N14 when compared to that of TMV-L. Collectively, these changes may have significant implications in the attenuation of the virulence of TMV-N14.

  12. Genome-wide characterization of microsatelittes and marker development in the carcinogenic liver fluke Clonorchis sinensis

    PubMed Central

    Nguyen, Thao T.B.; Arimatsu, Yuji; Hong, Sung-Jong; Brindley, Paul J.; Blair, David; Laha, Thewarach; Sripa, Banchob

    2015-01-01

    Clonorchis sinensis is an important carcinogenic human liver fluke endemic in East and Southeast Asia. There are several conventional molecular markers have been used for identification and genetic diversity, however, no information about microsatellites of this liver fluke published so far. We here report microsatellite characterization and marker development for genetic diversity study in C. sinensis using genome-wide bioinformatics approach. Based on our search criteria, a total of 256,990 microsatellites (≥ 12 base pairs) were identified from genome database of C. sinensis with hexa-nucleotide motif being the most abundant (51%) followed by penta-nucleotide (18.3%) and tri-nucleotide (12.7%). The tetra-nucleotide, di-nucleotide and mononucleotide motifs accounted for 9.75 %, 7.63% and 0.14%, respectively. The total length of all microsatellites accounts for 0. 72 % of 547 Mb of the whole genome size and the frequency of microsatellites were found to be one microsatellite in every 2.13 kb of DNA. For the di-, tri, and tetra-nucleotide, the repeat numbers redundant are six (28%), four (45%) and three (76%), respectively. The ATC repeat is the most abundant microsatellites followed by AT, AAT and AC, respectively. Within 40 microsatellite loci developed, 24 microsatellite markers showed potential to differentiate between C. sinensis and O. viverrini. Seven out of 24 loci showed heterozygous with observed heterozygosity ranged from 0.467 to 1. Four-primer sets could amplify both C. sinensis and O. viverrini DNA with different sizes. This study provides basic information of C. sinensis microsatellites and the genome-wide markers developed may be a useful tool for genetic study of C. sinensis. PMID:25782682

  13. The accessibility of etheno-nucleotides to collisional quenchers and the nucleotide cleft in G- and F-actin.

    PubMed Central

    Root, D. D.; Reisler, E.

    1992-01-01

    Recent publication of the atomic structure of G-actin (Kabsch, W., Mannherz, H. G., Suck, D., Pai, E. F., & Holmes, K. C., 1990, Nature 347, 37-44) raises questions about how the conformation of actin changes upon its polymerization. In this work, the effects of various quenchers of etheno-nucleotides bound to G- and F-actin were examined in order to assess polymerization-related changes in the nucleotide phosphate site. The Mg(2+)-induced polymerization of actin quenched the fluorescence of the etheno-nucleotides by approximately 20% simultaneously with the increase in light scattering by actin. A conformational change at the nucleotide binding site was also indicated by greater accessibility of F-actin than G-actin to positively, negatively, and neutrally charged collisional quenchers. The difference in accessibility between G- and F-actin was greatest for I-, indicating that the environment of the etheno group is more positively charged in the polymerized form of actin. Based on calculations of the change in electric potential of the environment of the etheno group, specific polymerization-related movements of charged residues in the atomic structure of G-actin are suggested. The binding of S-1 to epsilon-ATP-G-actin increased the accessibility of the etheno group to I- even over that in Mg(2+)-polymerized actin. The quenching of the etheno group by nitromethane was, however, unaffected by the binding of S-1 to actin. Thus, the binding of S-1 induces conformational changes in the cleft region of actin that are different from those caused by Mg2+ polymerization of actin.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1304380

  14. The guanine nucleotide exchange factor Ric-8A induces domain separation and Ras domain plasticity in Gαi1

    PubMed Central

    Van Eps, Ned; Thomas, Celestine J.; Hubbell, Wayne L.; Sprang, Stephen R.

    2015-01-01

    Heterotrimeric G proteins are activated by exchange of GDP for GTP at the G protein alpha subunit (Gα), most notably by G protein-coupled transmembrane receptors. Ric-8A is a soluble cytoplasmic protein essential for embryonic development that acts as both a guanine nucleotide exchange factor (GEF) and a chaperone for Gα subunits of the i, q, and 12/13 classes. Previous studies demonstrated that Ric-8A stabilizes a dynamically disordered state of nucleotide-free Gα as the catalytic intermediate for nucleotide exchange, but no information was obtained on the structures involved or the magnitude of the structural fluctuations. In the present study, site-directed spin labeling (SDSL) together with double electron-electron resonance (DEER) spectroscopy is used to provide global distance constraints that identify discrete members of a conformational ensemble in the Gαi1:Ric-8A complex and the magnitude of structural differences between them. In the complex, the helical and Ras-like nucleotide-binding domains of Gαi1 pivot apart to occupy multiple resolved states with displacements as large as 25 Å. The domain displacement appears to be distinct from that observed in Gαs upon binding of Gs to the β2 adrenergic receptor. Moreover, the Ras-like domain exhibits structural plasticity within and around the nucleotide-binding cavity, and the switch I and switch II regions, which are known to adopt different conformations in the GDP- and GTP-bound states of Gα, undergo structural rearrangements. Collectively, the data show that Ric-8A induces a conformationally heterogeneous state of Gαi and provide insight into the mechanism of action of a nonreceptor Gα GEF. PMID:25605908

  15. Adenine nucleotide-dependent and redox-independent control of mitochondrial malate dehydrogenase activity in Arabidopsis thaliana.

    PubMed

    Yoshida, Keisuke; Hisabori, Toru

    2016-06-01

    Mitochondrial metabolism is important for sustaining cellular growth and maintenance; however, the regulatory mechanisms underlying individual processes in plant mitochondria remain largely uncharacterized. Previous redox-proteomics studies have suggested that mitochondrial malate dehydrogenase (mMDH), a key enzyme in the tricarboxylic acid (TCA) cycle and redox shuttling, is under thiol-based redox regulation as a target candidate of thioredoxin (Trx). In addition, the adenine nucleotide status may be another factor controlling mitochondrial metabolism, as respiratory ATP production in mitochondria is believed to be influenced by several environmental stimuli. Using biochemical and reverse-genetic approaches, we addressed the redox- and adenine nucleotide-dependent regulation of mMDH in Arabidopsis thaliana. Recombinant mMDH protein formed intramolecular disulfide bonds under oxidative conditions, but these bonds did not have a considerable effect on mMDH activity. Mitochondria-localized o-type Trx (Trx-o) did not facilitate re-reduction of oxidized mMDH. Determination of the in vivo redox state revealed that mMDH was stably present in the reduced form even in Trx-o-deficient plants. Accordingly, we concluded that mMDH is not in the class of redox-regulated enzymes. By contrast, mMDH activity was lowered by adenine nucleotides (AMP, ADP, and ATP). Each adenine nucleotide suppressed mMDH activity with different potencies and ATP exerted the largest inhibitory effect with a significantly lower K(I). Correspondingly, mMDH activity was inhibited by the increase in ATP/ADP ratio within the physiological range. These results suggest that mMDH activity is finely controlled in response to variations in mitochondrial adenine nucleotide balance. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. The CD8α gene in duck (Anatidae): cloning, characterization, and expression during viral infection.

    PubMed

    Xu, Qi; Chen, Yang; Zhao, Wen Ming; Huang, Zheng Yang; Duan, Xiu Jun; Tong, Yi Yu; Zhang, Yang; Li, Xiu; Chang, Guo Bin; Chen, Guo Hong

    2015-02-01

    Cluster of differentiation 8 alpha (CD8α) is critical for cell-mediated immune defense and T-cell development. Although CD8α sequences have been reported for several species, very little is known about CD8α in ducks. To elucidate the mechanisms involved in the innate and adaptive immune responses of ducks, we cloned CD8α coding sequences from domestic, Muscovy, Mallard, and Spotbill ducks using reverse transcription polymerase chain reaction (RT-PCR). Each sequence consisted of 714 nucleotides and encoded a signal peptide, an IgV-like domain, a stalk region, a transmembrane region, and a cytoplasmic tail. We identified 58 nucleotide differences and 37 amino acid differences among the four types of duck; of these, 53 nucleotide and 33 amino acid differences were between Muscovy ducks and the other duck species. The CD8α cDNA sequence from domestic duck consisted of a 61-nucleotide 5' untranslated region (UTR), a 714-nucleotide open reading frame, and an 849-nucleotide 3' UTR. Multiple sequence alignments showed that the amino acid sequence of CD8α is conserved in vertebrates. RT-PCR revealed that expression of CD8α mRNA of domestic ducks was highest in the thymus and very low in the kidney, cerebrum, cerebellum, and muscle. Immunohistochemical analyses detected CD8α on the splenic corpuscle and periarterial lymphatic sheath of the spleen. CD8α mRNA in domestic ducklings was initially up-regulated, and then down-regulated, in the thymus, spleen, and liver after treatment with duck hepatitis virus type I (DHV-1) or the immunostimulant polyriboinosinic polyribocytidylic acid (poly I:C).

  17. Sequence diversity within the reovirus S2 gene: reovirus genes reassort in nature, and their termini are predicted to form a panhandle motif.

    PubMed Central

    Chapell, J D; Goral, M I; Rodgers, S E; dePamphilis, C W; Dermody, T S

    1994-01-01

    To better understand genetic diversity within mammalian reoviruses, we determined S2 nucleotide and deduced sigma 2 amino acid sequences of nine reovirus strains and compared these sequences with those of prototype strains of the three reovirus serotypes. The S2 gene and sigma 2 protein are highly conserved among the four type 1, one type 2, and seven type 3 strains studied. Phylogenetic analyses based on S2 nucleotide sequences of the 12 reovirus strains indicate that diversity within the S2 gene is independent of viral serotype. Additionally, we found marked topological differences between phylogenetic trees generated from S1 and S2 gene nucleotide sequences of the seven type 3 strains. These results demonstrate that reovirus S1 and S2 genes have distinct evolutionary histories, thus providing phylogenetic evidence for lateral transfer of reovirus genes in nature. When variability among the 12 sigma 2-encoding S2 nucleotide sequences was analyzed at synonymous positions, we found that approximately 60 nucleotides at the 5' terminus and 30 nucleotides at the 3' terminus were markedly conserved in comparison with other sigma 2-encoding regions of S2. Predictions of RNA secondary structures indicate that the more conserved S2 sequences participate in the formation of an extended region of duplex RNA interrupted by a pair of stem-loops. Among the 12 deduced sigma 2 amino acid sequences examined, substitutions were observed at only 11% of amino acid positions. This finding suggests that constraints on the structure or function of sigma 2, perhaps in part because of its location in the virion core, have limited sequence diversity within this protein. PMID:8289378

  18. Growth of wildtype and mutant E. coli strains in minimal media for optimal production of nucleic acids for preparing labeled nucleotides

    PubMed Central

    Thakur, Chandar S.; Brown, Margaret E.; Sama, Jacob N.; Jackson, Melantha E.

    2010-01-01

    Since RNAs lie at the center of most cellular processes, there is a need for synthesizing large amounts of RNAs made from stable isotope-labeled nucleotides to advance the study of their structure and dynamics by nuclear magnetic resonance (NMR) spectroscopy. A particularly effective means of obtaining labeled nucleotides is to harvest these nucleotides from bacteria grown in defined minimal media supplemented with 15NH4Cl and various carbon sources. Given the high cost of carbon precursors required for labeling nucleic acids for NMR studies, it becomes important to evaluate the optimal growth for commonly used strains under standard minimal media conditions. Such information is lacking. In this study, we characterize the growth for Escherichia coli strains K12, K10zwf, and DL323 in three minimal media with isotopic-labeled carbon sources of acetate, glycerol, and glycerol combined with formate. Of the three media, the LeMaster-Richards and the Studier media outperform the commonly used M9 media and both support optimal growth of E. coli for the production of nucleotides. However, the growth of all three E. coli strains in acetate is reduced almost twofold compared to growth in glycerol. Analysis of the metabolic pathway and previous gene array studies help to explain this differential growth in glycerol and acetate. These studies should benefit efforts to make selective 13C-15N isotopic-labeled nucleotides for synthesizing biologically important RNAs. Electronic supplementary material The online version of this article (doi:10.1007/s00253-010-2813-y) contains supplementary material, which is available to authorized users. PMID:20730533

  19. Modular Organization of Residue-Level Contacts Shapes the Selection Pressure on Individual Amino Acid Sites of Ribosomal Proteins.

    PubMed

    Mallik, Saurav; Kundu, Sudip

    2017-04-01

    Understanding the molecular evolution of macromolecular complexes in the light of their structure, assembly, and stability is of central importance. Here, we address how the modular organization of native molecular contacts shapes the selection pressure on individual residue sites of ribosomal complexes. The bacterial ribosomal complex is represented as a residue contact network where nodes represent amino acid/nucleotide residues and edges represent their van der Waals interactions. We find statistically overrepresented native amino acid-nucleotide contacts (OaantC, one amino acid contacts one or multiple nucleotides, internucleotide contacts are disregarded). Contact number is defined as the number of nucleotides contacted. Involvement of individual amino acids in OaantCs with smaller contact numbers is more random, whereas only a few amino acids significantly contribute to OaantCs with higher contact numbers. An investigation of structure, stability, and assembly of bacterial ribosome depicts the involvement of these OaantCs in diverse biophysical interactions stabilizing the complex, including high-affinity protein-RNA contacts, interprotein cooperativity, intersubunit bridge, packing of multiple ribosomal RNA domains, etc. Amino acid-nucleotide constituents of OaantCs with higher contact numbers are generally associated with significantly slower substitution rates compared with that of OaantCs with smaller contact numbers. This evolutionary rate heterogeneity emerges from the strong purifying selection pressure that conserves the respective amino acid physicochemical properties relevant to the stabilizing interaction with OaantC nucleotides. An analysis of relative molecular orientations of OaantC residues and their interaction energetics provides the biophysical ground of purifying selection conserving OaantC amino acid physicochemical properties. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Altered erythrocyte nucleotide patterns are characteristic of inherited disorders of purine or pyrimidine metabolism.

    PubMed

    Simmonds, H A; Fairbanks, L D; Morris, G S; Webster, D R; Harley, E H

    1988-02-15

    This paper compares erythrocyte nucleotide levels in patients with eight different inherited purine or pyrimidine enzyme defects identified amongst a variety of patients referred predominantly for investigation of severe neurological abnormalities, or immunodeficiency syndromes. Characteristic nucleotide patterns were identified only in the six disorders (four involving purine and two pyrimidine metabolism) where there was clinical evidence of cellular toxicity. They were frequently related to the accumulation of abnormal metabolites in body fluids. These erythrocyte studies have demonstrated the following. 1. ATP depletion is not an invariable feature of adenosine deaminase (ADA) deficiency, but the accumulation of the deoxyribonucleotides dATP, or dGTP, is diagnostic of ADA, or purine nucleoside phosphorylase (PNP) deficiency, respectively. The early accumulation of dATP in foetal blood is a valuable aid to prenatal diagnosis of ADA deficiency. 2. GTP depletion appears to reflect the degree of CNS involvement in hypoxanthine-guanine phosphoribosyltransferase and PNP deficiency, as well as PP-ribose-P synthetase superactivity. Other diagnostic changes involving increased pyrimidine sugars and increased or decreased NAD levels, or ZTP in Lesch Nyhan erythrocytes, show no consistent correlation with the clinical manifestations. 3. These altered nucleotide levels afford a novel means for carrier detection of the X-linked defect associated with aberrant PP-ribose-P synthetase activity, where no other test is yet available. Measurement of erythrocyte nucleotide levels thus provides a simple and rapid aid to diagnosis and may sometimes be essential for determining prognosis, carrier detection, or monitoring therapy. These characteristic 'fingerprints' may give some insight into the mechanism by which the abnormal gene product produces disease. Such grossly altered nucleotide levels could also result in loss of erythrocyte flexibility, increased destruction and hence the anaemia, or other clinical manifestations, observed in some disorders.

  1. Revisiting the Roco G-protein cycle.

    PubMed

    Terheyden, Susanne; Ho, Franz Y; Gilsbach, Bernd K; Wittinghofer, Alfred; Kortholt, Arjan

    2015-01-01

    Mutations in leucine-rich-repeat kinase 2 (LRRK2) are the most frequent cause of late-onset Parkinson's disease (PD). LRRK2 belongs to the Roco family of proteins which share a conserved Ras-like G-domain (Roc) and a C-terminal of Roc (COR) domain tandem. The nucleotide state of small G-proteins is strictly controlled by guanine-nucleotide-exchange factors (GEFs) and GTPase-activating proteins (GAPs). Because of contradictory structural and biochemical data, the regulatory mechanism of the LRRK2 Roc G-domain and the RocCOR tandem is still under debate. In the present study, we solved the first nucleotide-bound Roc structure and used LRRK2 and bacterial Roco proteins to characterize the RocCOR function in more detail. Nucleotide binding induces a drastic structural change in the Roc/COR domain interface, a region strongly implicated in patients with an LRRK2 mutation. Our data confirm previous assumptions that the C-terminal subdomain of COR functions as a dimerization device. We show that the dimer formation is independent of nucleotide. The affinity for GDP/GTP is in the micromolar range, the result of which is high dissociation rates in the s-1 range. Thus Roco proteins are unlikely to need GEFs to achieve activation. Monomeric LRRK2 and Roco G-domains have a similar low GTPase activity to small G-proteins. We show that GTPase activity in bacterial Roco is stimulated by the nucleotide-dependent dimerization of the G-domain within the complex. We thus propose that the Roco proteins do not require GAPs to stimulate GTP hydrolysis but stimulate each other by one monomer completing the catalytic machinery of the other.

  2. Defective Guanine Nucleotide Exchange in the Elongation Factor-like 1 (EFL1) GTPase by Mutations in the Shwachman-Diamond Syndrome Protein*

    PubMed Central

    García-Márquez, Adrián; Gijsbers, Abril; de la Mora, Eugenio; Sánchez-Puig, Nuria

    2015-01-01

    Ribosome biogenesis is orchestrated by the action of several accessory factors that provide time and directionality to the process. One such accessory factor is the GTPase EFL1 involved in the cytoplasmic maturation of the ribosomal 60S subunit. EFL1 and SBDS, the protein mutated in the Shwachman-Diamond syndrome (SBDS), release the anti-association factor eIF6 from the surface of the ribosomal subunit 60S. Here we report a kinetic analysis of fluorescent guanine nucleotides binding to EFL1 alone and in the presence of SBDS using fluorescence stopped-flow spectroscopy. Binding kinetics of EFL1 to both GDP and GTP suggests a two-step mechanism with an initial binding event followed by a conformational change of the complex. Furthermore, the same behavior was observed in the presence of the SBDS protein irrespective of the guanine nucleotide evaluated. The affinity of EFL1 for GTP is 10-fold lower than that calculated for GDP. Association of EFL1 to SBDS did not modify the affinity for GTP but dramatically decreased that for GDP by increasing the dissociation rate of the nucleotide. Thus, SBDS acts as a guanine nucleotide exchange factor (GEF) for EFL1 promoting its activation by the release of GDP. Finally, fluorescence anisotropy measurements showed that the S143L mutation present in the Shwachman-Diamond syndrome altered a surface epitope for EFL1 and largely decreased the affinity for it. These results suggest that loss of interaction between these proteins due to mutations in the disease consequently prevents the nucleotide exchange regulation the SBDS exerts on EFL1. PMID:25991726

  3. Plasma Membrane-Located Purine Nucleotide Transport Proteins Are Key Components for Host Exploitation by Microsporidian Intracellular Parasites

    PubMed Central

    Heinz, Eva; Hacker, Christian; Dean, Paul; Mifsud, John; Goldberg, Alina V.; Williams, Tom A.; Nakjang, Sirintra; Gregory, Alison; Hirt, Robert P.; Lucocq, John M.; Kunji, Edmund R. S.; Embley, T. Martin

    2014-01-01

    Microsporidia are obligate intracellular parasites of most animal groups including humans, but despite their significant economic and medical importance there are major gaps in our understanding of how they exploit infected host cells. We have investigated the evolution, cellular locations and substrate specificities of a family of nucleotide transport (NTT) proteins from Trachipleistophora hominis, a microsporidian isolated from an HIV/AIDS patient. Transport proteins are critical to microsporidian success because they compensate for the dramatic loss of metabolic pathways that is a hallmark of the group. Our data demonstrate that the use of plasma membrane-located nucleotide transport proteins (NTT) is a key strategy adopted by microsporidians to exploit host cells. Acquisition of an ancestral transporter gene at the base of the microsporidian radiation was followed by lineage-specific events of gene duplication, which in the case of T. hominis has generated four paralogous NTT transporters. All four T. hominis NTT proteins are located predominantly to the plasma membrane of replicating intracellular cells where they can mediate transport at the host-parasite interface. In contrast to published data for Encephalitozoon cuniculi, we found no evidence for the location for any of the T. hominis NTT transporters to its minimal mitochondria (mitosomes), consistent with lineage-specific differences in transporter and mitosome evolution. All of the T. hominis NTTs transported radiolabelled purine nucleotides (ATP, ADP, GTP and GDP) when expressed in Escherichia coli, but did not transport radiolabelled pyrimidine nucleotides. Genome analysis suggests that imported purine nucleotides could be used by T. hominis to make all of the critical purine-based building-blocks for DNA and RNA biosynthesis during parasite intracellular replication, as well as providing essential energy for parasite cellular metabolism and protein synthesis. PMID:25474405

  4. Structural insights into translational recoding by frameshift suppressor tRNA SufJ

    DOE PAGES

    Fagan, Crystal E.; Maehigashi, Tatsuya; Dunkle, Jack A.; ...

    2014-10-28

    The three-nucleotide mRNA reading frame is tightly regulated during translation to ensure accurate protein expression. Translation errors that lead to aberrant protein production can result from the uncoupled movement of the tRNA in either the 5' or 3' direction on mRNA. Here, we report the biochemical and structural characterization of +1 frameshift suppressor tRNA SufJ, a tRNA known to decode four, instead of three, nucleotides. Frameshift suppressor tRNA SufJ contains an insertion 5' to its anticodon, expanding the anticodon loop from seven to eight nucleotides. Our results indicate that the expansion of the anticodon loop of either ASL SufJ ormore » tRNA SufJ does not affect its affinity for the A site of the ribosome. Structural analyses of both ASL SufJ and ASL Thr bound to the Thermus thermophilus 70S ribosome demonstrate both ASLs decode in the zero frame. Although the anticodon loop residues 34–37 are superimposable with canonical seven-nucleotide ASLs, the single C31.5 insertion between nucleotides 31 and 32 in ASL SufJ imposes a conformational change of the anticodon stem, that repositions and tilts the ASL toward the back of the A site. Further modeling analyses reveal that this tilting would cause a distortion in full-length A-site tRNA SufJ during tRNA selection and possibly impede gripping of the anticodon stem by 16S rRNA nucleotides in the P site. Together, these data implicate tRNA distortion as a major driver of noncanonical translation events such as frameshifting.« less

  5. The SAM domain of mouse SAMHD1 is critical for its activation and regulation.

    PubMed

    Buzovetsky, Olga; Tang, Chenxiang; Knecht, Kirsten M; Antonucci, Jenna M; Wu, Li; Ji, Xiaoyun; Xiong, Yong

    2018-01-29

    Human SAMHD1 (hSAMHD1) is a retroviral restriction factor that blocks HIV-1 infection by depleting the cellular nucleotides required for viral reverse transcription. SAMHD1 is allosterically activated by nucleotides that induce assembly of the active tetramer. Although the catalytic core of hSAMHD1 has been studied extensively, previous structures have not captured the regulatory SAM domain. Here we report the crystal structure of full-length SAMHD1 by capturing mouse SAMHD1 (mSAMHD1) structures in three different nucleotide bound states. Although mSAMHD1 and hSAMHD1 are highly similar in sequence and function, we find that mSAMHD1 possesses a more complex nucleotide-induced activation process, highlighting the regulatory role of the SAM domain. Our results provide insights into the regulation of SAMHD1 activity, thereby facilitating the improvement of HIV mouse models and the development of new therapies for certain cancers and autoimmune diseases.

  6. ATR inhibition facilitates targeting of leukemia dependence on convergent nucleotide biosynthetic pathways

    DOE PAGES

    Le, Thuc M.; Poddar, Soumya; Capri, Joseph R.; ...

    2017-08-14

    It is known that leukemia cells rely on two nucleotide biosynthetic pathways, de novo and salvage, to produce dNTPs for DNA replication. Here, using metabolomic, proteomic, and phosphoproteomic approaches, we show that inhibition of the replication stress sensing kinase ataxia telangiectasia and Rad3-related protein (ATR) reduces the output of both de novo and salvage pathways by regulating the activity of their respective rate-limiting enzymes, ribonucleotide reductase (RNR) and deoxycytidine kinase (dCK), via distinct molecular mechanisms. Quantification of nucleotide biosynthesis in ATR-inhibited acute lymphoblastic leukemia (ALL) cells reveals substantial remaining de novo and salvage activities, and could not eliminate the diseasemore » in vivo. However, targeting these remaining activities with RNR and dCK inhibitors triggers lethal replication stress in vitro and long-term disease-free survival in mice with B-ALL, without detectable toxicity. Thus the functional interplay between alternative nucleotide biosynthetic routes and ATR provides therapeutic opportunities in leukemia and potentially other cancers.« less

  7. Nucleotide Catabolism on the Surface of Aortic Valve Xenografts; Effects of Different Decellularization Strategies.

    PubMed

    Kutryb-Zajac, Barbara; Yuen, Ada H Y; Khalpey, Zain; Zukowska, Paulina; Slominska, Ewa M; Taylor, Patricia M; Goldstein, Steven; Heacox, Albert E; Lavitrano, Marialuisa; Chester, Adrian H; Yacoub, Magdi H; Smolenski, Ryszard T

    2016-04-01

    Extracellular nucleotide metabolism controls thrombosis and inflammation and may affect degeneration and calcification of aortic valve prostheses. We evaluated the effect of different decellularization strategies on enzyme activities involved in extracellular nucleotide metabolism. Porcine valves were tested intact or decellularized either by detergent treatment or hypotonic lysis and nuclease digestion. The rates of ATP hydrolysis, AMP hydrolysis, and adenosine deamination were estimated by incubation of aorta or valve leaflet sections with substrates followed by HPLC analysis. We demonstrated relatively high activities of ecto-enzymes on porcine valve as compared to the aortic wall. Hypotonic lysis/nuclease digestion preserved >80 % of ATP and AMP hydrolytic activity but reduced adenosine deamination to <10 %. Detergent decellularization completely removed (<5 %) all these activities. These results demonstrate high intensity of extracellular nucleotide metabolism on valve surface and indicate that various valve decellularization techniques differently affect ecto-enzyme activities that could be important in the development of improved valve prostheses.

  8. Simultaneous determination of 5'-monophosphate nucleotides in infant formulas by HPLC-MS.

    PubMed

    Ren, Yiping; Zhang, Jingshun; Song, Xiaodan; Chen, Xiaochun; Li, Duo

    2011-04-01

    A method was developed for simultaneous determination of 5'-monophosphate nucleotides, adenosine 5'-monophosphate, cytidine 5'-monophosphate, guanosine 5'-monophosphate, inosine 5'-monophosphate, and uridine 5'-monophosphate in infant formulas by high-performance liquid chromatography-mass spectrometry equipped with electrospray ionization source. The complete chromatographic separation of five nucleotides was achieved through a Symmetry C(18) column, after a binary gradient elution with water containing 0.1% formic acid and acetonitrile as mobile phase. The multi-reaction monitoring mode was applied for tandem mass spectrometry analysis. The established method was further validated by determining the linearity (R(2) > 0.999), recovery (92.0-105.0%), and precision (relative standard deviation ≤6.97%). To verify the applicability of the method, thirty commercially available infant formulas were randomly purchased from the supermarkets in Hangzhou, China, and then analyzed. The results showed that the developed method is validated, sensitive, and reliable for quantitation of nucleotides in infant formulas.

  9. Determination of the kinetics of guanine nucleotide exchange on EF-Tu and EF-Ts: continuing uncertainties.

    PubMed

    Manchester, Keith L

    2004-01-30

    An analysis is made of the rate constants for the reactions involving the interactions of EF-Tu, EF-Ts, GDP, and GTP recently derived by Gromadski et al. [Biochemistry 41 (2002) 162]. Though their measured values appear to allow a reasonable rate of nucleotide exchange sufficient to support rates of protein synthesis in vivo, their data underestimate the thermodynamic barrier involved in nucleotide exchange and therefore cannot be considered definitive. A kinetic scheme consistent with the thermodynamic barrier can be achieved by modification of various rate constants, particularly of those involving the release of EF-Ts from EF-Tu.GTP.EF-Ts, but such constants are markedly different from what are experimentally observed. It thus remains impossible at present satisfactorily to model guanine nucleotide exchange on EF-Tu, catalysed by EF-Ts by a double displacement mechanism, with experimentally derived rate constants. Metabolic control analysis has been applied to determine the degree of flux control of the different steps in the pathway.

  10. Association of single nucleotide polymorphism in CD28(C/T-I3 + 17) and CD40 (C/T-1) genes with the Graves' disease.

    PubMed

    Mustafa, Saima; Fatima, Hira; Fatima, Sadia; Khosa, Tafheem; Akbar, Atif; Shaikh, Rehan Sadiq; Iqbal, Furhan

    2018-01-01

    To find out a correlation between the single nucleotide polymorphisms in cluster of differentiation 28 and cluster of differentiation 40 genes with Graves' disease, if any. This case-control study was conducted at the Multan Institute of Nuclear Medicine and Radiotherapy, Multan, Pakistan, and comprised blood samples of Graves' disease patients and controls. Various risk factors were also correlated either with the genotype at each single-nucleotide polymorphism or with various combinations of genotypes studied during present investigation. Of the 160 samples, there were 80(50%) each from patients and controls. Risk factor analysis revealed that gender (p=0.008), marital status (p<0.001), education (p<0.001), smoking (p<0.001), tri-iodothyronine (P <0.001), thyroxin (p<0.001) and thyroid-stimulating hormone (p<0.000) levels in blood were associated with Graves' disease. Both single-nucleotide polymorphisms in both genes were not associated with Graves' disease, either individually or in any combined form.

  11. Pyruvate kinase isoform expression alters nucleotide synthesis to impact cell proliferation

    PubMed Central

    Lunt, Sophia Y.; Muralidhar, Vinayak; Hosios, Aaron M.; Israelsen, William J.; Gui, Dan Y.; Newhouse, Lauren; Ogrodzinski, Martin; Hecht, Vivian; Xu, Kali; Acevedo, Paula N. Marín; Hollern, Daniel P.; Bellinger, Gary; Dayton, Talya L.; Christen, Stefan; Elia, Ilaria; Dinh, Anh T.; Stephanopoulos, Gregory; Manalis, Scott R.; Yaffe, Michael B.; Andrechek, Eran R.; Fendt, Sarah-Maria; Heiden, Matthew G. Vander

    2014-01-01

    SUMMARY Metabolic regulation influences cell proliferation. The influence of pyruvate kinase isoforms on tumor cells has been extensively studied, but whether PKM2 is required for normal cell proliferation is unknown. We examine how PKM2-deletion affects proliferation and metabolism in non-transformed, non-immortalized PKM2-expressing primary cells. We find that deletion of PKM2 in primary cells results in PKM1 expression and proliferation arrest. PKM1 expression, rather than PKM2 loss, is responsible for this effect, and proliferation arrest cannot be explained by cell differentiation, senescence, death, changes in gene expression, or prevention of cell growth. Instead, PKM1 expression impairs nucleotide production and the ability to synthesize DNA and progress through the cell cycle. Nucleotide biosynthesis is limiting, as proliferation arrest is characterized by severe thymidine depletion, and supplying exogenous thymine rescues both nucleotide levels and cell proliferation. Thus, PKM1 expression promotes a metabolic state that is unable to support DNA synthesis. PMID:25482511

  12. Correlation approach to identify coding regions in DNA sequences

    NASA Technical Reports Server (NTRS)

    Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1994-01-01

    Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

  13. Yap reprograms glutamine metabolism to increase nucleotide biosynthesis and enable liver growth.

    PubMed

    Cox, Andrew G; Hwang, Katie L; Brown, Kristin K; Evason, Kimberley; Beltz, Sebastian; Tsomides, Allison; O'Connor, Keelin; Galli, Giorgio G; Yimlamai, Dean; Chhangawala, Sagar; Yuan, Min; Lien, Evan C; Wucherpfennig, Julia; Nissim, Sahar; Minami, Akihiro; Cohen, David E; Camargo, Fernando D; Asara, John M; Houvras, Yariv; Stainier, Didier Y R; Goessling, Wolfram

    2016-08-01

    The Hippo pathway is an important regulator of organ size and tumorigenesis. It is unclear, however, how Hippo signalling provides the cellular building blocks required for rapid growth. Here, we demonstrate that transgenic zebrafish expressing an activated form of the Hippo pathway effector Yap1 (also known as YAP) develop enlarged livers and are prone to liver tumour formation. Transcriptomic and metabolomic profiling identify that Yap1 reprograms glutamine metabolism. Yap1 directly enhances glutamine synthetase (glul) expression and activity, elevating steady-state levels of glutamine and enhancing the relative isotopic enrichment of nitrogen during de novo purine and pyrimidine biosynthesis. Genetic or pharmacological inhibition of GLUL diminishes the isotopic enrichment of nitrogen into nucleotides, suppressing hepatomegaly and the growth of liver cancer cells. Consequently, Yap-driven liver growth is susceptible to nucleotide inhibition. Together, our findings demonstrate that Yap1 integrates the anabolic demands of tissue growth during development and tumorigenesis by reprogramming nitrogen metabolism to stimulate nucleotide biosynthesis.

  14. ATR inhibition facilitates targeting of leukemia dependence on convergent nucleotide biosynthetic pathways

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Le, Thuc M.; Poddar, Soumya; Capri, Joseph R.

    It is known that leukemia cells rely on two nucleotide biosynthetic pathways, de novo and salvage, to produce dNTPs for DNA replication. Here, using metabolomic, proteomic, and phosphoproteomic approaches, we show that inhibition of the replication stress sensing kinase ataxia telangiectasia and Rad3-related protein (ATR) reduces the output of both de novo and salvage pathways by regulating the activity of their respective rate-limiting enzymes, ribonucleotide reductase (RNR) and deoxycytidine kinase (dCK), via distinct molecular mechanisms. Quantification of nucleotide biosynthesis in ATR-inhibited acute lymphoblastic leukemia (ALL) cells reveals substantial remaining de novo and salvage activities, and could not eliminate the diseasemore » in vivo. However, targeting these remaining activities with RNR and dCK inhibitors triggers lethal replication stress in vitro and long-term disease-free survival in mice with B-ALL, without detectable toxicity. Thus the functional interplay between alternative nucleotide biosynthetic routes and ATR provides therapeutic opportunities in leukemia and potentially other cancers.« less

  15. Plant nitrogen regulatory P-PII polypeptides

    DOEpatents

    Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

    2004-11-23

    The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the invention may be used to engineer organisms to overexpress wild-type or mutant P-PII regulatory protein. Engineered plants that overexpress or underexpress P-PII regulatory protein may have increased nitrogen assimilation capacity. Engineered organisms may be used to produce P-PII proteins which, in turn, can be used for a variety of purposes including in vitro screening of herbicides. P-PII nucleotide sequences have additional uses as probes for isolating additional genomic clones having the promoters of P-PII gene. P-PII promoters are light- and/or sucrose-inducible and may be advantageously used in genetic engineering of plants.

  16. Interactions between Kar2p and Its Nucleotide Exchange Factors Sil1p and Lhs1p Are Mechanistically Distinct*

    PubMed Central

    Hale, Sarah J.; Lovell, Simon C.; de Keyzer, Jeanine; Stirling, Colin J.

    2010-01-01

    Kar2p, an essential Hsp70 chaperone in the endoplasmic reticulum of Saccharomyces cerevisiae, facilitates the transport and folding of nascent polypeptides within the endoplasmic reticulum lumen. The chaperone activity of Kar2p is regulated by its intrinsic ATPase activity that can be stimulated by two different nucleotide exchange factors, namely Sil1p and Lhs1p. Here, we demonstrate that the binding requirements for Lhs1p are complex, requiring both the nucleotide binding domain plus the linker domain of Kar2p. In contrast, the IIB domain of Kar2p is sufficient for binding of Sil1p, and point mutations within IIB specifically blocked Sil1p-dependent activation while remaining competent for activation by Lhs1p. Taken together, these results demonstrate that the interactions between Kar2p and its two nucleotide exchange factors can be functionally resolved and are thus mechanistically distinct. PMID:20430899

  17. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    NASA Astrophysics Data System (ADS)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  18. Molecular and Subcellular-Scale Modeling of Nucleotide Diffusion in the Cardiac Myofilament Lattice

    PubMed Central

    Kekenes-Huskey, Peter M.; Liao, Tao; Gillette, Andrew K.; Hake, Johan E.; Zhang, Yongjie; Michailova, Anushka P.; McCulloch, Andrew D.; McCammon, J. Andrew

    2013-01-01

    Contractile function of cardiac cells is driven by the sliding displacement of myofilaments powered by the cycling myosin crossbridges. Critical to this process is the availability of ATP, which myosin hydrolyzes during the cross-bridge cycle. The diffusion of adenine nucleotides through the myofilament lattice has been shown to be anisotropic, with slower radial diffusion perpendicular to the filament axis relative to parallel, and is attributed to the periodic hexagonal arrangement of the thin (actin) and thick (myosin) filaments. We investigated whether atomistic-resolution details of myofilament proteins can refine coarse-grain estimates of diffusional anisotropy for adenine nucleotides in the cardiac myofibril, using homogenization theory and atomistic thin filament models from the Protein Data Bank. Our results demonstrate considerable anisotropy in ATP and ADP diffusion constants that is consistent with experimental measurements and dependent on lattice spacing and myofilament overlap. A reaction-diffusion model of the half-sarcomere further suggests that diffusional anisotropy may lead to modest adenine nucleotide gradients in the myoplasm under physiological conditions. PMID:24209858

  19. Information Entropy Analysis of the H1N1 Genetic Code

    NASA Astrophysics Data System (ADS)

    Martwick, Andy

    2010-03-01

    During the current H1N1 pandemic, viral samples are being obtained from large numbers of infected people world-wide and are being sequenced on the NCBI Influenza Virus Resource Database. The information entropy of the sequences was computed from the probability of occurrence of each nucleotide base at every position of each set of sequences using Shannon's definition of information entropy, [ H=∑bpb,2( 1pb ) ] where H is the observed information entropy at each nucleotide position and pb is the probability of the base pair of the nucleotides A, C, G, U. Information entropy of the current H1N1 pandemic is compared to reference human and swine H1N1 entropy. As expected, the current H1N1 entropy is in a low entropy state and has a very large mutation potential. Using the entropy method in mature genes we can identify low entropy regions of nucleotides that generally correlate to critical protein function.

  20. The C2'- and C3'-endo equilibrium for AMP molecules bound in the cystathionine-beta-synthase domain.

    PubMed

    Feng, Na; Qi, Chao; Hou, Yan-Jie; Zhang, Ying; Wang, Da-Cheng; Li, De-Feng

    2018-03-04

    The equilibrium between C2'- and C3'-endo conformations of nucleotides in solution, as well as their polymers DNA and RNA, has been well studied in previous work. However, this equilibrium of nucleotides in their binding state remains unclear. We observed two AMP molecules, in C3'- and C2'-endo conformations respectively, simultaneously bound to a cystathionine-beta-synthase (CBS) domain dimer of the magnesium and cobalt efflux protein CorC in the crystallographic study. The C2'-endo AMP molecule assumes the higher sugar pucker energy and one more hydrogen bond with the protein than the C3'-endo molecule does. The balance between the high sugar pucker energy and the low binding energy suggests an equilibrium or switch between C2'- and C3'-endo conformations of the bound nucleotides. Our work challenge the previous hypothesis that the ribose of the bound nucleotides would be locked in a fixed conformation. Copyright © 2018 Elsevier Inc. All rights reserved.

  1. Quantitative Understanding of SHAPE Mechanism from RNA Structure and Dynamics Analysis.

    PubMed

    Hurst, Travis; Xu, Xiaojun; Zhao, Peinan; Chen, Shi-Jie

    2018-05-10

    The selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) method probes RNA local structural and dynamic information at single nucleotide resolution. To gain quantitative insights into the relationship between nucleotide flexibility, RNA 3D structure, and SHAPE reactivity, we develop a 3D Structure-SHAPE Relationship model (3DSSR) to rebuild SHAPE profiles from 3D structures. The model starts from RNA structures and combines nucleotide interaction strength and conformational propensity, ligand (SHAPE reagent) accessibility, and base-pairing pattern through a composite function to quantify the correlation between SHAPE reactivity and nucleotide conformational stability. The 3DSSR model shows the relationship between SHAPE reactivity and RNA structure and energetics. Comparisons between the 3DSSR-predicted SHAPE profile and the experimental SHAPE data show correlation, suggesting that the extracted analytical function may have captured the key factors that determine the SHAPE reactivity profile. Furthermore, the theory offers an effective method to sieve RNA 3D models and exclude models that are incompatible with experimental SHAPE data.

  2. Yap reprograms glutamine metabolism to increase nucleotide biosynthesis and enable liver growth

    PubMed Central

    Brown, Kristin K.; Evason, Kimberley; Beltz, Sebastian; Tsomides, Allison; O'Connor, Keelin; Galli, Giorgio G.; Yimlamai, Dean; Chhangawala, Sagar; Yuan, Min; Lien, Evan C.; Wucherpfennig, Julia; Nissim, Sahar; Minami, Akihiro; Cohen, David E.; Camargo, Fernando D.; Asara, John M.; Houvras, Yariv; Stainier, Didier Y.R.; Goessling, Wolfram

    2016-01-01

    The Hippo pathway is an important regulator of organ size and tumorigenesis. It is unclear, however, how Hippo signaling provides the cellular building blocks required for rapid growth. Here, we demonstrate that transgenic zebrafish expressing an activated form of the Hippo pathway effector Yap1 (also known as YAP) develop enlarged livers and are prone to liver tumor formation. Transcriptomic and metabolomic profiling identify that Yap1 reprograms glutamine metabolism. Yap1 directly enhances glutamine synthetase (glul) expression and activity, elevating steady-state levels of glutamine and enhancing the relative isotopic enrichment of nitrogen during de novo purine and pyrimidine biosynthesis. Genetic or pharmacological inhibition of GLUL diminishes the isotopic enrichment of nitrogen into nucleotides, suppresses hepatomegaly and the growth of liver cancer cells. Consequently, Yap-driven liver growth is susceptible to nucleotide inhibition. Together, our findings demonstrate that Yap1 integrates the anabolic demands of tissue growth during development and tumorigenesis by reprogramming nitrogen metabolism to stimulate nucleotide biosynthesis. PMID:27428308

  3. Nucleotide variability and linkage disequilibrium patterns in the porcine MUC4 gene.

    PubMed

    Yang, Ming; Yang, Bin; Yan, Xueming; Ouyang, Jing; Zeng, Weihong; Ai, Huashui; Ren, Jun; Huang, Lusheng

    2012-07-13

    MUC4 is a type of membrane anchored glycoprotein and serves as the major constituent of mucus that covers epithelial surfaces of many tissues such as trachea, colon and cervix. MUC4 plays important roles in the lubrication and protection of the surface epithelium, cell proliferation and differentiation, immune response, cell adhesion and cancer development. To gain insights into the evolution of the porcine MUC4 gene, we surveyed the nucleotide variability and linkage disequilibrium (LD) within this gene in Chinese indigenous breeds and Western commercial breeds. A total of 53 SNPs covering the MUC4 gene were genotyped on 5 wild boars and 307 domestic pigs representing 11 Chinese breeds and 3 Western breeds. The nucleotide variability, haplotype phylogeny and LD extent of MUC4 were analyzed in these breeds. Both Chinese and Western breeds had considerable nucleotide diversity at the MUC4 locus. Western pig breeds like Duroc and Large White have comparable nucleotide diversity as many of Chinese breeds, thus artificial selection for lean pork production have not reduced the genetic variability of MUC4 in Western commercial breeds. Haplotype phylogeny analyses indicated that MUC4 had evolved divergently in Chinese and Western pigs. The dendrogram of genetic differentiation between breeds generally reflected demographic history and geographical distribution of these breeds. LD patterns were unexpectedly similar between Chinese and Western breeds, in which LD usually extended less than 20 kb. This is different from the presumed high LD extent (more than 100 kb) in Western commercial breeds. The significant positive Tajima'D, and Fu and Li's D statistics in a few Chinese and Western breeds implied that MUC4 might undergo balancing selection in domestic breeds. Nevertheless, we cautioned that the significant statistics could be upward biased by SNP ascertainment process. Chinese and Western breeds have similar nucleotide diversity but evolve divergently in the MUC4 region. Western breeds exhibited unusual low LD extent at the MUC4 locus, reflecting the complexity of nucleotide variability of pig genome. The finding suggests that high density (e.g. 1SNP/10 kb) markers are required to capture the underlying causal variants at such regions.

  4. Purine 3':5'-cyclic nucleotides with the nucleobase in a syn orientation: cAMP, cGMP and cIMP.

    PubMed

    Řlepokura, Katarzyna Anna

    2016-06-01

    Purine 3':5'-cyclic nucleotides are very well known for their role as the secondary messengers in hormone action and cellular signal transduction. Nonetheless, their solid-state conformational details still require investigation. Five crystals containing purine 3':5'-cyclic nucleotides have been obtained and structurally characterized, namely adenosine 3':5'-cyclic phosphate dihydrate, C10H12N5O6P·2H2O or cAMP·2H2O, (I), adenosine 3':5'-cyclic phosphate 0.3-hydrate, C10H12N5O6P·0.3H2O or cAMP·0.3H2O, (II), guanosine 3':5'-cyclic phosphate pentahydrate, C10H12N5O7P·5H2O or cGMP·5H2O, (III), sodium guanosine 3':5'-cyclic phosphate tetrahydrate, Na(+)·C10H11N5O7P(-)·4H2O or Na(cGMP)·4H2O, (IV), and sodium inosine 3':5'-cyclic phosphate tetrahydrate, Na(+)·C10H10N4O7P(-)·4H2O or Na(cIMP)·4H2O, (V). Most of the cyclic nucleotide zwitterions/anions [two from four cAMP present in total in (I) and (II), cGMP in (III), cGMP(-) in (IV) and cIMP(-) in (V)] are syn conformers about the N-glycosidic bond, and this nucleobase arrangement is accompanied by Crib-H...Npur hydrogen bonds (rib = ribose and pur = purine). The base orientation is tuned by the ribose pucker. An analysis of data obtained from the Cambridge Structural Database made in the context of syn-anti conformational preferences has revealed that among the syn conformers of various purine nucleotides, cyclic nucleotides and dinucleotides predominate significantly. The interactions stabilizing the syn conformation have been indicated. The inter-nucleotide contacts in (I)-(V) have been systematized in terms of the chemical groups involved. All five structures display three-dimensional hydrogen-bonded networks.

  5. Identification and Characterization of Novel Variations in Platelet G-Protein Coupled Receptor (GPCR) Genes in Patients Historically Diagnosed with Type 1 von Willebrand Disease.

    PubMed

    Stockley, Jacqueline; Nisar, Shaista P; Leo, Vincenzo C; Sabi, Essa; Cunningham, Margaret R; Eikenboom, Jeroen C; Lethagen, Stefan; Schneppenheim, Reinhard; Goodeve, Anne C; Watson, Steve P; Mundell, Stuart J; Daly, Martina E

    2015-01-01

    The clinical expression of type 1 von Willebrand disease may be modified by co-inheritance of other mild bleeding diatheses. We previously showed that mutations in the platelet P2Y12 ADP receptor gene (P2RY12) could contribute to the bleeding phenotype in patients with type 1 von Willebrand disease. Here we investigated whether variations in platelet G protein-coupled receptor genes other than P2RY12 also contributed to the bleeding phenotype. Platelet G protein-coupled receptor genes P2RY1, F2R, F2RL3, TBXA2R and PTGIR were sequenced in 146 index cases with type 1 von Willebrand disease and the potential effects of identified single nucleotide variations were assessed using in silico methods and heterologous expression analysis. Seven heterozygous single nucleotide variations were identified in 8 index cases. Two single nucleotide variations were detected in F2R; a novel c.-67G>C transversion which reduced F2R transcriptional activity and a rare c.1063C>T transition predicting a p.L355F substitution which did not interfere with PAR1 expression or signalling. Two synonymous single nucleotide variations were identified in F2RL3 (c.402C>G, p.A134 =; c.1029 G>C p.V343 =), both of which introduced less commonly used codons and were predicted to be deleterious, though neither of them affected PAR4 receptor expression. A third single nucleotide variation in F2RL3 (c.65 C>A; p.T22N) was co-inherited with a synonymous single nucleotide variation in TBXA2R (c.6680 C>T, p.S218 =). Expression and signalling of the p.T22N PAR4 variant was similar to wild-type, while the TBXA2R variation introduced a cryptic splice site that was predicted to cause premature termination of protein translation. The enrichment of single nucleotide variations in G protein-coupled receptor genes among type 1 von Willebrand disease patients supports the view of type 1 von Willebrand disease as a polygenic disorder.

  6. Interactive computer programs for the graphic analysis of nucleotide sequence data.

    PubMed Central

    Luckow, V A; Littlewood, R K; Rownd, R H

    1984-01-01

    A group of interactive computer programs have been developed which aid in the collection and graphical analysis of nucleotide and protein sequence data. The programs perform the following basic functions: a) enter, edit, list, and rearrange sequence data; b) permit automatic entry of nucleotide sequence data directly from an autoradiograph into the computer; c) search for restriction sites or other specified patterns and plot a linear or circular restriction map, or print their locations; d) plot base composition; e) analyze homology between sequences by plotting a two-dimensional graphic matrix; and f) aid in plotting predicted secondary structures of RNA molecules. PMID:6546437

  7. Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.

    PubMed

    Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru

    2017-04-18

    Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.

  8. The augmentation algorithm and molecular phylogenetic trees

    NASA Technical Reports Server (NTRS)

    Holmquist, R.

    1978-01-01

    Moore's (1977) augmentation procedure is discussed, and it is concluded that the procedure is valid for obtaining estimates of the total number of fixed nucleotide substitutions both theoretically and in practice, for both simulated and real data, and in agreement, for experimentally dense data sets, with stochastic estimates of the divergence, provided the restrictions on codon mutability resulting from natural selection are explicitly allowed for. Tateno and Nei's (1978) critique that the augmentation procedure has a systematic bias toward overestimation of the total number of nucleotide replacements is disputed, and a data analysis suggests that ancestral sequences inferred by the method of parsimony contain a large number of incorrectly assigned nucleotides.

  9. High speed nucleic acid sequencing

    DOEpatents

    Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

    2011-05-17

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid. Each type of labeled nucleotide comprises an acceptor fluorophore attached to a phosphate portion of the nucleotide such that the fluorophore is removed upon incorporation into a growing strand. Fluorescent signal is emitted via fluorescent resonance energy transfer between the donor fluorophore and the acceptor fluorophore as each nucleotide is incorporated into the growing strand. The sequence is deduced by identifying which base is being incorporated into the growing strand.

  10. Prebiotic chemistry and nucleic acid replication

    NASA Technical Reports Server (NTRS)

    Orgel, L. E.; Lohrmann, R.

    1974-01-01

    Recent work is reviewed on some reactions that could have occurred on the primitive earth and that could have played a part in the evolution of a self-replicating system. The transition from the primitive atmosphere to the simplest replicating molecules is considered in four stages: (1) the formation of a 'prebiotic soup' of organic precursors, including the purine and pyrimidine bases and the pentose sugars; (2) the condensation of these precursors and inorganic phosphate to form monomeric nucleotides and activated nucleotide derivatives; (3) the polymerization of nucleotide derivatives to oligonucleotides; and (4) the complementary replication of oligonucleotides in a template-directed process that depends on Watson-Crick base pairing.

  11. Bacterial nucleotide-based second messengers.

    PubMed

    Pesavento, Christina; Hengge, Regine

    2009-04-01

    In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.

  12. [Single nucleotide polymorphism and its application in allogeneic hematopoietic stem cell transplantation--review].

    PubMed

    Li, Su-Xia

    2004-12-01

    Single nucleotide polymorphism (SNP) is the third genetic marker after restriction fragment length polymorphism (RFLP) and short tandem repeat. It represents the most density genetic variability in the human genome and has been widely used in gene location, cloning, and research of heredity variation, as well as parenthood identification in forensic medicine. As steady heredity polymorphism, single nucleotide polymorphism is becoming the focus of attention in monitoring chimerism and minimal residual disease in the patients after allogeneic hematopoietic stem cell transplantation. The article reviews SNP heredity characterization, analysis techniques and its applications in allogeneic stem cell transplantation and other fields.

  13. Stereoselective formation of a 2 prime (3 prime)- aminoacyl ester of a nucleotide

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    Reaction of DL-series and adenosine-5-phosphorimidazolide in the presence of adenosine-5'-(0-methylphosphate) and imidazole resulted in the stereoselective synthesis of the aminoacyl nucleotide ester, 2'(3')-0-seryl-adenosine-5'-(0-methylphosphate). The enantiomeric excess of D-serine incorporated into 2'(3')-0-seryl-adenosine-5'-(0-methylphosphate) was about 9%. Adenylyl-(5->N)-serine and an unknown product also incorporated an excess of D-serine, however, seryl-serine showed an excess of L-serine. The relationship of these results to the origin of the biological pairing of L-amino acids and nucleotides containing D-ribose is discussed.

  14. Hydrolytic and alcoholytic dephosphorylation of nucleotides by acid phosphatase in the presence of ethanol.

    PubMed

    Tomaszewski, M; Buchowicz, J

    1971-08-01

    The effect of ethanol on the activity of acid phosphatase from wheat germ was studied, by using ribonucleoside monophosphates as the enzyme substrates. The nucleotides were effectively degraded to the corresponding nucleosides in the presence of ethanol at all concentrations tested, including a 96% (v/v) solution. However, the nucleotide dephosphorylation was accompanied by the liberation of orthophosphate only when the concentration of ethanol in the assay mixture did not exceed 15%. No inorganic phosphate was liberated when ethanol was present at higher concentrations. Instead, monoethyl phosphate was formed in quantities expected for orthophosphate. The results are explained in terms of phosphatase-catalysed alcoholysis.

  15. First report of Beet western yellows virus infecting Epiphyllum spp

    USDA-ARS?s Scientific Manuscript database

    Beet western yellow virus (BWYV) was identified from an orchid cactus (Epiphyllum spp.) hybrid without obvious symptoms by high-throughput sequencing. The nearly complete genomic sequence of 5,458 nucleotides of the virus was determined. The isolate has the highest nucleotide sequence identity (93%)...

  16. A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

  17. Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes

    USDA-ARS?s Scientific Manuscript database

    Technical Abstract: 20-75 CHARACTER LINES A strategy for a genome-wide assessment of nucleotide diversity in a polyploid species must minimize the inclusion of homoeologous sequences into diversity estimates and reliably allocate individual haplotypes into respective genomes. In this study, nucle...

  18. Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

    USDA-ARS?s Scientific Manuscript database

    High-density single nucleotide polymorphism (SNP) genotyping chips are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships among individuals in populations and studying marker-trait associations in mapping experiments. We developed a genotyping array includ...

  19. Multilocus patterns of nucleotide polymorphism and demographic change in Taxodium distichum (Cupressaceae) in the lower Mississippi River alluvial valley

    USGS Publications Warehouse

    Kusumi, Junko; Zidong, Li; Kado, Tomoyuki; Tsumura, Yoshihiko; Middleton, Beth A.; Tachida, Hidenori

    2010-01-01

    Conclusions: Taxodium distichum had significantly higher nucleotide variation than C. japonica, and its patterns of polymorphism contrasted strikingly with those of the latter, which previously has been inferred to have experienced a reduction in population size.

  20. Novel high-speed droplet-allele specific-polymerase chain reaction: application in the rapid genotyping of single nucleotide polymorphisms.

    PubMed

    Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki

    2013-09-23

    Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Distinctive features of single nucleotide alterations in induced pluripotent stem cells with different types of DNA repair deficiency disorders

    PubMed Central

    Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro

    2016-01-01

    Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874

  2. Hypochlorous acid-promoted loss of metabolic energy in Escherichia coli.

    PubMed Central

    Barrette, W C; Albrich, J M; Hurst, J K

    1987-01-01

    Oxidation of Escherichia coli by hypochlorous acid (HOCl) or chloramine (NH2Cl) gives rise to massive hydrolysis of cytosolic nucleotide phosphoanhydride bonds, although no immediate change occurs in either the nucleotide pool size or the concentrations of extracellular end products of AMP catabolism. Titrimetric curves of the extent of hydrolysis coincide with curves for loss of cell viability, e.g., reduction in the adenylate energy charge from 0.8 to 0.1-0.2 accompanies loss of 99% of the bacterial CFU. The oxidative damage caused by HOCl is irreversible within 100 ms of exposure of the organism, although nucleotide phosphate bond hydrolysis requires several minutes to reach completion. Neither HOCl nor NH2Cl reacts directly with nucleotides to hydrolyze phosphoanhydride bonds. Loss of viability is also accompanied by inhibition of induction of beta-galactosidase. The proton motive force, determined from the distribution of 14C-radiolabeled lipophilic ions, declines with incremental addition of HOCl after loss of respiratory function; severalfold more oxidant is required for the dissipation of the proton motive force than for loss of viability. These observations establish a causal link between loss of metabolic energy and cellular death and indicate that the mechanisms of oxidant-induced nucleotide phosphate bond hydrolysis are indirect and that they probably involve damage to the energy-transducing and transport proteins located in the bacterial plasma membrane. PMID:2820883

  3. Coupling of guanine nucleotide inhibitory protein to somatostatin receptors on pancreatic acinar membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sakamoto, C.; Matozaki, T.; Nagao, M.

    1987-09-01

    Guanine nucleotides and pertussis toxin were used to investigate whether somatostatin receptors interact with the guanine nucleotide inhibitory protein (NI) on pancreatic acinar membranes in the rat. Guanine nucleotides reduced /sup 125/I-(Tyr/sup 1/)somatostatin binding to acinar membranes up to 80%, with rank order of potency being 5'-guanylyl imidodiphosphate (Gpp(NH)p)>GTP>TDP>GMP. Scatchard analysis revealed that the decrease in somatostatin binding caused by Gpp(NH)p was due to the decrease in the maximum binding capacity without a significant change in the binding affinity. The inhibitory effect of Gpp(NH)p was partially abolished in the absence of Mg/sup 2 +/. When pancreatic acini were treated withmore » 1 ..mu..g/ml pertussis toxin for 4 h, subsequent /sup 125/I-(Tyr/sup 1/)somatostatin binding to acinar membranes was reduced. Pertussis toxin treatment also abolished the inhibitory effect of somatostatin on vasoactive intestinal peptide-stimulated increase in cellular content of adenosine 3',5'-cyclic monophosphate (cAMP) in the acini. The present results suggest that 1) somatostatin probably functions in the pancreas to regulate adenylate cyclase enzyme system via Ni, 2) the extent of modification of Ni is correlated with the ability of somatostatin to inhibit cAMP accumulation in acini, and 3) guanine nucleotides also inhibit somatostatin binding to its receptor.« less

  4. The use of modified and non-natural nucleotides provide unique insights into pro-mutagenic replication catalyzed by polymerase eta

    PubMed Central

    Choi, Jung-Suk; Dasari, Anvesh; Hu, Peter; Benkovic, Stephen J.; Berdis, Anthony J.

    2016-01-01

    This report evaluates the pro-mutagenic behavior of 8-oxo-guanine (8-oxo-G) by quantifying the ability of high-fidelity and specialized DNA polymerases to incorporate natural and modified nucleotides opposite this lesion. Although high-fidelity DNA polymerases such as pol δ and the bacteriophage T4 DNA polymerase replicating 8-oxo-G in an error-prone manner, they display remarkably low efficiencies for TLS compared to normal DNA synthesis. In contrast, pol η shows a combination of high efficiency and low fidelity when replicating 8-oxo-G. These combined properties are consistent with a pro-mutagenic role for pol η when replicating this DNA lesion. Studies using modified nucleotide analogs show that pol η relies heavily on hydrogen-bonding interactions during translesion DNA synthesis. However, nucleobase modifications such as alkylation to the N2 position of guanine significantly increase error-prone synthesis catalyzed by pol η when replicating 8-oxo-G. Molecular modeling studies demonstrate the existence of a hydrophobic pocket in pol η that participates in the increased utilization of certain hydrophobic nucleotides. A model is proposed for enhanced pro-mutagenic replication catalyzed by pol η that couples efficient incorporation of damaged nucleotides opposite oxidized DNA lesions created by reactive oxygen species. The biological implications of this model toward increasing mutagenic events in lung cancer are discussed. PMID:26717984

  5. Kinetic parameters and renal clearances of plasma adenosine 3′,5′-monophosphate and guanosine 3′,5′-monophosphate in man

    PubMed Central

    Broadus, Arthur E.; Kaminsky, Neil I.; Hardman, Joel G.; Sutherland, Earl W.; Liddle, Grant W.

    1970-01-01

    Kinetic parameters and the renal clearances of plasma adenosine 3′,5′-monophosphate (cyclic AMP) and guanosine 3′,5′-monophosphate (cyclic GMP) were evaluated in normal subjects using tritium-labeled cyclic nucleotides. Each tracer was administered both by single, rapid intravenous injection and by constant intravenous infusion, and the specific activities of the cyclic nucleotides in plasma and urine were determined. Both cyclic AMP and cyclic GMP were cleared from plasma by glomerular filtration. The kidney was found to add a variable quantity of endogenous cyclic AMP to the tubular urine, amounting to an average of approximately one-third of the total level of cyclic AMP excreted. Plasma was the source of virtually all of the cyclic GMP excreted. Plasma levels of the cyclic nucleotides appeared to be in dynamic steady state. The apparent volumes of distribution of both nucleotides exceeded extracellular fluid volume, averaging 27 and 38% of body weight for cyclic AMP and cyclic GMP, respectively. Plasma production rates ranged from 9 to 17 nmoles/min for cyclic AMP and from 7 to 13 nmoles/min for cyclic GMP. Plasma clearance rates averaged 668 ml/min for cyclic AMP and 855 ml/min for cyclic GMP. Approximately 85% of the elimination of the cyclic nucleotides from the circulation was due to extrarenal clearance. PMID:5480849

  6. Transcripts of the NADH-dehydrogenase subunit 3 gene are differentially edited in Oenothera mitochondria.

    PubMed Central

    Schuster, W; Wissinger, B; Unseld, M; Brennicke, A

    1990-01-01

    A number of cytosines are altered to be recognized as uridines in transcripts of the nad3 locus in mitochondria of the higher plant Oenothera. Such nucleotide modifications can be found at 16 different sites within the nad3 coding region. Most of these alterations in the mRNA sequence change codon identities to specify amino acids better conserved in evolution. Individual cDNA clones differ in their degree of editing at five nucleotide positions, three of which are silent, while two lead to codon alterations specifying different amino acids. None of the cDNA clones analysed is maximally edited at all possible sites, suggesting slow processing or lowered stringency of editing at these nucleotides. Differentially edited transcripts could be editing intermediates or could code for differing polypeptides. Two edited nucleotides in an open reading frame located upstream of nad3 change two amino acids in the deduced polypeptide. Part of the well-conserved ribosomal protein gene rps12 also encoded downstream of nad3 in other plants, is lost in Oenothera mitochondria by recombination events. The functional rps12 protein must be imported from the cytoplasm since the deleted sequences of this gene are not found in the Oenothera mitochondrial genome. The pseudogene sequence is not edited at any nucleotide position. Images Fig. 3. Fig. 4. Fig. 7. PMID:1688531

  7. Parallel increase of dolichol pathway and nucleotide pyrophosphatases in rat hepatocytes by dexamethasone

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sarkar, M.; Mookerjea, S.

    1986-05-01

    Incorporation of (/sup 14/C)-mannose to dolichol phosphate mannose, dolichol pyrophosphate oligosaccharide and N-linked glycoproteins in cultured hepatocytes was increased by dexamethasone. Nucleotide pyrophosphatases are now measured to investigate possible control of glycosylation by the nucleotide sugar pools. Dexamethasone caused about 2 fold increase of UDP-GlcNAc and GDP-Man pyrophosphatase activity which is evident as early as 4 hr and increased up to 12 hr of incubation. The K/sub m/ for UDP-GlcNAc and GDP-Man were respectively 0.43 mM and 0.47 mM in homogenate membrane and the values remained unchanged by dexamethasone treatment. However the V/sub max/ of the enzymes were increased withmore » both UDP-GlcNAc and GDP-Man. The broad pH optima of the enzymes (pH 8 to 10) indicated their alkaline nature. Mixing experiments of the cell homogenates from control and dexamethasone treated cells showed that UDP-GlcNAc and GDP-Man pyrophosphatase activities were additive which ruled out the possibility of presence of any activator or removal of any inhibitor due to dexamethasone. The parallel increase of nucleotide pyrophosphatase and dolichol linked pathway by dexamethasone does not support the possibility that stimulation of glycoprotein synthesis by dexamethasone is mediated by transfer of nucleotide sugars towards dolichol saccharides.« less

  8. Mechanism of conformational coupling in SecA: Key role of hydrogen-bonding networks and water interactions.

    PubMed

    Milenkovic, Stefan; Bondar, Ana-Nicoleta

    2016-02-01

    SecA uses the energy yielded by the binding and hydrolysis of adenosine triphosphate (ATP) to push secretory pre-proteins across the plasma membrane in bacteria. Hydrolysis of ATP occurs at the nucleotide-binding site, which contains the conserved carboxylate groups of the DEAD-box helicases. Although crystal structures provide valuable snapshots of SecA along its reaction cycle, the mechanism that ensures conformational coupling between the nucleotide-binding site and the other domains of SecA remains unclear. The observation that SecA contains numerous hydrogen-bonding groups raises important questions about the role of hydrogen-bonding networks and hydrogen-bond dynamics in long-distance conformational couplings. To address these questions, we explored the molecular dynamics of SecA from three different organisms, with and without bound nucleotide, in water. By computing two-dimensional hydrogen-bonding maps we identify networks of hydrogen bonds that connect the nucleotide-binding site to remote regions of the protein, and sites in the protein that respond to specific perturbations. We find that the nucleotide-binding site of ADP-bound SecA has a preferred geometry whereby the first two carboxylates of the DEAD motif bridge via hydrogen-bonding water. Simulations of a mutant with perturbed ATP hydrolysis highlight the water-bridged geometry as a key structural element of the reaction path. Copyright © 2015. Published by Elsevier B.V.

  9. Substrate-Dependence of Competitive Nucleotide Pyrophosphatase/Phosphodiesterase1 (NPP1) Inhibitors

    PubMed Central

    Lee, Sang-Yong; Sarkar, Soumya; Bhattarai, Sanjay; Namasivayam, Vigneshwaran; De Jonghe, Steven; Stephan, Holger; Herdewijn, Piet; El-Tayeb, Ali; Müller, Christa E.

    2017-01-01

    Nucleotide pyrophosphatase/phosphodiesterase type 1 (NPP1) is a membrane glycoprotein involved in the hydrolysis of extracellular nucleotides. Its major substrate is ATP which is converted to AMP and diphosphate. NPP1 was proposed as a new therapeutic target in brain cancer and immuno-oncology. Several NPP1 inhibitors have been reported to date, most of which were evaluated vs. the artificial substrate p-nitrophenyl 5′-thymidine monophosphate (p-Nph-5′-TMP). Recently, we observed large discrepancies in inhibitory potencies for a class of competitive NPP1 inhibitors when tested vs. the artificial substrate p-Nph-5′-TMP as compared to the natural substrate ATP. Therefore, the goal of the present study was to investigate whether inhibitors of human NPP1 generally display substrate-dependent inhibitory potency. Systematic evaluation of nucleotidic as well as non-nucleotidic NPP1 inhibitors revealed significant differences in determined Ki values for competitive, but not for non- and un-competitive inhibitors when tested vs. the frequently used artificial substrate p-Nph-5′-TMP as compared to ATP. Allosteric modulation of NPP1 by p-Nph-5′-TMP may explain these discrepancies. Results obtained using the AMP derivative p-nitrophenyl 5′-adenosine monophosphate (p-Nph-5′-AMP) as an alternative artificial substrate correlated much better with those employing the natural substrate ATP. PMID:28261095

  10. Comparative characterization of nucleotides, nucleosides and nucleobases in Abelmoschus manihot roots, stems, leaves and flowers during different growth periods by UPLC-TQ-MS/MS.

    PubMed

    Du, Le-Yue; Qian, Da-Wei; Jiang, Shu; Shang, Er-Xin; Guo, Jian-Ming; Liu, Pei; Su, Shu-Lan; Duan, Jin-Ao; Zhao, Min

    2015-12-01

    Nucleotides, nucleosides and nucleobases have been proven as important bioactive compounds related to many physiological processes. Abelmoschus manihot (L.) Medicus from the family of Malvaceae is an annual herbal plant of folk medicine widely distributed in Oceania and Asia. However, up to now, no detailed information could be available for the types and contents of nucleotides, nucleosides and nucleobases contained in A. manihot roots, stems, leaves as well as the flowers. In the present study, an UPLC-TQ-MS/MS method was established for detection of the twelve nucleotides, nucleosides and nucleobases. The validated method was successfully applied to identify the 12 analytes in different parts of A. manihot harvested at ten growth periods. 2'-deoxyinosine was not detected in all of the A. manihot samples. The data demonstrated that the distribution and concentration of the 12 compounds in A. manihot four parts were arranged in a decreasing order as leaf>flower>stem>root. Based on the results, the leaves and flowers of A. manihot could be developed as health products possessed nutraceutical and bioactive properties in the future. This method might also be utilized for the quality control of the A. manihot leaves and other herbal medicines being rich in nucleotides, nucleosides and nulecobases. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. The immediate upstream region of the 5′-UTR from the AUG start codon has a pronounced effect on the translational efficiency in Arabidopsis thaliana

    PubMed Central

    Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan

    2014-01-01

    The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084

  12. Mitochondrial control-region sequence variation in aboriginal Australians.

    PubMed Central

    van Holst Pellekaan, S; Frommer, M; Sved, J; Boettcher, B

    1998-01-01

    The mitochondrial D-loop hypervariable segment 1 (mt HVS1) between nucleotides 15997 and 16377 has been examined in aboriginal Australian people from the Darling River region of New South Wales (riverine) and from Yuendumu in central Australia (desert). Forty-seven unique HVS1 types were identified, varying at 49 nucleotide positions. Pairwise analysis by calculation of BEPPI (between population proportion index) reveals statistically significant structure in the populations, although some identical HVS1 types are seen in the two contrasting regions. mt HVS1 types may reflect more-ancient distributions than do linguistic diversity and other culturally distinguishing attributes. Comparison with sequences from five published global studies reveals that these Australians demonstrate greatest divergence from some Africans, least from Papua New Guinea highlanders, and only slightly more from some Pacific groups (Indonesian, Asian, Samoan, and coastal Papua New Guinea), although the HVS1 types vary at different nucleotide sites. Construction of a median network, displaying three main groups, suggests that several hypervariable nucleotide sites within the HVS1 are likely to have undergone mutation independently, making phylogenetic comparison with global samples by conventional methods difficult. Specific nucleotide-site variants are major separators in median networks constructed from Australian HVS1 types alone and for one global selection. The distribution of these, requiring extended study, suggests that they may be signatures of different groups of prehistoric colonizers into Australia, for which the time of colonization remains elusive. PMID:9463317

  13. A ruler protein in a complex for antiviral defense determines the length of small interfering CRISPR RNAs.

    PubMed

    Hatoum-Aslan, Asma; Samai, Poulami; Maniv, Inbal; Jiang, Wenyan; Marraffini, Luciano A

    2013-09-27

    Small RNAs undergo maturation events that precisely determine the length and structure required for their function. CRISPRs (clustered regularly interspaced short palindromic repeats) encode small RNAs (crRNAs) that together with CRISPR-associated (cas) genes constitute a sequence-specific prokaryotic immune system for anti-viral and anti-plasmid defense. crRNAs are subject to multiple processing events during their biogenesis, and little is known about the mechanism of the final maturation step. We show that in the Staphylococcus epidermidis type III CRISPR-Cas system, mature crRNAs are measured in a Cas10·Csm ribonucleoprotein complex to yield discrete lengths that differ by 6-nucleotide increments. We looked for mutants that impact this crRNA size pattern and found that an alanine substitution of a conserved aspartate residue of Csm3 eliminates the 6-nucleotide increments in the length of crRNAs. In vitro, recombinant Csm3 binds RNA molecules at multiple sites, producing gel-shift patterns that suggest that each protein binds 6 nucleotides of substrate. In vivo, changes in the levels of Csm3 modulate the crRNA size distribution without disrupting the 6-nucleotide periodicity. Our data support a model in which multiple Csm3 molecules within the Cas10·Csm complex bind the crRNA with a 6-nucleotide periodicity to function as a ruler that measures the extent of crRNA maturation.

  14. Evidence of codon usage in the nearest neighbor spacing distribution of bases in bacterial genomes

    NASA Astrophysics Data System (ADS)

    Higareda, M. F.; Geiger, O.; Mendoza, L.; Méndez-Sánchez, R. A.

    2012-02-01

    Statistical analysis of whole genomic sequences usually assumes a homogeneous nucleotide density throughout the genome, an assumption that has been proved incorrect for several organisms since the nucleotide density is only locally homogeneous. To avoid giving a single numerical value to this variable property, we propose the use of spectral statistics, which characterizes the density of nucleotides as a function of its position in the genome. We show that the cumulative density of bases in bacterial genomes can be separated into an average (or secular) plus a fluctuating part. Bacterial genomes can be divided into two groups according to the qualitative description of their secular part: linear and piecewise linear. These two groups of genomes show different properties when their nucleotide spacing distribution is studied. In order to analyze genomes having a variable nucleotide density, statistically, the use of unfolding is necessary, i.e., to get a separation between the secular part and the fluctuations. The unfolding allows an adequate comparison with the statistical properties of other genomes. With this methodology, four genomes were analyzed Burkholderia, Bacillus, Clostridium and Corynebacterium. Interestingly, the nearest neighbor spacing distributions or detrended distance distributions are very similar for species within the same genus but they are very different for species from different genera. This difference can be attributed to the difference in the codon usage.

  15. Small-GTPase-associated signaling by the guanine nucleotide exchange factors CpDock180 and CpCdc24, the GTPase effector CpSte20, and the scaffold protein CpBem1 in Claviceps purpurea.

    PubMed

    Herrmann, Andrea; Tillmann, Britta A M; Schürmann, Janine; Bölker, Michael; Tudzynski, Paul

    2014-04-01

    Monomeric GTPases of the Rho subfamily are important mediators of polar growth and NADPH (Nox) signaling in a variety of organisms. These pathways influence the ability of Claviceps purpurea to infect host plants. GTPase regulators contribute to the nucleotide loading cycle that is essential for proper functionality of the GTPases. Scaffold proteins gather GTPase complexes to facilitate proper function. The guanine nucleotide exchange factors (GEFs) CpCdc24 and CpDock180 activate GTPase signaling by triggering nucleotide exchange of the GTPases. Here we show that CpCdc24 harbors nucleotide exchange activity for both Rac and Cdc42 homologues. The GEFs partly share the cellular distribution of the GTPases and interact with the putative upstream GTPase CpRas1. Interaction studies show the formation of higher-order protein complexes, mediated by the scaffold protein CpBem1. Besides the GTPases and GEFs, these complexes also contain the GTPase effectors CpSte20 and CpCla4, as well as the regulatory protein CpNoxR. Functional characterizations suggest a role of CpCdc24 mainly in polarity, whereas CpDock180 is involved in stress tolerance mechanisms. These findings indicate the dynamic formation of small GTPase complexes and improve the model for GTPase-associated signaling in C. purpurea.

  16. Interaction of ligands with the opiate receptors of brain membranes: Regulation by ions and nucleotides

    PubMed Central

    Blume, Arthur J.

    1978-01-01

    This study shows that nucleotides, as well as ions, regulate the opiate receptors of brain. GMP-P(NH)P and Na+ reduce the amount of steady-state specific [3H]dihydromorphine binding and increase the rate of dissociation of the ligand from the opiate receptor. In contrast, Mn2+ decreases the rate of ligand dissociation and antagonizes the ability of Na+ to increase dissociation. The effects of GMP-P(NH)P on steady-state binding and dissociation are not reversed by washing. Only GTP, GDP, ITP, and IMP-P(NH)P, in addition to GMP-P(NH)P, increase the rate of dihydromorphine dissociation. The site of nucleotide action appears to have high affinity: <1 μM GMP-P(NH)P produces half-maximal increases in ligand dissociation. GMP-P(NH)P- and Na+-directed increases in dissociation have also been found for the opiate agonists [3H]etorphine, [3H]Leu-enkephalin, and [3H]Met-enkephalin and the opiate antagonist [3H]naltrexone. Mn2+-directed decreases in dissociation have been found for the agonist [3H]-etorphine and the antagonist [3H]naltrexone. Although the plasma membrane receptors for a number of other neuro-transmitters and hormones are also regulated by guanine nucleotides, the opiate receptors appear unique because only they show nucleotide regulation of both agonist and antagonist binding. PMID:205867

  17. Conservation/Mutation in the Splice Sites of Mitochondrial Solute Carrier Genes of Vertebrates.

    PubMed

    Calvello, Rosa; Panaro, Maria A; Salvatore, Rosaria; Mitolo, Vincenzo; Cianciulli, Antonia

    2016-10-01

    The "canonical" introns begin by the dinucleotide GT and end by the dinucleotide AG. GT, together with a few downstream nucleotides, and AG, with a few of the immediately preceding nucleotides, are thought to be the strongest splicing signals (5'ss and 3'ss, respectively). We examined the composition of the intronic initial and terminal hexanucleotides of the mitochondrial solute carrier genes (SLC25A's) of zebrafish, chicken, mouse, and human. These genes are orthologous and we selected the transcripts in which the arrangement of exons and introns was superimposable in the species considered. Both 5'ss and 3'ss were highly polymorphic, with 104 and 126 different configurations, respectively, in our sample. In the line of evolution from zebrafish to chicken, as well as in that from zebrafish to mammals, the average nucleotide conservation in the four variable nucleotides was about 50 % at 5' and 40 % at 3'. In the divergent evolution of mouse and human, the conservation was about 80 % at 5' and 70 % at 3'. Despite these changes, the splicing signals remain strong enough to operate at the same site. At both 5' and 3', the frequency of a nucleotide at a given position in the zebrafish sequence is positively correlated with its conservation in chicken and mammals, suggesting that selection continued to operate in birds and mammals along similar lines.

  18. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    PubMed

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Mechanism of the Exchange Reaction in HRAS from Multiscale Modeling

    PubMed Central

    Kapoor, Abhijeet; Travesset, Alex

    2014-01-01

    HRAS regulates cell growth promoting signaling processes by cycling between active (GTP-bound) and inactive (GDP-bound) states. Understanding the transition mechanism is central for the design of small molecules to inhibit the formation of RAS-driven tumors. Using a multiscale approach involving coarse-grained (CG) simulations, all-atom classical molecular dynamics (CMD; total of 3.02 µs), and steered molecular dynamics (SMD) in combination with Principal Component Analysis (PCA), we identified the structural features that determine the nucleotide (GDP) exchange reaction. We show that weakening the coupling between the SwitchI (residues 25–40) and SwitchII (residues 59–75) accelerates the opening of SwitchI; however, an open conformation of SwitchI is unstable in the absence of guanine nucleotide exchange factors (GEFs) and rises up towards the bound nucleotide to close the nucleotide pocket. Both I21 and Y32, play a crucial role in SwitchI transition. We show that an open SwitchI conformation is not necessary for GDP destabilization but is required for GDP/Mg escape from the HRAS. Further, we present the first simulation study showing displacement of GDP/Mg away from the nucleotide pocket. Both SwitchI and SwitchII, delays the escape of displaced GDP/Mg in the absence of GEF. Based on these results, a model for the mechanism of GEF in accelerating the exchange process is hypothesized. PMID:25272152

  20. Evidence for Natural Selection in Nucleotide Content Relationships Based on Complete Mitochondrial Genomes: Strong Effect of Guanine Content on Separation between Terrestrial and Aquatic Vertebrates.

    PubMed

    Sorimachi, Kenji; Okayasu, Teiji

    2015-01-01

    The complete vertebrate mitochondrial genome consists of 13 coding genes. We used this genome to investigate the existence of natural selection in vertebrate evolution. From the complete mitochondrial genomes, we predicted nucleotide contents and then separated these values into coding and non-coding regions. When nucleotide contents of a coding or non-coding region were plotted against the nucleotide content of the complete mitochondrial genomes, we obtained linear regression lines only between homonucleotides and their analogs. On every plot using G or A content purine, G content in aquatic vertebrates was higher than that in terrestrial vertebrates, while A content in aquatic vertebrates was lower than that in terrestrial vertebrates. Based on these relationships, vertebrates were separated into two groups, terrestrial and aquatic. However, using C or T content pyrimidine, clear separation between these two groups was not obtained. The hagfish (Eptatretus burgeri) was further separated from both terrestrial and aquatic vertebrates. Based on these results, nucleotide content relationships predicted from the complete vertebrate mitochondrial genomes reveal the existence of natural selection based on evolutionary separation between terrestrial and aquatic vertebrate groups. In addition, we propose that separation of the two groups might be linked to ammonia detoxification based on high G and low A contents, which encode Glu rich and Lys poor proteins.

  1. Switch II Mutants Reveal Coupling between the Nucleotide- and Actin-Binding Regions in Myosin V

    PubMed Central

    Trivedi, Darshan V.; David, Charles; Jacobs, Donald J.; Yengo, Christopher M.

    2012-01-01

    Conserved active-site elements in myosins and other P-loop NTPases play critical roles in nucleotide binding and hydrolysis; however, the mechanisms of allosteric communication among these mechanoenzymes remain unresolved. In this work we introduced the E442A mutation, which abrogates a salt-bridge between switch I and switch II, and the G440A mutation, which abolishes a main-chain hydrogen bond associated with the interaction of switch II with the γ phosphate of ATP, into myosin V. We used fluorescence resonance energy transfer between mant-labeled nucleotides or IAEDANS-labeled actin and FlAsH-labeled myosin V to examine the conformation of the nucleotide- and actin-binding regions, respectively. We demonstrate that in the absence of actin, both the G440A and E442A mutants bind ATP with similar affinity and result in only minor alterations in the conformation of the nucleotide-binding pocket (NBP). In the presence of ADP and actin, both switch II mutants disrupt the formation of a closed NBP actomyosin.ADP state. The G440A mutant also prevents ATP-induced opening of the actin-binding cleft. Our results indicate that the switch II region is critical for stabilizing the closed NBP conformation in the presence of actin, and is essential for communication between the active site and actin-binding region. PMID:22713570

  2. Investigation of the Solubility and Enzymatic Activity of a Thioredoxin-Gelonin Fusion Protein

    DTIC Science & Technology

    1997-05-01

    1992). Figure lb is a diagram based on nuclear magnetic resonance data (NMR) of a 29-nucleotide RNA sequence containing the 17-nucleotide S/R loop and...Battalion Chemical Officer, Nuclear , Biological, Chancl Recoassanm Platoon Leader, Chemical Company Executive Officer, US Army Chemical Officer Advanced

  3. Genome-wide association study of fertility traits in dairy cattle using high-density single nucleotide polymorphism marker panels

    USDA-ARS?s Scientific Manuscript database

    Unfavorable genetic correlations between production and fertility traits are well documented. Genetic selection for fertility traits is slow, however, due to low heritabilities. Identification of single nucleotide polymorphisms (SNP) involved in reproduction could improve reliability of genomic esti...

  4. Alfalfa virus S, a new species in the family Alphaflexiviridae

    USDA-ARS?s Scientific Manuscript database

    A new species of the family Alphaflexiviridae provisionally named alfalfa virus S (AVS) was discovered in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by high throughput sequenc...

  5. Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

    USDA-ARS?s Scientific Manuscript database

    : Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

  6. Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms

    USDA-ARS?s Scientific Manuscript database

    We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...

  7. Design and Testing of Bi-functional, P-loop Targeted MDM2 Inhibitors

    DTIC Science & Technology

    2008-03-01

    Nucleotide Binding Activity of the Mdm2 RING Domain Christina Priest, Masha Poyurovsky, Brent Stockwell and Carol Prives Department of Biological Sciences...Deconstructing nucleotide binding activity of the Mdm2 RING domain Christina Priest, Carol Prives* and Masha V. Poyurovsky Department of Biological Sciences

  8. High-throughput single nucleotide polymorphism genotyping for breeding applications in rice using the BeadXpress platform

    USDA-ARS?s Scientific Manuscript database

    Multiplexed single nucleotide polymorphism (SNP) markers have the potential to increase the speed and cost-effectiveness of genotyping, provided that an optimal SNP density is used for each application. To test the efficiency of multiplexed SNP genotyping for diversity, mapping and breeding applicat...

  9. Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

    USDA-ARS?s Scientific Manuscript database

    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

  10. Informativeness of single nucleotide polymorphisms and relationships among onion populations from important world production regions

    USDA-ARS?s Scientific Manuscript database

    Single nucleotide polymorphisms (SNPs) were genotyped using a high-density array and DNAs from individual plants from important onion populations from major production regions world-wide and the likely progenitor of onion, Allium vavilovii. Genotypes at 1226 SNPs were used to estimate genetic relati...

  11. Associations between single nucleotide polymorphisms in folate uptake and metabolizing genes with blood folate, homocysteine and DNA uracil concentrations

    USDA-ARS?s Scientific Manuscript database

    Background: Folate is an essential nutrient which supports nucleotide synthesis and biological methylation reactions. Diminished folate status results in chromosome breakage and is associated with several diseases including colorectal cancer. Folate status is also inversely related to plasma homocys...

  12. POLYMORPHISMS IN THE DNA NUCLEOTIDE EXCISION REPAIR GENES AND LUNG CANCER RISK IN XUAN WEI, CHINA

    EPA Science Inventory

    The lung cancer mortality rate in Xuan Wei County, China is among the highest in the country and has been etiologically attributed to exposure to indoor smoky coal emissions that contain very high levels of polycyclic aromatic hydrocarbons (PAHs). Nucleotide excision repair (NE...

  13. Molecular Characterization of an Avian Astrovirus

    PubMed Central

    Koci, Matthew D.; Seal, Bruce S.; Schultz-Cherry, Stacey

    2000-01-01

    Astroviruses are known to cause enteric disease in several animal species, including turkeys. However, only human astroviruses have been well characterized at the nucleotide level. Herein we report the nucleotide sequence, genomic organization, and predicted amino acid sequence of a turkey astrovirus isolated from poults with an emerging enteric disease. PMID:10846102

  14. Relationships among calpastatin single nucleotide polymorphisms, calpastatin expression and tenderness in pork longissimus

    USDA-ARS?s Scientific Manuscript database

    Genome scans in the pig have identified a region on chromosome 2 (SSC2) associated with tenderness. Calpastatin is a likely positional candidate gene in this region because of its inhibitory role in the calpain system that is involved in postmortem tenderization. Novel single nucleotide polymorphism...

  15. Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli 0157:H7

    USDA-ARS?s Scientific Manuscript database

    Escherichia coli O157:H7 is a zoonotic human pathogen for which cattle are an important reservoir host. Using both previously published and new sequencing data, a 48-locus single nucleotide polymorphism (SNP) based typing panel was developed that redundantly identified eleven genogroups that span ...

  16. A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

  17. Nucleotide-protectable labeling of sulfhydryl groups in subunit I of the ATPase from Halobacterium saccharovorum

    NASA Technical Reports Server (NTRS)

    Sulzner, Michael; Stan-Lotter, Helga; Hochstein, Lawrence I.

    1992-01-01

    The membrane ATPase from Halobacterium saccharovorum was purified as described by Hochstein et al. (1987) and was incubated with C-14 labeled N-ethylmaleimide (NEM), with and without adenine nucleotides, to determine the effect of nucleotides on the enzyme labeling. It was found that NEM incorporates into the 87,000-Da subunit (subunit I) of the enzyme and that the conditions for enzyme modification are similar to those which result in the inhibition of the enzyme activity. The presence of ATP, ADP, and AMP was found to reduce both the inhibitor incorporation and enzyme inhibition. It was shown that the reaction involves a modification of thiol groups.

  18. Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation

    PubMed Central

    Sampson, Juliana K.; Sheth, Nihar U.; Koparde, Vishal N.; Scalora, Allison F.; Serrano, Myrna G.; Lee, Vladimir; Roberts, Catherine H.; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H.; Buck, Gregory A.; Neale, Michael C.; Toor, Amir A.

    2016-01-01

    Summary Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. PMID:24749631

  19. Allopurinol Use During Maintenance Therapy for Acute Lymphoblastic Leukemia Avoids Mercaptopurine-related Hepatotoxicity.

    PubMed

    Giamanco, Nicole M; Cunningham, Bethany S; Klein, Laura S; Parekh, Dina S; Warwick, Anne B; Lieuw, Kenneth

    2016-03-01

    6-Mercaptopurine (6-MP) is the mainstay of treatment for acute lymphoblastic leukemia and lymphoblastic lymphoma. It is metabolized into the pharmacologically active, 6-thioguanine nucleotide (6-TGN), and 6-methyl mercaptopurine nucleotides (6-MMPN), which is associated with hepatotoxicity that jeopardizes antileukemic therapy. Allopurinol alters the metabolism of 6-MP to increase 6-TGN levels and decreases 6-methyl mercaptopurine nucleotides levels. We report 2 cases in which combination therapy of allopurinol with 6-MP was used successfully to avoid hepatotoxicity while delivering adequate 6-TGN levels. We suggest that this combination therapy can be used safely to change the metabolite production in patients who develop excessive hepatotoxicity.

  20. Labeled Nucleoside Triphosphates with Reversibly Terminating Aminoalkoxyl Groups

    PubMed Central

    Hutter, Daniel; Kim, Myong-Jung; Karalkar, Nilesh; Leal, Nicole A.; Chen, Fei; Guggenheim, Evan; Visalakshi, Visa; Olejnik, Jerzy; Gordon, Steven; Benner, Steven A.

    2013-01-01

    Nucleoside triphosphates having a 3′-ONH2 blocking group have been prepared with and without fluorescent tags on their nucleobases. DNA polymerases were identified that accepted these, adding a single nucleotide to the 3′-end of a primer in a template-directed extension reaction that then stops. Nitrite chemistry was developed to cleave the 3′-ONH2 group under mild conditions to allow continued primer extension. Extension-cleavage-extension cycles in solution were demonstrated with untagged nucleotides and mixtures of tagged and untagged nucleotides. Multiple extension-cleavage-extension cycles were demonstrated on an Intelligent Bio-Systems Sequencer, showing the potential of the 3′-ONH2 blocking group in “next generation sequencing”. PMID:21128174

  1. Structural and metabolic characterization of RNAs from rats with experimental Guerin tumor - I. Nucleotide composition of RNAs from the liver and tumor tissues of rats.

    PubMed

    Ratkiewicz, A; Galasinski, W

    1976-01-01

    The characteristics of the ribonucleic acids of Guerin tumor was the subject of this work. The effect of tumor development on the structure of the ribonucleic acids in the liver of tumor bearing rats was studied. Some differences of nucleotide compositions in RNAs isolated from subcellular fractions of liver of control and tumor bearing rats and of cancer tissue were observed. The nucleotide compositions of cancer nuclear RNA is distinctly different from liver RNA. The changes in primary structure of liver RNAs due by development of tumor in rats may be result of metabolic peculiarities of these RNAs.

  2. Esterification of all four monoribonucleotides with acetyl-D-L-valine proceeds with a preference for the D-isomer but the D/L ratio in the products declines as a function of the hydrophobicity of the nucleotide

    NASA Technical Reports Server (NTRS)

    Wickramasinghe, N. S.; Lacey, J. C. Jr; Lacey JC, J. r. (Principal Investigator)

    1992-01-01

    We recently reported that esterification of 5'-AMP with N-acetyl amino acids proceeds with a preference for D-amino acids, and the D/L ratio in products declines as the hydrophobicity of the amino acid declines. Using one amino acid, Ac-Val, we now show that esterification of all four nucleotides proceeds with a preference for the D-isomer and the preference declines as the hydrophobicity of the nucleotide declines. So, in both types of experiments, the preferences seem determined by hydrophobic interactions.

  3. Imputation of single nucleotide polymorhpism genotypes of Hereford cattle: reference panel size, family relationship and population structure

    USDA-ARS?s Scientific Manuscript database

    The objective of this study is to investigate single nucleotide polymorphism (SNP) genotypes imputation of Hereford cattle. Purebred Herefords were from two sources, Line 1 Hereford (N=240) and representatives of Industry Herefords (N=311). Using different reference panels of 62 and 494 males with 1...

  4. Porcine insulin receptor substrate 4 (IRS4) gene: cloning, polymorphism and association study

    USDA-ARS?s Scientific Manuscript database

    Using PCR and IPCR techniques we obtained a 4498 bp nucleotide sequence FN424076 encompassing the complete coding sequence of the porcine IRS4 gene and its proximal promoter. The 1269-amino acid porcine protein deduced from the nucleotide sequence shares 92% identity with the human IRS4 and possesse...

  5. Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

    USDA-ARS?s Scientific Manuscript database

    Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

  6. A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

    USDA-ARS?s Scientific Manuscript database

    Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

  7. Single nucleotide polymorphisms in candidate genes associated with fertilizing ability of sperm and subsequent embryonic development in cattle

    USDA-ARS?s Scientific Manuscript database

    Fertilization and development of the preimplantation embryo is under genetic control. The goal of the current study was to test 434 single nucleotide polymorphisms (SNPs) for association with genetic variation in fertilization and early embryonic development. The approach was to produce embryos from...

  8. Prospects for inferring pairwise relationships with single nucleotide polymorphisms

    Treesearch

    Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody

    2003-01-01

    An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...

  9. Short communication: Relationship of call rate and accuracy of single nucleotide polymorphism genotypes in dairy cattle

    USDA-ARS?s Scientific Manuscript database

    Call rate has been used as a measure of quality on both a single nucleotide polymorphism (SNP) and animal basis since SNP genotypes were first used in genomic evaluation of dairy cattle. The genotyping laboratories perform initial quality control screening and genotypes that fail are usually exclude...

  10. Single nucleotide polymorphisms generated by genotyping by sequencing to characterize genome-wide diversity, linkage disequilibrium, and selective sweeps in cultivated watermelon

    USDA-ARS?s Scientific Manuscript database

    Large datasets containing single nucleotide polymorphisms (SNPs) are used to analyze genome-wide diversity in a robust collection of cultivars from representative accessions, across the world. The extent of linkage disequilibrium (LD) within a population determines the number of markers required fo...

  11. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    PubMed Central

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  12. Begomoviruses infecting weeds in Cuba: increased host range and a novel virus infecting Sida rhombifolia.

    PubMed

    Fiallo-Olivé, Elvira; Navas-Castillo, Jesús; Moriones, Enrique; Martínez-Zubiaur, Yamila

    2012-01-01

    As a result of surveys conducted during the last few years to search for wild reservoirs of begomoviruses in Cuba, we detected a novel bipartite begomovirus, sida yellow mottle virus (SiYMoV), infecting Sida rhombifolia plants. The complete genome sequence was obtained, showing that DNA-A was 2622 nucleotides (nt) in length and that it was most closely related (87.6% nucleotide identity) to DNA-A of an isolate of sida golden mosaic virus (SiGMV) that infects snap beans (Phaseolus vulgaris) in Florida. The DNA-B sequence was 2600 nt in length and shared the highest nucleotide identity (75.1%) with corchorus yellow spot virus (CoYSV). Phylogenetic relationship analysis showed that both DNA components of SiYMoV were grouped in the Abutilon clade, along with begomoviruses from Florida and the Caribbean islands. We also present here the complete nucleotide sequence of a novel strain of sida yellow vein virus found infecting Malvastrum coromandelianum and an isolate of euphorbia mosaic virus that was found for the first time infecting Euphorbia heterophylla in Cuba.

  13. Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.

    PubMed

    Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro

    2015-11-01

    The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Binding of nickel /II/ to 5-prime-nucleoside monophosphates and related compounds. [role in origin of life

    NASA Technical Reports Server (NTRS)

    Orenberg, J. B.; Kjos, K. M.; Winkler, R.; Link, J.; Lawless, J. G.

    1982-01-01

    The interactions of Ni(II) cation with a representative suite of purine bases and the respective nucleosides and nucleotides have been studied by ultraviolet difference spectroscopy. Apparent association constants were determined for each system at pH 7.0, using computer linear regression coupled with an iteration technique. The specificity of binding of Ni(2+) for the purine nucleotides studied at pH 7.0 was 5-prime-GMP greater than 5-prime-AMP; a similar ordering was also found for the respective nucleosides and bases. In this study binding was not observed for the suite of pyramidines used, although an Ni(2+) -cytidine complex has been observed (Fiskin and Beer, 1965). It was also found that Ni(2+) bound more strongly to the purine 5-prime-nucleotides than to the respective nucleosides and bases. These trends are explained in terms of metal-ligand bonds and available bonding positions on the ligands. A role for metal-ion-nucleotide types of complexes is suggested in the processes that might have given rise to the origin of life.

  15. Nucleotides with altered hydrogen bonding capacities impede human DNA polymerase η by reducing synthesis in the presence of the major cisplatin DNA adduct.

    PubMed

    Nilforoushan, Arman; Furrer, Antonia; Wyss, Laura A; van Loon, Barbara; Sturla, Shana J

    2015-04-15

    Human DNA polymerase η (hPol η) contributes to anticancer drug resistance by catalyzing the replicative bypass of DNA adducts formed by the widely used chemotherapeutic agent cis-diamminedichloroplatinum (cisplatin). A chemical basis for overcoming bypass-associated resistance requires greater knowledge of how small molecules influence the hPol η-catalyzed bypass of DNA adducts. In this study, we demonstrated how synthetic nucleoside triphosphates act as hPol η substrates and characterized their influence on hPol η-mediated DNA synthesis over unmodified and platinated DNA. The single nucleotide incorporation efficiency of the altered nucleotides varied by more than 10-fold and the higher incorporation rates appeared to be attributable to the presence of an additional hydrogen bond between incoming dNTP and templating base. Finally, full-length DNA synthesis in the presence of increasing concentrations of synthetic nucleotides reduced the amount of DNA product independent of the template, representing the first example of hPol η inhibition in the presence of a platinated DNA template.

  16. Structural Basis of Cyclic Nucleotide Selectivity in cGMP-dependent Protein Kinase II

    DOE PAGES

    Campbell, James C.; Kim, Jeong Joo; Li, Kevin Y.; ...

    2016-01-14

    Membrane-bound cGMP-dependent protein kinase (PKG) II is an important regulator of bone growth, renin secretion, and memory formation. Despite its crucial physiological roles, little is known about its cyclic nucleotide selectivity mechanism due to a lack of structural information. Here, we find that the C-terminal cyclic nucleotide binding (CNB-B) domain of PKGII binds cGMP with higher affinity and selectivity when compared with its N-terminal CNB (CNB-A) domain. To understand the structural basis of cGMP selectivity, we solved co-crystal structures of the CNB domains with cyclic nucleotides. Our structures combined with mutagenesis demonstrate that the guanine-specific contacts at Asp-412 and Arg-415more » of the αC-helix of CNB-B are crucial for cGMP selectivity and activation of PKG II. Structural comparison with the cGMP selective CNB domains of human PKG I and Plasmodium falciparum PKG (PfPKG) shows different contacts with the guanine moiety, revealing a unique cGMP selectivity mechanism for PKG II.« less

  17. Viral replication. Structural basis for RNA replication by the hepatitis C virus polymerase.

    PubMed

    Appleby, Todd C; Perry, Jason K; Murakami, Eisuke; Barauskas, Ona; Feng, Joy; Cho, Aesop; Fox, David; Wetmore, Diana R; McGrath, Mary E; Ray, Adrian S; Sofia, Michael J; Swaminathan, S; Edwards, Thomas E

    2015-02-13

    Nucleotide analog inhibitors have shown clinical success in the treatment of hepatitis C virus (HCV) infection, despite an incomplete mechanistic understanding of NS5B, the viral RNA-dependent RNA polymerase. Here we study the details of HCV RNA replication by determining crystal structures of stalled polymerase ternary complexes with enzymes, RNA templates, RNA primers, incoming nucleotides, and catalytic metal ions during both primed initiation and elongation of RNA synthesis. Our analysis revealed that highly conserved active-site residues in NS5B position the primer for in-line attack on the incoming nucleotide. A β loop and a C-terminal membrane-anchoring linker occlude the active-site cavity in the apo state, retract in the primed initiation assembly to enforce replication of the HCV genome from the 3' terminus, and vacate the active-site cavity during elongation. We investigated the incorporation of nucleotide analog inhibitors, including the clinically active metabolite formed by sofosbuvir, to elucidate key molecular interactions in the active site. Copyright © 2015, American Association for the Advancement of Science.

  18. Mechanism of nucleotide sensing in group II chaperonins.

    PubMed

    Pereira, Jose H; Ralston, Corie Y; Douglas, Nicholai R; Kumar, Ramya; Lopez, Tom; McAndrew, Ryan P; Knee, Kelly M; King, Jonathan A; Frydman, Judith; Adams, Paul D

    2012-02-01

    Group II chaperonins mediate protein folding in an ATP-dependent manner in eukaryotes and archaea. The binding of ATP and subsequent hydrolysis promotes the closure of the multi-subunit rings where protein folding occurs. The mechanism by which local changes in the nucleotide-binding site are communicated between individual subunits is unknown. The crystal structure of the archaeal chaperonin from Methanococcus maripaludis in several nucleotides bound states reveals the local conformational changes associated with ATP hydrolysis. Residue Lys-161, which is extremely conserved among group II chaperonins, forms interactions with the γ-phosphate of ATP but shows a different orientation in the presence of ADP. The loss of the ATP γ-phosphate interaction with Lys-161 in the ADP state promotes a significant rearrangement of a loop consisting of residues 160-169. We propose that Lys-161 functions as an ATP sensor and that 160-169 constitutes a nucleotide-sensing loop (NSL) that monitors the presence of the γ-phosphate. Functional analysis using NSL mutants shows a significant decrease in ATPase activity, suggesting that the NSL is involved in timing of the protein folding cycle.

  19. Direct photoaffinity labeling of an allosteric site on subunit protein M1 of mouse ribonucleotide reductase by dTTP.

    PubMed Central

    Eriksson, S; Caras, I W; Martin, D W

    1982-01-01

    The protein M1 subunit of ribonucleotide reductase contains at least two allosteric nucleotide binding sites that control the capacity of the enzyme to reduce ribonucleotides to the deoxyribonucleotides required for DNA synthesis. Direct photoaffinity labeling of partially purified protein M1 from mouse T-lymphoma (S49) cells was observed after UV irradiation in the presence of dTTP at 0 degrees C. The relative molar incorporation of nucleotide per subunit was 4-8%. Competition experiments showed that the dTTP was bound to an allosteric domain genetically and kinetically defined as the substrate specificity site of the enzyme. An altered protein M1 isolated from a thymidine-resistant mutant cell line showed significantly decreased photoincorporation of dTTP, consistent with the fact that its CDP reductase activity is resistant to feedback inhibition by dTTP. Specific photolabeling of several other proteins with pyrimidine and purine nucleotides was also found, indicating the general usefulness of direct photoaffinity labeling in the study of enzymes involved in nucleotide and nucleic acid metabolism. Images PMID:7033963

  20. Novel biocatalytic systems for maintaining the nucleotide balance based on adenylate kinase immobilized on carbon nanostructures.

    PubMed

    Hetmann, Anna; Wujak, Magdalena; Bolibok, Paulina; Zięba, Wojciech; Wiśniewski, Marek; Roszek, Katarzyna

    2018-07-01

    In this study graphene oxide (GO), carbon quantum dots (CQD) and carbon nanoonions (CNO) have been characterized and applied for the first time as a matrix for recombinant adenylate kinase (AK, EC 2.7.4.3) immobilization. AK is an enzyme fulfilling a key role in metabolic processes. This phosphotransferase catalyzes the interconversion of adenine nucleotides (ATP, ADP and AMP) and thereby participates in nucleotide homeostasis, monitors a cellular energy charge as well as acts as a component of purinergic signaling system. The AK activity in all obtained biocatalytic systems was higher as compared to the free enzyme. We have found that the immobilization on carbon nanostructures increased both activity and stability of AK. Moreover, the biocatalytic systems consisting of AK immobilized on carbon nanostructures can be easily and efficiently lyophilized without risk of desorption or decrease in the catalytic activity of the investigated enzyme. The positive action of AK-GO biocatalytic system in maintaining the nucleotide balance in in vitro cell culture was proved. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. The effect of folate supplements on 6-mercaptopurine remission maintenance therapy in childhood leukaemia.

    PubMed Central

    Lennard, L.; Lilleyman, J. S.; Maddocks, J. L.

    1986-01-01

    The effect of folic acid supplements on 6-mercaptopurine remission maintenance therapy in lymphoblastic leukaemia (ALL) was investigated in a retrospective longitudinal study of 10 children. Red cell concentrations of 6-thioguanine nucleotide, a cytotoxic metabolite of 6-mercaptopurine, were measured and the peripheral neutrophil count was used as an index of myelosuppression. During the control period of the study there were significant correlations between 6-mercaptopurine dose and 6-thioguanine nucleotide concentration (rs = 0.59, P less than 0.0005) and between 6-thioguanine nucleotide concentration and the peripheral neutrophil count at 14 days (rs = 0.58, P less than 0.0005). These relationships were absent when the same children were subsequently taking folate supplements. Also when taking folate supplements the children tolerated significantly more 6-mercaptopurine (P less than 0.005) for a significantly longer time (P less than 0.005) before neutropenia developed. There was no significant difference in red cell 6-thioguanine nucleotide concentration in the absence and presence of folate supplements. These findings suggest that folate supplements may interfere with remission maintenance therapy in ALL. PMID:3456241

  2. Phylogenetic Diversity of NTT Nucleotide Transport Proteins in Free-Living and Parasitic Bacteria and Eukaryotes

    PubMed Central

    Major, Peter; Embley, T. Martin

    2017-01-01

    Plasma membrane-located nucleotide transport proteins (NTTs) underpin the lifestyle of important obligate intracellular bacterial and eukaryotic pathogens by importing energy and nucleotides from infected host cells that the pathogens can no longer make for themselves. As such their presence is often seen as a hallmark of an intracellular lifestyle associated with reductive genome evolution and loss of primary biosynthetic pathways. Here, we investigate the phylogenetic distribution of NTT sequences across the domains of cellular life. Our analysis reveals an unexpectedly broad distribution of NTT genes in both host-associated and free-living prokaryotes and eukaryotes. We also identify cases of within-bacteria and bacteria-to-eukaryote horizontal NTT transfer, including into the base of the oomycetes, a major clade of parasitic eukaryotes. In addition to identifying sequences that retain the canonical NTT structure, we detected NTT gene fusions with HEAT-repeat and cyclic nucleotide binding domains in Cyanobacteria, pathogenic Chlamydiae and Oomycetes. Our results suggest that NTTs are versatile functional modules with a much wider distribution and a broader range of potential roles than has previously been appreciated. PMID:28164241

  3. Nucleotide sequencing and serological evidence that the recently recognized deer tick virus is a genotype of Powassan virus.

    PubMed

    Beasley, D W; Suderman, M T; Holbrook, M R; Barrett, A D

    2001-11-05

    Deer tick virus (DTV) is a recently recognized North American virus isolated from Ixodes dammini ticks. Nucleotide sequencing of fragments of structural and non-structural protein genes suggested that this virus was most closely related to the tick-borne flavivirus Powassan (POW), which causes potentially fatal encephalitis in humans. To determine whether DTV represents a new and distinct member of the Flavivirus genus of the family Flaviviridae, we sequenced the structural protein genes and 5' and 3' non-coding regions of this virus. In addition, we compared the reactivity of DTV and POW in hemagglutination inhibition tests with a panel of polyclonal and monoclonal antisera, and performed cross-neutralization experiments using anti-DTV antisera. Nucleotide sequencing revealed a high degree of homology between DTV and POW at both nucleotide (>80% homology) and amino acid (>90% homology) levels, and the two viruses were indistinguishable in serological assays and mouse neuroinvasiveness. On the basis of these results, we suggest that DTV should be classified as a genotype of POW virus.

  4. Lack of Association Between Polymorphisms in Dopa Decarboxylase and Dopamine Receptor-1 Genes With Childhood Autism in Chinese Han Population.

    PubMed

    Yu, Hong; Liu, Jun; Yang, Aiping; Yang, Guohui; Yang, Wenjun; Lei, Heyue; Quan, Jianjun; Zhang, Zengyu

    2016-04-01

    Genetic factors play an important role in childhood autism. This study is to determine the association of single-nucleotide polymorphisms in dopa decarboxylase (DDC) and dopamine receptor-1 (DRD1) genes with childhood autism, in a Chinese Han population. A total of 211 autistic children and 250 age- and gender-matched healthy controls were recruited. The severity of disease was determined by Children Autism Rating Scale scores. TaqMan Probe by real-time polymerase chain reaction was used to determine genotypes and allele frequencies of single-nucleotide polymorphism rs6592961 in DDC and rs251937 in DRD1. Case-control and case-only studies were respectively performed, to determine the contribution of both single-nucleotide polymorphisms to the predisposition of disease and its severity. Our results showed that there was no significant association of the genotypes and allele frequencies of both single-nucleotide polymorphisms concerning childhood autism and its severity. More studies with larger samples are needed to corroborate their predicting roles. © The Author(s) 2015.

  5. Mitochondrial genome nucleotide substitution pattern between domesticated silkmoth, Bombyx mori, and its wild ancestors, Chinese Bombyx mandarina and Japanese Bombyx mandarina

    PubMed Central

    2010-01-01

    Bombyx mori and Bombyx mandarina are morphologically and physiologically similar. In this study, we compared the nucleotide variations in the complete mitochondrial (mt) genomes between the domesticated silkmoth, B. mori, and its wild ancestors, Chinese B. mandarina (ChBm) and Japanese B. mandarina (JaBm). The sequence divergence and transition mutation ratio between B. mori and ChBm are significantly smaller than those observed between B. mori and JaBm. The preference of transition by DNA strands between B. mori and ChBm is consistent with that between B. mori and JaBm, however, the regional variation in nucleotide substitution rate shows a different feature. These results suggest that the ChBm mt genome is not undergoing the same evolutionary process as JaBm, providing evidence for selection on mtDNA. Moreover, investigation of the nucleotide sequence divergence in the A+T-rich region of Bombyx mt genomes also provides evidence for the assumption that the A+T-rich region might not be the fastest evolving region of the mtDNA of insects. PMID:21637625

  6. Nucleobase but not Sugar Fidelity is Maintained in the Sabin I RNA-Dependent RNA Polymerase.

    PubMed

    Liu, Xinran; Musser, Derek M; Lee, Cheri A; Yang, Xiaorong; Arnold, Jamie J; Cameron, Craig E; Boehr, David D

    2015-10-26

    The Sabin I poliovirus live, attenuated vaccine strain encodes for four amino acid changes (i.e., D53N, Y73H, K250E, and T362I) in the RNA-dependent RNA polymerase (RdRp). We have previously shown that the T362I substitution leads to a lower fidelity RdRp, and viruses encoding this variant are attenuated in a mouse model of poliovirus. Given these results, it was surprising that the nucleotide incorporation rate and nucleobase fidelity of the Sabin I RdRp is similar to that of wild-type enzyme, although the Sabin I RdRp is less selective against nucleotides with modified sugar groups. We suggest that the other Sabin amino acid changes (i.e., D53N, Y73H, K250E) help to re-establish nucleotide incorporation rates and nucleotide discrimination near wild-type levels, which may be a requirement for the propagation of the virus and its efficacy as a vaccine strain. These results also suggest that the nucleobase fidelity of the Sabin I RdRp likely does not contribute to viral attenuation.

  7. O-ribosyl-phosphate purine as a constant modified nucleotide located at position 64 in cytoplasmic initiator tRNAs(Met) of yeasts.

    PubMed Central

    Glasser, A L; Desgres, J; Heitzler, J; Gehrke, C W; Keith, G

    1991-01-01

    The unknown modified nucleotide G*, isolated from both Schizosaccharomyces pombe and Torulopsis utilis initiator tRNAs(Met), has been identified as an O-ribosyl-(1"----2')-guanosine-5"-phosphate, called Gr(p), by means of HPLC, UV-absorption, mass spectrometry and periodate oxidation procedures. By comparison with the previously published structure of Ar(p) isolated from Saccharomyces cerevisiae initiator tRNA(Met), the (1"----2')-glycosidic bond in Gr(p) has been postulated to have a beta-spatial conformation. The modified nucleotide Gr(p) is located at position 64 in the tRNA(Met) molecules, i.e. at the same position as Ar(p). Since we have also characterized Gr(p) in Candida albicans initiator tRNA(Met), the phosphoribosylation of purine 64 can be considered as a constant nucleotide modification in the cytoplasmic initiator tRNAs(Met) of all yeast species so far sequenced. Precise evidence for the presence of Gr(p) in initiator tRNAs(Met) of several plants is also reported. PMID:1656390

  8. Single-molecule comparison of DNA Pol I activity with native and analog nucleotides

    NASA Astrophysics Data System (ADS)

    Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip

    2014-03-01

    DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.

  9. Two-dimensional cross correlation analysis of protein unfolding: Portrayal of the thermal denaturation of CMP kinases in the absence and presence of substrates

    NASA Astrophysics Data System (ADS)

    Schultz, Christian P.; Bârzu, Octavian; Mantsch, Henry H.

    2000-03-01

    The functional role of CMP kinases is to regenerate mono-phosphate nucleotides in cells by transferring phosphate residues from tri-phosphorylated nucleotides to monophosphorylated nucleotides. These enzymes possess two binding sites and maintain a highly conserved secondary structure. They are essential for cell survival. Herein we compare the infrared spectra of two similar, but not identical enzymes, the CMP kinases from Escherichia coli and Bacillus subtilis. A two-dimensional cross correlation analysis of the infrared spectra reveals differences in the denaturation behavior of the two proteins. Different secondary structure elements show different time-delayed or advanced unfolding events in the two enzymes. When bound to the active sites, the two nucleotide-substrates CMP and ATP exert a stabilizing effect on the structure of both proteins. The changes observed upon thermal denaturation are different for the two enzymes. Model 2D correlations are used to simulate the different denaturation of the two enzymes. Thermal denaturation and aggregation can be distinguished as two processes separated in time.

  10. The EMBL nucleotide sequence database

    PubMed Central

    Stoesser, Guenter; Baker, Wendy; van den Broek, Alexandra; Camon, Evelyn; Garcia-Pastor, Maria; Kanz, Carola; Kulikova, Tamara; Lombard, Vincent; Lopez, Rodrigo; Parkinson, Helen; Redaschi, Nicole; Sterk, Peter; Stoehr, Peter; Tuli, Mary Ann

    2001-01-01

    The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/) is maintained at the European Bioinformatics Institute (EBI) in an international collaboration with the DNA Data Bank of Japan (DDBJ) and GenBank at the NCBI (USA). Data is exchanged amongst the collaborating databases on a daily basis. The major contributors to the EMBL database are individual authors and genome project groups. Webin is the preferred web-based submission system for individual submitters, whilst automatic procedures allow incorporation of sequence data from large-scale genome sequencing centres and from the European Patent Office (EPO). Database releases are produced quarterly. Network services allow free access to the most up-to-date data collection via ftp, email and World Wide Web interfaces. EBI’s Sequence Retrieval System (SRS), a network browser for databanks in molecular biology, integrates and links the main nucleotide and protein databases plus many specialized databases. For sequence similarity searching a variety of tools (e.g. Blitz, Fasta, BLAST) are available which allow external users to compare their own sequences against the latest data in the EMBL Nucleotide Sequence Database and SWISS-PROT. PMID:11125039

  11. Inhibition of Glucuronokinase by Substrate Analogs 1

    PubMed Central

    Gillard, Douglas F.; Dickinson, David B.

    1978-01-01

    Glucuronokinase from Lilium longiflorum pollen was purified 30- to 40- fold on a blue dextran-Sepharose column. Substrate analogs were tested for inhibitory effects, and nucleotide substrate specificity of the enzyme was determined. Nine nucleotides were tested, and all were inhibitory when the substrate was ATP. ADP was competitive with ATP and had a Ki value of 0.23 mm. None of the other nucleotide triphosphates could effectively substitute for ATP as a nucleotide substrate. Ten mm dATP and ITP reacted only 3% as rapidly as 10 mm ATP, while the rates for 10 mm GTP, CTP, UTP, and TTP were less than 1%. The glucuronic acid analogs, methyl α-glucuronoside, methyl β-glucuronoside, β-glucuronic acid-1-phosphate, and 4-O-methylglucuronic acid were tested as possible enzyme inhibitors. The three methyl derivatives showed little or no inhibition. The β-glucuronic acid-1-phosphate was inhibitory, with 50% inhibition obtained at 1 to 3 mm depending on the concentration of the glucuronic acid. It is concluded that the glucuronic acid-binding site on the enzyme is highly selective. PMID:16660589

  12. Extension of the COG and arCOG databases by amino acid and nucleotide sequences

    PubMed Central

    Meereis, Florian; Kaufmann, Michael

    2008-01-01

    Background The current versions of the COG and arCOG databases, both excellent frameworks for studies in comparative and functional genomics, do not contain the nucleotide sequences corresponding to their protein or protein domain entries. Results Using sequence information obtained from GenBank flat files covering the completely sequenced genomes of the COG and arCOG databases, we constructed NUCOCOG (nucleotide sequences containing COG databases) as an extended version including all nucleotide sequences and in addition the amino acid sequences originally utilized to construct the current COG and arCOG databases. We make available three comprehensive single XML files containing the complete databases including all sequence information. In addition, we provide a web interface as a utility suitable to browse the NUCOCOG database for sequence retrieval. The database is accessible at . Conclusion NUCOCOG offers the possibility to analyze any sequence related property in the context of the COG and arCOG framework simply by using script languages such as PERL applied to a large but single XML document. PMID:19014535

  13. Biochemical, sensory and microbiological attributes of bream (Megalobrama amblycephala) during partial freezing and chilled storage.

    PubMed

    Song, Yongling; Luo, Yongkang; You, Juan; Shen, Huixing; Hu, Sumei

    2012-01-15

    Bream is one of the main farmed freshwater fish species in China. This study aimed to examine the nucleotide degradation of bream during partial freezing and chilled storage and to assess the possible usefulness of nucleotide ratios (K, Ki, H, P, Fr and G values) as freshness indices in comparison with sensory assessment and total viable counts. Total viable counts were 5.74 and 4.66 log(colony-forming units g(-1)) on the day of sensory rejection under chilled storage and partial freezing storage respectively. The inosine 5-monophosphate decrease and inosine increase were faster in chilled storage than in partial freezing storage. Hypoxanthine levels increased continuously with time under both storage regimes. Among the nucleotide ratios, the K, Ki, P, G and Fr values were superior to the H value and provided useful freshness indicators for both storage conditions. Bream in chilled storage were sensorially acceptable only up to 10 days, compared with 33 days for bream in partial freezing storage. Partial freezing delayed the nucleotide degradation of bream. Copyright © 2011 Society of Chemical Industry.

  14. Molecular dynamics studies on the interaction and encapsulation processes of the nucleotide and peptide chains inside of a carbon nanotube matrix with inclusion of gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Kholmurodov, Kholmirzo; Dushanov, Eric; Khusenov, Mirzoaziz; Rahmonov, Khaiyom; Zelenyak, Tatyana; Doroshkevich, Alexander; Majumder, Subrata

    2017-05-01

    Studying of molecular systems as single nucleotides, nucleotide and peptide chains, RNA and DNA interacting with metallic nanoparticles within a carbon nanotube matrix represents a great interest in modern research. In this respect it is worth mentioning the development of the electronics diagnostic apparatus, the biochemical and biotechnological application tools (nanorobotic design, facilities of drug delivery in a living cell), so on. In the present work using molecular dynamics (MD) simulation method the interaction process of small nucleotide chains (NCs) and elongated peptide chains with different sets of metallic nanoparticles (NPs) on a matrix from carbon nanotube (CNT) were simulated to study their mechanisms of encapsulation and folding processes. We have performed a series of the MD calculations with different NC,peptides-NP-CNT models that were aimed on the investigation of the peculiarities of NC,peptide-NP interactions, the formation of bonds and structures in the system, as well as the dynamical behavior in an environment confined by the CNT matrix.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pallan, Pradeep S.; Marshall, William S.; Harp, Joel

    To understand the role of structural elements of RNA pseudoknots in controlling the extent of -1-type ribosomal frameshifting, we determined the crystal structure of a high-efficiency frameshifting mutant of the pseudoknot from potato leaf roll virus (PLRV). Correlations of the structure with available in vitro frameshifting data for PLRV pseudoknot mutants implicate sequence and length of a stem-loop linker as modulators of frameshifting efficiency. Although the sequences and overall structures of the RNA pseudoknots from PLRV and beet western yellow virus (BWYV) are similar, nucleotide deletions in the linker and adjacent minor groove loop abolish frameshifting only with the latter.more » Conversely, mutant PLRV pseudoknots with up to four nucleotides deleted in this region exhibit nearly wild-type frameshifting efficiencies. The crystal structure helps rationalize the different tolerances for deletions in the PLRV and BWYV RNAs, and we have used it to build a three-dimensional model of the PRLV pseudoknot with a four-nucleotide deletion. The resulting structure defines a minimal RNA pseudoknot motif composed of 22 nucleotides capable of stimulating -1-type ribosomal frameshifts.« less

  16. [Determination of genetic bases of auxotrophy in Yersinia pestis ssp. caucasica strains].

    PubMed

    Odinokov, G N; Eroshenko, G A; Kukleva, L M; Shavina, N Iu; Krasnov, Ia M; Kutyrev, V V

    2012-04-01

    Based on the results of computer analysis of nucleotide sequences in strains Yersinia pestis and Y. pseudotuberculosis recorded in the files of NCBI GenBank database, differences between genes argA, aroG, aroF, thiH, and thiG of strain Pestoides F (subspecies caucasica) were found, compared to other strains of plaque agent and pseudotuberculosis microbe. Using PCR with calculated primers and the method of sequence analysis, the structure of variable regions of these genes was studied in 96 natural Y. pestis and Y. pseudotuberculosis strains. It was shown that all examined strains of subspecies caucasica, unlike strains of plague-causing agent of other subspecies and pseudotubercolosis microbe, had identical mutations in genes argA (integration of the insertion sequence IS100), aroG (insertion of ten nucleotides), aroF (inserion of IS100), thiH (insertion of nucleotide T), and thiG (deletion of 13 nucleotides). These mutations are the reason for the absence in strains belonging to this subspecies of the ability to synthesize arginine, phenylalanine, tyrosine, and vitamin B1 (thiamine), and cause their auxotrophy for these growth factors.

  17. In vitro nonenzymatic glycation of guanosine 5'-triphosphate by dihydroxyacetone phosphate.

    PubMed

    Li, Yuyuan; Cohenford, Menashi A; Dutta, Udayan; Dain, Joel A

    2008-11-01

    Dihydroxyacetone phosphate (DHAP) is a glycolytic intermediate that has been found to be significantly elevated in the erythrocytes of diabetic patients and patients with triosephosphate isomerase deficiency. DHAP spontaneously breaks down to methylglyoxal, a potent glycating agent that reacts with proteins and nucleic acids in vivo to form advanced glycation endproducts (AGEs). Like methylglyoxal, DHAP itself is also a glycating metabolite, capable of condensing with proteins and altering their structure or function. The objective of this investigation was to evaluate the susceptibility of nucleotides to nonenzymatic attack by DHAP, and to determine the factors influencing the rate and extent of nucleotide glycation by this sugar. Of the four nucleotide triphosphates (ATP, CTP, GTP and UTP) that were studied, only GTP was reactive, forming a wide range of UV and fluorescent products with DHAP. Increases in temperature and nucleotide concentration enhanced the rate and extent of GTP glycation by DHAP and promoted the heterogeneity of AGEs. Capillary electrophoresis, HPLC, and mass spectrometry allowed for a thorough analysis of the glycated products and demonstrated that the reaction of DHAP with GTP occurred via the classical Amadori pathway.

  18. Mapping RNA Structure In Vitro with SHAPE Chemistry and Next-Generation Sequencing (SHAPE-Seq).

    PubMed

    Watters, Kyle E; Lucks, Julius B

    2016-01-01

    Mapping RNA structure with selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistry has proven to be a versatile method for characterizing RNA structure in a variety of contexts. SHAPE reagents covalently modify RNAs in a structure-dependent manner to create adducts at the 2'-OH group of the ribose backbone at nucleotides that are structurally flexible. The positions of these adducts are detected using reverse transcriptase (RT) primer extension, which stops one nucleotide before the modification, to create a pool of cDNAs whose lengths reflect the location of SHAPE modification. Quantification of the cDNA pools is used to estimate the "reactivity" of each nucleotide in an RNA molecule to the SHAPE reagent. High reactivities indicate nucleotides that are structurally flexible, while low reactivities indicate nucleotides that are inflexible. These SHAPE reactivities can then be used to infer RNA structures by restraining RNA structure prediction algorithms. Here, we provide a state-of-the-art protocol describing how to perform in vitro RNA structure probing with SHAPE chemistry using next-generation sequencing to quantify cDNA pools and estimate reactivities (SHAPE-Seq). The use of next-generation sequencing allows for higher throughput, more consistent data analysis, and multiplexing capabilities. The technique described herein, SHAPE-Seq v2.0, uses a universal reverse transcription priming site that is ligated to the RNA after SHAPE modification. The introduced priming site allows for the structural analysis of an RNA independent of its sequence.

  19. Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae.

    PubMed

    Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe

    2015-05-30

    Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.

  20. The use of modified and non-natural nucleotides provide unique insights into pro-mutagenic replication catalyzed by polymerase eta.

    PubMed

    Choi, Jung-Suk; Dasari, Anvesh; Hu, Peter; Benkovic, Stephen J; Berdis, Anthony J

    2016-02-18

    This report evaluates the pro-mutagenic behavior of 8-oxo-guanine (8-oxo-G) by quantifying the ability of high-fidelity and specialized DNA polymerases to incorporate natural and modified nucleotides opposite this lesion. Although high-fidelity DNA polymerases such as pol δ and the bacteriophage T4 DNA polymerase replicating 8-oxo-G in an error-prone manner, they display remarkably low efficiencies for TLS compared to normal DNA synthesis. In contrast, pol η shows a combination of high efficiency and low fidelity when replicating 8-oxo-G. These combined properties are consistent with a pro-mutagenic role for pol η when replicating this DNA lesion. Studies using modified nucleotide analogs show that pol η relies heavily on hydrogen-bonding interactions during translesion DNA synthesis. However, nucleobase modifications such as alkylation to the N2 position of guanine significantly increase error-prone synthesis catalyzed by pol η when replicating 8-oxo-G. Molecular modeling studies demonstrate the existence of a hydrophobic pocket in pol η that participates in the increased utilization of certain hydrophobic nucleotides. A model is proposed for enhanced pro-mutagenic replication catalyzed by pol η that couples efficient incorporation of damaged nucleotides opposite oxidized DNA lesions created by reactive oxygen species. The biological implications of this model toward increasing mutagenic events in lung cancer are discussed. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Zampanolide Binding to Tubulin Indicates Cross-Talk of Taxane Site with Colchicine and Nucleotide Sites.

    PubMed

    Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando

    2018-03-23

    The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.

  2. Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

    PubMed

    Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

    2011-12-01

    Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  3. Alchemical Free Energy Calculations for Nucleotide Mutations in Protein-DNA Complexes.

    PubMed

    Gapsys, Vytautas; de Groot, Bert L

    2017-12-12

    Nucleotide-sequence-dependent interactions between proteins and DNA are responsible for a wide range of gene regulatory functions. Accurate and generalizable methods to evaluate the strength of protein-DNA binding have long been sought. While numerous computational approaches have been developed, most of them require fitting parameters to experimental data to a certain degree, e.g., machine learning algorithms or knowledge-based statistical potentials. Molecular-dynamics-based free energy calculations offer a robust, system-independent, first-principles-based method to calculate free energy differences upon nucleotide mutation. We present an automated procedure to set up alchemical MD-based calculations to evaluate free energy changes occurring as the result of a nucleotide mutation in DNA. We used these methods to perform a large-scale mutation scan comprising 397 nucleotide mutation cases in 16 protein-DNA complexes. The obtained prediction accuracy reaches 5.6 kJ/mol average unsigned deviation from experiment with a correlation coefficient of 0.57 with respect to the experimentally measured free energies. Overall, the first-principles-based approach performed on par with the molecular modeling approaches Rosetta and FoldX. Subsequently, we utilized the MD-based free energy calculations to construct protein-DNA binding profiles for the zinc finger protein Zif268. The calculation results compare remarkably well with the experimentally determined binding profiles. The software automating the structure and topology setup for alchemical calculations is a part of the pmx package; the utilities have also been made available online at http://pmx.mpibpc.mpg.de/dna_webserver.html .

  4. Gause's Principle and the Effect of Resource Partitioning on the Dynamical Coexistence of Replicating Templates

    PubMed Central

    Szilágyi, András; Zachar, István; Szathmáry, Eörs

    2013-01-01

    Models of competitive template replication, although basic for replicator dynamics and primordial evolution, have not yet taken different sequences explicitly into account, neither have they analyzed the effect of resource partitioning (feeding on different resources) on coexistence. Here we show by analytical and numerical calculations that Gause's principle of competitive exclusion holds for template replicators if resources (nucleotides) affect growth linearly and coexistence is at fixed point attractors. Cases of complementary or homologous pairing between building blocks with parallel or antiparallel strands show no deviation from the rule that the nucleotide compositions of stably coexisting species must be different and there cannot be more coexisting replicator species than nucleotide types. Besides this overlooked mechanism of template coexistence we show also that interesting sequence effects prevail as parts of sequences that are copied earlier affect coexistence more strongly due to the higher concentration of the corresponding replication intermediates. Template and copy always count as one species due their constraint of strict stoichiometric coupling. Stability of fixed-point coexistence tends to decrease with the length of sequences, although this effect is unlikely to be detrimental for sequences below 100 nucleotides. In sum, resource partitioning (niche differentiation) is the default form of competitive coexistence for replicating templates feeding on a cocktail of different nucleotides, as it may have been the case in the RNA world. Our analysis of different pairing and strand orientation schemes is relevant for artificial and potentially astrobiological genetics. PMID:23990769

  5. Identification of a nucleotide in 5′ untranslated region contributing to virus replication and virulence of Coxsackievirus A16

    PubMed Central

    Li, Zhaolong; Liu, Xin; Wang, Shaohua; Li, Jingliang; Hou, Min; Liu, Guanchen; Zhang, Wenyan; Yu, Xiao-Fang

    2016-01-01

    Coxsackievirus A16 (CA16) and enterovirus 71 (EV71) are two main causative pathogens of hand, foot and mouth disease (HFMD). Unlike EV71, virulence determinants of CA16, particularly within 5′ untranslated region (5′UTR), have not been investigated until now. Here, a series of nucleotides present in 5′UTR of lethal but not in non-lethal CA16 strains were screened by aligning nucleotide sequences of lethal circulating Changchun CA16 and the prototype G10 as well as non-lethal SHZH05 strains. A representative infectious clone based on a lethal Changchun024 sequence and infectious mutants with various nucleotide alterations in 5′UTR were constructed and further investigated by assessing virus replication in vitro and virulence in neonatal mice. Compared to the lethal infectious clone, the M2 mutant with a change from cytosine to uracil at nucleotide 104 showed weaker virulence and lower replication capacity. The predicted secondary structure of the 5′UTR of CA16 RNA showed that M2 mutant located between the cloverleaf and stem-loop II, affected interactions between the 5′UTR and the heterogeneous nuclear ribonucleoprotein K (hnRNP K) and A1 (hnRNP A1) that are important for translational activity. Thus, our research determined a virulence-associated site in the 5′UTR of CA16, providing a crucial molecular target for antiviral drug development. PMID:26861413

  6. A Ruler Protein in a Complex for Antiviral Defense Determines the Length of Small Interfering CRISPR RNAs

    PubMed Central

    Hatoum-Aslan, Asma; Samai, Poulami; Maniv, Inbal; Jiang, Wenyan; Marraffini, Luciano A.

    2013-01-01

    Small RNAs undergo maturation events that precisely determine the length and structure required for their function. CRISPRs (clustered regularly interspaced short palindromic repeats) encode small RNAs (crRNAs) that together with CRISPR-associated (cas) genes constitute a sequence-specific prokaryotic immune system for anti-viral and anti-plasmid defense. crRNAs are subject to multiple processing events during their biogenesis, and little is known about the mechanism of the final maturation step. We show that in the Staphylococcus epidermidis type III CRISPR-Cas system, mature crRNAs are measured in a Cas10·Csm ribonucleoprotein complex to yield discrete lengths that differ by 6-nucleotide increments. We looked for mutants that impact this crRNA size pattern and found that an alanine substitution of a conserved aspartate residue of Csm3 eliminates the 6-nucleotide increments in the length of crRNAs. In vitro, recombinant Csm3 binds RNA molecules at multiple sites, producing gel-shift patterns that suggest that each protein binds 6 nucleotides of substrate. In vivo, changes in the levels of Csm3 modulate the crRNA size distribution without disrupting the 6-nucleotide periodicity. Our data support a model in which multiple Csm3 molecules within the Cas10·Csm complex bind the crRNA with a 6-nucleotide periodicity to function as a ruler that measures the extent of crRNA maturation. PMID:23935102

  7. TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs.

    PubMed

    Xu, Zhi; Reynolds, Gavin P; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

    2016-11-01

    Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks' antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. © The Author 2016. Published by Oxford University Press on behalf of CINP.

  8. TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs

    PubMed Central

    Reynolds, Gavin P.; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

    2016-01-01

    Background: Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). Methods: A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks’ antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Results: Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. Conclusions: These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. PMID:27521242

  9. Analysis of in vivo correction of defined mismatches in the DNA mismatch repair mutants msh2, msh3 and msh6 of Saccharomyces cerevisiae.

    PubMed

    Lühr, B; Scheller, J; Meyer, P; Kramer, W

    1998-02-01

    We have analysed the correction of defined mismatches in wild-type and msh2, msh3, msh6 and msh3 msh6 mutants of Saccharomyces cerevisiae in two different yeast strain backgrounds by transformation with plasmid heteroduplex DNA constructs. Ten different base/base mismatches, two single-nucleotide loops and a 38-nucleotide loop were tested. Repair of all types of mismatches was severely impaired in msh2 and msh3 msh6 mutants. In msh6 mutants, repair efficiency of most base/base mismatches was reduced to a similar extent as in msh3 msh6 double mutants. G/T and A/C mismatches, however, displayed residual repair in msh6 mutants in one strain background, implying a role for Msh3p in recognition of base/base mismatches. Furthermore, the efficiency of repair of base/base mismatches was considerably reduced in msh3 mutants in one strain background, indicating a requirement for MSH3 for fully efficient mismatch correction. Also the efficiency of repair of the 38-nucleotide loop was reduced in msh3 mutants, and to a lesser extent in msh6 mutants. The single-nucleotide loop with an unpaired A was less efficiently repaired in msh3 mutants and that with an unpaired T was less efficiently corrected in msh6 mutants, indicating non-redundant functions for the two proteins in the recognition of single-nucleotide loops.

  10. Natural History of Human Respiratory Syncytial Virus Inferred from Phylogenetic Analysis of the Attachment (G) Glycoprotein with a 60-Nucleotide Duplication

    PubMed Central

    Trento, Alfonsina; Viegas, Mariana; Galiano, Mónica; Videla, Cristina; Carballal, Guadalupe; Mistchenko, Alicia S.; Melero, José A.

    2006-01-01

    A total of 47 clinical samples were identified during an active surveillance program of respiratory infections in Buenos Aires (BA) (1999 to 2004) that contained sequences of human respiratory syncytial virus (HRSV) with a 60-nucleotide duplication in the attachment (G) protein gene. This duplication was analogous to that previously described for other three viruses also isolated in Buenos Aires in 1999 (A. Trento et al., J. Gen. Virol. 84:3115-3120, 2003). Phylogenetic analysis indicated that BA sequences with that duplication shared a common ancestor (dated about 1998) with other HRSV G sequences reported worldwide after 1999. The duplicated nucleotide sequence was an exact copy of the preceding 60 nucleotides in early viruses, but both copies of the duplicated segment accumulated nucleotide substitutions in more recent viruses at a rate apparently higher than in other regions of the G protein gene. The evolution of the viruses with the duplicated G segment apparently followed the overall evolutionary pattern previously described for HRSV, and this genotype has replaced other prevailing antigenic group B genotypes in Buenos Aires and other places. Thus, the duplicated segment represents a natural tag that can be used to track the dissemination and evolution of HRSV in an unprecedented setting. We have taken advantage of this situation to reexamine the molecular epidemiology of HRSV and to explore the natural history of this important human pathogen. PMID:16378999

  11. miRNAs trigger widespread epigenetically activated siRNAs from transposons in Arabidopsis.

    PubMed

    Creasey, Kate M; Zhai, Jixian; Borges, Filipe; Van Ex, Frederic; Regulski, Michael; Meyers, Blake C; Martienssen, Robert A

    2014-04-17

    In plants, post-transcriptional gene silencing (PTGS) is mediated by DICER-LIKE 1 (DCL1)-dependent microRNAs (miRNAs), which also trigger 21-nucleotide secondary short interfering RNAs (siRNAs) via RNA-DEPENDENT RNA POLYMERASE 6 (RDR6), DCL4 and ARGONAUTE 1 (AGO1), whereas transcriptional gene silencing (TGS) of transposons is mediated by 24-nucleotide heterochromatic (het)siRNAs, RDR2, DCL3 and AGO4 (ref. 4). Transposons can also give rise to abundant 21-nucleotide 'epigenetically activated' small interfering RNAs (easiRNAs) in DECREASED DNA METHYLATION 1 (ddm1) and DNA METHYLTRANSFERASE 1 (met1) mutants, as well as in the vegetative nucleus of pollen grains and in dedifferentiated plant cell cultures. Here we show that easiRNAs in Arabidopsis thaliana resemble secondary siRNAs, in that thousands of transposon transcripts are specifically targeted by more than 50 miRNAs for cleavage and processing by RDR6. Loss of RDR6, DCL4 or DCL1 in a ddm1 background results in loss of 21-nucleotide easiRNAs and severe infertility, but 24-nucleotide hetsiRNAs are partially restored, supporting an antagonistic relationship between PTGS and TGS. Thus miRNA-directed easiRNA biogenesis is a latent mechanism that specifically targets transposon transcripts, but only when they are epigenetically reactivated during reprogramming of the germ line. This ancient recognition mechanism may have been retained both by transposons to evade long-term heterochromatic silencing and by their hosts for genome defence.

  12. De novo assembly of pen shell ( Atrina pectinata) transcriptome and screening of its genic microsatellites

    NASA Astrophysics Data System (ADS)

    Sun, Xiujun; Li, Dongming; Liu, Zhihong; Zhou, Liqing; Wu, Biao; Yang, Aiguo

    2017-10-01

    The pen shell ( Atrina pectinata) is a large wedge-shaped bivalve, which belongs to family Pinnidae. Due to its large and nutritious adductor muscle, it is the popular seafood with high commercial value in Asia-Pacific countries. However, limiting genomic and transcriptomic data have hampered its genetic investigations. In this study, the transcriptome of A. pectinata was deeply sequenced using Illumina pair-end sequencing technology. After assembling, a total of 127263 unigenes were obtained. Functional annotation indicated that the highest percentage of unigenes (18.60%) was annotated on GO database, followed by 18.44% on PFAM database and 17.04% on NR database. There were 270 biological pathways matched with those in KEGG database. Furthermore, a total of 23452 potential simple sequence repeats (SSRs) were identified, of them the most abundant type was mono-nucleotide repeats (12902, 55.01%), which was followed by di-nucleotide (8132, 34.68%), tri-nucleotide (2010, 8.57%), tetra-nucleotide (401, 1.71%), and penta-nucleotide (7, 0.03%) repeats. Sixty SSRs were selected for validating and developing genic SSR markers, of them 23 showed polymorphism in a cultured population with the average observed and expected heterozygosities of 0.412 and 0.579, respectively. In this study, we established the first comprehensive transcript dataset of A. pectinata genes. Our results demonstrated that RNA-Seq is a fast and cost-effective method for genic SSR development in non-model species.

  13. Enhanced activity of the purine nucleotide cycle of the exercising muscle in patients with hyperthyroidism.

    PubMed

    Fukui, H; Taniguchi , S; Ueta, Y; Yoshida, A; Ohtahara, A; Hisatome, I; Shigemasa, C

    2001-05-01

    Myopathy frequently develops in patients with hyperthyroidism, but its precise mechanism is not clearly understood. In this study we focused on the purine nucleotide cycle, which contributes to ATP balance in skeletal muscles. To investigate purine metabolism in muscles, we measured metabolites related to the purine nucleotide cycle using the semiischemic forearm test. We examined the following four groups: patients with untreated thyrotoxic Graves' disease (untreated group), patients with Graves' disease treated with methimazole (treated group), patients in remission (remission group), and healthy volunteers (control group). To trace the glycolytic process, we measured glycolytic metabolites (lactate and pyruvate) as well as purine metabolites (ammonia and hypoxanthine). In the untreated group, the levels of lactate, pyruvate, and ammonia released were remarkably higher than those in the control group. Hypoxanthine release also increased in the untreated group, but the difference among the patient groups was not statistically significant. The accelerated purine catabolism did not improve after 3 months of treatment with methimazole, but it was completely normalized in the remission group. This indicated that long-term maintenance of thyroid function was necessary for purine catabolism to recover. We presume that an unbalanced ATP supply or conversion of muscle fiber type may account for the acceleration of the purine nucleotide cycle under thyrotoxicosis. Such acceleration of the purine nucleotide cycle is thought to be in part a protective mechanism against a rapid collapse of the ATP energy balance in exercising muscles of patients with hyperthyroidism.

  14. Evidence of paired M2 muscarinic receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Potter, L.T.; Ballesteros, L.A.; Bichajian, L.H.

    Binding assays involving various antagonists, including N-(3H) methylscopolamine, (3H)quinuclidinyl benzilate, AFDX-116, pirenzepine, and propylbenzilylcholine mustard, disclosed only a single population of M2 muscarinic receptors in membranes from the rat brainstem (medulla, pons, and colliculi). However, competition curves between N-(3H)methylscopolamine and various agonists, including oxotremorine, cis-dioxolane, and acetylethylcholine mustard, showed approximately equal numbers of guanine nucleotide-sensitive high affinity (H) sites and guanine nucleotide-insensitive low affinity (L) sites. This 50% H phenomenon persisted in different buffers, at different temperatures, after the number of receptors was halved (and, thus, the remaining receptor to guanine nucleotide-binding protein ratio was doubled), after membrane solubilization withmore » digitonin, and when rabbit cardiac membranes were used instead of rat brainstem membranes. Preferential occupation of H sites with acetylethylcholine mustard, and of L sites with quinuclidinyl benzilate or either mustard, yielded residual free receptor populations showing predominantly L and H sites, respectively. Low concentrations of (3H)-oxotremorine-M labeled only H sites, and the Bmax for these sites was 49% of the Bmax found with (3H)quinuclidinyl benzilate plus guanine nucleotide. These and other results are most consistent with the idea that H and L receptor sites exist on separate but dimeric receptor molecules and with the hypothesis that only the H receptors cycle between high and low affinity, depending upon interactions between this receptor molecule and a guanine nucleotide-binding protein.« less

  15. Functional interactions between A' helices in the C-linker of open CNG channels.

    PubMed

    Hua, Li; Gordon, Sharona E

    2005-03-01

    Cyclic nucleotide-gated (CNG) channels are nonselective cation channels that are activated by the direct binding of the cyclic nucleotides cAMP and cGMP. The region linking the last membrane-spanning region (S6) to the cyclic nucleotide binding domain in the COOH terminus, termed the C-linker, has been shown to play an important role in coupling cyclic nucleotide binding to opening of the pore. In this study, we explored the intersubunit proximity between the A' helices of the C-linker regions of CNGA1 in functional channels using site-specific cysteine substitution. We found that intersubunit disulfide bonds can be formed between the A' helices in open channels, and that inducing disulfide bonds in most of the studied constructs resulted in potentiation of channel activation. This suggests that the A' helices of the C-linker regions are in close proximity when the channel is in the open state. Our finding is not compatible with a homology model of the CNGA1 C-linker made from the recently published X-ray crystallographic structure of the hyperpolarization-activated, cyclic nucleotide-modulated (HCN) channel COOH terminus, and leads us to suggest that the C-linker region depicted in the crystal structure may represent the structure of the closed state. The opening conformational change would then involve a movement of the A' helices from a position parallel to the axis of the membrane to one perpendicular to the axis of the membrane.

  16. Genome Survey Sequencing of Luffa Cylindrica L. and Microsatellite High Resolution Melting (SSR-HRM) Analysis for Genetic Relationship of Luffa Genotypes.

    PubMed

    An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin

    2017-09-11

    Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica , about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N 50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both "Zheda 23" and "Zheda 83". Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species.

  17. Recognition Tunneling of Canonical and Modified RNA Nucleotides for Their Identification with the Aid of Machine Learning.

    PubMed

    Im, JongOne; Sen, Suman; Lindsay, Stuart; Zhang, Peiming

    2018-06-28

    In the present study, we demonstrate a tunneling nanogap technique to identify individual RNA nucleotides, which can be used as a mechanism to read the nucleobases for direct sequencing of RNA in a solid-state nanopore. The tunneling nanogap is composed of two electrodes separated by a distance of <3 nm and functionalized with a recognition molecule. When a chemical entity is captured in the gap, it generates electron tunneling currents, a process we call recognition tunneling (RT). Using RT nanogaps created in a scanning tunneling microscope (STM), we acquired the electron tunneling signals for the canonical and two modified RNA nucleotides. To call the individual RNA nucleotides from the RT data, we adopted a machine learning algorithm, support vector machine (SVM), for the data analysis. Through the SVM, we were able to identify the individual RNA nucleotides and distinguish them from their DNA counterparts with reasonably high accuracy. Since each RNA nucleoside contains a hydroxyl group at the 2'-position of its sugar ring in an RNA strand, it allows for the formation of a tunneling junction at a larger nanogap compared to the DNA nucleoside in a DNA strand, which lacks the 2' hydroxyl group. It also proves advantageous for the manufacture of RT devices. This study is a proof-of-principle demonstration for the development of an RT nanopore device for directly sequencing single RNA molecules, including those bearing modifications.

  18. Absence of ancient DNA in sub-fossil insect inclusions preserved in 'Anthropocene' Colombian copal.

    PubMed

    Penney, David; Wadsworth, Caroline; Fox, Graeme; Kennedy, Sandra L; Preziosi, Richard F; Brown, Terence A

    2013-01-01

    Insects preserved in copal, the sub-fossilized resin precursor of amber, have potential value in molecular ecological studies of recently-extinct species and of extant species that have never been collected as living specimens. The objective of the work reported in this paper was therefore to determine if ancient DNA is present in insects preserved in copal. We prepared DNA libraries from two stingless bees (Apidae: Meliponini: Trigonisca ameliae) preserved in 'Anthropocene' Colombian copal, dated to 'post-Bomb' and 10,612±62 cal yr BP, respectively, and obtained sequence reads using the GS Junior 454 System. Read numbers were low, but were significantly higher for DNA extracts prepared from crushed insects compared with extracts obtained by a non-destructive method. The younger specimen yielded sequence reads up to 535 nucleotides in length, but searches of these sequences against the nucleotide database revealed very few significant matches. None of these hits was to stingless bees though one read of 97 nucleotides aligned with two non-contiguous segments of the mitochondrial cytochrome oxidase subunit I gene of the East Asia bumblebee Bombus hypocrita. The most significant hit was for 452 nucleotides of a 470-nucleotide read that aligned with part of the genome of the root-nodulating bacterium Bradyrhizobium japonicum. The other significant hits were to proteobacteria and an actinomycete. Searches directed specifically at Apidae nucleotide sequences only gave short and insignificant alignments. All of the reads from the older specimen appeared to be artefacts. We were therefore unable to obtain any convincing evidence for the preservation of ancient DNA in either of the two copal inclusions that we studied, and conclude that DNA is not preserved in this type of material. Our results raise further doubts about claims of DNA extraction from fossil insects in amber, many millions of years older than copal.

  19. BEND3 is involved in the human-specific repression of calreticulin: Implication for the evolution of higher brain functions in human.

    PubMed

    Aghajanirefah, A; Nguyen, L N; Ohadi, M

    2016-01-15

    Recent emerging evidence indicates that changes in gene expression levels are linked to human evolution. We have previously reported a human-specific nucleotide in the promoter sequence of the calreticulin (CALR) gene at position -220C, which is the site of action of valproic acid. Reversion of this nucleotide to the ancestral A-allele has been detected in patients with degrees of deficit in higher brain cognitive functions. This mutation has since been reported in the 1000 genomes database at an approximate frequency of <0.0004 in humans (rs138452745). In the study reported here, we present update on the status of rs138452745 across evolution, based on the Ensembl and NCBI databases. The DNA pulldown assay was also used to identify the proteins binding to the C- and A-alleles, using two cell lines, SK-N-BE and HeLa. Consistent with our previous findings, the C-allele is human-specific, and the A-allele is the rule across all other species (N=38). This nucleotide resides in a block of 12-nucleotides that is strictly conserved across evolution. The DNA pulldown experiments revealed that in both SK-N-BE and HeLa cells, the transcription repressor BEN domain containing 3 (BEND3) binds to the human-specific C-allele, whereas the nuclear factor I (NFI) family members, NF1A, B, C, and X, specifically bind to the ancestral A-allele. This binding pattern is consistent with a previously reported decreased promoter activity of the C-allele vs. the A-allele. We propose that there is a link between binding of BEND3 to the CALR rs138452745 C-allele and removal of NFI binding site from this nucleotide, and the evolution of human-specific higher brain functions. To our knowledge, CALR rs138452745 is the first instance of enormous nucleotide conservation across evolution, except in the human species. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Dual modulation of chloride conductance by nucleotides in pancreatic and parotid zymogen granules.

    PubMed Central

    Thévenod, F; Gasser, K W; Hopfer, U

    1990-01-01

    The regulation of Cl- conductance by cytoplasmic nucleotides was investigated in pancreatic and parotid zymogen granules. Cl- conductance was assayed by measuring the rate of cation-ionophore-induced osmotic lysis of granules suspended in iso-osmotic salt solutions. Both inhibition and stimulation were observed, depending on the type and concentration of nucleotide. Under optimal conditions, the average inhibition measured in different preparations was 1.6-fold, whereas the average stimulation was 4.4-fold. ATP was inhibitory at 1-10 microM but stimulated Cl- conductance above 50 microM. Stimulation by ATP was more pronounced in granules with low endogenous Cl- conductance. The potency of nucleotides in terms of inhibition was ATP greater than adenosine 5'-[gamma-thio]triphosphate (ATP[S]) greater than UTP much greater than or equal to CTP much greater than or equal to GTP much greater than or equal to guanosine 5'-[gamma-thio]triphosphate (GTP[S]) much greater than or equal to ITP. The potency with respect to stimulation had the following order: adenosine 5'-[beta gamma-methylene]triphosphate (App[CH2]p) greater than ATP greater than guanosine 5'-[beta-thio]diphosphate (GDP[S]). Adenosine 5'-[beta gamma-imido]triphosphate (App[NH]p) was also stimulatory, and was more potent than ATP in the parotid granules, but less potent in the pancreatic granules. Aluminium fluoride stimulated Cl- conductance maximally at 15-30 microM-Al3+ and 10-15 mM-F. F was less effective at higher concentrations. Protein phosphorylation by kinases was apparently not involved, since the nucleotide effects (1) could be mimicked by non-hydrolysable analogues of ATP and GTP, (2) showed reversibility, and (3) were not abolished by the protein kinase inhibitors 1-(5-isoquinolinesulphonyl)-2-methylpiperazine (H-7) or staurosporine. The data suggest the presence of at least two binding sites for nucleotides, whereby occupancy of one induces inhibition and occupancy of the other induces stimulation. PMID:2264815

Top