Sample records for observation form dof

  1. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  2. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    PubMed Central

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

  3. ZmDof3, a maize endosperm-specific Dof protein gene, regulates starch accumulation and aleurone development in maize endosperm.

    PubMed

    Qi, Xin; Li, Shixue; Zhu, Yaxi; Zhao, Qian; Zhu, Dengyun; Yu, Jingjuan

    2017-01-01

    To explore the function of Dof transcription factors during kernel development in maize, we first identified Dof genes in the maize genome. We found that ZmDof3 was exclusively expressed in the endosperm of maize kernel and had the features of a Dof transcription factor. Suppression of ZmDof3 resulted in a defective kernel phenotype with reduced starch content and a partially patchy aleurone layer. The expression levels of starch synthesis-related genes and aleurone differentiation-associated genes were down-regulated in ZmDof3 knockdown kernels, indicating that ZmDof3 plays an important role in maize endosperm development. The maize endosperm, occupying a large proportion of the kernel, plays an important role in seed development and germination. Current knowledge regarding the regulation of endosperm development is limited. Dof proteins, a family of plant-specific transcription factors, play critical roles in diverse biological processes. In this study, an endosperm-specific Dof protein gene, ZmDof3, was identified in maize through genome-wide screening. Suppression of ZmDof3 resulted in a defective kernel phenotype. The endosperm of ZmDof3 knockdown kernels was loosely packed with irregular starch granules observed by electronic microscope. Through genome-wide expression profiling, we found that down-regulated genes were enriched in GO terms related to carbohydrate metabolism. Moreover, ZmDof3 could bind to the Dof core element in the promoter of starch biosynthesis genes Du1 and Su2 in vitro and in vivo. In addition, the aleurone at local position in mature ZmDof3 knockdown kernels varied from one to three layers, which consisted of smaller and irregular cells. Further analyses showed that knockdown of ZmDof3 reduced the expression of Nkd1, which is involved in aleurone cell differentiation, and that ZmDof3 could bind to the Dof core element in the Nkd1 promoter. Our study reveals that ZmDof3 functions in maize endosperm development as a positive regulator in

  4. The LET Procedure for Prosthetic Myocontrol: Towards Multi-DOF Control Using Single-DOF Activations.

    PubMed

    Nowak, Markus; Castellini, Claudio

    2016-01-01

    Simultaneous and proportional myocontrol of dexterous hand prostheses is to a large extent still an open problem. With the advent of commercially and clinically available multi-fingered hand prostheses there are now more independent degrees of freedom (DOFs) in prostheses than can be effectively controlled using surface electromyography (sEMG), the current standard human-machine interface for hand amputees. In particular, it is uncertain, whether several DOFs can be controlled simultaneously and proportionally by exclusively calibrating the intended activation of single DOFs. The problem is currently solved by training on all required combinations. However, as the number of available DOFs grows, this approach becomes overly long and poses a high cognitive burden on the subject. In this paper we present a novel approach to overcome this problem. Multi-DOF activations are artificially modelled from single-DOF ones using a simple linear combination of sEMG signals, which are then added to the training set. This procedure, which we named LET (Linearly Enhanced Training), provides an augmented data set to any machine-learning-based intent detection system. In two experiments involving intact subjects, one offline and one online, we trained a standard machine learning approach using the full data set containing single- and multi-DOF activations as well as using the LET-augmented data set in order to evaluate the performance of the LET procedure. The results indicate that the machine trained on the latter data set obtains worse results in the offline experiment compared to the full data set. However, the online implementation enables the user to perform multi-DOF tasks with almost the same precision as single-DOF tasks without the need of explicitly training multi-DOF activations. Moreover, the parameters involved in the system are statistically uniform across subjects.

  5. Expression of the Maize Dof1 Transcription Factor in Wheat and Sorghum

    PubMed Central

    Peña, Pamela A.; Quach, Truyen; Sato, Shirley; Ge, Zhengxiang; Nersesian, Natalya; Changa, Taity; Dweikat, Ismail; Soundararajan, Madhavan; Clemente, Tom E.

    2017-01-01

    Nitrogen is essential for plant growth and development. Improving the ability of plants to acquire and assimilate nitrogen more efficiently is a key agronomic parameter that will augment sustainability in agriculture. A transcription factor approach was pursued to address improvement of nitrogen use efficiency in two major commodity crops. To this end, the Zea mays Dof1 (ZmDof1) transcription factor was expressed in both wheat (Triticum aestivum) and sorghum (Sorghum bicolor) either constitutively, UBI4 promoter from sugarcane, or in a tissue specific fashion via the maize rbcS1 promoter. The primary transcription activation target of ZmDof1, phosphoenolpyruvate carboxylase (PEPC), is observed in transgenic wheat events. Expression ZmDof1 under control of the rbcs1 promoter translates to increase in biomass and yield components in wheat. However, constitutive expression of ZmDof1 led to the down-regulation of genes involved in photosynthesis and the functional apparatus of chloroplasts, and an outcome that negatively impacts photosynthesis, height, and biomass in wheat. Similar patterns were also observed in sorghum transgenic events harboring the constitutive expression cassette of ZmDof1. These results indicate that transcription factor strategies to boost agronomic phenotypic outcomes in crops need to consider expression patterns of the genetic elements to be introduced. PMID:28424717

  6. Spatial and rotational quality assurance of 6DOF patient tracking systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belcher, Andrew H.; Liu, Xinmin; Grelewicz, Zachary

    earlier generation 3D optical surface tracking unit was observed to have worse tracking capabilities than both the IR camera unit and the newer 3D surface tracking system with maximal RMSE of 0.69, 0.74, 0.47 mm, 0.28°, 0.19°, and 0.18°, in LR, SI, AP, pitch, roll, and yaw, respectively, in the same 6DOF evaluation space. Conclusions: The proposed technique was found to be effective at evaluating the performance of 6DOF patient tracking systems. All observed optical tracking systems were found to exhibit tracking capabilities at the sub-millimeter and subdegree level within a 6DOF workspace.« less

  7. Assessment of Healthcare Worker Protocol Deviations and Self-Contamination During Personal Protective Equipment Donning and Doffing.

    PubMed

    Kwon, Jennie H; Burnham, Carey-Ann D; Reske, Kimberly A; Liang, Stephen Y; Hink, Tiffany; Wallace, Meghan A; Shupe, Angela; Seiler, Sondra; Cass, Candice; Fraser, Victoria J; Dubberke, Erik R

    2017-09-01

    OBJECTIVE To evaluate healthcare worker (HCW) risk of self-contamination when donning and doffing personal protective equipment (PPE) using fluorescence and MS2 bacteriophage. DESIGN Prospective pilot study. SETTING Tertiary-care hospital. PARTICIPANTS A total of 36 HCWs were included in this study: 18 donned/doffed contact precaution (CP) PPE and 18 donned/doffed Ebola virus disease (EVD) PPE. INTERVENTIONS HCWs donned PPE according to standard protocols. Fluorescent liquid and MS2 bacteriophage were applied to HCWs. HCWs then doffed their PPE. After doffing, HCWs were scanned for fluorescence and swabbed for MS2. MS2 detection was performed using reverse transcriptase PCR. The donning and doffing processes were videotaped, and protocol deviations were recorded. RESULTS Overall, 27% of EVD PPE HCWs and 50% of CP PPE HCWs made ≥1 protocol deviation while donning, and 100% of EVD PPE HCWs and 67% of CP PPE HCWs made ≥1 protocol deviation while doffing (P=.02). The median number of doffing protocol deviations among EVD PPE HCWs was 4, versus 1 among CP PPE HCWs. Also, 15 EVD PPE protocol deviations were committed by doffing assistants and/or trained observers. Fluorescence was detected on 8 EVD PPE HCWs (44%) and 5 CP PPE HCWs (28%), most commonly on hands. MS2 was recovered from 2 EVD PPE HCWs (11%) and 3 CP PPE HCWs (17%). CONCLUSIONS Protocol deviations were common during both EVD and CP PPE doffing, and some deviations during EVD PPE doffing were committed by the HCW doffing assistant and/or the trained observer. Self-contamination was common. PPE donning/doffing are complex and deserve additional study. Infect Control Hosp Epidemiol 2017;38:1077-1083.

  8. Characterization of Dof Transcription Factors and Their Responses to Osmotic Stress in Poplar (Populus trichocarpa)

    PubMed Central

    Wang, Han; Zhao, Shicheng; Gao, Yuchi; Yang, Jingli

    2017-01-01

    The DNA-binding One Zinc Finger (Dof) genes are ubiquitous in many plant species and are especial transcription regulators that participate in plant growth, development and various procedures, including biotic and abiotic stress reactions. In this study, we identified 41 PtrDof members from Populus trichocarpa genomes and classified them into four groups. The conserved motifs and gene structures of some PtrDof genes belonging to the same subgroup were almost the same. The 41 PtrDof genes were dispersed on 18 of the 19 Populus chromosomes. Many key stress- or phytohormone-related cis-elements were discovered in the PtrDof gene promoter regions. Consequently, we undertook expression profiling of the PtrDof genes in leaves and roots in response to osmotic stress and abscisic acid. A total of seven genes (PtrDof14, 16, 25, 27, 28, 37 and 39) in the Populus Dof gene family were consistently upregulated at point in all time in the leaves and roots under osmotic and abscisic acid (ABA) stress. We observed that 12 PtrDof genes could be targeted by 15 miRNAs. Moreover, we mapped the cleavage site in PtrDof30 using the 5’RLM-RACE. The results showed that PtrDofs may have a role in resistance to abiotic stress in Populus trichocarpa. PMID:28095469

  9. Standardized Observational Assessment of Attention Deficit Hyperactivity Disorder Combined and Predominantly Inattentive Subtypes. II. Classroom Observations.

    PubMed

    McConaughy, Stephanie H; Ivanova, Masha Y; Antshel, Kevin; Eiraldi, Ricardo B; Dumenci, Levent

    2009-07-01

    Trained classroom observers used the Direct Observation Form (DOF; McConaughy & Achenbach, 2009) to rate observations of 163 6- to 11-year-old children in their school classrooms. Participants were assigned to four groups based on a parent diagnostic interview and parent and teacher rating scales: Attention Deficit Hyperactivity Disorder (ADHD)-Combined type (n = 64); ADHD-Inattentive type (n = 22); clinically referred without ADHD (n = 51); and nonreferred control children (n = 26). The ADHD-Combined group scored significantly higher than the referred without ADHD group and controls on the DOF Intrusive and Oppositional syndromes, Attention Deficit Hyperactivity Problems scale, Hyperactivity-Impulsivity subscale, and Total Problems; and significantly lower on the DOF On-Task score. The ADHD-Inattentive group scored significantly higher than controls on the DOF Sluggish Cognitive Tempo and Attention Problems syndromes, Inattention subscale, and Total Problems; and significantly lower on the DOF On-Task score. Implications are discussed regarding the discriminative validity of standardized classroom observations for identifying children with ADHD and differentiating between the two ADHD subtypes.

  10. Standardized Observational Assessment of Attention Deficit Hyperactivity Disorder Combined and Predominantly Inattentive Subtypes. II. Classroom Observations

    PubMed Central

    McConaughy, Stephanie H.; Ivanova, Masha Y.; Antshel, Kevin; Eiraldi, Ricardo B.; Dumenci, Levent

    2010-01-01

    Trained classroom observers used the Direct Observation Form (DOF; McConaughy & Achenbach, 2009) to rate observations of 163 6- to 11-year-old children in their school classrooms. Participants were assigned to four groups based on a parent diagnostic interview and parent and teacher rating scales: Attention Deficit Hyperactivity Disorder (ADHD)—Combined type (n = 64); ADHD—Inattentive type (n = 22); clinically referred without ADHD (n = 51); and nonreferred control children (n = 26). The ADHD—Combined group scored significantly higher than the referred without ADHD group and controls on the DOF Intrusive and Oppositional syndromes, Attention Deficit Hyperactivity Problems scale, Hyperactivity-Impulsivity subscale, and Total Problems; and significantly lower on the DOF On-Task score. The ADHD—Inattentive group scored significantly higher than controls on the DOF Sluggish Cognitive Tempo and Attention Problems syndromes, Inattention subscale, and Total Problems; and significantly lower on the DOF On-Task score. Implications are discussed regarding the discriminative validity of standardized classroom observations for identifying children with ADHD and differentiating between the two ADHD subtypes. PMID:20802813

  11. TH-AB-202-11: Spatial and Rotational Quality Assurance of 6DOF Patient Tracking Systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belcher, AH; Liu, X; Grelewicz, Z

    2016-06-15

    Purpose: External tracking systems used for patient positioning and motion monitoring during radiotherapy are now capable of detecting both translations and rotations (6DOF). In this work, we develop a novel technique to evaluate the 6DOF performance of external motion tracking systems. We apply this methodology to an infrared (IR) marker tracking system and two 3D optical surface mapping systems in a common tumor 6DOF workspace. Methods: An in-house designed and built 6DOF parallel kinematics robotic motion phantom was used to follow input trajectories with sub-millimeter and sub-degree accuracy. The 6DOF positions of the robotic system were then tracked and recordedmore » independently by three optical camera systems. A calibration methodology which associates the motion phantom and camera coordinate frames was first employed, followed by a comprehensive 6DOF trajectory evaluation, which spanned a full range of positions and orientations in a 20×20×16 mm and 5×5×5 degree workspace. The intended input motions were compared to the calibrated 6DOF measured points. Results: The technique found the accuracy of the IR marker tracking system to have maximal root mean square error (RMSE) values of 0.25 mm translationally and 0.09 degrees rotationally, in any one axis, comparing intended 6DOF positions to positions measured by the IR camera. The 6DOF RSME discrepancy for the first 3D optical surface tracking unit yielded maximal values of 0.60 mm and 0.11 degrees over the same 6DOF volume. An earlier generation 3D optical surface tracker was observed to have worse tracking capabilities than both the IR camera unit and the newer 3D surface tracking system with maximal RMSE of 0.74 mm and 0.28 degrees within the same 6DOF evaluation space. Conclusion: The proposed technique was effective at evaluating the performance of 6DOF patient tracking systems. All systems examined exhibited tracking capabilities at the sub-millimeter and sub-degree level within a 6DOF workspace.« less

  12. The banana fruit Dof transcription factor MaDof23 acts as a repressor and interacts with MaERF9 in regulating ripening-related genes

    PubMed Central

    Feng, Bi-hong; Han, Yan-chao; Xiao, Yun-yi; Kuang, Jian-fei; Fan, Zhong-qi; Chen, Jian-ye; Lu, Wang-jin

    2016-01-01

    The DNA binding with one finger (Dof) proteins, a family of plant-specific transcription factors, are involved in a variety of plant biological processes. However, little information is available on their involvement in fruit ripening. We have characterized 25 MaDof genes from banana fruit (Musa acuminata), designated as MaDof1–MaDof25. Gene expression analysis in fruit subjected to different ripening conditions revealed that MaDofs were differentially expressed during different stages of ripening. MaDof10, 23, 24, and 25 were ethylene-inducible and nuclear-localized, and their transcript levels increased during fruit ripening. Moreover, yeast two-hybrid and bimolecular fluorescence complementation analyses demonstrated a physical interaction between MaDof23 and MaERF9, a potential regulator of fruit ripening reported in a previous study. We determined that MaDof23 is a transcriptional repressor, whereas MaERF9 is a transcriptional activator. We suggest that they might act antagonistically in regulating 10 ripening-related genes, including MaEXP1/2/3/5, MaXET7, MaPG1, MaPME3, MaPL2, MaCAT, and MaPDC, which are associated with cell wall degradation and aroma formation. Taken together, our findings provide new insight into the transcriptional regulation network controlling banana fruit ripening. PMID:26889012

  13. Genome-wide characterization of the SiDof gene family in foxtail millet (Setaria italica).

    PubMed

    Zhang, Li; Liu, Baoling; Zheng, Gewen; Zhang, Aiying; Li, Runzhi

    2017-01-01

    Dof (DNA binding with one finger) proteins, which constitute a class of transcription factors found exclusively in plants, are involved in numerous physiological and biochemical reactions affecting growth and development. A genome-wide analysis of SiDof genes was performed in this study. Thirty five SiDof genes were identified and those genes were unevenly distributed across nine chromosomes in the Seteria italica genome. Protein lengths, molecular weights, and theoretical isoelectric points of SiDofs all vary greatly. Gene structure analysis demonstrated that most SiDof genes lack introns. Phylogenetic analysis of SiDof proteins and Dof proteins from Arabidopsis thaliana, rice, sorghum, and Setaria viridis revealed six major groups. Analysis of RNA-Seq data indicated that SiDof gene expression levels varied across roots, stems, leaves, and spike. In addition, expression profiling of SiDof genes in response to stress suggested that SiDof 7 and SiDof 15 are involved in drought stress signalling. Overall, this study could provide novel information on SiDofs for further investigation in foxtail millet. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  14. Automated optimal coordination of multiple-DOF neuromuscular actions in feedforward neuroprostheses.

    PubMed

    Lujan, J Luis; Crago, Patrick E

    2009-01-01

    This paper describes a new method for designing feedforward controllers for multiple-muscle, multiple-DOF, motor system neural prostheses. The design process is based on experimental measurement of the forward input/output properties of the neuromechanical system and numerical optimization of stimulation patterns to meet muscle coactivation criteria, thus resolving the muscle redundancy (i.e., overcontrol) and the coupled DOF problems inherent in neuromechanical systems. We designed feedforward controllers to control the isometric forces at the tip of the thumb in two directions during stimulation of three thumb muscles as a model system. We tested the method experimentally in ten able-bodied individuals and one patient with spinal cord injury. Good control of isometric force in both DOFs was observed, with rms errors less than 10% of the force range in seven experiments and statistically significant correlations between the actual and target forces in all ten experiments. Systematic bias and slope errors were observed in a few experiments, likely due to the neuromuscular fatigue. Overall, the tests demonstrated the ability of a general design approach to satisfy both control and coactivation criteria in multiple-muscle, multiple-axis neuromechanical systems, which is applicable to a wide range of neuromechanical systems and stimulation electrodes.

  15. Fluctuation of Dof1/Dof2 expression ratio under the influence of varying nitrogen and light conditions: involvement in differential regulation of nitrogen metabolism in two genotypes of finger millet (Eleusine coracana L.).

    PubMed

    Gupta, Supriya; Gupta, Sanjay Mohan; Gupta, Alok Kumar; Gaur, Vikram Singh; Kumar, Anil

    2014-08-10

    In order to gain insights into the mechanism of high nitrogen use efficiency (NUE) of finger millet (FM) the role of Dof2 transcription factor (TF), which is a repressor of genes involved in C/N metabolism was investigated. The partial cDNA fragment of EcDof2 (912-bp; GenBank acc. no. KF261117) was isolated and characterized from finger millet (FM) that showed 63% and 58% homology with Dof2 of Zea mays at nucleotide and protein level, respectively. Its expression studies were carried out along with the activator EcDof1 in two genotypes (GE3885, high protein genotype (HPG); GE1437, low protein genotype (LPG)) of FM differing in grain protein contents (13.8% and 6.2%) showed that EcDof2 is expressed in both shoot and root tissues with significantly (p≤0.05) higher expression in the roots. The diurnal expression of both EcDof1 and EcDof2 in shoots was differential having different time of peak expression indicating a differential response to diurnal condition. Under continuous dark conditions, expression of EcDof1 and EcDof2 oscillated in both the genotypes whereas on illumination, the fold expression of EcDof1 was higher as compared to EcDof2. Under increasing nitrate concentration, EcDof2 expression increases in roots and shoots of LPG while it remains unchanged in HPG. However, the EcDof1 expression was found to increase in both genotypes. Further, time kinetics studies under single nitrate concentration revealed that EcDof2 was repressed in the roots of both genotypes whereas EcDof1 oscillated with time. The EcDof1/EcDof2 ratio measured showed differential response under different light and nitrogen conditions. It was higher in the roots of HPG indicating higher activation of genes involved in N uptake and assimilation resulting in high grain protein accumulation. The results indicate that both light and nitrogen concentration influence Dof1 and Dof2 expression and suggests a complex pattern of regulation of genes influenced by these plant specific TFs. In

  16. Efficient Kinematic Computations For 7-DOF Manipulators

    NASA Technical Reports Server (NTRS)

    Seraji, Homayoun; Long, Mark K.; Kreutz-Delgado, Kenneth

    1994-01-01

    Efficient algorithms for forward kinematic mappings of seven-degree-of-freedom (7-DOF) robotic manipulator having revolute joints developed on basis of representation of redundant DOF in terms of parameter called "arm angle." Continuing effort to exploit redundancy in manipulator according to concept of basic and additional tasks. Concept also discussed in "Configuration-Control Scheme Copes With Singularities" (NPO-18556) and "Increasing the Dexterity of Redundant Robots" (NPO-17801).

  17. Improved Multiple-DOF SAW Piezoelectric Motors

    NASA Technical Reports Server (NTRS)

    Bar-Cohen, Yoseph; Bao, Xiaoqi; Hull, Anthony; Wright, John

    2003-01-01

    Surface-acoustic-wave (SAW) piezoelectric motors of a proposed type would be capable of operating in multiple degrees of freedom (DOFs) simultaneously and would be amenable to integration into diverse structures and mechanisms. These motors would be compact and structurally simple and would not contain bearings or lead screws. One example of a particularly useful motor of this type would be a two-dimensional- translation stage. Another such example would be a self-actuated spherical joint that could be made to undergo controlled, simultaneous rotations about two orthogonal axes: Such a motor could serve as a mechanism for aiming an "eyeball" camera or as a compact transducer in, and an integral part of, a joint in a robot arm. The multiple-DOF SAW piezoelectric motors as now proposed would be successors to the ones reported in "Multiple-DOF Surface-Acoustic-Wave Piezoelectric Motors" (NPO-20735), NASA Tech Briefs, Vol. 24, No. 12 (December 2000), page 5b. The basic principle of operation of a multiple-DOF SAW piezoelectric motor is a straightforward extension of that of single-DOF SAW piezoelectric motors, which have been reported in several previous NASA Tech Briefs articles: For example, in the case of a linear SAW piezoelectric motor, piezoelectric transducers at opposite ends of a stator excite surface acoustic waves that travel along the surface of the stator. An object (denoted the slider) is pressed against the stator with sufficient pressure (in practice .300 MPa) that it remains in frictional contact with the stator at all times. The slider rides the crests of the waves and is thereby made to move along the surface of the stator. The direction of motion (forward or backward) is controlled by selecting the relative phase of waves generated by the two piezoelectric transducers. The speed increases with the amplitude of the waves and thus with the magnitude of the voltage applied to the transducers.

  18. An 8-DOF dual-arm system for advanced teleoperation performance experiments

    NASA Technical Reports Server (NTRS)

    Bejczy, Antal K.; Szakaly, Zoltan F.

    1992-01-01

    This paper describes the electro-mechanical and control features of an 8-DOF manipulator manufactured by AAI Corporation and installed at the Jet Propulsion Lab. (JPL) in a dual-arm setting. The 8-DOF arm incorporates a variety of features not found in other lab or industrial manipulators. Some of the unique features are: 8-DOF revolute configuration with no lateral offsets at joint axes; 1 to 5 payload to weight ratio with 20 kg (44 lb) payload at a 1.75 m (68.5 in.) reach; joint position measurement with dual relative encoders and potentiometer; infinite roll of joint 8 with electrical and fiber optic slip rings; internal fiber optic link of 'smart' end effectors; four-axis wrist; graphite epoxy links; high link and joint stiffness; use of an upgraded JPL Universal Motor Controller (UMC) capable of driving up to 16 joints. The 8-DOF arm is equipped with a 'smart' end effector which incorporates a 6-DOF forcemoment sensor at the end effector base and grasp force sensors at the base of the parallel jaws. The 8-DOF arm is interfaced to a 6 DOF force reflecting hand controller. The same system is duplicated for and installed at NASA-Langley.

  19. Design and fabrication of a 1-DOF drive mode and 2-DOF sense mode micro-gyroscope using SU-8 based UV-LIGA process

    NASA Astrophysics Data System (ADS)

    Verma, Payal; Juneja, Sucheta; Savelyev, Dmitry A.; Khonina, Svetlana N.; Gopal, Ram

    2016-04-01

    This paper presents design and fabrication of a 1-DOF (degree-of-freedom) drive mode and 2-DOF sense mode micro-gyroscope. It is an inherently robust structure and offers a high sense frequency bandwidth. The proposed design utilizes resonance of the1-DOF drive mode oscillator and employs dynamic amplification concept in sense modes to increase the sensitivity while maintaining robustness. The 2-DOF in the sense direction renders the device immune to process imperfections and environmental effects. The design is simulated using FEA software (CoventorWare®). The device is designed considering process compatibility with SU-8 based UV-LIGA process, which is an economical fabrication technique. The complete fabrication process is presented along with SEM images of the fabricated device. The device has 9 µm thick Nickel as the key structural layer with an overall reduced key structure size of 2.2 mm by 2.1 mm.

  20. Active fault tolerant control based on interval type-2 fuzzy sliding mode controller and non linear adaptive observer for 3-DOF laboratory helicopter.

    PubMed

    Zeghlache, Samir; Benslimane, Tarak; Bouguerra, Abderrahmen

    2017-11-01

    In this paper, a robust controller for a three degree of freedom (3 DOF) helicopter control is proposed in presence of actuator and sensor faults. For this purpose, Interval type-2 fuzzy logic control approach (IT2FLC) and sliding mode control (SMC) technique are used to design a controller, named active fault tolerant interval type-2 Fuzzy Sliding mode controller (AFTIT2FSMC) based on non-linear adaptive observer to estimate and detect the system faults for each subsystem of the 3-DOF helicopter. The proposed control scheme allows avoiding difficult modeling, attenuating the chattering effect of the SMC, reducing the rules number of the fuzzy controller. Exponential stability of the closed loop is guaranteed by using the Lyapunov method. The simulation results show that the AFTIT2FSMC can greatly alleviate the chattering effect, providing good tracking performance, even in presence of actuator and sensor faults. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

  1. Standardized Observational Assessment of Attention Deficit Hyperactivity Disorder Combined and Predominantly Inattentive Subtypes. II. Classroom Observations

    ERIC Educational Resources Information Center

    McConaughy, Stephanie H.; Ivanova, Masha Y.; Antshel, Kevin; Eiraldi, Ricardo B.; Dumenci, Levent

    2009-01-01

    Trained classroom observers used the Direct Observation Form (DOF; McConaughy & Achenbach, 2009) to rate observations of 163 6- to 11-year-old children in their school classrooms. Participants were assigned to four groups based on a parent diagnostic interview and parent and teacher rating scales: Attention Deficit Hyperactivity Disorder…

  2. Effect of suspension kinematic on 14 DOF vehicle model

    NASA Astrophysics Data System (ADS)

    Wongpattananukul, T.; Chantharasenawong, C.

    2017-12-01

    Computer simulations play a major role in shaping modern science and engineering. They reduce time and resource consumption in new studies and designs. Vehicle simulations have been studied extensively to achieve a vehicle model used in minimum lap time solution. Simulation result accuracy depends on the abilities of these models to represent real phenomenon. Vehicles models with 7 degrees of freedom (DOF), 10 DOF and 14 DOF are normally used in optimal control to solve for minimum lap time. However, suspension kinematics are always neglected on these models. Suspension kinematics are defined as wheel movements with respect to the vehicle body. Tire forces are expressed as a function of wheel slip and wheel position. Therefore, the suspension kinematic relation is appended to the 14 DOF vehicle model to investigate its effects on the accuracy of simulate trajectory. Classical 14 DOF vehicle model is chosen as baseline model. Experiment data is collected from formula student style car test runs as baseline data for simulation and comparison between baseline model and model with suspension kinematic. Results show that in a single long turn there is an accumulated trajectory error in baseline model compared to model with suspension kinematic. While in short alternate turns, the trajectory error is much smaller. These results show that suspension kinematic had an effect on the trajectory simulation of vehicle. Which optimal control that use baseline model will result in inaccuracy control scheme.

  3. Real-time robustness evaluation of regression based myoelectric control against arm position change and donning/doffing

    PubMed Central

    Hahne, Janne Mathias; Müller, Klaus-Robert

    2017-01-01

    There are some practical factors, such as arm position change and donning/doffing, which prevent robust myoelectric control. The objective of this study is to precisely characterize the impacts of the two representative factors on myoelectric controllability in practical control situations, thereby providing useful references that can be potentially used to find better solutions for clinically reliable myoelectric control. To this end, a real-time target acquisition task was performed by fourteen subjects including one individual with congenital upper-limb deficiency, where the impacts of arm position change, donning/doffing and a combination of both factors on control performance was systematically evaluated. The changes in online performance were examined with seven different performance metrics to comprehensively evaluate various aspects of myoelectric controllability. As a result, arm position change significantly affects offline prediction accuracy, but not online control performance due to real-time feedback, thereby showing no significant correlation between offline and online performance. Donning/doffing was still problematic in online control conditions. It was further observed that no benefit was attained when using a control model trained with multiple position data in terms of arm position change, and the degree of electrode shift caused by donning/doffing was not severely associated with the degree of performance loss under practical conditions (around 1 cm electrode shift). Since this study is the first to concurrently investigate the impacts of arm position change and donning/doffing in practical myoelectric control situations, all findings of this study provide new insights into robust myoelectric control with respect to arm position change and donning/doffing. PMID:29095846

  4. Real-time robustness evaluation of regression based myoelectric control against arm position change and donning/doffing.

    PubMed

    Hwang, Han-Jeong; Hahne, Janne Mathias; Müller, Klaus-Robert

    2017-01-01

    There are some practical factors, such as arm position change and donning/doffing, which prevent robust myoelectric control. The objective of this study is to precisely characterize the impacts of the two representative factors on myoelectric controllability in practical control situations, thereby providing useful references that can be potentially used to find better solutions for clinically reliable myoelectric control. To this end, a real-time target acquisition task was performed by fourteen subjects including one individual with congenital upper-limb deficiency, where the impacts of arm position change, donning/doffing and a combination of both factors on control performance was systematically evaluated. The changes in online performance were examined with seven different performance metrics to comprehensively evaluate various aspects of myoelectric controllability. As a result, arm position change significantly affects offline prediction accuracy, but not online control performance due to real-time feedback, thereby showing no significant correlation between offline and online performance. Donning/doffing was still problematic in online control conditions. It was further observed that no benefit was attained when using a control model trained with multiple position data in terms of arm position change, and the degree of electrode shift caused by donning/doffing was not severely associated with the degree of performance loss under practical conditions (around 1 cm electrode shift). Since this study is the first to concurrently investigate the impacts of arm position change and donning/doffing in practical myoelectric control situations, all findings of this study provide new insights into robust myoelectric control with respect to arm position change and donning/doffing.

  5. Swarm Counter-Asymmetric-Threat (CAT) 6-DOF Dynamics Simulation

    DTIC Science & Technology

    2005-07-01

    NAWCWD TP 8593 Swarm Counter-Asymmetric-Threat ( CAT ) 6-DOF Dynamics Simulation by James Bobinchak Weapons and Energetics...mathematical models used in the swarm counter- asymmetric-threat ( CAT ) simulation and the results of extensive Monte Carlo simulations. The swarm CAT ...Asymmetric-Threat ( CAT ) 6-DOF Dynamics Simulation (U) 6. AUTHOR(S) James Bobinchak and Gary Hewer 7. PERFORMING ORGANIZATION NAME(S) AND

  6. Adding Liquid Payloads Effects to the 6-DOF Trajectory of Spinning Projectiles

    DTIC Science & Technology

    2010-03-01

    Adding Liquid Payloads Effects to the 6-DOF Trajectory of Spinning Projectiles by Gene R. Cooper ARL-TR-5118 March 2010...Liquid Payloads Effects to the 6-DOF Trajectory of Spinning Projectiles Gene R. Cooper Weapons and Materials Research Directorate, ARL...September 2007 4. TITLE AND SUBTITLE Adding Liquid Payloads Effects to the 6-DOF Trajectory of Spinning Projectiles 5a. CONTRACT NUMBER 5b. GRANT

  7. Human Factors Risk Analyses of a Doffing Protocol for Ebola-Level Personal Protective Equipment: Mapping Errors to Contamination.

    PubMed

    Mumma, Joel M; Durso, Francis T; Ferguson, Ashley N; Gipson, Christina L; Casanova, Lisa; Erukunuakpor, Kimberly; Kraft, Colleen S; Walsh, Victoria L; Zimring, Craig; DuBose, Jennifer; Jacob, Jesse T

    2018-03-05

    Doffing protocols for personal protective equipment (PPE) are critical for keeping healthcare workers (HCWs) safe during care of patients with Ebola virus disease. We assessed the relationship between errors and self-contamination during doffing. Eleven HCWs experienced with doffing Ebola-level PPE participated in simulations in which HCWs donned PPE marked with surrogate viruses (ɸ6 and MS2), completed a clinical task, and were assessed for contamination after doffing. Simulations were video recorded, and a failure modes and effects analysis and fault tree analyses were performed to identify errors during doffing, quantify their risk (risk index), and predict contamination data. Fifty-one types of errors were identified, many having the potential to spread contamination. Hand hygiene and removing the powered air purifying respirator (PAPR) hood had the highest total risk indexes (111 and 70, respectively) and number of types of errors (9 and 13, respectively). ɸ6 was detected on 10% of scrubs and the fault tree predicted a 10.4% contamination rate, likely occurring when the PAPR hood inadvertently contacted scrubs during removal. MS2 was detected on 10% of hands, 20% of scrubs, and 70% of inner gloves and the predicted rates were 7.3%, 19.4%, 73.4%, respectively. Fault trees for MS2 and ɸ6 contamination suggested similar pathways. Ebola-level PPE can both protect and put HCWs at risk for self-contamination throughout the doffing process, even among experienced HCWs doffing with a trained observer. Human factors methodologies can identify error-prone steps, delineate the relationship between errors and self-contamination, and suggest remediation strategies.

  8. Genome wide in silico characterization of Dof gene families of pigeonpea (Cajanus cajan (L) Millsp.).

    PubMed

    Malviya, N; Gupta, S; Singh, V K; Yadav, M K; Bisht, N C; Sarangi, B K; Yadav, D

    2015-02-01

    The DNA binding with One Finger (Dof) protein is a plant specific transcription factor involved in the regulation of wide range of processes. The analysis of whole genome sequence of pigeonpea has identified 38 putative Dof genes (CcDof) distributed on 8 chromosomes. A total of 17 out of 38 CcDof genes were found to be intronless. A comprehensive in silico characterization of CcDof gene family including the gene structure, chromosome location, protein motif, phylogeny, gene duplication and functional divergence has been attempted. The phylogenetic analysis resulted in 3 major clusters with closely related members in phylogenetic tree revealed common motif distribution. The in silico cis-regulatory element analysis revealed functional diversity with predominance of light responsive and stress responsive elements indicating the possibility of these CcDof genes to be associated with photoperiodic control and biotic and abiotic stress. The duplication pattern showed that tandem duplication is predominant over segmental duplication events. The comparative phylogenetic analysis of these Dof proteins along with 78 soybean, 36 Arabidopsis and 30 rice Dof proteins revealed 7 major clusters. Several groups of orthologs and paralogs were identified based on phylogenetic tree constructed. Our study provides useful information for functional characterization of CcDof genes.

  9. Genome-Wide Screening and Characterization of the Dof Gene Family in Physic Nut (Jatropha curcas L.).

    PubMed

    Wang, Peipei; Li, Jing; Gao, Xiaoyang; Zhang, Di; Li, Anlin; Liu, Changning

    2018-05-29

    Physic nut ( Jatropha curcas L.) is a species of flowering plant with great potential for biofuel production and as an emerging model organism for functional genomic analysis, particularly in the Euphorbiaceae family. DNA binding with one finger (Dof) transcription factors play critical roles in numerous biological processes in plants. Nevertheless, the knowledge about members, and the evolutionary and functional characteristics of the Dof gene family in physic nut is insufficient. Therefore, we performed a genome-wide screening and characterization of the Dof gene family within the physic nut draft genome. In total, 24 JcDof genes (encoding 33 JcDof proteins) were identified. All the JcDof genes were divided into three major groups based on phylogenetic inference, which was further validated by the subsequent gene structure and motif analysis. Genome comparison revealed that segmental duplication may have played crucial roles in the expansion of the JcDof gene family, and gene expansion was mainly subjected to positive selection. The expression profile demonstrated the broad involvement of JcDof genes in response to various abiotic stresses, hormonal treatments and functional divergence. This study provides valuable information for better understanding the evolution of JcDof genes, and lays a foundation for future functional exploration of JcDof genes.

  10. Adaptive DOF for plenoptic cameras

    NASA Astrophysics Data System (ADS)

    Oberdörster, Alexander; Lensch, Hendrik P. A.

    2013-03-01

    Plenoptic cameras promise to provide arbitrary re-focusing through a scene after the capture. In practice, however, the refocusing range is limited by the depth of field (DOF) of the plenoptic camera. For the focused plenoptic camera, this range is given by the range of object distances for which the microimages are in focus. We propose a technique of recording light fields with an adaptive depth of focus. Between multiple exposures { or multiple recordings of the light field { the distance between the microlens array (MLA) and the image sensor is adjusted. The depth and quality of focus is chosen by changing the number of exposures and the spacing of the MLA movements. In contrast to traditional cameras, extending the DOF does not necessarily lead to an all-in-focus image. Instead, the refocus range is extended. There is full creative control about the focus depth; images with shallow or selective focus can be generated.

  11. An Evolutionarily Conserved DOF-CONSTANS Module Controls Plant Photoperiodic Signaling.

    PubMed

    Lucas-Reina, Eva; Romero-Campero, Francisco J; Romero, José M; Valverde, Federico

    2015-06-01

    The response to daylength is a crucial process that evolved very early in plant evolution, entitling the early green eukaryote to predict seasonal variability and attune its physiological responses to the environment. The photoperiod responses evolved into the complex signaling pathways that govern the angiosperm floral transition today. The Chlamydomonas reinhardtii DNA-Binding with One Finger (CrDOF) gene controls transcription in a photoperiod-dependent manner, and its misexpression influences algal growth and viability. In short days, CrDOF enhances CrCO expression, a homolog of plant CONSTANS (CO), by direct binding to its promoter, while it reduces the expression of cell division genes in long days independently of CrCO. In Arabidopsis (Arabidopsis thaliana), transgenic plants overexpressing CrDOF show floral delay and reduced expression of the photoperiodic genes CO and FLOWERING LOCUS T. The conservation of the DOF-CO module during plant evolution could be an important clue to understanding diversification by the inheritance of conserved gene toolkits in key developmental programs. © 2015 American Society of Plant Biologists. All Rights Reserved.

  12. Comparative study of 2-DOF micromirrors for precision light manipulation

    NASA Astrophysics Data System (ADS)

    Young, Johanna I.; Shkel, Andrei M.

    2001-08-01

    Many industry experts predict that the future of fiber optic telecommunications depends on the development of all-optical components for switching of photonic signals from fiber to fiber throughout the networks. MEMS is a promising technology for providing all-optical switching at high speeds with significant cost reductions. This paper reports on the the analysis of two designs for 2-DOF electrostatically actuated MEMS micromirrors for precision controllable large optical switching arrays. The behavior of the micromirror designs is predicted by coupled-field electrostatic and modal analysis using a finite element analysis (FEA) multi-physics modeling software. The analysis indicates that the commonly used gimbal type mirror design experiences electrostatic interference and would therefore be difficult to precisely control for 2-DOF motion. We propose a new design approach which preserves 2-DOF actuation while minimizing electrostatic interference between the drive electrodes and the mirror. Instead of using two torsional axes, we use one actuator which combines torsional and flexural DOFs. A comparative analysis of the conventional gimbal design and the one proposed in this paper is performed.

  13. Genome-wide analysis of the DNA-binding with one zinc finger (Dof) transcription factor family in bananas.

    PubMed

    Dong, Chen; Hu, Huigang; Xie, Jianghui

    2016-12-01

    DNA-binding with one finger (Dof) domain proteins are a multigene family of plant-specific transcription factors involved in numerous aspects of plant growth and development. In this study, we report a genome-wide search for Musa acuminata Dof (MaDof) genes and their expression profiles at different developmental stages and in response to various abiotic stresses. In addition, a complete overview of the Dof gene family in bananas is presented, including the gene structures, chromosomal locations, cis-regulatory elements, conserved protein domains, and phylogenetic inferences. Based on the genome-wide analysis, we identified 74 full-length protein-coding MaDof genes unevenly distributed on 11 chromosomes. Phylogenetic analysis with Dof members from diverse plant species showed that MaDof genes can be classified into four subgroups (StDof I, II, III, and IV). The detailed genomic information of the MaDof gene homologs in the present study provides opportunities for functional analyses to unravel the exact role of the genes in plant growth and development.

  14. A piezoelectric six-DOF vibration energy harvester based on parallel mechanism: dynamic modeling, simulation, and experiment

    NASA Astrophysics Data System (ADS)

    Yuan, G.; Wang, D. H.

    2017-03-01

    Multi-directional and multi-degree-of-freedom (multi-DOF) vibration energy harvesting are attracting more and more research interest in recent years. In this paper, the principle of a piezoelectric six-DOF vibration energy harvester based on parallel mechanism is proposed to convert the energy of the six-DOF vibration to single-DOF vibrations of the limbs on the energy harvester and output voltages. The dynamic model of the piezoelectric six-DOF vibration energy harvester is established to estimate the vibrations of the limbs. On this basis, a Stewart-type piezoelectric six-DOF vibration energy harvester is developed and explored. In order to validate the established dynamic model and the analysis results, the simulation model of the Stewart-type piezoelectric six-DOF vibration energy harvester is built and tested with different vibration excitations by SimMechanics, and some preliminary experiments are carried out. The results show that the vibration of the limbs on the piezoelectric six-DOF vibration energy harvester can be estimated by the established dynamic model. The developed Stewart-type piezoelectric six-DOF vibration energy harvester can harvest the energy of multi-directional linear vibration and multi-axis rotating vibration with resonance frequencies of 17 Hz, 25 Hz, and 47 Hz. Moreover, the resonance frequencies of the developed piezoelectric six-DOF vibration energy harvester are not affected by the direction changing of the vibration excitation.

  15. Position calibration of a 3-DOF hand-controller with hybrid structure

    NASA Astrophysics Data System (ADS)

    Zhu, Chengcheng; Song, Aiguo

    2017-09-01

    A hand-controller is a human-robot interactive device, which measures the 3-DOF (Degree of Freedom) position of the human hand and sends it as a command to control robot movement. The device also receives 3-DOF force feedback from the robot and applies it to the human hand. Thus, the precision of 3-DOF position measurements is a key performance factor for hand-controllers. However, when using a hybrid type 3-DOF hand controller, various errors occur and are considered originating from machining and assembly variations within the device. This paper presents a calibration method to improve the position tracking accuracy of hybrid type hand-controllers by determining the actual size of the hand-controller parts. By re-measuring and re-calibrating this kind of hand-controller, the actual size of the key parts that cause errors is determined. Modifying the formula parameters with the actual sizes, which are obtained in the calibrating process, improves the end position tracking accuracy of the device.

  16. Development of biomimetic quadruped walking robot with 2-DOF waist joint

    NASA Astrophysics Data System (ADS)

    Kim, Kyoung-Ho; Park, Se-Hoon; Lee, Yun-Jung

    2005-12-01

    This paper presented a novel bio-mimetic quadruped walking robot with 2-DOF (Degree Of Freedom) waist joint, which connects the front and the rear parts of the body. The waist-jointed walking robot can guarantee more stable and more animal-like gait than that of a conventional single-rigid-body walking robot. The developed robot, called ELIRO-II (Eating LIzard RObot version 2), can bend its body from side to side by using 1-DOF passive waist joint while the legs is transferred, thereby increasing the stride and speed of the robot. In addition, ELIRO-II has one more active DOF to bend its body up and down, which increases the mobility in irregular terrain such as slope and stairs. We design the mechanical structure of the robot, which is small and light to have high mobility. This research described characteristics of the 2-DOF waists joint and leg mechanism as well as a hardware and software of the controller of ELIRO-II.

  17. Topology search of 3-DOF translational parallel manipulators with three identical limbs for leg mechanisms

    NASA Astrophysics Data System (ADS)

    Wang, Mingfeng; Ceccarelli, Marco

    2015-07-01

    Three-degree of freedom(3-DOF) translational parallel manipulators(TPMs) have been widely studied both in industry and academia in the past decades. However, most architectures of 3-DOF TPMs are created mainly on designers' intuition, empirical knowledge, or associative reasoning and the topology synthesis researches of 3-DOF TPMs are still limited. In order to find out the atlas of designs for 3-DOF TPMs, a topology search is presented for enumeration of 3-DOF TPMs whose limbs can be modeled as 5-DOF serial chains. The proposed topology search of 3-DOF TPMs is aimed to overcome the sensitivities of the design solution of a 3-DOF TPM for a LARM leg mechanism in a biped robot. The topology search, which is based on the concept of generation and specialization in graph theory, is reported as a step-by-step procedure with desired specifications, principle and rules of generalization, design requirements and constraints, and algorithm of number synthesis. In order to obtain new feasible designs for a chosen example and to limit the search domain under general considerations, one topological generalized kinematic chain is chosen to be specialized. An atlas of new feasible designs is obtained and analyzed for a specific solution as leg mechanisms. The proposed methodology provides a topology search for 3-DOF TPMs for leg mechanisms, but it can be also expanded for other applications and tasks.

  18. Motion control of 7-DOF arms - The configuration control approach

    NASA Technical Reports Server (NTRS)

    Seraji, Homayoun; Long, Mark K.; Lee, Thomas S.

    1993-01-01

    Graphics simulation and real-time implementation of configuration control schemes for a redundant 7-DOF Robotics Research arm are described. The arm kinematics and motion control schemes are described briefly. This is followed by a description of a graphics simulation environment for 7-DOF arm control on the Silicon Graphics IRIS Workstation. Computer simulation results are presented to demonstrate elbow control, collision avoidance, and optimal joint movement as redundancy resolution goals. The laboratory setup for experimental validation of motion control of the 7-DOF Robotics Research arm is then described. The configuration control approach is implemented on a Motorola-68020/VME-bus-based real-time controller, with elbow positioning for redundancy resolution. Experimental results demonstrate the efficacy of configuration control for real-time control.

  19. Members of the Dof transcription factor family in Triticum aestivum are associated with light-mediated gene regulation.

    PubMed

    Shaw, Lindsay M; McIntyre, C Lynne; Gresshoff, Peter M; Xue, Gang-Ping

    2009-11-01

    DNA binding with One Finger (Dof) protein is a plant-specific transcription factor implicated in the regulation of many important plant-specific processes, including photosynthesis and carbohydrate metabolism. This study has identified 31 Dof genes (TaDof) in bread wheat through extensive analysis of current nucleotide databases. Phylogenetic analysis suggests that the TaDof family can be divided into four clades. Expression analysis of the TaDof family across all major organs using quantitative RT-PCR and searches of the wheat genome array database revealed that the majority of TaDof members were predominately expressed in vegetative organs. A large number of TaDof members were down-regulated by drought and/or were responsive to the light and dark cycle. Further expression analysis revealed that light up-regulated TaDof members were highly correlated in expression with a number of genes that are involved in photosynthesis or sucrose transport. These data suggest that the TaDof family may have an important role in light-mediated gene regulation, including involvement in the photosynthetic process.

  20. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    PubMed

    Guo, Yong; Qiu, Li-Juan

    2013-01-01

    The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max). In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs) were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  1. Simulations of 6-DOF Motion with a Cartesian Method

    NASA Technical Reports Server (NTRS)

    Murman, Scott M.; Aftosmis, Michael J.; Berger, Marsha J.; Kwak, Dochan (Technical Monitor)

    2003-01-01

    Coupled 6-DOF/CFD trajectory predictions using an automated Cartesian method are demonstrated by simulating a GBU-32/JDAM store separating from an F-18C aircraft. Numerical simulations are performed at two Mach numbers near the sonic speed, and compared with flight-test telemetry and photographic-derived data. Simulation results obtained with a sequential-static series of flow solutions are contrasted with results using a time-dependent flow solver. Both numerical methods show good agreement with the flight-test data through the first half of the simulations. The sequential-static and time-dependent methods diverge over the last half of the trajectory prediction. after the store produces peak angular rates. A cost comparison for the Cartesian method is included, in terms of absolute cost and relative to computing uncoupled 6-DOF trajectories. A detailed description of the 6-DOF method, as well as a verification of its accuracy, is provided in an appendix.

  2. Design and implementation of a 2-DOF PID compensation for magnetic levitation systems.

    PubMed

    Ghosh, Arun; Rakesh Krishnan, T; Tejaswy, Pailla; Mandal, Abhisek; Pradhan, Jatin K; Ranasingh, Subhakant

    2014-07-01

    This paper employs a 2-DOF (degree of freedom) PID controller for compensating a physical magnetic levitation system. It is shown that because of having a feedforward gain in the proposed 2-DOF PID control, the transient performance of the compensated system can be changed in a desired manner unlike the conventional 1-DOF PID control. It is also shown that for a choice of PID parameters, although the theoretical loop robustness is the same for both the compensated systems, in real-time, 2-DOF PID control may provide superior robustness if a suitable choice of the feedforward parameter is made. The results are verified through simulations and experiments. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

  3. Modeling and controller design of a 6-DOF precision positioning system

    NASA Astrophysics Data System (ADS)

    Cai, Kunhai; Tian, Yanling; Liu, Xianping; Fatikow, Sergej; Wang, Fujun; Cui, Liangyu; Zhang, Dawei; Shirinzadeh, Bijan

    2018-05-01

    A key hurdle to meet the needs of micro/nano manipulation in some complex cases is the inadequate workspace and flexibility of the operation ends. This paper presents a 6-degree of freedom (DOF) serial-parallel precision positioning system, which consists of two compact type 3-DOF parallel mechanisms. Each parallel mechanism is driven by three piezoelectric actuators (PEAs), guided by three symmetric T-shape hinges and three elliptical flexible hinges, respectively. It can extend workspace and improve flexibility of the operation ends. The proposed system can be assembled easily, which will greatly reduce the assembly errors and improve the positioning accuracy. In addition, the kinematic and dynamic model of the 6-DOF system are established, respectively. Furthermore, in order to reduce the tracking error and improve the positioning accuracy, the Discrete-time Model Predictive Controller (DMPC) is applied as an effective control method. Meanwhile, the effectiveness of the DMCP control method is verified. Finally, the tracking experiment is performed to verify the tracking performances of the 6-DOF stage.

  4. Development of 6-DOF painting robot control system

    NASA Astrophysics Data System (ADS)

    Huang, Junbiao; Liu, Jianqun; Gao, Weiqiang

    2017-01-01

    With the development of society, the spraying technology of manufacturing industry in China has changed from the manual operation to the 6-DOF (Degree Of Freedom)robot automatic spraying. Spraying painting robot can not only complete the work which does harm to human being, but also improve the production efficiency and save labor costs. Control system is the most critical part of the 6-DOF robots, however, there is still a lack of relevant technology research in China. It is very necessary to study a kind of control system of 6-DOF spraying painting robots which is easy to operation, and has high efficiency and stable performance. With Googol controller platform, this paper develops programs based on Windows CE embedded systems to control the robot to finish the painting work. Software development is the core of the robot control system, including the direct teaching module, playback module, motion control module, setting module, man-machine interface, alarm module, log module, etc. All the development work of the entire software system has been completed, and it has been verified that the entire software works steady and efficient.

  5. An Evolutionarily Conserved DOF-CONSTANS Module Controls Plant Photoperiodic Signaling1[OPEN

    PubMed Central

    2015-01-01

    The response to daylength is a crucial process that evolved very early in plant evolution, entitling the early green eukaryote to predict seasonal variability and attune its physiological responses to the environment. The photoperiod responses evolved into the complex signaling pathways that govern the angiosperm floral transition today. The Chlamydomonas reinhardtii DNA-Binding with One Finger (CrDOF) gene controls transcription in a photoperiod-dependent manner, and its misexpression influences algal growth and viability. In short days, CrDOF enhances CrCO expression, a homolog of plant CONSTANS (CO), by direct binding to its promoter, while it reduces the expression of cell division genes in long days independently of CrCO. In Arabidopsis (Arabidopsis thaliana), transgenic plants overexpressing CrDOF show floral delay and reduced expression of the photoperiodic genes CO and FLOWERING LOCUS T. The conservation of the DOF-CO module during plant evolution could be an important clue to understanding diversification by the inheritance of conserved gene toolkits in key developmental programs. PMID:25897001

  6. Evolution analysis of Dof transcription factor family and their expression in response to multiple abiotic stresses in Malus domestica.

    PubMed

    Zhang, Zhengrong; Yuan, Li; Liu, Xin; Chen, Xuesen; Wang, Xiaoyun

    2018-01-10

    As a family of transcription factors, DNA binding with one figure (Dof) proteins play important roles in various biological processes in plants. Here, a total of 60 putative apple (Malus domestica) Dof genes (MdDof) were identified and mapped to different chromosomes. Chromosomal distribution and synteny analysis indicated that the expansion of the MdDof genes came primarily from segmental and duplication events, and from whole genome duplication, which lead to more Dof members in apples than in other plants. All 60 MdDof genes were classified into thirteen groups, according to multiple sequence alignment and the phylogenetic tree constructed of Dof genes from apple, peach (Prunus persica), Arabidopsis and rice. Within each group, the members shared a similar exon/intron and motif compositions, although the sizes of the MdDof genes and encoding proteins were quite different. Several Dof genes from the apple and peach were identified to be homologues based on their close synteny relationship, which suggested that these genes bear similar functions. Half of the MdDof genes were randomly selected to determine their responses to different stresses. The majority of MdDof genes were quite sensitive to PEG, NaCl, cold and exogenous ABA treatment. Our results suggested that MdDof family members may play important roles in plant tolerance to abiotic stress. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Incremental Validity of Test Session and Classroom Observations in a Multimethod Assessment of Attention Deficit/Hyperactivity Disorder

    ERIC Educational Resources Information Center

    McConaughy, Stephanie H.; Harder, Valerie S.; Antshel, Kevin M.; Gordon, Michael; Eiraldi, Ricardo; Dumenci, Levent

    2010-01-01

    This study tested the incremental validity of behavioral observations, over and above parent and teacher reports, for assessing symptoms of Attention Deficit/Hyperactivity Disorder (ADHD) in children ages 6 to 12, using the Test Observation Form (TOF) and Direct Observation Form (DOF) from the Achenbach System of Empirically Based Assessment. The…

  8. TH-EF-BRB-08: Robotic Motion Compensation for Radiation Therapy: A 6DOF Phantom Study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belcher, AH; Liu, X; Wiersma, R

    Purpose: The high accuracy of frame-based stereotactic radiosurgery (SRS), which uses a rigid frame fixed to the patient’s skull, is offset by potential drawbacks of poor patient compliance and clinical workflow restrictions. Recent research into frameless SRS has so far resulted in reduced accuracy. In this study, we investigate the use of a novel 6 degree-of-freedom (6DOF) robotic head motion cancellation system that continuously detects and compensates for patient head motions during a SRS delivery. This approach has the potential to reduce invasiveness while still achieving accuracies better or equal to traditional frame-based SRS. Methods: A 6DOF parallel kinematics roboticsmore » stage was constructed, and controlled using an inverse kinematics-based motion compensation algorithm. A 6DOF stereoscopic infrared (IR) marker tracking system was used to monitor real-time motions at sub-millimeter and sub-degree levels. A novel 6DOF calibration technique was first applied to properly orient the camera coordinate frame to match that of the LINAC and robotic control frames. Simulated head motions were measured by the system, and the robotic stage responded to these 6DOF motions automatically, returning the reflective marker coordinate frame to its original position. Results: After the motions were introduced to the system in the phantom-based study, the robotic stage automatically and rapidly returned the phantom to LINAC isocenter. When errors exceeded the compensation lower threshold of 0.25 mm or 0.25 degrees, the system registered the 6DOF error and generated a cancellation trajectory. The system responded in less than 0.5 seconds and returned all axes to less than 0.1 mm and 0.1 degree after the 6DOF compensation was performed. Conclusion: The 6DOF real-time motion cancellation system was found to be effective at compensating for translational and rotational motions to current SRS requirements. This system can improve frameless SRS by automatically returning

  9. 6DOF Testing of the SLS Inertial Navigation Unit

    NASA Technical Reports Server (NTRS)

    Geohagan, Kevin W.; Bernard, William P.; Oliver, T. Emerson; Strickland, Dennis J.; Leggett, Jared O.

    2018-01-01

    The Navigation System on the NASA Space Launch System (SLS) Block 1 vehicle performs initial alignment of the Inertial Navigation System (INS) navigation frame through gyrocompass alignment (GCA). In lieu of direct testing of GCA accuracy in support of requirement verification, the SLS Navigation Team proposed and conducted an engineering test to, among other things, validate the GCA performance and overall behavior of the SLS INS model through comparison with test data. This paper will detail dynamic hardware testing of the SLS INS, conducted by the SLS Navigation Team at Marshall Space Flight Center's 6DOF Table Facility, in support of GCA performance characterization and INS model validation. A 6-DOF motion platform was used to produce 6DOF pad twist and sway dynamics while a simulated SLS flight computer communicated with the INS. Tests conducted include an evaluation of GCA algorithm robustness to increasingly dynamic pad environments, an examination of GCA algorithm stability and accuracy over long durations, and a long-duration static test to gather enough data for Allan Variance analysis. Test setup, execution, and data analysis will be discussed, including analysis performed in support of SLS INS model validation.

  10. Database Driven 6-DOF Trajectory Simulation for Debris Transport Analysis

    NASA Technical Reports Server (NTRS)

    West, Jeff

    2008-01-01

    Debris mitigation and risk assessment have been carried out by NASA and its contractors supporting Space Shuttle Return-To-Flight (RTF). As a part of this assessment, analysis of transport potential for debris that may be liberated from the vehicle or from pad facilities prior to tower clear (Lift-Off Debris) is being performed by MSFC. This class of debris includes plume driven and wind driven sources for which lift as well as drag are critical for the determination of the debris trajectory. As a result, NASA MSFC has a need for a debris transport or trajectory simulation that supports the computation of lift effect in addition to drag without the computational expense of fully coupled CFD with 6-DOF. A database driven 6-DOF simulation that uses aerodynamic force and moment coefficients for the debris shape that are interpolated from a database has been developed to meet this need. The design, implementation, and verification of the database driven six degree of freedom (6-DOF) simulation addition to the Lift-Off Debris Transport Analysis (LODTA) software are discussed in this paper.

  11. Design and characterization of an ocean wave powered lifejacket using 2DOF floating boards

    NASA Astrophysics Data System (ADS)

    Mi, Jia; Xu, Lin; Yang, Yaling; Zuo, Lei

    2018-04-01

    Lifejacket is an indispensable life-saving equipment for ships and airplanes. Traditional lifejacket is designed to prevent human from drowning. However, the water temperature is usually low, especially in winter, which significantly reduces the human body temperature and leads to death. Meanwhile, power is critical for drowning people to use emergency communication equipment. This paper proposed an ocean wave powered lifejacket using 2DOF floating boards to provide both buoyance and electricity for drowning people. Hence, they can use this continuous electric power to keep key body warm and send distress signal. This lifejacket is featured with two 2DOF floating boards and the mechanical motion rectifier (MMR) can convert the 2-DOF motions to the unidirectional rotation of generator. The design principle is illustrated and the dynamic modelling for the 2-DOF motions has been analyzed. Bench test and lake test have been conducted to validate the design concept.

  12. Type synthesis for 4-DOF parallel press mechanism using GF set theory

    NASA Astrophysics Data System (ADS)

    He, Jun; Gao, Feng; Meng, Xiangdun; Guo, Weizhong

    2015-07-01

    Parallel mechanisms is used in the large capacity servo press to avoid the over-constraint of the traditional redundant actuation. Currently, the researches mainly focus on the performance analysis for some specific parallel press mechanisms. However, the type synthesis and evaluation of parallel press mechanisms is seldom studied, especially for the four degrees of freedom(DOF) press mechanisms. The type synthesis of 4-DOF parallel press mechanisms is carried out based on the generalized function(GF) set theory. Five design criteria of 4-DOF parallel press mechanisms are firstly proposed. The general procedure of type synthesis of parallel press mechanisms is obtained, which includes number synthesis, symmetrical synthesis of constraint GF sets, decomposition of motion GF sets and design of limbs. Nine combinations of constraint GF sets of 4-DOF parallel press mechanisms, ten combinations of GF sets of active limbs, and eleven combinations of GF sets of passive limbs are synthesized. Thirty-eight kinds of press mechanisms are presented and then different structures of kinematic limbs are designed. Finally, the geometrical constraint complexity( GCC), kinematic pair complexity( KPC), and type complexity( TC) are proposed to evaluate the press types and the optimal press type is achieved. The general methodologies of type synthesis and evaluation for parallel press mechanism are suggested.

  13. BATMAV: a 2-DOF bio-inspired flapping flight platform

    NASA Astrophysics Data System (ADS)

    Bunget, Gheorghe; Seelecke, Stefan

    2010-04-01

    Due to the availability of small sensors, Micro-Aerial Vehicles (MAVs) can be used for detection missions of biological, chemical and nuclear agents. Traditionally these devices used fixed or rotary wings, actuated with electric DC motortransmission, a system which brings the disadvantage of a heavier platform. The overall objective of the BATMAV project is to develop a biologically inspired bat-like MAV with flexible and foldable wings for flapping flight. This paper presents a flight platform that features bat-inspired wings which are able to actively fold their elbow joints. A previous analysis of the flight physics for small birds, bats and large insects, revealed that the mammalian flight anatomy represents a suitable flight platform that can be actuated efficiently using Shape Memory Alloy (SMA) artificial-muscles. A previous study of the flight styles in bats based on the data collected by Norberg [1] helped to identify the required joint angles as relevant degrees of freedom for wing actuation. Using the engineering theory of robotic manipulators, engineering kinematic models of wings with 2 and 3-DOFs were designed to mimic the wing trajectories of the natural flier Plecotus auritus. Solid models of the bat-like skeleton were designed based on the linear and angular dimensions resulted from the kinematic models. This structure of the flight platform was fabricated using rapid prototyping technologies and assembled to form a desktop prototype with 2-DOFs wings. Preliminary flapping test showed suitable trajectories for wrist and wingtip that mimic the flapping cycle of the natural flyer.

  14. Bilateral, Misalignment-Compensating, Full-DOF Hip Exoskeleton: Design and Kinematic Validation

    PubMed Central

    Degelaen, Marc; Lefeber, Nina; Swinnen, Eva; Vanderborght, Bram; Lefeber, Dirk

    2017-01-01

    A shared design goal for most robotic lower limb exoskeletons is to reduce the metabolic cost of locomotion for the user. Despite this, only a limited amount of devices was able to actually reduce user metabolic consumption. Preservation of the natural motion kinematics was defined as an important requirement for a device to be metabolically beneficial. This requires the inclusion of all human degrees of freedom (DOF) in a design, as well as perfect alignment of the rotation axes. As perfect alignment is impossible, compensation for misalignment effects should be provided. A misalignment compensation mechanism for a 3-DOF system is presented in this paper. It is validated by the implementation in a bilateral hip exoskeleton, resulting in a compact and lightweight device that can be donned fast and autonomously, with a minimum of required adaptations. Extensive testing of the prototype has shown that hip range of motion of the user is maintained while wearing the device and this for all three hip DOFs. This allowed the users to maintain their natural motion patterns when they are walking with the novel hip exoskeleton. PMID:28790799

  15. A 6DOF passive vibration isolator using X-shape supporting structures

    NASA Astrophysics Data System (ADS)

    Wu, Zhijing; Jing, Xingjian; Sun, Bo; Li, Fengming

    2016-10-01

    A novel 6 degree of freedom (6-DOF) passive vibration isolator is studied theoretically and validated with experiments. Based on the Stewart platform configuration, the 6-DOF isolator is constructed by 6 X-shape structures as legs, which can realize very good and tunable vibration isolation performance in all 6 directions with a passive manner. The mechanic model is established for static analysis of the working range, static stiffness and loading capacity. Thereafter, the equation of motion of the isolator is derived with the Hamilton principle. The equivalent stiffness and the displacement transmissibility in the six decoupled DOFs direction are then discussed with experimental results for validation. The results reveal that (a) by designing the structure parameters, the system can possess flexible stiffness such as negative, quasi-zero and positive stiffness, (b) due to the combination of the Stewart platform and the X-shape structure, the system can have very good vibration isolation performance in all the 6 directions and in a passive manner, and (c) compared with the simplified linear-stiffness legs, the nonlinearity of the X-shape structures enhance the passive isolator to have much better vibration isolation performance.

  16. Drosophila Heartless Acts with Heartbroken/Dof in Muscle Founder Differentiation

    PubMed Central

    Dutta, Devkanya; Shaw, Sanjeev; Maqbool, Tariq; Pandya, Hetal

    2005-01-01

    The formation of a multi-nucleate myofibre is directed, in Drosophila, by a founder cell. In the embryo, founders are selected by Notch-mediated lateral inhibition, while during adult myogenesis this mechanism of selection does not appear to operate. We show, in the muscles of the adult abdomen, that the Fibroblast growth factor pathway mediates founder cell choice in a novel manner. We suggest that the developmental patterns of Heartbroken/Dof and Sprouty result in defining the domain and timing of activation of the Fibroblast growth factor receptor Heartless in specific myoblasts, thereby converting them into founder cells. Our results point to a way in which muscle differentiation could be initiated and define a critical developmental function for Heartbroken/Dof in myogenesis. PMID:16207075

  17. Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development.

    PubMed

    da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

    2016-01-01

    The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.

  18. Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development

    PubMed Central

    da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

    2016-01-01

    The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir. PMID:27610237

  19. A novel approach to the design of a needle driver with multiple DOFs for pediatric laparoscopic surgery.

    PubMed

    Fujii, Masahiro; Sugita, Naohiko; Ishimaru, Tetsuya; Iwanaka, Tadashi; Mitsuishi, Mamoru

    2013-02-01

    The objective of our research was to design and develop a novel needle driver with multiple degrees of freedom (DOFs) for pediatric laparoscopic surgery. Pediatric laparoscopic surgery has many advantages for patients, but the difficulty of the operation is increased due to many restrictions. For example, the motion of the needle driver is restricted by the insertion points, and the operation workspace is smaller in children than in adults. A needle driver with 3 DOFs and a 3.5-mm diameter is proposed and implemented in this study. Grasping DOF is achieved using a piston mechanism actuated by a wire. Deflection and rotation DOFs are actuated by gears. Experiments were conducted to evaluate the workspace and ligation force, and the results confirmed that the needle driver meets all the necessary requirements. Finally, a first reaction of a pediatric surgeon on the suturing and ligaturing capabilities of the prototype is reported. A multi-DOF needle driver with a new mechanism was proposed for pediatric laparoscopic surgery and a first prototype was developed. It is expected that further elaboration of the developed first prototype of the needle driver may contribute to the advancement of pediatric laparoscopic surgery.

  20. Synchronized motion control and precision positioning compensation of a 3-DOFs macro-micro parallel manipulator fully actuated by piezoelectric actuators

    NASA Astrophysics Data System (ADS)

    Zhang, Quan; Li, Chaodong; Zhang, Jiantao; Zhang, Xu

    2017-11-01

    The macro-micro combined approach, as an effective way to realize trans-scale nano-precision positioning with multi-dimensions and high velocity, plays a significant role in integrated circuit manufacturing field. A 3-degree-of-freedoms (3-DOFs) macro-micro manipulator is designed and analyzed to compromise the conflictions among the large stroke, high precision and multi-DOFs. The macro manipulator is a 3-Prismatic-Revolute-Revolute (3-PRR) structure parallel manipulator which is driven by three linear ultrasonic motors. The dynamic model and the cross-coupling error based synchronized motion controller of the 3-PRR parallel manipulator are theoretical analyzed and experimental tested. To further improve the positioning accuracy, a 3-DOFs monolithic compliant manipulator actuated by three piezoelectric stack actuators is designed. Then a multilayer BP neural network based inverse kinematic model identifier is developed to perform the positioning control. Finally, by forming the macro-micro structure, the dual stage manipulator successfully achieved the positioning task from the point (2 mm, 2 mm, 0 rad) back to the original point (0 mm, 0 mm, 0 rad) with the translation errors in X and Y directions less than ±50 nm and the rotation error around Z axis less than ±1 μrad, respectively.

  1. Thermal Actuation Based 3-DoF Non-Resonant Microgyroscope Using MetalMUMPs

    PubMed Central

    Shakoor, Rana Iqtidar; Bazaz, Shafaat Ahmed; Kraft, Michael; Lai, Yongjun; Masood ul Hassan, Muhammad

    2009-01-01

    High force, large displacement and low voltage consumption are a primary concern for microgyroscopes. The chevron-shaped thermal actuators are unique in terms of high force generation combined with the large displacements at a low operating voltage in comparison with traditional electrostatic actuators. A Nickel based 3-DoF micromachined gyroscope comprising 2-DoF drive mode and 1-DoF sense mode oscillator utilizing the chevron-shaped thermal actuators is presented here. Analytical derivations and finite element simulations are carried out to predict the performance of the proposed device using the thermo-physical properties of electroplated nickel. The device sensitivity is improved by utilizing the dynamical amplification of the oscillation in 2-DoF drive mode using an active-passive mass configuration. A comprehensive theoretical description, dynamics and mechanical design considerations of the proposed gyroscopes model are discussed in detail. Parametric optimization of gyroscope, its prototype modeling and fabrication using MetalMUMPs has also been investigated. Dynamic transient simulation results predicted that the sense mass of the proposed device achieved a drive displacement of 4.1μm when a sinusoidal voltage of 0.5V is applied at 1.77 kHz exhibiting a mechanical sensitivity of 1.7μm /°/s in vacuum. The wide bandwidth frequency response of the 2-DoF drive mode oscillator consists of two resonant peaks and a flat region of 2.11 kHz between the peaks defining the operational frequency region. The sense mode resonant frequency can lie anywhere within this region and therefore the amplitude of the response is insensitive to structural parameter variations, enhancing device robustness against such variations. The proposed device has a size of 2.2 × 2.6 mm2, almost one third in comparison with existing M-DoF vibratory gyroscope with an estimated power consumption of 0.26 Watts. These predicted results illustrate that the chevron-shaped thermal actuator has

  2. Frequency Response Function Expansion for Unmeasured Translation and Rotation Dofs for Impedance Modelling Applications

    NASA Astrophysics Data System (ADS)

    Avitabile, P.; O'Callahan, J.

    2003-07-01

    Inclusion of rotational effects is critical for the accuracy of the predicted system characteristics, in almost all system modelling studies. However, experimentally derived information for the description of one or more of the components for the system will generally not have any rotational effects included in the description of the component. The lack of rotational effects has long affected the results from any system model development whether using a modal-based approach or an impedance-based approach. Several new expansion processes are described herein for the development of FRFs needed for impedance-based system models. These techniques expand experimentally derived mode shapes, residual modes from the modal parameter estimation process and FRFs directly to allow for the inclusion of the necessary rotational dof. The FRFs involving translational to rotational dofs are developed as well as the rotational to rotational dof. Examples are provided to show the use of these techniques.

  3. Modeling and simulation of a 2-DOF bidirectional electrothermal microactuator

    NASA Astrophysics Data System (ADS)

    Topaloglu, N.; Elbuken, C.; Nieva, P. M.; Yavuz, M.; Huissoon, J. P.

    2008-03-01

    In this paper we present the modeling and simulation of a 2 degree-of-freedom (DOF) bidirectional electrothermal actuator. The four arm microactuator was designed to move in both the horizontal and vertical axes. By tailoring the geometrical parameters of the design, the in-plane and out-of-plane motions were decoupled, resulting in enhanced mobility in both directions. The motion of the actuator was modeled analytically using an electro-thermo-mechanical analysis. To validate the analytical model, finite element simulations were performed using ANSYS. The microactuators were fabricated using PolyMUMPS process and experimental results show good agreement with both the analytical model and the simulations. We demonstrated that the 2-DOF bidirectional electrothermal actuator can achieve 3.7 μm in-plane and 13.3 μm out-of-plane deflections with an input voltage of 10 V.

  4. Digital compensation techniques for the effects of time lag in closed-loop simulation using the 6 DOF motion system

    NASA Technical Reports Server (NTRS)

    Brown, R.

    1982-01-01

    Efforts are continued to develop digital filter compensation schemes for the correction of momentum gains observed in the closed loop simulation of the docking of two satellites using the 6 DOF motion system. Several filters that work well for small delays ( .100ms) and a non-preloaded probe are discussed.

  5. 6DOF Testing of the SLS Inertial Navigation Unit

    NASA Technical Reports Server (NTRS)

    Geohagan, Kevin; Bernard, Bill; Oliver, T. Emerson; Leggett, Jared; Strickland, Dennis

    2018-01-01

    The Navigation System on the NASA Space Launch System (SLS) Block 1 vehicle performs initial alignment of the Inertial Navigation System (INS) navigation frame through gyrocompass alignment (GCA). Because the navigation architecture for the SLS Block 1 vehicle is a purely inertial system, the accuracy of the achieved orbit relative to mission requirements is very sensitive to initial alignment accuracy. The assessment of this sensitivity and many others via simulation is a part of the SLS Model-Based Design and Model-Based Requirements approach. As a part of the aforementioned, 6DOF Monte Carlo simulation is used in large part to develop and demonstrate verification of program requirements. To facilitate this and the GN&C flight software design process, an SLS-Program-controlled Design Math Model (DMM) of the SLS INS was developed by the SLS Navigation Team. The SLS INS model implements all of the key functions of the hardware-namely, GCA, inertial navigation, and FDIR (Fault Detection, Isolation, and Recovery)-in support of SLS GN&C design requirements verification. Despite the strong sensitivity to initial alignment, GCA accuracy requirements were not verified by test due to program cost and schedule constraints. Instead, the system relies upon assessments performed using the SLS INS model. In order to verify SLS program requirements by analysis, the SLS INS model is verified and validated against flight hardware. In lieu of direct testing of GCA accuracy in support of requirement verification, the SLS Navigation Team proposed and conducted an engineering test to, among other things, validate the GCA performance and overall behavior of the SLS INS model through comparison with test data. This paper will detail dynamic hardware testing of the SLS INS, conducted by the SLS Navigation Team at Marshall Space Flight Center's 6DOF Table Facility, in support of GCA performance characterization and INS model validation. A 6-DOF motion platform was used to produce 6DOF

  6. Fast 5DOF needle tracking in iOCT.

    PubMed

    Weiss, Jakob; Rieke, Nicola; Nasseri, Mohammad Ali; Maier, Mathias; Eslami, Abouzar; Navab, Nassir

    2018-06-01

    Intraoperative optical coherence tomography (iOCT) is an increasingly available imaging technique for ophthalmic microsurgery that provides high-resolution cross-sectional information of the surgical scene. We propose to build on its desirable qualities and present a method for tracking the orientation and location of a surgical needle. Thereby, we enable the direct analysis of instrument-tissue interaction directly in OCT space without complex multimodal calibration that would be required with traditional instrument tracking methods. The intersection of the needle with the iOCT scan is detected by a peculiar multistep ellipse fitting that takes advantage of the directionality of the modality. The geometric modeling allows us to use the ellipse parameters and provide them into a latency-aware estimator to infer the 5DOF pose during needle movement. Experiments on phantom data and ex vivo porcine eyes indicate that the algorithm retains angular precision especially during lateral needle movement and provides a more robust and consistent estimation than baseline methods. Using solely cross-sectional iOCT information, we are able to successfully and robustly estimate a 5DOF pose of the instrument in less than 5.4 ms on a CPU.

  7. Spacsuit donning and doffing in zero-g training for Story Musgrave STS-6

    NASA Image and Video Library

    1982-07-14

    S82-33603 (November 1982) --- Astronaut F. Story Musgrave, STS-6 mission specialist, is assisted in a suit donning and doffing exercise in the weightlessness provided by a KC-135 ?zero-gravity? aircraft. Dr. Musgrave and the next mission?s other mission specialist, astronaut Donald H. Peterson, participated in the donning and doffing as a simulation for their preparations aboard the Challenger when they are called upon to perform an extravehicular activity (EVA) which was postponed from NASA?s first operational STS flight earlier this month. The suit is called an Extravehicular Mobility Unit (EMU). Photo credit: NASA

  8. Statistical Sensor Fusion of a 9-DOF Mems Imu for Indoor Navigation

    NASA Astrophysics Data System (ADS)

    Chow, J. C. K.

    2017-09-01

    Sensor fusion of a MEMS IMU with a magnetometer is a popular system design, because such 9-DoF (degrees of freedom) systems are capable of achieving drift-free 3D orientation tracking. However, these systems are often vulnerable to ambient magnetic distortions and lack useful position information; in the absence of external position aiding (e.g. satellite/ultra-wideband positioning systems) the dead-reckoned position accuracy from a 9-DoF MEMS IMU deteriorates rapidly due to unmodelled errors. Positioning information is valuable in many satellite-denied geomatics applications (e.g. indoor navigation, location-based services, etc.). This paper proposes an improved 9-DoF IMU indoor pose tracking method using batch optimization. By adopting a robust in-situ user self-calibration approach to model the systematic errors of the accelerometer, gyroscope, and magnetometer simultaneously in a tightly-coupled post-processed least-squares framework, the accuracy of the estimated trajectory from a 9-DoF MEMS IMU can be improved. Through a combination of relative magnetic measurement updates and a robust weight function, the method is able to tolerate a high level of magnetic distortions. The proposed auto-calibration method was tested in-use under various heterogeneous magnetic field conditions to mimic a person walking with the sensor in their pocket, a person checking their phone, and a person walking with a smartwatch. In these experiments, the presented algorithm improved the in-situ dead-reckoning orientation accuracy by 79.8-89.5 % and the dead-reckoned positioning accuracy by 72.9-92.8 %, thus reducing the relative positioning error from metre-level to decimetre-level after ten seconds of integration, without making assumptions about the user's dynamics.

  9. Stability analysis of a time-periodic 2-dof MEMS structure

    NASA Astrophysics Data System (ADS)

    Kniffka, Till Jochen; Welte, Johannes; Ecker, Horst

    2012-11-01

    . Continuation analysis including stability evaluations are executed and show the frequency ranges for which the 2-dof system becomes unstable due to parametric resonances. Moreover, the existence of frequency intervals are shown where enhanced damping for the system is observed for this MEMS. The results from the stability studies are confirmed by simulation results.

  10. The Impact of Environmental Design on Doffing Personal Protective Equipment in a Healthcare Environment: A Formative Human Factors Trial.

    PubMed

    Herlihey, Tracey A; Gelmi, Stefano; Cafazzo, Joseph A; Hall, Trevor N T

    2017-06-01

    OBJECTIVE To explore the impact of environmental design on doffing personal protective equipment in a simulated healthcare environment. METHODS A mixed-methods approach was used that included human-factors usability testing and qualitative questionnaire responses. A patient room and connecting anteroom were constructed for testing purposes. This experimental doffing area was designed to overcome the environmental failures identified in a previous study and was not constructed based on any generalizable hospital standard. RESULTS In total, 72 healthcare workers from Ontario, Canada, took part in the study and tested the simulated doffing area. The following environmental design changes were tested and were deemed effective: increasing prominence of color-coded zones; securing disinfectant wipes and hand sanitizer; outlining disposal bins locations; providing mirrors to detect possible contamination; providing hand rails to assist with doffing; and restricting the space to doff. Further experimentation and iterative design are required with regard to several important features: positioning the disposal bins for safety, decreasing the risk of contamination and user accessibility; optimal positioning of mirrors for safety; communication within the team; and positioning the secondary team member for optimal awareness. Additional design suggestions also emerged during this study, and they require future investigation. CONCLUSIONS This study highlights the importance of the environment on doffing personal protective equipment in a healthcare setting. Iterative testing and modification of the design of the environment (doffing area) are important to enhancing healthcare worker safety. Infect Control Hosp Epidemiol 2017;38:712-717.

  11. Direct adaptive robust tracking control for 6 DOF industrial robot with enhanced accuracy.

    PubMed

    Yin, Xiuxing; Pan, Li

    2018-01-01

    A direct adaptive robust tracking control is proposed for trajectory tracking of 6 DOF industrial robot in the presence of parametric uncertainties, external disturbances and uncertain nonlinearities. The controller is designed based on the dynamic characteristics in the working space of the end-effector of the 6 DOF robot. The controller includes robust control term and model compensation term that is developed directly based on the input reference or desired motion trajectory. A projection-type parametric adaptation law is also designed to compensate for parametric estimation errors for the adaptive robust control. The feasibility and effectiveness of the proposed direct adaptive robust control law and the associated projection-type parametric adaptation law have been comparatively evaluated based on two 6 DOF industrial robots. The test results demonstrate that the proposed control can be employed to better maintain the desired trajectory tracking even in the presence of large parametric uncertainties and external disturbances as compared with PD controller and nonlinear controller. The parametric estimates also eventually converge to the real values along with the convergence of tracking errors, which further validate the effectiveness of the proposed parametric adaption law. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

  12. MEMS 3-DoF gyroscope design, modeling and simulation through equivalent circuit lumped parameter model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mian, Muhammad Umer, E-mail: umermian@gmail.com; Khir, M. H. Md.; Tang, T. B.

    Pre-fabrication, behavioural and performance analysis with computer aided design (CAD) tools is a common and fabrication cost effective practice. In light of this we present a simulation methodology for a dual-mass oscillator based 3 Degree of Freedom (3-DoF) MEMS gyroscope. 3-DoF Gyroscope is modeled through lumped parameter models using equivalent circuit elements. These equivalent circuits consist of elementary components which are counterpart of their respective mechanical components, used to design and fabricate 3-DoF MEMS gyroscope. Complete designing of equivalent circuit model, mathematical modeling and simulation are being presented in this paper. Behaviors of the equivalent lumped models derived for themore » proposed device design are simulated in MEMSPRO T-SPICE software. Simulations are carried out with the design specifications following design rules of the MetalMUMPS fabrication process. Drive mass resonant frequencies simulated by this technique are 1.59 kHz and 2.05 kHz respectively, which are close to the resonant frequencies found by the analytical formulation of the gyroscope. The lumped equivalent circuit modeling technique proved to be a time efficient modeling technique for the analysis of complex MEMS devices like 3-DoF gyroscopes. The technique proves to be an alternative approach to the complex and time consuming couple field analysis Finite Element Analysis (FEA) previously used.« less

  13. Development of an Underactuated 2-DOF Wrist Joint using McKibben PAMs

    NASA Astrophysics Data System (ADS)

    Rajagopal, S. P.; Jain, S.; Ramasubramanian, S. N.; Johnson, B. V.; Dwivedy, S. K.

    2014-10-01

    In this work, model of an underactuated 2-DOF wrist joint with pneumatically actuated muscles is proposed. For the joint, McKibben-type artificial muscles are used in parallel configuration for the actuation. For each Degree of Freedom (DOF) one agonist-antagonist pair arrangement is usually used with a pulley mechanism. A mathematical model of wrist joint is derived using conventional forward kinematic analysis. The static model relating pressure in the muscle with the orientation of the wrist joint is obtained by combining the experimental data and mathematical model. Regulation of pressure can be achieved by pulse width modulation control of on/off solenoid valves. A set of free vibration experiments are done for the dynamic identification of the muscle characteristics.

  14. 24 DOF EMG controlled hybrid actuated prosthetic hand.

    PubMed

    Atasoy, A; Kaya, E; Toptas, E; Kuchimov, S; Kaplanoglu, E; Ozkan, M

    2016-08-01

    A complete mechanical design concept of an electromyogram (EMG) controlled hybrid prosthetic hand, with 24 degree of freedom (DOF) anthropomorphic structure is presented. Brushless DC motors along with Shape Memory Alloy (SMA) actuators are used to achieve dexterous functionality. An 8 channel EMG is used for detecting 7 basic hand gestures for control purposes. The prosthetic hand will be integrated with the Neural Network (NNE) based controller in the next phase of the study.

  15. Overexpression of a pine Dof transcription factor in hybrid poplars: A comparative study in trees growing under controlled and natural conditions.

    PubMed

    Rueda-López, Marina; Pascual, María Belén; Pallero, Mercedes; Henao, Luisa María; Lasa, Berta; Jauregui, Ivan; Aparicio-Tejo, Pedro M; Cánovas, Francisco M; Ávila, Concepción

    2017-01-01

    In this work, the role of the pine transcriptional regulator Dof 5 in carbon and nitrogen metabolism has been examined in poplar trees. The overexpression of the gene and potential effects on growth and biomass production were compared between trees growing in a growth chamber under controlled conditions and trees growing in a field trial during two growth seasons. Ten-week-old transgenic poplars exhibited higher growth than untransformed controls and exhibited enhanced capacity for inorganic nitrogen uptake in the form of nitrate. Furthermore, the transgenic trees accumulated significantly more carbohydrates such as glucose, fructose, sucrose and starch. Lignin content increased in the basal part of the stem likely due to the thicker stem of the transformed plants. The enhanced levels of lignin were correlated with higher expression of the PAL1 and GS1.3 genes, which encode key enzymes involved in the phenylalanine deamination required for lignin biosynthesis. However, the results in the field trial experiment diverged from those observed in the chamber system. The lines overexpressing PpDof5 showed attenuated growth during the two growing seasons and no modification of carbon or nitrogen metabolism. These results were not associated with a decrease in the expression of the transgene, but they can be ascribed to the nitrogen available in the field soil compared to that available for growth under controlled conditions. This work highlights the paramount importance of testing transgenic lines in field trials.

  16. Overexpression of a pine Dof transcription factor in hybrid poplars: A comparative study in trees growing under controlled and natural conditions

    PubMed Central

    Rueda-López, Marina; Pascual, María Belén; Pallero, Mercedes; Henao, Luisa María; Lasa, Berta; Jauregui, Ivan; Aparicio-Tejo, Pedro M.; Cánovas, Francisco M.

    2017-01-01

    In this work, the role of the pine transcriptional regulator Dof 5 in carbon and nitrogen metabolism has been examined in poplar trees. The overexpression of the gene and potential effects on growth and biomass production were compared between trees growing in a growth chamber under controlled conditions and trees growing in a field trial during two growth seasons. Ten-week-old transgenic poplars exhibited higher growth than untransformed controls and exhibited enhanced capacity for inorganic nitrogen uptake in the form of nitrate. Furthermore, the transgenic trees accumulated significantly more carbohydrates such as glucose, fructose, sucrose and starch. Lignin content increased in the basal part of the stem likely due to the thicker stem of the transformed plants. The enhanced levels of lignin were correlated with higher expression of the PAL1 and GS1.3 genes, which encode key enzymes involved in the phenylalanine deamination required for lignin biosynthesis. However, the results in the field trial experiment diverged from those observed in the chamber system. The lines overexpressing PpDof5 showed attenuated growth during the two growing seasons and no modification of carbon or nitrogen metabolism. These results were not associated with a decrease in the expression of the transgene, but they can be ascribed to the nitrogen available in the field soil compared to that available for growth under controlled conditions. This work highlights the paramount importance of testing transgenic lines in field trials. PMID:28376100

  17. Development of a simple system for simultaneously measuring 6DOF geometric motion errors of a linear guide.

    PubMed

    Qibo, Feng; Bin, Zhang; Cunxing, Cui; Cuifang, Kuang; Yusheng, Zhai; Fenglin, You

    2013-11-04

    A simple method for simultaneously measuring the 6DOF geometric motion errors of the linear guide was proposed. The mechanisms for measuring straightness and angular errors and for enhancing their resolution are described in detail. A common-path method for measuring the laser beam drift was proposed and it was used to compensate the errors produced by the laser beam drift in the 6DOF geometric error measurements. A compact 6DOF system was built. Calibration experiments with certain standard measurement meters showed that our system has a standard deviation of 0.5 µm in a range of ± 100 µm for the straightness measurements, and standard deviations of 0.5", 0.5", and 1.0" in the range of ± 100" for pitch, yaw, and roll measurements, respectively.

  18. The JPL Serpentine Robot: A 12 DOF System for Inspection

    NASA Technical Reports Server (NTRS)

    Paljug, E.; Ohm, T.; Hayati, S.

    1995-01-01

    The Serpentine Robot is a prototype hyper-redundant (snake-like) manipulator system developed at the Jet Propulsion Laboratory. It is designed to navigate and perform tasks in obstructed and constrained environments in which conventional 6 DOF manipulators cannot function. Described are the robot mechanical design, a joint assembly low level inverse kinematic algorithm, control development, and applications.

  19. Towards frameless maskless SRS through real-time 6DoF robotic motion compensation

    NASA Astrophysics Data System (ADS)

    Belcher, Andrew H.; Liu, Xinmin; Chmura, Steven; Yenice, Kamil; Wiersma, Rodney D.

    2017-12-01

    Stereotactic radiosurgery (SRS) uses precise dose placement to treat conditions of the CNS. Frame-based SRS uses a metal head ring fixed to the patient’s skull to provide high treatment accuracy, but patient comfort and clinical workflow may suffer. Frameless SRS, while potentially more convenient, may increase uncertainty of treatment accuracy and be physiologically confining to some patients. By incorporating highly precise robotics and advanced software algorithms into frameless treatments, we present a novel frameless and maskless SRS system where a robot provides real-time 6DoF head motion stabilization allowing positional accuracies to match or exceed those of traditional frame-based SRS. A 6DoF parallel kinematics robot was developed and integrated with a real-time infrared camera in a closed loop configuration. A novel compensation algorithm was developed based on an iterative closest-path correction approach. The robotic SRS system was tested on six volunteers, whose motion was monitored and compensated for in real-time over 15 min simulated treatments. The system’s effectiveness in maintaining the target’s 6DoF position within preset thresholds was determined by comparing volunteer head motion with and without compensation. Comparing corrected and uncorrected motion, the 6DoF robotic system showed an overall improvement factor of 21 in terms of maintaining target position within 0.5 mm and 0.5 degree thresholds. Although the system’s effectiveness varied among the volunteers examined, for all volunteers tested the target position remained within the preset tolerances 99.0% of the time when robotic stabilization was used, compared to 4.7% without robotic stabilization. The pre-clinical robotic SRS compensation system was found to be effective at responding to sub-millimeter and sub-degree cranial motions for all volunteers examined. The system’s success with volunteers has demonstrated its capability for implementation with frameless and

  20. Towards frameless maskless SRS through real-time 6DoF robotic motion compensation.

    PubMed

    Belcher, Andrew H; Liu, Xinmin; Chmura, Steven; Yenice, Kamil; Wiersma, Rodney D

    2017-11-13

    Stereotactic radiosurgery (SRS) uses precise dose placement to treat conditions of the CNS. Frame-based SRS uses a metal head ring fixed to the patient's skull to provide high treatment accuracy, but patient comfort and clinical workflow may suffer. Frameless SRS, while potentially more convenient, may increase uncertainty of treatment accuracy and be physiologically confining to some patients. By incorporating highly precise robotics and advanced software algorithms into frameless treatments, we present a novel frameless and maskless SRS system where a robot provides real-time 6DoF head motion stabilization allowing positional accuracies to match or exceed those of traditional frame-based SRS. A 6DoF parallel kinematics robot was developed and integrated with a real-time infrared camera in a closed loop configuration. A novel compensation algorithm was developed based on an iterative closest-path correction approach. The robotic SRS system was tested on six volunteers, whose motion was monitored and compensated for in real-time over 15 min simulated treatments. The system's effectiveness in maintaining the target's 6DoF position within preset thresholds was determined by comparing volunteer head motion with and without compensation. Comparing corrected and uncorrected motion, the 6DoF robotic system showed an overall improvement factor of 21 in terms of maintaining target position within 0.5 mm and 0.5 degree thresholds. Although the system's effectiveness varied among the volunteers examined, for all volunteers tested the target position remained within the preset tolerances 99.0% of the time when robotic stabilization was used, compared to 4.7% without robotic stabilization. The pre-clinical robotic SRS compensation system was found to be effective at responding to sub-millimeter and sub-degree cranial motions for all volunteers examined. The system's success with volunteers has demonstrated its capability for implementation with frameless and maskless SRS

  1. Compliance analysis of a 3-DOF spindle head by considering gravitational effects

    NASA Astrophysics Data System (ADS)

    Li, Qi; Wang, Manxin; Huang, Tian; Chetwynd, Derek G.

    2015-01-01

    The compliance modeling is one of the most significant issues in the stage of preliminary design for parallel kinematic machine(PKM). The gravity ignored in traditional compliance analysis has a significant effect on pose accuracy of tool center point(TCP) when a PKM is horizontally placed. By taking gravity into account, this paper presents a semi-analytical approach for compliance analysis of a 3-DOF spindle head named the A3 head. The architecture behind the A3 head is a 3-R PS parallel mechanism having one translational and two rotational movement capabilities, which can be employed to form the main body of a 5-DOF hybrid kinematic machine especially designed for high-speed machining of large aircraft components. The force analysis is carried out by considering both the externally applied wrench imposed upon the platform as well as gravity of all moving components. Then, the deflection analysis is investigated to establish the relationship between the deflection twist and compliances of all joints and links using semi-analytical method. The merits of this approach lie in that platform deflection twist throughout the entire task workspace can be evaluated in a very efficient manner. The effectiveness of the proposed approach is verified by the FEA and experiment at different configurations and the results show that the discrepancy of the compliances is less than 0.04 μm/N-1 and that of the deformations is less than 10μm. The computational and experimental results show that the deflection twist induced by gravity forces of the moving components has significant bearings on pose accuracy of the platform, providing an informative guidance for the improvement of the current design. The proposed approach can be easily applied to the compliance analysis of PKM by considering gravitational effects and to evaluate the deformation caused by gravity throughout the entire workspace.

  2. Nonlinear dynamics and health monitoring of 6-DOF breathing cracked Jeffcott rotor

    NASA Astrophysics Data System (ADS)

    Zhao, Jie; DeSmidt, Hans; Yao, Wei

    2015-04-01

    Jeffcott rotor is employed to study the nonlinear vibration characteristics of breathing cracked rotor system and explore the possibility of further damage identification. This paper is an extension work of prior study based on 4 degree-of-freedom Jeffcott rotor system. With consideration of disk tilting and gyroscopic effect, 6-dof EOM is derived and the crack model is established using SERR (strain energy release rate) in facture mechanics. Same as the prior work, the damaged stiffness matrix is updated by computing the instant crack closure line through Zero Stress Intensity Factor method. The breathing crack area is taken as a variable to analyze the breathing behavior in terms of eccentricity phase and shaft speed. Furthermore, the coupled vibration among lateral, torsional and longitudinal d.o.f is studied under torsional/axial excitation. The final part demonstrates the possibility of using vibration signal of damaged system for the crack diagnosis and health monitoring.

  3. Hand rehabilitation after stroke using a wearable, high DOF, spring powered exoskeleton.

    PubMed

    Tianyao Chen; Lum, Peter S

    2016-08-01

    Stroke patients often have inappropriate finger flexor activation and finger extensor weakness, which makes it difficult to open their affected hand for functional grasp. The goal was to develop a passive, lightweight, wearable device to enable improved hand function during performance of activities of daily living. The device, HandSOME II, assists with opening the patient's hand using 11 elastic actuators that apply extension torques to finger and thumb joints. Device design and initial testing are described. A novel mechanical design applies forces orthogonal to the finger segments despite the fact that all of the device DOFs are not aligned with human joint DOF. In initial testing with seven stroke subjects with impaired hand function, use of HandSOME II significantly increased maximum extension angles and range of motion in all of the index finger joints (P<;0.05). HandSOME II allows performance of all the grip patterns used in daily activities and can be used as part of home-based therapy programs.

  4. Activation of a development-specific gene, dofA, by FruA, an essential transcription factor for development of Myxococcus xanthus.

    PubMed

    Ueki, Toshiyuki; Inouye, Sumiko

    2005-12-01

    FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

  5. Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus

    PubMed Central

    Ueki, Toshiyuki; Inouye, Sumiko

    2005-01-01

    FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development. PMID:16321956

  6. Adaptive control of 5 DOF upper-limb exoskeleton robot with improved safety.

    PubMed

    Kang, Hao-Bo; Wang, Jian-Hui

    2013-11-01

    This paper studies an adaptive control strategy for a class of 5 DOF upper-limb exoskeleton robot with a special safety consideration. The safety requirement plays a critical role in the clinical treatment when assisting patients with shoulder, elbow and wrist joint movements. With the objective of assuring the tracking performance of the pre-specified operations, the proposed adaptive controller is firstly designed to be robust to the model uncertainties. To further improve the safety and fault-tolerance in the presence of unknown large parameter variances or even actuator faults, the adaptive controller is on-line updated according to the information provided by an adaptive observer without additional sensors. An output tracking performance is well achieved with a tunable error bound. The experimental example also verifies the effectiveness of the proposed control scheme. © 2013 ISA. Published by ISA. All rights reserved.

  7. Design of a 7-DOF slave robot integrated with a magneto-rheological haptic master

    NASA Astrophysics Data System (ADS)

    Hwang, Yong-Hoon; Cha, Seung-Woo; Kang, Seok-Rae; Choi, Seung-Bok

    2017-04-01

    In this study, a 7-DOF slave robot integrated with the haptic master is designed and its dynamic motion is controlled. The haptic master is made using a controllable magneto-rheological (MR) clutch and brake and it provides the surgeon with a sense of touch by using both kinetic and kinesthetic information. Due to the size constraint of the slave robot, a wire actuating is adopted to make the desired motion of the end-effector which has 3-DOF instead of a conventional direct-driven motor. Another motions of the link parts that have 4-DOF use direct-driven motor. In total system, for working as a haptic device, the haptic master need to receive the information of repulsive forces applied on the slave robot. Therefore, repulsive forces on the end-effector are sensed by using three uniaxial torque transducer inserted in the wire actuating system and another repulsive forces applied on link part are sensed by using 6-axis transducer that is able to sense forces and torques. Using another 6-axis transducer, verify the reliability of force information on final end of slave robot. Lastly, integrated with a MR haptic master, psycho-physical test is conducted by different operators who can feel the different repulsive force or torque generated from the haptic master which is equivalent to the force or torque occurred on the end-effector to demonstrate the effectiveness of the proposed system.

  8. Torque Measurement of 3-DOF Haptic Master Operated by Controllable Electrorheological Fluid

    NASA Astrophysics Data System (ADS)

    Oh, Jong-Seok; Choi, Seung-Bok; Lee, Yang-Sub

    2015-02-01

    This work presents a torque measurement method of 3-degree-of-freedom (3-DOF) haptic master featuring controllable electrorheological (ER) fluid. In order to reflect the sense of an organ for a surgeon, the ER haptic master which can generate the repulsive torque of an organ is utilized as a remote controller for a surgery robot. Since accurate representation of organ feeling is essential for the success of the robot-assisted surgery, it is indispensable to develop a proper torque measurement method of 3-DOF ER haptic master. After describing the structural configuration of the haptic master, the torque models of ER spherical joint are mathematically derived based on the Bingham model of ER fluid. A new type of haptic device which has pitching, rolling, and yawing motions is then designed and manufactured using a spherical joint mechanism. Subsequently, the field-dependent parameters of the Bingham model are identified and generating repulsive torque according to applied electric field is measured. In addition, in order to verify the effectiveness of the proposed torque model, a comparative work between simulated and measured torques is undertaken.

  9. Spacsuit donning and doffing in zero-g training for Don Peterson STS-6

    NASA Technical Reports Server (NTRS)

    1982-01-01

    Spacsuit donning and doffing in zero-g training for Don Peterson of the STS-6 crew. The training is being held aboard the KC-135 to simulate weightlessness. He is being assisted to don the lower torso of the extravehicular mobility unit (EMU) by an ILC technician.

  10. Operation analysis of a Chebyshev-Pantograph leg mechanism for a single DOF biped robot

    NASA Astrophysics Data System (ADS)

    Liang, Conghui; Ceccarelli, Marco; Takeda, Yukio

    2012-12-01

    In this paper, operation analysis of a Chebyshev-Pantograph leg mechanism is presented for a single degree of freedom (DOF) biped robot. The proposed leg mechanism is composed of a Chebyshev four-bar linkage and a pantograph mechanism. In contrast to general fully actuated anthropomorphic leg mechanisms, the proposed leg mechanism has peculiar features like compactness, low-cost, and easy-operation. Kinematic equations of the proposed leg mechanism are formulated for a computer oriented simulation. Simulation results show the operation performance of the proposed leg mechanism with suitable characteristics. A parametric study has been carried out to evaluate the operation performance as function of design parameters. A prototype of a single DOF biped robot equipped with two proposed leg mechanisms has been built at LARM (Laboratory of Robotics and Mechatronics). Experimental test shows practical feasible walking ability of the prototype, as well as drawbacks are discussed for the mechanical design.

  11. Robust design of a 2-DOF GMV controller: a direct self-tuning and fuzzy scheduling approach.

    PubMed

    Silveira, Antonio S; Rodríguez, Jaime E N; Coelho, Antonio A R

    2012-01-01

    This paper presents a study on self-tuning control strategies with generalized minimum variance control in a fixed two degree of freedom structure-or simply GMV2DOF-within two adaptive perspectives. One, from the process model point of view, using a recursive least squares estimator algorithm for direct self-tuning design, and another, using a Mamdani fuzzy GMV2DOF parameters scheduling technique based on analytical and physical interpretations from robustness analysis of the system. Both strategies are assessed by simulation and real plants experimentation environments composed of a damped pendulum and an under development wind tunnel from the Department of Automation and Systems of the Federal University of Santa Catarina. Copyright © 2011 ISA. Published by Elsevier Ltd. All rights reserved.

  12. A new continuous sliding mode control approach with actuator saturation for control of 2-DOF helicopter system.

    PubMed

    Sadala, S P; Patre, B M

    2018-03-01

    The 2-degree of freedom (DOF) helicopter system is a typical higher-order, multi-variable, nonlinear and strong coupled control system. The helicopter dynamics also includes parametric uncertainties and is subject to unknown external disturbances. Such complicated system requires designing a sophisticated control algorithm that can handle these difficulties. This paper presents a new robust control algorithm which is a combination of two continuous control techniques, composite nonlinear feedback (CNF) and super-twisting control (STC) methods. In the existing integral sliding mode (ISM) based CNF control law, the discontinuous term exhibits chattering which is not desirable for many practical applications. As the continuity of well known STC reduces chattering in the system, the proposed strategy is beneficial over the current ISM based CNF control law which has a discontinuous term. Two controllers with integral sliding surface are designed to control the position of the pitch and the yaw angles of the 2- DOF helicopter. The adequacy of this specific combination has been exhibited through general analysis, simulation and experimental results of 2-DOF helicopter setup. The acquired results demonstrate the good execution of the proposed controller regarding stabilization, following reference input without overshoot against actuator saturation and robustness concerning to the limited matched disturbances. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

  13. SPACESUIT DONNING AND DOFFING - ZERO-G TRAINING - DON PETERSON - STS-6

    NASA Image and Video Library

    1982-07-14

    Spacesuit Donning and Doffing in Zero-G Training for Don Peterson of the STS-6 Crew with Astronaut Jerry Ross assisting; and, apparatus for testing the JSC Mechanically-Induced Settling Technology (MIST) Experiment. The training is being held aboard the KC-135 to simulate weightlessness. He is being assisted to don the lower torso of the Extravehicular Mobility Unit (EMU) by an ILC Technician. 1. ASTRONAUT ROSS, JERRY L. - ZERO-G SUITING 2. SHUTTLE - EXPERIMENTS (MIST)

  14. Position versus force control: using the 2-DOF robotic ankle trainer to assess ankle's motor control.

    PubMed

    Farjadian, Amir B; Nabian, Mohsen; Hartman, Amber; Corsino, Johnathan; Mavroidis, Constantinos; Holden, Maureen K

    2014-01-01

    An estimated of 2,000,000 acute ankle sprains occur annually in the United States. Furthermore, ankle disabilities are caused by neurological impairments such as traumatic brain injury, cerebral palsy and stroke. The virtually interfaced robotic ankle and balance trainer (vi-RABT) was introduced as a cost-effective platform-based rehabilitation robot to improve overall ankle/balance strength, mobility and control. The system is equipped with 2 degrees of freedom (2-DOF) controlled actuation along with complete means of angle and torque measurement mechanisms. Vi-RABT was used to assess ankle strength, flexibility and motor control in healthy human subjects, while playing interactive virtual reality games on the screen. The results suggest that in the task with 2-DOF, subjects have better control over ankle's position vs. force.

  15. The Teacher Observation Form: Revisions and Updates

    ERIC Educational Resources Information Center

    Peters, Scott J.; Gates, Jillian C.

    2010-01-01

    This article discusses the original development and subsequent updates and revisions made to the Teacher Observation Form (TOF). The TOF is a 12-item form to be used by evaluators in the observation of teachers of gifted and talented students. After nearly 25 years of use, the original TOF was revised based on input from content experts and…

  16. ShouldeRO, an alignment-free two-DOF rehabilitation robot for the shoulder complex.

    PubMed

    Dehez, Bruno; Sapin, Julien

    2011-01-01

    This paper presents a robot aimed to assist the shoulder movements of stroke patients during their rehabilitation process. This robot has the general form of an exoskeleton, but is characterized by an action principle on the patient no longer requiring a tedious and accurate alignment of the robot and patient's joints. It is constituted of a poly-articulated structure whose actuation is deported and transmission is ensured by Bowden cables. It manages two of the three rotational degrees of freedom (DOFs) of the shoulder. Quite light and compact, its proximal end can be rigidly fixed to the patient's back on a rucksack structure. As for its distal end, it is connected to the arm through passive joints and a splint guaranteeing the robot action principle, i.e. exert a force perpendicular to the patient's arm, whatever its configuration. This paper also presents a first prototype of this robot and some experimental results such as the arm angular excursions reached with the robot in the three joint planes. © 2011 IEEE

  17. Super Strypi HWIL 6DOF (Hardware-In-Loop six-degree-of-freedom) Rev. 2175

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gilkey, Jeff C.; Harl, Nathan R.; Kowalchuk, Scott A.

    2016-02-23

    The Super Strypi HWIL is a six degree-of-freedom (6DOF) simulation for the Super Strypi Launch Vehicle. The simulation is used to test the NGC flight software including the navigation software. Aerodynamic and propulsive forces, mass properties, ACS (attitude control system) parameters are defined in input files. Output parameters are saved to a Matlab mat file.

  18. A Sub-Millimetric 3-DOF Force Sensing Instrument with Integrated Fiber Bragg Grating for Retinal Microsurgery

    PubMed Central

    He, Xingchi; Handa, James; Gehlbach, Peter; Taylor, Russell; Iordachita, Iulian

    2013-01-01

    Vitreoretinal surgery requires very fine motor control to perform precise manipulation of the delicate tissue in the interior of the eye. Besides physiological hand tremor, fatigue, poor kinesthetic feedback, and patient movement, the absence of force sensing is one of the main technical challenges. Previous two degrees of freedom (DOF) force sensing instruments have demonstrated robust force measuring performance. The main design challenge is to incorporate high sensitivity axial force sensing. This paper reports the development of a sub-millimetric 3-DOF force sensing pick instrument based on fiber Bragg grating (FBG) sensors. The configuration of the four FBG sensors is arranged to maximize the decoupling between axial and transverse force sensing. A super-elastic nitinol flexure is designed to achieve high axial force sensitivity. An automated calibration system was developed for repeatability testing, calibration, and validation. Experimental results demonstrate a FBG sensor repeatability of 1.3 pm. The linear model for calculating the transverse forces provides an accurate global estimate. While the linear model for axial force is only locally accurate within a conical region with a 30° vertex angle, a second-order polynomial model can provide a useful global estimate for axial force. Combining the linear model for transverse forces and nonlinear model for axial force, the 3-DOF force sensing instrument can provide sub-millinewton resolution for axial force and a quarter millinewton for transverse forces. Validation with random samples show the force sensor can provide consistent and accurate measurement of three dimensional forces. PMID:24108455

  19. Modeling of the 6DOF Missile Dynamics using the NED Axes System

    DTIC Science & Technology

    1997-08-01

    representer le corps du missile, l’autodirecteur ainsi que Ia ligne missile-but. Le systeme d’axes le plus couramment utilise dans le domaine de la ...simulation de missiles tactiques ainsi que dans la librairie de composantes de modele de simulation du CRDV est le systeme d’axes NED, qui utilise l’axe x...RESEARCH ESTABLISHMENT CENTRE DE RECHERCHES POUR LA DEFENSE VALCARTIER,QuEBEC DREV- N-9703 MODELING OF THE 6DOF MISSILE DYNAMICS USING THE NED AXES

  20. Simulation on measurement of five-DOF motion errors of high precision spindle with cylindrical capacitive sensor

    NASA Astrophysics Data System (ADS)

    Zhang, Min; Wang, Wen; Xiang, Kui; Lu, Keqing; Fan, Zongwei

    2015-02-01

    This paper describes a novel cylindrical capacitive sensor (CCS) to measure the spindle five degree-of-freedom (DOF) motion errors. The operating principle and mathematical models of the CCS are presented. Using Ansoft Maxwell software to calculate the different capacitances in different configurations, structural parameters of end face electrode are then investigated. Radial, axial and tilt motions are also simulated by making comparisons with the given displacements and the simulation values respectively. It could be found that the proposed CCS has a high accuracy for measuring radial motion error when the average eccentricity is about 15 μm. Besides, the maximum relative error of axial displacement is 1.3% when the axial motion is within [0.7, 1.3] mm, and the maximum relative error of the tilt displacement is 1.6% as rotor tilts around a single axis within [-0.6, 0.6]°. Finally, the feasibility of the CCS for measuring five DOF motion errors is verified through simulation and analysis.

  1. Composite Material Testing Data Reduction to Adjust for the Systematic 6-DOF Testing Machine Aberrations

    Treesearch

    Athanasios lliopoulos; John G. Michopoulos; John G. C. Hermanson

    2012-01-01

    This paper describes a data reduction methodology for eliminating the systematic aberrations introduced by the unwanted behavior of a multiaxial testing machine, into the massive amounts of experimental data collected from testing of composite material coupons. The machine in reference is a custom made 6-DoF system called NRL66.3 and developed at the NAval...

  2. Telerobotic control of a dextrous manipulator using master and six-DOF hand-controllers for space assembly and servicing tasks

    NASA Technical Reports Server (NTRS)

    O'Hara, John M.

    1987-01-01

    Two studies were conducted evaluating methods of controlling a telerobot; bilateral force reflecting master controllers and proportional rate six degrees of freedom (DOF) hand controllers. The first study compared the controllers on performance of single manipulator arm tasks, a peg-in-the-hole task, and simulated satellite orbital replacement unit changeout. The second study, a Space Station truss assembly task, required simultaneous operation of both manipulator arms (all 12 DOFs) and complex multiaxis slave arm movements. Task times were significantly longer and fewer errors were committed with the hand controllers. The hand controllers were also rated significantly higher in cognitive and manual control workload on the two-arm task. The master controllers were rated significantly higher in physical workload. There were no significant differences in ratings of manipulator control quality.

  3. Vehicle active steering control research based on two-DOF robust internal model control

    NASA Astrophysics Data System (ADS)

    Wu, Jian; Liu, Yahui; Wang, Fengbo; Bao, Chunjiang; Sun, Qun; Zhao, Youqun

    2016-07-01

    Because of vehicle's external disturbances and model uncertainties, robust control algorithms have obtained popularity in vehicle stability control. The robust control usually gives up performance in order to guarantee the robustness of the control algorithm, therefore an improved robust internal model control(IMC) algorithm blending model tracking and internal model control is put forward for active steering system in order to reach high performance of yaw rate tracking with certain robustness. The proposed algorithm inherits the good model tracking ability of the IMC control and guarantees robustness to model uncertainties. In order to separate the design process of model tracking from the robustness design process, the improved 2 degree of freedom(DOF) robust internal model controller structure is given from the standard Youla parameterization. Simulations of double lane change maneuver and those of crosswind disturbances are conducted for evaluating the robust control algorithm, on the basis of a nonlinear vehicle simulation model with a magic tyre model. Results show that the established 2-DOF robust IMC method has better model tracking ability and a guaranteed level of robustness and robust performance, which can enhance the vehicle stability and handling, regardless of variations of the vehicle model parameters and the external crosswind interferences. Contradiction between performance and robustness of active steering control algorithm is solved and higher control performance with certain robustness to model uncertainties is obtained.

  4. Estimation of continuous multi-DOF finger joint kinematics from surface EMG using a multi-output Gaussian Process.

    PubMed

    Ngeo, Jimson; Tamei, Tomoya; Shibata, Tomohiro

    2014-01-01

    Surface electromyographic (EMG) signals have often been used in estimating upper and lower limb dynamics and kinematics for the purpose of controlling robotic devices such as robot prosthesis and finger exoskeletons. However, in estimating multiple and a high number of degrees-of-freedom (DOF) kinematics from EMG, output DOFs are usually estimated independently. In this study, we estimate finger joint kinematics from EMG signals using a multi-output convolved Gaussian Process (Multi-output Full GP) that considers dependencies between outputs. We show that estimation of finger joints from muscle activation inputs can be improved by using a regression model that considers inherent coupling or correlation within the hand and finger joints. We also provide a comparison of estimation performance between different regression methods, such as Artificial Neural Networks (ANN) which is used by many of the related studies. We show that using a multi-output GP gives improved estimation compared to multi-output ANN and even dedicated or independent regression models.

  5. Asynchronous steady-state visual evoked potential based BCI control of a 2-DoF artificial upper limb.

    PubMed

    Horki, Petar; Neuper, Christa; Pfurtscheller, Gert; Müller-Putz, Gernot

    2010-12-01

    A brain-computer interface (BCI) provides a direct connection between the human brain and a computer. One type of BCI can be realized using steady-state visual evoked potentials (SSVEPs), resulting from repetitive stimulation. The aim of this study was the realization of an asynchronous SSVEP-BCI, based on canonical correlation analysis, suitable for the control of a 2-degrees of freedom (DoF) hand and elbow neuroprosthesis. To determine whether this BCI is suitable for the control of 2-DoF neuroprosthetic devices, online experiments with a virtual and a robotic limb feedback were conducted with eight healthy subjects and one tetraplegic patient. All participants were able to control the artificial limbs with the BCI. In the online experiments, the positive predictive value (PPV) varied between 69% and 83% and the false negative rate (FNR) varied between 1% and 17%. The spinal cord injured patient achieved PPV and FNR values within one standard deviation of the mean for all healthy subjects.

  6. A simple 5-DoF MR-compatible motion signal measurement system.

    PubMed

    Chung, Soon-Cheol; Kim, Hyung-Sik; Yang, Jae-Woong; Lee, Su-Jeong; Choi, Mi-Hyun; Kim, Ji-Hye; Yeon, Hong-Won; Park, Jang-Yeon; Yi, Jeong-Han; Tack, Gye-Rae

    2011-09-01

    The purpose of this study was to develop a simple motion measurement system with magnetic resonance (MR) compatibility and safety. The motion measurement system proposed here can measure 5-DoF motion signals without deteriorating the MR images, and it has no effect on the intense and homogeneous main magnetic field, the temporal-gradient magnetic field (which varies rapidly with time), the transceiver radio frequency (RF) coil, and the RF pulse during MR data acquisition. A three-axis accelerometer and a two-axis gyroscope were used to measure 5-DoF motion signals, and Velcro was used to attach a sensor module to a finger or wrist. To minimize the interference between the MR imaging system and the motion measurement system, nonmagnetic materials were used for all electric circuit components in an MR shield room. To remove the effect of RF pulse, an amplifier, modulation circuit, and power supply were located in a shielded case, which was made of copper and aluminum. The motion signal was modulated to an optic signal using pulse width modulation, and the modulated optic signal was transmitted outside the MR shield room using a high-intensity light-emitting diode and an optic cable. The motion signal was recorded on a PC by demodulating the transmitted optic signal into an electric signal. Various kinematic variables, such as angle, acceleration, velocity, and jerk, can be measured or calculated by using the motion measurement system developed here. This system also enables motion tracking by extracting the position information from the motion signals. It was verified that MR images and motion signals could reliably be measured simultaneously.

  7. Compensator-based 6-DOF control for probe asteroid-orbital-frame hovering with actuator limitations

    NASA Astrophysics Data System (ADS)

    Liu, Xiaosong; Zhang, Peng; Liu, Keping; Li, Yuanchun

    2016-05-01

    This paper is concerned with 6-DOF control of a probe hovering in the orbital frame of an asteroid. Considering the requirements of the scientific instruments pointing direction and orbital position in practical missions, the coordinate control of relative attitude and orbit between the probe and target asteroid is imperative. A 6-DOF dynamic equation describing the relative translational and rotational motion of a probe in the asteroid's orbital frame is derived, taking the irregular gravitation, model and parameter uncertainties and external disturbances into account. An adaptive sliding mode controller is employed to guarantee the convergence of the state error, where the adaptation law is used to estimate the unknown upper bound of system uncertainty. Then the controller is improved to deal with the practical problem of actuator limitations by introducing a RBF neural network compensator, which is used to approximate the difference between the actual control with magnitude constraint and the designed nominal control law. The closed-loop system is proved to be asymptotically stable through the Lyapunov stability analysis. Numerical simulations are performed to compare the performances of the preceding designed control laws. Simulation results demonstrate the validity of the control scheme using the compensator-based adaptive sliding mode control law in the presence of actuator limitations, system uncertainty and external disturbance.

  8. 6-DoF Haptic Rendering Using Continuous Collision Detection between Points and Signed Distance Fields.

    PubMed

    Hongyi Xu; Barbic, Jernej

    2017-01-01

    We present an algorithm for fast continuous collision detection between points and signed distance fields, and demonstrate how to robustly use it for 6-DoF haptic rendering of contact between objects with complex geometry. Continuous collision detection is often needed in computer animation, haptics, and virtual reality applications, but has so far only been investigated for polygon (triangular) geometry representations. We demonstrate how to robustly and continuously detect intersections between points and level sets of the signed distance field. We suggest using an octree subdivision of the distance field for fast traversal of distance field cells. We also give a method to resolve continuous collisions between point clouds organized into a tree hierarchy and a signed distance field, enabling rendering of contact between rigid objects with complex geometry. We investigate and compare two 6-DoF haptic rendering methods now applicable to point-versus-distance field contact for the first time: continuous integration of penalty forces, and a constraint-based method. An experimental comparison to discrete collision detection demonstrates that the continuous method is more robust and can correctly resolve collisions even under high velocities and during complex contact.

  9. A novel 4-DOF surgical instrument with modular joints and 6-Axis Force sensing capability.

    PubMed

    Li, Kun; Pan, Bo; Zhang, Fuhai; Gao, Wenpeng; Fu, Yili; Wang, Shuguo

    2017-03-01

    It is difficult for surgeons to exert appropriate forces during delicate operations due to lack of force feedback in robot-assisted minimally invasive surgery (RMIS). A 4-DOF surgical grasper with a modular wrist and 6-axis force sensing capability is developed. A grasper integrated with a miniature force and torque sensor based on the Stewart platform is designed, and a cable tension decomposition mechanism is designed to alleviate influence of the cable tension to the sensor. A modularized wrist consisting of four joint units is designed to facilitate integration of the sensor and eliminate coupled motion of the wrist. Sensing ranges of this instrument are ±10 N and ±160 N mm, and resolutions are 1.2% in radial directions, 5% in axial direction, and 4.2% in rotational directions. An ex vivo experiment shows that this instrument prototype successfully measures the interaction forces. A 4-DOF surgical instrument with modular joints and 6-axis force sensing capability is developed. This instrument can be used for force feedback in RMIS. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  10. Development of 3 DOF manipulator using ER fluid clutches for reduction of collision force

    NASA Astrophysics Data System (ADS)

    Boku, Kazuhiko; Nakamura, Taro

    2009-02-01

    .With robots and users more commonly sharing space such as in the fields of medicine and home automation, the possibility of a physical collision has increased, even though many robots use actuators with high-ratio gear trains to minimize the effects of impact. We developed a 3-DOF manipulator having a smart flexible joint using an ER fluid and a sensor-equipped pneumatic cushion. Results of position control and collision experiments using the manipulator demonstrated its effectiveness.

  11. Perturbation analysis of 6DoF flight dynamics and passive dynamic stability of hovering fruit fly Drosophila melanogaster.

    PubMed

    Gao, Na; Aono, Hikaru; Liu, Hao

    2011-02-07

    Insects exhibit exquisite control of their flapping flight, capable of performing precise stability and steering maneuverability. Here we develop an integrated computational model to investigate flight dynamics of insect hovering based on coupling the equations of 6 degree of freedom (6DoF) motion with the Navier-Stokes (NS) equations. Unsteady aerodynamics is resolved by using a biology-inspired dynamic flight simulator that integrates models of realistic wing-body morphology and kinematics, and a NS solver. We further develop a dynamic model to solve the rigid body equations of 6DoF motion by using a 4th-order Runge-Kutta method. In this model, instantaneous forces and moments based on the NS-solutions are represented in terms of Fourier series. With this model, we perform a systematic simulation-based analysis on the passive dynamic stability of a hovering fruit fly, Drosophila melanogaster, with a specific focus on responses of state variables to six one-directional perturbation conditions during latency period. Our results reveal that the flight dynamics of fruit fly hovering does not have a straightforward dynamic stability in a conventional sense that perturbations damp out in a manner of monotonous convergence. However, it is found to exist a transient interval containing an initial converging response observed for all the six perturbation variables and a terminal instability that at least one state variable subsequently tends to diverge after several wing beat cycles. Furthermore, our results illustrate that a fruit fly does have sufficient time to apply some active mediation to sustain a steady hovering before losing body attitudes. Copyright © 2010 Elsevier Ltd. All rights reserved.

  12. A 6-DOF vibration isolation system for hydraulic hybrid vehicles

    NASA Astrophysics Data System (ADS)

    Nguyen, The; Elahinia, Mohammad; Olson, Walter W.; Fontaine, Paul

    2006-03-01

    This paper presents the results of vibration isolation analysis for the pump/motor component of hydraulic hybrid vehicles (HHVs). The HHVs are designed to combine gasoline/diesel engine and hydraulic power in order to improve the fuel efficiency and reduce the pollution. Electric hybrid technology is being applied to passenger cars with small and medium engines to improve the fuel economy. However, for heavy duty vehicles such as large SUVs, trucks, and buses, which require more power, the hydraulic hybridization is a more efficient choice. In function, the hydraulic hybrid subsystem improves the fuel efficiency of the vehicle by recovering some of the energy that is otherwise wasted in friction brakes. Since the operation of the main component of HHVs involves with rotating parts and moving fluid, noise and vibration are an issue that affects both passengers (ride comfort) as well as surrounding people (drive-by noise). This study looks into the possibility of reducing the transmitted noise and vibration from the hydraulic subsystem to the vehicle's chassis by using magnetorheological (MR) fluid mounts. To this end, the hydraulic subsystem is modeled as a six degree of freedom (6-DOF) rigid body. A 6-DOF isolation system, consisting of five mounts connected to the pump/motor at five different locations, is modeled and simulated. The mounts are designed by combining regular elastomer components with MR fluids. In the simulation, the real loading and working conditions of the hydraulic subsystem are considered and the effects of both shock and vibration are analyzed. The transmissibility of the isolation system is monitored in a wide range of frequencies. The geometry of the isolation system is considered in order to sustain the weight of the hydraulic system without affecting the design of the chassis and the effectiveness of the vibration isolating ability. The simulation results shows reduction in the transmitted vibration force for different working cycles of

  13. Developing a 3-DOF Compliant Perching Arm for a Free-Flying Robot on the International Space Station

    NASA Technical Reports Server (NTRS)

    Park, In-Won; Smith, Marion F.; Sanchez, Hugo S.; Wong, Sze Wun; Piacenza, Pedro; Ciocarlie, Matei

    2017-01-01

    This paper presents the design and control of the 3-DOF compliant perching arm for the free-flying Astrobee robots that will operate inside the International Space Station (ISS). The robots are intended to serve as a flexible platform for future guest scientists to use for zero-gravity robotics research - thus, the arm is designed to support manipulation research. It provides a 1-DOF underactuated tendon-driven gripper capable of enveloping a range of objects of different shapes and sizes. Co-located RGB camera and LIDAR sensors provide perception. The Astrobee robots will be capable of grasping each other in flight, to simulate orbital capture scenarios. The arm's end-effector module is swappable on-orbit, allowing guest scientists to add upgraded grippers, or even additional arm degrees of freedom. The design of the arm balances research capabilities with Astrobee's operational need to perch on ISS handrails to reduce power consumption. Basic arm functioning and grip strength were evaluated using an integrated Astrobee prototype riding on a low-friction air bearing.

  14. Output Error Analysis of Planar 2-DOF Five-bar Mechanism

    NASA Astrophysics Data System (ADS)

    Niu, Kejia; Wang, Jun; Ting, Kwun-Lon; Tao, Fen; Cheng, Qunchao; Wang, Quan; Zhang, Kaiyang

    2018-03-01

    Aiming at the mechanism error caused by clearance of planar 2-DOF Five-bar motion pair, the method of equivalent joint clearance of kinematic pair to virtual link is applied. The structural error model of revolute joint clearance is established based on the N-bar rotation laws and the concept of joint rotation space, The influence of the clearance of the moving pair is studied on the output error of the mechanis. and the calculation method and basis of the maximum error are given. The error rotation space of the mechanism under the influence of joint clearance is obtained. The results show that this method can accurately calculate the joint space error rotation space, which provides a new way to analyze the planar parallel mechanism error caused by joint space.

  15. Towards Kilo-Hertz 6-DoF Visual Tracking Using an Egocentric Cluster of Rolling Shutter Cameras.

    PubMed

    Bapat, Akash; Dunn, Enrique; Frahm, Jan-Michael

    2016-11-01

    To maintain a reliable registration of the virtual world with the real world, augmented reality (AR) applications require highly accurate, low-latency tracking of the device. In this paper, we propose a novel method for performing this fast 6-DOF head pose tracking using a cluster of rolling shutter cameras. The key idea is that a rolling shutter camera works by capturing the rows of an image in rapid succession, essentially acting as a high-frequency 1D image sensor. By integrating multiple rolling shutter cameras on the AR device, our tracker is able to perform 6-DOF markerless tracking in a static indoor environment with minimal latency. Compared to state-of-the-art tracking systems, this tracking approach performs at significantly higher frequency, and it works in generalized environments. To demonstrate the feasibility of our system, we present thorough evaluations on synthetically generated data with tracking frequencies reaching 56.7 kHz. We further validate the method's accuracy on real-world images collected from a prototype of our tracking system against ground truth data using standard commodity GoPro cameras capturing at 120 Hz frame rate.

  16. Model identification and vision-based H∞ position control of 6-DoF cable-driven parallel robots

    NASA Astrophysics Data System (ADS)

    Chellal, R.; Cuvillon, L.; Laroche, E.

    2017-04-01

    This paper presents methodologies for the identification and control of 6-degrees of freedom (6-DoF) cable-driven parallel robots (CDPRs). First a two-step identification methodology is proposed to accurately estimate the kinematic parameters independently and prior to the dynamic parameters of a physics-based model of CDPRs. Second, an original control scheme is developed, including a vision-based position controller tuned with the H∞ methodology and a cable tension distribution algorithm. The position is controlled in the operational space, making use of the end-effector pose measured by a motion-tracking system. A four-block H∞ design scheme with adjusted weighting filters ensures good trajectory tracking and disturbance rejection properties for the CDPR system, which is a nonlinear-coupled MIMO system with constrained states. The tension management algorithm generates control signals that maintain the cables under feasible tensions. The paper makes an extensive review of the available methods and presents an extension of one of them. The presented methodologies are evaluated by simulations and experimentally on a redundant 6-DoF INCA 6D CDPR with eight cables, equipped with a motion-tracking system.

  17. A numerical and experimental study on optimal design of multi-DOF viscoelastic supports for passive vibration control in rotating machinery

    NASA Astrophysics Data System (ADS)

    Ribeiro, Eduardo Afonso; Lopes, Eduardo Márcio de Oliveira; Bavastri, Carlos Alberto

    2017-12-01

    Viscoelastic materials have played an important role in passive vibration control. Nevertheless, the use of such materials in supports of rotating machines, aiming at controlling vibration, is more recent, mainly when these supports present additional complexities like multiple degrees of freedom and require accurate models to predict the dynamic behavior of viscoelastic materials working in a broad band of frequencies and temperatures. Previously, the authors propose a methodology for an optimal design of viscoelastic supports (VES) for vibration suppression in rotordynamics, which improves the dynamic prediction accuracy, the speed calculation, and the modeling of VES as complex structures. However, a comprehensive numerical study of the dynamics of rotor-VES systems, regarding the types and combinations of translational and rotational degrees of freedom (DOFs), accompanied by the corresponding experimental validation, is still lacking. This paper presents such a study considering different types and combinations of DOFs in addition to the simulation of their number of additional masses/inertias, as well as the kind and association of the applied viscoelastic materials (VEMs). The results - regarding unbalance frequency response, transmissibility and displacement due to static loads - lead to: 1) considering VES as complex structures which allow improving the efficacy in passive vibration control; 2) acknowledging the best configuration concerning DOFs and VEM choice and association for a practical application concerning passive vibration control and load resistance. The specific outcomes of the conducted experimental validation attest the accuracy of the proposed methodology.

  18. Measurement system and model for simultaneously measuring 6DOF geometric errors.

    PubMed

    Zhao, Yuqiong; Zhang, Bin; Feng, Qibo

    2017-09-04

    A measurement system to simultaneously measure six degree-of-freedom (6DOF) geometric errors is proposed. The measurement method is based on a combination of mono-frequency laser interferometry and laser fiber collimation. A simpler and more integrated optical configuration is designed. To compensate for the measurement errors introduced by error crosstalk, element fabrication error, laser beam drift, and nonparallelism of two measurement beam, a unified measurement model, which can improve the measurement accuracy, is deduced and established using the ray-tracing method. A numerical simulation using the optical design software Zemax is conducted, and the results verify the correctness of the model. Several experiments are performed to demonstrate the feasibility and effectiveness of the proposed system and measurement model.

  19. Research and implementation of a new 6-DOF light-weight robot

    NASA Astrophysics Data System (ADS)

    Tao, Zihang; Zhang, Tao; Qi, Mingzhong; Ji, Junhui

    2017-06-01

    Traditional industrial robots have some weaknesses such as low payload-weight, high power consumption and high cost. These drawbacks limit their applications in such areas, special application, service and surgical robots. To improve these shortcomings, a new kind 6-DOF light-weight robot was designed based on modular joints and modular construction. This paper discusses the general requirements of the light-weight robots. Based on these requirements the novel robot is designed. The new robot is described from two aspects, mechanical design and control system. A prototype robot had developed and a joint performance test platform had designed. Position and velocity tests had conducted to evaluate the performance of the prototype robot. Test results showed that the prototype worked well.

  20. Designing, Fabrication and Controlling Of Multipurpose3-DOF Robotic Arm

    NASA Astrophysics Data System (ADS)

    Nabeel, Hafiz Muhammad; Azher, Anum; Usman Ali, Syed M.; Wahab Mughal, Abdul

    2013-12-01

    In the present work, we have successfully designed and developed a 3-DOF articulated Robotic Arm capable of performing typical industrial tasks such as painting or spraying, assembling and handling automobiles parts and etc., in resemblance to a human arm. The mechanical assembly is designed on SOLIDWORKS and aluminum grade 6061 -T6 is used for its fabrication in order to reduce the structure weight. We have applied inverse kinematics to determine the joint angles, equations are fed into an efficient microcontroller ATMEGA16 which performs all the calculations to determine the joint angles on the basis of given coordinates to actuate the joints through motorized control. Good accuracy was obtained with quadrature optical encoders installed in each joint to achieve the desired position and a LabVIEW based GUI is designed to provide human machine interface.

  1. Scaling and characterisation of a 2-DoF velocity amplified electromagnetic vibration energy harvester

    NASA Astrophysics Data System (ADS)

    O’Donoghue, D.; Frizzell, R.; Punch, J.

    2018-07-01

    Vibration energy harvesters (VEHs) offer an alternative to batteries for the autonomous operation of low-power electronics. Understanding the influence of scaling on VEHs is of great importance in the design of reduced scale harvesters. The nonlinear harvesters investigated here employ velocity amplification, a technique used to increase velocity through impacts, to improve the power output of multiple-degree-of-freedom VEHs, compared to linear resonators. Such harvesters, employing electromagnetic induction, are referred to as velocity amplified electromagnetic generators (VAEGs), with gains in power achieved by increasing the relative velocity between the magnet and coil in the transducer. The influence of scaling on a nonlinear 2-DoF VAEG is presented. Due to the increased complexity of VAEGs, compared to linear systems, linear scaling theory cannot be directly applied to VAEGs. Therefore, a detailed nonlinear scaling method is utilised. Experimental and numerical methods are employed. This nonlinear scaling method can be used for analysing the scaling behaviour of all nonlinear electromagnetic VEHs. It is demonstrated that the electromagnetic coupling coefficient degrades more rapidly with scale for systems with larger displacement amplitudes, meaning that systems operating at low frequencies will scale poorly compared to those operating at higher frequencies. The load power of the 2-DoF VAEG is predicted to scale as {P}L\\propto {s}5.51 (s = volume1/3), suggesting that achieving high power densities in a VAEG with low device volume is extremely challenging.

  2. Pressure-constrained, reduced-DOF, interconnected parallel manipulators with applications to space suit design

    NASA Astrophysics Data System (ADS)

    Jacobs, Shane Earl

    This dissertation presents the concept of a Morphing Upper Torso, an innovative pressure suit design that incorporates robotic elements to enable a resizable, highly mobile and easy to don/doff spacesuit. The torso is modeled as a system of interconnected, pressure-constrained, reduced-DOF, wire-actuated parallel manipulators, that enable the dimensions of the suit to be reconfigured to match the wearer. The kinematics, dynamics and control of wire-actuated manipulators are derived and simulated, along with the Jacobian transforms, which relate the total twist vector of the system to the vector of actuator velocities. Tools are developed that allow calculation of the workspace for both single and interconnected reduced-DOF robots of this type, using knowledge of the link lengths. The forward kinematics and statics equations are combined and solved to produce the pose of the platforms along with the link tensions. These tools allow analysis of the full Morphing Upper Torso design, in which the back hatch of a rear-entry torso is interconnected with the waist ring, helmet ring and two scye bearings. Half-scale and full-scale experimental models are used along with analytical models to examine the feasibility of this novel space suit concept. The analytical and experimental results demonstrate that the torso could be expanded to facilitate donning and doffng, and then contracted to match different wearer's body dimensions. Using the system of interconnected parallel manipulators, suit components can be accurately repositioned to different desired configurations. The demonstrated feasibility of the Morphing Upper Torso concept makes it an exciting candidate for inclusion in a future planetary suit architecture.

  3. Transformation of nonlinear discrete-time system into the extended observer form

    NASA Astrophysics Data System (ADS)

    Kaparin, V.; Kotta, Ü.

    2018-04-01

    The paper addresses the problem of transforming discrete-time single-input single-output nonlinear state equations into the extended observer form, which, besides the input and output, also depends on a finite number of their past values. Necessary and sufficient conditions for the existence of both the extended coordinate and output transformations, solving the problem, are formulated in terms of differential one-forms, associated with the input-output equation, corresponding to the state equations. An algorithm for transformation of state equations into the extended observer form is proposed and illustrated by an example. Moreover, the considered approach is compared with the method of dynamic observer error linearisation, which likewise is intended to enlarge the class of systems transformable into an observer form.

  4. Study on Parallel 2-DOF Rotation Machanism in Radar

    NASA Astrophysics Data System (ADS)

    Jiang, Ming; Hu, Xuelong; Liu, Lei; Yu, Yunfei

    The spherical parallel machine has become the world's academic and industrial focus of the field in recent years due to its simple and economical manufacture as well as its structural compactness especially suitable for areas where space gesture changes. This paper dwells upon its present research and development home and abroad. The newer machine (RGRR-II) can rotate around the axis z within 360° and the axis y1 from -90° to +90°. It has the advantages such as less moving parts (only 3 parts), larger ratio of work space to machine size, zero mechanic coupling, no singularity. Constructing rotation machine with spherical parallel 2-DOF rotation join (RGRR-II) may realize semispherical movement with zero dead point and extent the range. Control card (PA8000NT Series CNC) is installed in the computer. The card can run the corresponding software which realizes radar movement control. The machine meets the need of radars in plane and satellite which require larger detection range, lighter weight and compacter structure.

  5. Measurement of the passive stiffness of ankle joint in 3 DOF using stewart platform type ankle foot device.

    PubMed

    Nomura, Kenta; Yonezawa, Teru; Mizoguchi, Hiroshi; Takemura, Hiroshi

    2016-08-01

    This paper presents a method to measure the passive stiffness of an ankle joint in three degrees of freedom (DOF) under two motion speeds (1 Hz and 5 degree/s) using a developed Stewart platform-type device. The developed device can reproduce input motions of the foot in 6 DOF by controlling six pneumatic linear motion actuators. We used the device to measure the passive stiffness of an ankle joint undergoing three kinds of motion, namely dorsi-plantar flexion, inversion-eversion, and adduction-abduction. The measured values of the passive stiffness of the ankle joint in dorsiflexion that we obtained agreed well with that obtained in a previous study, indicating that the developed device is useful for measuring the passive stiffness of ankle joint. In addition, the developed device can be used to measure the stiffness in inversion-eversion and adduction-abduction motions as well, parameters that have never been measured. The results we obtained demonstrated certain interesting features as we varied both the direction and pace of motion (e.g., there were significant differences in the stiffness not only between adduction and abduction during the faster pace, but also between these and the other motions).

  6. Design and Calibration of a New 6 DOF Haptic Device

    PubMed Central

    Qin, Huanhuan; Song, Aiguo; Liu, Yuqing; Jiang, Guohua; Zhou, Bohe

    2015-01-01

    For many applications such as tele-operational robots and interactions with virtual environments, it is better to have performance with force feedback than without. Haptic devices are force reflecting interfaces. They can also track human hand positions simultaneously. A new 6 DOF (degree-of-freedom) haptic device was designed and calibrated in this study. It mainly contains a double parallel linkage, a rhombus linkage, a rotating mechanical structure and a grasping interface. Benefited from the unique design, it is a hybrid structure device with a large workspace and high output capability. Therefore, it is capable of multi-finger interactions. Moreover, with an adjustable base, operators can change different postures without interrupting haptic tasks. To investigate the performance regarding position tracking accuracy and static output forces, we conducted experiments on a three-dimensional electric sliding platform and a digital force gauge, respectively. Displacement errors and force errors are calculated and analyzed. To identify the capability and potential of the device, four application examples were programmed. PMID:26690449

  7. Numerical Investigation of Swimmer’s Gliding Stage with 6-DOF Movement

    PubMed Central

    Li, Tianzeng; Cai, Wenhao; Zhan, Jiemin

    2017-01-01

    The purpose of this study is to analyze the motion status of swimmers during their gliding stage using a numerical simulation method. This simulation strategy is conducted by solving the 3D incompressible Navier-Stokes equations using the Realizable k-ε turbulence closure equations in combination with the Six Degrees of Freedom (6-DOF) method. The uneven mass distribution of a swimmer and the roughness of the surface of the body are taken into consideration. The hydrodynamic characteristics and movement characteristics of the swimmers at different launch speeds were analyzed. The calculated results suggest that an optimal instant for starting propulsive movement is when the velocity of the swimmer decreases by 1.75 m/s to 2.0 m/s from an initial horizontal velocity of 3.1 m/s to 3.5 m/s. PMID:28125724

  8. The dispersal of planet-forming discs: theory confronts observations.

    PubMed

    Ercolano, Barbara; Pascucci, Ilaria

    2017-04-01

    Discs of gas and dust around million-year-old stars are a by-product of the star formation process and provide the raw material to form planets. Hence, their evolution and dispersal directly impact what type of planets can form and affect the final architecture of planetary systems. Here, we review empirical constraints on disc evolution and dispersal with special emphasis on transition discs, a subset of discs that appear to be caught in the act of clearing out planet-forming material. Along with observations, we summarize theoretical models that build our physical understanding of how discs evolve and disperse and discuss their significance in the context of the formation and evolution of planetary systems. By confronting theoretical predictions with observations, we also identify the most promising areas for future progress.

  9. The dispersal of planet-forming discs: theory confronts observations

    PubMed Central

    Pascucci, Ilaria

    2017-01-01

    Discs of gas and dust around million-year-old stars are a by-product of the star formation process and provide the raw material to form planets. Hence, their evolution and dispersal directly impact what type of planets can form and affect the final architecture of planetary systems. Here, we review empirical constraints on disc evolution and dispersal with special emphasis on transition discs, a subset of discs that appear to be caught in the act of clearing out planet-forming material. Along with observations, we summarize theoretical models that build our physical understanding of how discs evolve and disperse and discuss their significance in the context of the formation and evolution of planetary systems. By confronting theoretical predictions with observations, we also identify the most promising areas for future progress. PMID:28484640

  10. Design of a 6-DOF upper limb rehabilitation exoskeleton with parallel actuated joints.

    PubMed

    Chen, Yanyan; Li, Ge; Zhu, Yanhe; Zhao, Jie; Cai, Hegao

    2014-01-01

    In this paper, a 6-DOF wearable upper limb exoskeleton with parallel actuated joints which perfectly mimics human motions is proposed. The upper limb exoskeleton assists the movement of physically weak people. Compared with the existing upper limb exoskeletons which are mostly designed using a serial structure with large movement space but small stiffness and poor wearable ability, a prototype for motion assistance based on human anatomy structure has been developed in our design. Moreover, the design adopts balls instead of bearings to save space, which simplifies the structure and reduces the cost of the mechanism. The proposed design also employs deceleration processes to ensure that the transmission ratio of each joint is coincident.

  11. Reconstruction of normal forms by learning informed observation geometries from data.

    PubMed

    Yair, Or; Talmon, Ronen; Coifman, Ronald R; Kevrekidis, Ioannis G

    2017-09-19

    The discovery of physical laws consistent with empirical observations is at the heart of (applied) science and engineering. These laws typically take the form of nonlinear differential equations depending on parameters; dynamical systems theory provides, through the appropriate normal forms, an "intrinsic" prototypical characterization of the types of dynamical regimes accessible to a given model. Using an implementation of data-informed geometry learning, we directly reconstruct the relevant "normal forms": a quantitative mapping from empirical observations to prototypical realizations of the underlying dynamics. Interestingly, the state variables and the parameters of these realizations are inferred from the empirical observations; without prior knowledge or understanding, they parametrize the dynamics intrinsically without explicit reference to fundamental physical quantities.

  12. Evaluation of a six-DOF electrodynamic shaker system.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gregory, Danny Lynn; Smallwood, David Ora

    2009-03-01

    relationships between the shakers all six rigid body modes (three translation, and three rotations) can be excited. The system is over determined. There are more shakers than degrees of freedom. This provided an interesting control problem. The problem was approached using the input-output transformation matrices provided in the Spectral control system. Twelve accelerometers were selected for the control accelerometers (a tri-axial accelerometer at each corner of the table (see Figure 5). Figure 6 shows the nomenclature used to identify the shakers and control accelerometers. A fifth tri-axial accelerometer was placed at the center of the table, but it was not used for control. Thus we had 12 control accelerometers and 12 shakers to control a 6-dof shaker. The 12 control channels were reduced to a 6-dof control using a simple input transformation matrix. The control was defined by a 6x6 spectral density matrix. The six outputs in the control variable coordinates were transformed to twelve physical drive signals using another simple output transformation matrix. It was assumed that the accelerometers and shakers were well matched such that the transformation matrices were independent of frequency and could be deduced from rigid body considerations. The input/output transformations are shown in Equations 1 and 2.« less

  13. Simulation and training of lumbar punctures using haptic volume rendering and a 6DOF haptic device

    NASA Astrophysics Data System (ADS)

    Färber, Matthias; Heller, Julika; Handels, Heinz

    2007-03-01

    The lumbar puncture is performed by inserting a needle into the spinal chord of the patient to inject medicaments or to extract liquor. The training of this procedure is usually done on the patient guided by experienced supervisors. A virtual reality lumbar puncture simulator has been developed in order to minimize the training costs and the patient's risk. We use a haptic device with six degrees of freedom (6DOF) to feedback forces that resist needle insertion and rotation. An improved haptic volume rendering approach is used to calculate the forces. This approach makes use of label data of relevant structures like skin, bone, muscles or fat and original CT data that contributes information about image structures that can not be segmented. A real-time 3D visualization with optional stereo view shows the punctured region. 2D visualizations of orthogonal slices enable a detailed impression of the anatomical context. The input data consisting of CT and label data and surface models of relevant structures is defined in an XML file together with haptic rendering and visualization parameters. In a first evaluation the visible human male data has been used to generate a virtual training body. Several users with different medical experience tested the lumbar puncture trainer. The simulator gives a good haptic and visual impression of the needle insertion and the haptic volume rendering technique enables the feeling of unsegmented structures. Especially, the restriction of transversal needle movement together with rotation constraints enabled by the 6DOF device facilitate a realistic puncture simulation.

  14. Performing Complex Tasks by Users With Upper-Extremity Disabilities Using a 6-DOF Robotic Arm: A Study.

    PubMed

    Al-Halimi, Reem K; Moussa, Medhat

    2017-06-01

    In this paper, we report on the results of a study that was conducted to examine how users suffering from severe upper-extremity disabilities can control a 6 degrees-of-freedom (DOF) robotics arm to complete complex activities of daily living. The focus of the study is not on assessing the robot arm but on examining the human-robot interaction patterns. Three participants were recruited. Each participant was asked to perform three tasks: eating three pieces of pre-cut bread from a plate, drinking three sips of soup from a bowl, and opening a right-handed door with lever handle. Each of these tasks was repeated three times. The arm was mounted on the participant's wheelchair, and the participants were free to move the arm as they wish to complete these tasks. Each task consisted of a sequence of modes where a mode is defined as arm movement in one DOF. Results show that participants used a total of 938 mode movements with an average of 75.5 (std 10.2) modes for the eating task, 70 (std 8.8) modes for the soup task, and 18.7 (std 4.5) modes for the door opening task. Tasks were then segmented into smaller subtasks. It was found that there are patterns of usage per participant and per subtask. These patterns can potentially allow a robot to learn from user's demonstration what is the task being executed and by whom and respond accordingly to reduce user effort.

  15. Relationship and inter observer agreement of tooth and face forms in a Saudi subpopulation.

    PubMed

    Habib, Syed Rashid; Shiddi, Ibraheem Al; Al-Sufyani, Mohammed D; Althobaiti, Fahad A

    2015-04-01

    To determine the relationship of tooth form with the face form by different observers and further investigate the inter observer agreement on tooth forms, face forms, their relationship among male Saudis. A comparative cross-sectional study. Department of Prosthodontics, College of Dentistry, King Saud University, Riyadh, KSA, from February till August 2013. Ninety four male participants aged 18 - 35 years were randomly recruited for the study. Full-face and anterior teeth (intraoral) digital photographs in the frontal plane were recorded. The outline tracings of the face and the tooth were obtained using Autocad (version 2010) software. The outline of the tooth was enlarged proportionately, without altering the length to width ratio to fit the face outline. The outlines were then evaluated visually by 6 prosthodontists and results were tabulated. The most common type of face form (49.65%) and tooth form (56.38%) was square tapering. Using the visual method, a good relationship (31.41%), moderate relationship (35.31%), weak relationship (19.68%) and no relationship (13.65%) between the tooth form and face form was found by the observers. Overall kappa for inter observer agreement on face form, tooth form and their relationship was 0.24, 0.17 and 0.26 respectively. The kappa values showed a fair agreement between the observers. The study results indicated that there was no highly defined relationship between the tooth form and face form in the studied Saudi subpopulation. A fair agreement was found between the observers for classifying the tooth forms, face froms and their relationship.

  16. Effects of uniformities of deposition of respirable particles on filters on determining their quartz contents by using the direct on-filter X-ray diffraction (DOF XRD) method.

    PubMed

    Chen, Ching-Hwa; Tsaia, Perng-Jy; Lai, Chane-Yu; Peng, Ya-Lian; Soo, Jhy-Charm; Chen, Cheng-Yao; Shih, Tung-Sheng

    2010-04-15

    In this study, field samplings were conducted in three workplaces of a foundry plant, including the molding, demolding, and bead blasting, respectively. Three respirable aerosol samplers (including a 25-mm aluminum cyclone, nylon cyclone, and IOSH cyclone) were used side-by-side to collect samples from each selected workplace. For each collected sample, the uniformity of the deposition of respirable dusts on the filter was measured and its free silica content was determined by both the DOF XRD method and NIOSH 7500 XRD method (i.e., the reference method). A same trend in measured uniformities can be found in all selected workplaces: 25-mm aluminum cyclone>nylon cyclone>IOSH cyclone. Even for samples collected by the sampler with the highest uniformity (i.e., 25-mm aluminum cyclone), the use of the DOF XRD method would lead to the measured free silica concentrations 1.15-2.89 times in magnitude higher than that of the reference method. A new filter holder should be developed with the minimum uniformity comparable to that of NIOSH 7500 XRD method (=0.78) in the future. The use of conversion factors for correcting quartz concentrations obtained from the DOF XRD method based on the measured uniformities could be suitable for the foundry industry at this stage. 2009 Elsevier B.V. All rights reserved.

  17. Vitality Forms Processing in the Insula during Action Observation: A Multivoxel Pattern Analysis.

    PubMed

    Di Cesare, Giuseppe; Valente, Giancarlo; Di Dio, Cinzia; Ruffaldi, Emanuele; Bergamasco, Massimo; Goebel, Rainer; Rizzolatti, Giacomo

    2016-01-01

    Observing the style of an action done by others allows the observer to understand the cognitive state of the agent. This information has been defined by Stern "vitality forms". Previous experiments showed that the dorso-central insula is selectively active both during vitality form observation and execution. In the present study, we presented participants with videos showing hand actions performed with different velocities and asked them to judge either their vitality form (gentle, neutral, rude) or their velocity (slow, medium, fast). The aim of the present study was to assess, using multi-voxel pattern analysis, whether vitality forms and velocities of observed goal-directed actions are differentially processed in the insula, and more specifically whether action velocity is encoded per se or it is an element that triggers neural populations of the insula encoding the vitality form. The results showed that, consistently across subjects, in the dorso-central sector of the insula there were voxels selectively tuned to vitality forms, while voxel tuned to velocity were rare. These results indicate that the dorso-central insula, which previous data showed to be involved in the vitality form processing, contains voxels specific for the action style processing.

  18. Development of Creative Behavior Observation Form: A Study on Validity and Reliability

    ERIC Educational Resources Information Center

    Dere, Zeynep; Ömeroglu, Esra

    2018-01-01

    This study, Creative Behavior Observation Form was developed to assess creativity of the children. While the study group on the reliability and validity of Creative Behavior Observation Form was being developed, 257 children in total who were at the ages of 5-6 were used as samples with stratified sampling method. Content Validity Index (CVI) and…

  19. Joint-space adaptive control of a 6 DOF end-effector with closed-kinematic chain mechanism

    NASA Technical Reports Server (NTRS)

    Nguyen, Charles C.; Zhou, Zhen-Lei

    1989-01-01

    The development is presented for a joint-space adaptive scheme that controls the joint position of a six-degree-of-freedom (DOF) robot end-effector performing fine and precise motion within a very limited workspace. The end-effector was built to study autonomous assembly of NASA hardware in space. The design of the adaptive controller is based on the concept of model reference adaptive control (MRAC) and Lyapunov direct method. In the development, it is assumed that the end-effector performs slowly varying motion. Computer simulation is performed to investigate the performance of the developed control scheme on position control of the end-effector. Simulation results manifest that the adaptive control scheme provides excellent tracking of several test paths.

  20. Vitality Forms Processing in the Insula during Action Observation: A Multivoxel Pattern Analysis

    PubMed Central

    Di Cesare, Giuseppe; Valente, Giancarlo; Di Dio, Cinzia; Ruffaldi, Emanuele; Bergamasco, Massimo; Goebel, Rainer; Rizzolatti, Giacomo

    2016-01-01

    Observing the style of an action done by others allows the observer to understand the cognitive state of the agent. This information has been defined by Stern “vitality forms”. Previous experiments showed that the dorso-central insula is selectively active both during vitality form observation and execution. In the present study, we presented participants with videos showing hand actions performed with different velocities and asked them to judge either their vitality form (gentle, neutral, rude) or their velocity (slow, medium, fast). The aim of the present study was to assess, using multi-voxel pattern analysis, whether vitality forms and velocities of observed goal-directed actions are differentially processed in the insula, and more specifically whether action velocity is encoded per se or it is an element that triggers neural populations of the insula encoding the vitality form. The results showed that, consistently across subjects, in the dorso-central sector of the insula there were voxels selectively tuned to vitality forms, while voxel tuned to velocity were rare. These results indicate that the dorso-central insula, which previous data showed to be involved in the vitality form processing, contains voxels specific for the action style processing. PMID:27375461

  1. NGVLA Observations of Dense Gas Filaments in Star-Forming Regions

    NASA Astrophysics Data System (ADS)

    Di Francesco, James; Chen, Mike; Keown, Jared; GAS Team, KEYSTONE Team

    2018-01-01

    Recent observations of continuum emission from nearby star-forming regions with Herschel and JCMT have revealed that filaments are ubiquitous structures within molecular clouds. Such filaments appear to be intimately connected to star formation, with those having column densities of AV > 8 hosting the majority of prestellar cores and young protostars in clouds. Indeed, this “threshold” can be explained simply as the result of supercritical cylinder fragmentation. How specifically star-forming filaments form in molecular clouds, however, remains unclear, though gravity and turbulence are likely involved. Observations of their kinematics are needed to understand how mass flows both onto and through these filaments. We show here results from two recent surveys, the Green Bank Ammonia Survey (GAS) and the K-band Examinations of Young Stellar Object Natal Environments (KEYSTONE) that have used the Green Bank Telescope’s K-band Focal Plane Array instrument to map NH3 (1,1) emission from dense gas in nearby star-forming regions. Data from both surveys show that NH3 emission traces extremely well the high column density gas across these star-forming regions. In particular, the GAS results for NGC 1333 show NH3-based velocity gradients either predominantly parallel or perpendicular to the filament spines. Though the GAS and KEYSTONE data are vital for probing filaments, higher resolutions than possible with the GBT alone are needed to examine the kinematic patterns on the 0.1-pc scales of star-forming cores within filaments. We describe how the Next Generation Very Large Array (NGVLA) will uniquely provide the key wide-field data of high sensitivity needed to explore how ambient gas in molecular clouds forms filaments that evolve toward star formation.

  2. Direct Observation of Accretion onto a Hypernova's Newly Formed Black Hole

    NASA Astrophysics Data System (ADS)

    Milisavljevic, Dan

    2017-09-01

    Models of energetic core-collapse supernovae and long-duration gamma-ray bursts often invoke engine-driven scenarios associated with the formation of compact objects that input energy into the explosion. To date, only indirect evidence of black holes or magnetars formed in these events exists from observations obtained when the explosions are most luminous. Here we request a modest 15 ks Chandra pilot observation of the exceptionally important nearby hypernova SN2002ap to test models that predict X-ray emission associated with its remnant black hole to be detectable after 15 yr of ejecta expansion. Direct observation a newly formed "baby" black hole would be a landmark discovery capable of opening up new ways to investigate fundamental aspects of the core collapse process.

  3. Development of a 6DOF robotic motion phantom for radiation therapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belcher, Andrew H.; Liu, Xinmin; Grelewicz, Zachary

    Purpose: The use of medical technology capable of tracking patient motion or positioning patients along 6 degree-of-freedom (6DOF) has steadily increased in the field of radiation therapy. However, due to the complex nature of tracking and performing 6DOF motion, it is critical that such technology is properly verified to be operating within specifications in order to ensure patient safety. In this study, a robotic motion phantom is presented that can be programmed to perform highly accurate motion along any X (left–right), Y (superior–inferior), Z (anterior–posterior), pitch (around X), roll (around Y), and yaw (around Z) axes. In addition, highly synchronizedmore » motion along all axes can be performed in order to simulate the dynamic motion of a tumor in 6D. The accuracy and reproducibility of this 6D motion were characterized. Methods: An in-house designed and built 6D robotic motion phantom was constructed following the Stewart–Gough parallel kinematics platform archetype. The device was controlled using an inverse kinematics formulation, and precise movements in all 6 degrees-of-freedom (X, Y, Z, pitch, roll, and yaw) were performed, both simultaneously and separately for each degree-of-freedom. Additionally, previously recorded 6D cranial and prostate motions were effectively executed. The robotic phantom movements were verified using a 15 fps 6D infrared marker tracking system and the measured trajectories were compared quantitatively to the intended input trajectories. The workspace, maximum 6D velocity, backlash, and weight load capabilities of the system were also established. Results: Evaluation of the 6D platform demonstrated translational root mean square error (RMSE) values of 0.14, 0.22, and 0.08 mm over 20 mm in X and Y and 10 mm in Z, respectively, and rotational RMSE values of 0.16°, 0.06°, and 0.08° over 10° of pitch, roll, and yaw, respectively. The robotic stage also effectively performed controlled 6D motions, as well as

  4. Validation of a Custom Instrumented Retainer Form Factor for Measuring Linear and Angular Head Impact Kinematics.

    PubMed

    Miller, Logan E; Kuo, Calvin; Wu, Lyndia C; Urban, Jillian E; Camarillo, David B; Stitzel, Joel D

    2018-05-01

    Head impact exposure in popular contact sports is not well understood, especially in the youth population, despite recent advances in impact-sensing technology which has allowed widespread collection of real-time head impact data. Previous studies indicate that a custom-instrumented mouthpiece is a superior method for collecting accurate head acceleration data. The objective of this study was to evaluate the efficacy of mounting a sensor device inside an acrylic retainer form factor to measure six-degrees-of-freedom (6DOF) head kinematic response. This study compares 6DOF mouthpiece kinematics at the head center of gravity (CG) to kinematics measured by an anthropomorphic test device (ATD). This study found that when instrumentation is mounted in the rigid retainer form factor, there is good coupling with the upper dentition and highly accurate kinematic results compared to the ATD. Peak head kinematics were correlated with r2 > 0.98 for both rotational velocity and linear acceleration and r2 = 0.93 for rotational acceleration. These results indicate that a rigid retainer-based form factor is an accurate and promising method of collecting head impact data. This device can be used to study head impacts in helmeted contact sports such as football, hockey, and lacrosse as well as nonhelmeted sports such as soccer and basketball. Understanding the magnitude and frequency of impacts sustained in various sports using an accurate head impact sensor, such as the one presented in this study, will improve our understanding of head impact exposure and sports-related concussion.

  5. Optimal design of an alignment-free two-DOF rehabilitation robot for the shoulder complex.

    PubMed

    Galinski, Daniel; Sapin, Julien; Dehez, Bruno

    2013-06-01

    This paper presents the optimal design of an alignment-free exoskeleton for the rehabilitation of the shoulder complex. This robot structure is constituted of two actuated joints and is linked to the arm through passive degrees of freedom (DOFs) to drive the flexion-extension and abduction-adduction movements of the upper arm. The optimal design of this structure is performed through two steps. The first step is a multi-objective optimization process aiming to find the best parameters characterizing the robot and its position relative to the patient. The second step is a comparison process aiming to select the best solution from the optimization results on the basis of several criteria related to practical considerations. The optimal design process leads to a solution outperforming an existing solution on aspects as kinematics or ergonomics while being more simple.

  6. The Role of Direct and Visual Force Feedback in Suturing Using a 7-DOF Dual-Arm Teleoperated System.

    PubMed

    Talasaz, Ali; Trejos, Ana Luisa; Patel, Rajni V

    2017-01-01

    The lack of haptic feedback in robotics-assisted surgery can result in tissue damage or accidental tool-tissue hits. This paper focuses on exploring the effect of haptic feedback via direct force reflection and visual presentation of force magnitudes on performance during suturing in robotics-assisted minimally invasive surgery (RAMIS). For this purpose, a haptics-enabled dual-arm master-slave teleoperation system capable of measuring tool-tissue interaction forces in all seven Degrees-of-Freedom (DOFs) was used. Two suturing tasks, tissue puncturing and knot-tightening, were chosen to assess user skills when suturing on phantom tissue. Sixteen subjects participated in the trials and their performance was evaluated from various points of view: force consistency, number of accidental hits with tissue, amount of tissue damage, quality of the suture knot, and the time required to accomplish the task. According to the results, visual force feedback was not very useful during the tissue puncturing task as different users needed different amounts of force depending on the penetration of the needle into the tissue. Direct force feedback, however, was more useful for this task to apply less force and to minimize the amount of damage to the tissue. Statistical results also reveal that both visual and direct force feedback were required for effective knot tightening: direct force feedback could reduce the number of accidental hits with the tissue and also the amount of tissue damage, while visual force feedback could help to securely tighten the suture knots and maintain force consistency among different trials/users. These results provide evidence of the importance of 7-DOF force reflection when performing complex tasks in a RAMIS setting.

  7. Sensor module design and forward and inverse kinematics analysis of 6-DOF sorting transferring robot

    NASA Astrophysics Data System (ADS)

    Zhou, Huiying; Lin, Jiajian; Liu, Lei; Tao, Meng

    2017-09-01

    To meet the demand of high strength express sorting, it is significant to design a robot with multiple degrees of freedom that can sort and transfer. This paper uses infrared sensor, color sensor and pressure sensor to receive external information, combine the plan of motion path in advance and the feedback information from the sensors, then write relevant program. In accordance with these, we can design a 6-DOF robot that can realize multi-angle seizing. In order to obtain characteristics of forward and inverse kinematics, this paper describes the coordinate directions and pose estimation by the D-H parameter method and closed solution. On the basis of the solution of forward and inverse kinematics, geometric parameters of links and link parameters are optimized in terms of application requirements. In this way, this robot can identify route, sort and transfer.

  8. 6 DOF synchronized control for spacecraft formation flying with input constraint and parameter uncertainties.

    PubMed

    Lv, Yueyong; Hu, Qinglei; Ma, Guangfu; Zhou, Jiakang

    2011-10-01

    This paper treats the problem of synchronized control of spacecraft formation flying (SFF) in the presence of input constraint and parameter uncertainties. More specifically, backstepping based robust control is first developed for the total 6 DOF dynamic model of SFF with parameter uncertainties, in which the model consists of relative translation and attitude rotation. Then this controller is redesigned to deal with the input constraint problem by incorporating a command filter such that the generated control could be implementable even under physical or operating constraints on the control input. The convergence of the proposed control algorithms is proved by the Lyapunov stability theorem. Compared with conventional methods, illustrative simulations of spacecraft formation flying are conducted to verify the effectiveness of the proposed approach to achieve the spacecraft track the desired attitude and position trajectories in a synchronized fashion even in the presence of uncertainties, external disturbances and control saturation constraint. Copyright © 2011 ISA. Published by Elsevier Ltd. All rights reserved.

  9. Synchronization of multiple 3-DOF helicopters under actuator faults and saturations with prescribed performance.

    PubMed

    Yang, Huiliao; Jiang, Bin; Yang, Hao; Liu, Hugh H T

    2018-04-01

    The distributed cooperative control strategy is proposed to make the networked nonlinear 3-DOF helicopters achieve the attitude synchronization in the presence of actuator faults and saturations. Based on robust adaptive control, the proposed control method can both compensate the uncertain partial loss of control effectiveness and deal with the system uncertainties. To address actuator saturation problem, the control scheme is designed to ensure that the saturation constraint on the actuation will not be violated during the operation in spite of the actuator faults. It is shown that with the proposed control strategy, both the tracking errors of the leading helicopter and the attitude synchronization errors of each following helicopter are bounded in the existence of faulty actuators and actuator saturations. Moreover, the state responses of the entire group would not exceed the predesigned performance functions which are totally independent from the underlaying interaction topology. Simulation results illustrate the effectiveness of the proposed control scheme. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

  10. An Adaptive 6-DOF Tracking Method by Hybrid Sensing for Ultrasonic Endoscopes

    PubMed Central

    Du, Chengyang; Chen, Xiaodong; Wang, Yi; Li, Junwei; Yu, Daoyin

    2014-01-01

    In this paper, a novel hybrid sensing method for tracking an ultrasonic endoscope within the gastrointestinal (GI) track is presented, and the prototype of the tracking system is also developed. We implement 6-DOF localization by sensing integration and information fusion. On the hardware level, a tri-axis gyroscope and accelerometer, and a magnetic angular rate and gravity (MARG) sensor array are attached at the end of endoscopes, and three symmetric cylindrical coils are placed around patients' abdomens. On the algorithm level, an adaptive fast quaternion convergence (AFQC) algorithm is introduced to determine the orientation by fusing inertial/magnetic measurements, in which the effects of magnetic disturbance and acceleration are estimated to gain an adaptive convergence output. A simplified electro-magnetic tracking (SEMT) algorithm for dimensional position is also implemented, which can easily integrate the AFQC's results and magnetic measurements. Subsequently, the average position error is under 0.3 cm by reasonable setting, and the average orientation error is 1° without noise. If magnetic disturbance or acceleration exists, the average orientation error can be controlled to less than 3.5°. PMID:24915179

  11. Design and control of a 3-DOF rehabilitation robot for forearm and wrist.

    PubMed

    Lincong Luo; Liang Peng; Zengguang Hou; Weiqun Wang

    2017-07-01

    This paper presents a 3-DOF compact rehabilitation robot, involving mechanical structure design, control system design and gravity compensation analysis. The robot can simultaneously provide assistance for pronation/supination(P/S), flexion/extension(F/E) and adduction/abduction(A/A) joints rehabilitation training. The P/S and F/E joints are designed to be driven by cable transmission to gain a high backdrivability, and an adjustment plate is adopted to decrease the distance between the rotation axis of F/E joint of the human wrist and the robot. In addition, gravity compensation is considered to offset the impact of self-gravity on the performance of the controller. A "moving window" control strategy based on impedance control is proposed and implemented on the robot. A comparison between the "moving window" control and classical impedance control indicates that the former has more potential to stimulate the voluntary efforts of the participant, and has a less limitation moving in a fixed reference trajectory. Meanwhile, the results also validate the feasibility and safety of the wrist robot system.

  12. Quantum Computation Based on Photons with Three Degrees of Freedom

    PubMed Central

    Luo, Ming-Xing; Li, Hui-Ran; Lai, Hong; Wang, Xiaojun

    2016-01-01

    Quantum systems are important resources for quantum computer. Different from previous encoding forms using quantum systems with one degree of freedom (DoF) or two DoFs, we investigate the possibility of photon systems encoding with three DoFs consisting of the polarization DoF and two spatial DoFs. By exploring the optical circular birefringence induced by an NV center in a diamond embedded in the photonic crystal cavity, we propose several hybrid controlled-NOT (hybrid CNOT) gates operating on the two-photon or one-photon system. These hybrid CNOT gates show that three DoFs may be encoded as independent qubits without auxiliary DoFs. Our result provides a useful way to reduce quantum simulation resources by exploring complex quantum systems for quantum applications requiring large qubit systems. PMID:27174302

  13. Quantum Computation Based on Photons with Three Degrees of Freedom.

    PubMed

    Luo, Ming-Xing; Li, Hui-Ran; Lai, Hong; Wang, Xiaojun

    2016-05-13

    Quantum systems are important resources for quantum computer. Different from previous encoding forms using quantum systems with one degree of freedom (DoF) or two DoFs, we investigate the possibility of photon systems encoding with three DoFs consisting of the polarization DoF and two spatial DoFs. By exploring the optical circular birefringence induced by an NV center in a diamond embedded in the photonic crystal cavity, we propose several hybrid controlled-NOT (hybrid CNOT) gates operating on the two-photon or one-photon system. These hybrid CNOT gates show that three DoFs may be encoded as independent qubits without auxiliary DoFs. Our result provides a useful way to reduce quantum simulation resources by exploring complex quantum systems for quantum applications requiring large qubit systems.

  14. A ring-type multi-DOF ultrasonic motor with four feet driving consistently.

    PubMed

    Shi, Shengjun; Xiong, Huaiyin; Liu, Yingxiang; Chen, Weishan; Liu, Junkao

    2017-04-01

    A new type of multiple-degree-of-freedom (multi-DOF) ultrasonic motor was developed aiming at high output torque and compact structure. To reach this purpose, a ring type composite stator was proposed with four driving feet uniformly arranged in the inner circumference of the ring stator. The stator employs two orthogonal axial bending modes and a radial bending mode, by exciting two of them simultaneously, to generate elliptic trajectories on driving feet tips and to push sphere rotor around x, y and z axis respectively. Based on the deduced criteria, a specific combination of the A(0,5) axial bending modes and R(0,2) radial bending mode were chosen to realize that the rotating directions of the elliptical driving trajectories on four feet tips can push the sphere rotor to spin in the same direction consistently, thus the efficiency and output performance will be improved by decreasing the slip between feet and rotor. FEM was used to design the motor including selecting key parameters to tune the resonant frequencies by sensitivity analysis, and a prototype was fabricated and tested. The experiment results showed that the maximum output torque of the motor is 0.118Nm and the maximum speed is 55r/min. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Design of a 7-DOF haptic master using a magneto-rheological devices for robot surgery

    NASA Astrophysics Data System (ADS)

    Kang, Seok-Rae; Choi, Seung-Bok; Hwang, Yong-Hoon; Cha, Seung-Woo

    2017-04-01

    This paper presents a 7 degrees-of-freedom (7-DOF) haptic master which is applicable to the robot-assisted minimally invasive surgery (RMIS). By utilizing a controllable magneto-rheological (MR) fluid, the haptic master can provide force information to the surgeon during surgery. The proposed haptic master consists of three degrees motions of X, Y, Z and four degrees motions of the pitch, yaw, roll and grasping. All of them have force feedback capability. The proposed haptic master can generate the repulsive forces or torques by activating MR clutch and MR brake. Both MR clutch and MR brake are designed and manufactured with consideration of the size and output torque which is usable to the robotic surgery. A proportional-integral-derivative (PID) controller is then designed and implemented to achieve torque/force tracking trajectories. It is verified that the proposed haptic master can track well the desired torque and force occurred in the surgical place by controlling the input current applied to MR clutch and brake.

  16. Design and Preliminary Evaluation of a Two DOFs Cable-Driven Ankle–Foot Prosthesis with Active Dorsiflexion–Plantarflexion and Inversion–Eversion

    PubMed Central

    Ficanha, Evandro Maicon; Ribeiro, Guilherme Aramizo; Dallali, Houman; Rastgaar, Mohammad

    2016-01-01

    This paper describes the design of an ankle–foot robotic prosthesis controllable in the sagittal and frontal planes. The prosthesis was designed to meet the mechanical characteristics of the human ankle including power, range of motion, and weight. To transfer the power from the motors and gearboxes to the ankle–foot mechanism, a Bowden cable system was used. The Bowden cable allows for optimal placement of the motors and gearboxes in order to improve gait biomechanics such as the metabolic energy cost and gait asymmetry during locomotion. Additionally, it allows flexibility in the customization of the device to amputees with different residual limb sizes. To control the prosthesis, impedance controllers in both sagittal and frontal planes were developed. The impedance controllers used torque feedback from strain gages installed on the foot. Preliminary evaluation was performed to verify the capability of the prosthesis to track the kinematics of the human ankle in two degrees of freedom (DOFs), the mechanical efficiency of the Bowden cable transmission, and the ability of the prosthesis to modulate the impedance of the ankle. Moreover, the system was characterized by describing the relationship between the stiffness of the impedance controllers to the actual stiffness of the ankle. Efficiency estimation showed 85.4% efficiency in the Bowden cable transmission. The prosthesis was capable of properly mimicking human ankle kinematics and changing its mechanical impedance in two DOFs in real time with a range of stiffness sufficient for normal human walking. In dorsiflexion–plantarflexion (DP), the stiffness ranged from 0 to 236 Nm/rad and in inversion–eversion (IE), the stiffness ranged from 1 to 33 Nm/rad. PMID:27200342

  17. A combined vision-inertial fusion approach for 6-DoF object pose estimation

    NASA Astrophysics Data System (ADS)

    Li, Juan; Bernardos, Ana M.; Tarrío, Paula; Casar, José R.

    2015-02-01

    The estimation of the 3D position and orientation of moving objects (`pose' estimation) is a critical process for many applications in robotics, computer vision or mobile services. Although major research efforts have been carried out to design accurate, fast and robust indoor pose estimation systems, it remains as an open challenge to provide a low-cost, easy to deploy and reliable solution. Addressing this issue, this paper describes a hybrid approach for 6 degrees of freedom (6-DoF) pose estimation that fuses acceleration data and stereo vision to overcome the respective weaknesses of single technology approaches. The system relies on COTS technologies (standard webcams, accelerometers) and printable colored markers. It uses a set of infrastructure cameras, located to have the object to be tracked visible most of the operation time; the target object has to include an embedded accelerometer and be tagged with a fiducial marker. This simple marker has been designed for easy detection and segmentation and it may be adapted to different service scenarios (in shape and colors). Experimental results show that the proposed system provides high accuracy, while satisfactorily dealing with the real-time constraints.

  18. Integration of computer-assisted fracture reduction system and a hybrid 3-DOF-RPS mechanism for assisting the orthopedic surgery

    NASA Astrophysics Data System (ADS)

    Irwansyah; Sinh, N. P.; Lai, J. Y.; Essomba, T.; Asbar, R.; Lee, P. Y.

    2018-02-01

    In this paper, we present study to integrate virtual fracture bone reduction simulation tool with a novel hybrid 3-DOF-RPS external fixator to relocate back bone fragments into their anatomically original position. A 3D model of fractured bone was reconstructed and manipulated using 3D design and modeling software, PhysiGuide. The virtual reduction system was applied to reduce a bilateral femoral shaft fracture type 32-A3. Measurement data from fracture reduction and fixation stages were implemented to manipulate the manipulator pose in patient’s clinical case. The experimental result presents that by merging both of those techniques will give more possibilities to reduce virtual bone reduction time, improve facial and shortest healing treatment.

  19. Non-symmetric forms of non-linear vibrations of flexible cylindrical panels and plates under longitudinal load and additive white noise

    NASA Astrophysics Data System (ADS)

    Krysko, V. A.; Awrejcewicz, J.; Krylova, E. Yu; Papkova, I. V.; Krysko, A. V.

    2018-06-01

    Parametric non-linear vibrations of flexible cylindrical panels subjected to additive white noise are studied. The governing Marguerre equations are investigated using the finite difference method (FDM) of the second-order accuracy and the Runge-Kutta method. The considered mechanical structural member is treated as a system of many/infinite number of degrees of freedom (DoF). The dependence of chaotic vibrations on the number of DoFs is investigated. Reliability of results is guaranteed by comparing the results obtained using two qualitatively different methods to reduce the problem of PDEs (partial differential equations) to ODEs (ordinary differential equations), i.e. the Faedo-Galerkin method in higher approximations and the 4th and 6th order FDM. The Cauchy problem obtained by the FDM is eventually solved using the 4th-order Runge-Kutta methods. The numerical experiment yielded, for a certain set of parameters, the non-symmetric vibration modes/forms with and without white noise. In particular, it has been illustrated and discussed that action of white noise on chaotic vibrations implies quasi-periodicity, whereas the previously non-symmetric vibration modes are closer to symmetric ones.

  20. Spectral Upscaling for Graph Laplacian Problems with Application to Reservoir Simulation

    DOE PAGES

    Barker, Andrew T.; Lee, Chak S.; Vassilevski, Panayot S.

    2017-10-26

    Here, we consider coarsening procedures for graph Laplacian problems written in a mixed saddle-point form. In that form, in addition to the original (vertex) degrees of freedom (dofs), we also have edge degrees of freedom. We extend previously developed aggregation-based coarsening procedures applied to both sets of dofs to now allow more than one coarse vertex dof per aggregate. Those dofs are selected as certain eigenvectors of local graph Laplacians associated with each aggregate. Additionally, we coarsen the edge dofs by using traces of the discrete gradients of the already constructed coarse vertex dofs. These traces are defined on themore » interface edges that connect any two adjacent aggregates. The overall procedure is a modification of the spectral upscaling procedure developed in for the mixed finite element discretization of diffusion type PDEs which has the important property of maintaining inf-sup stability on coarse levels and having provable approximation properties. We consider applications to partitioning a general graph and to a finite volume discretization interpreted as a graph Laplacian, developing consistent and accurate coarse-scale models of a fine-scale problem.« less

  1. Dimensional synthesis of a 3-DOF parallel manipulator with full circle rotation

    NASA Astrophysics Data System (ADS)

    Ni, Yanbing; Wu, Nan; Zhong, Xueyong; Zhang, Biao

    2015-07-01

    Parallel robots are widely used in the academic and industrial fields. In spite of the numerous achievements in the design and dimensional synthesis of the low-mobility parallel robots, few research efforts are directed towards the asymmetric 3-DOF parallel robots whose end-effector can realize 2 translational and 1 rotational(2T1R) motion. In order to develop a manipulator with the capability of full circle rotation to enlarge the workspace, a new 2T1R parallel mechanism is proposed. The modeling approach and kinematic analysis of this proposed mechanism are investigated. Using the method of vector analysis, the inverse kinematic equations are established. This is followed by a vigorous proof that this mechanism attains an annular workspace through its circular rotation and 2 dimensional translations. Taking the first order perturbation of the kinematic equations, the error Jacobian matrix which represents the mapping relationship between the error sources of geometric parameters and the end-effector position errors is derived. With consideration of the constraint conditions of pressure angles and feasible workspace, the dimensional synthesis is conducted with a goal to minimize the global comprehensive performance index. The dimension parameters making the mechanism to have optimal error mapping and kinematic performance are obtained through the optimization algorithm. All these research achievements lay the foundation for the prototype building of such kind of parallel robots.

  2. Robust energy harvesting from walking vibrations by means of nonlinear cantilever beams

    NASA Astrophysics Data System (ADS)

    Kluger, Jocelyn M.; Sapsis, Themistoklis P.; Slocum, Alexander H.

    2015-04-01

    by the cantilever-surface mechanism. The optimization results show that the 2DOF nonlinear system presents the best average performance when the excitation signals have three possible forms. Moreover, we observe that while for the linear systems the optimal performance is obtained for small values of the electromagnetic damping, for the 2DOF nonlinear system optimal performance is achieved for large values of damping. This feature is of particular importance for the system's robustness to parasitic damping.

  3. Development and first use of a novel cylindrical ball bearing phantom for 9-DOF geometric calibrations of flat panel imaging devices used in image-guided ion beam therapy

    NASA Astrophysics Data System (ADS)

    Zechner, A.; Stock, M.; Kellner, D.; Ziegler, I.; Keuschnigg, P.; Huber, P.; Mayer, U.; Sedlmayer, F.; Deutschmann, H.; Steininger, P.

    2016-11-01

    Image guidance during highly conformal radiotherapy requires accurate geometric calibration of the moving components of the imager. Due to limited manufacturing accuracy and gravity-induced flex, an x-ray imager’s deviation from the nominal geometrical definition has to be corrected for. For this purpose a ball bearing phantom applicable for nine degrees of freedom (9-DOF) calibration of a novel cone-beam computed tomography (CBCT) scanner was designed and validated. In order to ensure accurate automated marker detection, as many uniformly distributed markers as possible should be used with a minimum projected inter-marker distance of 10 mm. Three different marker distributions on the phantom cylinder surface were simulated. First, a fixed number of markers are selected and their coordinates are randomly generated. Second, the quasi-random method is represented by setting a constraint on the marker distances in the projections. The third approach generates the ball coordinates helically based on the Golden ratio, ϕ. Projection images of the phantom incorporating the CBCT scanner’s geometry were simulated and analysed with respect to uniform distribution and intra-marker distance. Based on the evaluations a phantom prototype was manufactured and validated by a series of flexmap calibration measurements and analyses. The simulation with randomly distributed markers as well as the quasi-random approach showed an insufficient uniformity of the distribution over the detector area. The best compromise between uniform distribution and a high packing fraction of balls is provided by the Golden section approach. A prototype was manufactured accordingly. The phantom was validated for 9-DOF geometric calibrations of the CBCT scanner with independently moveable source and detector arms. A novel flexmap calibration phantom intended for 9-DOF was developed. The ball bearing distribution based on the Golden section was found to be highly advantageous. The phantom showed

  4. Development and first use of a novel cylindrical ball bearing phantom for 9-DOF geometric calibrations of flat panel imaging devices used in image-guided ion beam therapy.

    PubMed

    Zechner, A; Stock, M; Kellner, D; Ziegler, I; Keuschnigg, P; Huber, P; Mayer, U; Sedlmayer, F; Deutschmann, H; Steininger, P

    2016-11-21

    Image guidance during highly conformal radiotherapy requires accurate geometric calibration of the moving components of the imager. Due to limited manufacturing accuracy and gravity-induced flex, an x-ray imager's deviation from the nominal geometrical definition has to be corrected for. For this purpose a ball bearing phantom applicable for nine degrees of freedom (9-DOF) calibration of a novel cone-beam computed tomography (CBCT) scanner was designed and validated. In order to ensure accurate automated marker detection, as many uniformly distributed markers as possible should be used with a minimum projected inter-marker distance of 10 mm. Three different marker distributions on the phantom cylinder surface were simulated. First, a fixed number of markers are selected and their coordinates are randomly generated. Second, the quasi-random method is represented by setting a constraint on the marker distances in the projections. The third approach generates the ball coordinates helically based on the Golden ratio, ϕ. Projection images of the phantom incorporating the CBCT scanner's geometry were simulated and analysed with respect to uniform distribution and intra-marker distance. Based on the evaluations a phantom prototype was manufactured and validated by a series of flexmap calibration measurements and analyses. The simulation with randomly distributed markers as well as the quasi-random approach showed an insufficient uniformity of the distribution over the detector area. The best compromise between uniform distribution and a high packing fraction of balls is provided by the Golden section approach. A prototype was manufactured accordingly. The phantom was validated for 9-DOF geometric calibrations of the CBCT scanner with independently moveable source and detector arms. A novel flexmap calibration phantom intended for 9-DOF was developed. The ball bearing distribution based on the Golden section was found to be highly advantageous. The phantom showed

  5. A T-Type Capacitive Sensor Capable of Measuring 5-DOF Error Motions of Precision Spindles

    PubMed Central

    Xiang, Kui; Qiu, Rongbo; Mei, Deqing; Chen, Zichen

    2017-01-01

    The precision spindle is a core component of high-precision machine tools, and the accurate measurement of its error motions is important for improving its rotation accuracy as well as the work performance of the machine. This paper presents a T-type capacitive sensor (T-type CS) with an integrated structure. The proposed sensor can measure the 5-degree-of-freedom (5-DOF) error motions of a spindle in-situ and simultaneously by integrating electrode groups in the cylindrical bore of the stator and the outer end face of its flange, respectively. Simulation analysis and experimental results show that the sensing electrode groups with differential measurement configuration have near-linear output for the different types of rotor displacements. What’s more, the additional capacitance generated by fringe effects has been reduced about 90% with the sensing electrode groups fabricated based on flexible printed circuit board (FPCB) and related processing technologies. The improved signal processing circuit has also been increased one times in the measuring performance and makes the measured differential output capacitance up to 93% of the theoretical values. PMID:28846631

  6. Multi-innovation auto-constructed least squares identification for 4 DOF ship manoeuvring modelling with full-scale trial data.

    PubMed

    Zhang, Guoqing; Zhang, Xianku; Pang, Hongshuai

    2015-09-01

    This research is concerned with the problem of 4 degrees of freedom (DOF) ship manoeuvring identification modelling with the full-scale trial data. To avoid the multi-innovation matrix inversion in the conventional multi-innovation least squares (MILS) algorithm, a new transformed multi-innovation least squares (TMILS) algorithm is first developed by virtue of the coupling identification concept. And much effort is made to guarantee the uniformly ultimate convergence. Furthermore, the auto-constructed TMILS scheme is derived for the ship manoeuvring motion identification by combination with a statistic index. Comparing with the existing results, the proposed scheme has the significant computational advantage and is able to estimate the model structure. The illustrative examples demonstrate the effectiveness of the proposed algorithm, especially including the identification application with full-scale trial data. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

  7. Concurrent Validity of the Classroom Strategies Scale for Elementary School--Observer Form

    ERIC Educational Resources Information Center

    Reddy, Linda A.; Fabiano, Gregory A.; Dudek, Christopher M.

    2013-01-01

    The present study is an initial investigation of the concurrent validity of a new assessment, the Classroom Strategies Scale (CSS version 2.0) for Elementary School--Observer Form. The CSS assesses teachers' use of instructional and behavioral management strategies. In the present study, the CSS is compared to the Classroom Assessment Scoring…

  8. JPL Developments in Retrieval Algorithms for Geostationary Observations - Applications to H2CO

    NASA Technical Reports Server (NTRS)

    Kurosu, Thomas P.; Kulawik, Susan; Natraj, Vijay

    2012-01-01

    JPL has strong expertise in atmospheric retrievals from UV and thermal IR, and a wide range of tools to apply to observations and instrument characterization. Radiative Transfer, AMF, Inversion, Fitting, Assimilation. Tools were applied for a preliminary study of H2CO sensitivities from GEO. Results show promise for moderate/strong H2CO lading but also that low background conditions will prove a challenge. H2CO DOF are not too strongly dependent on FWHM. GEMS (Geostationary Environmental Monitoring Spectrometer) choice of 0.6 nm FWHM (?) spectral resolution is adequate for H2CO retrievals. Case study can easily be adapted to GEMS observations/instrument model for more in-depth sensitivity characterization.

  9. NTT Observations Indicate that Brown Dwarfs Form Like Stars

    NASA Astrophysics Data System (ADS)

    2001-06-01

    Dusty Disks Detected around Very Young Substellar Objects in the Orion Nebula Summary An international team of astronomers [2] is announcing today the discovery of dusty disks surrounding numerous very faint objects that are believed to be recently formed Brown Dwarfs in the Orion Nebula [3]. This finding is based on detailed observations with SOFI, a specialised infrared-sensitive instrument at the ESO 3.5-m New Technology Telescope at the La Silla Observatory. It is of special interest because it sheds light on the origin and nature of substellar objects, known as "Brown Dwarfs" . In particular, these results suggest that Brown Dwarfs share a common origin with stars and that Brown Dwarfs are more similar in nature to stars than to planets and, like stars, have the potential to form with accompanying systems of planets. Moreover, the presence of dusty protoplanetary disks around the faintest objects in the Orion Nebula cluster confirms both the membership of these faint stars in the cluster and their nature as bona-fide substellar objects, making this the largest population of Brown Dwarf objects yet known . These important results are being reported today to the American Astronomical Society Meeting in Pasadena (California, USA). PR Photo 22a/01 : Infrared picture of the Orion Nebula (NTT + SOFI). PR Photo 22b/01 : "Finding Chart" for Very Young Brown Dwarfs in the Orion Nebula. PR Photo 22c/01 : Animated GIF presentation of PR Photos 22a+b/01. Faint substellar objects in the Milky Way Over the past 5 years, several groups of astronomers have identified a type of very faint, substellar objects within our Milky Way galaxy. These gaseous objects have very low masses and will never shine like normal stars because they cannot achieve central temperatures high enough for sustained thermal nuclear reactions to occur in their cores. Such objects weigh less than about 7% of our Sun and have been variously called "Brown Dwarfs" , "Failed Stars" or "Super Planets

  10. Design of human controlled 1 DOF right hand exoskeleton using electromyography signal

    NASA Astrophysics Data System (ADS)

    Azzam, M.; Wijaya, S. K.; Prawito

    2017-07-01

    Exoskeleton in general is a structure that is anatomically designed to be able to accommodate the physical movement of its user and provide additional strength. The use of EMG signal to control a 1 DOF right arm exoskeleton is evaluated in this research. This research aims to achieve optimum control using EMG signal. EMG signal is a variation of voltage that occurs when muscle contracts hence its strong correlation with the user's intention of movement. The RMS values of each EMG signal that originates from bicep and tricep muscle are calculated and processed to determine the direction and speed of rotation of a DC motor that actuates the exoskeleton. The RMS calculation is conducted at various array length that will theoretically affect its accuracy. The difference between those two RMS values is then calculated and interpreted as the intention of flexion or extension movement that will control the DC motor rotational direction. The absolute value of the RMS difference multiplied with a gain factor is used to regulate the duty cycle of a PWM signal that is used to control the rotational speed of the DC motor. To achieve the smallest settling time, array length and gain factor were varied. The test was conducted in two stages, static and dynamic tests. The test result shows a trend where the settling time decreases when array length is shortened and gain is increased. It shows that optimum control can be achieved by selecting the right array length and gain.

  11. A 6-DOF parallel bone-grinding robot for cervical disc replacement surgery.

    PubMed

    Tian, Heqiang; Wang, Chenchen; Dang, Xiaoqing; Sun, Lining

    2017-12-01

    Artificial cervical disc replacement surgery has become an effective and main treatment method for cervical disease, which has become a more common and serious problem for people with sedentary work. To improve cervical disc replacement surgery significantly, a 6-DOF parallel bone-grinding robot is developed for cervical bone-grinding by image navigation and surgical plan. The bone-grinding robot including mechanical design and low level control is designed. The bone-grinding robot navigation is realized by optical positioning with spatial registration coordinate system defined. And a parametric robot bone-grinding plan and high level control have been developed for plane grinding for cervical top endplate and tail endplate grinding by a cylindrical grinding drill and spherical grinding for two articular surfaces of bones by a ball grinding drill. Finally, the surgical flow for a robot-assisted cervical disc replacement surgery procedure is present. The final experiments results verified the key technologies and performance of the robot-assisted surgery system concept excellently, which points out a promising clinical application with higher operability. Finally, study innovations, study limitations, and future works of this present study are discussed, and conclusions of this paper are also summarized further. This bone-grinding robot is still in the initial stage, and there are many problems to be solved from a clinical point of view. Moreover, the technique is promising and can give a good support for surgeons in future clinical work.

  12. Adaptive optimization by 6 DOF robotic couch in prostate volumetric IMRT treatment: rototranslational shift and dosimetric consequences

    PubMed Central

    Placidi, Lorenzo; Azario, Luigi; Mattiucci, Gian Carlo; Greco, Francesca; Damiani, Andrea; Mantini, Giovanna; Frascino, Vincenzo; Piermattei, Angelo; Valentini, Vincenzo; Balducci, Mario

    2015-01-01

    The purpose of this study was to investigate the magnitude and dosimetric relevance of translational and rotational shifts on IGRT prostate volumetric‐modulated arc therapy (VMAT) using Protura six degrees of freedom (DOF) Robotic Patient Positioning System. Patients with cT3aN0M0 prostate cancer, treated with VMAT simultaneous integrated boost (VMAT‐SIB), were enrolled. PTV2 was obtained adding 0.7 cm margin to seminal vesicles base (CTV2), while PTV1 adding to prostate (CTV1) 0.7 cm margin in all directions, except 1.2 cm, as caudal margin. A daily CBCT was acquired before dose delivery. The translational and rotational displacements were corrected through Protura Robotic Couch, collected and applied to the simulation CT to obtain a translated CT (tCT) and a rototranslated CT (rtCT) on which we recalculated the initial treatment plan (TP). We analyzed the correlation between dosimetric coverage, organs at risk (OAR) sparing, and translational or rotational displacements. The dosimetric impact of a rototranslational correction was calculated. From October 2012 to September 2013, a total of 263 CBCT scans from 12 patients were collected. Translational shifts were <5mm in 81% of patients and the rotational shifts were <2∘ in 93% of patient scans. The dosimetric analysis was performed on 172 CBCT scans and calculating 344 VMAT‐TP. Two significant linear correlations were observed between yaw and the V20 femoral heads and between pitch rotation and V50 rectum (p<0.001); rototranslational correction seems to impact more on PTV2 than on PTV1, especially when margins are reduced. Rotational errors are of dosimetric significance in sparing OAR and in target coverage. This is relevant for femoral heads and rectum because of major distance from isocenter, and for seminal vesicles because of irregular shape. No correlation was observed between translational and rotational errors. A study considering the intrafractional error and the deformable registration is ongoing

  13. Stable, non-dissipative, and conservative flux-reconstruction schemes in split forms

    NASA Astrophysics Data System (ADS)

    Abe, Yoshiaki; Morinaka, Issei; Haga, Takanori; Nonomura, Taku; Shibata, Hisaichi; Miyaji, Koji

    2018-01-01

    A stable, non-dissipative, and conservative flux-reconstruction (FR) scheme is constructed and demonstrated for the compressible Euler and Navier-Stokes equations. A proposed FR framework adopts a split form (also known as the skew-symmetric form) for convective terms. Sufficient conditions to satisfy both the primary conservation (PC) and kinetic energy preservation (KEP) properties are rigorously derived by polynomial-based analysis for a general FR framework. It is found that the split form needs to be expressed in the PC split form or KEP split form to satisfy each property in discrete sense. The PC split form is retrieved from existing general forms (Kennedy and Gruber [33]); in contrast, we have newly introduced the KEP split form as a comprehensive form constituting a KEP scheme in the FR framework. Furthermore, Gauss-Lobatto (GL) solution points and g2 correction function are required to satisfy the KEP property while any correction functions are available for the PC property. The split-form FR framework to satisfy the KEP property, eventually, is similar to the split-form DGSEM-GL method proposed by Gassner [23], but which, in this study, is derived solely by polynomial-based analysis without explicitly using the diagonal-norm SBP property. Based on a series of numerical tests (e.g., Sod shock tube), both the PC and KEP properties have been verified. We have also demonstrated that using a non-dissipative KEP flux, a sixteenth-order (p15) simulation of the viscous Taylor-Green vortex (Re = 1 , 600) is stable and its results are free of unphysical oscillations on relatively coarse mesh (total number of degrees of freedom (DoFs) is 1283).

  14. Form and function in hillslope hydrology: characterization of subsurface flow based on response observations

    NASA Astrophysics Data System (ADS)

    Angermann, Lisa; Jackisch, Conrad; Allroggen, Niklas; Sprenger, Matthias; Zehe, Erwin; Tronicke, Jens; Weiler, Markus; Blume, Theresa

    2017-07-01

    The phrase form and function was established in architecture and biology and refers to the idea that form and functionality are closely correlated, influence each other, and co-evolve. We suggest transferring this idea to hydrological systems to separate and analyze their two main characteristics: their form, which is equivalent to the spatial structure and static properties, and their function, equivalent to internal responses and hydrological behavior. While this approach is not particularly new to hydrological field research, we want to employ this concept to explicitly pursue the question of what information is most advantageous to understand a hydrological system. We applied this concept to subsurface flow within a hillslope, with a methodological focus on function: we conducted observations during a natural storm event and followed this with a hillslope-scale irrigation experiment. The results are used to infer hydrological processes of the monitored system. Based on these findings, the explanatory power and conclusiveness of the data are discussed. The measurements included basic hydrological monitoring methods, like piezometers, soil moisture, and discharge measurements. These were accompanied by isotope sampling and a novel application of 2-D time-lapse GPR (ground-penetrating radar). The main finding regarding the processes in the hillslope was that preferential flow paths were established quickly, despite unsaturated conditions. These flow paths also caused a detectable signal in the catchment response following a natural rainfall event, showing that these processes are relevant also at the catchment scale. Thus, we conclude that response observations (dynamics and patterns, i.e., indicators of function) were well suited to describing processes at the observational scale. Especially the use of 2-D time-lapse GPR measurements, providing detailed subsurface response patterns, as well as the combination of stream-centered and hillslope-centered approaches

  15. A 3-DOF parallel robot with spherical motion for the rehabilitation and evaluation of balance performance.

    PubMed

    Patanè, Fabrizio; Cappa, Paolo

    2011-04-01

    In this paper a novel electrically actuated parallel robot with three degrees-of-freedom (3 DOF) for dynamic postural studies is presented. The design has been described, the solution to the inverse kinematics has been found, and a numerical solution for the direct kinematics has been proposed. The workspace of the implemented robot is characterized by an angular range of motion of about ±10° for roll and pitch when yaw is in the range ±15°. The robot was constructed and the orientation accuracy was tested by means of an optoelectronic system and by imposing a sinusoidal input, with a frequency of 1 Hz and amplitude of 10°, along the three axes, in sequence. The collected data indicated a phase delay of 1° and an amplitude error of 0.5%-1.5%; similar values were observed for cross-axis sensitivity errors. We also conducted a clinical application on a group of normal subjects, who were standing in equilibrium on the robot base with eyes open (EO) and eyes closed (EC), which was rotated with a tri-axial sinusoidal trajectory with a frequency of 0.5 Hz and amplitude 5° for roll and pitch and 10° for the yaw. The postural configuration of the subjects was recorded with an optoelectronic system. However, due to the mainly technical nature of this paper, only initial validation outcomes are reported here. The clinical application showed that only the tilt and displacement on the sagittal pane of head, trunk, and pelvis in the trials conducted with eyes closed were affected by drift and that the reduction of the yaw rotation and of the mediolateral translation was not a controlled parameter, as happened, instead, for the other anatomical directions.

  16. Submillimeter-wave Observations of Complex Organic Molecules in Southern Massive Star Forming Regions

    NASA Astrophysics Data System (ADS)

    Kamegai, Kazuhisa; Sakai, Takeshi; Sakai, Nami; Hirota, Tomoya; Yamamoto, Satoshi

    2013-03-01

    Submillimeter-wave observations of complex organic molecules toward southern massive star forming regions were carried out with ASTE 10m telescope. Methyl formate (HCOOCH3) and dimethyl ether (CH3OCH3) were detected in some molecular cloud cores with young protostars. Differences in chemical composition among neighboring cores were also found.

  17. Direct Observation of the BCC (100) Plane in Thin Films of Sphere-forming Diblock Copolymers

    NASA Astrophysics Data System (ADS)

    Ji, Shengxiang; Nagpal, Umang; Liao, Wen; de Pablo, Juan; Nealey, Paul

    2010-03-01

    In sphere-forming diblock copolymers, periodic arrays of spheres are arranged in a body-centred cubic (BCC) lattice structure in bulk. However, in thin films different surface morphologies were observed as a function of the film thickness, and the transition from the hexagonal array to the BCC (110) arrangement of spheres on film surfaces was located with respect to the increase of the film thickness. Here we report the first direct observation of the BCC (100) plane in thin films of poly (styrene-b-methyl methacrylate) diblock copolymers on homogeneous substrates. By balancing the surface energies of both blocks, the lower energy BCC (100) plane corresponding to a square arrangement of half spheres, formed on film surfaces when the film thickness was commensurate with the spacing, L100, between (100) planes or greater than 2 L100. A hexagonal arrangement of spheres was only observed when the thickness was less than 2 L100 and incommensurate with 1 L100. Monte Carlo (MC) simulation confirmed our experimental observation and was used to investigate the transition of the arrangement of spheres as a function of the film thickness.

  18. Molecular Gas Content of an Extremely Star-forming Herschel Observed Lensed Dusty Galaxy at z=2.685

    NASA Astrophysics Data System (ADS)

    Nayyeri, Hooshang; Cooray, Asantha R.; H-ATLAS

    2017-01-01

    We present the results of combined deep near-infrared, far infrared and millimeter observations of an extremely star forming lensed dusty star-forming galaxy (DSFG) identified from the Herschel Astrophysical Terahertz Large Area Survey (H-ATLAS). The high redshift DSFG is gravitationally lensed by a massive WISE identified cluster at z~1 (spectroscopically confirmed with Keck/DEIMOS and Gemini/GMOS) producing multiply lensed images and arcs observed in the optical. The DSFG is spectroscopically confirmed at z=2.685 from CO(1-0) observations by GBT and separately from CO(3-2) observations by CARMA. We use the combined spectroscopic and imaging observations to construct a detailed lens model of the background DSFG which allowed us to study the sources plane properties of the target. Multi-band data from Keck/NIRC2, HST/WFC3 and Herschel yields star formation rate and stellar mass well above the main sequence. Observations of the dust continuum by the Sub-millimeter Array yields an observed total ISM mass of 6.5E+11 M* which is responsible for the intense observed star formation rates. Comparing the measured SFR with molecular gas measurements from CO(1-0) observations reveals that this system has relatively short gas depletion time scale which is consistent with the starburst phase observed in high redshift sub-millimeter galaxies.

  19. Multi-wavelength observations of the star forming region in L1616

    NASA Astrophysics Data System (ADS)

    Alcalá, J. M.; Wachter, S.; Covino, E.; Sterzik, M. F.; Durisen, R. H.; Freyberg, M. J.; Hoard, D. W.; Cooksey, K.

    2004-03-01

    We present the results of a multi-wavelength study of the star forming region in L1616. Our observations include ROSAT All-Sky Survey (RASS) and High Resolution Imager (HRI) X-ray observations, optical wide-field imaging and near-IR imaging data and optical long-slit and multi-object spectroscopic follow-up. 22 new low-mass pre-main sequence (PMS) stars are found to be distributed mainly to the East of the L1616 cometary cloud, in about a one-square-degree field. We find that the class-III infrared sources outnumber the class-II infrared sources by a factor of about three. The X-ray properties of the PMS stars in L1616 are quite similar to those of PMS stars detected in the Orion Nebula Cluster. The comparison of the position of the L1616 PMS stars in the HR diagram with theoretical PMS evolutionary tracks yields an average age of 1-2 Myr, with a very small age spread of about 1 Myr. Unlike the fossil star forming regions in Orion, L1616 appears to be a region of on-going star formation relatively far from the Orion A and B clouds. Given the small age spread, the spatial distribution of the PMS stars relative to the head of the cloud, as well as its cometary shape and high star formation efficiency, we conclude that the star formation in L1616 was most likely induced by a single event, the impact of the winds of the massive stars of the Orion OB association or a supernova explosion being the possible triggers. The Initial Mass Function (IMF) in L1616 is roughly consistent with that of the field in the mass range 0.3< M/M⊙ < 2.5. Several faint objects, detected in our optical images, are good candidates for young Brown Dwarfs (BDs). We might expect the number of BDs in L1616 to be intermediate between Taurus and the Trapezium. Based on observations carried out at the European Southern Observatory, La Silla, Chile under proposals numbers 56.E-0566 and 64.I-0355, and at the Calar Alto observatory.

  20. Process Parameters Optimization in Single Point Incremental Forming

    NASA Astrophysics Data System (ADS)

    Gulati, Vishal; Aryal, Ashmin; Katyal, Puneet; Goswami, Amitesh

    2016-04-01

    This work aims to optimize the formability and surface roughness of parts formed by the single-point incremental forming process for an Aluminium-6063 alloy. The tests are based on Taguchi's L18 orthogonal array selected on the basis of DOF. The tests have been carried out on vertical machining center (DMC70V); using CAD/CAM software (SolidWorks V5/MasterCAM). Two levels of tool radius, three levels of sheet thickness, step size, tool rotational speed, feed rate and lubrication have been considered as the input process parameters. Wall angle and surface roughness have been considered process responses. The influential process parameters for the formability and surface roughness have been identified with the help of statistical tool (response table, main effect plot and ANOVA). The parameter that has the utmost influence on formability and surface roughness is lubrication. In the case of formability, lubrication followed by the tool rotational speed, feed rate, sheet thickness, step size and tool radius have the influence in descending order. Whereas in surface roughness, lubrication followed by feed rate, step size, tool radius, sheet thickness and tool rotational speed have the influence in descending order. The predicted optimal values for the wall angle and surface roughness are found to be 88.29° and 1.03225 µm. The confirmation experiments were conducted thrice and the value of wall angle and surface roughness were found to be 85.76° and 1.15 µm respectively.

  1. Forming Hot Jupiters: Observational Constraints on Gas Giant Formation and migration

    NASA Astrophysics Data System (ADS)

    Becker, Juliette; Vanderburg, Andrew; Adams, Fred C.; Khain, Tali; Bryan, Marta

    2018-04-01

    Since the first extrasolar planets were detected, the existence of hot Jupiters has challenged prevailing theories of planet formation. The three commonly considered pathways for hot Jupiter formation are in situ formation, runaway accretion in the outer disk followed by disk migration, and tidal migration (occurring after the disk has dissipated). None of these explains the entire observed sample of hot Jupiters, suggesting that different selections of systems form via different pathways. The way forward is to use observational data to constrain the migration pathways of particular classes of systems, and subsequently assemble these results into a coherent picture of hot Jupiter formation. We present constraints on the migratory pathway for one particular type of system: hot Jupiters orbiting cool stars (T< 6200 K). Using the full observational sample, we find that the orbits of most wide planetary companions to hot Jupiters around these cool stars must be well aligned with the orbits of the hot Jupiters and the spins of the host stars. The population of systems containing both a hot Jupiter and an exterior companion around a cool star thus generally exist in roughly coplanar configurations, consistent with the idea that disk-driven migratory mechanisms have assembled most of this class of systems. We then discuss the overall applicability of this result to a wider range of systems and the broader implications on planet formation.

  2. Five-DOF innovative linear MagLev slider to account for pitch, tilt and load uncertainty

    NASA Astrophysics Data System (ADS)

    Kao, Yi-Ming; Tsai, Nan-Chyuan; Chiu, Hsin-Lin

    2017-02-01

    This paper is focused at position deviation regulation upon a slider by Fuzzy Sliding Mode Control (FSMC). Five Degrees Of Freedom (DOF) of position deviation are required to be regulated except for the direction (i.e., X-axis) in which the slider moves forward and backward. Totally 8 sets of Magnetic Actuators (MAs) and an Electro-Pneumatic Transducer (EPT) are employed to drive the slider carrying loads under the commands of FSMC. EPT is applied to adjust the pressure of compressed air to counterbalance the weight of slider itself. At first, the system dynamic model of slider, including load uncertainty and load position uncertainty, is established. Intensive computer simulations are undertaken to verify the validity of proposed control strategy. Finally, a prototype of realistic slider position deviation regulation system is successfully built up. According to the experiments by cooperation of pneumatic and magnetic control, the actual linear position deviations of slider can be regulated within ±8 μm and angular position deviations within ±1 mini-degrees. From the viewpoint of energy consumption, the applied currents to 8 sets of MAs are all below 1.2 A. To sum up, the closed-loop levitation system by cooperation of pneumatic and magnetic control is capable to account for load uncertainty and uncertainty of the standing position of load to be carried.

  3. Two improvements on numerical simulation of 2-DOF vortex-induced vibration with low mass ratio

    NASA Astrophysics Data System (ADS)

    Kang, Zhuang; Ni, Wen-chi; Zhang, Xu; Sun, Li-ping

    2017-12-01

    Till now, there have been lots of researches on numerical simulation of vortex-induced vibration. Acceptable results have been obtained for fixed cylinders with low Reynolds number. However, for responses of 2-DOF vortex-induced vibration with low mass ratio, the accuracy is not satisfactory, especially for the maximum amplitudes. In Jauvtis and Williamson's work, the maximum amplitude of the cylinder with low mass ratio m*=2.6 can reach as large as 1.5 D to be called as the "super-upper branch", but from current literatures, few simulation results can achieve such value, even fail to capture the upper branch. Besides, it is found that the amplitude decays too fast in the lower branch with the RANS-based turbulence model. The reason is likely to be the defects of the turbulence model itself in the prediction of unsteady separated flows as well as the unreasonable setting of the numerical simulation parameters. Aiming at above issues, a modified turbulence model is proposed in this paper, and the effect of the acceleration of flow field on the response of vortex-induced vibration is studied based on OpenFOAM. By analyzing the responses of amplitude, phase and trajectory, frequency and vortex mode, it is proved that the vortex-induced vibration can be predicted accurately with the modified turbulence model under appropriate flow field acceleration.

  4. Wide-Field Infrared Survey Explorer Observations of the Evolution of Massive Star-Forming Regions

    NASA Technical Reports Server (NTRS)

    Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Rebull, L. M.; Padgett, D. L.; Assef, R. J.

    2011-01-01

    We present the results of a mid-infrared survey of 11 outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from the first burst of massive star formation with the molecular cloud material leftover from that earlier generation of stars.We dub this process the "fireworks hypothesis" since star formation by this mechanism would proceed rapidly and resemble a burst of fireworks.We have also analyzed small cutout WISE images of the structures around the edges of these massive star-forming regions. We observe large (1-3 pc size) pillar and trunk-like structures of diffuse emission nebulosity tracing excited polycyclic aromatic hydrocarbon molecules and small dust grains at the perimeter of the massive star-forming regions. These structures contain small clusters of emerging Class I and Class II sources, but some are forming only a single to a few new stars.

  5. Wide-Field Infrared Survey Explorer Observations of the Evolution of Massive Star-Forming Regions

    NASA Technical Reports Server (NTRS)

    Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Rebull, L. M.; Padgett, D. L.; Asslef, R. J.

    2012-01-01

    We present the results of a mid-infrared survey of II outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from the first burst of massive star formation with the molecular cloud material leftover from that earlier generation of stars. We dub this process the "fireworks hypothesis" since star formation by this mechanism would proceed rapidly and resemble a burst of fireworks. We have also analyzed small cutout WISE images of the structures around the edges of these massive star-forming regions. We observe large (1-3 pc size) pillar and trunk-like structures of diffuse emission nebulosity tracing excited polycyclic aromatic hydrocarbon molecules and small dust grains at the perimeter of the massive star-forming regions. These structures contain small clusters of emerging Class I and Class II sources, but some are forming only a single to a few new stars.

  6. The opercular mouth-opening mechanism of largemouth bass functions as a 3D four-bar linkage with three degrees of freedom.

    PubMed

    Olsen, Aaron M; Camp, Ariel L; Brainerd, Elizabeth L

    2017-12-15

    The planar, one degree of freedom (1-DoF) four-bar linkage is an important model for understanding the function, performance and evolution of numerous biomechanical systems. One such system is the opercular mechanism in fishes, which is thought to function like a four-bar linkage to depress the lower jaw. While anatomical and behavioral observations suggest some form of mechanical coupling, previous attempts to model the opercular mechanism as a planar four-bar have consistently produced poor model fits relative to observed kinematics. Using newly developed, open source mechanism fitting software, we fitted multiple three-dimensional (3D) four-bar models with varying DoF to in vivo kinematics in largemouth bass to test whether the opercular mechanism functions instead as a 3D four-bar with one or more DoF. We examined link position error, link rotation error and the ratio of output to input link rotation to identify a best-fit model at two different levels of variation: for each feeding strike and across all strikes from the same individual. A 3D, 3-DoF four-bar linkage was the best-fit model for the opercular mechanism, achieving link rotational errors of less than 5%. We also found that the opercular mechanism moves with multiple degrees of freedom at the level of each strike and across multiple strikes. These results suggest that active motor control may be needed to direct the force input to the mechanism by the axial muscles and achieve a particular mouth-opening trajectory. Our results also expand the versatility of four-bar models in simulating biomechanical systems and extend their utility beyond planar or single-DoF systems. © 2017. Published by The Company of Biologists Ltd.

  7. Overexpression of Grain Amaranth (Amaranthus hypochondriacus) AhERF or AhDOF Transcription Factors in Arabidopsis thaliana Increases Water Deficit- and Salt-Stress Tolerance, Respectively, via Contrasting Stress-Amelioration Mechanisms

    PubMed Central

    Massange-Sánchez, Julio A.; Palmeros-Suárez, Paola A.; Espitia-Rangel, Eduardo; Rodríguez-Arévalo, Isaac; Sánchez-Segura, Lino; Martínez-Gallardo, Norma A.; Alatorre-Cobos, Fulgencio; Tiessen, Axel; Délano-Frier, John P.

    2016-01-01

    Two grain amaranth transcription factor (TF) genes were overexpressed in Arabidopsis plants. The first, coding for a group VII ethylene response factor TF (i.e., AhERF-VII) conferred tolerance to water-deficit stress (WS) in transgenic Arabidopsis without affecting vegetative or reproductive growth. A significantly lower water-loss rate in detached leaves coupled to a reduced stomatal opening in leaves of plants subjected to WS was associated with this trait. WS tolerance was also associated with an increased antioxidant enzyme activity and the accumulation of putative stress-related secondary metabolites. However, microarray and GO data did not indicate an obvious correlation between WS tolerance, stomatal closure, and abscisic acid (ABA)-related signaling. This scenario suggested that stomatal closure during WS in these plants involved ABA-independent mechanisms, possibly involving reactive oxygen species (ROS). WS tolerance may have also involved other protective processes, such as those employed for methyl glyoxal detoxification. The second, coding for a class A and cluster I DNA binding with one finger TF (i.e., AhDof-AI) provided salt-stress (SS) tolerance with no evident fitness penalties. The lack of an obvious development-related phenotype contrasted with microarray and GO data showing an enrichment of categories and genes related to developmental processes, particularly flowering. SS tolerance also correlated with increased superoxide dismutase activity but not with augmented stomatal closure. Additionally, microarray and GO data indicated that, contrary to AhERF-VII, SS tolerance conferred by AhDof-AI in Arabidopsis involved ABA-dependent and ABA-independent stress amelioration mechanisms. PMID:27749893

  8. Insights from Synthetic Star-forming Regions. I. Reliable Mock Observations from SPH Simulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koepferl, Christine M.; Robitaille, Thomas P.; Biscani, Francesco

    Through synthetic observations of a hydrodynamical simulation of an evolving star-forming region, we assess how the choice of observational techniques affects the measurements of properties that trace star formation. Testing and calibrating observational measurements requires synthetic observations that are as realistic as possible. In this part of the series (Paper I), we explore different techniques for mapping the distributions of densities and temperatures from the particle-based simulations onto a Voronoi mesh suitable for radiative transfer and consequently explore their accuracy. We further test different ways to set up the radiative transfer in order to produce realistic synthetic observations. We give amore » detailed description of all methods and ultimately recommend techniques. We have found that the flux around 20 μ m is strongly overestimated when blindly coupling the dust radiative transfer temperature with the hydrodynamical gas temperature. We find that when instead assuming a constant background dust temperature in addition to the radiative transfer heating, the recovered flux is consistent with actual observations. We present around 5800 realistic synthetic observations for Spitzer and Herschel bands, at different evolutionary time-steps, distances, and orientations. In the upcoming papers of this series (Papers II, III, and IV), we will test and calibrate measurements of the star formation rate, gas mass, and the star formation efficiency using our realistic synthetic observations.« less

  9. Multiple timescales of cyclical behaviour observed at two dome-forming eruptions

    NASA Astrophysics Data System (ADS)

    Lamb, Oliver D.; Varley, Nick R.; Mather, Tamsin A.; Pyle, David M.; Smith, Patrick J.; Liu, Emma J.

    2014-09-01

    Cyclic behaviour over a range of timescales is a well-documented feature of many dome-forming volcanoes, but has not previously been identified in high resolution seismic data from Volcán de Colima (Mexico). Using daily seismic count datasets from Volcán de Colima and Soufrière Hills volcano (Montserrat), this study explores parallels in the long-term behaviour of seismicity at two long-lived systems. Datasets are examined using multiple techniques, including Fast-Fourier Transform, Detrended Fluctuation Analysis and Probabilistic Distribution Analysis, and the comparison of results from two systems reveals interesting parallels in sub-surface processes operating at both systems. Patterns of seismicity at both systems reveal complex but broadly similar long-term temporal patterns with cycles on the order of ~ 50- to ~ 200-days. These patterns are consistent with previously published spectral analyses of SO2 flux time-series at Soufrière Hills volcano, and are attributed to variations in the movement of magma in each system. Detrended Fluctuation Analysis determined that both volcanic systems showed a systematic relationship between the number of seismic events and the relative ‘roughness' of the time-series, and explosions at Volcán de Colima showed a 1.5-2 year cycle; neither observation has a clear explanatory mechanism. At Volcán de Colima, analysis of repose intervals between seismic events shows long-term behaviour that responds to changes in activity at the system. Similar patterns for both volcanic systems suggest a common process or processes driving the observed signal but it is not clear from these results alone what those processes may be. Further attempts to model conduit processes at each volcano must account for the similarities and differences in activity within each system. The identification of some commonalities in the patterns of behaviour during long-lived dome-forming eruptions at andesitic volcanoes provides a motivation for

  10. HST/COS Observations Of Lyman-α Emission From =0.03 Star Forming Galaxies

    NASA Astrophysics Data System (ADS)

    Wofford, Aida; Leitherer, C.; Salzer, J.; COS Science Team

    2012-01-01

    Although HI Lyman-alpha (Lyα, 1216 Å) is expected to be the strongest recombination line in HII nebulae, it is resonantly scattered by neutral hydrogen and is easily destroyed by dust. And yet, some star-forming galaxies show Lyα in emission. As evidenced by high dispersion HST/GHRS+STIS FUV spectroscopy of a handful of local (z<0.03) galaxies, the velocity shift between the neutral gas and the ionized gas plays a key role in driving the observed Lyα escape. We present HST/COS/G130M 1150-1450 Å (observed-frame) spectroscopy of 20 new targets located at a mean redshift of =0.03. The targets were selected from the KISSR survey on the basis of their GALEX FUV continuum luminosity. The observations cover the central 1-2 kpc of each galaxy, a wide range in metallicity ([O/H]=-0.83 to 0.38), and at least two orders of magnitude in FUV continuum luminosity. Seven objects show Lyα emission in the form of a P-Cygni or double-peaked profile. For 6/7 of the latter objects we are able to show that the emission is accompanied of O I gas outflows with speeds of up to 200 km/s. Two objects have Lyα luminosities comparable to the GALEX Lyα luminosities of targets at =0.3, but we find no Lyα emitters with EW(Lyα)>20 Å, such as those discovered with GALEX at z=0.2-0.35. We compare the observed Lyα/Hα line intensity ratios with predictions from dust-free cases A and B recombination under normal HII region conditions. We find evidence of O I gas inflow in the most metal-poor objects. This work is supported by NASA grant N1317.

  11. Design of a 4-DOF MR haptic master for application to robot surgery: virtual environment work

    NASA Astrophysics Data System (ADS)

    Oh, Jong-Seok; Choi, Seung-Hyun; Choi, Seung-Bok

    2014-09-01

    This paper presents the design and control performance of a novel type of 4-degrees-of-freedom (4-DOF) haptic master in cyberspace for a robot-assisted minimally invasive surgery (RMIS) application. By using a controllable magnetorheological (MR) fluid, the proposed haptic master can have a feedback function for a surgical robot. Due to the difficulty in utilizing real human organs in the experiment, the cyberspace that features the virtual object is constructed to evaluate the performance of the haptic master. In order to realize the cyberspace, a volumetric deformable object is represented by a shape-retaining chain-linked (S-chain) model, which is a fast volumetric model and is suitable for real-time applications. In the haptic architecture for an RMIS application, the desired torque and position induced from the virtual object of the cyberspace and the haptic master of real space are transferred to each other. In order to validate the superiority of the proposed master and volumetric model, a tracking control experiment is implemented with a nonhomogenous volumetric cubic object to demonstrate that the proposed model can be utilized in real-time haptic rendering architecture. A proportional-integral-derivative (PID) controller is then designed and empirically implemented to accomplish the desired torque trajectories. It has been verified from the experiment that tracking the control performance for torque trajectories from a virtual slave can be successfully achieved.

  12. Assessment of Self-Contamination During Removal of Personal Protective Equipment for Ebola Patient Care.

    PubMed

    Casanova, Lisa M; Teal, Lisa J; Sickbert-Bennett, Emily E; Anderson, Deverick J; Sexton, Daniel J; Rutala, William A; Weber, David J

    2016-10-01

    OBJECTIVE Ebola virus disease (EVD) places healthcare personnel (HCP) at high risk for infection during patient care, and personal protective equipment (PPE) is critical. Protocols for EVD PPE doffing have not been validated for prevention of viral self-contamination. Using surrogate viruses (non-enveloped MS2 and enveloped Φ6), we assessed self-contamination of skin and clothes when trained HCP doffed EVD PPE using a standardized protocol. METHODS A total of 15 HCP donned EVD PPE for this study. Virus was applied to PPE, and a trained monitor guided them through the doffing protocol. Of the 15 participants, 10 used alcohol-based hand rub (ABHR) for glove and hand hygiene and 5 used hypochlorite for glove hygiene and ABHR for hand hygiene. Inner gloves, hands, face, and scrubs were sampled after doffing. RESULTS After doffing, MS2 virus was detected on the inner glove worn on the dominant hand for 8 of 15 participants, on the non-dominant inner glove for 6 of 15 participants, and on scrubs for 2 of 15 participants. All MS2 on inner gloves was observed when ABHR was used for glove hygiene; none was observed when hypochlorite was used. When using hypochlorite for glove hygiene, 1 participant had MS2 on hands, and 1 had MS2 on scrubs. CONCLUSIONS A structured doffing protocol using a trained monitor and ABHR protects against enveloped virus self-contamination. Non-enveloped virus (MS2) contamination was detected on inner gloves, possibly due to higher resistance to ABHR. Doffing protocols protective against all viruses need to incorporate highly effective glove and hand hygiene agents. Infect Control Hosp Epidemiol 2016;1-6.

  13. Hamiltonian formalism for f (T ) gravity

    NASA Astrophysics Data System (ADS)

    Ferraro, Rafael; Guzmán, María José

    2018-05-01

    We present the Hamiltonian formalism for f (T ) gravity, and prove that the theory has n/(n -3 ) 2 +1 degrees of freedom (d.o.f.) in n dimensions. We start from a scalar-tensor action for the theory, which represents a scalar field minimally coupled with the torsion scalar T that defines the teleparallel equivalent of general relativity (TEGR) Lagrangian. T is written as a quadratic form of the coefficients of anholonomy of the vierbein. We obtain the primary constraints through the analysis of the structure of the eigenvalues of the multi-index matrix involved in the definition of the canonical momenta. The auxiliary scalar field generates one extra primary constraint when compared with the TEGR case. The secondary constraints are the super-Hamiltonian and supermomenta constraints, that are preserved from the Arnowitt-Deser-Misner formulation of GR. There is a set of n/(n -1 ) 2 primary constraints that represent the local Lorentz transformations of the theory, which can be combined to form a set of n/(n -1 ) 2 -1 first-class constraints, while one of them becomes second class. This result is irrespective of the dimension, due to the structure of the matrix of the brackets between the constraints. The first-class canonical Hamiltonian is modified due to this local Lorentz violation, and the only one local Lorentz transformation that becomes second-class pairs up with the second-class constraint π ≈0 to remove one d.o.f. from the n2+1 pairs of canonical variables. The remaining n/(n -1 ) 2 +2 n -1 primary constraints remove the same number of d.o.f., leaving the theory with n/(n -3 ) 2 +1 d.o.f. This means that f (T ) gravity has only one extra d.o.f., which could be interpreted as a scalar d.o.f.

  14. The search for radio emission from exoplanets using LOFAR low-frequency beam-formed observations

    NASA Astrophysics Data System (ADS)

    Turner, Jake D.; Griessmeier, Jean-Mathias; Zarka, Philippe

    2018-01-01

    Detection of radio emission from exoplanets can provide information on the star-planet system that is very difficult or impossible to study otherwise, such as the planet’s magnetic field, magnetosphere, rotation period, orbit inclination, and star-planet interactions. Such a detection in the radio domain would open up a whole new field in the study of exoplanets, however, currently there are no confirmed detections of an exoplanet at radio frequencies. In this study, we discuss our ongoing observational campaign searching for exoplanetary radio emissions using beam-formed observations within the Low Band of the Low-Frequency Array (LOFAR). To date we have observed three exoplanets: 55 Cnc, Upsilon Andromedae, and Tau Boötis. These planets were selected according to theoretical predictions, which indicated them as among the best candidates for an observation. During the observations we usually recorded three beams simultaneously, one on the exoplanet and two on patches of nearby “empty” sky. An automatic pipeline was created to automatically find RFI, calibrate the data due to instrumental effects, and to search for emission in the exoplanet beam. Additionally, we observed Jupiter with LOFAR with the same exact observational setup as the exoplanet observations. The main goals of the Jupiter observations are to train the detection algorithm and to calculate upper limits in the case of a non-detection. Data analysis is currently ongoing. Conclusions reached at the time of the meeting, about detection of or upper limit to the planetary signal, will be presented.

  15. ALMA observation of high-z extreme star-forming environments discovered by Planck/Herschel

    NASA Astrophysics Data System (ADS)

    Kneissl, R.

    2015-05-01

    The Comic Microwave Background satellite Planck with its High Frequency Instrument has surveyed the mm/sub-mm sky in six frequency channels from 100 to 900 GHz. A sample of 228 cold sources of the Cosmic Infrared Background was observed in follow-up with Herschel SPIRE. The majority of sources appear to be over-densities of star-forming galaxies matching the size of high-z proto-cluster regions, while a 3% fraction are individual bright, lensed galaxies. A large observing program is underway with the aim of resolving the regions into the constituent members of the Planck sources. First ALMA data have been received on one Planck/Herschel proto-cluster candidate, showing the expected large over-abundance of bright mm/sub-mm sources within the cluster region. ALMA long baseline data of the brightest lensed galaxy in the sample with > 1 Jy at 350 μm are also forthcoming.

  16. Bistable energy harvesting enhancement with an auxiliary linear oscillator

    NASA Astrophysics Data System (ADS)

    Harne, R. L.; Thota, M.; Wang, K. W.

    2013-12-01

    Recent work has indicated that linear vibrational energy harvesters with an appended degree-of-freedom (DOF) may be advantageous for introducing new dynamic forms to extend the operational bandwidth. Given the additional interest in bistable harvester designs, which exhibit a propitious snap through effect from one stable state to the other, it is a logical extension to explore the influence of an added DOF to a bistable system. However, bistable snap through is not a resonant phenomenon, which tempers the presumption that the dynamics induced by an additional DOF on bistable designs would inherently be beneficial as for linear systems. This paper presents two analytical formulations to assess the fundamental and superharmonic steady-state dynamics of an excited bistable energy harvester to which is attached an auxiliary linear oscillator. From an energy harvesting perspective, the model predicts that the additional linear DOF uniformly amplifies the bistable harvester response magnitude and generated power for excitation frequencies less than the attachment’s resonance while improved power density spans a bandwidth below this frequency. Analyses predict bandwidths having co-existent responses composed of a unique proportion of fundamental and superharmonic dynamics. Experiments validate key analytical predictions and observe the ability for the coupled system to develop an advantageous multi-harmonic interwell response when the initial conditions are insufficient for continuous high-energy orbit at the excitation frequency. Overall, the addition of an auxiliary linear oscillator to a bistable harvester is found to be an effective means of enhancing the energy harvesting performance and robustness.

  17. Tropospheric Vertical Distribution of Tropical Atlantic Ozone Observed by TES during the Northern African Biomass Burning Season

    NASA Technical Reports Server (NTRS)

    Jourdain, L.; Worden, H. M.; Worden, J. R.; Bowman, K.; Li, Q.; Eldering, A.; Kulawik, S. S.; Osterman, G.; Boersma, K. F.; Fisher, B.; hide

    2007-01-01

    We present vertical distributions of ozone from the Tropospheric Emission Spectrometer (TES) over the tropical Atlantic Ocean during January 2005. Between 10N and 20S, TES ozone retrievals have Degrees of Freedom for signal (DOF) around 0.7 - 0.8 each for tropospheric altitudes above and below 500 hPa. As a result, TES is able to capture for the first time from space a distribution characterized by two maxima: one in the lower troposphere north of the ITCZ and one in the middle and upper troposphere south of the ITCZ. We focus our analysis on the north tropical Atlantic Ocean, where most of previous satellite observations showed discrepancies with in-situ ozone observations and models. Trajectory analyses and a sensitivity study using the GEOS-Chem model confirm the influence of northern Africa biomass burning on the elevated ozone mixing ratios observed by TES over this region.

  18. Robot-Aided Mapping of Wrist Proprioceptive Acuity across a 3D Workspace

    PubMed Central

    Marini, Francesca; Squeri, Valentina; Morasso, Pietro; Konczak, Jürgen; Masia, Lorenzo

    2016-01-01

    Proprioceptive signals from peripheral mechanoreceptors form the basis for bodily perception and are known to be essential for motor control. However we still have an incomplete understanding of how proprioception differs between joints, whether it differs among the various degrees-of-freedom (DoFs) within a particular joint, and how such differences affect motor control and learning. We here introduce a robot-aided method to objectively measure proprioceptive function: specifically, we systematically mapped wrist proprioceptive acuity across the three DoFs of the wrist/hand complex with the aim to characterize the wrist position sense. Thirty healthy young adults performed an ipsilateral active joint position matching task with their dominant wrist using a haptic robotic exoskeleton. Our results indicate that the active wrist position sense acuity is anisotropic across the joint, with the abduction/adduction DoF having the highest acuity (the error of acuity for flexion/extension is 4.64 ± 0.24°; abduction/adduction: 3.68 ± 0.32°; supination/pronation: 5.15 ± 0.37°) and they also revealed that proprioceptive acuity decreases for smaller joint displacements. We believe this knowledge is imperative in a clinical scenario when assessing proprioceptive deficits and for understanding how such sensory deficits relate to observable motor impairments. PMID:27536882

  19. Determination of the position and orientation of a flat piezoelectric micro-stage by moving the optical axis.

    PubMed

    Zhuang, Guo-Yuan; Lee, Hau-Wei; Liu, Chien-Hung

    2014-10-01

    A moving optical axis measurement system with six degrees-of-freedom (DOF) is proposed in this study. The system is very simple and can be placed inside a flat piezoelectric micro-stage. The system comprises three two-DOF optical measurement modules, each having a quadrant photo diode (QPD), a lens, and a laser diode. These three modules and the geometric configuration of their installation allow displacement measurements with up to six-DOF to be made. A mathematical model of this system is also presented. By analyzing the sensitivity and relationship between the displacement of the stage and each of the QPD light spots, movement can be observed. Signal feedback enables multi-axis nano-scale positioning control. We also present a new six-DOF nano stage, which uses piezoelectric actuators for displacement. This stage was used to verify the proposed six-DOF measurement system. Linear and angular resolution of the system can be down to 10 nm and 0.1 arcsec. Linear and angular displacement measurement errors of this six-DOF measurement system are in the range of ±70 nm and ±0.65 arcsec.

  20. Determination of the position and orientation of a flat piezoelectric micro-stage by moving the optical axis

    NASA Astrophysics Data System (ADS)

    Zhuang, Guo-Yuan; Lee, Hau-Wei; Liu, Chien-Hung

    2014-10-01

    A moving optical axis measurement system with six degrees-of-freedom (DOF) is proposed in this study. The system is very simple and can be placed inside a flat piezoelectric micro-stage. The system comprises three two-DOF optical measurement modules, each having a quadrant photo diode (QPD), a lens, and a laser diode. These three modules and the geometric configuration of their installation allow displacement measurements with up to six-DOF to be made. A mathematical model of this system is also presented. By analyzing the sensitivity and relationship between the displacement of the stage and each of the QPD light spots, movement can be observed. Signal feedback enables multi-axis nano-scale positioning control. We also present a new six-DOF nano stage, which uses piezoelectric actuators for displacement. This stage was used to verify the proposed six-DOF measurement system. Linear and angular resolution of the system can be down to 10 nm and 0.1 arcsec. Linear and angular displacement measurement errors of this six-DOF measurement system are in the range of ±70 nm and ±0.65 arcsec.

  1. Herschel Observations of C+ in the Vicinity of Star Forming Complexes in the Galactic Plane

    NASA Astrophysics Data System (ADS)

    Pineda, Jorge; Velusamy, T.; Langer, W.; Goldsmith, P.; Li, D.; Yorke, H.

    2010-05-01

    The CII fine-structure line at 158 um, is an excellent tracer of the warm diffuse gas and the hot, dense Photon Dominated Regions (PDRs). We can, therefore, use the CII emission as a probe to understand the effects of star formation on their interstellar environment. Here we present the first results from the Galactic Observations of Terahertz C+ (GOT C+), a Herschel Key Project study of CII fine structure emission in the vicinity of star forming complexes. In the Priority Science Phase of HIFI observations, the GOT C+ project collects data along a dozen lines of sight passing near star forming regions in the inner Galaxy from longitude 310 degrees to 25 degrees. We discuss our first results on the transition between dense and hot gas (traced by CII) and dense and cold gas (traced by 12CO and 13CO). This research was conducted at the Jet Propulsion Laboratory, California Institute of Technology under contract with the National Aeronautics and Space Administration. JLP was supported under the NASA Postdoctoral Program at JPL, Caltech, administered by Oak Ridge Associated Universities through a contract with NASA, and is currently supported as a Caltech-JPL Postdoc.

  2. Performance evaluation of a dental handpiece in simulation of clinical finishing using a novel 2DOF in vitro apparatus.

    PubMed

    Yin, L; Song, X F; Qu, S F; Huang, T; Mei, J P; Yang, Z Y; Li, J

    2006-11-01

    This paper reports on the performance evaluation of a dental handpiece in simulation of clinical finishing using a novel two-degrees-of-freedom (2DOF) in vitro apparatus. The instrumented apparatus consisted of a two-dimensional computer-controlled coordinate worktable carrying a dental handpiece, a piezoelectric force dynamometer, and a high-speed data acquisition and signal conditioning system for simulating the clinical operations and monitoring the dental finishing processes. The performance of the dental handpiece was experimentally evaluated with respect to rotational speed, torque, and specific finishing energy under the applied clinical finishing conditions. The results show that the rotational speeds of the dental handpiece decreased by increasing either the depth of cut or the feed rate at a constant clinically applied air pressure and water flowrate. They also decreased when increasing both the tangential and normal finishing forces. The specific finishing energy decreased with an increase in either depth of cut or feed rate, while the finishing torque increased as either the depth of cut or the feed rate was increased. Implications of these results were to provide guidance for proper applications of dental handpieces in clinical practice.

  3. Measurement of Form-Factor-Independent Observables in the Decay B0→K*0μ+μ-

    NASA Astrophysics Data System (ADS)

    Aaij, R.; Adeva, B.; Adinolfi, M.; Adrover, C.; Affolder, A.; Ajaltouni, Z.; Albrecht, J.; Alessio, F.; Alexander, M.; Ali, S.; Alkhazov, G.; Alvarez Cartelle, P.; Alves, A. A., Jr.; Amato, S.; Amerio, S.; Amhis, Y.; Anderlini, L.; Anderson, J.; Andreassen, R.; Andrews, J. E.; Appleby, R. B.; Aquines Gutierrez, O.; Archilli, F.; Artamonov, A.; Artuso, M.; Aslanides, E.; Auriemma, G.; Baalouch, M.; Bachmann, S.; Back, J. J.; Baesso, C.; Balagura, V.; Baldini, W.; Barlow, R. J.; Barschel, C.; Barsuk, S.; Barter, W.; Bauer, Th.; Bay, A.; Beddow, J.; Bedeschi, F.; Bediaga, I.; Belogurov, S.; Belous, K.; Belyaev, I.; Ben-Haim, E.; Bencivenni, G.; Benson, S.; Benton, J.; Berezhnoy, A.; Bernet, R.; Bettler, M.-O.; van Beuzekom, M.; Bien, A.; Bifani, S.; Bird, T.; Bizzeti, A.; Bjørnstad, P. M.; Blake, T.; Blanc, F.; Blouw, J.; Blusk, S.; Bocci, V.; Bondar, A.; Bondar, N.; Bonivento, W.; Borghi, S.; Borgia, A.; Bowcock, T. J. V.; Bowen, E.; Bozzi, C.; Brambach, T.; van den Brand, J.; Bressieux, J.; Brett, D.; Britsch, M.; Britton, T.; Brook, N. H.; Brown, H.; Burducea, I.; Bursche, A.; Busetto, G.; Buytaert, J.; Cadeddu, S.; Callot, O.; Calvi, M.; Calvo Gomez, M.; Camboni, A.; Campana, P.; Campora Perez, D.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carranza-Mejia, H.; Carson, L.; Carvalho Akiba, K.; Casse, G.; Castillo Garcia, L.; Cattaneo, M.; Cauet, Ch.; Cenci, R.; Charles, M.; Charpentier, Ph.; Chen, P.; Chiapolini, N.; Chrzaszcz, M.; Ciba, K.; Cid Vidal, X.; Ciezarek, G.; Clarke, P. E. L.; Clemencic, M.; Cliff, H. V.; Closier, J.; Coca, C.; Coco, V.; Cogan, J.; Cogneras, E.; Collins, P.; Comerma-Montells, A.; Contu, A.; Cook, A.; Coombes, M.; Coquereau, S.; Corti, G.; Couturier, B.; Cowan, G. A.; Craik, D. C.; Cunliffe, S.; Currie, R.; D'Ambrosio, C.; David, P.; David, P. N. Y.; Davis, A.; De Bonis, I.; De Bruyn, K.; De Capua, S.; De Cian, M.; De Miranda, J. M.; De Paula, L.; De Silva, W.; De Simone, P.; Decamp, D.; Deckenhoff, M.; Del Buono, L.; Déléage, N.; Derkach, D.; Deschamps, O.; Dettori, F.; Di Canto, A.; Dijkstra, H.; Dogaru, M.; Donleavy, S.; Dordei, F.; Dosil Suárez, A.; Dossett, D.; Dovbnya, A.; Dupertuis, F.; Durante, P.; Dzhelyadin, R.; Dziurda, A.; Dzyuba, A.; Easo, S.; Egede, U.; Egorychev, V.; Eidelman, S.; van Eijk, D.; Eisenhardt, S.; Eitschberger, U.; Ekelhof, R.; Eklund, L.; El Rifai, I.; Elsasser, Ch.; Falabella, A.; Färber, C.; Fardell, G.; Farinelli, C.; Farry, S.; Ferguson, D.; Fernandez Albor, V.; Ferreira Rodrigues, F.; Ferro-Luzzi, M.; Filippov, S.; Fiore, M.; Fitzpatrick, C.; Fontana, M.; Fontanelli, F.; Forty, R.; Francisco, O.; Frank, M.; Frei, C.; Frosini, M.; Furcas, S.; Furfaro, E.; Gallas Torreira, A.; Galli, D.; Gandelman, M.; Gandini, P.; Gao, Y.; Garofoli, J.; Garosi, P.; Garra Tico, J.; Garrido, L.; Gaspar, C.; Gauld, R.; Gersabeck, E.; Gersabeck, M.; Gershon, T.; Ghez, Ph.; Gibson, V.; Giubega, L.; Gligorov, V. V.; Göbel, C.; Golubkov, D.; Golutvin, A.; Gomes, A.; Gorbounov, P.; Gordon, H.; Gotti, C.; Grabalosa Gándara, M.; Graciani Diaz, R.; Granado Cardoso, L. A.; Graugés, E.; Graziani, G.; Grecu, A.; Greening, E.; Gregson, S.; Griffith, P.; Grünberg, O.; Gui, B.; Gushchin, E.; Guz, Yu.; Gys, T.; Hadjivasiliou, C.; Haefeli, G.; Haen, C.; Haines, S. C.; Hall, S.; Hamilton, B.; Hampson, T.; Hansmann-Menzemer, S.; Harnew, N.; Harnew, S. T.; Harrison, J.; Hartmann, T.; He, J.; Head, T.; Heijne, V.; Hennessy, K.; Henrard, P.; Hernando Morata, J. A.; van Herwijnen, E.; Hess, M.; Hicheur, A.; Hicks, E.; Hill, D.; Hoballah, M.; Hombach, C.; Hopchev, P.; Hulsbergen, W.; Hunt, P.; Huse, T.; Hussain, N.; Hutchcroft, D.; Hynds, D.; Iakovenko, V.; Idzik, M.; Ilten, P.; Jacobsson, R.; Jaeger, A.; Jans, E.; Jaton, P.; Jawahery, A.; Jing, F.; John, M.; Johnson, D.; Jones, C. R.; Joram, C.; Jost, B.; Kaballo, M.; Kandybei, S.; Kanso, W.; Karacson, M.; Karbach, T. M.; Kenyon, I. R.; Ketel, T.; Keune, A.; Khanji, B.; Kochebina, O.; Komarov, I.; Koopman, R. F.; Koppenburg, P.; Korolev, M.; Kozlinskiy, A.; Kravchuk, L.; Kreplin, K.; Kreps, M.; Krocker, G.; Krokovny, P.; Kruse, F.; Kucharczyk, M.; Kudryavtsev, V.; Kurek, K.; Kvaratskheliya, T.; La Thi, V. N.; Lacarrere, D.; Lafferty, G.; Lai, A.; Lambert, D.; Lambert, R. W.; Lanciotti, E.; Lanfranchi, G.; Langenbruch, C.; Latham, T.; Lazzeroni, C.; Le Gac, R.; van Leerdam, J.; Lees, J.-P.; Lefèvre, R.; Leflat, A.; Lefrançois, J.; Leo, S.; Leroy, O.; Lesiak, T.; Leverington, B.; Li, Y.; Li Gioi, L.; Liles, M.; Lindner, R.; Linn, C.; Liu, B.; Liu, G.; Lohn, S.; Longstaff, I.; Lopes, J. H.; Lopez-March, N.; Lu, H.; Lucchesi, D.; Luisier, J.; Luo, H.; Machefert, F.; Machikhiliyan, I. V.; Maciuc, F.; Maev, O.; Malde, S.; Manca, G.; Mancinelli, G.; Maratas, J.; Marconi, U.; Marino, P.; Märki, R.; Marks, J.; Martellotti, G.; Martens, A.; Martín Sánchez, A.; Martinelli, M.; Martinez Santos, D.; Martins Tostes, D.; Martynov, A.; Massafferri, A.; Matev, R.; Mathe, Z.; Matteuzzi, C.; Maurice, E.; Mazurov, A.; McCarthy, J.; McNab, A.; McNulty, R.; McSkelly, B.; Meadows, B.; Meier, F.; Meissner, M.; Merk, M.; Milanes, D. A.; Minard, M.-N.; Molina Rodriguez, J.; Monteil, S.; Moran, D.; Morawski, P.; Mordà, A.; Morello, M. J.; Mountain, R.; Mous, I.; Muheim, F.; Müller, K.; Muresan, R.; Muryn, B.; Muster, B.; Naik, P.; Nakada, T.; Nandakumar, R.; Nasteva, I.; Needham, M.; Neubert, S.; Neufeld, N.; Nguyen, A. D.; Nguyen, T. D.; Nguyen-Mau, C.; Nicol, M.; Niess, V.; Niet, R.; Nikitin, N.; Nikodem, T.; Nomerotski, A.; Novoselov, A.; Oblakowska-Mucha, A.; Obraztsov, V.; Oggero, S.; Ogilvy, S.; Okhrimenko, O.; Oldeman, R.; Orlandea, M.; Otalora Goicochea, J. M.; Owen, P.; Oyanguren, A.; Pal, B. K.; Palano, A.; Palczewski, T.; Palutan, M.; Panman, J.; Papanestis, A.; Pappagallo, M.; Parkes, C.; Parkinson, C. J.; Passaleva, G.; Patel, G. D.; Patel, M.; Patrick, G. N.; Patrignani, C.; Pavel-Nicorescu, C.; Pazos Alvarez, A.; Pellegrino, A.; Penso, G.; Pepe Altarelli, M.; Perazzini, S.; Perez Trigo, E.; Pérez-Calero Yzquierdo, A.; Perret, P.; Perrin-Terrin, M.; Pescatore, L.; Pesen, E.; Petridis, K.; Petrolini, A.; Phan, A.; Picatoste Olloqui, E.; Pietrzyk, B.; Pilař, T.; Pinci, D.; Playfer, S.; Plo Casasus, M.; Polci, F.; Polok, G.; Poluektov, A.; Polycarpo, E.; Popov, A.; Popov, D.; Popovici, B.; Potterat, C.; Powell, A.; Prisciandaro, J.; Pritchard, A.; Prouve, C.; Pugatch, V.; Puig Navarro, A.; Punzi, G.; Qian, W.; Rademacker, J. H.; Rakotomiaramanana, B.; Rangel, M. S.; Raniuk, I.; Rauschmayr, N.; Raven, G.; Redford, S.; Reid, M. M.; dos Reis, A. C.; Ricciardi, S.; Richards, A.; Rinnert, K.; Rives Molina, V.; Roa Romero, D. A.; Robbe, P.; Roberts, D. A.; Rodrigues, E.; Rodriguez Perez, P.; Roiser, S.; Romanovsky, V.; Romero Vidal, A.; Rouvinet, J.; Ruf, T.; Ruffini, F.; Ruiz, H.; Ruiz Valls, P.; Sabatino, G.; Saborido Silva, J. J.; Sagidova, N.; Sail, P.; Saitta, B.; Salustino Guimaraes, V.; Sanmartin Sedes, B.; Sannino, M.; Santacesaria, R.; Santamarina Rios, C.; Santovetti, E.; Sapunov, M.; Sarti, A.; Satriano, C.; Satta, A.; Savrie, M.; Savrina, D.; Schaack, P.; Schiller, M.; Schindler, H.; Schlupp, M.; Schmelling, M.; Schmidt, B.; Schneider, O.; Schopper, A.; Schune, M.-H.; Schwemmer, R.; Sciascia, B.; Sciubba, A.; Seco, M.; Semennikov, A.; Senderowska, K.; Sepp, I.; Serra, N.; Serrano, J.; Seyfert, P.; Shapkin, M.; Shapoval, I.; Shatalov, P.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, O.; Shevchenko, V.; Shires, A.; Silva Coutinho, R.; Sirendi, M.; Skwarnicki, T.; Smith, N. A.; Smith, E.; Smith, J.; Smith, M.; Sokoloff, M. D.; Soler, F. J. P.; Soomro, F.; Souza, D.; Souza De Paula, B.; Spaan, B.; Sparkes, A.; Spradlin, P.; Stagni, F.; Stahl, S.; Steinkamp, O.; Stevenson, S.; Stoica, S.; Stone, S.; Storaci, B.; Straticiuc, M.; Straumann, U.; Subbiah, V. K.; Sun, L.; Swientek, S.; Syropoulos, V.; Szczekowski, M.; Szczypka, P.; Szumlak, T.; T'Jampens, S.; Teklishyn, M.; Teodorescu, E.; Teubert, F.; Thomas, C.; Thomas, E.; van Tilburg, J.; Tisserand, V.; Tobin, M.; Tolk, S.; Tonelli, D.; Topp-Joergensen, S.; Torr, N.; Tournefier, E.; Tourneur, S.; Tran, M. T.; Tresch, M.; Tsaregorodtsev, A.; Tsopelas, P.; Tuning, N.; Ubeda Garcia, M.; Ukleja, A.; Urner, D.; Ustyuzhanin, A.; Uwer, U.; Vagnoni, V.; Valenti, G.; Vallier, A.; Van Dijk, M.; Vazquez Gomez, R.; Vazquez Regueiro, P.; Vázquez Sierra, C.; Vecchi, S.; Velthuis, J. J.; Veltri, M.; Veneziano, G.; Vesterinen, M.; Viaud, B.; Vieira, D.; Vilasis-Cardona, X.; Vollhardt, A.; Volyanskyy, D.; Voong, D.; Vorobyev, A.; Vorobyev, V.; Voß, C.; Voss, H.; Waldi, R.; Wallace, C.; Wallace, R.; Wandernoth, S.; Wang, J.; Ward, D. R.; Watson, N. K.; Webber, A. D.; Websdale, D.; Whitehead, M.; Wicht, J.; Wiechczynski, J.; Wiedner, D.; Wiggers, L.; Wilkinson, G.; Williams, M. P.; Williams, M.; Wilson, F. F.; Wimberley, J.; Wishahi, J.; Wislicki, W.; Witek, M.; Wotton, S. A.; Wright, S.; Wu, S.; Wyllie, K.; Xie, Y.; Xing, Z.; Yang, Z.; Young, R.; Yuan, X.; Yushchenko, O.; Zangoli, M.; Zavertyaev, M.; Zhang, F.; Zhang, L.; Zhang, W. C.; Zhang, Y.; Zhelezov, A.; Zhokhov, A.; Zhong, L.; Zvyagin, A.

    2013-11-01

    We present a measurement of form-factor-independent angular observables in the decay B0→K*(892)0μ+μ-. The analysis is based on a data sample corresponding to an integrated luminosity of 1.0fb-1, collected by the LHCb experiment in pp collisions at a center-of-mass energy of 7 TeV. Four observables are measured in six bins of the dimuon invariant mass squared q2 in the range 0.1observed in one q2 bin for one of the observables. Considering the 24 measurements as independent, the probability to observe such a discrepancy, or larger, in one is 0.5%.

  4. Simulations of star-forming molecular clouds: observational predictions

    NASA Astrophysics Data System (ADS)

    Zhang, Shangjia; Hartmann, Lee; Kuznetsova, Aleksandra; Abelardo Zamora, Manuel

    2018-01-01

    Observations of protostellar molecular cloud cores can be used to test theories of star formation. However, observational results can be biased because of limited information: (a) only two spatial dimensions and one velocity dimension can be measured, (b) and cores generally are not spherically symmetric. We use numerical simulations of the formation and collapse of molecular gas with sink particles to make observational predictions. We use the radiative transfer code LIME to predict CO and NH3 channel maps. We find reasonable agreement with observed velocity structures and gradients but occasional large differences depending on viewing angle.

  5. From Evaluation to Collaborative Reflection: Teacher Candidate Perceptions of a Digital Learner-Centered Classroom Observation Form

    ERIC Educational Resources Information Center

    Flores, Raymond; Krutka, Daniel G.; Mason, Katherine; Bergman, Daniel J.

    2014-01-01

    In efforts to promote a more learner-centered approach to supervision, faculty members at a Midwestern U.S. university piloted a new digital classroom observation form. Participants included middle/secondary teacher candidates (N = 28) in their final semester of their programs. The overall goal of this study was to gather teacher candidates'…

  6. Aerodynamic Drag Analysis of 3-DOF Flex-Gimbal GyroWheel System in the Sense of Ground Test

    PubMed Central

    Huo, Xin; Feng, Sizhao; Liu, Kangzhi; Wang, Libin; Chen, Weishan

    2016-01-01

    GyroWheel is an innovative device that combines the actuating capabilities of a control moment gyro with the rate sensing capabilities of a tuned rotor gyro by using a spinning flex-gimbal system. However, in the process of the ground test, the existence of aerodynamic disturbance is inevitable, which hinders the improvement of the specification performance and control accuracy. A vacuum tank test is a possible candidate but is sometimes unrealistic due to the substantial increase in costs and complexity involved. In this paper, the aerodynamic drag problem with respect to the 3-DOF flex-gimbal GyroWheel system is investigated by simulation analysis and experimental verification. Concretely, the angular momentum envelope property of the spinning rotor system is studied and its integral dynamical model is deduced based on the physical configuration of the GyroWheel system with an appropriately defined coordinate system. In the sequel, the fluid numerical model is established and the model geometries are checked with FLUENT software. According to the diversity and time-varying properties of the rotor motions in three-dimensions, the airflow field around the GyroWheel rotor is analyzed by simulation with respect to its varying angular velocity and tilt angle. The IPC-based experimental platform is introduced, and the properties of aerodynamic drag in the ground test condition are obtained through comparing the simulation with experimental results. PMID:27941602

  7. Observability of forming planets and their circumplanetary discs - I. Parameter study for ALMA

    NASA Astrophysics Data System (ADS)

    Szulágyi, J.; Plas, G. van der; Meyer, M. R.; Pohl, A.; Quanz, S. P.; Mayer, L.; Daemgen, S.; Tamburello, V.

    2018-01-01

    We present mock observations of forming planets with Atacama Large Millimeter Array (ALMA). The possible detections of circumplanetary discs (CPDs) were investigated around planets of Saturn, 1, 3, 5, and 10 Jupiter-masses that are placed at 5.2 au from their star. The radiative, 3D hydrodynamic simulations were then post-processed with RADMC3D and the ALMA observation simulator. We found that even though the CPDs are too small to be resolved, they are hot due to the accreting planet in the optically thick limit; therefore, the best chance to detect them with continuum observations in this case is at the shortest ALMA wavelengths, such as band 9 (440 μm). Similar fluxes were found in the case of Saturn and Jupiter-mass planets, as for the 10 MJup gas-giant, due to temperature-weighted optical depth effects: when no deep gap is carved, the planet region is blanketed by the optically thick circumstellar disc leading to a less efficient cooling there. A test was made for a 52 au orbital separation, which showed that optically thin CPDs are also detectable in band 7 but they need longer integration times (>5 h). Comparing the gap profiles of the same simulation at various ALMA bands and the hydro simulation confirmed that they change significantly, first because the gap is wider at longer wavelengths due to decreasing optical depth; secondly, the beam convolution makes the gap shallower and at least 25 per cent narrower. Therefore, caution has to be made when estimating planet masses based on ALMA continuum observations of gaps.

  8. Relationship of Topside Ionospheric Ion Outflows to Auroral Forms and Precipitations, Plasma Waves, and Convection Observed by POLAR

    NASA Technical Reports Server (NTRS)

    Hirahara, M.; Horwitz, J. L.; Moore, T. E.; Germany, G. A.; Spann, J. F.; Peterson, W. K.; Shelley, E. G.; Chandler, M. O.; Giles, B. L.; Craven, P. D.; hide

    1997-01-01

    The POLAR satellite often observes upflowing ionospheric ions (UFls) in and near the auroral oval on southern perigee (approximately 5000 km altitude) passes. We present the UFI features observed by the thermal ion dynamics experiment (TIDE) and the toroidal imaging mass-angle spectrograph (TIMAS) in the dusk-dawn sector under two different geomagnetic activity conditions in order to elicit their relationships with auroral forms, wave emissions, and convection pattern from additional POLAR instruments. During the active interval, the ultraviolet imager (UVI) observed a bright discrete aurora on the dusk side after the substorm onset and then observed a small isolated aurora form and diffuse auroras on the dawn side during the recovery phase. The UFls showed clear conic distributions when the plasma wave instrument (PWI) detected strong broadband wave emissions below approximately 10 kHz, while no significant auroral activities were observed by UVI. At higher latitudes, the low-energy UFI conics gradually changed to the polar wind component with decreasing intensity of the broadband emissions. V-shaped auroral kilometric radiation (AKR) signatures observed above approximately 200 kHz by PWI coincided with the region where the discrete aurora and the UFI beams were detected. The latitude of these features was lower than that of the UFI conics. During the observations of the UFI beams and conics, the lower-frequency fluctuations observed by the electric field instrument (EFI) were also enhanced, and the convection directions exhibited large fluctuations. It is evident that large electrostatic potential drops produced the precipitating electrons and discrete auroras, the UFI beams, and the AKR, which is also supported by the energetic plasma data from HYDRA. Since the intense broadband emissions were also observed with the UFIs. the ionospheric ions could be energized transversely before or during the parallel acceleration due to the potential drops.

  9. Relationship of Topside Ionospheric Ion Outflows to Auroral Forms and Precipitation, Plasma Waves, and Convection Observed by Polar

    NASA Technical Reports Server (NTRS)

    Hirahara, M.; Horwitz, J. L.; Moore, T. E.; Germany, G. A.; Spann, J. F.; Peterson, W. K.; Shelley, E. G.; Chandler, M. O.; Giles, B. L.; Craven, P. D.; hide

    1998-01-01

    The POLAR satellite often observes upflowing ionospheric ions (UFIs) in and near the aurora] oval on southern perigee (approx. 5000 km altitude) passes. We present the UFI features observed by the thermal ion dynamics experiment (TIDE) and the toroidal imaging mass angle spectrograph (TIMAS) in the dusk-dawn sector under two different geomagnetic activity conditions in order to elicit their relationships with auroral forms, wave emissions, and convection pattern from additional POLAR instruments. During the active interval, the ultraviolet imager (UVI) observed a bright discrete aurora on the duskside after the substorm onset and then observed a small isolated aurora form and diffuse auroras on the dawnside during the recovery phase. The UFIs showed clear conic distributions when the plasma wave instrument (PWI) detected strong broadband wave emissions below approx. 10 kHz, while no significant auroral activities were observed by UVI. At higher latitudes, the low-energy UFI conics gradually changed to the polar wind component with decreasing intensity of the broadband emissions. V-shaped auroral kilometric radiation (AKR) signatures observed above -200 kHz by PWI coincided with the region where the discrete aurora and the UFI beams were detected. The latitude of these features was lower than that of the UFI conics. During the observations of the UFI beams and conics, the lower-frequency fluctuations observed by the electric field instrument were also enhanced, and the convection directions exhibited large fluctuations. It is evident that large electrostatic potential drops produced the precipitating electrons and discrete auroras, the UFI beams, and the AKR, which is also supported by the energetic plasma data from HYDRA. Since the intense broadband emissions were also observed with the UFIs, the ionospheric ions could be energized transversely before or during the parallel acceleration due to the potential drops.

  10. Design and Evaluation of Shape-Changing Haptic Interfaces for Pedestrian Navigation Assistance.

    PubMed

    Spiers, Adam J; Dollar, Aaron M

    2017-01-01

    Shape-changing interfaces are a category of device capable of altering their form in order to facilitate communication of information. In this work, we present a shape-changing device that has been designed for navigation assistance. 'The Animotus' (previously, 'The Haptic Sandwich' ), resembles a cube with an articulated upper half that is able to rotate and extend (translate) relative to the bottom half, which is fixed in the user's grasp. This rotation and extension, generally felt via the user's fingers, is used to represent heading and proximity to navigational targets. The device is intended to provide an alternative to screen or audio based interfaces for visually impaired, hearing impaired, deafblind, and sighted pedestrians. The motivation and design of the haptic device is presented, followed by the results of a navigation experiment that aimed to determine the role of each device DOF, in terms of facilitating guidance. An additional device, 'The Haptic Taco', which modulated its volume in response to target proximity (negating directional feedback), was also compared. Results indicate that while the heading (rotational) DOF benefited motion efficiency, the proximity (translational) DOF benefited velocity. Combination of the two DOF improved overall performance. The volumetric Taco performed comparably to the Animotus' extension DOF.

  11. Very Large Array OH Zeeman Observations of the Star-forming Region S88B

    NASA Astrophysics Data System (ADS)

    Sarma, A. P.; Brogan, C. L.; Bourke, T. L.; Eftimova, M.; Troland, T. H.

    2013-04-01

    We present observations of the Zeeman effect in OH thermal absorption main lines at 1665 and 1667 MHz taken with the Very Large Array toward the star-forming region S88B. The OH absorption profiles toward this source are complicated, and contain several blended components toward a number of positions. Almost all of the OH absorbing gas is located in the eastern parts of S88B, toward the compact continuum source S88B-2 and the eastern parts of the extended continuum source S88B-1. The ratio of 1665/1667 MHz OH line intensities indicates the gas is likely highly clumped, in agreement with other molecular emission line observations in the literature. S88-B appears to present a similar geometry to the well-known star-forming region M17, in that there is an edge-on eastward progression from ionized to molecular gas. The detected magnetic fields appear to mirror this eastward transition; we detected line-of-sight magnetic fields ranging from 90 to 400 μG, with the lowest values of the field to the southwest of the S88B-1 continuum peak, and the highest values to its northeast. We used the detected fields to assess the importance of the magnetic field in S88B by a number of methods; we calculated the ratio of thermal to magnetic pressures, we calculated the critical field necessary to completely support the cloud against self-gravity and compared it to the observed field, and we calculated the ratio of mass to magnetic flux in terms of the critical value of this parameter. All these methods indicated that the magnetic field in S88B is dynamically significant, and should provide an important source of support against gravity. Moreover, the magnetic energy density is in approximate equipartition with the turbulent energy density, again pointing to the importance of the magnetic field in this region.

  12. Observational Constraints on the Nature of the Dark Energy: First Cosmological Results From the ESSENCE Supernova Survey

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wood-Vasey, W.Michael; Miknaitis, G.; Stubbs, C.W.

    We present constraints on the dark energy equation-of-state parameter, w = P/({rho}c{sup 2}), using 60 Type Ia supernovae (SNe Ia) from the ESSENCE supernova survey. We derive a set of constraints on the nature of the dark energy assuming a flat Universe. By including constraints on ({Omega}{sub M}, w) from baryon acoustic oscillations, we obtain a value for a static equation-of-state parameter w = -1.05{sub -0.12}{sup +0.13} (stat 1{sigma}) {+-} 0.13 (sys) and {Omega}{sub M} = 0.274{sub -0.020}{sup +0.033} (stat 1{sigma}) with a best-fit {chi}{sup 2}/DoF of 0.96. These results are consistent with those reported by the Super-Nova Legacy Surveymore » in a similar program measuring supernova distances and redshifts. We evaluate sources of systematic error that afflict supernova observations and present Monte Carlo simulations that explore these effects. Currently, the largest systematic currently with the potential to affect our measurements is the treatment of extinction due to dust in the supernova host galaxies. Combining our set of ESSENCE SNe Ia with the SuperNova Legacy Survey SNe Ia, we obtain a joint constraint of w = -1.07{sub -0.09}{sup +0.09} (stat 1{sigma}) {+-} 0.13 (sys), {Omega}{sub M} = 0.267{sub -0.018}{sup +0.028} (stat 1{sigma}) with a best-fit {chi}{sup 2}/DoF of 0.91. The current SNe Ia data are fully consistent with a cosmological constant.« less

  13. The high-mass star-forming core G35.2N: what have we learnt from SOFIA and ALMA observations?

    NASA Astrophysics Data System (ADS)

    Zinnecker, Hans; Sandell, Goeran

    2014-07-01

    G35.2N is a luminouos, star forming core in a filamentary cloud at a distance of 2.2 kpc. It is associated with a thermal N-S radio jet and a misaligned NE-SW CO outflow observed both with SOFIA FORCAST (30 and 40 microns, ~4" resolution; Zhang, Tan, de Buizer et al. 2013) and with ALMA band 7 (850 micron line and continuum, 0.4" resolution; Sanchez-Monge, Cesaroni, Beltran et al. 2013, 2014). The ALMA observations revealed a NW-SE Keplerian rotating disk in the CH3CN molecule (Sanchez-Monge et al.) with an enclosed protostellar mass of 18 +/- 3 Mo, whose orientation is inconsistent with the N-S radio jet, and whose protostellar mass is marginally inconsistent with the one inferred from the SED modelling (20-34 Mo, L ~ 10(5) Lo; Zhang et al.) We review the various assumptions involved in the derivation of the disk interpretation and the SED modelling. The dynamical mass could be in the form of a close binary (two 9 Mo stars, say) in which case the predicted total luminosity would be 3 x 10(4) Lo, close to the actually observed one (as opposed to the modelled one, which takes into account the flashlight effect and unmeasured radiation that escapes along a bipolar cavity). One the other hand, if the inferred higher-luminosity model is correct, the disk interpretation of ALMA rotation curve may have to be challenged, and what seems like a nice disk might be a more complex dynamical structure, such as a warped or precessing disk around a binary protostar or a different (outflow-related) velocity-structure altogether. These observations show the complexity of the interpretation of multi-wavelength observations of high-mass star forming regions when viewed with different spatial resolutions.

  14. Comparison and Analysis of ISO/IEEE 11073, IHE PCD-01, and HL7 FHIR Messages for Personal Health Devices

    PubMed Central

    Do, Hyoungho

    2018-01-01

    Objectives Increasing use of medical devices outside of healthcare facilities inevitably requires connectivity and interoperability between medical devices and healthcare information systems. To this end, standards have been developed and used to provide interoperability between personal health devices (PHDs) and external systems. ISO/IEEE 11073 standards and IHE PCD-01 standard messages have been used the most in the exchange of observation data of health devices. Recently, transmitting observation data using the HL7 FHIR standard has been devised in the name of DoF (Devices on FHIR) and adopted very fast. We compare and analyze these standards and suggest that which standard will work best at the different environments of device usage. Methods We generated each message/resource of the three standards for observed vital signs from blood pressure monitor and thermometer. Then, the size, the contents, and the exchange processes of these messages are compared and analyzed. Results ISO/IEEE 11073 standard message has the smallest data size, but it has no ability to contain the key information, patient information. On the other hand, PCD-01 messages and FHIR standards have the fields for patient information. HL7 DoF standards provide reusing of information unit known as resource, and it is relatively easy to parse DoF messages since it uses widely known XML and JSON. Conclusions ISO/IEEE 11073 standards are suitable for devices having very small computing power. IHE PCD-01 and HL7 DoF messages can be used for the devices that need to be connected to hospital information systems that require patient information. When information reuse is frequent, DoF is advantageous over PCD-01. PMID:29503752

  15. Comparison and Analysis of ISO/IEEE 11073, IHE PCD-01, and HL7 FHIR Messages for Personal Health Devices.

    PubMed

    Lee, Sungkee; Do, Hyoungho

    2018-01-01

    Increasing use of medical devices outside of healthcare facilities inevitably requires connectivity and interoperability between medical devices and healthcare information systems. To this end, standards have been developed and used to provide interoperability between personal health devices (PHDs) and external systems. ISO/IEEE 11073 standards and IHE PCD-01 standard messages have been used the most in the exchange of observation data of health devices. Recently, transmitting observation data using the HL7 FHIR standard has been devised in the name of DoF (Devices on FHIR) and adopted very fast. We compare and analyze these standards and suggest that which standard will work best at the different environments of device usage. We generated each message/resource of the three standards for observed vital signs from blood pressure monitor and thermometer. Then, the size, the contents, and the exchange processes of these messages are compared and analyzed. ISO/IEEE 11073 standard message has the smallest data size, but it has no ability to contain the key information, patient information. On the other hand, PCD-01 messages and FHIR standards have the fields for patient information. HL7 DoF standards provide reusing of information unit known as resource, and it is relatively easy to parse DoF messages since it uses widely known XML and JSON. ISO/IEEE 11073 standards are suitable for devices having very small computing power. IHE PCD-01 and HL7 DoF messages can be used for the devices that need to be connected to hospital information systems that require patient information. When information reuse is frequent, DoF is advantageous over PCD-01.

  16. Multi-thermal observations of newly formed loops in a dynamic flare

    NASA Technical Reports Server (NTRS)

    Svestka, Zdenek F.; Fontenla, Juan M.; Machado, Marcos E.; Martin, Sara F.; Neidig, Donald F.

    1987-01-01

    The dynamic flare of November 6, 1980 (max at about 15:26 UT) developed a rich system of growing loops which could be followed in H-alpha for 1.5 hr. Throughout the flare, these loops, near the limb, were seen in emission against the disk. Theoretical computations of deviations from LTE populations for a hydrogen atom reveal that this requires electron densities in the loops close to, or in excess of 10 to the 12th/cu cm. From measured widths of higher Balmer lines the density at the tops of the loops was found to be 4 x 10 to the 12th/cu cm if no nonthermal motions were present, or 5 x 10 to the 11th/cu cm for a turbulent velocity of about 12 km/s. It is now general knowledge that flare loops are initially observed in X-rays and become visible in H-alpha only after cooling. For such a high density, a loop would cool through radiation from 10 to the 7th to 10 to the 4th K within a few minutes so that the dense H-alpha loops should have heights very close to the heights of the X-ray loops. This, however, contradicts the observations obtained by the HXIS and FCS instruments on board SMM which show the X-ray loops at much higher altitudes than the loops in H-alpha. Therefore, it is suggested that the density must have been significantly lower when the loops were formed, and that the flare loops were apparently both shrinking and increasing in density while cooling.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, J; Nguyen, D; O’Brien, R

    Purpose: Kilovoltage intrafraction monitoring (KIM) scheme has been successfully used to simultaneously monitor 3D tumor motion during radiotherapy. Recently, an iterative closest point (ICP) algorithm was implemented in KIM to also measure rotations about three axes, enabling real-time tracking of tumor motion in six degrees-of-freedom (DoF). This study aims to evaluate the accuracy of the six DoF motion estimates of KIM by comparing it with the corresponding motion (i) measured by the Calypso; and (ii) derived from kV/MV triangulation. Methods: (i) Various motions (static and dynamic) were applied to a CIRS phantom with three embedded electromagnetic transponders (Calypso Medical) usingmore » a 5D motion platform (HexaMotion) and a rotating treatment couch while both KIM and Calypso were used to concurrently track the phantom motion in six DoF. (ii) KIM was also used to retrospectively estimate six DoF motion from continuous sets of kV projections of a prostate, implanted with three gold fiducial markers (2 patients with 80 fractions in total), acquired during the treatment. Corresponding motion was obtained from kV/MV triangulation using a closed form least squares method based on three markers’ positions. Only the frames where all three markers were present were used in the analysis. The mean differences between the corresponding motion estimates were calculated for each DoF. Results: Experimental results showed that the mean of absolute differences in six DoF phantom motion measured by Calypso and KIM were within 1.1° and 0.7 mm. kV/MV triangulation derived six DoF prostate tumor better agreed with KIM estimated motion with the mean (s.d.) difference of up to 0.2° (1.36°) and 0.2 (0.25) mm for rotation and translation, respectively. Conclusion: These results suggest that KIM can provide an accurate six DoF intrafraction tumor during radiotherapy.« less

  18. Achievable degrees of freedom of MIMO two-way relay interference channel with delayed CSIT

    NASA Astrophysics Data System (ADS)

    Li, Qingyun; Wu, Gang; Li, Shaoqian

    2016-10-01

    In this paper, assuming each node has delayed channel state information at the transmitter (CSIT), we investigate the achievable degrees of freedom (DOF) of MIMO two-way relay interference channel in frequency division duplex (FDD) systems, where there are K user pairs (i.e., 2K users) and each user in a user pair exchanges messages with the other user in the same user pair simultaneously via an intermediate relay. We propose a two-stage transmission scheme and derive the closed-form expressions for its achievable DOF.

  19. Electrical generation and control of the valley carriers in a monolayer transition metal dichalcogenide

    NASA Astrophysics Data System (ADS)

    Ye, Yu; Xiao, Jun; Wang, Hailong; Ye, Ziliang; Zhu, Hanyu; Zhao, Mervin; Wang, Yuan; Zhao, Jianhua; Yin, Xiaobo; Zhang, Xiang

    2016-07-01

    Electrically controlling the flow of charge carriers is the foundation of modern electronics. By accessing the extra spin degree of freedom (DOF) in electronics, spintronics allows for information processes such as magnetoresistive random-access memory. Recently, atomic membranes of transition metal dichalcogenides (TMDCs) were found to support unequal and distinguishable carrier distribution in different crystal momentum valleys. This valley polarization of carriers enables a new DOF for information processing. A variety of valleytronic devices such as valley filters and valves have been proposed, and optical valley excitation has been observed. However, to realize its potential in electronics it is necessary to electrically control the valley DOF, which has so far remained a significant challenge. Here, we experimentally demonstrate the electrical generation and control of valley polarization. This is achieved through spin injection via a diluted ferromagnetic semiconductor and measured through the helicity of the electroluminescence due to the spin-valley locking in TMDC monolayers. We also report a new scheme of electronic devices that combine both the spin and valley DOFs. Such direct electrical generation and control of valley carriers opens up new dimensions in utilizing both the spin and valley DOFs for next-generation electronics and computing.

  20. Observation of a system of linear loops formed by re-growing hairs on rat skin.

    PubMed

    Liu, Li-Yuan; Guo, Dong-Sheng; Xin, Xiu-Yu; Fang, Jin

    2008-07-01

    This paper details linear hair re-growth patterns observed in rats. Adult rats were shaved and observed. The first wave of hair re-growth did not distribute everywhere, but along specific craniocaudally-oriented lines. The hair-lines were 2-15 mm wide and ran from the head, through the torso to the limbs, and were symmetrical along the left and right sides of the body. The symmetric hair-lines from both sides of the body converged around the mouth, nose, and at the pubic region or ventral midline to form a system of hair-loop-lines (HLLs). The loops can be differentiated into four main patterns. The Dorsal Loop and the Lateral Dorsal Loop run along the dorsum and hindlimb. The Ventral Loop and Lateral Ventral Loop travel along the thorax, abdomen, and forelimb. These hair-lines coincide with our previously observed sympathetic-substance lines (SSLs) in the rat's skin. Histological observation indicates that rat hair follicles along the hair-lines were at anagen phase. The catecholamine histofluorescent check showed abundant sympathetic nerve fibers beneath the hair-lines. After the rats' hairs were dyed, and selected portions shaved, re-growth was only observed on the shaved portions, indicating that the linear hair growth closely correlated with the shaving. Lastly we examine the cause of the preferential re-growth and briefly discuss the purpose and physiological role of the HLL. (c) 2008 Wiley-Liss, Inc.

  1. Time and Frequency-Domain Cross-Verification of SLS 6DOF Trajectory Simulations

    NASA Technical Reports Server (NTRS)

    Johnson, Matthew; McCullough, John

    2017-01-01

    The Space Launch System (SLS) Guidance, Navigation, and Control (GNC) team and its partners have developed several time- and frequency-based simulations for development and analysis of the proposed SLS launch vehicle. The simulations differ in fidelity and some have unique functionality that allows them to perform specific analyses. Some examples of the purposes of the various models are: trajectory simulation, multi-body separation, Monte Carlo, hardware in the loop, loads, and frequency domain stability analyses. While no two simulations are identical, many of the models are essentially six degree-of-freedom (6DOF) representations of the SLS plant dynamics, hardware implementation, and flight software. Thus at a high level all of those models should be in agreement. Comparison of outputs from several SLS trajectory and stability analysis tools are ongoing as part of the program's current verification effort. The purpose of these comparisons is to highlight modeling and analysis differences, verify simulation data sources, identify inconsistencies and minor errors, and ultimately to verify output data as being a good representation of the vehicle and subsystem dynamics. This paper will show selected verification work in both the time and frequency domain from the current design analysis cycle of the SLS for several of the design and analysis simulations. In the time domain, the tools that will be compared are MAVERIC, CLVTOPS, SAVANT, STARS, ARTEMIS, and POST 2. For the frequency domain analysis, the tools to be compared are FRACTAL, SAVANT, and STARS. The paper will include discussion of these tools including their capabilities, configurations, and the uses to which they are put in the SLS program. Determination of the criteria by which the simulations are compared (matching criteria) requires thoughtful consideration, and there are several pitfalls that may occur that can severely punish a simulation if not considered carefully. The paper will discuss these

  2. MID-INFRARED SPECTROSCOPIC OBSERVATIONS OF THE DUST-FORMING CLASSICAL NOVA V2676 OPH

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kawakita, Hideyo; Arai, Akira; Shinnaka, Yoshiharu

    2017-02-01

    The dust-forming nova V2676 Oph is unique in that it was the first nova to provide evidence of C{sub 2} and CN molecules during its near-maximum phase and evidence of CO molecules during its early decline phase. Observations of this nova have revealed the slow evolution of its lightcurves and have also shown low isotopic ratios of carbon ({sup 12}C/{sup 13}C) and nitrogen ({sup 14}N/{sup 15}N) in its envelope. These behaviors indicate that the white dwarf (WD) star hosting V2676 Oph is a CO-rich WD rather than an ONe-rich WD (typically larger in mass than the former). We performed mid-infraredmore » spectroscopic and photometric observations of V2676 Oph in 2013 and 2014 (respectively 452 and 782 days after its discovery). No significant [Ne ii] emission at 12.8 μ m was detected at either epoch. These provided evidence for a CO-rich WD star hosting V2676 Oph. Both carbon-rich and oxygen-rich grains were detected in addition to an unidentified infrared feature at 11.4 μ m originating from polycyclic aromatic hydrocarbon molecules or hydrogenated amorphous carbon grains in the envelope of V2676 Oph.« less

  3. Ice Mapping Observations in Galactic Star-Forming Regions: the AKARI Legacy

    NASA Astrophysics Data System (ADS)

    Fraser, Helen Jane; Suutarinnen, Aleksi; Noble, Jennifer

    2015-08-01

    It is becoming increasingly clear that explaining the small-scale distribution of many gas-phase molecules relies on our interpretation of the complex inter-connectivity between gas- and solid-phase interstellar chemistries. Inputs to proto-stellar astrochemical models are required that exploit ice compositions reflecting the historical physical conditions in pre-stellar environments when the ices first formed. Such data are required to translate the near-universe picture of ice-composition to our understanding of the role of extra-galactic ices in star-formation at higher redshifts.Here we present the first attempts at multi-object ice detections, and the subsequent ice column density mapping. The AKARI space telescope was uniquely capable of observing all the ice features between 2 and 5 microns, thereby detecting H2O, CO and CO2 ices concurrently, through their stretching vibrational features. Our group has successfully extracted an unprecedented volume of ice spectra from AKARI, including sources with not more than 2 mJy flux at 3 microns, showing:(a) H2O CO and CO2 ices on 30 lines of sight towards pre-stellar and star-forming cores, which when combined with laboratory experiments indicate how the chemistries of these three ices are interlinked (Noble et al (2013)),(b) ice maps showing the spatial distribution of water ice across 12 pre-stellar cores, in different molecular clouds (Suutarinnen et al (2015)), and the distribution of ice components within these cores on 1000 AU scales (Noble et al (2015)),(c) over 200 new detections of water ice, mostly on lines of sight towards background sources (> 145), indicating that water ice column density has a minimum value as a function of Av, but on a cloud-by-cloud basis typically correlates with Av, and dust emissivity at 250 microns (Suutarinnen et al (2015)),(d) the first detections of HDO ice towards background stars (Fraser et al (2015)).We discuss whether these results support the picture of a generic chemical

  4. Predictive validity of the classroom strategies scale-observer form on statewide testing scores: an initial investigation.

    PubMed

    Reddy, Linda A; Fabiano, Gregory A; Dudek, Christopher M; Hsu, Louis

    2013-12-01

    The present study examined the validity of a teacher observation measure, the Classroom Strategies Scale--Observer Form (CSS), as a predictor of student performance on statewide tests of mathematics and English language arts. The CSS is a teacher practice observational measure that assesses evidence-based instructional and behavioral management practices in elementary school. A series of two-level hierarchical generalized linear models were fitted to data of a sample of 662 third- through fifth-grade students to assess whether CSS Part 2 Instructional Strategy and Behavioral Management Strategy scale discrepancy scores (i.e., ∑ |recommended frequency--frequency ratings|) predicted statewide mathematics and English language arts proficiency scores when percentage of minority students in schools was controlled. Results indicated that the Instructional Strategy scale discrepancy scores significantly predicted mathematics and English language arts proficiency scores: Relatively larger discrepancies on observer ratings of what teachers did versus what should have been done were associated with lower proficiency scores. Results offer initial evidence of the predictive validity of the CSS Part 2 Instructional Strategy discrepancy scores on student academic outcomes. PsycINFO Database Record (c) 2013 APA, all rights reserved.

  5. Valley magnetoelectricity in single-layer MoS2

    NASA Astrophysics Data System (ADS)

    Lee, Jieun; Wang, Zefang; Xie, Hongchao; Mak, Kin Fai; Shan, Jie

    2017-09-01

    The magnetoelectric (ME) effect, the phenomenon of inducing magnetization by application of an electric field or vice versa, holds great promise for magnetic sensing and switching applications. Studies of the ME effect have so far focused on the control of the electron spin degree of freedom (DOF) in materials such as multiferroics and conventional semiconductors. Here, we report a new form of the ME effect based on the valley DOF in two-dimensional Dirac materials. By breaking the three-fold rotational symmetry in single-layer MoS 2 via a uniaxial stress, we have demonstrated the pure electrical generation of valley magnetization in this material, and its direct imaging by Kerr rotation microscopy. The observed out-of-plane magnetization is independent of in-plane magnetic field, linearly proportional to the in-plane current density, and optimized when the current is orthogonal to the strain-induced piezoelectric field. These results are fully consistent with a theoretical model of valley magnetoelectricity driven by Berry curvature effects. Furthermore, the effect persists at room temperature, opening possibilities for practical valleytronic devices.

  6. Valley magnetoelectricity in single-layer MoS2.

    PubMed

    Lee, Jieun; Wang, Zefang; Xie, Hongchao; Mak, Kin Fai; Shan, Jie

    2017-09-01

    The magnetoelectric (ME) effect, the phenomenon of inducing magnetization by application of an electric field or vice versa, holds great promise for magnetic sensing and switching applications. Studies of the ME effect have so far focused on the control of the electron spin degree of freedom (DOF) in materials such as multiferroics and conventional semiconductors. Here, we report a new form of the ME effect based on the valley DOF in two-dimensional Dirac materials. By breaking the three-fold rotational symmetry in single-layer MoS 2 via a uniaxial stress, we have demonstrated the pure electrical generation of valley magnetization in this material, and its direct imaging by Kerr rotation microscopy. The observed out-of-plane magnetization is independent of in-plane magnetic field, linearly proportional to the in-plane current density, and optimized when the current is orthogonal to the strain-induced piezoelectric field. These results are fully consistent with a theoretical model of valley magnetoelectricity driven by Berry curvature effects. Furthermore, the effect persists at room temperature, opening possibilities for practical valleytronic devices.

  7. Exact docking flight controller for autonomous aerial refueling with back-stepping based high order sliding mode

    NASA Astrophysics Data System (ADS)

    Su, Zikang; Wang, Honglun; Li, Na; Yu, Yue; Wu, Jianfa

    2018-02-01

    Autonomous aerial refueling (AAR) exact docking control has always been an intractable problem due to the strong nonlinearity, the tight coupling of the 6 DOF aircraft model and the complex disturbances of the multiple environment flows. In this paper, the strongly coupled nonlinear 6 DOF model of the receiver aircraft which considers the multiple flow disturbances is established in the affine nonlinear form to facilitate the nonlinear controller design. The items reflecting the influence of the unknown flow disturbances in the receiver dynamics are taken as the components of the "lumped disturbances" together with the items which have no linear correlation with the virtual control variables. These unmeasurable lumped disturbances are estimated and compensated by a specially designed high order sliding mode observer (HOSMO) with excellent estimation property. With the compensation of the estimated lumped disturbances, a back-stepping high order sliding mode based exact docking flight controller is proposed for AAR in the presence of multiple flow disturbances. Extensive simulation results demonstrate the feasibility and superiority of the proposed docking controller.

  8. X-RAY AND RADIO OBSERVATIONS OF THE MASSIVE STAR-FORMING REGION IRAS 20126+4104

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Montes, V. A.; Hofner, P.; Anderson, C.

    2015-08-15

    We present results from Chandra ACIS-I and Karl G. Jansky Very Large Array 6 cm continuum observations of the IRAS 20126+4104 massive star-forming region. We detect 150 X-ray sources within the 17′ × 17′ ACIS-I field, and a total of 13 radio sources within the 9.′2 primary beam at 4.9 GHz. Among these observtions are the first 6 cm detections of the central sources reported by Hofner et al., namely, I20N1, I20S, and I20var. A new variable radio source is also reported. Searching the 2MASS archive, we identified 88 near-infrared (NIR) counterparts to the X-ray sources. Only four of the X-raymore » sources had 6 cm counterparts. Based on an NIR color–color analysis and on the Besançon simulation of Galactic stellar populations, we estimate that approximately 80 X-ray sources are associated with this massive star-forming region. We detect an increasing surface density of X-ray sources toward the massive protostar and infer the presence of a cluster of at least 43 young stellar objects within a distance of 1.2 pc from the massive protostar.« less

  9. An Observationally Constrained Model of a Flux Rope that Formed in the Solar Corona

    NASA Astrophysics Data System (ADS)

    James, Alexander W.; Valori, Gherardo; Green, Lucie M.; Liu, Yang; Cheung, Mark C. M.; Guo, Yang; van Driel-Gesztelyi, Lidia

    2018-03-01

    Coronal mass ejections (CMEs) are large-scale eruptions of plasma from the coronae of stars. Understanding the plasma processes involved in CME initiation has applications for space weather forecasting and laboratory plasma experiments. James et al. used extreme-ultraviolet (EUV) observations to conclude that a magnetic flux rope formed in the solar corona above NOAA Active Region 11504 before it erupted on 2012 June 14 (SOL2012-06-14). In this work, we use data from the Solar Dynamics Observatory (SDO) to model the coronal magnetic field of the active region one hour prior to eruption using a nonlinear force-free field extrapolation, and find a flux rope reaching a maximum height of 150 Mm above the photosphere. Estimations of the average twist of the strongly asymmetric extrapolated flux rope are between 1.35 and 1.88 turns, depending on the choice of axis, although the erupting structure was not observed to kink. The decay index near the apex of the axis of the extrapolated flux rope is comparable to typical critical values required for the onset of the torus instability, so we suggest that the torus instability drove the eruption.

  10. ALMA observations of atomic carbon in z ˜ 4 dusty star-forming galaxies

    NASA Astrophysics Data System (ADS)

    Bothwell, M. S.; Aguirre, J. E.; Aravena, M.; Bethermin, M.; Bisbas, T. G.; Chapman, S. C.; De Breuck, C.; Gonzalez, A. H.; Greve, T. R.; Hezaveh, Y.; Ma, J.; Malkan, M.; Marrone, D. P.; Murphy, E. J.; Spilker, J. S.; Strandet, M.; Vieira, J. D.; Weiß, A.

    2017-04-01

    We present Atacama Large Millimeter Array [C I](1 - 0) (rest frequency 492 GHz) observations for a sample of 13 strongly lensed dusty star-forming galaxies (DSFGs) originally discovered at 1.4 mm in a blank-field survey by the South Pole Telescope (SPT). We compare these new data with available [C I] observations from the literature, allowing a study of the interstellar medium (ISM) properties of ˜30 extreme DSFGs spanning a redshift range 2 < z < 5. Using the [C I] line as a tracer of the molecular ISM, we find a mean molecular gas mass for SPT-DSFGs of 6.6 × 1010 M⊙. This is in tension with gas masses derived via low-J 12CO and dust masses; bringing the estimates into accordance requires either (a) an elevated CO-to-H2 conversion factor for our sample of αCO ˜ 2.5 and a gas-to-dust ratio ˜200, or (b) an high carbon abundance X_{C I} ˜ 7× 10^{-5}. Using observations of a range of additional atomic and molecular lines (including [C I], [C II]and multiple transitions of CO), we use a modern photodissociation region code (3D-PDR) to assess the physical conditions (including the density, UV radiation field strength and gas temperature) within the ISM of the DSFGs in our sample. We find that the ISM within our DSFGs is characterized by dense gas permeated by strong UV fields. We note that previous efforts to characterize photodissociation region regions in DSFGs may have significantly under-estimated the density of the ISM. Combined, our analysis suggests that the ISM of extreme dusty starbursts at high redshift consists of dense, carbon-rich gas not directly comparable to the ISM of starbursts in the local Universe.

  11. Coastal heavy rainband formed along Sumatera Island, Indonesia, observed with X-band Doppler radars during HARIMAU2011 campaign

    NASA Astrophysics Data System (ADS)

    Mori, Shuichi; Jun-Ichi, Hamada; Hattori, Miki; Kamimera, Hideyuki; Wu, Peiming; Arbain, Ardhi A.; Lestari, Sopia; Syamsudin, Fadli; Yamanaka, Manabu D.

    2013-04-01

    Coastal heavy rainbands (CHeRs) are widely identified over Asian monsoon region (e.g., Western Ghats, Bay of Bengal, Gulf of Thailand, and western Philippines) by satellite observations. Some of them are explained by synoptic wind-terrain interaction (Xie et al., 2006 JC) because they are anchored along mountain ranges face to southwest direction and predominant during boreal summer southwesterly monsoon season. Most Asian megacities are located in coastal regions, thus they have much chance to be suffered from torrential rainfall embedded in CHeRs which may cause flash floods in downtown cities and landslides in mountainous regions. Moreover, rainfall amount over the coastal land varies quite largely if those CHeRs change their lateral location a little, therefore water resource management for social community is seriously sensitive to their variability. Satellite observations show that CHeRs are modified by various kinds of environmental variations, e.g., diurnal, intraseasonal, monsoonal, ENSO, and IOD. However, climatology, structure, and mechanism of CHeRs have not been examined in detail from mesoscale points of view because there are quite few studies based on ground based radar observations. Previous studies (e.g., Mori et al. 2004 MWR; Yamanaka et al. 2008 JDR; Wu et al. 2007 SOLA) showed most CHeRs in Indonesia are identified along coastlines where convective diurnal variation is predominant, and coastal heavy rain are brought mainly in the nighttime observed with a radar-profiler network deployed by Hydrometeorological ARray for Intraseasonal variation (ISV) - Monsoon AUtomonitoring (HARIMAU) project. In addition, they are confirmed even in the seasons when the wind-terrain interaction cannot explain them well. These results suggest that CHeRs are formed by not only the synoptic wind-terrain effect but also mesoscale convections which developed nocturnally everyday along coastlines. We carried out the HARIMAU2011 campaign observation over Sumatera Island

  12. Gene- and environment-dependent neuroendocrine etiogenesis of homosexuality and transsexualism.

    PubMed

    Dörner, G; Poppe, I; Stahl, F; Kölzsch, J; Uebelhack, R

    1991-01-01

    Sexual brain organization is dependent on sex hormone and neurotransmitter levels occurring during critical developmental periods. The higher the androgen levels during brain organization, caused by genetic and/or environmental factors, the higher is the biological predisposition to bi- and homosexuality or even transsexualism in females and the lower it is in males. Adrenal androgen excess, leading to heterotypical sexual orientation and/or gender role behavior in genetic females, can be caused by 21-hydroxylase deficiency, especially when associated with prenatal stress. The cortisol (F) precursor 21-deoxycortisol (21-DOF) was found to be significantly increased after ACTH stimulation in homosexual as compared to heterosexual females. 21-DOF was increased significantly before and even highly significantly after ACTH stimulation in female-to-male transsexuals. In view of these data, heterozygous and homozygous forms, respectively, of 21-hydroxylase deficiency represent a genetic predisposition to androgen-dependent development of homosexuality and transsexualism in females. Testicular androgen deficiency in prenatal life, giving rise to heterotypical sexual orientation and/or gender role behavior in genetic males, may be induced by prenatal stress and/or maternal or fetal genetic alterations. Most recently, in mothers of homosexual men--following ACTH stimulation--a significantly increased prevalence of high 21-DOF plasma values and 21-DOF/F ratios was found, which surpassed the mean + 1 SD level of heterosexual control women. In homosexual men as well--following ACTH stimulation--most of the 21-DOF plasma values and 21-DOF/F ratios also surpassed the mean + 1 SD level of heterosexual men. In only one out of 9 homosexual males, neither in his blood nor in that of his mother increased 21-DOF values and 21-DOF/F ratios were found after ACTH stimulation. In this homosexual man, however, the plasma dehydroepiandrosterone sulfate (DHEA-S) values and the DHEA-S/1000 x A

  13. In-situ observations of flux ropes formed in association with a pair of spiral nulls in magnetotail plasmas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guo, Ruilong; Xie, Lun; He, Jiansen

    Signatures of secondary islands are frequently observed in the magnetic reconnection regions of magnetotail plasmas. In this paper, magnetic structures with the secondary-island signatures observed by Cluster are reassembled by a fitting-reconstruction method. The results show three-dimensionally that a secondary island event can manifest the flux rope formed with an A{sub s}-type null and a B{sub s}-type null paired via their spines. We call this A{sub s}-spine-B{sub s}-like configuration the helically wrapped spine model. The reconstructed field lines wrap around the spine to form the flux rope, and an O-type topology is therefore seen on the plane perpendicular to themore » spine. Magnetized electrons are found to rotate on and cross the fan surface, suggesting that both the torsional-spine and the spine-fan reconnection take place in the configuration. Furthermore, detailed analysis implies that the spiral nulls and flux ropes were locally generated nearby the spacecraft in the reconnection outflow region, indicating that secondary reconnection may occur in the exhaust away from the primary reconnection site.« less

  14. Depth-of-Focus and its Association with the Spherical Aberration Sign. A Ray-Tracing Analysis

    PubMed Central

    Bakaraju, Ravi C.; Ehrmann, Klaus; Papas, Eric B.; Ho, Arthur

    2010-01-01

    Purpose To investigate the relationship between the sign of spherical aberration (SA) and the corresponding depth-of-focus (DoF) values around best focus, at three different spatial frequencies (SF). Additionally, to study the influence of the Stiles-Crawford effect (SCE) on DoF. Methods We modeled schematic eyes having a range of SA values, C (4, 0), from -0.20 to 0.20 μm, at 6 mm pupil, in a ray-tracing software (Zemax). The through-focus optical performance was obtained via Modulation Transfer Function (MTF) calculations using thin paraxial lenses in-front of the model eye, from -2.00 to+2.00 D in 0.05D steps. Through-focus full-width (defocus) occurring at the half maximum of MTF value was considered as DoF, in diopters. Results For the low-SF configuration, +SA and –SA results were close to being mirror symmetries of one another. However, for midand high- SF targets, in the SA range spanning from -0.15 to 0.15 μm, models of equal SA magnitude but opposite sign produced similar DoF measures, but those with SA more negative than -0.15 μm showed marginally higher DoF than their positive counterparts. The SCE improved DoF for low SF (10 cycles/mm), while for mid and higher SF (>30 cycles/mm) mixed results were observed. Conclusions As regards presbyopic-correction strategies that use deliberately induced aberrations to increase the depth of focus, the current study suggests that both positive and negative SA have equal potential. However, practical considerations will probably limit the useful DoF achievable through the utilization of SCE in presbyopes. for reference to a contemporary record detailing refractive history.

  15. Six Degree-of-Freedom Measurements of Human Mild Traumatic Brain Injury.

    PubMed

    Hernandez, Fidel; Wu, Lyndia C; Yip, Michael C; Laksari, Kaveh; Hoffman, Andrew R; Lopez, Jaime R; Grant, Gerald A; Kleiven, Svein; Camarillo, David B

    2015-08-01

    This preliminary study investigated whether direct measurement of head rotation improves prediction of mild traumatic brain injury (mTBI). Although many studies have implicated rotation as a primary cause of mTBI, regulatory safety standards use 3 degree-of-freedom (3DOF) translation-only kinematic criteria to predict injury. Direct 6DOF measurements of human head rotation (3DOF) and translation (3DOF) have not been previously available to examine whether additional DOFs improve injury prediction. We measured head impacts in American football, boxing, and mixed martial arts using 6DOF instrumented mouthguards, and predicted clinician-diagnosed injury using 12 existing kinematic criteria and 6 existing brain finite element (FE) criteria. Among 513 measured impacts were the first two 6DOF measurements of clinically diagnosed mTBI. For this dataset, 6DOF criteria were the most predictive of injury, more than 3DOF translation-only and 3DOF rotation-only criteria. Peak principal strain in the corpus callosum, a 6DOF FE criteria, was the strongest predictor, followed by two criteria that included rotation measurements, peak rotational acceleration magnitude and Head Impact Power (HIP). These results suggest head rotation measurements may improve injury prediction. However, more 6DOF data is needed to confirm this evaluation of existing injury criteria, and to develop new criteria that considers directional sensitivity to injury.

  16. Nitrogen and hydrogen fractionation in high-mass star-forming cores from observations of HCN and HNC

    NASA Astrophysics Data System (ADS)

    Colzi, L.; Fontani, F.; Caselli, P.; Ceccarelli, C.; Hily-Blant, P.; Bizzocchi, L.

    2018-02-01

    The ratio between the two stable isotopes of nitrogen, 14N and 15N, is well measured in the terrestrial atmosphere ( 272), and for the pre-solar nebula ( 441, deduced from the solar wind). Interestingly, some pristine solar system materials show enrichments in 15N with respect to the pre-solar nebula value. However, it is not yet clear if and how these enrichments are linked to the past chemical history because we have only a limited number of measurements in dense star-forming regions. In this respect, dense cores, which are believed to be the precursors of clusters and also contain intermediate- and high-mass stars, are important targets because the solar system was probably born within a rich stellar cluster, and such clusters are formed in high-mass star-forming regions. The number of observations in such high-mass dense cores has remained limited so far. In this work, we show the results of IRAM-30 m observations of the J = 1-0 rotational transition of the molecules HCN and HNC and their 15N-bearing counterparts towards 27 intermediate- and high-mass dense cores that are divided almost equally into three evolutionary categories: high-mass starless cores, high-mass protostellar objects, and ultra-compact HII regions. We have also observed the DNC(2-1) rotational transition in order to search for a relation between the isotopic ratios D/H and 14N/15N. We derive average 14N/15N ratios of 359 ± 16 in HCN and of 438 ± 21 in HNC, with a dispersion of about 150-200. We find no trend of the 14N/15N ratio with evolutionary stage. This result agrees with what has been found for N2H+ and its isotopologues in the same sources, although the 14N/15N ratios from N2H+ show a higher dispersion than in HCN/HNC, and on average, their uncertainties are larger as well. Moreover, we have found no correlation between D/H and 14N/15N in HNC. These findings indicate that (1) the chemical evolution does not seem to play a role in the fractionation of nitrogen, and that (2) the

  17. A comparative study of sensor fault diagnosis methods based on observer for ECAS system

    NASA Astrophysics Data System (ADS)

    Xu, Xing; Wang, Wei; Zou, Nannan; Chen, Long; Cui, Xiaoli

    2017-03-01

    The performance and practicality of electronically controlled air suspension (ECAS) system are highly dependent on the state information supplied by kinds of sensors, but faults of sensors occur frequently. Based on a non-linearized 3-DOF 1/4 vehicle model, different methods of fault detection and isolation (FDI) are used to diagnose the sensor faults for ECAS system. The considered approaches include an extended Kalman filter (EKF) with concise algorithm, a strong tracking filter (STF) with robust tracking ability, and the cubature Kalman filter (CKF) with numerical precision. We propose three filters of EKF, STF, and CKF to design a state observer of ECAS system under typical sensor faults and noise. Results show that three approaches can successfully detect and isolate faults respectively despite of the existence of environmental noise, FDI time delay and fault sensitivity of different algorithms are different, meanwhile, compared with EKF and STF, CKF method has best performing FDI of sensor faults for ECAS system.

  18. Implementation of Kane's Method for a Spacecraft Composed of Multiple Rigid Bodies

    NASA Technical Reports Server (NTRS)

    Stoneking, Eric T.

    2013-01-01

    Equations of motion are derived for a general spacecraft composed of rigid bodies connected via rotary (spherical or gimballed) joints in a tree topology. Several supporting concepts are developed in depth. Basis dyads aid in the transition from basis-free vector equations to component-wise equations. Joint partials allow abstraction of 1-DOF, 2-DOF, 3-DOF gimballed and spherical rotational joints to a common notation. The basic building block consisting of an "inner" body and an "outer" body connected by a joint enables efficient organization of arbitrary tree structures. Kane's equation is recast in a form which facilitates systematic assembly of large systems of equations, and exposes a relationship of Kane's equation to Newton and Euler's equations which is obscured by the usual presentation. The resulting system of dynamic equations is of minimum dimension, and is suitable for numerical solution by computer. Implementation is ·discussed, and illustrative simulation results are presented.

  19. ALMA OBSERVATIONS OF SPT-DISCOVERED, STRONGLY LENSED, DUSTY, STAR-FORMING GALAXIES

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hezaveh, Y. D.; Marrone, D. P.; Spilker, J. S.

    2013-04-20

    We present Atacama Large Millimeter/submillimeter Array (ALMA) 860 {mu}m imaging of four high-redshift (z = 2.8-5.7) dusty sources that were detected using the South Pole Telescope (SPT) at 1.4 mm and are not seen in existing radio to far-infrared catalogs. At 1.''5 resolution, the ALMA data reveal multiple images of each submillimeter source, separated by 1''-3'', consistent with strong lensing by intervening galaxies visible in near-IR imaging of these sources. We describe a gravitational lens modeling procedure that operates on the measured visibilities and incorporates self-calibration-like antenna phase corrections as part of the model optimization, which we use to interpretmore » the source structure. Lens models indicate that SPT0346-52, located at z = 5.7, is one of the most luminous and intensely star-forming sources in the universe with a lensing corrected FIR luminosity of 3.7 Multiplication-Sign 10{sup 13} L{sub Sun} and star formation surface density of 4200 M{sub Sun} yr{sup -1} kpc{sup -2}. We find magnification factors of 5 to 22, with lens Einstein radii of 1.''1-2.''0 and Einstein enclosed masses of 1.6-7.2 Multiplication-Sign 10{sup 11} M{sub Sun }. These observations confirm the lensing origin of these objects, allow us to measure their intrinsic sizes and luminosities, and demonstrate the important role that ALMA will play in the interpretation of lensed submillimeter sources.« less

  20. Comparative study of lossy and lossless data compression in distributed optical fiber sensing systems

    NASA Astrophysics Data System (ADS)

    Atubga, David; Wu, Huijuan; Lu, Lidong; Sun, Xiaoyan

    2017-02-01

    Typical fully distributed optical fiber sensors (DOFS) with dozens of kilometers are equivalent to tens of thousands of point sensors along the whole monitoring line, which means tens of thousands of data will be generated for one pulse launching period. Therefore, in an all-day nonstop monitoring, large volumes of data are created thereby triggering the demand for large storage space and high speed for data transmission. In addition, when the monitoring length and channel numbers increase, the data also increase extensively. The task of mitigating large volumes of data accumulation, large storage capacity, and high-speed data transmission is, therefore, the aim of this paper. To demonstrate our idea, we carried out a comparative study of two lossless methods, Huffman and Lempel Ziv Welch (LZW), with a lossy data compression algorithm, fast wavelet transform (FWT) based on three distinctive DOFS sensing data, such as Φ-OTDR, P-OTDR, and B-OTDA. Our results demonstrated that FWT yielded the best compression ratio with good consumption time, irrespective of errors in signal construction of the three DOFS data. Our outcomes indicate the promising potentials of FWT which makes it more suitable, reliable, and convenient for real-time compression of the DOFS data. Finally, it was observed that differences in the DOFS data structure have some influence on both the compression ratio and computational cost.

  1. Mathematical modeling and design of a novel 2-DOF micro attraction actuator for a micro optical switch

    NASA Astrophysics Data System (ADS)

    Kamiya, Daiki; Bagheri, Saeed; Horie, Mikio

    2004-08-01

    Many studies on optical switches have been performed in an attempt to develop optical information networks to speed information technology. In reality, however, mirror manipulators cannot be applied to multiple input and output systems due to both insufficient output displacements by the mirror parts inside the manipulator, and the difficulty of designing structures and mechanisms suitable for multi-dimensional manipulation. The principal reasons for insufficient displacement are the high rigidity of the elastic parts compared to the available driving forces and the pull-in effect. Therefore, in order to develop optical switches capable of multiple input and output switching, we suggest a novel 2-DOF(degree of freedom) electrostatic microactuator. The actuator is composed of one mirror with four beams laid about it in a corkscrew pattern, with four corkscrew electrodes on the substrate below and one mirror support pyramid situated under the mirror. Using electrostatic force, one or more of the beams are attracted from their outer ends toward the substrate. The mirror is then tilted by an angle proportional to the attracted length along the beam. The inclination and direction of the mirror are determined by the combined attracted length of the four beams. In this work we derive the mathematical model for the corkscrew beam microactuator for optical switches and show that this mathematical model accurately simulates the device by comparison with finite element analysis results. We use this mathematical model for design of the microactuator. Further we show that the designed optical switch microactuator is capable of rotating the mirror from +32 to -32 degrees about two axes with a maximum operating voltage of 163 volts. Finally, stress analysis of the actuator shows that the generated stress in the structure is at most 369 MPa.

  2. Usefulness of head injury instruction forms in home observation of mild head injuries.

    PubMed

    Warren, D; Kissoon, N

    1989-06-01

    We prospectively studied a group of patients with mild head injury discharged for home observation to determine whether written instructions assisted in recall of signs and symptoms, increased patient satisfaction, or resulted in any additional benefit over verbal explanations alone. We also evaluated the level of comprehension required to understand the written instructions in their present form. Over a three-month period, 72 patients (43 male, 29 female) with a mean age of 4.4 (SD +/- 3.9) years were studied. In addition to verbal explanations for all parents, 38 parents received written instructions. Each group remembered 4/7 (57%) of signs and symptoms and was equally satisfied with verbal explanations. The majority (84%) of parents who received instruction sheets intended to keep these for further reference. Low recall of two instructions may be due to poor comprehension of the language used. We conclude that written instructions (1) did not add significantly to recall, (2) may provide reassurance to parents, and (3) need to be written in simple lay terms in order to be understood by the parents/patients served.

  3. Simulation of cooperating robot manipulators on a mobile platform

    NASA Technical Reports Server (NTRS)

    Murphy, Stephen H.; Wen, John Ting-Yung; Saridis, George N.

    1991-01-01

    The dynamic equations of motion are presented for two or more cooperating manipulators on a freely moving mobile platform. The system of cooperating robot manipulators forms a closed kinematic chain where the force of interaction must be included in the formulation of robot and platform dynamics. The formulation includes the full dynamic interactions from arms to platform and arm tip to arm tip, and the possible translation and rotation of the platform. The equations of motion are shown to be identical in structure to the fixed-platform cooperative manipulator dynamics. The number of DOFs of the system is sufficiently large to make recursive dynamic calculation methods potentially more efficient than closed-form solutions. A complete simulation with two 6-DOF manipulators of a free-floating platform is presented along a with a multiple-arm controller to position the common load.

  4. Oscillation Amplitude Growth for a Decelerating Object with Constant Pitch Damping

    NASA Technical Reports Server (NTRS)

    Schoenenberger, Mark; Queen, Eric M.; Litton, Daniel

    2006-01-01

    The equations governing the deceleration and oscillation of a blunt body moving along a planar trajectory are re-expressed in the form of the Euler-Cauchy equation. An analytic solution of this equation describes the oscillation amplitude growth and frequency dilation with time for a statically stable decelerating body with constant pitch damping. The oscillation histories for several constant pitch damping values, predicted by the solution of the Euler-Cauchy equation are compared to POST six degree-of-freedom (6-DoF) trajectory simulations. The simulations use simplified aerodynamic coefficients matching the Euler-Cauchy approximations. Agreement between the model predictions and simulation results are excellent. Euler-Cauchy curves are also fit through nonlinear 6-DoF simulations and ballistic range data to identify static stability and pitch damping coefficients. The model os shown to closely fit through the data points and capture the behavior of the blunt body observed in simulation and experiment. The extracted coefficients are in reasonable agreement with higher fidelity, nonlinear parameter identification results. Finally, a nondimensional version of the Euler-Cauchy equation is presented and shown to be a simple and effective tool for designing dynamically scaled experiments for decelerating blunt capsule flight.

  5. Developing a Simulation-Based Training Program for the Prehospital Professionals and Students on the Management of Middle East Respiratory Syndrome.

    PubMed

    Elcin, Melih; Onan, Arif; Odabasi, Orhan; Saylam, Melahat; Ilhan, Handan; Daylan Kockaya, Pinar; Gurcuoglu, Ilker; Uckuyu, Yavuz; Cengiz, Duygu; Nacar, Osman Arikan

    2016-12-01

    Middle East Respiratory Syndrome (MERS) is a major global health threat. Prehospital professionals face the risk of infection as they work to save lives. They should be made aware of the disease and be prepared to handle such cases. The aims of our study are to develop a training program about the prehospital management of a MERS case using standardized patient (SP) scenarios, to evaluate the awareness and preparedness of the participants about MERS, and to evaluate the effectiveness of this training. We developed 5 scenarios using SPs and an observation form. We included paramedic students and emergency medical service (EMS) providers in our study. They were involved in the simulations. A total of 24 paramedic students and 33 EMS providers participated in our study. Sixteen (84%) of 19 teams recognized the possibility of MERS as a measure of their awareness in the baseline evaluation. The participants lacked donning and doffing personal protective equipments, which revealed their baseline level of preparedness for MERS. Certain improvements in donning and doffing personal protective equipment were observed in the posttraining evaluation. The participants provided positive feedback on the training program. The training program was appropriate for both paramedic students and EMS providers. A positive educational climate was created. Because the main concerns of this study were awareness and preparedness, which required human interaction, the SP methodology was the optimal simulation modality.

  6. Dynamic simulation of knee-joint loading during gait using force-feedback control and surrogate contact modelling.

    PubMed

    Walter, Jonathan P; Pandy, Marcus G

    2017-10-01

    The aim of this study was to perform multi-body, muscle-driven, forward-dynamics simulations of human gait using a 6-degree-of-freedom (6-DOF) model of the knee in tandem with a surrogate model of articular contact and force control. A forward-dynamics simulation incorporating position, velocity and contact force-feedback control (FFC) was used to track full-body motion capture data recorded for multiple trials of level walking and stair descent performed by two individuals with instrumented knee implants. Tibiofemoral contact force errors for FFC were compared against those obtained from a standard computed muscle control algorithm (CMC) with a 6-DOF knee contact model (CMC6); CMC with a 1-DOF translating hinge-knee model (CMC1); and static optimization with a 1-DOF translating hinge-knee model (SO). Tibiofemoral joint loads predicted by FFC and CMC6 were comparable for level walking, however FFC produced more accurate results for stair descent. SO yielded reasonable predictions of joint contact loading for level walking but significant differences between model and experiment were observed for stair descent. CMC1 produced the least accurate predictions of tibiofemoral contact loads for both tasks. Our findings suggest that reliable estimates of knee-joint loading may be obtained by incorporating position, velocity and force-feedback control with a multi-DOF model of joint contact in a forward-dynamics simulation of gait. Copyright © 2017 IPEM. Published by Elsevier Ltd. All rights reserved.

  7. Selecting seats for steel industry mobile machines based on seat effective amplitude transmissibility and comfort.

    PubMed

    Conrad, Leanne F; Oliver, Michele L; Jack, Robert J; Dickey, James P; Eger, Tammy R

    2014-01-01

    The purpose of this work was to help a steel industry partner select the most appropriate of three high end heavy equipment seats to retrofit a number of their heavy mobile machines used in the steel making process. The participants included 8 males (22.3 ± 2.0 yrs.) and 8 females (23.5 ± 1.8 yrs.) with no experience operating heavy mobile equipment. Previously recorded 6-DOF chassis acceleration data from a Pot Hauler (a machine which picks up and transports pots of slag) were used to extract six, 20 second representative profiles for implementation on a lab-based heavy machine simulator (6-DOF Parallel Robotics System Corporation robot). Subjects sat on three heavy equipment seats (BeGe7150, Grammar MSG 95G1721, and a 6801 Isringhausen with the seat pan cushion retrofitted with a Skydex cushion) mounted on the simulator. Each subject completed three trials for each combination of seat (n=3) and vibration profile (n=6). Chassis and operator/seat interface vibration were measured by 2, 6-DOF vibration transducers. Variables included Seat Effective Amplitude Transmissibility (SEAT) (X,Y,Z,Roll,Pitch,Yaw,6DOF Vector Sum) to determine if the seat was attenuating or amplifying the vibration, 6-degree of freedom (DOF) vibration total value weighted predicted comfort (Avc) (according to ISO 2631-1) and operator reported comfort (ORC). Factorial ANOVAs revealed significant differences (p < or = 0.05) between seats for all SEAT variables but different seats performed better than others depending on the axis. Significant differences between males and females were observed for SEAT in X,Y, and Pitch as well as for Avs. As expected there were significant differences between vibration profiles for all assessed variables. A number of interaction effects were observed, the most frequently occurring of which was between seat and vibration profile. Based upon the number of seat and vibration profile interactions, results suggest that a single seat is not suited for all tested

  8. Two-degrees-of-freedom piezo-driven fast steering mirror with cross-axis decoupling capability

    NASA Astrophysics Data System (ADS)

    Shao, Shubao; Tian, Zheng; Song, Siyang; Xu, Minglong

    2018-05-01

    Because mechanical cross coupling between its axes would lead to degradation of the scanning precision of a piezo-driven fast steering mirror (PFSM), a two-degrees-of-freedom (2-DoF) PFSM with a cross-axis decoupling capability, in which 2-DoF flexure hinges are used, is proposed in this work. The overall structure of the proposed PFSM is first introduced and then both static and dynamic models are established analytically; in addition, the decoupling mechanism is described in detail and the low dynamic cross coupling ratios that occur between the two DoFs are shown. Because of the decoupling property of the PFSM, the 2-DoF motion is treated as a combination of two independent one-degree-of-freedom (1-DoF) motions and two independent proportional-integral-derivative controllers are thus used separately in the control of the two DoFs. Based on this control strategy, experiments involving both 1-DoF trajectory tracking and 2-DoF trajectory tracking are implemented. The test results show that the proposed PFSM can achieve the tilt range of ±7 mrad for both axes with the low coupling ratios that are less than 2% (-34 dB), and the bandwidths of both axes are higher than 810 Hz; in addition, the maximal tracking full scale range errors for 1-DoF trajectory tracking and 2-DoF trajectory tracking are less than 0.2% and 1%, respectively, where the larger error of 2-DoF trajectory tracking is mainly caused by the remaining cross coupling between axes.

  9. A comparison of optimisation methods and knee joint degrees of freedom on muscle force predictions during single-leg hop landings.

    PubMed

    Mokhtarzadeh, Hossein; Perraton, Luke; Fok, Laurence; Muñoz, Mario A; Clark, Ross; Pivonka, Peter; Bryant, Adam L

    2014-09-22

    The aim of this paper was to compare the effect of different optimisation methods and different knee joint degrees of freedom (DOF) on muscle force predictions during a single legged hop. Nineteen subjects performed single-legged hopping manoeuvres and subject-specific musculoskeletal models were developed to predict muscle forces during the movement. Muscle forces were predicted using static optimisation (SO) and computed muscle control (CMC) methods using either 1 or 3 DOF knee joint models. All sagittal and transverse plane joint angles calculated using inverse kinematics or CMC in a 1 DOF or 3 DOF knee were well-matched (RMS error<3°). Biarticular muscles (hamstrings, rectus femoris and gastrocnemius) showed more differences in muscle force profiles when comparing between the different muscle prediction approaches where these muscles showed larger time delays for many of the comparisons. The muscle force magnitudes of vasti, gluteus maximus and gluteus medius were not greatly influenced by the choice of muscle force prediction method with low normalised root mean squared errors (<48%) observed in most comparisons. We conclude that SO and CMC can be used to predict lower-limb muscle co-contraction during hopping movements. However, care must be taken in interpreting the magnitude of force predicted in the biarticular muscles and the soleus, especially when using a 1 DOF knee. Despite this limitation, given that SO is a more robust and computationally efficient method for predicting muscle forces than CMC, we suggest that SO can be used in conjunction with musculoskeletal models that have a 1 or 3 DOF knee joint to study the relative differences and the role of muscles during hopping activities in future studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Correction of contaminated yaw rate signal and estimation of sensor bias for an electric vehicle under normal driving conditions

    NASA Astrophysics Data System (ADS)

    Zhang, Guoguang; Yu, Zitian; Wang, Junmin

    2017-03-01

    Yaw rate is a crucial signal for the motion control systems of ground vehicles. Yet it may be contaminated by sensor bias. In order to correct the contaminated yaw rate signal and estimate the sensor bias, a robust gain-scheduling observer is proposed in this paper. First of all, a two-degree-of-freedom (2DOF) vehicle lateral and yaw dynamic model is presented, and then a Luenberger-like observer is proposed. To make the observer more applicable to real vehicle driving operations, a 2DOF vehicle model with uncertainties on the coefficients of tire cornering stiffness is employed. Further, a gain-scheduling approach and a robustness enhancement are introduced, leading to a robust gain-scheduling observer. Sensor bias detection mechanism is also designed. Case studies are conducted using an electric ground vehicle to assess the performance of signal correction and sensor bias estimation under difference scenarios.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fasiello, Matteo; Vlah, Zvonimir

    A specific value for the cosmological constant Λ can account for late-time cosmic acceleration. However, motivated by the so-called cosmological constant problem(s), several alternative mechanisms have been explored. To date, a host of well-studied dynamical dark energy and modified gravity models exists. Going beyond ΛCDM often comes with additional degrees of freedom (dofs). For these to pass existing observational tests, an efficient screening mechanism must be in place. Furthermore, the linear and quasi-linear regimes of structure formation are ideal probes of such dofs and can capture the onset of screening. We propose here a semi-phenomenological “filter” to account for screeningmore » dynamics on LSS observables, with special emphasis on Vainshtein-type screening.« less

  12. Screening in perturbative approaches to LSS

    DOE PAGES

    Fasiello, Matteo; Vlah, Zvonimir

    2017-08-24

    A specific value for the cosmological constant Λ can account for late-time cosmic acceleration. However, motivated by the so-called cosmological constant problem(s), several alternative mechanisms have been explored. To date, a host of well-studied dynamical dark energy and modified gravity models exists. Going beyond ΛCDM often comes with additional degrees of freedom (dofs). For these to pass existing observational tests, an efficient screening mechanism must be in place. Furthermore, the linear and quasi-linear regimes of structure formation are ideal probes of such dofs and can capture the onset of screening. We propose here a semi-phenomenological “filter” to account for screeningmore » dynamics on LSS observables, with special emphasis on Vainshtein-type screening.« less

  13. Chandra and ALMA observations of the nuclear activity in two strongly lensed star-forming galaxies

    NASA Astrophysics Data System (ADS)

    Massardi, M.; Enia, A. F. M.; Negrello, M.; Mancuso, C.; Lapi, A.; Vignali, C.; Gilli, R.; Burkutean, S.; Danese, L.; Zotti, G. De

    2018-02-01

    -z galaxies with high star formation rates. This is useful to extend the investigation of the relationship between star formation and nuclear activity to two intrinsically less luminous high-z star-forming galaxies than was possible so far. Given our results for only two objects, they alone cannot constrain the evolutionary models, but provide us with interesting hints and set an observational path toward addressing the role of star formation and nuclear activity in forming galaxies. The reduced images and data cubes as FITS files are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/610/A53

  14. Cloud Structure of Galactic OB Cluster-forming Regions from Combining Ground- and Space-based Bolometric Observations

    NASA Astrophysics Data System (ADS)

    Lin, Yuxin; Liu, Hauyu Baobab; Li, Di; Zhang, Zhi-Yu; Ginsburg, Adam; Pineda, Jaime E.; Qian, Lei; Galván-Madrid, Roberto; McLeod, Anna Faye; Rosolowsky, Erik; Dale, James E.; Immer, Katharina; Koch, Eric; Longmore, Steve; Walker, Daniel; Testi, Leonardo

    2016-09-01

    We have developed an iterative procedure to systematically combine the millimeter and submillimeter images of OB cluster-forming molecular clouds, which were taken by ground-based (CSO, JCMT, APEX, and IRAM-30 m) and space telescopes (Herschel and Planck). For the seven luminous (L\\gt {10}6 L ⊙) Galactic OB cluster-forming molecular clouds selected for our analyses, namely W49A, W43-Main, W43-South, W33, G10.6-0.4, G10.2-0.3, and G10.3-0.1, we have performed single-component, modified blackbody fits to each pixel of the combined (sub)millimeter images, and the Herschel PACS and SPIRE images at shorter wavelengths. The ˜10″ resolution dust column density and temperature maps of these sources revealed dramatically different morphologies, indicating very different modes of OB cluster-formation, or parent molecular cloud structures in different evolutionary stages. The molecular clouds W49A, W33, and G10.6-0.4 show centrally concentrated massive molecular clumps that are connected with approximately radially orientated molecular gas filaments. The W43-Main and W43-South molecular cloud complexes, which are located at the intersection of the Galactic near 3 kpc (or Scutum) arm and the Galactic bar, show a widely scattered distribution of dense molecular clumps/cores over the observed ˜10 pc spatial scale. The relatively evolved sources G10.2-0.3 and G10.3-0.1 appear to be affected by stellar feedback, and show a complicated cloud morphology embedded with abundant dense molecular clumps/cores. We find that with the high angular resolution we achieved, our visual classification of cloud morphology can be linked to the systematically derived statistical quantities (I.e., the enclosed mass profile, the column density probability distribution function (N-PDF), the two-point correlation function of column density, and the probability distribution function of clump/core separations). In particular, the massive molecular gas clumps located at the center of G10.6-0.4 and

  15. Knowledge capture and the retirement of the director of finance: succession planning in the San Mateo County Human Services Agency.

    PubMed

    Winship, Kathy

    2012-01-01

    Concern over the impending retirement of several top-level managers led a county agency to engage in efforts aimed at more efficient succession management. Administrators developed plans to prevent the loss of invaluable knowledge and wisdom accompanying retirement of experienced agency leaders. The agency's Director of Finance (DoF) was one of the first key figures projected to retire, and a succession plan was implemented to transfer his knowledge for use after his departure. The knowledge transfer process involved three stages, including: (1) employing the DoF as teacher, having him develop curricula and conduct trainings; (2) engaging the DoF as mentor, allowing an existing staff member and the DoF's successor to shadow and be coached by the DoF; and (3) developing a knowledge management system that could be used after the DoF departed. This case study describes the knowledge transfer process and experiences shared by the DoF and this agency. Copyright © Taylor & Francis Group, LLC

  16. Observational constraints on secret neutrino interactions from big bang nucleosynthesis

    NASA Astrophysics Data System (ADS)

    Huang, Guo-yuan; Ohlsson, Tommy; Zhou, Shun

    2018-04-01

    We investigate possible interactions between neutrinos and massive scalar bosons via gϕν ¯ν ϕ (or massive vector bosons via gVν ¯γμν Vμ) and explore the allowed parameter space of the coupling constant gϕ (or gV) and the scalar (or vector) boson mass mϕ (or mV) by requiring that these secret neutrino interactions (SNIs) should not spoil the success of big bang nucleosynthesis (BBN). Incorporating the SNIs into the evolution of the early Universe in the BBN era, we numerically solve the Boltzmann equations and compare the predictions for the abundances of light elements with observations. It turns out that the constraint on gϕ and mϕ in the scalar-boson case is rather weak, due to a small number of degrees of freedom (d.o.f.). However, in the vector-boson case, the most stringent bound on the coupling gV≲6 ×10-10 at 95% confidence level is obtained for mV≃1 MeV , while the bound becomes much weaker gV≲8 ×10-6 for smaller masses mV≲10-4 MeV . Moreover, we discuss in some detail how the SNIs affect the cosmological evolution and the abundances of the lightest elements.

  17. Some TEM observations of Al2O3 scales formed on NiCrAl alloys

    NASA Technical Reports Server (NTRS)

    Smialek, J.; Gibala, R.

    1979-01-01

    The microstructural development of Al2O3 scales on NiCrAl alloys has been examined by transmission electron microscopy. Voids were observed within grains in scales formed on a pure NiCrAl alloy. Both voids and oxide grains grew measurably with oxidation time at 1100 C. The size and amount of porosity decreased towards the oxide-metal growth interface. The voids resulted from an excess number of oxygen vacancies near the oxidemetal interface. Short-circuit diffusion paths were discussed in reference to current growth stress models for oxide scales. Transient oxidation of pure, Y-doped, and Zr-doped NiCrAl was also examined. Oriented alpha-(Al, Cr)2O3 and Ni(Al, Cr)2O4 scales often coexisted in layered structures on all three alloys. Close-packed oxygen planes and directions in the corundum and spinel layers were parallel. The close relationship between oxide layers provided a gradual transition from initial transient scales to steady state Al2O3 growth.

  18. Rotation and direction judgment from visual images head-slaved in two and three degrees-of-freedom.

    PubMed

    Adelstein, B D; Ellis, S R

    2000-03-01

    The contribution to spatial awareness of adding a roll degree-of-freedom (DOF) to telepresence camera platform yaw and pitch was examined in an experiment where subjects judged direction and rotation of stationary target markers in a remote scene. Subjects viewed the scene via head-slaved camera images in a head-mounted display. Elimination of the roll DOF affected rotation judgment, but only at extreme yaw and pitch combinations, and did not affect azimuth and elevation judgement. Systematic azimuth overshoot occurred regardless of roll condition. Observed rotation misjudgments are explained by kinematic models for eye-head direction of gaze.

  19. Multi beam observations of cosmic radio noise using a VHF radar with beam forming by a Butler matrix

    NASA Astrophysics Data System (ADS)

    Renkwitz, T.; Singer, W.; Latteck, R.; Rapp, M.

    2011-08-01

    The Leibniz-Institute of Atmospheric Physics (IAP) in Kühlungsborn started to install a new MST radar on the North-Norwegian island Andøya (69.30° N, 16.04° E) in 2009. The new Middle Atmosphere Alomar Radar System (MAARSY) replaces the previous ALWIN radar which has been successfully operated for more than 10 years. The MAARSY radar provides increased temporal and spatial resolution combined with a flexible sequential point-to-point steering of the radar beam. To increase the spatiotemporal resolution of the observations a 16-port Butler matrix has been built and implemented to the radar. In conjunction with 64 Yagi antennas of the former ALWIN antenna array the Butler matrix simultaneously provides 16 individual beams. The beam forming capability of the Butler matrix arrangement has been verified observing the galactic cosmic radio noise of the supernova remnant Cassiopeia A. Furthermore, this multi beam configuration has been used in passive experiments to estimate the cosmic noise absorption at 53.5 MHz during events of enhanced solar and geomagnetic activity as indicators for enhanced ionization at altitudes below 90 km. These observations are well correlated with simultaneous observations of corresponding beams of the co-located imaging riometer AIRIS (69.14° N, 16.02° E) at 38.2 MHz. In addition, enhanced cosmic noise absorption goes along with enhanced electron densities at altitudes below about 90 km as observed with the co-located Saura MF radar using differential absorption and differential phase measurements.

  20. A comparison of the real-time controllability of pattern recognition to conventional myoelectric control for discrete and simultaneous movements

    PubMed Central

    2014-01-01

    Myoelectric control has been used for decades to control powered upper limb prostheses. Conventional, amplitude-based control has been employed to control a single prosthesis degree of freedom (DOF) such as closing and opening of the hand. Within the last decade, new and advanced arm and hand prostheses have been constructed that are capable of actuating numerous DOFs. Pattern recognition control has been proposed to control a greater number of DOFs than conventional control, but has traditionally been limited to sequentially controlling DOFs one at a time. However, able-bodied individuals use multiple DOFs simultaneously, and it may be beneficial to provide amputees the ability to perform simultaneous movements. In this study, four amputees who had undergone targeted motor reinnervation (TMR) surgery with previous training using myoelectric prostheses were configured to use three control strategies: 1) conventional amplitude-based myoelectric control, 2) sequential (one-DOF) pattern recognition control, 3) simultaneous pattern recognition control. Simultaneous pattern recognition was enabled by having amputees train each simultaneous movement as a separate motion class. For tasks that required control over just one DOF, sequential pattern recognition based control performed the best with the lowest average completion times, completion rates and length error. For tasks that required control over 2 DOFs, the simultaneous pattern recognition controller performed the best with the lowest average completion times, completion rates and length error compared to the other control strategies. In the two strategies in which users could employ simultaneous movements (conventional and simultaneous pattern recognition), amputees chose to use simultaneous movements 78% of the time with simultaneous pattern recognition and 64% of the time with conventional control for tasks that required two DOF motions to reach the target. These results suggest that when amputees are given the

  1. The effect of bed forms on the dynamics of the fluid mud transport: preliminary insights from field observations and numerical simulations

    NASA Astrophysics Data System (ADS)

    Ozdemir, C. E.; Traykovski, P.

    2014-12-01

    Understanding the dynamics and the transport mechanisms of fluidmud is crucial to illuminate the details regarding the attenuation in the surface wave energy over muddy seabed and wave-supported gravity-driven mud flows that take place in nearshore environments. Although there is significant progress through theoretical, experimental, and numerical studies, little attention has been drawn to the intricate alteration in the fluidmud transport over bedforms that inherently exist in the actual field conditions. Specifically, interfacial waves at the fluidmud interface were observed in coastal Louisiana as a part of MURI field experiments in 2010. It is also observed that wave attenuation was dominated by viscous processes during laminar flow and attenuation decreased duing the transition to turbulence. Considering the slow growth of shear instability at the interface, bed forms have a critical role to initiate the growth of interfacial waves and the subsequent transition to turbulence. In this study, we investigate the role of bed forms on the dynamics of moderately thin fluidmud layer via large eddy simulations. Three mud viscosity values, based on the field observations, are tested for a 20 centimeters of mud layer over ripples: (i)ν = 1 x 10-3, (ii) ν = 1 x 10-4 , and (iii) ν = 1 x 10-5 . In Case (i), wave energy dissipation is nearly the same as the one over a flat bed. Case (ii) shows that there is a 10 to 20 percent increase in the wave energy dissipation especially at the fluidmud interface. Finally, in Case (iii), we observe the high-energy transitional flow characteristics. In this presentation, we shall also share the detailed analyses of these simulations.

  2. National Fire News- Current Wildfires

    MedlinePlus

    ... of Denali Bella Creek Southwest Area Forestry, DOF ST 2,631 0 Bismark Galena Zone BLM 876 ... of Hughes Devil's Elbow Southwest Area Forestry, DOF ST 180 0 Door Mountains Southwest Area Forestry, DOF ...

  3. UAV observation of newly formed volcanic island, Nishinoshima, Japan, from a ship

    NASA Astrophysics Data System (ADS)

    Ohminato, T.; Kaneko, T.; Takagi, A.

    2016-12-01

    We conducted an aerial observation at Nishinoshima island, south of Japan, from Jun 7 to Jun 9, 2016 by using an Unmanned Aerial Vehicle (UAV), a radio controlled small helicopter. Takeoff and landing of the UAV was conducted on a ship. Nishinoshima is a small island, 130km west of Chichijima in Ogasawara Islands, Japan. New eruption started in November 2013 in a shallow sea approximately 400 m southeast of the existing Nishinoshima Island. It started from a small islet and evolved with 1-5 × 105 m3/day discharge rate (Maeno et al, 2016). In late December 2013, the islet coalesced with the existing Nishinoshima. In 16 month, the lava field reached 2.6×106 m2and covered almost all of the existing Nishinoshima. Human landing upon the newly formed part of the island has still been prohibited due to the danger of sudden eruptions. Before our mission, some pumice or rock samples had been taken from the island but their amount was not enough to conduct detailed petrological analyses. The evolution of the lava field from the central cone has been well documented by using images taken from satellites and airplanes. However, due to the limited resolution of satellite images or photos taken from distant airplanes, there still be uncertainties in detailed morphological evolution of lava flows. The purpose of our observation includes, 1) sampling of pyroclasts near the central cone in order to investigate the condition of magma chamber and magma ascent process, and 2) taking high resolution 4K images in order to clarify the characteristic morphology of the lava flow covering the island. During the three days operation, we were successfully able to sample 250g of pyroclasts and to take 1.5TB of 4K movies. Conducting UAV's takeoff and landing on a ship was not an easy task. We used a marine research ship, Keifu-Maru, operated by Japan Meteorological Agency. The ship size is 1483 tons. On the ship deck, there are several structures which can interfere with the helicopter

  4. Forms of vitality play in infancy.

    PubMed

    Español, Silvia; Martínez, Mauricio; Bordoni, Mariana; Camarasa, Rosario; Carretero, Soledad

    2014-12-01

    In this paper we report a qualitative study based on the constant comparative method to initiate the systematic study of forms of vitality play. This is an unnoticed non-figurative play frame linked to early social play and temporal arts in which child and adult elaborate the dynamics of their own movements and sounds in a repetition-variation form. In the introduction we present the theoretical underpinnings and the sporadic observations we have done in previous studies. Then, by the iterative observations of the recorded material of a longitudinal case study on play during the third year of life, we generated the general category of forms of vitality play and four subcategories of display modes of forms of vitality play (improvised forms of vitality play, ritualized forms of vitality play, forms of vitality play combined with pretend play, and forms of vitality play combined with role playing) which are illustrated with descriptive narratives. We discuss the properties of the developed categories, the limits of the present study, and the need to continue systematizing the research on this playful activity.

  5. Radiometry with nighttime DMSP images in digital form. [satellite earth observations

    NASA Technical Reports Server (NTRS)

    Croft, T. A.

    1981-01-01

    The USAF Defense Meteorological Satellite Program (DMSP) spacecraft sends images to earth in the form of numbers. It has been common practice to erase the only digital records, the magnetic tapes, for reuse, after films (resembling photographs) have been created from the numbers. While the DMSP images have been widely used, their application in research has been hindered by both the lack of digital data and the lack of an authoritative source of related technical information. The character of the digital form is considered. Each image is essentially a three-dimensional list (X,Y,Z) in which X and Y represent the position coordinates of a pixel and Z is its associated radiance. Only the value of Z is given and the X-Y position must be deduced from adjunct information. Each original scan composed of 1464 pixels represents an area on the earth's surface about 3 km wide and 3000 km long. Strengths and weaknesses of the system with respect to research applications are considered, and concepts for the design of a nocturnal imager are discussed.

  6. Development and reliability testing of a food store observation form.

    PubMed

    Rimkus, Leah; Powell, Lisa M; Zenk, Shannon N; Han, Euna; Ohri-Vachaspati, Punam; Pugach, Oksana; Barker, Dianne C; Resnick, Elissa A; Quinn, Christopher M; Myllyluoma, Jaana; Chaloupka, Frank J

    2013-01-01

    To develop a reliable food store observational data collection instrument to be used for measuring product availability, pricing, and promotion. Observational data collection. A total of 120 food stores (26 supermarkets, 34 grocery stores, 54 gas/convenience stores, and 6 mass merchandise stores) in the Chicago metropolitan statistical area. Inter-rater reliability for product availability, pricing, and promotion measures on a food store observational data collection instrument. Cohen's kappa coefficient and proportion of overall agreement for dichotomous variables and intra-class correlation coefficient for continuous variables. Inter-rater reliability, as measured by average kappa coefficient, was 0.84 for food and beverage product availability measures, 0.80 for interior store characteristics, and 0.70 for exterior store characteristics. For continuous measures, average intra-class correlation coefficient was 0.82 for product pricing measures; 0.90 for counts of fresh, frozen, and canned fruit and vegetable options; and 0.85 for counts of advertisements on the store exterior and property. The vast majority of measures demonstrated substantial or almost perfect agreement. Although some items may require revision, results suggest that the instrument may be used to reliably measure the food store environment. Copyright © 2013 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.

  7. Scanning and transmission electron microscopic observation of the parasitic form of Trichophyton violaceum in the infected hair from tinea capitis.

    PubMed

    Zhuang, Kaiwen; Ran, Xin; Lei, Song; Zhang, Chaoliang; Lama, Jebina; Ran, Yuping

    2014-01-01

    Trichophyton violaceum is a pathogen of tinea capitis and usually cause infection of scalp and hair in children. To investigate the parasitic form of T. violaceum in the human hair tissue, the infected hair strands were collected from a 9-year-old boy with tinea capitis due to T. violaceum and observed under both the scanning electron microscope (SEM) and transmission electron microscope (TEM). The SEM and TEM findings revealed that T. violaceum parasitically lives in the hair shaft in various forms and the morphological transformation of the fungus from hyphae into arthrospores was noted. The involved hair shaft was damaged to the great extent and its ultrastructural changes were evident. Those morphological characteristics of T. violaceum and the three-dimensional ultastructure changes of infected hairs give a better knowledge about the host-fungus relationship in tinea capitis. © 2014 Wiley Periodicals, Inc.

  8. Observational Signatures of Cloud-Cloud Collision in the Extended Star-forming Region S235

    NASA Astrophysics Data System (ADS)

    Dewangan, L. K.; Ojha, D. K.

    2017-11-01

    We present a multi-wavelength data analysis of the extended star-forming region S235 (hereafter E-S235), where two molecular clouds are present. In E-S235, using the 12CO (1-0) and 13CO (1-0) line data, a molecular cloud linked with the site “S235main” is traced in a velocity range [-24, -18] km s-1, while the other one containing the sites S235A, S235B, and S235C (hereafter “S235ABC”) is depicted in a velocity range [-18, -13] km s-1. In the velocity space, these two clouds are separated by ˜4 km s-1, and are interconnected by a lower-intensity intermediate velocity emission, tracing a broad bridge feature. In the velocity channel maps, a possible complementary molecular pair at [-21, -20] km s-1 and [-16, -15] km s-1 is also evident. The sites, “S235ABC,” east 1, and south-west, are spatially seen in the interface of two clouds. Together, these observed features are consistent with the predictions of numerical models of the cloud-cloud collision (CCC) process, favoring the onset of the CCC in E-S235 about 0.5 Myr ago. Deep UKIDSS near-infrared photometric analysis of point-like sources reveals significant clustering of young stellar populations toward the sites located at the junction, and the “S235main.” The sites “S235ABC” harbor young compact H II regions with dynamical ages of ˜0.06-0.22 Myr, and these sites (including south-west and east 1) also contain dust clumps (having M clump ˜ 40 to 635 {M}⊙ ). Our observational findings suggest that the star formation activities (including massive stars) appear to be influenced by the CCC mechanism at the junction.

  9. Theoretical performance analysis of doped optical fibers based on pseudo parameters

    NASA Astrophysics Data System (ADS)

    Karimi, Maryam; Seraji, Faramarz E.

    2010-09-01

    Characterization of doped optical fibers (DOFs) is an essential primary stage for design of DOF-based devices. This paper presents design of novel measurement techniques to determine DOFs parameters using mono-beam propagation in a low-loss medium by generating pseudo parameters for the DOFs. The designed techniques are able to characterize simultaneously the absorption, emission cross-sections (ACS and ECS), and dopant concentration of DOFs. In both the proposed techniques, we assume pseudo parameters for the DOFs instead of their actual values and show that the choice of these pseudo parameters values for design of DOF-based devices, such as erbium-doped fiber amplifier (EDFA), are appropriate and the resulting error is quite negligible when compared with the actual parameters values.Utilization of pseudo ACS and ECS values in design procedure of EDFAs does not require the measurement of background loss coefficient (BLC) and makes the rate equation of the DOFs simple. It is shown that by using the pseudo parameters values obtained by the proposed techniques, the error in the gain of a designed EDFA with a BLC of about 1 dB/km, are about 0.08 dB. It is further indicated that the same scenario holds good for BLC lower than 5 dB/m and higher than 12 dB/m. The proposed characterization techniques have simple procedures and are low cost that can have an advantageous use in manufacturing of the DOFs.

  10. Multivariable Dynamic Ankle Mechanical Impedance With Active Muscles

    PubMed Central

    Lee, Hyunglae; Krebs, Hermano Igo; Hogan, Neville

    2015-01-01

    Multivariable dynamic ankle mechanical impedance in two coupled degrees-of-freedom (DOFs) was quantified when muscles were active. Measurements were performed at five different target activation levels of tibialis anterior and soleus, from 10% to 30% of maximum voluntary contraction (MVC) with increments of 5% MVC. Interestingly, several ankle behaviors characterized in our previous study of the relaxed ankle were observed with muscles active: ankle mechanical impedance in joint coordinates showed responses largely consistent with a second-order system consisting of inertia, viscosity, and stiffness; stiffness was greater in the sagittal plane than in the frontal plane at all activation conditions for all subjects; and the coupling between dorsiflexion–plantarflexion and inversion–eversion was small—the two DOF measurements were well explained by a strictly diagonal impedance matrix. In general, ankle stiffness increased linearly with muscle activation in all directions in the 2-D space formed by the sagittal and frontal planes, but more in the sagittal than in the frontal plane, resulting in an accentuated “peanut shape.” This characterization of young healthy subjects’ ankle mechanical impedance with active muscles will serve as a baseline to investigate pathophysiological ankle behaviors of biomechanically and/or neurologically impaired patients. PMID:25203497

  11. Far-infrared observations of a massive cluster forming in the Monoceros R2 filament hub

    NASA Astrophysics Data System (ADS)

    Rayner, T. S. M.; Griffin, M. J.; Schneider, N.; Motte, F.; Könyves, V.; André, P.; Di Francesco, J.; Didelon, P.; Pattle, K.; Ward-Thompson, D.; Anderson, L. D.; Benedettini, M.; Bernard, J.-P.; Bontemps, S.; Elia, D.; Fuente, A.; Hennemann, M.; Hill, T.; Kirk, J.; Marsh, K.; Men'shchikov, A.; Nguyen Luong, Q.; Peretto, N.; Pezzuto, S.; Rivera-Ingraham, A.; Roy, A.; Rygl, K.; Sánchez-Monge, Á.; Spinoglio, L.; Tigé, J.; Treviño-Morales, S. P.; White, G. J.

    2017-10-01

    We present far-infrared observations of Monoceros R2 (a giant molecular cloud at approximately 830 pc distance, containing several sites of active star formation), as observed at 70 μm, 160 μm, 250 μm, 350 μm, and 500 μm by the Photodetector Array Camera and Spectrometer (PACS) and Spectral and Photometric Imaging Receiver (SPIRE) instruments on the Herschel Space Observatory as part of the Herschel imaging survey of OB young stellar objects (HOBYS) Key programme. The Herschel data are complemented by SCUBA-2 data in the submillimetre range, and WISE and Spitzer data in the mid-infrared. In addition, C18O data from the IRAM 30-m Telescope are presented, and used for kinematic information. Sources were extracted from the maps with getsources, and from the fluxes measured, spectral energy distributions were constructed, allowing measurements of source mass and dust temperature. Of177 Herschel sources robustly detected in the region (a detection with high signal-to-noise and low axis ratio at multiple wavelengths), including protostars and starless cores, 29 are found in a filamentary hub at the centre of the region (a little over 1% of the observed area). These objects are on average smaller, more massive, and more luminous than those in the surrounding regions (which together suggest that they are at a later stage of evolution), a result that cannot be explained entirely by selection effects. These results suggest a picture in which the hub may have begun star formation at a point significantly earlier than the outer regions, possibly forming as a result of feedback from earlier star formation. Furthermore, the hub may be sustaining its star formation by accreting material from the surrounding filaments. Full Tables 4 and D.1-D.9 and the C180 datacube are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/607/A22

  12. Observed form and action of the magnetic energy release in flares

    NASA Technical Reports Server (NTRS)

    Machado, Marcos E.; Moore, Ronald L.

    1986-01-01

    The observable spatio-temporal characteristics of the energy release in flares and their association with the magnetic environment and tracers of field dynamics are reviewed. The observations indicate that impulsive phase manifestations, like particle acceleration, may be related to the formation of neutral sheets at the interface between interacting bipoles, but that the site for the bulk of the energy release is within closed loops rather than at the interaction site.

  13. Optimal combination of minimum degrees of freedom to be actuated in the lower limbs to facilitate arm-free paraplegic standing.

    PubMed

    Kim, Joon-Young; Mills, James K; Vette, Albert H; Popovic, Milos R

    2007-12-01

    Arm-free paraplegic standing via functional electrical stimulation (FES) has drawn much attention in the biomechanical field as it might allow a paraplegic to stand and simultaneously use both arms to perform daily activities. However, current FES systems for standing require that the individual actively regulates balance using one or both arms, thus limiting the practical use of these systems. The purpose of the present study was to show that actuating only six out of 12 degrees of freedom (12-DOFs) in the lower limbs to allow paraplegics to stand freely is theoretically feasible with respect to multibody stability and physiological torque limitations of the lower limb DOF. Specifically, the goal was to determine the optimal combination of the minimum DOF that can be realistically actuated using FES while ensuring stability and able-bodied kinematics during perturbed arm-free standing. The human body was represented by a three-dimensional dynamics model with 12-DOFs in the lower limbs. Nakamura's method (Nakamura, Y., and Ghodoussi, U., 1989, "Dynamics Computation of Closed-Link Robot Mechanisms With Nonredundant and Redundant Actuators," IEEE Trans. Rob. Autom., 5(3), pp. 294-302) was applied to estimate the joint torques of the system using experimental motion data from four healthy subjects. The torques were estimated by applying our previous finding that only 6 (6-DOFs) out of 12-DOFs in the lower limbs need to be actuated to facilitate stable standing. Furthermore, it was shown that six cases of 6-DOFs exist, which facilitate stable standing. In order to characterize each of these cases in terms of the torque generation patterns and to identify a potential optimal 6-DOF combination, the joint torques during perturbations in eight different directions were estimated for all six cases of 6-DOFs. The results suggest that the actuation of both ankle flexionextension, both knee flexionextension, one hip flexionextension, and one hip abductionadduction DOF will

  14. An Observational Study of Blended Young Stellar Clusters in the Galactic Plane - Do Massive Stars form First?

    NASA Astrophysics Data System (ADS)

    Martínez-Galarza, Rafael; Protopapas, Pavlos; Smith, Howard A.; Morales, Esteban

    2018-01-01

    From an observational point of view, the early life of massive stars is difficult to understand partly because star formation occurs in crowded clusters where individual stars often appear blended together in the beams of infrared telescopes. This renders the characterization of the physical properties of young embedded clusters via spectral energy distribution (SED) fitting a challenging task. Of particular relevance for the testing of star formation models is the question of whether the claimed universality of the IMF (references) is reflected in an equally universal integrated galactic initial mass function (IGIMF) of stars. In other words, is the set of all stellar masses in the galaxy sampled from a single universal IMF, or does the distribution of masses depend on the environment, making the IGIMF different from the canonical IMF? If the latter is true, how different are the two? We present a infrared SED analysis of ~70 Spitzer-selected, low mass ($<100~\\rm{M}_{\\odot}$), galactic blended clusters. For all of the clusters we obtain the most probable individual SED of each member and derive their physical properties, effectively deblending the confused emission from individual YSOs. Our algorithm incorporates a combined probabilistic model of the blended SEDs and the unresolved images in the long-wavelength end. We find that our results are compatible with competitive accretion in the central regions of young clusters, with the most massive stars forming early on in the process and less massive stars forming about 1Myr later. We also find evidence for a relationship between the total stellar mass of the cluster and the mass of the most massive member that favors optimal sampling in the cluster and disfavors random sampling for the canonical IMF, implying that star formation is self-regulated, and that the mass of the most massive star in a cluster depends on the available resources. The method presented here is easily adapted to future observations of

  15. A general theory of linear cosmological perturbations: scalar-tensor and vector-tensor theories

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lagos, Macarena; Baker, Tessa; Ferreira, Pedro G.

    We present a method for parametrizing linear cosmological perturbations of theories of gravity, around homogeneous and isotropic backgrounds. The method is sufficiently general and systematic that it can be applied to theories with any degrees of freedom (DoFs) and arbitrary gauge symmetries. In this paper, we focus on scalar-tensor and vector-tensor theories, invariant under linear coordinate transformations. In the case of scalar-tensor theories, we use our framework to recover the simple parametrizations of linearized Horndeski and ''Beyond Horndeski'' theories, and also find higher-derivative corrections. In the case of vector-tensor theories, we first construct the most general quadratic action for perturbationsmore » that leads to second-order equations of motion, which propagates two scalar DoFs. Then we specialize to the case in which the vector field is time-like (à la Einstein-Aether gravity), where the theory only propagates one scalar DoF. As a result, we identify the complete forms of the quadratic actions for perturbations, and the number of free parameters that need to be defined, to cosmologically characterize these two broad classes of theories.« less

  16. The dust attenuation of star-forming galaxies at z ˜ 3 and beyond: New insights from ALMA observations

    NASA Astrophysics Data System (ADS)

    Fudamoto, Y.; Oesch, P. A.; Schinnerer, E.; Groves, B.; Karim, A.; Magnelli, B.; Sargent, M. T.; Cassata, P.; Lang, P.; Liu, D.; Le Fèvre, O.; Leslie, S.; Smolčić, V.; Tasca, L.

    2017-11-01

    We present results on the dust attenuation of galaxies at redshift ∼3-6 by studying the relationship between the UV spectral slope (βUV) and the infrared excess (IRX; LIR/LUV) using Atacama Large Millimeter/submillimeter Array (ALMA) far-infrared continuum observations. Our study is based on a sample of 67 massive, star-forming galaxies with a median mass of M* ∼ 1010.7 M⊙ spanning a redshift range z = 2.6-3.7 (median z = 3.2) that were observed with ALMA at λ _{rest}=300 {μ m}. Both the individual ALMA detections (41 sources) and stacks including all galaxies show the IRX-βUV relationship at z ∼ 3 is mostly consistent with that of local starburst galaxies on average. However, we find evidence for a large dispersion around the mean relationship by up to ±0.5 dex. Nevertheless, the locally calibrated dust correction factors based on the IRX-βUV relation are on average applicable to main-sequence z ∼ 3 galaxies. This does not appear to be the case at even higher redshifts, however. Using public ALMA observations of z ∼ 4-6 galaxies we find evidence for a significant evolution in the IRX-βUV and the IRX-M* relations beyond z ∼ 3 towards lower IRX values. We discuss several caveats that could affect these results, including the assumed dust temperature. ALMA observations of larger z > 3 galaxy sample spanning a wide range of physical parameters (e.g. lower stellar mass) will be important to investigate this intriguing redshift evolution further.

  17. On-Board Imaging Validation of Optically Guided Stereotactic Radiosurgery Positioning System for Conventionally Fractionated Radiotherapy for Paranasal Sinus and Skull Base Cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxim, Peter G.; Loo, Billy W.; Murphy, James D.

    2011-11-15

    Purpose: To evaluate the positioning accuracy of an optical positioning system for stereotactic radiosurgery in a pilot experience of optically guided, conventionally fractionated, radiotherapy for paranasal sinus and skull base tumors. Methods and Materials: Before each daily radiotherapy session, the positioning of 28 patients was set up using an optical positioning system. After this initial setup, the patients underwent standard on-board imaging that included daily orthogonal kilovoltage images and weekly cone beam computed tomography scans. Daily translational shifts were made after comparing the on-board images with the treatment planning computed tomography scans. These daily translational shifts represented the daily positionalmore » error in the optical tracking system and were recorded during the treatment course. For 13 patients treated with smaller fields, a three-degree of freedom (3DOF) head positioner was used for more accurate setup. Results: The mean positional error for the optically guided system in patients with and without the 3DOF head positioner was 1.4 {+-} 1.1 mm and 3.9 {+-} 1.6 mm, respectively (p <.0001). The mean positional error drifted 0.11 mm/wk upward during the treatment course for patients using the 3DOF head positioner (p = .057). No positional drift was observed in the patients without the 3DOF head positioner. Conclusion: Our initial clinical experience with optically guided head-and-neck fractionated radiotherapy was promising and demonstrated clinical feasibility. The optically guided setup was especially useful when used in conjunction with the 3DOF head positioner and when it was recalibrated to the shifts using the weekly portal images.« less

  18. Wavefront coding for fast, high-resolution light-sheet microscopy (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Olarte, Omar E.; Licea-Rodriguez, Jacob; Loza-Alvarez, Pablo

    2017-02-01

    Some biological experiments demand the observation of dynamics processes in 3D with high spatiotemporal resolution. The use of wavefront coding to extend the depth-of-field (DOF) of the collection arm of a light-sheet microscope is an interesting alternative for fast 3D imaging. Under this scheme, the 3D features of the sample are captured at high volumetric rates while the light sheet is swept rapidly within the extended DOF. The DOF is extended by coding the pupil function of the imaging lens by using a custom-designed phase mask. A posterior restoration step is required to decode the information of the captured images based on the applied phase mask [1]. This hybrid optical-digital approach is known as wavefront coding (WFC). Previously, we have demonstrated this method for performing fast 3D imaging of biological samples at medium resolution [2]. In this work, we present the extension of this approach for high-resolution microscopes. Under these conditions, the effective DOF of a standard high NA objective is of a few micrometers. Here we demonstrate that by the use of WFC, we can extend the DOF more than one order of magnitude keeping the high-resolution imaging. This is demonstrated for two designed phase masks using Zebrafish and C. elegans samples. [1] Olarte, O.E., Andilla, J., Artigas, D., and Loza-Alvarez, P., "Decoupled Illumination-Detection Microscopy. Selected Optics in Year 2105," in Optics and Photonics news 26, p. 41 (2015). [2] Olarte, O.E., Andilla, J., Artigas, D., and Loza-Alvarez, P., "Decoupled illumination detection in light sheet microscopy for fast volumetric imaging," Optica 2(8), 702 (2015).

  19. In situ observation of ultrasonic cavitation-induced fragmentation of the primary crystals formed in Al alloys.

    PubMed

    Wang, Feng; Tzanakis, Iakovos; Eskin, Dmitry; Mi, Jiawei; Connolley, Thomas

    2017-11-01

    The cavitation-induced fragmentation of primary crystals formed in Al alloys were investigated for the first time by high-speed imaging using a novel experimental approach. Three representative primary crystal types, Al 3 Ti, Si and Al 3 V with different morphologies and mechanical properties were first extracted by deep etching of the corresponding Al alloys and then subjected to ultrasonic cavitation processing in distilled water. The dynamic interaction between the cavitation bubbles and primary crystals was imaged in situ and in real time. Based on the recorded image sequences, the fragmentation mechanisms of primary crystals were studied. It was found that there are three major mechanisms by which the primary crystals were fragmented by cavitation bubbles. The first one was a slow process via fatigue-type failure. A cyclic pressure exerted by stationary pulsating bubbles caused the propagation of a crack pre-existing in the primary crystal to a critical length which led to fragmentation. The second mechanism was a sudden process due to the collapse of bubbles in a passing cavitation cloud. The pressure produced upon the collapse of the cloud promoted rapid monotonic crack growth and fast fracture in the primary crystals. The third observed mechanism was normal bending fracture as a result of the high pressure arising from the collapse of a bubble cloud and the crack formation at the branch connection points of dendritic primary crystals. The fragmentation of dendrite branches due to the interaction between two freely moving dendritic primary crystals was also observed. A simplified fracture analysis of the observed phenomena was performed. The specific fragmentation mechanism for the primary crystals depended on their morphology and mechanical properties. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.

  20. Comparing position and orientation accuracy of different electromagnetic sensors for tracking during interventions.

    PubMed

    Nijkamp, Jasper; Schermers, Bram; Schmitz, Sander; de Jonge, Sofieke; Kuhlmann, Koert; van der Heijden, Ferdinand; Sonke, Jan-Jakob; Ruers, Theo

    2016-08-01

    To compare the position and orientation accuracy between using one 6-degree of freedom (DOF) electromagnetic (EM) sensor, or the position information of three 5DOF sensors within the scope of tumor tracking. The position accuracy of Northern Digital Inc Aurora 5DOF and 6DOF sensors was determined for a table-top field generator (TTFG) up to a distance of 52 cm. For each sensor 716 positions were measured for 10 s at 15 Hz. Orientation accuracy was determined for each of the orthogonal axis at the TTFG distances of 17, 27, 37 and 47 cm. For the 6DOF sensors, orientation was determined for sensors in-line with the orientation axis, and perpendicular. 5DOF orientation accuracy was determined for a theoretical 4 cm tumor. An optical tracking system was used as reference. Position RMSE and jitter were comparable between the sensors and increasing with distance. Jitter was within 0.1 cm SD within 45 cm distance to the TTFG. Position RMSE was approximately 0.1 cm up to 32 cm distance, increasing to 0.4 cm at 52 cm distance. Orientation accuracy of the 6DOF sensor was within 1[Formula: see text], except when the sensor was in-line with the rotation axis perpendicular to the TTFG plane (4[Formula: see text] errors at 47 cm). Orientation accuracy using 5DOF positions was within 1[Formula: see text] up to 37 cm and 2[Formula: see text] at 47 cm. The position and orientation accuracy of a 6DOF sensor was comparable with a sensor configuration consisting of three 5DOF sensors. To achieve tracking accuracy within 1 mm and 1[Formula: see text], the distance to the TTFG should be limited to approximately 30 cm.

  1. SDO AIA Observations of Large-Scale Coronal Disturbances in the Form of Propagating Fronts

    NASA Astrophysics Data System (ADS)

    Nitta, Nariaki V.; Schrijver, Carolus J.; Title, Alan M.; Liu, Wei

    2013-03-01

    One of the most spectacular phenomena detected by SOHO EIT was the large-scale propagating fronts associated with solar eruptions. Initially these 'EIT' waves were thought to be coronal counterparts of chromospheric Moreton waves. However, different spatial and kinematic properties of the fronts seen in H-alpha and EUV images, and far more frequent occurrences of the latter have led to various interpretations that are still actively debated by a number of researchers. A major factor for the lack of closure was the various limitation in EIT data, including the cadence that was typically every 12 minutes. Now we have significantly improved data from SDO AIA, which have revealed some very interesting phenomena associated with EIT waves. However, the studies so far conducted using AIA data have primarily dealt with single or a small number of events, where selection bias and particular observational conditions may prevent us from discovering the general and true nature of EIT waves. Although automated detection of EIT waves was promised for AIA images some time ago, it is still not actually implemented in the data pipeline. Therefore we have manually found nearly 200 examples of large-scale propagating fronts, going through movies of difference images from the AIA 193 A channel up to January 2013. We present our study of the kinematic properties of the fronts in a subset of about 150 well-observed events in relation with other phenomena that can accompany EIT waves. Our emphasis is on the relation of the fronts with the associated coronal eruptions often but not always taking the form of full-blown CMEs, utilizing STEREO data for a subset of more than 80 events that have occurred near the limb as viewed from one of the STEREO spacecraft. In these events, the availability of data from the STEREO inner coronagraph (COR1) as well as from the EUVI allows us to trace eruptions off the solar disk during the times of our propagating fronts. The representative relations

  2. Observational Searches for Star-Forming Galaxies at z > 6

    NASA Astrophysics Data System (ADS)

    Finkelstein, Steven L.

    2016-08-01

    Although the universe at redshifts greater than six represents only the first one billion years (< 10%) of cosmic time, the dense nature of the early universe led to vigorous galaxy formation and evolution activity which we are only now starting to piece together. Technological improvements have, over only the past decade, allowed large samples of galaxies at such high redshifts to be collected, providing a glimpse into the epoch of formation of the first stars and galaxies. A wide variety of observational techniques have led to the discovery of thousands of galaxy candidates at z > 6, with spectroscopically confirmed galaxies out to nearly z = 9. Using these large samples, we have begun to gain a physical insight into the processes inherent in galaxy evolution at early times. In this review, I will discuss (i) the selection techniques for finding distant galaxies, including a summary of previous and ongoing ground and space-based searches, and spectroscopic follow-up efforts, (ii) insights into galaxy evolution gleaned from measures such as the rest-frame ultraviolet luminosity function, the stellar mass function, and galaxy star-formation rates, and (iii) the effect of galaxies on their surrounding environment, including the chemical enrichment of the universe, and the reionisation of the intergalactic medium. Finally, I conclude with prospects for future observational study of the distant universe, using a bevy of new state-of-the-art facilities coming online over the next decade and beyond.

  3. Overview Snapshot Observational Technique (OSOT): Administration Manual Experimental Research Form.

    ERIC Educational Resources Information Center

    Coller, Alan R.

    Overview Snapshot Observational Technical (OSOT) is specifically designed to allow users to obtain both pictorial and categorical data related to the transactions in context component of early childhood (prekindergarten and kindergarten) educational programs. Such information is especially useful in operations calling for descriptive evaluation.…

  4. Assessment of suturing in the vertical plane shows the efficacy of the multi-degree-of-freedom needle driver for neonatal laparoscopy.

    PubMed

    Takazawa, Shinya; Ishimaru, Tetsuya; Fujii, Masahiro; Harada, Kanako; Sugita, Naohiko; Mitsuishi, Mamoru; Iwanaka, Tadashi

    2013-11-01

    We have developed a thin needle driver with multiple degrees-of-freedom (DOFs) for neonatal laparoscopic surgery. The tip of this needle driver has three DOFs for grasp, deflection and rotation. Our aim was to evaluate the performance of the multi-DOF needle driver in vertical plane suturing. Six pediatric surgeons performed four directional suturing tasks in the vertical plane using the multi-DOF needle driver and a conventional one. Assessed parameters were the accuracy of insertion and exit, the depth of suture, the inclination angle of the needle and the force applied on the model. In left and right direction sutures, the inclination angle of the needle with the multi-DOF needle driver was significantly smaller than that with the conventional one (p = 0.014, 0.042, respectively). In left and right direction sutures, the force for pulling the model with the multi-DOF needle driver was smaller than that with the conventional one (p = 0.036, 0.010, respectively). This study showed that multi-directional suturing on a vertical plane using the multi-DOF needle driver had better needle trajectories and was less invasive as compared to a conventional needle driver.

  5. Quantum computation based on photonic systems with two degrees of freedom assisted by the weak cross-Kerr nonlinearity.

    PubMed

    Luo, Ming-Xing; Li, Hui-Ran; Lai, Hong

    2016-07-18

    Most of previous quantum computations only take use of one degree of freedom (DoF) of photons. An experimental system may possess various DoFs simultaneously. In this paper, with the weak cross-Kerr nonlinearity, we investigate the parallel quantum computation dependent on photonic systems with two DoFs. We construct nearly deterministic controlled-not (CNOT) gates operating on the polarization spatial DoFs of the two-photon or one-photon system. These CNOT gates show that two photonic DoFs can be encoded as independent qubits without auxiliary DoF in theory. Only the coherent states are required. Thus one half of quantum simulation resources may be saved in quantum applications if more complicated circuits are involved. Hence, one may trade off the implementation complexity and simulation resources by using different photonic systems. These CNOT gates are also used to complete various applications including the quantum teleportation and quantum superdense coding.

  6. Quantum computation based on photonic systems with two degrees of freedom assisted by the weak cross-Kerr nonlinearity

    PubMed Central

    Luo, Ming-Xing; Li, Hui-Ran; Lai, Hong

    2016-01-01

    Most of previous quantum computations only take use of one degree of freedom (DoF) of photons. An experimental system may possess various DoFs simultaneously. In this paper, with the weak cross-Kerr nonlinearity, we investigate the parallel quantum computation dependent on photonic systems with two DoFs. We construct nearly deterministic controlled-not (CNOT) gates operating on the polarization spatial DoFs of the two-photon or one-photon system. These CNOT gates show that two photonic DoFs can be encoded as independent qubits without auxiliary DoF in theory. Only the coherent states are required. Thus one half of quantum simulation resources may be saved in quantum applications if more complicated circuits are involved. Hence, one may trade off the implementation complexity and simulation resources by using different photonic systems. These CNOT gates are also used to complete various applications including the quantum teleportation and quantum superdense coding. PMID:27424767

  7. Spatial forms and mental imagery.

    PubMed

    Price, Mark C

    2009-01-01

    Four studies investigated how general mental imagery might be involved in mediating the phenomenon of 'synaesthetic' spatial forms - i.e., the experience that sequences such as months or numbers have spatial locations. In Study 1, people with spatial forms scored higher than controls on visual imagery self-report scales. This is consistent with the suggestion that strong general imagery is at least a necessary condition to experience spatial forms. However self-reported spatial imagery did not differ between groups, suggesting either that the spatial nature of forms is mediated by special synaesthetic mechanisms, or that forms are depictive visual images rather than explicit spatial models. A methodological implication of Study 1 was that a general tendency for people with spatial forms to use imagery strategies might account for some of their previously-reported behavioural differences with control groups. This concern was supported by Studies 2-4. Normal participants were encouraged to visually image the months in various spatial layouts, and spatial associations for months were tested using left/right key presses to classify month names as belonging to the first or second half of the year (Studies 2-3) or as odd/even (Study 4). Reaction times showed month-SNARC (Spatial Numerical Association of Response Codes) effects of similar magnitude to previously-reported data from spatial form participants (Price and Mentzoni, 2008). Additionally, reversing the spatial associations within instructed images was sufficient to reverse the direction of observed month-SNARC effects (i.e., positive vs negative slope), just as different spatial forms were previously shown to modulate the direction of effects (ibid.). Results challenge whether previously observed behavioural differences between spatial form and control groups need to be explained in terms of special synaesthetic mechanisms rather than intentional imagery strategies. It is argued that usually strong general

  8. 3D printing antagonistic systems of artificial muscle using projection stereolithography.

    PubMed

    Peele, Bryan N; Wallin, Thomas J; Zhao, Huichan; Shepherd, Robert F

    2015-09-09

    The detailed mechanical design of a digital mask projection stereolithgraphy system is described for the 3D printing of soft actuators. A commercially available, photopolymerizable elastomeric material is identified and characterized in its liquid and solid form using rheological and tensile testing. Its capabilities for use in directly printing high degree of freedom (DOF), soft actuators is assessed. An outcome is the ∼40% strain to failure of the printed elastomer structures. Using the resulting material properties, numerical simulations of pleated actuator architectures are analyzed to reduce stress concentration and increase actuation amplitudes. Antagonistic pairs of pleated actuators are then fabricated and tested for four-DOF, tentacle-like motion. These antagonistic pairs are shown to sweep through their full range of motion (∼180°) with a period of less than 70 ms.

  9. From reaching to reach-to-grasp: the arm posture difference and its implications on human motion control strategy.

    PubMed

    Li, Zhi; Milutinović, Dejan; Rosen, Jacob

    2017-05-01

    Reach-to-grasp arm postures differ from those in pure reaching because they are affected by grasp position/orientation, rather than simple transport to a position during a reaching motion. This paper investigates this difference via an analysis of experimental  data collected on reaching and reach-to-grasp motions. A seven-degree-of-freedom (DOFs) kinematic arm model with the swivel angle is used for the motion analysis. Compared to a widely used anatomical arm model, this model distinguishes clearly the four grasping-relevant DOFs (GR-DOFs) that are affected by positions and orientations of the objects to be grasped. These four GR-DOFs include the swivel angle that measures the elbow rotation about the shoulder-wrist axis, and three wrist joint angles. For each GR-DOF, we quantify position vs orientation task-relevance bias that measures how much the DOF is affected by the grasping position vs orientation. The swivel angle and forearm supination have similar bias, and the analysis of their motion suggests two hypotheses regarding the synergistic coordination of the macro- and micro-structures of the human arm (1) DOFs with similar task-relevance are synergistically coordinated; and (2) such synergy breaks when a task-relevant DOF is close to its joint limit without necessarily reaching the limit. This study provides a motion analysis method to reduce the control complexity for reach-to-grasp tasks, and suggests using dynamic coupling to coordinate the hand and arm of upper-limb exoskeletons.

  10. Transfer of bacteriophage MS2 and fluorescein from N95 filtering facepiece respirators to hands: Measuring fomite potential

    PubMed Central

    Brady, Tyler M.; Strauch, Amanda L.; Almaguer, Claudia M.; Niezgoda, George; Shafer, Ronald E.; Yorio, Patrick L.; Fisher, Edward M.

    2017-01-01

    Contact transmission of pathogens from personal protective equipment is a concern within the healthcare industry. During public health emergency outbreaks, resources become constrained and the reuse of personal protective equipment, such as N95 filtering facepiece respirators, may be needed. This study was designed to characterize the transfer of bacteriophage MS2 and fluorescein between filtering facepiece respirators and the wearer’s hands during three simulated use scenarios. Filtering facepiece respirators were contaminated with MS2 and fluorescein in droplets or droplet nuclei. Thirteen test subjects performed filtering facepiece respirator use scenarios including improper doffing, proper doffing and reuse, and improper doffing and reuse. Fluorescein and MS2 contamination transfer were quantified. The average MS2 transfer from filtering facepiece respirators to the subjects’ hands ranged from 7.6–15.4% and 2.2–2.7% for droplet and droplet nuclei derived contamination, respectively. Handling filtering facepiece respirators contaminated with droplets resulted in higher levels of MS2 transfer compared to droplet nuclei for all use scenarios (p = 0.007). MS2 transfer from droplet contaminated filtering facepiece respirators during improper doffing and reuse was greater than transfer during improper doffing (p = 0.008) and proper doffing and reuse (p = 0.042). Droplet contamination resulted in higher levels of fluorescein transfer compared to droplet nuclei contaminated filtering facepiece respirators for all use scenarios (p = 0.009). Fluorescein transfer was greater for improper doffing and reuse (p = 0.007) from droplet contaminated masks compared to droplet nuclei contaminated filtering facepiece respirators and for improper doffing and reuse when compared improper doffing (p = 0.017) and proper doffing and reuse (p = 0.018) for droplet contaminated filtering facepiece respirators. For droplet nuclei contaminated filtering facepiece respirators, the

  11. A novel method for simultaneous measurement of doped optical fiber parameters

    NASA Astrophysics Data System (ADS)

    Karimi, M.; Seraji, F. E.

    2010-05-01

    Simultaneous measurement technique of evaluating the doped optical fibers (DOF) parameters is a suitable scheme for DOF production industries. In this paper, we introduce a novel technique to characterize simultaneously the main parameters of DOF such as absorption and emission cross-sections (ACS, ECS), background loss coefficient (BLC), and low dopant concentration using the gain equation of DOFs. We used this new method to determine the ACS, ECS, BLC in a standard sample of Al-P-Erbium doped optical fiber. The results have been analyzed and compared with other reports.

  12. Effect of multiple forming tools on geometrical and mechanical properties in incremental sheet forming

    NASA Astrophysics Data System (ADS)

    Wernicke, S.; Dang, T.; Gies, S.; Tekkaya, A. E.

    2018-05-01

    The tendency to a higher variety of products requires economical manufacturing processes suitable for the production of prototypes and small batches. In the case of complex hollow-shaped parts, single point incremental forming (SPIF) represents a highly flexible process. The flexibility of this process comes along with a very long process time. To decrease the process time, a new incremental forming approach with multiple forming tools is investigated. The influence of two incremental forming tools on the resulting mechanical and geometrical component properties compared to SPIF is presented. Sheets made of EN AW-1050A were formed to frustums of a pyramid using different tool-path strategies. Furthermore, several variations of the tool-path strategy are analyzed. A time saving between 40% and 60% was observed depending on the tool-path and the radii of the forming tools while the mechanical properties remained unchanged. This knowledge can increase the cost efficiency of incremental forming processes.

  13. Challenging shock models with SOFIA OH observations in the high-mass star-forming region Cepheus A

    NASA Astrophysics Data System (ADS)

    Gusdorf, A.; Güsten, R.; Menten, K. M.; Flower, D. R.; Pineau des Forêts, G.; Codella, C.; Csengeri, T.; Gómez-Ruiz, A. I.; Heyminck, S.; Jacobs, K.; Kristensen, L. E.; Leurini, S.; Requena-Torres, M. A.; Wampfler, S. F.; Wiesemeyer, H.; Wyrowski, F.

    2016-01-01

    Context. OH is a key molecule in H2O chemistry, a valuable tool for probing physical conditions, and an important contributor to the cooling of shock regions around high-mass protostars. OH participates in the re-distribution of energy from the protostar towards the surrounding Interstellar Medium. Aims: Our aim is to assess the origin of the OH emission from the Cepheus A massive star-forming region and to constrain the physical conditions prevailing in the emitting gas. We thus want to probe the processes at work during the formation of massive stars. Methods: We present spectrally resolved observations of OH towards the protostellar outflows region of Cepheus A with the GREAT spectrometer onboard the Stratospheric Observatory for Infrared Astronomy (SOFIA) telescope. Three triplets were observed at 1834.7 GHz, 1837.8 GHz, and 2514.3 GHz (163.4 μm, 163.1 μm between the 2Π1/2 J = 1/2 states, and 119.2 μm, a ground transition between the 2Π3/2 J = 3/2 states), at angular resolutions of 16.̋3, 16.̋3, and 11.̋9, respectively. We also present the CO (16-15) spectrum at the same position. We compared the integrated intensities in the redshifted wings to the results of shock models. Results: The two OH triplets near 163 μm are detected in emission, but with blending hyperfine structure unresolved. Their profiles and that of CO (16-15) can be fitted by a combination of two or three Gaussians. The observed 119.2 μm triplet is seen in absorption, since its blending hyperfine structure is unresolved, but with three line-of-sight components and a blueshifted emission wing consistent with that of the other lines. The OH line wings are similar to those of CO, suggesting that they emanate from the same shocked structure. Conclusions: Under this common origin assumption, the observations fall within the model predictions and within the range of use of our model only if we consider that four shock structures are caught in our beam. Overall, our comparisons suggest that

  14. In Vitro Study of Taenia solium Postoncospheral Form.

    PubMed

    Chile, Nancy; Clark, Taryn; Arana, Yanina; Ortega, Ynes R; Palma, Sandra; Mejia, Alan; Angulo, Noelia; Kosek, Jon C; Kosek, Margaret; Gomez-Puerta, Luis A; Garcia, Hector H; Gavidia, Cesar M; Gilman, Robert H; Verastegui, Manuela

    2016-02-01

    The transitional period between the oncosphere and the cysticercus of Taenia solium is the postoncospheral (PO) form, which has not yet been completely characterized. The aim of this work was to standardize a method to obtain T. solium PO forms by in vitro cultivation. We studied the morphology of the PO form and compared the expression of antigenic proteins among the PO form, oncosphere, and cysticerci stages. T. solium activated oncospheres were co-cultured with ten cell lines to obtain PO forms, which we studied at three stages of development--days 15, 30, and 60. A high percentage (32%) of PO forms was obtained using HCT-8 cells in comparison to the other cell lines. The morphology was observed by bright field, scanning, and transmission electron microscopy. Morphology of the PO form changed over time, with the six hooks commonly seen in the oncosphere stage disappearing in the PO forms, and vesicles and microtriches observed in the tegument. The PO forms grew as they aged, reaching a diameter of 2.5 mm at 60 days of culture. 15-30 day PO forms developed into mature cysticerci when inoculated into rats. Antigenic proteins expressed in the PO forms are also expressed by the oncosphere and cysticerci stages, with more cysticerci antigenic proteins expressed as the PO forms ages. This is the first report of an in vitro production method of T. solium PO forms. The changes observed in protein expression may be useful in identifying new targets for vaccine development. In vitro culture of PO form will aid in understanding the host-parasite relationship, since the structural changes of the developing PO forms may reflect the parasite's immunoprotective mechanisms. A wider application of this method could significantly reduce the use of animals, and thus the costs and time required for further experimental investigations.

  15. {sup 13}C-METHYL FORMATE: OBSERVATIONS OF A SAMPLE OF HIGH-MASS STAR-FORMING REGIONS INCLUDING ORION-KL AND SPECTROSCOPIC CHARACTERIZATION

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Favre, Cécile; Bergin, Edwin A.; Crockett, Nathan R.

    2015-01-01

    We have surveyed a sample of massive star-forming regions located over a range of distances from the Galactic center for methyl formate, HCOOCH{sub 3}, and its isotopologues H{sup 13}COOCH{sub 3} and HCOO{sup 13}CH{sub 3}. The observations were carried out with the APEX telescope in the frequency range 283.4-287.4 GHz. Based on the APEX observations, we report tentative detections of the {sup 13}C-methyl formate isotopologue HCOO{sup 13}CH{sub 3} toward the following four massive star-forming regions: Sgr B2(N-LMH), NGC 6334 IRS 1, W51 e2, and G19.61-0.23. In addition, we have used the 1 mm ALMA science verification observations of Orion-KL and confirm the detection ofmore » the {sup 13}C-methyl formate species in Orion-KL and image its spatial distribution. Our analysis shows that the {sup 12}C/{sup 13}C isotope ratio in methyl formate toward the Orion-KL Compact Ridge and Hot Core-SW components (68.4 ± 10.1 and 71.4 ± 7.8, respectively) are, for both the {sup 13}C-methyl formate isotopologues, commensurate with the average {sup 12}C/{sup 13}C ratio of CO derived toward Orion-KL. Likewise, regarding the other sources, our results are consistent with the {sup 12}C/{sup 13}C in CO. We also report the spectroscopic characterization, which includes a complete partition function, of the complex H{sup 13}COOCH{sub 3} and HCOO{sup 13}CH{sub 3} species. New spectroscopic data for both isotopomers H{sup 13}COOCH{sub 3} and HCOO{sup 13}CH{sub 3}, presented in this study, have made it possible to measure this fundamentally important isotope ratio in a large organic molecule for the first time.« less

  16. Parallel Photonic Quantum Computation Assisted by Quantum Dots in One-Side Optical Microcavities

    PubMed Central

    Luo, Ming-Xing; Wang, Xiaojun

    2014-01-01

    Universal quantum logic gates are important elements for a quantum computer. In contrast to previous constructions on one degree of freedom (DOF) of quantum systems, we investigate the possibility of parallel quantum computations dependent on two DOFs of photon systems. We construct deterministic hyper-controlled-not (hyper-CNOT) gates operating on the spatial-mode and the polarization DOFs of two-photon or one-photon systems by exploring the giant optical circular birefringence induced by quantum-dot spins in one-sided optical microcavities. These hyper-CNOT gates show that the quantum states of two DOFs can be viewed as independent qubits without requiring auxiliary DOFs in theory. This result can reduce the quantum resources by half for quantum applications with large qubit systems, such as the quantum Shor algorithm. PMID:25030424

  17. Parallel photonic quantum computation assisted by quantum dots in one-side optical microcavities.

    PubMed

    Luo, Ming-Xing; Wang, Xiaojun

    2014-07-17

    Universal quantum logic gates are important elements for a quantum computer. In contrast to previous constructions on one degree of freedom (DOF) of quantum systems, we investigate the possibility of parallel quantum computations dependent on two DOFs of photon systems. We construct deterministic hyper-controlled-not (hyper-CNOT) gates operating on the spatial-mode and the polarization DOFs of two-photon or one-photon systems by exploring the giant optical circular birefringence induced by quantum-dot spins in one-sided optical microcavities. These hyper-CNOT gates show that the quantum states of two DOFs can be viewed as independent qubits without requiring auxiliary DOFs in theory. This result can reduce the quantum resources by half for quantum applications with large qubit systems, such as the quantum Shor algorithm.

  18. 13C-Methyl Formate: Observations of a Sample of High-mass Star-forming Regions Including orion-KL and Spectroscopic Characterization

    NASA Astrophysics Data System (ADS)

    Favre, Cécile; Carvajal, Miguel; Field, David; Jørgensen, Jes K.; Bisschop, Suzanne E.; Brouillet, Nathalie; Despois, Didier; Baudry, Alain; Kleiner, Isabelle; Bergin, Edwin A.; Crockett, Nathan R.; Neill, Justin L.; Margulès, Laurent; Huet, Thérèse R.; Demaison, Jean

    2014-12-01

    We have surveyed a sample of massive star-forming regions located over a range of distances from the Galactic center for methyl formate, HCOOCH3, and its isotopologues H13COOCH3 and HCOO13CH3. The observations were carried out with the APEX telescope in the frequency range 283.4-287.4 GHz. Based on the APEX observations, we report tentative detections of the 13C-methyl formate isotopologue HCOO13CH3 toward the following four massive star-forming regions: Sgr B2(N-LMH), NGC 6334 IRS 1, W51 e2, and G19.61-0.23. In addition, we have used the 1 mm ALMA science verification observations of Orion-KL and confirm the detection of the 13C-methyl formate species in Orion-KL and image its spatial distribution. Our analysis shows that the 12C/13C isotope ratio in methyl formate toward the Orion-KL Compact Ridge and Hot Core-SW components (68.4 ± 10.1 and 71.4 ± 7.8, respectively) are, for both the 13C-methyl formate isotopologues, commensurate with the average 12C/13C ratio of CO derived toward Orion-KL. Likewise, regarding the other sources, our results are consistent with the 12C/13C in CO. We also report the spectroscopic characterization, which includes a complete partition function, of the complex H13COOCH3 and HCOO13CH3 species. New spectroscopic data for both isotopomers H13COOCH3 and HCOO13CH3, presented in this study, have made it possible to measure this fundamentally important isotope ratio in a large organic molecule for the first time. This publication is based on data acquired with the Atacama Pathfinder Experiment (APEX). APEX is a collaboration between the Max-Planck-Institut fur Radioastronomie, the European Southern Observatory, and the Onsala Space Observatory (under program ID 089.F-9319).

  19. Evaluating evaluation forms form.

    PubMed

    Smith, Roger P

    2004-02-01

    To provide a tool for evaluating evaluation forms. A new form has been developed and tested on itself and a sample of evaluation forms obtained from the graduate medical education offices of several local universities. Additional forms from hospital administration were also subjected to analysis. The new form performed well when applied to itself. The form performed equally well when applied to the other (subject) forms, although their scores were embarrassingly poor. A new form for evaluating evaluation forms is needed, useful, and now available.

  20. Development and Reliability Testing of a Fast-Food Restaurant Observation Form.

    PubMed

    Rimkus, Leah; Ohri-Vachaspati, Punam; Powell, Lisa M; Zenk, Shannon N; Quinn, Christopher M; Barker, Dianne C; Pugach, Oksana; Resnick, Elissa A; Chaloupka, Frank J

    2015-01-01

    To develop a reliable observational data collection instrument to measure characteristics of the fast-food restaurant environment likely to influence consumer behaviors, including product availability, pricing, and promotion. The study used observational data collection. Restaurants were in the Chicago Metropolitan Statistical Area. A total of 131 chain fast-food restaurant outlets were included. Interrater reliability was measured for product availability, pricing, and promotion measures on a fast-food restaurant observational data collection instrument. Analysis was done with Cohen's κ coefficient and proportion of overall agreement for categorical variables and intraclass correlation coefficient (ICC) for continuous variables. Interrater reliability, as measured by average κ coefficient, was .79 for menu characteristics, .84 for kids' menu characteristics, .92 for food availability and sizes, .85 for beverage availability and sizes, .78 for measures on the availability of nutrition information,.75 for characteristics of exterior advertisements, and .62 and .90 for exterior and interior characteristics measures, respectively. For continuous measures, average ICC was .88 for food pricing measures, .83 for beverage prices, and .65 for counts of exterior advertisements. Over 85% of measures demonstrated substantial or almost perfect agreement. Although some measures required revision or protocol clarification, results from this study suggest that the instrument may be used to reliably measure the fast-food restaurant environment.

  1. Experimental Observation of the Effects of Translational and Rotational Electrode Misalignment on a Planar Linear Ion Trap Mass Spectrometer

    NASA Astrophysics Data System (ADS)

    Tian, Yuan; Decker, Trevor K.; McClellan, Joshua S.; Wu, Qinghao; De la Cruz, Abraham; Hawkins, Aaron R.; Austin, Daniel E.

    2018-04-01

    The performance of miniaturized ion trap mass analyzers is limited, in part, by the accuracy with which electrodes can be fabricated and positioned relative to each other. Alignment of plates in a two-plate planar LIT is ideal to characterize misalignment effects, as it represents the simplest possible case, having only six degrees of freedom (DOF) (three translational and three rotational). High-precision motorized actuators were used to vary the alignment between the two ion trap plates in five DOFs—x, y, z, pitch, and yaw. A comparison between the experiment and previous simulations shows reasonable agreement. Pitch, or the degree to which the plates are parallel along the axial direction, has the largest and sharpest impact to resolving power, with resolving power dropping noticeably with pitch misalignment of a fraction of a degree. Lateral displacement (x) and yaw (rotation of one plate, but plates remain parallel) both have a strong impact on ion ejection efficiency, but little effect on resolving power. The effects of plate spacing (y-displacement) on both resolving power and ion ejection efficiency are attributable to higher-order terms in the trapping field. Varying the DC (axial) trapping potential can elucidate the effects where more misalignments in more than one DOF affect performance. Implications of these results for miniaturized ion traps are discussed. [Figure not available: see fulltext.

  2. Histological observation on dental hard tissue irradiated by ultrashort-pulsed laser

    NASA Astrophysics Data System (ADS)

    Uchizono, Takeyuki; Awazu, Kunio; Igarashi, Akihiro; Kato, Junji; Hirai, Yoshito

    2006-04-01

    In the field of dentistry, effectiveness of USPL irradiation is researched because USPL has less thermal side effect to dental hard tissue. In this paper, we observed morphological change and optical change of dental hard tissue irradiated by USPL for discussing the safety and effectiveness of USPL irradiation to dental hard tissues. Irradiated samples were crown enamel and root dentin of bovine teeth. Lasers were Ti:sapphire laser, which had pulse duration (P d)of 130 fsec and pulse repetition rate (f) of 1kHz and wavelength (l) of 800nm, free electron laser (FEL), which had P d of 15 μsec and f of 10Hz and wavelength of 9.6μm, and Er:YAG laser, which had P d of 250 μsec and f of 10Hz and wavelength of 2.94μm. After laser irradiation, the sample surfaces and cross sections were examined with SEM and EDX. The optical change of samples was observed using FTIR. In SEM, the samples irradiated by USPL had sharp and accurate ablation with no crack and no carbonization. But, in FEL and Er:YAG laser, the samples has rough ablation with crack and carbonization. It was cleared that the P/Ca ratio of samples irradiated by USPL had same value as non-irradiated samples. There was no change in the IR absorption spectrum between samples irradiated by USPL and non-irradiated sample. But, they of samples irradiated by FEL and Er:YAG laser, however, had difference value as non-irradiated samples. These results showed that USPL might be effective to ablate dental hard tissue without thermal damage.

  3. Robotic Arm Manipulator Using Active Control for Sample Acquisition and Transfer, and Passive Mode for Surface Compliance

    NASA Technical Reports Server (NTRS)

    Liu, Jun; Underhill, Michael L.; Trease, Brian P.; Lindemann, Randel A.

    2010-01-01

    A robotic arm that consists of three joints with four degrees of freedom (DOF) has been developed. It can carry an end-effector to acquire and transfer samples by using active control and comply with surface topology in a passive mode during a brief surface contact. The three joints are arranged in such a way that one joint of two DOFs is located at the shoulder, one joint of one DOF is located at the elbow, and one joint of one DOF is located at the wrist. Operationally, three DOFs are moved in the same plane, and the remaining one on the shoulder is moved perpendicular to the other three for better compliance with ground surface and more flexibility of sample handling. Three out of four joints are backdriveable, making the mechanism less complex and more cost effective

  4. Chandra/ACIS Observations of the 30 Doradus Star-Forming Complex

    NASA Astrophysics Data System (ADS)

    Townsley, Leisa; Broos, Patrick; Feigelson, Eric; Burrows, David; Chu, You-Hua; Garmire, Gordon; Griffiths, Richard; Maeda, Yoshitomo; Pavlov, George; Tsuboi, Yohko

    2002-04-01

    30 Doradus is the archetype giant extragalactic H II region, a massive star-forming complex in the Large Magellanic Cloud. We examine high-spatial-resolution X-ray images and spectra of the essential parts of 30 Doradus, obtained with the Advanced CCD Imaging Spectrometer (ACIS) aboard the Chandra X-ray Observatory. The central cluster of young high-mass stars, R136, is resolved at the arcsecond level, allowing spectral analysis of bright constituents; other OB/Wolf-Rayet binaries and multiple systems (e.g. R139, R140) are also detected. Spatially-resolved spectra are presented for N157B, the composite SNR containing a 16-msec pulsar. The spectrally soft superbubble structures seen by ROSAT are dramatically imaged by Chandra; we explore the spectral differences they exhibit. Taken together, the components of 30 Doradus give us an excellent microscopic view of high-energy phenomena seen on larger scales in more distant galaxies as starbursts and galactic winds.

  5. Sample Teacher/Student Critical Incident Form.

    ERIC Educational Resources Information Center

    Bucks County Public Schools, Doylestown, PA.

    This form was devised to provide a set of procedures for collecting and utilizing direct observations of specific student behaviors which clearly illustrate the achievement of one of the ten goals of this program. Forms can be used by teachers, students, and parents. (See TM 001 375 for summary of project.) (MS)

  6. In Vitro Study of Taenia solium Postoncospheral Form

    PubMed Central

    Chile, Nancy; Clark, Taryn; Arana, Yanina; Ortega, Ynes R.; Palma, Sandra; Mejia, Alan; Angulo, Noelia; Kosek, Jon C.; Kosek, Margaret; Gomez-Puerta, Luis A.; Garcia, Hector H.; Gavidia, Cesar M.; Gilman, Robert H.; Verastegui, Manuela

    2016-01-01

    Background The transitional period between the oncosphere and the cysticercus of Taenia solium is the postoncospheral (PO) form, which has not yet been completely characterized. The aim of this work was to standardize a method to obtain T. solium PO forms by in vitro cultivation. We studied the morphology of the PO form and compared the expression of antigenic proteins among the PO form, oncosphere, and cysticerci stages. Methodology/Principal Findings T. solium activated oncospheres were co-cultured with ten cell lines to obtain PO forms, which we studied at three stages of development–days 15, 30, and 60. A high percentage (32%) of PO forms was obtained using HCT-8 cells in comparison to the other cell lines. The morphology was observed by bright field, scanning, and transmission electron microscopy. Morphology of the PO form changed over time, with the six hooks commonly seen in the oncosphere stage disappearing in the PO forms, and vesicles and microtriches observed in the tegument. The PO forms grew as they aged, reaching a diameter of 2.5 mm at 60 days of culture. 15–30 day PO forms developed into mature cysticerci when inoculated into rats. Antigenic proteins expressed in the PO forms are also expressed by the oncosphere and cysticerci stages, with more cysticerci antigenic proteins expressed as the PO forms ages. Conclusions/Significance This is the first report of an in vitro production method of T. solium PO forms. The changes observed in protein expression may be useful in identifying new targets for vaccine development. In vitro culture of PO form will aid in understanding the host-parasite relationship, since the structural changes of the developing PO forms may reflect the parasite’s immunoprotective mechanisms. A wider application of this method could significantly reduce the use of animals, and thus the costs and time required for further experimental investigations. PMID:26863440

  7. Vortex-induced vibrations of two cylinders in tandem arrangement in the proximity–wake interference region

    PubMed Central

    BORAZJANI, IMAN; SOTIROPOULOS, FOTIS

    2009-01-01

    We investigate numerically vortex-induced vibrations (VIV) of two identical two-dimensional elastically mounted cylinders in tandem in the proximity–wake interference regime at Reynolds number Re = 200 for systems having both one (transverse vibrations) and two (transverse and in-line) degrees of freedom (1-DOF and 2-DOF, respectively). For the 1-DOF system the computed results are in good qualitative agreement with available experiments at higher Reynolds numbers. Similar to these experiments our simulations reveal: (1) larger amplitudes of motion and a wider lock-in region for the tandem arrangement when compared with an isolated cylinder; (2) that at low reduced velocities the vibration amplitude of the front cylinder exceeds that of the rear cylinder; and (3) that above a threshold reduced velocity, large-amplitude VIV are excited for the rear cylinder with amplitudes significantly larger than those of the front cylinder. By analysing the simulated flow patterns we identify the VIV excitation mechanisms that lead to such complex responses and elucidate the near-wake vorticity dynamics and vortex-shedding modes excited in each case. We show that at low reduced velocities vortex shedding provides the initial excitation mechanism, which gives rise to a vertical separation between the two cylinders. When this vertical separation exceeds one cylinder diameter, however, a significant portion of the incoming flow is able to pass through the gap between the two cylinders and the gap-flow mechanism starts to dominate the VIV dynamics. The gap flow is able to periodically force either the top or the bottom shear layer of the front cylinder into the gap region, setting off a series of very complex vortex-to-vortex and vortex-to-cylinder interactions, which induces pressure gradients that result in a large oscillatory force in phase with the vortex shedding and lead to the experimentally observed larger vibration amplitudes. When the vortex shedding is the dominant

  8. CTEPP DATA COLLECTION FORM 02: HOUSE/BUILDING CHARACTERISTICS OBSERVATION SURVEY FOR THE HOME

    EPA Science Inventory

    This data collection form is used to document the physical characteristics of the home and identify and inventory possible sources of pollutants.

    The Children's Total Exposure to Persistent Pesticides and Other Persistent Pollutant (CTEPP) study was one of the largest aggregate...

  9. Object form discontinuity facilitates displacement discrimination across saccades.

    PubMed

    Demeyer, Maarten; De Graef, Peter; Wagemans, Johan; Verfaillie, Karl

    2010-06-01

    Stimulus displacements coinciding with a saccadic eye movement are poorly detected by human observers. In recent years, converging evidence has shown that this phenomenon does not result from poor transsaccadic retention of presaccadic stimulus position information, but from the visual system's efforts to spatially align presaccadic and postsaccadic perception on the basis of visual landmarks. It is known that this process can be disrupted, and transsaccadic displacement detection performance can be improved, by briefly blanking the stimulus display during and immediately after the saccade. In the present study, we investigated whether this improvement could also follow from a discontinuity in the task-irrelevant form of the displaced stimulus. We observed this to be the case: Subjects more accurately identified the direction of intrasaccadic displacements when the displaced stimulus simultaneously changed form, compared to conditions without a form change. However, larger improvements were still observed under blanking conditions. In a second experiment, we show that facilitation induced by form changes and blanks can combine. We conclude that a strong assumption of visual stability underlies the suppression of transsaccadic change detection performance, the rejection of which generalizes from stimulus form to stimulus position.

  10. A kinematic analysis of the Space Station remote manipulator system (SSRMS)

    NASA Technical Reports Server (NTRS)

    Crane, Carl D., III; Duffy, Joseph; Carnahan, Tim

    1991-01-01

    An efficient reverse analysis of three 6-degree-of-freedom (dof) subchains of the 7-dof SSRMS is presented. The first subchain is formed by locking the seventh joint. The second subchain is formed by locking the second joint, while the third subchain is formed by locking the first joint (the grounded joint is counted as the first joint in the chain). There are a maximum of eight different arm configurations in each of the three subchains, and these were determined by employing a computer-efficient algorithm, which required the rooting of only at most quadratic polynomials. The algorithms were implemented, and the SSRMS was employed in an animated environment to perform and practice a number of useful tasks for Space Station servicing. The locking of the second joint has the advantage in that an operator can choose the orientation of the plane that contains the two longest links so as to avoid collisions with obstacles. However, it has the disadvantage that when the second joint angle equals 0 deg or 180 deg, the manipulator is in a singularity configuration. This plane can also be oriented by specifying the first joint angle, so that the plane can be oriented arbitrarily and, in this, the singularity is avoided.

  11. Downstream-of-FGFR Is a Fibroblast Growth Factor-Specific Scaffolding Protein and Recruits Corkscrew upon Receptor Activation

    PubMed Central

    Petit, Valérie; Nussbaumer, Ute; Dossenbach, Caroline; Affolter, Markus

    2004-01-01

    Fibroblast growth factor (FGF) receptor (FGFR) signaling controls the migration of glial, mesodermal, and tracheal cells in Drosophila melanogaster. Little is known about the molecular events linking receptor activation to cytoskeletal rearrangements during cell migration. We have performed a functional characterization of Downstream-of-FGFR (Dof), a putative adapter protein that acts specifically in FGFR signal transduction in Drosophila. By combining reverse genetic, cell culture, and biochemical approaches, we demonstrate that Dof is a specific substrate for the two Drosophila FGFRs. After defining a minimal Dof rescue protein, we identify two regions important for Dof function in mesodermal and tracheal cell migration. The N-terminal 484 amino acids are strictly required for the interaction of Dof with the FGFRs. Upon receptor activation, tyrosine residue 515 becomes phosphorylated and recruits the phosphatase Corkscrew (Csw). Csw recruitment represents an essential step in FGF-induced cell migration and in the activation of the Ras/MAPK pathway. However, our results also indicate that the activation of Ras is not sufficient to activate the migration machinery in tracheal and mesodermal cells. Additional proteins binding either to the FGFRs, to Dof, or to Csw appear to be crucial for a chemotactic response. PMID:15082772

  12. Downstream-of-FGFR is a fibroblast growth factor-specific scaffolding protein and recruits Corkscrew upon receptor activation.

    PubMed

    Petit, Valérie; Nussbaumer, Ute; Dossenbach, Caroline; Affolter, Markus

    2004-05-01

    Fibroblast growth factor (FGF) receptor (FGFR) signaling controls the migration of glial, mesodermal, and tracheal cells in Drosophila melanogaster. Little is known about the molecular events linking receptor activation to cytoskeletal rearrangements during cell migration. We have performed a functional characterization of Downstream-of-FGFR (Dof), a putative adapter protein that acts specifically in FGFR signal transduction in Drosophila. By combining reverse genetic, cell culture, and biochemical approaches, we demonstrate that Dof is a specific substrate for the two Drosophila FGFRs. After defining a minimal Dof rescue protein, we identify two regions important for Dof function in mesodermal and tracheal cell migration. The N-terminal 484 amino acids are strictly required for the interaction of Dof with the FGFRs. Upon receptor activation, tyrosine residue 515 becomes phosphorylated and recruits the phosphatase Corkscrew (Csw). Csw recruitment represents an essential step in FGF-induced cell migration and in the activation of the Ras/MAPK pathway. However, our results also indicate that the activation of Ras is not sufficient to activate the migration machinery in tracheal and mesodermal cells. Additional proteins binding either to the FGFRs, to Dof, or to Csw appear to be crucial for a chemotactic response.

  13. Extended state observer based robust adaptive control on SE(3) for coupled spacecraft tracking maneuver with actuator saturation and misalignment

    NASA Astrophysics Data System (ADS)

    Zhang, Jianqiao; Ye, Dong; Sun, Zhaowei; Liu, Chuang

    2018-02-01

    This paper presents a robust adaptive controller integrated with an extended state observer (ESO) to solve coupled spacecraft tracking maneuver in the presence of model uncertainties, external disturbances, actuator uncertainties including magnitude deviation and misalignment, and even actuator saturation. More specifically, employing the exponential coordinates on the Lie group SE(3) to describe configuration tracking errors, the coupled six-degrees-of-freedom (6-DOF) dynamics are developed for spacecraft relative motion, in which a generic fully actuated thruster distribution is considered and the lumped disturbances are reconstructed by using anti-windup technique. Then, a novel ESO, developed via second order sliding mode (SOSM) technique and adding linear correction terms to improve the performance, is designed firstly to estimate the disturbances in finite time. Based on the estimated information, an adaptive fast terminal sliding mode (AFTSM) controller is developed to guarantee the almost global asymptotic stability of the resulting closed-loop system such that the trajectory can be tracked with all the aforementioned drawbacks addressed simultaneously. Finally, the effectiveness of the controller is illustrated through numerical examples.

  14. Development and Construct Validity of the Classroom Strategies Scale-Observer Form

    ERIC Educational Resources Information Center

    Reddy, Linda A.; Fabiano, Gregory; Dudek, Christopher M.; Hsu, Louis

    2013-01-01

    Research on progress monitoring has almost exclusively focused on student behavior and not on teacher practices. This article presents the development and validation of a new teacher observational assessment (Classroom Strategies Scale) of classroom instructional and behavioral management practices. The theoretical underpinnings and empirical…

  15. Controlled Photon Switch Assisted by Coupled Quantum Dots

    PubMed Central

    Luo, Ming-Xing; Ma, Song-Ya; Chen, Xiu-Bo; Wang, Xiaojun

    2015-01-01

    Quantum switch is a primitive element in quantum network communication. In contrast to previous switch schemes on one degree of freedom (DOF) of quantum systems, we consider controlled switches of photon system with two DOFs. These controlled photon switches are constructed by exploring the optical selection rules derived from the quantum-dot spins in one-sided optical microcavities. Several double controlled-NOT gate on different joint systems are greatly simplified with an auxiliary DOF of the controlling photon. The photon switches show that two DOFs of photons can be independently transmitted in quantum networks. This result reduces the quantum resources for quantum network communication. PMID:26095049

  16. Depth of focus enhancement of a modified imaging quasi-fractal zone plate.

    PubMed

    Zhang, Qinqin; Wang, Jingang; Wang, Mingwei; Bu, Jing; Zhu, Siwei; Gao, Bruce Z; Yuan, Xiaocong

    2012-10-01

    We propose a new parameter w for optimization of foci distribution of conventional fractal zone plates (FZPs) with a greater depth of focus (DOF) in imaging. Numerical simulations of DOF distribution on axis directions indicate that the values of DOF can be extended by a factor of 1.5 or more by a modified quasi-FZP. In experiments, we employ a simple object-lens-image-plane arrangement to pick up images at various positions within the DOF of a conventional FZP and a quasi-FZP, respectively. Experimental results show that the parameter w improves foci distribution of FZPs in good agreement with theoretical predictions.

  17. Depth of focus enhancement of a modified imaging quasi-fractal zone plate

    PubMed Central

    Zhang, Qinqin; Wang, Jingang; Wang, Mingwei; Bu, Jing; Zhu, Siwei; Gao, Bruce Z.; Yuan, Xiaocong

    2013-01-01

    We propose a new parameter w for optimization of foci distribution of conventional fractal zone plates (FZPs) with a greater depth of focus (DOF) in imaging. Numerical simulations of DOF distribution on axis directions indicate that the values of DOF can be extended by a factor of 1.5 or more by a modified quasi-FZP. In experiments, we employ a simple object–lens–image-plane arrangement to pick up images at various positions within the DOF of a conventional FZP and a quasi-FZP, respectively. Experimental results show that the parameter w improves foci distribution of FZPs in good agreement with theoretical predictions. PMID:24285908

  18. Effectiveness of Rotation-free Triangular and Quadrilateral Shell Elements in Sheet-metal Forming Simulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brunet, M.; Sabourin, F.

    2005-08-05

    This paper is concerned with the effectiveness of triangular 3-node shell element without rotational d.o.f. and the extension to a new 4-node quadrilateral shell element called S4 with only 3 translational degrees of freedom per node and one-point integration. The curvatures are computed resorting to the surrounding elements. Extension from rotation-free triangular element to a quadrilateral element requires internal curvatures in order to avoid singular bending stiffness. Two numerical examples with regular and irregular meshes are performed to show the convergence and accuracy. Deep-drawing of a box, spring-back analysis of a U-shape strip sheet and the crash simulation of amore » beam-box complete the demonstration of the bending capabilities of the proposed rotation-free triangular and quadrilateral elements.« less

  19. H2D(+) observations give an age of at least one million years for a cloud core forming Sun-like stars.

    PubMed

    Brünken, Sandra; Sipilä, Olli; Chambers, Edward T; Harju, Jorma; Caselli, Paola; Asvany, Oskar; Honingh, Cornelia E; Kamiński, Tomasz; Menten, Karl M; Stutzki, Jürgen; Schlemmer, Stephan

    2014-12-11

    The age of dense interstellar cloud cores, where stars and planets form, is a crucial parameter in star formation and difficult to measure. Some models predict rapid collapse, whereas others predict timescales of more than one million years (ref. 3). One possible approach to determining the age is through chemical changes as cloud contraction occurs, in particular through indirect measurements of the ratio of the two spin isomers (ortho/para) of molecular hydrogen, H2, which decreases monotonically with age. This has been done for the dense cloud core L183, for which the deuterium fractionation of diazenylium (N2H(+)) was used as a chemical clock to infer that the core has contracted rapidly (on a timescale of less than 700,000 years). Among astronomically observable molecules, the spin isomers of the deuterated trihydrogen cation, ortho-H2D(+) and para-H2D(+), have the most direct chemical connections to H2 (refs 8, 9, 10, 11, 12) and their abundance ratio provides a chemical clock that is sensitive to greater cloud core ages. So far this ratio has not been determined because para-H2D(+) is very difficult to observe. The detection of its rotational ground-state line has only now become possible thanks to accurate measurements of its transition frequency in the laboratory, and recent progress in instrumentation technology. Here we report observations of ortho- and para-H2D(+) emission and absorption, respectively, from the dense cloud core hosting IRAS 16293-2422 A/B, a group of nascent solar-type stars (with ages of less than 100,000 years). Using the ortho/para ratio in conjunction with chemical models, we find that the dense core has been chemically processed for at least one million years. The apparent discrepancy with the earlier N2H(+) work arises because that chemical clock turns off sooner than the H2D(+) clock, but both results imply that star-forming dense cores have ages of about one million years, rather than 100,000 years.

  20. Robust extraction of basis functions for simultaneous and proportional myoelectric control via sparse non-negative matrix factorization

    NASA Astrophysics Data System (ADS)

    Lin, Chuang; Wang, Binghui; Jiang, Ning; Farina, Dario

    2018-04-01

    Objective. This paper proposes a novel simultaneous and proportional multiple degree of freedom (DOF) myoelectric control method for active prostheses. Approach. The approach is based on non-negative matrix factorization (NMF) of surface EMG signals with the inclusion of sparseness constraints. By applying a sparseness constraint to the control signal matrix, it is possible to extract the basis information from arbitrary movements (quasi-unsupervised approach) for multiple DOFs concurrently. Main Results. In online testing based on target hitting, able-bodied subjects reached a greater throughput (TP) when using sparse NMF (SNMF) than with classic NMF or with linear regression (LR). Accordingly, the completion time (CT) was shorter for SNMF than NMF or LR. The same observations were made in two patients with unilateral limb deficiencies. Significance. The addition of sparseness constraints to NMF allows for a quasi-unsupervised approach to myoelectric control with superior results with respect to previous methods for the simultaneous and proportional control of multi-DOF. The proposed factorization algorithm allows robust simultaneous and proportional control, is superior to previous supervised algorithms, and, because of minimal supervision, paves the way to online adaptation in myoelectric control.

  1. 3D-2D registration in mobile radiographs: algorithm development and preliminary clinical evaluation

    NASA Astrophysics Data System (ADS)

    Otake, Yoshito; Wang, Adam S.; Uneri, Ali; Kleinszig, Gerhard; Vogt, Sebastian; Aygun, Nafi; Lo, Sheng-fu L.; Wolinsky, Jean-Paul; Gokaslan, Ziya L.; Siewerdsen, Jeffrey H.

    2015-03-01

    An image-based 3D-2D registration method is presented using radiographs acquired in the uncalibrated, unconstrained geometry of mobile radiography. The approach extends a previous method for six degree-of-freedom (DOF) registration in C-arm fluoroscopy (namely ‘LevelCheck’) to solve the 9-DOF estimate of geometry in which the position of the source and detector are unconstrained. The method was implemented using a gradient correlation similarity metric and stochastic derivative-free optimization on a GPU. Development and evaluation were conducted in three steps. First, simulation studies were performed that involved a CT scan of an anthropomorphic body phantom and 1000 randomly generated digitally reconstructed radiographs in posterior-anterior and lateral views. A median projection distance error (PDE) of 0.007 mm was achieved with 9-DOF registration compared to 0.767 mm for 6-DOF. Second, cadaver studies were conducted using mobile radiographs acquired in three anatomical regions (thorax, abdomen and pelvis) and three levels of source-detector distance (~800, ~1000 and ~1200 mm). The 9-DOF method achieved a median PDE of 0.49 mm (compared to 2.53 mm for the 6-DOF method) and demonstrated robustness in the unconstrained imaging geometry. Finally, a retrospective clinical study was conducted with intraoperative radiographs of the spine exhibiting real anatomical deformation and image content mismatch (e.g. interventional devices in the radiograph that were not in the CT), demonstrating a PDE = 1.1 mm for the 9-DOF approach. Average computation time was 48.5 s, involving 687 701 function evaluations on average, compared to 18.2 s for the 6-DOF method. Despite the greater computational load, the 9-DOF method may offer a valuable tool for target localization (e.g. decision support in level counting) as well as safety and quality assurance checks at the conclusion of a procedure (e.g. overlay of planning data on the radiograph for verification of

  2. UDOF direct improvement by modulating mask absorber thickness

    NASA Astrophysics Data System (ADS)

    Yu, Tuan-Yen; Lio, En Chuan; Chen, Po Tsang; Wei, Chih I.; Chen, Yi Ting; Peng, Ming Chun; Chou, William; Yu, Chun Chi

    2016-10-01

    As the process generation migrate to advanced and smaller dimension or pitch, the mask and resist 3D effects will impact the lithography focus common window severely because of both individual depth-of-focus (iDOF) range decrease and center mismatch. Furthermore, some chemical or thermal factors, such as PEB (Post Exposure Bake) also worsen the usable depth-of-focus (uDOF) performance. So the mismatch of thru-pitch iDOF center should be considered as a lithography process integration issue, and more complicated to partition the 3D effects induced by optical or chemical factors. In order to reduce the impact of 3D effects induced by both optical and chemical issues, and improve iDOF center mismatch, we would like to propose a mask absorber thickness offset approach, which is directly to compensate the iDOF center bias by adjusting mask absorber thickness, for iso, semi-iso or dense characteristics in line, space or via patterns to enlarge common process window, i.e uDOF, which intends to provide similar application as Flexwave[1] (ASML trademark). By the way, since mask absorber thickness offset approach is similar to focus tuning or change on wafer lithography process, it could be acted as the process tuning method of photoresist (PR) profile optimization locally, PR scum improvement in specific patterns or to modulate etching bias to meet process integration request. For mass production consideration, and available material, current att-PSM blank, quartz, MoSi with chrome layer as hard-mask in reticle process, will be implemented in this experiment, i.e. chrome will be kept remaining above partial thru-pitch patterns, and act as the absorber thickness bias in different patterns. And then, from the best focus offset of thru-pitch patterns, the iDOF center shifts could be directly corrected and to enlarge uDOF by increasing the overlap of iDOF. Finally, some negative tone development (NTD) result in line patterns will be demonstrated as well.

  3. Architectural study of the design and operation of advanced force feedback manual controllers

    NASA Technical Reports Server (NTRS)

    Tesar, Delbert; Kim, Whee-Kuk

    1990-01-01

    A teleoperator system consists of a manual controller, control hardware/software, and a remote manipulator. It was employed in either hazardous or unstructured, and/or remote environments. In teleoperation, the main-in-the-loop is the central concept that brings human intelligence to the teleoperator system. When teleoperation involves contact with an uncertain environment, providing the feeling of telepresence to the human operator is one of desired characteristics of the teleoperator system. Unfortunately, most available manual controllers in bilateral or force-reflecting teleoperator systems can be characterized by their bulky size, high costs, or lack of smoothness and transparency, and elementary architectures. To investigate other alternatives, a force-reflecting, 3 degree of freedom (dof) spherical manual controller is designed, analyzed, and implemented as a test bed demonstration in this research effort. To achieve an improved level of design to meet criteria such as compactness, portability, and a somewhat enhanced force-reflecting capability, the demonstration manual controller employs high gear-ratio reducers. To reduce the effects of the inertia and friction on the system, various force control strategies are applied and their performance investigated. The spherical manual controller uses a parallel geometry to minimize inertial and gravitational effects on its primary task of transparent information transfer. As an alternative to the spherical 3-dof manual controller, a new conceptual (or parallel) spherical 3-dof module is introduced with a full kinematic analysis. Also, the resulting kinematic properties are compared to those of other typical spherical 3-dof systems. The conceptual design of a parallel 6-dof manual controller and its kinematic analysis is presented. This 6-dof manual controller is similar to the Stewart Platform with the actuators located on the base to minimize the dynamic effects. Finally, a combination of the new 3-dof and 6-dof

  4. Evidence for a current sheet forming in the wake of a coronal mass ejection from multi-viewpoint coronagraph observations

    NASA Astrophysics Data System (ADS)

    Patsourakos, S.; Vourlidas, A.

    2011-01-01

    sheets. Therefore, our multi-viewpoint observations supply strong evidence that the observed post-CME ray is indeed related to a post-CME current sheet. Movies are only available in electronic form at http://www.aanda.org

  5. A double torsion pendulum with two cascade soft degrees of freedom

    NASA Astrophysics Data System (ADS)

    Marconi, L.; Stanga, R.; Bassan, M.

    2012-06-01

    We report on a double torsion pendulum, where motion along two degrees of freedom (DoFs) is almost free. The Test Mass (TM) is enclosed in a replica of the LISA-Pathfinder electrostatic readout and actuation system. This apparatus is designed to perform extensive ground testing of undesired effects such as leakage of the readout noise from one DoF to another, or actuation cross talks with closed feedback loop. Such investigation is relevant to the noise budget of LISA and LISA-Pathfinder missions, as the TM will be sensitive to weak forces along all 6 degrees of freedom (DoFs). The instrument being developed in Firenze is capable of measuring the forces and stiffnesses acting simultaneously along the 2 soft DoFs. We have completed an upgrade of the apparatus to a definitive configuration and we report on both advances in the commissioning tests and on measurements of residual charge, with the first DoF released.

  6. Use of ultraviolet-fluorescence-based simulation in evaluation of personal protective equipment worn for first assessment and care of a patient with suspected high-consequence infectious disease.

    PubMed

    Hall, S; Poller, B; Bailey, C; Gregory, S; Clark, R; Roberts, P; Tunbridge, A; Poran, V; Evans, C; Crook, B

    2018-06-01

    Variations currently exist across the UK in the choice of personal protective equipment (PPE) used by healthcare workers when caring for patients with suspected high-consequence infectious diseases (HCIDs). To test the protection afforded to healthcare workers by current PPE ensembles during assessment of a suspected HCID case, and to provide an evidence base to justify proposal of a unified PPE ensemble for healthcare workers across the UK. One 'basic level' (enhanced precautions) PPE ensemble and five 'suspected case' PPE ensembles were evaluated in volunteer trials using 'Violet'; an ultraviolet-fluorescence-based simulation exercise to visualize exposure/contamination events. Contamination was photographed and mapped. There were 147 post-simulation and 31 post-doffing contamination events, from a maximum of 980, when evaluating the basic level of PPE. Therefore, this PPE ensemble did not afford adequate protection, primarily due to direct contamination of exposed areas of the skin. For the five suspected case ensembles, 1584 post-simulation contamination events were recorded, from a maximum of 5110. Twelve post-doffing contamination events were also observed (face, two events; neck, one event; forearm, one event; lower legs, eight events). All suspected case PPE ensembles either had post-doffing contamination events or other significant disadvantages to their use. This identified the need to design a unified PPE ensemble and doffing procedure, incorporating the most protective PPE considered for each body area. This work has been presented to, and reviewed by, key stakeholders to decide on a proposed unified ensemble, subject to further evaluation. Crown Copyright © 2018. Published by Elsevier Ltd. All rights reserved.

  7. In vivo six-degree-of-freedom knee-joint kinematics in overground and treadmill walking following total knee arthroplasty.

    PubMed

    Guan, Shanyuanye; Gray, Hans A; Schache, Anthony G; Feller, Julian; de Steiger, Richard; Pandy, Marcus G

    2017-08-01

    No data are available to describe six-degree-of-freedom (6-DOF) knee-joint kinematics for one complete cycle of overground walking following total knee arthroplasty (TKA). The aims of this study were firstly, to measure 6-DOF knee-joint kinematics and condylar motion for overground walking following TKA; and secondly, to determine whether such data differed between overground and treadmill gait when participants walked at the same speed during both tasks. A unique mobile biplane X-ray imaging system enabled accurate measurement of 6-DOF TKA knee kinematics during overground walking by simultaneously tracking and imaging the joint. The largest rotations occurred for flexion-extension and internal-external rotation whereas the largest translations were associated with joint distraction and anterior-posterior drawer. Strong associations were found between flexion-extension and adduction-abduction (R 2  = 0.92), joint distraction (R 2  = 1.00), and anterior-posterior translation (R 2  = 0.77), providing evidence of kinematic coupling in the TKA knee. Although the measured kinematic profiles for overground walking were grossly similar to those for treadmill walking, several statistically significant differences were observed between the two conditions with respect to temporo-spatial parameters, 6-DOF knee-joint kinematics, and condylar contact locations and sliding. Thus, caution is advised when making recommendations regarding knee implant performance based on treadmill-measured knee-joint kinematic data. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:1634-1643, 2017. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  8. Performance assessment of a programmable five degrees-of-freedom motion platform for quality assurance of motion management techniques in radiotherapy.

    PubMed

    Huang, Chen-Yu; Keall, Paul; Rice, Adam; Colvill, Emma; Ng, Jin Aun; Booth, Jeremy T

    2017-09-01

    Inter-fraction and intra-fraction motion management methods are increasingly applied clinically and require the development of advanced motion platforms to facilitate testing and quality assurance program development. The aim of this study was to assess the performance of a 5 degrees-of-freedom (DoF) programmable motion platform HexaMotion (ScandiDos, Uppsala, Sweden) towards clinically observed tumor motion range, velocity, acceleration and the accuracy requirements of SABR prescribed in AAPM Task Group 142. Performance specifications for the motion platform were derived from literature regarding the motion characteristics of prostate and lung tumor targets required for real time motion management. The performance of the programmable motion platform was evaluated against (1) maximum range, velocity and acceleration (5 DoF), (2) static position accuracy (5 DoF) and (3) dynamic position accuracy using patient-derived prostate and lung tumor motion traces (3 DoF). Translational motion accuracy was compared against electromagnetic transponder measurements. Rotation was benchmarked with a digital inclinometer. The static accuracy and reproducibility for translation and rotation was <0.1 mm or <0.1°, respectively. The accuracy of reproducing dynamic patient motion was <0.3 mm. The motion platform's range met the need to reproduce clinically relevant translation and rotation ranges and its accuracy met the TG 142 requirements for SABR. The range, velocity and acceleration of the motion platform are sufficient to reproduce lung and prostate tumor motion for motion management. Programmable motion platforms are valuable tools in the investigation, quality assurance and commissioning of motion management systems in radiation oncology.

  9. Industrial dual arm robot manipulator for precise assembly of mechanical parts

    NASA Astrophysics Data System (ADS)

    Park, Chanhun; Kim, Doohyung; Park, Kyoungtaik; Choi, Youngjin

    2007-12-01

    A new structure of dual arm robot manipulator which consists of two industrial 6-DOF arms and one 2-DOF Torso is introduced. Each industrial 6-DOF arm is able to be used as a stand-alone industrial 6-DOF robot manipulator and as a part of dual arm manipulator at the same time. These structures help the robot maker which is willing to succeed in the emerging dual arm robot market in order to have high competition for the current industrial robot market at same time. Self-collision detection algorithm for multi-arm robot and kinematics algorithms for the developed dual arm robot manipulator which are implemented in our controller are introduced.

  10. Optimal quantum observables

    NASA Astrophysics Data System (ADS)

    Haapasalo, Erkka; Pellonpää, Juha-Pekka

    2017-12-01

    Various forms of optimality for quantum observables described as normalized positive-operator-valued measures (POVMs) are studied in this paper. We give characterizations for observables that determine the values of the measured quantity with probabilistic certainty or a state of the system before or after the measurement. We investigate observables that are free from noise caused by classical post-processing, mixing, or pre-processing of quantum nature. Especially, a complete characterization of pre-processing and post-processing clean observables is given, and necessary and sufficient conditions are imposed on informationally complete POVMs within the set of pure states. We also discuss joint and sequential measurements of optimal quantum observables.

  11. A resolved two-way coupled CFD/6-DOF approach for predicting embolus transport and the embolus-trapping efficiency of IVC filters.

    PubMed

    Aycock, Kenneth I; Campbell, Robert L; Manning, Keefe B; Craven, Brent A

    2017-06-01

    Inferior vena cava (IVC) filters are medical devices designed to provide a mechanical barrier to the passage of emboli from the deep veins of the legs to the heart and lungs. Despite decades of development and clinical use, IVC filters still fail to prevent the passage of all hazardous emboli. The objective of this study is to (1) develop a resolved two-way computational model of embolus transport, (2) provide verification and validation evidence for the model, and (3) demonstrate the ability of the model to predict the embolus-trapping efficiency of an IVC filter. Our model couples computational fluid dynamics simulations of blood flow to six-degree-of-freedom simulations of embolus transport and resolves the interactions between rigid, spherical emboli and the blood flow using an immersed boundary method. Following model development and numerical verification and validation of the computational approach against benchmark data from the literature, embolus transport simulations are performed in an idealized IVC geometry. Centered and tilted filter orientations are considered using a nonlinear finite element-based virtual filter placement procedure. A total of 2048 coupled CFD/6-DOF simulations are performed to predict the embolus-trapping statistics of the filter. The simulations predict that the embolus-trapping efficiency of the IVC filter increases with increasing embolus diameter and increasing embolus-to-blood density ratio. Tilted filter placement is found to decrease the embolus-trapping efficiency compared with centered filter placement. Multiple embolus-trapping locations are predicted for the IVC filter, and the trapping locations are predicted to shift upstream and toward the vessel wall with increasing embolus diameter. Simulations of the injection of successive emboli into the IVC are also performed and reveal that the embolus-trapping efficiency decreases with increasing thrombus load in the IVC filter. In future work, the computational tool could be

  12. A quantitative measure for degree of automation and its relation to system performance and mental load.

    PubMed

    Wei, Z G; Macwan, A P; Wieringa, P A

    1998-06-01

    In this paper we quantitatively model degree of automation (DofA) in supervisory control as a function of the number and nature of tasks to be performed by the operator and automation. This model uses a task weighting scheme in which weighting factors are obtained from task demand load, task mental load, and task effect on system performance. The computation of DofA is demonstrated using an experimental system. Based on controlled experiments using operators, analyses of the task effect on system performance, the prediction and assessment of task demand load, and the prediction of mental load were performed. Each experiment had a different DofA. The effect of a change in DofA on system performance and mental load was investigated. It was found that system performance became less sensitive to changes in DofA at higher levels of DofA. The experimental data showed that when the operator controlled a partly automated system, perceived mental load could be predicted from the task mental load for each task component, as calculated by analyzing a situation in which all tasks were manually controlled. Actual or potential applications of this research include a methodology to balance and optimize the automation of complex industrial systems.

  13. Free tropospheric observations of Carbonyl Sulfide from Aura Tropospheric Emission Spectrometer over ocean

    NASA Astrophysics Data System (ADS)

    Kuai, Le; Worden, John; Campbell, Ellitt; Kulawik, Susan; Montzka, Stephen; Liu, Jiabin

    2014-05-01

    Carbonyl sulfide (OCS) is the most abundant sulfur gas in the troposphere with a global averaging mixing ratio of about 500 part per trillion (ppt). The ocean is the primary source of OCS, emitting OCS directly or its precursors, carbon disulfide and dimethyl sulfide. The most important atmospheric sink of OCS is uptake by terrestrial plants via photosynthesis. Although the global budget of atmospheric OCS has been studied, the global integrated OCS fluxes have large uncertainties, e.g. the uncertainties of the ocean fluxes are as large as 100% or more and how the ocean sources are distributed is not well known. We developed a retrieval algorithm for free tropospheric carbonyl sulfide (OCS) observations above the ocean using radiance measurements from the Tropospheric Emission Spectrometer (TES). These first observations of the free tropospheric OCS provide global maps with information of OCS seasonal and spatial variability in the mid troposphere. These data will help to characterize ocean OCS fluxes. Evaluation of the biases and uncertainties in the TES OCS estimates against aircraft profiles from the HIPPO campaign and ground data from the NOAA Mauna Loa site suggests that the OCS retrievals (1) have less than 1.0 degree of freedom for signals (DOFs), (2) are sensitive in the mid-troposphere with a peak sensitivity typically between 300 to 500 hPa, (3) and have much smaller systematic errors from temperature, CO2 and H2O calibrations relative to random errors from measurement noise. Here we estimate the monthly means from TES measurements averaged over multiple years so that random errors are reduced and useful information about OCS seasonal and latitudinal variability can be derived. With this averaging, TES OCS data are found to be consistent (within the calculated uncertainties) with NOAA ground observations and HIPPO aircraft measurements and captures the seasonal and latitudinal variations observed by these in situ data within the estimated uncertainties

  14. Use of probabilistic weights to enhance linear regression myoelectric control

    NASA Astrophysics Data System (ADS)

    Smith, Lauren H.; Kuiken, Todd A.; Hargrove, Levi J.

    2015-12-01

    Objective. Clinically available prostheses for transradial amputees do not allow simultaneous myoelectric control of degrees of freedom (DOFs). Linear regression methods can provide simultaneous myoelectric control, but frequently also result in difficulty with isolating individual DOFs when desired. This study evaluated the potential of using probabilistic estimates of categories of gross prosthesis movement, which are commonly used in classification-based myoelectric control, to enhance linear regression myoelectric control. Approach. Gaussian models were fit to electromyogram (EMG) feature distributions for three movement classes at each DOF (no movement, or movement in either direction) and used to weight the output of linear regression models by the probability that the user intended the movement. Eight able-bodied and two transradial amputee subjects worked in a virtual Fitts’ law task to evaluate differences in controllability between linear regression and probability-weighted regression for an intramuscular EMG-based three-DOF wrist and hand system. Main results. Real-time and offline analyses in able-bodied subjects demonstrated that probability weighting improved performance during single-DOF tasks (p < 0.05) by preventing extraneous movement at additional DOFs. Similar results were seen in experiments with two transradial amputees. Though goodness-of-fit evaluations suggested that the EMG feature distributions showed some deviations from the Gaussian, equal-covariance assumptions used in this experiment, the assumptions were sufficiently met to provide improved performance compared to linear regression control. Significance. Use of probability weights can improve the ability to isolate individual during linear regression myoelectric control, while maintaining the ability to simultaneously control multiple DOFs.

  15. Contributions of different degrees of freedom to thermal transport in the C60 molecular crystal

    NASA Astrophysics Data System (ADS)

    Kumar, Sushant; Shao, Cheng; Lu, Simon; McGaughey, Alan J. H.

    2018-03-01

    Three models of the C60 molecular crystal are studied using molecular dynamics simulations to resolve the roles played by intermolecular and intramolecular degrees of freedom (DOF) in its structural, mechanical, and thermal properties at temperatures between 35 and 400 K. In the full DOF model, all DOF are active. In the rigid body model, the intramolecular DOF are frozen, such that only center of mass (COM) translations and molecular rotations/librations are active. In the point mass model, the molecule is replaced by a point mass, such that only COM translations are active. The zero-pressure lattice constants and bulk moduli predicted from the three models fall within ranges of 0.15 and 20%. The thermal conductivity of the point mass model is the largest across the temperature range, showing a crystal-like temperature dependence (i.e., it decreases with increasing temperature) due to the presence of phonon modes associated with the COM translations. The rigid body model thermal conductivity is the smallest and follows two distinct regimes. It is crystal-like at low temperatures and becomes temperature invariant at high temperatures. The latter is typical of the behavior of an amorphous material. By calculating the rotational diffusion coefficient, the transition between the two regimes is found to occur at the temperature where the molecules begin to rotate freely. Above this temperature, phonons related to COM translations are scattered by the rotational DOF. The full DOF model thermal conductivity is larger than that of the rigid body model, indicating that intramolecular DOF contribute to thermal transport.

  16. Characteristics of energy exchange between inter- and intramolecular degrees of freedom in crystalline 1,3,5-triamino-2,4,6-trinitrobenzene (TATB) with implications for coarse-grained simulations of shock waves in polyatomic molecular crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kroonblawd, Matthew P.; Sewell, Thomas D., E-mail: sewellt@missouri.edu; Maillet, Jean-Bernard, E-mail: jean-bernard.maillet@cea.fr

    2016-02-14

    In this report, we characterize the kinetics and dynamics of energy exchange between intramolecular and intermolecular degrees of freedom (DoF) in crystalline 1,3,5-triamino-2,4,6-trinitrobenzene (TATB). All-atom molecular dynamics (MD) simulations are used to obtain predictions for relaxation from certain limiting initial distributions of energy between the intra- and intermolecular DoF. The results are used to parameterize a coarse-grained Dissipative Particle Dynamics at constant Energy (DPDE) model for TATB. Each TATB molecule in the DPDE model is represented as an all-atom, rigid-molecule mesoparticle, with explicit external (molecular translational and rotational) DoF and coarse-grained implicit internal (vibrational) DoF. In addition to conserving linearmore » and angular momentum, the DPDE equations of motion conserve the total system energy provided that particles can exchange energy between their external and internal DoF. The internal temperature of a TATB molecule is calculated using an internal equation of state, which we develop here, and the temperatures of the external and internal DoF are coupled using a fluctuation-dissipation relation. The DPDE force expression requires specification of the input parameter σ that determines the rate at which energy is exchanged between external and internal DoF. We adjusted σ based on the predictions for relaxation processes obtained from MD simulations. The parameterized DPDE model was employed in large-scale simulations of shock compression of TATB. We show that the rate of energy exchange governed by σ can significantly influence the transient behavior of the system behind the shock.« less

  17. Real-time simultaneous and proportional myoelectric control using intramuscular EMG

    NASA Astrophysics Data System (ADS)

    Smith, Lauren H.; Kuiken, Todd A.; Hargrove, Levi J.

    2014-12-01

    Objective. Myoelectric prostheses use electromyographic (EMG) signals to control movement of prosthetic joints. Clinically available myoelectric control strategies do not allow simultaneous movement of multiple degrees of freedom (DOFs); however, the use of implantable devices that record intramuscular EMG signals could overcome this constraint. The objective of this study was to evaluate the real-time simultaneous control of three DOFs (wrist rotation, wrist flexion/extension, and hand open/close) using intramuscular EMG. Approach. We evaluated task performance of five able-bodied subjects in a virtual environment using two control strategies with fine-wire EMG: (i) parallel dual-site differential control, which enabled simultaneous control of three DOFs and (ii) pattern recognition control, which required sequential control of DOFs. Main results. Over the course of the experiment, subjects using parallel dual-site control demonstrated increased use of simultaneous control and improved performance in a Fitts’ Law test. By the end of the experiment, performance using parallel dual-site control was significantly better (up to a 25% increase in throughput) than when using sequential pattern recognition control for tasks requiring multiple DOFs. The learning trends with parallel dual-site control suggested that further improvements in performance metrics were possible. Subjects occasionally experienced difficulty in performing isolated single-DOF movements with parallel dual-site control but were able to accomplish related Fitts’ Law tasks with high levels of path efficiency. Significance. These results suggest that intramuscular EMG, used in a parallel dual-site configuration, can provide simultaneous control of a multi-DOF prosthetic wrist and hand and may outperform current methods that enforce sequential control.

  18. Star-forming Filament Models

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Myers, Philip C., E-mail: pmyers@cfa.harvard.edu

    2017-03-20

    New models of star-forming filamentary clouds are presented in order to quantify their properties and to predict their evolution. These 2D axisymmetric models describe filaments that have no core, one low-mass core, and one cluster-forming core. They are based on Plummer-like cylinders and spheroids that are bounded by a constant-density surface of finite extent. In contrast to 1D Plummer-like models, they have specific values of length and mass, they approximate observed column density maps, and their distributions of column density ( N -pdfs) are pole-free. Each model can estimate the star-forming potential of a core-filament system by identifying the zonemore » of gas dense enough to form low-mass stars and by counting the number of enclosed thermal Jeans masses. This analysis suggests that the Musca central filament may be near the start of its star-forming life, with enough dense gas to make its first ∼3 protostars, while the Coronet filament is near the midpoint of its star formation, with enough dense gas to add ∼8 protostars to its ∼20 known stars. In contrast, L43 appears to be near the end of its star-forming life, since it lacks enough dense gas to add any new protostars to the two young stellar objectsalready known.« less

  19. The association between self-perceived proficiency of personal protective equipment and objective performance: An observational study during a bioterrorism simulation drill.

    PubMed

    Fogel, Itay; David, Osant; Balik, Chaya H; Eisenkraft, Arik; Poles, Lion; Shental, Omri; Kassirer, Michael; Brosh-Nissimov, Tal

    2017-11-01

    The recent Ebola virus disease outbreak emphasized the potential misuse of personal protective equipment (PPE) by health care workers (HCWs) during such an event. We aimed to compare self-perceived proficiency of PPE use and objective performance, and identify predictors of low compliance and PPE misuse. An observational study combined with subjective questionnaires were carried out during a bioterror simulation drill. Forty-two observers evaluated performance under PPE. Mistakes were recorded and graded using a structured observational format and were correlated with the subjective questionnaires and with demographic parameters. One hundred seventy-eight HCWs from community clinics and hospitals were included. The mean self-perceived proficiency was high (6.1 out of 7), mean level of comfort was moderate (4.0 out of 7), and mean objective performance was intermediate (9.5 out of 13). There was no correlation between comfort and objective performance scores. Self-perceived proficiency was in correlation with donning and continuous performance with PPE but not with doffing. Clinic personnel performed better than personnel in hospitals (40.3% vs 67.8% with 3 or more mistakes, respectively; P = .001). Demographic characteristics had no correlation with objective or self-perceived performance. Self-perceived proficiency is a poor predictor of appropriate PPE use. The results suggest poor awareness of the possibility of PPE misuse. Copyright © 2017 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  20. Earth Observing System Covariance Realism

    NASA Technical Reports Server (NTRS)

    Zaidi, Waqar H.; Hejduk, Matthew D.

    2016-01-01

    The purpose of covariance realism is to properly size a primary object's covariance in order to add validity to the calculation of the probability of collision. The covariance realism technique in this paper consists of three parts: collection/calculation of definitive state estimates through orbit determination, calculation of covariance realism test statistics at each covariance propagation point, and proper assessment of those test statistics. An empirical cumulative distribution function (ECDF) Goodness-of-Fit (GOF) method is employed to determine if a covariance is properly sized by comparing the empirical distribution of Mahalanobis distance calculations to the hypothesized parent 3-DoF chi-squared distribution. To realistically size a covariance for collision probability calculations, this study uses a state noise compensation algorithm that adds process noise to the definitive epoch covariance to account for uncertainty in the force model. Process noise is added until the GOF tests pass a group significance level threshold. The results of this study indicate that when outliers attributed to persistently high or extreme levels of solar activity are removed, the aforementioned covariance realism compensation method produces a tuned covariance with up to 80 to 90% of the covariance propagation timespan passing (against a 60% minimum passing threshold) the GOF tests-a quite satisfactory and useful result.

  1. Keck Deep Fields. I. Observations, Reductions, and the Selection of Faint Star-forming Galaxies at Redshifts z ~ 4, 3, and 2

    NASA Astrophysics Data System (ADS)

    Sawicki, Marcin; Thompson, David

    2005-12-01

    We introduce a very deep, Rlim~27, multicolor imaging survey of very faint star-forming galaxies at z~4, 3, 2.2, and 1.7. This survey, carried out on the Keck I telescope, uses the very same UnGRI filter system that is employed by the Steidel team to select galaxies at these redshifts and thus allows us to construct identically selected but much fainter samples. However, our survey reaches ~1.5 mag deeper than the work of Steidel and his group, letting us probe substantially below the characteristic luminosity L* and thus study the properties and redshift evolution of the faint component of the high-z galaxy population. The survey covers 169 arcmin2 in three spatially independent patches on the sky and-to R<=27-contains 427 GRI-selected z~4 Lyman break galaxies, 1481 UnGR-selected z~3 Lyman break galaxies, 2417 UnGR-selected z~2.2 star-forming galaxies, and 2043 UnGR-selected z~1.7 star-forming galaxies. In this paper, the first in a series, we introduce the survey, describe our observing and data reduction strategies, and outline the selection of our z~4, 3, 2.2, and 1.7 samples. Based on data obtained at the W. M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and the National Aeronautics and Space Administration. The Observatory was made possible by the generous financial support of the W. M. Keck Foundation.

  2. Distributed Optical Fiber Sensors Based on Optical Frequency Domain Reflectometry: A review.

    PubMed

    Ding, Zhenyang; Wang, Chenhuan; Liu, Kun; Jiang, Junfeng; Yang, Di; Pan, Guanyi; Pu, Zelin; Liu, Tiegen

    2018-04-03

    Distributed optical fiber sensors (DOFS) offer unprecedented features, the most unique one of which is the ability of monitoring variations of the physical and chemical parameters with spatial continuity along the fiber. Among all these distributed sensing techniques, optical frequency domain reflectometry (OFDR) has been given tremendous attention because of its high spatial resolution and large dynamic range. In addition, DOFS based on OFDR have been used to sense many parameters. In this review, we will survey the key technologies for improving sensing range, spatial resolution and sensing performance in DOFS based on OFDR. We also introduce the sensing mechanisms and the applications of DOFS based on OFDR including strain, stress, vibration, temperature, 3D shape, flow, refractive index, magnetic field, radiation, gas and so on.

  3. Verifying genuine high-order entanglement.

    PubMed

    Li, Che-Ming; Chen, Kai; Reingruber, Andreas; Chen, Yueh-Nan; Pan, Jian-Wei

    2010-11-19

    High-order entanglement embedded in multipartite multilevel quantum systems (qudits) with many degrees of freedom (DOFs) plays an important role in quantum foundation and quantum engineering. Verifying high-order entanglement without the restriction of system complexity is a critical need in any experiments on general entanglement. Here, we introduce a scheme to efficiently detect genuine high-order entanglement, such as states close to genuine qudit Bell, Greenberger-Horne-Zeilinger, and cluster states as well as multilevel multi-DOF hyperentanglement. All of them can be identified with two local measurement settings per DOF regardless of the qudit or DOF number. The proposed verifications together with further utilities such as fidelity estimation could pave the way for experiments by reducing dramatically the measurement overhead.

  4. WEAK AND COMPACT RADIO EMISSION IN EARLY HIGH-MASS STAR-FORMING REGIONS. I. VLA OBSERVATIONS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosero, V.; Hofner, P.; Claussen, M.

    2016-12-01

    We present a high-sensitivity radio continuum survey at 6 and 1.3 cm using the Karl G. Jansky Very Large Array toward a sample of 58 high-mass star-forming regions. Our sample was chosen from dust clumps within infrared dark clouds with and without IR sources (CMC–IRs and CMCs, respectively), and hot molecular cores (HMCs), with no previous, or relatively weak radio continuum detection at the 1 mJy level. Due to the improvement in the continuum sensitivity of the Very Large Array, this survey achieved map rms levels of ∼3–10  μ Jy beam{sup −1} at sub-arcsecond angular resolution. We extracted 70 continuum sourcesmore » associated with 1.2 mm dust clumps. Most sources are weak, compact, and prime candidates for high-mass protostars. Detection rates of radio sources associated with the millimeter dust clumps for CMCs, CMC–IRs, and HMCs are 6%, 53%, and 100%, respectively. This result is consistent with increasing high-mass star formation activity from CMCs to HMCs. The radio sources located within HMCs and CMC–IRs occur close to the dust clump centers, with a median offset from it of 12,000 au and 4000 au, respectively. We calculated 5–25 GHz spectral indices using power-law fits and obtained a median value of 0.5 (i.e., flux increasing with frequency), suggestive of thermal emission from ionized jets. In this paper we describe the sample, observations, and detections. The analysis and discussion will be presented in Paper II.« less

  5. The formation of prebiotic molecules in star-forming regions

    NASA Astrophysics Data System (ADS)

    Rivilla, V. M.

    New sensitive observations using the current generation of (sub)millimeter telescopes have revealed in several star-forming regions molecular species of different chemical families (e.g. sugars, esters, isocyanates, phosphorus-bearing species) that may play an important role in prebiotic chemistry, and eventually in the origin of life. The observed molecular abundances of complex organic molecules (glycolaldehyde, ethylene glycol and ethyl formate) are better explained by surface-phase chemistry on dust grains, although gas-phase reactions can also play an important role, as in the case of methyl isocyanate. The PO molecule - a basic chemical bond to build-up the backbone of the DNA - has been detected for the first time in star-forming regions. These new observations indicate that phosphorus, a key element for the development of life, is much more abundant in star-forming regions than previously thought.

  6. Predicting tibiotalar and subtalar joint angles from skin-marker data with dual-fluoroscopy as a reference standard.

    PubMed

    Nichols, Jennifer A; Roach, Koren E; Fiorentino, Niccolo M; Anderson, Andrew E

    2016-09-01

    Evidence suggests that the tibiotalar and subtalar joints provide near six degree-of-freedom (DOF) motion. Yet, kinematic models frequently assume one DOF at each of these joints. In this study, we quantified the accuracy of kinematic models to predict joint angles at the tibiotalar and subtalar joints from skin-marker data. Models included 1 or 3 DOF at each joint. Ten asymptomatic subjects, screened for deformities, performed 1.0m/s treadmill walking and a balanced, single-leg heel-rise. Tibiotalar and subtalar joint angles calculated by inverse kinematics for the 1 and 3 DOF models were compared to those measured directly in vivo using dual-fluoroscopy. Results demonstrated that, for each activity, the average error in tibiotalar joint angles predicted by the 1 DOF model were significantly smaller than those predicted by the 3 DOF model for inversion/eversion and internal/external rotation. In contrast, neither model consistently demonstrated smaller errors when predicting subtalar joint angles. Additionally, neither model could accurately predict discrete angles for the tibiotalar and subtalar joints on a per-subject basis. Differences between model predictions and dual-fluoroscopy measurements were highly variable across subjects, with joint angle errors in at least one rotation direction surpassing 10° for 9 out of 10 subjects. Our results suggest that both the 1 and 3 DOF models can predict trends in tibiotalar joint angles on a limited basis. However, as currently implemented, neither model can predict discrete tibiotalar or subtalar joint angles for individual subjects. Inclusion of subject-specific attributes may improve the accuracy of these models. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Real-time simultaneous and proportional myoelectric control using intramuscular EMG

    PubMed Central

    Kuiken, Todd A; Hargrove, Levi J

    2014-01-01

    Objective Myoelectric prostheses use electromyographic (EMG) signals to control movement of prosthetic joints. Clinically available myoelectric control strategies do not allow simultaneous movement of multiple degrees of freedom (DOFs); however, the use of implantable devices that record intramuscular EMG signals could overcome this constraint. The objective of this study was to evaluate the real-time simultaneous control of three DOFs (wrist rotation, wrist flexion/extension, and hand open/close) using intramuscular EMG. Approach We evaluated task performance of five able-bodied subjects in a virtual environment using two control strategies with fine-wire EMG: (i) parallel dual-site differential control, which enabled simultaneous control of three DOFs and (ii) pattern recognition control, which required sequential control of DOFs. Main Results Over the course of the experiment, subjects using parallel dual-site control demonstrated increased use of simultaneous control and improved performance in a Fitts' Law test. By the end of the experiment, performance using parallel dual-site control was significantly better (up to a 25% increase in throughput) than when using sequential pattern recognition control for tasks requiring multiple DOFs. The learning trends with parallel dual-site control suggested that further improvements in performance metrics were possible. Subjects occasionally experienced difficulty in performing isolated single-DOF movements with parallel dual-site control but were able to accomplish related Fitts' Law tasks with high levels of path efficiency. Significance These results suggest that intramuscular EMG, used in a parallel dual-site configuration, can provide simultaneous control of a multi-DOF prosthetic wrist and hand and may outperform current methods that enforce sequential control. PMID:25394366

  8. Kinematic Analysis of a Six-Degrees-of-Freedom Model Based on ISB Recommendation: A Repeatability Analysis and Comparison with Conventional Gait Model.

    PubMed

    Żuk, Magdalena; Pezowicz, Celina

    2015-01-01

    Objective. The purpose of the present work was to assess the validity of a six-degrees-of-freedom gait analysis model based on the ISB recommendation on definitions of joint coordinate systems (ISB 6DOF) through a quantitative comparison with the Helen Hays model (HH) and repeatability assessment. Methods. Four healthy subjects were analysed with both marker sets: an HH marker set and four marker clusters in ISB 6DOF. A navigated pointer was used to indicate the anatomical landmark position in the cluster reference system according to the ISB recommendation. Three gait cycles were selected from the data collected simultaneously for the two marker sets. Results. Two protocols showed good intertrial repeatability, which apart from pelvic rotation did not exceed 2°. The greatest differences between protocols were observed in the transverse plane as well as for knee angles. Knee internal/external rotation revealed the lowest subject-to-subject and interprotocol repeatability and inconsistent patterns for both protocols. Knee range of movement in transverse plane was overestimated for the HH set (the mean is 34°), which could indicate the cross-talk effect. Conclusions. The ISB 6DOF anatomically based protocol enabled full 3D kinematic description of joints according to the current standard with clinically acceptable intertrial repeatability and minimal equipment requirements.

  9. Distance-to-Agreement Investigation of Tomotherapy's Bony Anatomy-Based Autoregistration and Planning Target Volume Contour-Based Optimization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Suh, Steve, E-mail: ssuh@coh.org; Schultheiss, Timothy E.

    Purpose: To compare Tomotherapy's megavoltage computed tomography bony anatomy autoregistration with the best achievable registration, assuming no deformation and perfect knowledge of planning target volume (PTV) location. Methods and Materials: Distance-to-agreement (DTA) of the PTV was determined by applying a rigid-body shift to the PTV region of interest of the prostate from its reference position, assuming no deformations. Planning target volume region of interest of the prostate was extracted from the patient archives. The reference position was set by the 6 degrees of freedom (dof)—x, y, z, roll, pitch, and yaw—optimization results from the previous study at this institution. Themore » DTA and the compensating parameters were calculated by the shift of the PTV from the reference 6-dof to the 4-dof—x, y, z, and roll—optimization. In this study, the effectiveness of Tomotherapy's 4-dof bony anatomy–based autoregistration was compared with the idealized 4-dof PTV contour-based optimization. Results: The maximum DTA (maxDTA) of the bony anatomy-based autoregistration was 3.2 ± 1.9 mm, with the maximum value of 8.0 mm. The maxDTA of the contour-based optimization was 1.8 ± 1.3 mm, with the maximum value of 5.7 mm. Comparison of Pearson correlation of the compensating parameters between the 2 4-dof optimization algorithms shows that there is a small but statistically significant correlation in y and z (0.236 and 0.300, respectively), whereas there is very weak correlation in x and roll (0.062 and 0.025, respectively). Conclusions: We find that there is an average improvement of approximately 1 mm in terms of maxDTA on the PTV going from 4-dof bony anatomy-based autoregistration to the 4-dof contour-based optimization. Pearson correlation analysis of the 2 4-dof optimizations suggests that uncertainties due to deformation and inadequate resolution account for much of the compensating parameters, but pitch variation also makes a statistically

  10. CTEPP STANDARD OPERATING PROCEDURE FOR RECORDING DATA COLLECTION FORMS (SOP-2.22)

    EPA Science Inventory

    This SOP describes the method for recording information onto the data collection forms. The data collection forms are organized into 10 modules: Recruitment Survey; House/Building Characteristics Observation Survey; Day Care Center/Building Characteristics Observation Survey; Par...

  11. Direct and Inverse Kinematics of a Novel Tip-Tilt-Piston Parallel Manipulator

    NASA Technical Reports Server (NTRS)

    Tahmasebi, Farhad

    2004-01-01

    Closed-form direct and inverse kinematics of a new three degree-of-freedom (DOF) parallel manipulator with inextensible limbs and base-mounted actuators are presented. The manipulator has higher resolution and precision than the existing three DOF mechanisms with extensible limbs. Since all of the manipulator actuators are base-mounted; higher payload capacity, smaller actuator sizes, and lower power dissipation can be obtained. The manipulator is suitable for alignment applications where only tip, tilt, and piston motions are significant. The direct kinematics of the manipulator is reduced to solving an eighth-degree polynomial in the square of tangent of half-angle between one of the limbs and the base plane. Hence, there are at most 16 assembly configurations for the manipulator. In addition, it is shown that the 16 solutions are eight pairs of reflected configurations with respect to the base plane. Numerical examples for the direct and inverse kinematics of the manipulator are also presented.

  12. Kinematics of a New High Precision Three Degree-of-Freedom Parallel Manipulator

    NASA Technical Reports Server (NTRS)

    Tahmasebi, Farhad

    2005-01-01

    Closed-form direct and inverse kinematics of a new three degree-of-freedom (DOF) parallel manipulator with inextensible limbs and base-mounted actuators are presented. The manipulator has higher resolution and precision than the existing three DOF mechanisms with extensible limbs. Since all of the manipulator actuators are base-mounted; higher payload capacity, smaller actuator sizes, and lower power dissipation can be obtained. The manipulator is suitable for alignment applications where only tip, tilt, and piston motions are significant. The direct kinematics of the manipulator is reduced to solving an eighth-degree polynomial in the square of tangent of half-angle between one of the limbs and the base plane. Hence, there are at most sixteen assembly configurations for the manipulator. In addition, it is shown that the sixteen solutions are eight pairs of reflected configurations with respect to the base plane. Numerical examples for the direct and inverse kinematics of the manipulator are also presented.

  13. Exact analytical approach for six-degree-of-freedom measurement using image-orientation-change method.

    PubMed

    Tsai, Chung-Yu

    2012-04-01

    An exact analytical approach is proposed for measuring the six-degree-of-freedom (6-DOF) motion of an object using the image-orientation-change (IOC) method. The proposed measurement system comprises two reflector systems, where each system consists of two reflectors and one position sensing detector (PSD). The IOCs of the object in the two reflector systems are described using merit functions determined from the respective PSD readings before and after motion occurs, respectively. The three rotation variables are then determined analytically from the eigenvectors of the corresponding merit functions. After determining the three rotation variables, the order of the translation equations is downgraded to a linear form. Consequently, the solution for the three translation variables can also be analytically determined. As a result, the motion transformation matrix describing the 6-DOF motion of the object is fully determined. The validity of the proposed approach is demonstrated by means of an illustrative example.

  14. Low-Cost Nested-MIMO Array for Large-Scale Wireless Sensor Applications.

    PubMed

    Zhang, Duo; Wu, Wen; Fang, Dagang; Wang, Wenqin; Cui, Can

    2017-05-12

    In modern communication and radar applications, large-scale sensor arrays have increasingly been used to improve the performance of a system. However, the hardware cost and circuit power consumption scale linearly with the number of sensors, which makes the whole system expensive and power-hungry. This paper presents a low-cost nested multiple-input multiple-output (MIMO) array, which is capable of providing O ( 2 N 2 ) degrees of freedom (DOF) with O ( N ) physical sensors. The sensor locations of the proposed array have closed-form expressions. Thus, the aperture size and number of DOF can be predicted as a function of the total number of sensors. Additionally, with the help of time-sequence-phase-weighting (TSPW) technology, only one receiver channel is required for sampling the signals received by all of the sensors, which is conducive to reducing the hardware cost and power consumption. Numerical simulation results demonstrate the effectiveness and superiority of the proposed array.

  15. Low-Cost Nested-MIMO Array for Large-Scale Wireless Sensor Applications

    PubMed Central

    Zhang, Duo; Wu, Wen; Fang, Dagang; Wang, Wenqin; Cui, Can

    2017-01-01

    In modern communication and radar applications, large-scale sensor arrays have increasingly been used to improve the performance of a system. However, the hardware cost and circuit power consumption scale linearly with the number of sensors, which makes the whole system expensive and power-hungry. This paper presents a low-cost nested multiple-input multiple-output (MIMO) array, which is capable of providing O(2N2) degrees of freedom (DOF) with O(N) physical sensors. The sensor locations of the proposed array have closed-form expressions. Thus, the aperture size and number of DOF can be predicted as a function of the total number of sensors. Additionally, with the help of time-sequence-phase-weighting (TSPW) technology, only one receiver channel is required for sampling the signals received by all of the sensors, which is conducive to reducing the hardware cost and power consumption. Numerical simulation results demonstrate the effectiveness and superiority of the proposed array. PMID:28498329

  16. Forming Facial Expressions Influences Assessment of Others' Dominance but Not Trustworthiness.

    PubMed

    Ueda, Yoshiyuki; Nagoya, Kie; Yoshikawa, Sakiko; Nomura, Michio

    2017-01-01

    Forming specific facial expressions influences emotions and perception. Bearing this in mind, studies should be reconsidered in which observers expressing neutral emotions inferred personal traits from the facial expressions of others. In the present study, participants were asked to make happy, neutral, and disgusted facial expressions: for "happy," they held a wooden chopstick in their molars to form a smile; for "neutral," they clasped the chopstick between their lips, making no expression; for "disgusted," they put the chopstick between their upper lip and nose and knit their brows in a scowl. However, they were not asked to intentionally change their emotional state. Observers judged happy expression images as more trustworthy, competent, warm, friendly, and distinctive than disgusted expression images, regardless of the observers' own facial expression. Observers judged disgusted expression images as more dominant than happy expression images. However, observers expressing disgust overestimated dominance in observed disgusted expression images and underestimated dominance in happy expression images. In contrast, observers with happy facial forms attenuated dominance for disgusted expression images. These results suggest that dominance inferred from facial expressions is unstable and influenced by not only the observed facial expression, but also the observers' own physiological states.

  17. Distributed Optical Fiber Sensors Based on Optical Frequency Domain Reflectometry: A review

    PubMed Central

    Wang, Chenhuan; Liu, Kun; Jiang, Junfeng; Yang, Di; Pan, Guanyi; Pu, Zelin; Liu, Tiegen

    2018-01-01

    Distributed optical fiber sensors (DOFS) offer unprecedented features, the most unique one of which is the ability of monitoring variations of the physical and chemical parameters with spatial continuity along the fiber. Among all these distributed sensing techniques, optical frequency domain reflectometry (OFDR) has been given tremendous attention because of its high spatial resolution and large dynamic range. In addition, DOFS based on OFDR have been used to sense many parameters. In this review, we will survey the key technologies for improving sensing range, spatial resolution and sensing performance in DOFS based on OFDR. We also introduce the sensing mechanisms and the applications of DOFS based on OFDR including strain, stress, vibration, temperature, 3D shape, flow, refractive index, magnetic field, radiation, gas and so on. PMID:29614024

  18. The 2 Degrees of Freedom facility in Firenze for the study of weak forces

    NASA Astrophysics Data System (ADS)

    Marconi, L.; Stanga, R.; Lorenzini, M.; Grimani, C.; Bassan, M.; Pucacco, G.; Di Fiore, L.; De Rosa, R.; Garufi, F.; Milano, L.

    2010-05-01

    The LISA test-mass (TM) is sensitive to weak forces along all 6 Degrees of Freedom (DoFs). Extensi ve ground test ing is required in order to evaluate the influence of cross-talks of read-outs and actuators operating on different DoFs. To best represent the flight conditions, we developed in Firenze a facility with 2 soft DoFs. Using this facility we measure the forces and stiffnesses acting simultaneously along the 2 soft DoFs, and, more specifically, we will be able to de b ug residual couplings between the TM and the capacitive position sensor that reads the TM position, and to measure actuation cross talks with closed feedback loop. The facility is now ready, and here we report on the co mmi ssioning test s, and on the first measurements.

  19. Further X-Ray Observations of EXO 0748-676 in Quiescence: Evidence for a Cooling Neutron Star Crust

    DTIC Science & Technology

    2010-07-01

    Satellite Date ∆t Pow. frac. kT∞eff FX F th bol Lbol Red. χ 2 (days) (%) (eV) (d.o.f.) Swift† 2008-09-28 – 2008-10-07 4.9 10 fix 123.7± 5.4 1.31± 0.22 1.53...fixed. The quoted errors represent 90% confidence levels. FX represents the 0.5–10 keV total model flux and F thbol gives the 0.01–100 keV NSATMOS...Miller J. M., Wijnands R., 2010, submitted to ApJ Campana S., 2003, preprint ( astro -ph/0311212) Campana S., Colpi M., Mereghetti S., Stella L

  20. Development and construct validity of the Classroom Strategies Scale-Observer Form.

    PubMed

    Reddy, Linda A; Fabiano, Gregory; Dudek, Christopher M; Hsu, Louis

    2013-12-01

    Research on progress monitoring has almost exclusively focused on student behavior and not on teacher practices. This article presents the development and validation of a new teacher observational assessment (Classroom Strategies Scale) of classroom instructional and behavioral management practices. The theoretical underpinnings and empirical basis for the instructional and behavioral management scales are presented. The Classroom Strategies Scale (CSS) evidenced overall good reliability estimates including internal consistency, interrater reliability, test-retest reliability, and freedom from item bias on important teacher demographics (age, educational degree, years of teaching experience). Confirmatory factor analyses (CFAs) of CSS data from 317 classrooms were carried out to assess the level of empirical support for (a) a 4 first-order factor theory concerning teachers' instructional practices, and (b) a 4 first-order factor theory concerning teachers' behavior management practice. Several fit indices indicated acceptable fit of the (a) and (b) CFA models to the data, as well as acceptable fit of less parsimonious alternative CFA models that included 1 or 2 second-order factors. Information-theory-based indices generally suggested that the (a) and (b) CFA models fit better than some more parsimonious alternative CFA models that included constraints on relations of first-order factors. Overall, CFA first-order and higher order factor results support the CSS-Observer Total, Composite, and subscales. Suggestions for future measurement development efforts are outlined. PsycINFO Database Record (c) 2013 APA, all rights reserved.

  1. Built-in hyperspectral camera for smartphone in visible, near-infrared and middle-infrared lights region (third report): spectroscopic imaging for broad-area and real-time componential analysis system against local unexpected terrorism and disasters

    NASA Astrophysics Data System (ADS)

    Hosono, Satsuki; Kawashima, Natsumi; Wollherr, Dirk; Ishimaru, Ichiro

    2016-05-01

    The distributed networks for information collection of chemical components with high-mobility objects, such as drones or smartphones, will work effectively for investigations, clarifications and predictions against unexpected local terrorisms and disasters like localized torrential downpours. We proposed and reported the proposed spectroscopic line-imager for smartphones in this conference. In this paper, we will mention the wide-area spectroscopic-image construction by estimating 6 DOF (Degrees Of Freedom: parallel movements=x,y,z and rotational movements=θx, θy, θz) from line data to observe and analyze surrounding chemical-environments. Recently, smartphone movies, what were photographed by peoples happened to be there, had worked effectively to analyze what kinds of phenomenon had happened around there. But when a gas tank suddenly blew up, we did not recognize from visible-light RGB-color cameras what kinds of chemical gas components were polluting surrounding atmospheres. Conventionally Fourier spectroscopy had been well known as chemical components analysis in laboratory usages. But volatile gases should be analyzed promptly at accident sites. And because the humidity absorption in near and middle infrared lights has very high sensitivity, we will be able to detect humidity in the sky from wide field spectroscopic image. And also recently, 6-DOF sensors are easily utilized for estimation of position and attitude for UAV (Unmanned Air Vehicle) or smartphone. But for observing long-distance views, accuracies of angle measurements were not sufficient to merge line data because of leverage theory. Thus, by searching corresponding pixels between line spectroscopic images, we are trying to estimate 6-DOF in high accuracy.

  2. The neural basis of form and form-motion integration from static and dynamic translational Glass patterns: A rTMS investigation.

    PubMed

    Pavan, Andrea; Ghin, Filippo; Donato, Rita; Campana, Gianluca; Mather, George

    2017-08-15

    A long-held view of the visual system is that form and motion are independently analysed. However, there is physiological and psychophysical evidence of early interaction in the processing of form and motion. In this study, we used a combination of Glass patterns (GPs) and repetitive Transcranial Magnetic Stimulation (rTMS) to investigate in human observers the neural mechanisms underlying form-motion integration. GPs consist of randomly distributed dot pairs (dipoles) that induce the percept of an oriented stimulus. GPs can be either static or dynamic. Dynamic GPs have both a form component (i.e., orientation) and a non-directional motion component along the orientation axis. GPs were presented in two temporal intervals and observers were asked to discriminate the temporal interval containing the most coherent GP. rTMS was delivered over early visual area (V1/V2) and over area V5/MT shortly after the presentation of the GP in each interval. The results showed that rTMS applied over early visual areas affected the perception of static GPs, but the stimulation of area V5/MT did not affect observers' performance. On the other hand, rTMS was delivered over either V1/V2 or V5/MT strongly impaired the perception of dynamic GPs. These results suggest that early visual areas seem to be involved in the processing of the spatial structure of GPs, and interfering with the extraction of the global spatial structure also affects the extraction of the motion component, possibly interfering with early form-motion integration. However, visual area V5/MT is likely to be involved only in the processing of the motion component of dynamic GPs. These results suggest that motion and form cues may interact as early as V1/V2. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Early Formed Astrophysical Objects and Cosmological Antimatter

    NASA Astrophysics Data System (ADS)

    Dolgov, Alexander D.

    Astronomical observations of recent years show that the universe at high redshifts (about ten) is densely populated by early formed objects: bright galaxies, quasars, gamma-bursters, and it contains a lot of metals and dust. Such a rich variety of early formed objects have not been expected in the standard model of formation of astrophysical objects. There is serious tension between the standard theory and the observations. We describe the model which relaxes this tension and nicely fits the data. The model naturally leads to the creation of cosmologically significant antimatter which may be abundant even in the Galaxy. Phenomenological consequences of our scenario and the possibility of distant registration of antimatter are discussed.

  4. Early formed astrophysical objects and cosmological antimatter

    NASA Astrophysics Data System (ADS)

    Dolgov, Alexander D.

    2016-10-01

    Astronomical observations of recent years show that the universe at high redshifts (about ten) is densely populated by early formed objects: bright galaxies, quasars, gamma-bursters, and it contains a lot of metals and dust. Such a rich variety of early formed objects have not been expected in the standard model of formation of astrophysical objects. There is serious tension between the standard theory and the observations. We describe the model which relaxes this tension and nicely fits the data. The model naturally leads to the creation of cosmologically significant antimatter which may be abundant even in the Galaxy. Phenomenological consequences of our scenario and the possibility of distant registration of antimatter are discussed.

  5. Forms, Forms and More Forms. Book Seven. Project Drive.

    ERIC Educational Resources Information Center

    Zook, Doris; And Others

    This Project Drive booklet titled Forms, Forms, and More Forms is one of eight booklets designed for intermediate-level English-as-a-second-language students and low-level adult basic education/basic reading students. The goal of the booklet is to aid the student in developing the oral and sight vocabulary necessary for a basic driver training…

  6. Radio continuum observations of local star-forming galaxies using the Caltech Continuum Backend on the green bank telescope

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rabidoux, Katie; Pisano, D. J.; Kepley, Amanda A.

    2014-01-01

    We observed radio continuum emission in 27 local (D < 70 Mpc) star-forming galaxies with the Robert C. Byrd Green Bank Telescope between 26 GHz and 40 GHz using the Caltech Continuum Backend. We obtained detections for 22 of these galaxies at all four sub-bands and four more marginal detections by taking the average flux across the entire bandwidth. This is the first detection (full or marginal) at these frequencies for 22 of these galaxies. We fit spectral energy distributions (SEDs) for all of the four sub-band detections. For 14 of the galaxies, SEDs were best fit by a combinationmore » of thermal free-free and nonthermal synchrotron components. Eight galaxies with four sub-band detections had steep spectra that were only fit by a single nonthermal component. Using these fits, we calculated supernova rates, total number of equivalent O stars, and star formation rates within each ∼23'' beam. For unresolved galaxies, these physical properties characterize the galaxies' recent star formation on a global scale. We confirm that the radio-far-infrared correlation holds for the unresolved galaxies' total 33 GHz flux regardless of their thermal fractions, though the scatter on this correlation is larger than that at 1.4 GHz. In addition, we found that for the unresolved galaxies, there is an inverse relationship between the ratio of 33 GHz flux to total far-infrared flux and the steepness of the galaxy's spectral index between 1.4 GHz and 33 GHz. This relationship could be an indicator of the timescale of the observed episode of star formation.« less

  7. The NUHM2 after LHC Run 1

    DOE PAGES

    Buchmueller, O.; Cavanaugh, R.; Citron, M.; ...

    2014-12-17

    We make a frequentist analysis of the parameter space of the NUHM2, in which the soft supersymmetry (SUSY)-breaking contributions to the masses of the two Higgs multiplets, m 2 Hu,d, vary independently from the universal soft SUSY-breaking contributions m 2 0 to the masses of squarks and sleptons. Our analysis uses the MultiNest sampling algorithm with over 4 × 10⁸ points to sample the NUHM2 parameter space. It includes the ATLAS and CMS Higgs mass measurements as well as the ATLAS search for supersymmetric jets + /E T signals using the full LHC Run 1 data, the measurements of BR(Bmore » s→μ⁺μ⁻) by LHCb and CMS together with other B-physics observables, electroweak precision observables and the XENON100 and LUX searches for spin-independent dark-matter scattering. We find that the preferred regions of the NUHM2 parameter space have negative SUSY-breaking scalar masses squared at the GUT scale for squarks and sleptons, m 2 0 < 0, as well as m 2 Hu < m 2 Hd < 0. The tension present in the CMSSM and NUHM1 between the supersymmetric interpretation of (g – 2)μ and the absence to date of SUSY at the LHC is not significantly alleviated in the NUHM2. We find that the minimum χ 2 = 32.5 with 21 degrees of freedom (dof) in the NUHM2, to be compared with χ 2/dof = 35.0/23 in the CMSSM, and χ 2/dof = 32.7/22 in the NUHM1. We find that the one-dimensional likelihood functions for sparticle masses and other observables are similar to those found previously in the CMSSM and NUHM1.« less

  8. Development of a Rotary Wing Unmanned Aerial Vehicle (UAV) Simulation Model

    DTIC Science & Technology

    2014-03-01

    Features Language URL Autopilot: DIY UAV - 2 DOF proportional controller - Kalman filtering C http://autopilot.sour ceforge.net Paperazzi - 3 DOF...proprtional controller - Basic navigation OCaml http://paparazzi.ena c.fr JSBSim - Basic control system blockset - Sample autopilot

  9. Developing a multi-joint upper limb exoskeleton robot for diagnosis, therapy, and outcome evaluation in neurorehabilitation.

    PubMed

    Ren, Yupeng; Kang, Sang Hoon; Park, Hyung-Soon; Wu, Yi-Ning; Zhang, Li-Qun

    2013-05-01

    Arm impairments in patients post stroke involve the shoulder, elbow and wrist simultaneously. It is not very clear how patients develop spasticity and reduced range of motion (ROM) at the multiple joints and the abnormal couplings among the multiple joints and the multiple degrees-of-freedom (DOF) during passive movement. It is also not clear how they lose independent control of individual joints/DOFs and coordination among the joints/DOFs during voluntary movement. An upper limb exoskeleton robot, the IntelliArm, which can control the shoulder, elbow, and wrist, was developed, aiming to support clinicians and patients with the following integrated capabilities: 1) quantitative, objective, and comprehensive multi-joint neuromechanical pre-evaluation capabilities aiding multi-joint/DOF diagnosis for individual patients; 2) strenuous and safe passive stretching of hypertonic/deformed arm for loosening up muscles/joints based on the robot-aided diagnosis; 3) (assistive/resistive) active reaching training after passive stretching for regaining/improving motor control ability; and 4) quantitative, objective, and comprehensive neuromechanical outcome evaluation at the level of individual joints/DOFs, multiple joints, and whole arm. Feasibility of the integrated capabilities was demonstrated through experiments with stroke survivors and healthy subjects.

  10. TALARIS project update: Overview of flight testing and development of a prototype planetary surface exploration hopper

    NASA Astrophysics Data System (ADS)

    Rossi, Christopher; Cunio, Phillip M.; Alibay, Farah; Morrow, Joe; Nothnagel, Sarah L.; Steiner, Ted; Han, Christopher J.; Lanford, Ephraim; Hoffman, Jeffrey A.

    2012-12-01

    The TALARIS (Terrestrial Artificial Lunar And Reduced GravIty Simulator) project is intended to test GNC (Guidance, Navigation, and Control) algorithms on a prototype planetary surface exploration hopper in a dynamic environment with simulated reduced gravity. The vehicle is being developed by the Charles Stark Draper Laboratory and Massachusetts Institute of Technology in support of efforts in the Google Lunar X-Prize contest. This paper presents progress achieved since September 2010 in vehicle development and flight testing. Upgrades to the vehicle are described, including a redesign of the power train for the gravity-offset propulsion system and a redesign of key elements of the spacecraft emulator propulsion system. The integration of flight algorithms into modular flight software is also discussed. Results are reported for restricted degree of freedom (DOF) tests used to tune GNC algorithms on the path to a full 6-DOF hover-hop flight profile. These tests include 3-DOF tests on flat surfaces restricted to horizontal motion, and 2-DOF vertical tests restricted to vertical motion and 1-DOF attitude control. The results of tests leading up to full flight operations are described, as are lessons learned and future test plans.

  11. Robot-assisted microsurgical forceps with haptic feedback for transoral laser microsurgery.

    PubMed

    Deshpande, Nikhil; Chauhan, Manish; Pacchierotti, Claudio; Prattichizzo, Domenico; Caldwell, Darwin G; Mattos, Leonardo S

    2016-08-01

    In this paper, a novel, motorized, multi-degrees-of-freedom (DoF), microsurgical forceps tool is presented, which is based on a master-slave teleoperation architecture. The slave device is a 7-DoF manipulator with: (i) 6-DoF positioning and orientation, (ii) 1 open/close gripper DoF; and (iii) an integrated force/torque sensor for tissue grip-force measurement. The master device is a 7-DoF haptic interface which teleoperates the slave device, and provides haptic feedback in its gripper interface. The combination of the device and the surgeon interface replaces the manual, hand-held device providing easy-to-use and ergonomic tissue control, simplifying the surgical tasks. This makes the system suitable to real surgical scenarios in the operating room (OR). The performance of the system was analysed through the evaluation of teleoperation control and characterization of gripping force. The new system offers an overall positioning error of less than 400 μm demonstrating its safety and accuracy. Improved system precision, usability, and ergonomics point to the potential suitability of the device for the OR and its ability to advance haptic-feedback-enhanced transoral laser microsurgeries.

  12. The first ANDES elements: 9-DOF plate bending triangles

    NASA Technical Reports Server (NTRS)

    Militello, Carmelo; Felippa, Carlos A.

    1991-01-01

    New elements are derived to validate and assess the assumed natural deviatoric strain (ANDES) formulation. This is a brand new variant of the assumed natural strain (ANS) formulation of finite elements, which has recently attracted attention as an effective method for constructing high-performance elements for linear and nonlinear analysis. The ANDES formulation is based on an extended parametrized variational principle developed in recent publications. The key concept is that only the deviatoric part of the strains is assumed over the element whereas the mean strain part is discarded in favor of a constant stress assumption. Unlike conventional ANS elements, ANDES elements satisfy the individual element test (a stringent form of the patch test) a priori while retaining the favorable distortion-insensitivity properties of ANS elements. The first application of this formulation is the development of several Kirchhoff plate bending triangular elements with the standard nine degrees of freedom. Linear curvature variations are sampled along the three sides with the corners as gage reading points. These sample values are interpolated over the triangle using three schemes. Two schemes merge back to conventional ANS elements, one being identical to the Discrete Kirchhoff Triangle (DKT), whereas the third one produces two new ANDES elements. Numerical experiments indicate that one of the ANDES element is relatively insensitive to distortion compared to previously derived high-performance plate-bending elements, while retaining accuracy for nondistorted elements.

  13. Forming Stars Near Our Supermassive Black Hole

    NASA Astrophysics Data System (ADS)

    Kohler, Susanna

    2018-01-01

    Is it possible to form stars in the immediate vicinity of the hostile supermassive black hole at the center of our galaxy? New evidence suggests that nature has found a way.Infrared view of the central 300 light-years of our galaxy. [Hubble: NASA/ESA/Q.D. Wang; Spitzer: NASA/JPL/S. Stolovy]Too Hostile for Stellar Birth?Around Sgr A*, the supermassive black hole lurking at the Milky Ways center, lies a population of 200 massive, young, bright stars. Their very tight orbits around the black hole pose a mystery: did these intrepid stars somehow manage to form in situ, or did they instead migrate to their current locations from further out?For a star to be born out of a molecular cloud, the self-gravity of the cloud clump must be stronger than the other forces its subject to. Close to a supermassive black hole, the brutal tidal forces of the black hole dominate over all else. For this reason, it was thought that stars couldnt form in the hostile environment near a supermassive black hole until clues came along suggesting otherwise.Science as an Iterative ProcessVery Large Array observations of candidate photoevaporative protoplanetary disks discovered in 2015. [Yusef-Zadeh et al. 2015]Longtime AAS Nova readers might recall that one of our very first highlights on the site, back in August of 2015, was of a study led by Farhad Yusef-Zadeh of Northwestern University. In this study, the authors presented observations of candidate proplyds photoevaporative protoplanetary disks suggestive of star formation within a few light-years of the galactic center.While these observations seemed to indicate that stars might, even now, be actively forming near Sgr A*, they werent conclusive evidence. Follow-up observations of these and other signs of possible star formation were hindered by the challenges of observing the distant and crowded galactic center.Two and a half years later, Yusef-Zadeh and collaborators are back now aided by high-resolution and high-sensitivity observations

  14. Improved estimation of random vibration loads in launch vehicles

    NASA Technical Reports Server (NTRS)

    Mehta, R.; Erwin, E.; Suryanarayan, S.; Krishna, Murali M. R.

    1993-01-01

    Random vibration induced load is an important component of the total design load environment for payload and launch vehicle components and their support structures. The current approach to random vibration load estimation is based, particularly at the preliminary design stage, on the use of Miles' equation which assumes a single degree-of-freedom (DOF) system and white noise excitation. This paper examines the implications of the use of multi-DOF system models and response calculation based on numerical integration using the actual excitation spectra for random vibration load estimation. The analytical study presented considers a two-DOF system and brings out the effects of modal mass, damping and frequency ratios on the random vibration load factor. The results indicate that load estimates based on the Miles' equation can be significantly different from the more accurate estimates based on multi-DOF models.

  15. Classical molecular dynamics simulation of electronically non-adiabatic processes.

    PubMed

    Miller, William H; Cotton, Stephen J

    2016-12-22

    Both classical and quantum mechanics (as well as hybrids thereof, i.e., semiclassical approaches) find widespread use in simulating dynamical processes in molecular systems. For large chemical systems, however, which involve potential energy surfaces (PES) of general/arbitrary form, it is usually the case that only classical molecular dynamics (MD) approaches are feasible, and their use is thus ubiquitous nowadays, at least for chemical processes involving dynamics on a single PES (i.e., within a single Born-Oppenheimer electronic state). This paper reviews recent developments in an approach which extends standard classical MD methods to the treatment of electronically non-adiabatic processes, i.e., those that involve transitions between different electronic states. The approach treats nuclear and electronic degrees of freedom (DOF) equivalently (i.e., by classical mechanics, thereby retaining the simplicity of standard MD), and provides "quantization" of the electronic states through a symmetrical quasi-classical (SQC) windowing model. The approach is seen to be capable of treating extreme regimes of strong and weak coupling between the electronic states, as well as accurately describing coherence effects in the electronic DOF (including the de-coherence of such effects caused by coupling to the nuclear DOF). A survey of recent applications is presented to illustrate the performance of the approach. Also described is a newly developed variation on the original SQC model (found universally superior to the original) and a general extension of the SQC model to obtain the full electronic density matrix (at no additional cost/complexity).

  16. Four new polymorphic forms of suplatast tosilate.

    PubMed

    Nagai, Keiko; Ushio, Takanori; Miura, Hidenori; Nakamura, Takashi; Moribe, Kunikazu; Yamamoto, Keiji

    2014-01-02

    We found four new polymorphic forms (γ-, ε-, ζ-, and η-forms) of suplatast tosilate (ST) by recrystallization and seeding with ST-analogous compounds; three polymorphic forms (α-, β-, and δ-forms) of ST have been previously reported. The physicochemical properties of these new forms were investigated using infrared (IR) spectroscopy, solid-state nuclear magnetic resonance (NMR) spectroscopy, differential scanning calorimetry, and powder X-ray diffractometry. The presence of hydrogen bonds in the new forms was assessed from the IR and solid-state NMR spectra. The crystal structures of the ε- and η-forms were determined from their powder X-ray diffraction data using the direct space approach and the Monte Carlo method, followed by Rietveld refinement. The structures determined for the ε- and η-forms supported the presence of hydrogen bonds between the ST molecules, as the IR and solid-state NMR spectra indicated. The thermodynamic characteristics of the seven polymorphic forms were evaluated by determining the solubility of each form. The α-form was the most insoluble in 2-propanol at 35°C, and was thus concluded to be the most stable form. The ε-form was the most soluble, and a polymorphic transition from the ε- to the α-form was observed during solubility testing. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. An analytical study of a six degree-of-freedom active truss for use in vibration control

    NASA Technical Reports Server (NTRS)

    Wynn, Robert H., Jr.; Robertshaw, Harry H.; Horner, C. Garnett

    1990-01-01

    An analytical study of the vibration control capabilities of three configurations of an active truss is presented. The truss studied is composed of two bays of an octahedral-octahedral configuration. The three configurations of the active truss studies are: all six battens activated (6 DOF), the top three battens activated (3 DOF), and the bottom three battens activated (3 DOF). The closed-loop vibration control response of these three configurations are studied with respect to: vibration attenuation, energy utilized, and the effects of motor drive amplifier saturation non-linearities.

  18. Densified waste form and method for forming

    DOEpatents

    Garino, Terry J.; Nenoff, Tina M.; Sava Gallis, Dorina Florentina

    2015-08-25

    Materials and methods of making densified waste forms for temperature sensitive waste material, such as nuclear waste, formed with low temperature processing using metallic powder that forms the matrix that encapsulates the temperature sensitive waste material. The densified waste form includes a temperature sensitive waste material in a physically densified matrix, the matrix is a compacted metallic powder. The method for forming the densified waste form includes mixing a metallic powder and a temperature sensitive waste material to form a waste form precursor. The waste form precursor is compacted with sufficient pressure to densify the waste precursor and encapsulate the temperature sensitive waste material in a physically densified matrix.

  19. Sensory-Feedback Exoskeletal Arm Controller

    NASA Technical Reports Server (NTRS)

    An, Bin; Massie, Thomas H.; Vayner, Vladimir

    2004-01-01

    An electromechanical exoskeletal arm apparatus has been designed for use in controlling a remote robotic manipulator arm. The apparatus, called a force-feedback exoskeleton arm master (F-EAM) is comfortable to wear and easy to don and doff. It provides control signals from the wearer s arm to a robot arm or a computer simulator (e.g., a virtual-reality system); it also provides force and torque feedback from sensors on the robot arm or from the computer simulator to the wearer s arm. The F-EAM enables the wearer to make the robot arm gently touch objects and finely manipulate them without exerting excessive forces. The F-EAM features a lightweight design in which the motors and gear heads that generate force and torque feedback are made smaller than they ordinarily would be: this is achieved by driving the motors to power levels greater than would ordinarily be used in order to obtain higher torques, and by providing active liquid cooling of the motors to prevent overheating at the high drive levels. The F-EAM (see figure) includes an assembly that resembles a backpack and is worn like a backpack, plus an exoskeletal arm mechanism. The FEAM has five degrees of freedom (DOFs) that correspond to those of the human arm: 1. The first DOF is that of the side-to-side rotation of the upper arm about the shoulder (rotation about axis 1). The reflected torque for this DOF is provided by motor 1 via drum 1 and a planar four-bar linkage. 2. The second DOF is that of the up-and-down rotation of the arm about the shoulder. The reflected torque for this DOF is provided by motor 2 via drum 2. 3. The third DOF is that of twisting of the upper arm about its longitudinal axis. This DOF is implemented in a cable remote-center mechanism (CRCM). The reflected torque for this DOF is provided by motor 3, which drives the upper-arm cuff and the mechanism below it. A bladder inflatable by gas or liquid is placed between the cuff and the wearer s upper arm to compensate for misalignment

  20. Studies of Young, Star-forming Circumstellar Disks

    NASA Astrophysics Data System (ADS)

    Bae, Jaehan

    2017-08-01

    Disks of gas and dust around forming stars - circumstellar disks - last only a few million years. This is a very small fraction of the entire lifetime of Sun-like stars, several billion years. Nevertheless, by the time circumstellar disks dissipate stars complete building up their masses, giant planets finish accreting gas, and terrestrial bodies are nearly fully grown and ready for their final assembly to become planets. Understanding the evolution of circumstellar disks are thus crucial in many contexts. Using numerical simulations as the primary tool, my thesis has focused on the studies of various physical processes that can occur throughout the lifetime of circumstellar disks, from their formation to dispersal. Chapters 2, 3, and 4 emphasize the importance of early evolution, during which time a forming star-disk system obtains mass from its natal cloud: the infall phase. In Chapter 2 and 3, I have modeled episodic outbursts of accretion in protostellar systems resulting from disk instabilities - gravitational instability and magnetorotational instability. I showed that outbursts occur preferentially during the infall phase, because the mass addition provides more favorable conditions for gravitational instability to initiate the outburst cycle, and that forming stars build up a significant fraction of their masses through repeated short-lived, episodic outbursts. The infall phase can also be important for the formation of planets. Recent ALMA observations revealed sets of bright and dark rings in circumstellar disks of young, forming stars, potentially indicating early formation of planets. In Chapter 4, I showed that infall streams can create radial pressure bumps near the outer edge of the mass landing on the disk, from which vortices can form, collecting solid particles very efficiently to make initial seeds of planets. The next three chapters highlight the role of planets in setting the observational appearance and the evolution of circumstellar disks

  1. Densified waste form and method for forming

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garino, Terry J.; Nenoff, Tina M.; Sava Gallis, Dorina Florentina

    Materials and methods of making densified waste forms for temperature sensitive waste material, such as nuclear waste, formed with low temperature processing using metallic powder that forms the matrix that encapsulates the temperature sensitive waste material. The densified waste form includes a temperature sensitive waste material in a physically densified matrix, the matrix is a compacted metallic powder. The method for forming the densified waste form includes mixing a metallic powder and a temperature sensitive waste material to form a waste form precursor. The waste form precursor is compacted with sufficient pressure to densify the waste precursor and encapsulate themore » temperature sensitive waste material in a physically densified matrix.« less

  2. Six degree-of-freedom analysis of hip, knee, ankle and foot provides updated understanding of biomechanical work during human walking.

    PubMed

    Zelik, Karl E; Takahashi, Kota Z; Sawicki, Gregory S

    2015-03-01

    Measuring biomechanical work performed by humans and other animals is critical for understanding muscle-tendon function, joint-specific contributions and energy-saving mechanisms during locomotion. Inverse dynamics is often employed to estimate joint-level contributions, and deformable body estimates can be used to study work performed by the foot. We recently discovered that these commonly used experimental estimates fail to explain whole-body energy changes observed during human walking. By re-analyzing previously published data, we found that about 25% (8 J) of total positive energy changes of/about the body's center-of-mass and >30% of the energy changes during the Push-off phase of walking were not explained by conventional joint- and segment-level work estimates, exposing a gap in our fundamental understanding of work production during gait. Here, we present a novel Energy-Accounting analysis that integrates various empirical measures of work and energy to elucidate the source of unexplained biomechanical work. We discovered that by extending conventional 3 degree-of-freedom (DOF) inverse dynamics (estimating rotational work about joints) to 6DOF (rotational and translational) analysis of the hip, knee, ankle and foot, we could fully explain the missing positive work. This revealed that Push-off work performed about the hip may be >50% greater than conventionally estimated (9.3 versus 6.0 J, P=0.0002, at 1.4 m s(-1)). Our findings demonstrate that 6DOF analysis (of hip-knee-ankle-foot) better captures energy changes of the body than more conventional 3DOF estimates. These findings refine our fundamental understanding of how work is distributed within the body, which has implications for assistive technology, biomechanical simulations and potentially clinical treatment. © 2015. Published by The Company of Biologists Ltd.

  3. CTEPP DATA COLLECTION FORM 03:HOUSE/BUILDING CHARACTERISTICS OBSERVATION SURVEY FOR THE DAY CARE CENTER

    EPA Science Inventory

    This data collection form is used to document the physical characteristics of the day care center and identify and inventory possible sources of pollutants.

    The Children's Total Exposure to Persistent Pesticides and Other Persistent Pollutant (CTEPP) study was one of the large...

  4. Design of a surgical robot with dynamic vision field control for Single Port Endoscopic Surgery.

    PubMed

    Kobayashi, Yo; Sekiguchi, Yuta; Tomono, Yu; Watanabe, Hiroki; Toyoda, Kazutaka; Konishi, Kozo; Tomikawa, Morimasa; Ieiri, Satoshi; Tanoue, Kazuo; Hashizume, Makoto; Fujie, Masaktsu G

    2010-01-01

    Recently, a robotic system was developed to assist Single Port Endoscopic Surgery (SPS). However, the existing system required a manual change of vision field, hindering the surgical task and increasing the degrees of freedom (DOFs) of the manipulator. We proposed a surgical robot for SPS with dynamic vision field control, the endoscope view being manipulated by a master controller. The prototype robot consisted of a positioning and sheath manipulator (6 DOF) for vision field control, and dual tool tissue manipulators (gripping: 5DOF, cautery: 3DOF). Feasibility of the robot was demonstrated in vitro. The "cut and vision field control" (using tool manipulators) is suitable for precise cutting tasks in risky areas while a "cut by vision field control" (using a vision field control manipulator) is effective for rapid macro cutting of tissues. A resection task was accomplished using a combination of both methods.

  5. Simple method for experimentally testing any form of quantum contextuality

    NASA Astrophysics Data System (ADS)

    Cabello, Adán

    2016-03-01

    Contextuality provides a unifying paradigm for nonclassical aspects of quantum probabilities and resources of quantum information. Unfortunately, most forms of quantum contextuality remain experimentally unexplored due to the difficulty of performing sequences of projective measurements on individual quantum systems. Here we show that two-point correlations between binary compatible observables are sufficient to reveal any form of contextuality. This allows us to design simple experiments that are more robust against imperfections and easier to analyze, thus opening the door for observing interesting forms of contextuality, including those requiring quantum systems of high dimensions. In addition, it allows us to connect contextuality to communication complexity scenarios and reformulate a recent result relating contextuality and quantum computation.

  6. Total teleportation of a single-photon state

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Humble, Travis S; Bennink, Ryan S; Grice, Warren P

    2008-01-01

    Recent demonstrations of teleportation have transferred quantum information encoded into either polarization or field-quadrature degrees of freedom (DOFs), but an outstanding question is how to simultaneously teleport quantum information encoded into multiple DOFs. We describe how the transverse-spatial, spectral and polarization states of a single photon can be simultaneously teleported using a pair of multimode, polarization-entangled photons derived from spontaneous parametric down-conversion. Furthermore, when the initial photon pair is maximally entangled in the spatial, spectral, and polarization DOFs then the photon s full quantum state can be reliably teleported using a Bell-state measurement based on sum-frequency generation.

  7. Earthquake response analysis of 11-story RC building that suffered damage in 2011 East Japan Earthquake

    NASA Astrophysics Data System (ADS)

    Shibata, Akenori; Masuno, Hidemasa

    2017-10-01

    An eleven-story RC apartment building suffered medium damage in the 2011 East Japan earthquake and was retrofitted for re-use. Strong motion records were obtained near the building. This paper discusses the inelastic earthquake response analysis of the building using the equivalent single-degree-of-freedom (1-DOF) system to account for the features of damage. The method of converting the building frame into 1-DOF system with tri-linear reducing-stiffness restoring force characteristics was given. The inelastic response analysis of the building against the earthquake using the inelastic 1-DOF equivalent system could interpret well the level of actual damage.

  8. Amorphous calcium carbonate particles form coral skeletons

    DOE PAGES

    Mass, Tali; Giuffre, Anthony J.; Sun, Chang -Yu; ...

    2017-08-28

    Do corals form their skeletons by precipitation from solution or by attachment of amorphous precursor particles as observed in other minerals and biominerals? The classical model assumes precipitation in contrast with observed “vital effects,” that is, deviations from elemental and isotopic compositions at thermodynamic equilibrium. Here, we show direct spectromicroscopy evidence in Stylophora pistillata corals that two amorphous precursors exist, one hydrated and one anhydrous amorphous calcium carbonate (ACC); that these are formed in the tissue as 400-nm particles; and that they attach to the surface of coral skeletons, remain amorphous for hours, and finally, crystallize into aragonite (CaCO 3).more » We show in both coral and synthetic aragonite spherulites that crystal growth by attachment of ACC particles is more than 100 times faster than ion-by-ion growth from solution. Fast growth provides a distinct physiological advantage to corals in the rigors of the reef, a crowded and fiercely competitive ecosystem. Corals are affected by warming-induced bleaching and postmortem dissolution, but the finding here that ACC particles are formed inside tissue may make coral skeleton formation less susceptible to ocean acidification than previously assumed. If this is how other corals form their skeletons, perhaps this is how a few corals survived past CO 2 increases, such as the Paleocene–Eocene Thermal Maximum that occurred 56 Mya.« less

  9. Amorphous calcium carbonate particles form coral skeletons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mass, Tali; Giuffre, Anthony J.; Sun, Chang -Yu

    Do corals form their skeletons by precipitation from solution or by attachment of amorphous precursor particles as observed in other minerals and biominerals? The classical model assumes precipitation in contrast with observed “vital effects,” that is, deviations from elemental and isotopic compositions at thermodynamic equilibrium. Here, we show direct spectromicroscopy evidence in Stylophora pistillata corals that two amorphous precursors exist, one hydrated and one anhydrous amorphous calcium carbonate (ACC); that these are formed in the tissue as 400-nm particles; and that they attach to the surface of coral skeletons, remain amorphous for hours, and finally, crystallize into aragonite (CaCO 3).more » We show in both coral and synthetic aragonite spherulites that crystal growth by attachment of ACC particles is more than 100 times faster than ion-by-ion growth from solution. Fast growth provides a distinct physiological advantage to corals in the rigors of the reef, a crowded and fiercely competitive ecosystem. Corals are affected by warming-induced bleaching and postmortem dissolution, but the finding here that ACC particles are formed inside tissue may make coral skeleton formation less susceptible to ocean acidification than previously assumed. If this is how other corals form their skeletons, perhaps this is how a few corals survived past CO 2 increases, such as the Paleocene–Eocene Thermal Maximum that occurred 56 Mya.« less

  10. Amorphous calcium carbonate particles form coral skeletons

    NASA Astrophysics Data System (ADS)

    Mass, Tali; Giuffre, Anthony J.; Sun, Chang-Yu; Stifler, Cayla A.; Frazier, Matthew J.; Neder, Maayan; Tamura, Nobumichi; Stan, Camelia V.; Marcus, Matthew A.; Gilbert, Pupa U. P. A.

    2017-09-01

    Do corals form their skeletons by precipitation from solution or by attachment of amorphous precursor particles as observed in other minerals and biominerals? The classical model assumes precipitation in contrast with observed “vital effects,” that is, deviations from elemental and isotopic compositions at thermodynamic equilibrium. Here, we show direct spectromicroscopy evidence in Stylophora pistillata corals that two amorphous precursors exist, one hydrated and one anhydrous amorphous calcium carbonate (ACC); that these are formed in the tissue as 400-nm particles; and that they attach to the surface of coral skeletons, remain amorphous for hours, and finally, crystallize into aragonite (CaCO3). We show in both coral and synthetic aragonite spherulites that crystal growth by attachment of ACC particles is more than 100 times faster than ion-by-ion growth from solution. Fast growth provides a distinct physiological advantage to corals in the rigors of the reef, a crowded and fiercely competitive ecosystem. Corals are affected by warming-induced bleaching and postmortem dissolution, but the finding here that ACC particles are formed inside tissue may make coral skeleton formation less susceptible to ocean acidification than previously assumed. If this is how other corals form their skeletons, perhaps this is how a few corals survived past CO2 increases, such as the Paleocene-Eocene Thermal Maximum that occurred 56 Mya.

  11. Amorphous calcium carbonate particles form coral skeletons.

    PubMed

    Mass, Tali; Giuffre, Anthony J; Sun, Chang-Yu; Stifler, Cayla A; Frazier, Matthew J; Neder, Maayan; Tamura, Nobumichi; Stan, Camelia V; Marcus, Matthew A; Gilbert, Pupa U P A

    2017-09-12

    Do corals form their skeletons by precipitation from solution or by attachment of amorphous precursor particles as observed in other minerals and biominerals? The classical model assumes precipitation in contrast with observed "vital effects," that is, deviations from elemental and isotopic compositions at thermodynamic equilibrium. Here, we show direct spectromicroscopy evidence in Stylophora pistillata corals that two amorphous precursors exist, one hydrated and one anhydrous amorphous calcium carbonate (ACC); that these are formed in the tissue as 400-nm particles; and that they attach to the surface of coral skeletons, remain amorphous for hours, and finally, crystallize into aragonite (CaCO 3 ). We show in both coral and synthetic aragonite spherulites that crystal growth by attachment of ACC particles is more than 100 times faster than ion-by-ion growth from solution. Fast growth provides a distinct physiological advantage to corals in the rigors of the reef, a crowded and fiercely competitive ecosystem. Corals are affected by warming-induced bleaching and postmortem dissolution, but the finding here that ACC particles are formed inside tissue may make coral skeleton formation less susceptible to ocean acidification than previously assumed. If this is how other corals form their skeletons, perhaps this is how a few corals survived past CO 2 increases, such as the Paleocene-Eocene Thermal Maximum that occurred 56 Mya.

  12. Amorphous calcium carbonate particles form coral skeletons

    PubMed Central

    Mass, Tali; Giuffre, Anthony J.; Sun, Chang-Yu; Stifler, Cayla A.; Frazier, Matthew J.; Neder, Maayan; Tamura, Nobumichi; Stan, Camelia V.; Marcus, Matthew A.

    2017-01-01

    Do corals form their skeletons by precipitation from solution or by attachment of amorphous precursor particles as observed in other minerals and biominerals? The classical model assumes precipitation in contrast with observed “vital effects,” that is, deviations from elemental and isotopic compositions at thermodynamic equilibrium. Here, we show direct spectromicroscopy evidence in Stylophora pistillata corals that two amorphous precursors exist, one hydrated and one anhydrous amorphous calcium carbonate (ACC); that these are formed in the tissue as 400-nm particles; and that they attach to the surface of coral skeletons, remain amorphous for hours, and finally, crystallize into aragonite (CaCO3). We show in both coral and synthetic aragonite spherulites that crystal growth by attachment of ACC particles is more than 100 times faster than ion-by-ion growth from solution. Fast growth provides a distinct physiological advantage to corals in the rigors of the reef, a crowded and fiercely competitive ecosystem. Corals are affected by warming-induced bleaching and postmortem dissolution, but the finding here that ACC particles are formed inside tissue may make coral skeleton formation less susceptible to ocean acidification than previously assumed. If this is how other corals form their skeletons, perhaps this is how a few corals survived past CO2 increases, such as the Paleocene–Eocene Thermal Maximum that occurred 56 Mya. PMID:28847944

  13. X-33 Ascent Flight Controller Design by Trajectory Linearization: A Singular Perturbational Approach

    NASA Technical Reports Server (NTRS)

    Zhu, J. Jim; Banker, Brad D.; Hall, Charles E.

    2000-01-01

    The flight control of X-33 poses a challenge to conventional gain-scheduled flight controllers due to its large attitude maneuvers from liftoff to orbit and reentry. In addition, a wide range of uncertainties in vehicle handling qualities and disturbances must be accommodated by the attitude control system. Nonlinear tracking and decoupling control by trajectory linearization can be viewed as the ideal gain-scheduling controller designed at every point on the flight trajectory. Therefore it provides robust stability and performance at all stages of flight without interpolation of controller gains and eliminates costly controller redesigns due to minor airframe alteration or mission reconfiguration. In this paper, a prototype trajectory linearization design for an X-33 ascent flight controller is presented along with 3-DOF and 6-DOF simulation results. It is noted that the 6-DOF results were obtained from the 3-DOF design with only a few hours of tuning, which demonstrates the inherent robustness of the design technique. It is this "plug-and-play" feature that is much needed by NASA for the development, test and routine operations of the RLV'S. Plans for further research are also presented, and refined 6-DOF simulation results will be presented in the final version of the paper.

  14. Passive stiffness of coupled wrist and forearm rotations.

    PubMed

    Drake, Will B; Charles, Steven K

    2014-09-01

    Coordinated movement requires that the neuromuscular system account and compensate for movement dynamics. One particularly complex aspect of movement dynamics is the interaction that occurs between degrees of freedom (DOF), which may be caused by inertia, damping, and/or stiffness. During wrist rotations, the two DOF of the wrist (flexion-extension and radial-ulnar deviation, FE and RUD) are coupled through interaction torques arising from passive joint stiffness. One important unanswered question is whether the DOF of the forearm (pronation-supination, PS) is coupled to the two DOF of the wrist. Answering this question, and understanding the dynamics of wrist and forearm rotations in general, requires knowledge of the stiffness encountered during rotations involving all three DOF (PS, FE, and RUD). Here we present the first-ever measurement of the passive stiffness encountered during simultaneous wrist and forearm rotations. Using a wrist and forearm robot, we measured coupled wrist and forearm stiffness in 10 subjects and present it as a 3-by-3 stiffness matrix. This measurement of passive wrist and forearm stiffness will enable future studies investigating the dynamics of wrist and forearm rotations, exposing the dynamics for which the neuromuscular system must plan and compensate during movements involving the wrist and forearm.

  15. Embedded Distributed Optical Fiber Sensors in Reinforced Concrete Structures—A Case Study

    PubMed Central

    Villalba, Sergi

    2018-01-01

    When using distributed optical fiber sensors (DOFS) on reinforced concrete structures, a compromise must be achieved between the protection requirements and robustness of the sensor deployment and the accuracy of the measurements both in the uncracked and cracked stages and under loading, unloading and reloading processes. With this in mind the authors have carried out an experiment where polyimide-coated DOFS were installed on two concrete beams, both embedded in the rebar elements and also bonded to the concrete surface. The specimens were subjected to a three-point load test where after cracking, they are unloaded and reloaded again to assess the capability of the sensor when applied to a real loading scenarios in concrete structures. Rayleigh Optical Frequency Domain Reflectometry (OFDR) was used as the most suitable technique for crack detection in reinforced concrete elements. To verify the reliability and accuracy of the DOFS measurements, additional strain gauges were also installed at three locations along the rebar. The results show the feasibility of using a thin coated polyimide DOFS directly bonded on the reinforcing bar without the need of indention or mechanization. A proposal for a Spectral Shift Quality (SSQ) threshold is also obtained and proposed for future works when using polyimide-coated DOFS bonded to rebars with cyanoacrylate adhesive. PMID:29587449

  16. Embedded Distributed Optical Fiber Sensors in Reinforced Concrete Structures-A Case Study.

    PubMed

    Barrias, António; Casas, Joan R; Villalba, Sergi

    2018-03-26

    When using distributed optical fiber sensors (DOFS) on reinforced concrete structures, a compromise must be achieved between the protection requirements and robustness of the sensor deployment and the accuracy of the measurements both in the uncracked and cracked stages and under loading, unloading and reloading processes. With this in mind the authors have carried out an experiment where polyimide-coated DOFS were installed on two concrete beams, both embedded in the rebar elements and also bonded to the concrete surface. The specimens were subjected to a three-point load test where after cracking, they are unloaded and reloaded again to assess the capability of the sensor when applied to a real loading scenarios in concrete structures. Rayleigh Optical Frequency Domain Reflectometry (OFDR) was used as the most suitable technique for crack detection in reinforced concrete elements. To verify the reliability and accuracy of the DOFS measurements, additional strain gauges were also installed at three locations along the rebar. The results show the feasibility of using a thin coated polyimide DOFS directly bonded on the reinforcing bar without the need of indention or mechanization. A proposal for a Spectral Shift Quality (SSQ) threshold is also obtained and proposed for future works when using polyimide-coated DOFS bonded to rebars with cyanoacrylate adhesive.

  17. Design and evaluation of prosthetic shoulder controller

    PubMed Central

    Barton, Joseph E.; Sorkin, John D.

    2015-01-01

    We developed a 2-degree-of-freedom (DOF) shoulder position transducer (sensing shoulder protraction-retraction and elevation-depression) that can be used to control two of a powered prosthetic humerus' DOFs. We also developed an evaluation protocol based on Fitts' law to assess the performance of our device. The primary motivation for this work was to support development of powered prosthetic shoulder joints of a new generation of prosthetic arms for people with shoulder disarticulation and very high-level transhumeral amputation. We found that transducers that provided resistance to shoulder movement performed better than those providing no resistance. We also found that a position control scheme, where effector position is proportional to shoulder position, performed better than a velocity control scheme, where effector velocity is proportional to shoulder position. More generally, our transducer can be used to control motion along any two DOFs. It can also be used in a more general 4-DOF control scheme by sequentially controlling two DOFs at a time. The evaluation protocol has general applicability for researchers and practitioners. Researchers can employ it to compare different prosthesis designs and control schemes, while practitioners may find the evaluation protocol useful in evaluating and training people with amputation in the use of prostheses. PMID:25357185

  18. Functional insights into the late embryogenesis abundant (LEA) protein family from Dendrobium officinale (Orchidaceae) using an Escherichia coli system

    PubMed Central

    Ling, Hong; Zeng, Xu; Guo, Shunxing

    2016-01-01

    Late embryogenesis abundant (LEA) proteins, a diverse family, accumulate during seed desiccation in the later stages of embryogenesis. LEA proteins are associated with tolerance to abiotic stresses, such as drought, salinity and high or cold temperature. Here, we report the first comprehensive survey of the LEA gene family in Dendrobium officinale, an important and widely grown medicinal orchid in China. Based on phylogenetic relationships with the complete set of Arabidopsis and Oryza LEA proteins, 17 genes encoding D. officinale LEAs (DofLEAs) were identified and their deduced proteins were classified into seven groups. The motif composition of these deduced proteins was correlated with the gene structure found in each LEA group. Our results reveal the DofLEA genes are widely distributed and expressed in tissues. Additionally, 11 genes from different groups were introduced into Escherichia coli to assess the functions of DofLEAs. Expression of 6 and 7 DofLEAs in E. coli improved growth performance compared with the control under salt and heat stress, respectively. Based on qPCR data, all of these genes were up-regulated in various tissues following exposure to salt and heat stresses. Our results suggest that DofLEAs play an important role in responses to abiotic stress. PMID:28004781

  19. [Effect of extracts from Dendrobii ifficinalis flos on hyperthyroidism Yin deficiency mice].

    PubMed

    Lei, Shan-shan; Lv, Gui-yuan; Jin, Ze-wu; Li, Bo; Yang, Zheng-biao; Chen, Su-hong

    2015-05-01

    Some unhealthy life habits, such as long-term smoking, heavy drinking, sexual overstrain and frequent stay-up could induce the Yin deficiency symptoms of zygomatic red and dysphoria. Stems of Dendrobii officinalis flos (DOF) showed the efficacy of nourishing Yin. In this study, the hyperthyroidism Yin deficiency model was set up to study the yin nourishing effect and action mechanism of DOF, in order to provide the pharmacological basis for developing DOF resources and decreasing resource wastes. ICR mice were divided into five groups: the normal control group, the model control group, the positive control group and DOF extract groups (6.4 g · kg(-1)). Except for the normal group, the other groups were administrated with thyroxine for 30 d to set up the hyperthyroidism yin deficiency model. At the same time, the other groups were administrated with the corresponding drugs for 30 d. After administration for 4 weeks, the signs (facial temperature, pain domain, heart rate and autonomic activity) in mice were measured, and the facial and ear micro-circulation blood flow were detected by laser Doppler technology. After the last administration, all mice were fasted for 12 hours, blood were collected from their orbits, and serum were separated to detect AST, ALT, TG and TP by the automatic biochemistry analyzer and test T3, T4 and TSH levels by ELISA. (1) Compared with the normal control group, the model control group showed significant increases in facial and ear micro-circulation blood flow, facial temperature and heart rate (P < 0.05, P < 0.01), serum AST, ALT (P < 0.01), T3 level (P < 0.05), TSH level (P < 0.05) and notable deceases in pain domain (P < 0.01), TG level (P < 0.01). (2) Compared with the model control group, extracts from DOF (6 g · kg(-1)) could notably reduce facial and ear micro-circulation blood flow, facial temperature and heart rate (P < 0.05, P < 0.01) and AST (P < 0.05) and enhance pain domain (P < 0.01) and TG (P < 0.01). Extracts from DOF (4

  20. Design of a recovery system for a reentry vehicle

    NASA Technical Reports Server (NTRS)

    Von Eckroth, Wulf; Garrard, William L.; Miller, Norman

    1993-01-01

    Engineers are often required to design decelerator systems which are deployed in cross-wind orientations. If the system is not designed to minimize 'line sail', damage to the parachutes could result. A Reentry Vehicle Analysis Code (RVAC) and an accompanying graphics animation software program (DISPLAY) are presented in this paper. These computer codes allow the user to quickly apply the Purvis line sail modeling technique to any vehicle and then observe the relative motion of the vehicle, nose cap, suspension lines, pilot and drogue bags and canopies on a computer screen. Data files are created which allow plots of velocities, spacial positions, and dynamic pressures versus time to be generated. The code is an important tool for the design engineer because it integrates two degrees of freedom (DOF) line sail equations with a three DOF model of the reentry body and jettisoned nose cap to provide an animated output.

  1. Mechanical design and analysis of focal plate for gravity deformation

    NASA Astrophysics Data System (ADS)

    Wang, Jianping; Chu, Jiaru; Hu, Hongzhuan; Li, Kexuan; Zhou, Zengxiang

    2014-07-01

    The surface accuracy of astronomical telescope focal plate is a key indicator to precision stellar observation. To conduct accurate deformation measurement for focal plate in different status, a 6-DOF hexapod platform was used for attitude adjustment. For the small adjustment range of a classic 6-DOF hexapod platform, an improved structural arrangement method was proposed in the paper to achieve ultimate adjustment of the focal plate in horizontal and vertical direction. To validate the feasibility of this method, an angle change model which used ball hinge was set up for the movement and base plate. Simulation results in MATLAB suggested that the ball hinge angle change of movement and base plate is within the range of the limiting angle in the process of the platform plate adjusting to ultimate attitude. The proposed method has some guiding significance for accurate surface measurement of focal plate.

  2. The discovery of structural form

    PubMed Central

    Kemp, Charles; Tenenbaum, Joshua B.

    2008-01-01

    Algorithms for finding structure in data have become increasingly important both as tools for scientific data analysis and as models of human learning, yet they suffer from a critical limitation. Scientists discover qualitatively new forms of structure in observed data: For instance, Linnaeus recognized the hierarchical organization of biological species, and Mendeleev recognized the periodic structure of the chemical elements. Analogous insights play a pivotal role in cognitive development: Children discover that object category labels can be organized into hierarchies, friendship networks are organized into cliques, and comparative relations (e.g., “bigger than” or “better than”) respect a transitive order. Standard algorithms, however, can only learn structures of a single form that must be specified in advance: For instance, algorithms for hierarchical clustering create tree structures, whereas algorithms for dimensionality-reduction create low-dimensional spaces. Here, we present a computational model that learns structures of many different forms and that discovers which form is best for a given dataset. The model makes probabilistic inferences over a space of graph grammars representing trees, linear orders, multidimensional spaces, rings, dominance hierarchies, cliques, and other forms and successfully discovers the underlying structure of a variety of physical, biological, and social domains. Our approach brings structure learning methods closer to human abilities and may lead to a deeper computational understanding of cognitive development. PMID:18669663

  3. Relationships between particle precipitation and auroral forms

    NASA Technical Reports Server (NTRS)

    Burch, J. L.; Winningham, J. D.

    1978-01-01

    The paper discusses recent measurements pertaining to the relationship between high-latitude particle (electron) precipitation and auroras. The discussion covers three topics: the large-scale relationships between auroral forms and the particle populations of the magnetosphere as determined from satellite measurements; (2) the relationship between satellite and sounding-rocket observations, particularly field-aligned pitch-angle distributions and upward field-aligned currents measured in the vicinity of auroral forms; and (3) recent results on the interaction of auroral electrons with the atmosphere.

  4. Mid-Infrared Observations of Possible Intergalactic Star Forming Regions in the Leo Ring

    NASA Astrophysics Data System (ADS)

    Giroux, Mark; Smith, B.; Struck, C.

    2011-05-01

    Within the Leo group of galaxies lies a gigantic loop of intergalactic gas known as the Leo Ring. Not clearly associated with any particular galaxy, its origin remains uncertain. It may be a primordial intergalactic cloud alternatively, it may be a collision ring, or have a tidal origin. Combining archival Spitzer images of this structure with published UV and optical data, we investigate the mid-infrared properties of possible knots of star formation in the ring. These sources are very faint in the mid-infrared compared to star forming regions in the tidal features of interacting galaxies. This suggests they are either deficient in dust, or they may not be associated with the ring.

  5. 12 CFR 313.3 - Definitions.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Banking FEDERAL DEPOSIT INSURANCE CORPORATION PROCEDURE AND RULES OF PRACTICE PROCEDURES FOR CORPORATE...) Director means the Director of the Division of Finance (DOF), the Director of the Division of...) Division of Finance (DOF) means the Division of Finance of the FDIC. (n) Division of Resolutions and...

  6. Star-Forming Regions in Orion as a Dust Evolution Laboratory

    NASA Astrophysics Data System (ADS)

    Wiebe, D.; Murga, M.; Sivkova, E.

    2017-06-01

    Star-forming regions (SFR) represent a convenient opportunity to study various processes related both to dust growth and to dust destruction. While extragalactic SFRs allow considering these processes in a wide range of metallicities, UV field intensities, etc., the Orion star-forming complex opens up a possibility to observe dust evolution with an unprecedented angular resolution. We review various observations related to dust evolution in some most prominent Orion regions, paying special attention to organic dust evolution, and introduce a new model of organic dust evolution.

  7. Six-Degree-of-Freedom Trajectory Optimization Utilizing a Two-Timescale Collocation Architecture

    NASA Technical Reports Server (NTRS)

    Desai, Prasun N.; Conway, Bruce A.

    2005-01-01

    Six-degree-of-freedom (6DOF) trajectory optimization of a reentry vehicle is solved using a two-timescale collocation methodology. This class of 6DOF trajectory problems are characterized by two distinct timescales in their governing equations, where a subset of the states have high-frequency dynamics (the rotational equations of motion) while the remaining states (the translational equations of motion) vary comparatively slowly. With conventional collocation methods, the 6DOF problem size becomes extraordinarily large and difficult to solve. Utilizing the two-timescale collocation architecture, the problem size is reduced significantly. The converged solution shows a realistic landing profile and captures the appropriate high-frequency rotational dynamics. A large reduction in the overall problem size (by 55%) is attained with the two-timescale architecture as compared to the conventional single-timescale collocation method. Consequently, optimum 6DOF trajectory problems can now be solved efficiently using collocation, which was not previously possible for a system with two distinct timescales in the governing states.

  8. Direct Method Transcription for a Human-Class Translunar Injection Trajectory Optimization

    NASA Technical Reports Server (NTRS)

    Witzberger, Kevin E.; Zeiler, Tom

    2012-01-01

    This paper presents a new trajectory optimization software package developed in the framework of a low-to-high fidelity 3 degrees-of-freedom (DOF)/6-DOF vehicle simulation program named Mission Analysis Simulation Tool in Fortran (MASTIF) and its application to a translunar trajectory optimization problem. The functionality of the developed optimization package is implemented as a new "mode" in generalized settings to make it applicable for a general trajectory optimization problem. In doing so, a direct optimization method using collocation is employed for solving the problem. Trajectory optimization problems in MASTIF are transcribed to a constrained nonlinear programming (NLP) problem and solved with SNOPT, a commercially available NLP solver. A detailed description of the optimization software developed is provided as well as the transcription specifics for the translunar injection (TLI) problem. The analysis includes a 3-DOF trajectory TLI optimization and a 3-DOF vehicle TLI simulation using closed-loop guidance.

  9. A Generalized Method for Automatic Downhand and Wirefeed Control of a Welding Robot and Positioner

    NASA Technical Reports Server (NTRS)

    Fernandez, Ken; Cook, George E.

    1988-01-01

    A generalized method for controlling a six degree-of-freedom (DOF) robot and a two DOF positioner used for arc welding operations is described. The welding path is defined in the part reference frame, and robot/positioner joint angles of the equivalent eight DOF serial linkage are determined via an iterative solution. Three algorithms are presented: the first solution controls motion of the eight DOF mechanism such that proper torch motion is achieved while minimizing the sum-of-squares of joint displacements; the second algorithm adds two constraint equations to achieve torch control while maintaining part orientation so that welding occurs in the downhand position; and the third algorithm adds the ability to control the proper orientation of a wire feed mechanism used in gas tungsten arc (GTA) welding operations. A verification of these algorithms is given using ROBOSIM, a NASA developed computer graphic simulation software package design for robot systems development.

  10. Herschel Extreme Lensing Line Observations: Dynamics of Two Strongly Lensed Star-Forming Galaxies near Redshift z=2*

    NASA Technical Reports Server (NTRS)

    Rhoads, James E.; Rigby, Jane Rebecca; Malhotra, Sangeeta; Allam, Sahar; Carilli, Chris; Combes, Francoise; Finkelstein, Keely; Finkelstein, Steven; Frye, Brenda; Gerin, Maryvonne; hide

    2014-01-01

    We report on two regularly rotating galaxies at redshift z approx. = 2, using high-resolution spectra of the bright [C microns] 158 micrometers emission line from the HIFI instrument on the Herschel Space Observatory. Both SDSS090122.37+181432.3 ("S0901") and SDSSJ120602.09+514229.5 ("the Clone") are strongly lensed and show the double-horned line profile that is typical of rotating gas disks. Using a parametric disk model to fit the emission line profiles, we find that S0901 has a rotation speed of v sin(i) approx. = 120 +/- 7 kms(sup -1) and a gas velocity dispersion of (standard deviation)g < 23 km s(sup -1) (1(standard deviation)). The best-fitting model for the Clone is a rotationally supported disk having v sin(i) approx. = 79 +/- 11 km s(sup -1) and (standard deviation)g 4 kms(sup -1) (1(standard deviation)). However, the Clone is also consistent with a family of dispersion-dominated models having (standard deviation)g = 92 +/- 20 km s(sup -1). Our results showcase the potential of the [C microns] line as a kinematic probe of high-redshift galaxy dynamics: [C microns] is bright, accessible to heterodyne receivers with exquisite velocity resolution, and traces dense star-forming interstellar gas. Future [C microns] line observations with ALMA would offer the further advantage of spatial resolution, allowing a clearer separation between rotation and velocity dispersion.

  11. Adaptive Estimation and Heuristic Optimization of Nonlinear Spacecraft Attitude Dynamics

    DTIC Science & Technology

    2016-09-15

    Algorithm GPS Global Positioning System HOUF Higher Order Unscented Filter IC initial conditions IMM Interacting Multiple Model IMU Inertial Measurement Unit ...sources ranging from inertial measurement units to star sensors are used to construct observations for attitude estimation algorithms. The sensor...parameters. A single vector measurement will provide two independent parameters, as a unit vector constraint removes a DOF making the problem underdetermined

  12. Intervertebral anticollision constraints improve out-of-plane translation accuracy of a single-plane fluoroscopy-to-CT registration method for measuring spinal motion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, Cheng-Chung; Tsai, Tsung-Yuan; Hsu, Shih-Jung

    2013-03-15

    Purpose: The study aimed to propose a new single-plane fluoroscopy-to-CT registration method integrated with intervertebral anticollision constraints for measuring three-dimensional (3D) intervertebral kinematics of the spine; and to evaluate the performance of the method without anticollision and with three variations of the anticollision constraints via an in vitro experiment. Methods: The proposed fluoroscopy-to-CT registration approach, called the weighted edge-matching with anticollision (WEMAC) method, was based on the integration of geometrical anticollision constraints for adjacent vertebrae and the weighted edge-matching score (WEMS) method that matched the digitally reconstructed radiographs of the CT models of the vertebrae and the measured single-plane fluoroscopymore » images. Three variations of the anticollision constraints, namely, T-DOF, R-DOF, and A-DOF methods, were proposed. An in vitro experiment using four porcine cervical spines in different postures was performed to evaluate the performance of the WEMS and the WEMAC methods. Results: The WEMS method gave high precision and small bias in all components for both vertebral pose and intervertebral pose measurements, except for relatively large errors for the out-of-plane translation component. The WEMAC method successfully reduced the out-of-plane translation errors for intervertebral kinematic measurements while keeping the measurement accuracies for the other five degrees of freedom (DOF) more or less unaltered. The means (standard deviations) of the out-of-plane translational errors were less than -0.5 (0.6) and -0.3 (0.8) mm for the T-DOF method and the R-DOF method, respectively. Conclusions: The proposed single-plane fluoroscopy-to-CT registration method reduced the out-of-plane translation errors for intervertebral kinematic measurements while keeping the measurement accuracies for the other five DOF more or less unaltered. With the submillimeter and subdegree accuracy, the WEMAC method

  13. Effects of live and video form action observation training on upper limb function in children with hemiparetic cerebral palsy.

    PubMed

    Kim, Do Hyun; An, Duk-Hyun; Yoo, Won-Gyu

    2018-04-20

    The purpose of this study was to investigate the effects of live and video form action observation training (AOT) on upper limb (UL) movement acceleration and function in children with cerebral palsy (CP). In total, 12 children (7 boys, 5 girls) with CP participated in this study. The children were allocated randomly to live (experimental) and video (control) AOT groups. All children completed 20 treatment sessions, each 30 minutes in duration, 5 days per week for a month. Mediolateral (ML) and vertical (VT) acceleration data, Jebsen-Taylor Hand Function (JTHF) scores, and Box and Block Test (BBT) scores were obtained at baseline and at 4 weeks after the intervention. ML and VT movement acceleration and JTHF scores were significantly lower in the live group (p< 0.05). The BBT score was significantly higher in the live than in the video group (p< 0.05). Our findings suggest that live AOT is more effective than video AOT for improving UL movement acceleration and function. Clinically, our findings offer important insights for clinicians when planning AOT interventions to reduce UL movement acceleration and improve UL function.

  14. Sorted bed forms as self-organized patterns: 2. complex forcing scenarios

    USGS Publications Warehouse

    Coco, Giovanni; Murray, A. Brad; Green, Malcom O.; Thieler, E. Robert; Hume, T.M.

    2007-01-01

    We employ a numerical model to study the development of sorted bed forms under a variety of hydrodynamic and sedimentary conditions. Results indicate that increased variability in wave height decreases the growth rate of the features and can potentially give rise to complicated, a priori unpredictable, behavior. This happens because the system responds to a change in wave characteristics by attempting to self-organize into a patterned seabed of different geometry and spacing. The new wavelength might not have enough time to emerge before a new change in wave characteristics occurs, leading to less regular seabed configurations. The new seabed configuration is also highly dependent on the preexisting morphology, which further limits the possibility of predicting future behavior. For the same reasons, variability in the mean current magnitude and direction slows down the growth of features and causes patterns to develop that differ from classical sorted bed forms. Spatial variability in grain size distribution and different types of net sediment aggradation/degradation can also result in the development of sorted bed forms characterized by a less regular shape. Numerical simulations qualitatively agree with observed geometry (spacing and height) of sorted bed forms. Also in agreement with observations is that at shallower depths, sorted bed forms are more likely to be affected by changes in the forcing conditions, which might also explain why, in shallow waters, sorted bed forms are described as ephemeral features. Finally, simulations indicate that the different sorted bed form shapes and patterns observed in the field might not necessarily be related to diverse physical mechanisms. Instead, variations in sorted bed form characteristics may result from variations in local hydrodynamic and/or sedimentary conditions.

  15. Portraiture lens concept in a mobile phone camera

    NASA Astrophysics Data System (ADS)

    Sheil, Conor J.; Goncharov, Alexander V.

    2017-11-01

    A small form-factor lens was designed for the purpose of portraiture photography, the size of which allows use within smartphone casing. The current general requirement of mobile cameras having good all-round performance results in a typical, familiar, many-element design. Such designs have little room for improvement, in terms of the available degrees of freedom and highly-demanding target metrics such as low f-number and wide field of view. However, the specific application of the current portraiture lens relaxed the requirement of an all-round high-performing lens, allowing improvement of certain aspects at the expense of others. With a main emphasis on reducing depth of field (DoF), the current design takes advantage of the simple geometrical relationship between DoF and pupil diameter. The system has a large aperture, while a reasonable f-number gives a relatively large focal length, requiring a catadioptric lens design with double ray path; hence, field of view is reduced. Compared to typical mobile lenses, the large diameter reduces depth of field by a factor of four.

  16. Single point incremental forming: Formability of PC sheets

    NASA Astrophysics Data System (ADS)

    Formisano, A.; Boccarusso, L.; Carrino, L.; Lambiase, F.; Minutolo, F. Memola Capece

    2018-05-01

    Recent research on Single Point Incremental Forming of polymers has slightly covered the possibility of expanding the materials capability window of this flexible forming process beyond metals, by demonstrating the workability of thermoplastic polymers at room temperature. Given the different behaviour of polymers compared to metals, different aspects need to be deepened to better understand the behaviour of these materials when incrementally formed. Thus, the aim of the work is to investigate the formability of incrementally formed polycarbonate thin sheets. To this end, an experimental investigation at room temperature was conducted involving formability tests; varying wall angle cone and pyramid frusta were manufactured by processing polycarbonate sheets with different thicknesses and using tools with different diameters, in order to draw conclusions on the formability of polymer sheets through the evaluation of the forming angles and the observation of the failure mechanisms.

  17. Multivariable dynamic ankle mechanical impedance with relaxed muscles.

    PubMed

    Lee, Hyunglae; Krebs, Hermano Igo; Hogan, Neville

    2014-11-01

    Neurological or biomechanical disorders may distort ankle mechanical impedance and thereby impair locomotor function. This paper presents a quantitative characterization of multivariable ankle mechanical impedance of young healthy subjects when their muscles were relaxed, to serve as a baseline to compare with pathophysiological ankle properties of biomechanically and/or neurologically impaired patients. Measurements using a highly backdrivable wearable ankle robot combined with multi-input multi-output stochastic system identification methods enabled reliable characterization of ankle mechanical impedance in two degrees-of-freedom (DOFs) simultaneously, the sagittal and frontal planes. The characterization included important ankle properties unavailable from single DOF studies: coupling between DOFs and anisotropy as a function of frequency. Ankle impedance in joint coordinates showed responses largely consistent with a second-order system consisting of inertia, viscosity, and stiffness in both seated (knee flexed) and standing (knee straightened) postures. Stiffness in the sagittal plane was greater than in the frontal plane and furthermore, was greater when standing than when seated, most likely due to the stretch of bi-articular muscles (medial and lateral gastrocnemius). Very low off-diagonal partial coherences implied negligible coupling between dorsiflexion-plantarflexion and inversion-eversion. The directions of principal axes were tilted slightly counterclockwise from the original joint coordinates. The directional variation (anisotropy) of ankle impedance in the 2-D space formed by rotations in the sagittal and frontal planes exhibited a characteristic "peanut" shape, weak in inversion-eversion over a wide range of frequencies from the stiffness dominated region up to the inertia dominated region. Implications for the assessment of neurological and biomechanical impairments are discussed.

  18. Control of a Serpentine Robot for Inspection Tasks

    NASA Technical Reports Server (NTRS)

    Colbaugh, R.; Glass, K.; Seraji, H.

    1994-01-01

    This paper presents a simple and robust kinematic control scheme for the JPL serpentine robot system. The proposed strategy is developed using the dampened-least-squares/configuration control methodology, and permits the considerable dexterity of the JPL serpentine robot to be effectively utilized for maneuvering in the congested and uncertain workspaces often encountered in inspection tasks. Computer simulation results are given for the 20 degree-of-freedom (DOF) manipulator system obtained by mounting the twelve DOF serpentine robot at the end-effector of an eight DOF Robotics Research arm/lathe-bed system. These simulations demonstrate that the proposed approach provides an effective method of controlling this complex system.

  19. Tracing the Fuel for Forming Stars

    NASA Astrophysics Data System (ADS)

    Kohler, Susanna

    2017-11-01

    Huge reservoirs of cold hydrogen gas the raw fuel for star formation lurk in galaxies throughout the universe. A new study examines whether these reservoirs have always been similar, or whether those in distant galaxies are very different from those in local galaxies today.Left: Optical SLOAN images of the five HIGHz galaxies in this study. Right: ALMA images of the molecular gas in these galaxies. Both images are 30 wide. [Adapted from Cortese et al. 2017]Molecular or Atomic?The formation of stars is a crucial process that determines how galaxies are built and evolve over time. Weve observed that star formation takes place in cold clouds of molecular gas, and that star-formation rates increase in galaxies with a larger surface density of molecular hydrogen so we know that molecular hydrogen feeds the star-forming process.But not all cold gas in the interstellar medium of galaxies exists in molecular form. In the local universe, only around 30% of cold gas is found in molecular form (H2) and able to directly feed star formation; the rest is atomic hydrogen (H I). But is this true of galaxies earlier in the universe as well?Studying Distant GalaxiesCosmological simulations have predicted that earlier in our universes history, the ratio of molecular to atomic hydrogen could be larger i.e., more cold hydrogen may be in a form ready to fuel star formation but this prediction is difficult to test observationally. Currently, radio telescopes are not able to measure the atomic hydrogen in very distant galaxies, such as those at the peak of star formation in the universe, 10 billion years ago.Recently, however, we have measured atomic hydrogen in closer galaxies: those at a redshift of about z 0.20.4, a few billion years ago. One recent study of seven galaxies at this distance, usinga sample from a survey known as COOL BUDHIES, showed that the hydrogen reservoirs of these galaxies are dominated by molecular hydrogen, unlike in the local universe. If this is true of most

  20. GeV Observations of star-forming galaxies with the Fermi large area telescope

    DOE PAGES

    Ackermann, M.; Ajello, M.; Allafort, A.; ...

    2012-08-07

    Some recent detections of the starburst galaxies M82 and NGC 253 by gamma-ray telescopes suggest that galaxies rapidly forming massive stars are more luminous at gamma-ray energies compared to their quiescent relatives. Building upon those results, we examine a sample of 69 dwarf, spiral, and luminous and ultraluminous infrared galaxies at photon energies 0.1-100 GeV using 3 years of data collected by the Large Area Telescope (LAT) on the Fermi Gamma-ray Space Telescope (Fermi). Measured fluxes from significantly detected sources and flux upper limits for the remaining galaxies are used to explore the physics of cosmic rays in galaxies. Here,more » we find further evidence for quasi-linear scaling relations between gamma-ray luminosity and both radio continuum luminosity and total infrared luminosity which apply both to quiescent galaxies of the Local Group and low-redshift starburst galaxies (conservative P-values ≲ 0.05 accounting for statistical and systematic uncertainties). The normalizations of these scaling relations correspond to luminosity ratios of log (L 0.1-100 GeV/L 1.4 GHz) = 1.7 ± 0.1(statistical) ± 0.2(dispersion) and log (L 0.1-100 GeV/L 8-1000 μm) = –4.3 ± 0.1(statistical) ± 0.2(dispersion) for a galaxy with a star formation rate of 1 M ⊙yr –1, assuming a Chabrier initial mass function. Using the relationship between infrared luminosity and gamma-ray luminosity, the collective intensity of unresolved star-forming galaxies at redshifts 0 < z < 2.5 above 0.1 GeV is estimated to be 0.4-2.4 × 10 –6 ph cm –2 s –1 sr –1 (4%-23% of the intensity of the isotropic diffuse component measured with the LAT). Furthermore, we anticipate that ~10 galaxies could be detected by their cosmic-ray-induced gamma-ray emission during a 10 year Fermi mission.« less

  1. GeV Observations of star-forming galaxies with the Fermi large area telescope

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ackermann, M.; Ajello, M.; Allafort, A.

    Some recent detections of the starburst galaxies M82 and NGC 253 by gamma-ray telescopes suggest that galaxies rapidly forming massive stars are more luminous at gamma-ray energies compared to their quiescent relatives. Building upon those results, we examine a sample of 69 dwarf, spiral, and luminous and ultraluminous infrared galaxies at photon energies 0.1-100 GeV using 3 years of data collected by the Large Area Telescope (LAT) on the Fermi Gamma-ray Space Telescope (Fermi). Measured fluxes from significantly detected sources and flux upper limits for the remaining galaxies are used to explore the physics of cosmic rays in galaxies. Here,more » we find further evidence for quasi-linear scaling relations between gamma-ray luminosity and both radio continuum luminosity and total infrared luminosity which apply both to quiescent galaxies of the Local Group and low-redshift starburst galaxies (conservative P-values ≲ 0.05 accounting for statistical and systematic uncertainties). The normalizations of these scaling relations correspond to luminosity ratios of log (L 0.1-100 GeV/L 1.4 GHz) = 1.7 ± 0.1(statistical) ± 0.2(dispersion) and log (L 0.1-100 GeV/L 8-1000 μm) = –4.3 ± 0.1(statistical) ± 0.2(dispersion) for a galaxy with a star formation rate of 1 M ⊙yr –1, assuming a Chabrier initial mass function. Using the relationship between infrared luminosity and gamma-ray luminosity, the collective intensity of unresolved star-forming galaxies at redshifts 0 < z < 2.5 above 0.1 GeV is estimated to be 0.4-2.4 × 10 –6 ph cm –2 s –1 sr –1 (4%-23% of the intensity of the isotropic diffuse component measured with the LAT). Furthermore, we anticipate that ~10 galaxies could be detected by their cosmic-ray-induced gamma-ray emission during a 10 year Fermi mission.« less

  2. GeV Observations of star-forming glaxies with the FERMI Large Area Telescope

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ackermann, M.; Ajello, M.; Allafort, A.

    Recent detections of the starburst galaxies M82 and NGC 253 by gamma-ray telescopes suggest that galaxies rapidly forming massive stars are more luminous at gamma-ray energies compared to their quiescent relatives. Building upon those results, we examine a sample of 69 dwarf, spiral, and luminous and ultraluminous infrared galaxies at photon energies 0.1-100 GeV using 3 years of data collected by the Large Area Telescope (LAT) on the Fermi Gamma-ray Space Telescope (Fermi). Measured fluxes from significantly detected sources and flux upper limits for the remaining galaxies are used to explore the physics of cosmic rays in galaxies. We findmore » further evidence for quasi-linear scaling relations between gamma-ray luminosity and both radio continuum luminosity and total infrared luminosity which apply both to quiescent galaxies of the Local Group and low-redshift starburst galaxies (conservative P-values lesssim 0.05 accounting for statistical and systematic uncertainties). The normalizations of these scaling relations correspond to luminosity ratios of log (L 0.1-100 GeV/L 1.4 GHz) = 1.7 ± 0.1(statistical) ± 0.2(dispersion) and log (L 0.1-100 GeV/L 8-1000 μm) = –4.3 ± 0.1(statistical) ± 0.2(dispersion) for a galaxy with a star formation rate of 1 M ⊙ yr–1, assuming a Chabrier initial mass function. Using the relationship between infrared luminosity and gamma-ray luminosity, the collective intensity of unresolved star-forming galaxies at redshifts 0 < z < 2.5 above 0.1 GeV is estimated to be 0.4-2.4 × 10–6 ph cm–2 s–1 sr–1 (4%-23% of the intensity of the isotropic diffuse component measured with the LAT). We anticipate that ~10 galaxies could be detected by their cosmic-ray-induced gamma-ray emission during a 10 year Fermi mission.« less

  3. [Primary hyperparathyroidism - new clinical forms of the disease].

    PubMed

    Zajíčková, Kateřina

    Primary hyperparathyroidism (PHPT) has been increasingly diagnosed incidentally in its asymptomatic form owing to calcium screening tests. This form of PHPT represents 80% in developed countries. Although PHPT patients are asym-ptomatic, target organ (bone and kidney) involvement is frequently observed. Mild PHPT is associated with a reduction of bone mineral densityand, moreover, with increased risk of vertebral fractures. The extent of a patient evaluation and indications for parathyroidectomy are based on expert guidelines from 2014. Normocalcemic variant of PHPT has been recently recognized, possibly with higher prevalence in general population than the hypercalcemic form of PHPT. Normal but with respect to hypercalcemia inadequately high parathormon levels characterize normohormonal PHPT. If a hereditary form of PHPT is suspected, genetic testing is recommended. Although there are new clinical forms of PHPT, parathyroidectomy still represents the only curative approach to PHPT followed by substantial osteoprotective effect.Key words: asymptomatic form - normocalcemic form - normohormonal form - parathyroidectomy - primary hyperparathyroidism - recent guidelines for the management PHPT.

  4. Polarization Properties and Magnetic Field Structures in the High-mass Star-forming Region W51 Observed with ALMA

    NASA Astrophysics Data System (ADS)

    Koch, Patrick M.; Tang, Ya-Wen; Ho, Paul T. P.; Yen, Hsi-Wei; Su, Yu-Nung; Takakuwa, Shigehisa

    2018-03-01

    We present the first ALMA dust polarization observations toward the high-mass star-forming regions W51 e2, e8, and W51 North in Band 6 (230 GHz) with a resolution of about 0\\buildrel{\\prime\\prime}\\over{.} 26 (∼5 mpc). Polarized emission in all three sources is clearly detected and resolved. Measured relative polarization levels are between 0.1% and 10%. While the absolute polarization shows complicated structures, the relative polarization displays the typical anticorrelation with Stokes I, although with a large scatter. Inferred magnetic (B) field morphologies are organized and connected. Detailed substructures are resolved, revealing new features such as comet-shaped B-field morphologies in satellite cores, symmetrically converging B-field zones, and possibly streamlined morphologies. The local B-field dispersion shows some anticorrelation with the relative polarization. Moreover, the lowest polarization percentages together with largest dispersions coincide with B-field convergence zones. We put forward \\sin ω , where ω is the measurable angle between a local B-field orientation and local gravity, as a measure of how effectively the B field can oppose gravity. Maps of \\sin ω for all three sources show organized structures that suggest a locally varying role of the B field, with some regions where gravity can largely act unaffectedly, possibly in a network of narrow magnetic channels, and other regions where the B field can work maximally against gravity.

  5. A clinical study to evaluate the correlation between maxillary central incisor tooth form and face form in an Indian population.

    PubMed

    Koralakunte, Pavankumar R; Budihal, Dhanyakumar H

    2012-09-01

    A study was performed to examine the correlation between maxillary central incisor tooth form and face form in males and females in an Indian population. The selection of prosthetic teeth for edentulous patients is a primary issue in denture esthetics, especially in the case of maxillary central incisors, which are the most prominent teeth in the arch. Two hundred dental students of Indian origin comprising 79 males and 121 females aged 18-28 years studying at Bapuji Dental College and Hospital were randomly selected as the study subjects. A standardized photographic procedure was used to obtain images of the face and the maxillary central incisors. The outline forms of the face and the maxillary right central incisor tooth were determined using a standardized method. The outline forms obtained were used to classify both face form and tooth form on the basis of visual and William's methods. The means were considered after evaluation by five prosthodontists, and the results were tabulated. Statistical analysis was performed using the chi-squared test for association and Z-test for equality of proportions. A correlation greater than 50% was observed between tooth form and face form by the visual method, compared with one of 31.5% by William's method. There was no highly defined correlation between maxillary central incisor tooth form and face form among the male and female Indian subjects studied.

  6. Measurement of six-degree-of-freedom planar motions by using a multiprobe surface encoder

    NASA Astrophysics Data System (ADS)

    Li, Xinghui; Shimizu, Yuki; Ito, Takeshi; Cai, Yindi; Ito, So; Gao, Wei

    2014-12-01

    A multiprobe surface encoder for optical metrology of six-degree-of-freedom (six-DOF) planar motions is presented. The surface encoder is composed of an XY planar scale grating with identical microstructures in X- and Y-axes and an optical sensor head. In the optical sensor head, three paralleled laser beams were used as laser probes. After being divided by a beam splitter, the three laser probes were projected onto the scale grating and a reference grating with identical microstructures, respectively. For each probe, the first-order positive and negative diffraction beams along the X- and Y-directions from the scale grating and from the reference grating superimposed with each other and four pieces of interference signals were generated. Three-DOF translational motions of the scale grating Δx, Δy, and Δz can be obtained simultaneously from the interference signals of each probe. Three-DOF angular error motions θX, θY, and θZ can also be calculated simultaneously from differences of displacement output variations and the geometric relationship among the three probes. A prototype optical sensor head was designed, constructed, and evaluated. Experimental results verified that this surface encoder could provide measurement resolutions of subnanometer and better than 0.1 arc sec for three-DOF translational motions and three-DOF angular error motions, respectively.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    March-Leuba, S.; Jansen, J.F.; Kress, R.L.

    A new program package, Symbolic Manipulator Laboratory (SML), for the automatic generation of both kinematic and static manipulator models in symbolic form is presented. Critical design parameters may be identified and optimized using symbolic models as shown in the sample application presented for the Future Armor Rearm System (FARS) arm. The computer-aided development of the symbolic models yields equations with reduced numerical complexity. Important considerations have been placed on the closed form solutions simplification and on the user friendly operation. The main emphasis of this research is the development of a methodology which is implemented in a computer program capablemore » of generating symbolic kinematic and static forces models of manipulators. The fact that the models are obtained trigonometrically reduced is among the most significant results of this work and the most difficult to implement. Mathematica, a commercial program that allows symbolic manipulation, is used to implement the program package. SML is written such that the user can change any of the subroutines or create new ones easily. To assist the user, an on-line help has been written to make of SML a user friendly package. Some sample applications are presented. The design and optimization of the 5-degrees-of-freedom (DOF) FARS manipulator using SML is discussed. Finally, the kinematic and static models of two different 7-DOF manipulators are calculated symbolically.« less

  8. Development of the Symbolic Manipulator Laboratory modeling package for the kinematic design and optimization of the Future Armor Rearm System robot. Ammunition Logistics Program

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    March-Leuba, S.; Jansen, J.F.; Kress, R.L.

    1992-08-01

    A new program package, Symbolic Manipulator Laboratory (SML), for the automatic generation of both kinematic and static manipulator models in symbolic form is presented. Critical design parameters may be identified and optimized using symbolic models as shown in the sample application presented for the Future Armor Rearm System (FARS) arm. The computer-aided development of the symbolic models yields equations with reduced numerical complexity. Important considerations have been placed on the closed form solutions simplification and on the user friendly operation. The main emphasis of this research is the development of a methodology which is implemented in a computer program capablemore » of generating symbolic kinematic and static forces models of manipulators. The fact that the models are obtained trigonometrically reduced is among the most significant results of this work and the most difficult to implement. Mathematica, a commercial program that allows symbolic manipulation, is used to implement the program package. SML is written such that the user can change any of the subroutines or create new ones easily. To assist the user, an on-line help has been written to make of SML a user friendly package. Some sample applications are presented. The design and optimization of the 5-degrees-of-freedom (DOF) FARS manipulator using SML is discussed. Finally, the kinematic and static models of two different 7-DOF manipulators are calculated symbolically.« less

  9. Influence of tyre-road contact model on vehicle vibration response

    NASA Astrophysics Data System (ADS)

    Múčka, Peter; Gagnon, Louis

    2015-09-01

    The influence of the tyre-road contact model on the simulated vertical vibration response was analysed. Three contact models were compared: tyre-road point contact model, moving averaged profile and tyre-enveloping model. In total, 1600 real asphalt concrete and Portland cement concrete longitudinal road profiles were processed. The linear planar model of automobile with 12 degrees of freedom (DOF) was used. Five vibration responses as the measures of ride comfort, ride safety and dynamic load of cargo were investigated. The results were calculated as a function of vibration response, vehicle velocity, road quality and road surface type. The marked differences in the dynamic tyre forces and the negligible differences in the ride comfort quantities were observed among the tyre-road contact models. The seat acceleration response for three contact models and 331 DOF multibody model of the truck semi-trailer was compared with the measured response for a known profile of test section.

  10. Stability of polymorphic forms of ranitidine hydrochloride.

    PubMed

    Wu, V; Rades, T; Saville, D J

    2000-07-01

    Ranitidine-HCl can exist in two different polymorphic forms: form I (m.p. 134-140 degrees C) and form II (m.p. 140-144 degrees C). In the present study the stability of form I of ranitidine-HCl to a selection of powder pretreatments, to reflect conditions which might occur in manufacturing procedures, and also to a limited range of storage conditions was investigated. The original samples of form I and form II used were characterised by X-ray powder diffraction (XRPD), hot stage microscopy (HSM) and differential scanning calorimetry (DSC). A quantitative XRPD method for determining the fraction of form II in the presence of form I was used. XRPD data were analysed using regression techniques and artificial neural networks (ANN). The quantitative XRPD technique was then used to monitor the relative proportion of form II in each treated sample. Pretreatments of form I included (i) mixing with form II or with common excipients (ii) compression and grinding (iii) contact with solvents (followed by drying) before storage. Storage conditions involved three temperatures (20 degrees C, 30 degrees C, 42 degrees C) and three relative humidities (45% RH; 55% RH; 75% RH). Samples were stored for a period of 6 months. A limited factorial design was used. No increase in the form II:form I ratio was observed in the following pretreatment processes: introduction of form II nuclei into form I; introduction of excipients to form I; compression of form I powder at 5 and 15 tons; normal mixing and grinding processes; addition of isopropanol (IPA) or water/IPA mix followed by drying. In the pretreatment process where water was added to form I powder (with most or all of the powder dissolving), drying of the liquefied mass led to a mix of form I and form II. On storage at room temperature (20-30 degrees C), low relative humidity (45-55% RH), and in an air-tight container there was no increase in the form II:form I ratio. Storage of form I/form II mixes, particularly at high humidity

  11. Grand-design Spiral Arms in a Young Forming Circumstellar Disk

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tomida, Kengo; Lin, Chia Hui; Machida, Masahiro N.

    We study formation and long-term evolution of a circumstellar disk in a collapsing molecular cloud core using a resistive magnetohydrodynamic simulation. While the formed circumstellar disk is initially small, it grows as accretion continues, and its radius becomes as large as 200 au toward the end of the Class-I phase. A pair of grand-design spiral arms form due to gravitational instability in the disk, and they transfer angular momentum in the highly resistive disk. Although the spiral arms disappear in a few rotations as expected in a classical theory, new spiral arms form recurrently as the disk, soon becoming unstablemore » again by gas accretion. Such recurrent spiral arms persist throughout the Class-0 and I phases. We then perform synthetic observations and compare our model with a recent high-resolution observation of a young stellar object Elias 2–27, whose circumstellar disk has grand-design spiral arms. We find good agreement between our theoretical model and the observation. Our model suggests that the grand-design spiral arms around Elias 2–27 are consistent with material arms formed by gravitational instability. If such spiral arms commonly exist in young circumstellar disks, it implies that young circumstellar disks are considerably massive and gravitational instability is the key process of angular momentum transport.« less

  12. Normal forms for reduced stochastic climate models

    PubMed Central

    Majda, Andrew J.; Franzke, Christian; Crommelin, Daan

    2009-01-01

    The systematic development of reduced low-dimensional stochastic climate models from observations or comprehensive high-dimensional climate models is an important topic for atmospheric low-frequency variability, climate sensitivity, and improved extended range forecasting. Here techniques from applied mathematics are utilized to systematically derive normal forms for reduced stochastic climate models for low-frequency variables. The use of a few Empirical Orthogonal Functions (EOFs) (also known as Principal Component Analysis, Karhunen–Loéve and Proper Orthogonal Decomposition) depending on observational data to span the low-frequency subspace requires the assessment of dyad interactions besides the more familiar triads in the interaction between the low- and high-frequency subspaces of the dynamics. It is shown below that the dyad and multiplicative triad interactions combine with the climatological linear operator interactions to simultaneously produce both strong nonlinear dissipation and Correlated Additive and Multiplicative (CAM) stochastic noise. For a single low-frequency variable the dyad interactions and climatological linear operator alone produce a normal form with CAM noise from advection of the large scales by the small scales and simultaneously strong cubic damping. These normal forms should prove useful for developing systematic strategies for the estimation of stochastic models from climate data. As an illustrative example the one-dimensional normal form is applied below to low-frequency patterns such as the North Atlantic Oscillation (NAO) in a climate model. The results here also illustrate the short comings of a recent linear scalar CAM noise model proposed elsewhere for low-frequency variability. PMID:19228943

  13. Differing forms, differing purposes: A typology of health impact assessment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harris-Roxas, Ben, E-mail: b.harris-roxas@unsw.edu.au; Harris, Elizabeth, E-mail: e.harris@unsw.edu.a

    2011-07-15

    There is currently considerable diversity in health impact assessment (HIA) practice internationally. Historically this diversity has been described as simple dichotomies, for example the differences between HIAs of projects and policies. However these distinctions have failed to adequately describe the differences that can be observed between different forms of HIAs. This paper describes the three historical and disciplinary fields from which HIA has emerged - environmental health, a social view of health, and health equity. It also puts forward a typology of four different forms of HIA that can be observed in current HIA practice: mandated, decision-support, advocacy, and community-ledmore » HIAs. This paper argues that these different forms of HIA serve different purposes and are not necessarily in competition; rather they allow HIA to be responsive to a range of population health concerns and purposes.« less

  14. The Triangulation Interview Form: A Possible Criterion for Field-Based Objectives.

    ERIC Educational Resources Information Center

    Licata, Joseph W.; Norman, Reuben L.

    1979-01-01

    To test the general reliability and validity of the Triangulation Interview Form (TIF), 52 observers viewed a videotape simulation of an interview situation. Agreement among observers for each of 16 TIF questions ranged from 85 to 98 percent. Observers significantly discriminated between eight behaviors judged complete and eight behaviors judged…

  15. Real-time molecular scale observation of crystal formation.

    PubMed

    Schreiber, Roy E; Houben, Lothar; Wolf, Sharon G; Leitus, Gregory; Lang, Zhong-Ling; Carbó, Jorge J; Poblet, Josep M; Neumann, Ronny

    2017-04-01

    How molecules in solution form crystal nuclei, which then grow into large crystals, is a poorly understood phenomenon. The classical mechanism of homogeneous crystal nucleation proceeds via the spontaneous random aggregation of species from liquid or solution. However, a non-classical mechanism suggests the formation of an amorphous dense phase that reorders to form stable crystal nuclei. So far it has remained an experimental challenge to observe the formation of crystal nuclei from five to thirty molecules. Here, using polyoxometallates, we show that the formation of small crystal nuclei is observable by cryogenic transmission electron microscopy. We observe both classical and non-classical nucleation processes, depending on the identity of the cation present. The experiments verify theoretical studies that suggest non-classical nucleation is the lower of the two energy pathways. The arrangement in just a seven-molecule proto-crystal matches the order found by X-ray diffraction of a single bulk crystal, which demonstrates that the same structure was formed in each case.

  16. CSO CO (2–1) and Spitzer IRAC observations of a bipolar outflow in high-mass star-forming region IRAS 22506+5944

    NASA Astrophysics Data System (ADS)

    Xie, Ze-Qiang; Qiu, Ke-Ping

    2018-02-01

    We present Caltech Submillimeter Observatory CO (2–1) and Spitzer IRAC observations toward IRAS 22506+5944, which is a 104 L ⊙ massive star-forming region. The CO (2–1) maps show an east-west bipolar molecular outflow originating from the 3 mm dust continuum peak. The Spitzer IRAC color-composite image reveals a pair of bow-shaped tips which are prominent in excess 4.5μm emission and are located at the leading fronts of the bipolar outflow, providing compelling evidence for the existence of bow-shocks as the driving agents of the molecular outflow. By comparing our CO (2–1) observations with previously published CO (1–0) data, we find that the CO (2–1)/(1–0) line ratio increases from low (∼5 kms‑1) to moderate (∼8–12 kms‑1) velocities, and then decreases at higher velocities. This is qualitatively consistent with the scenario that the molecular outflow is driven by multiple bow-shocks. We also revisit the position-velocity diagram of the CO (1–0) data, and find two spur structures along the outflow axis, which are further evidence for the presence of multiple jet bowshocks. Finally, power-law fittings to the mass spectrum of the outflow gives power law indexes more consistent with the jet bow-shock model than the wide-angle wind model.

  17. Forming Spirals From Shadows

    NASA Astrophysics Data System (ADS)

    Kohler, Susanna

    2016-07-01

    and right sides of the disks here). [Montesinos et al. 2016]Observations of Shadow SpiralsIn the authors models, two shadowed regions result in the formation of two spiral arms. The arms that develop start at a pitch angle of 1522, and gradually evolve to a shallower 1114 pitch at distances of ~65150 AU.The more luminous the central star, the more quickly the spiral arms form, due to the greater contrast between illuminated and shadowed disk regions: for a 0.25 solar-mass disk illuminated by a 1 solar-luminosity star, arms start to form after about 2500 orbits. If we increasethe stars brightness to 100 solar luminosities, the arms form after only 150 orbits.Montesinos and collaborators conclude by testing whether or not such spiral structures would be observable. They use a 3D radiative transfer code to produce scattered-light predictions of what the disk would look like to direct-imaging telescopes. They find that these shadow-induced spirals should be detectable.This first study clearly demonstrates that large-scale spiral density waves can form in protoplanetary disks without the presence of planets. The authors now plan to add more detailed physics to their models to better understand what we might observe when looking at systems that were shapedin this way.Density evolution in two shadowed disks. Top row: disk illuminated by a 100 L star, at 150, 250, and 500 orbits (from left to right). Bottom row: disk illuminated by a 1 L star, at 2500, 3500, and 4000 orbits. The rightmost top and bottom panels show control simulations (no shadows were present on the disk) after 1000 and 6000 orbits. (A different type of spiral starts to develop in the bottom control simulation as a result of a gravitational instability, but it never extends to the edges of the disk.) [Montesinos et al. 2016]CitationMatas Montesinos et al 2016 ApJ 823 L8. doi:10.3847/2041-8205/823/1/L8

  18. Free-flying dynamics and control of an astronaut assistant robot based on fuzzy sliding mode algorithm

    NASA Astrophysics Data System (ADS)

    Gao, Qing; Liu, Jinguo; Tian, Tongtong; Li, Yangmin

    2017-09-01

    Space robots can perform some tasks in harsh environment as assistants of astronauts or substitutions of astronauts. Taking the limited working time and the arduous task of the astronauts in the space station into account, an astronaut assistant robot (AAR-2) applied in the space station is proposed and designed in this paper. The AAR-2 is achieved with some improvements on the basis of AAR-1 which was designed before. It can exploit its position and attitude sensors and control system to free flight or hover in the space cabin. And it also has a definite environmental awareness and artificial intelligence to complete some specified tasks under the control of astronauts or autonomously. In this paper, it mainly analyzes and controls the 6-DOF motion of the AAR-2. Firstly, the system configuration of AAR-2 is specifically described, and the movement principles are analyzed. Secondly, according to the physical model of the AAR-2, the Newton - Euler equation is applied in the preparation of space dynamics model of 6-DOF motion. Then, according to the mathematical model's characteristics which are nonlinear and strong coupling, a dual closed loop position and attitude controller based on fuzzy sliding mode control is proposed and designed. Finally, simulation experiments are appropriate to provide for AAR-2 control system by using Matlab/Simulink. From the simulation results it can be observed that the designed fuzzy sliding mode controller can control the 6-DOF motion of AAR-2 quickly and precisely.

  19. Direct observation of the oxidation of DNA bases by phosphate radicals formed under radiation: a model of the backbone-to-base hole transfer.

    PubMed

    Ma, Jun; Marignier, Jean-Louis; Pernot, Pascal; Houée-Levin, Chantal; Kumar, Anil; Sevilla, Michael D; Adhikary, Amitava; Mostafavi, Mehran

    2018-05-30

    In irradiated DNA, by the base-to-base and backbone-to-base hole transfer processes, the hole (i.e., the unpaired spin) localizes on the most electropositive base, guanine. Phosphate radicals formed via ionization events in the DNA-backbone must play an important role in the backbone-to-base hole transfer process. However, earlier studies on irradiated hydrated DNA, on irradiated DNA-models in frozen aqueous solution and in neat dimethyl phosphate showed the formation of carbon-centered radicals and not phosphate radicals. Therefore, to model the backbone-to-base hole transfer process, we report picosecond pulse radiolysis studies of the reactions between H2PO4˙ with the DNA bases - G, A, T, and C in 6 M H3PO4 at 22 °C. The time-resolved observations show that in 6 M H3PO4, H2PO4˙ causes the one-electron oxidation of adenine, guanine and thymine, by forming the cation radicals via a single electron transfer (SET) process; however, the rate constant of the reaction of H2PO4˙ with cytosine is too low (<107 L mol-1 s-1) to be measured. The rates of these reactions are influenced by the protonation states and the reorganization energies of the base radicals and of the phosphate radical in 6 M H3PO4.

  20. Biocrust-forming mosses mitigate the impact of aridity on soil microbial communities in drylands: observational evidence from three continents.

    PubMed

    Delgado-Baquerizo, Manuel; Maestre, Fernando T; Eldridge, David J; Bowker, Matthew A; Jeffries, Thomas C; Singh, Brajesh K

    2018-04-02

    Recent research indicates that increased aridity linked to climate change will reduce the diversity of soil microbial communities and shift their community composition in drylands, Earth's largest biome. However, we lack both a theoretical framework and solid empirical evidence of how important biotic components from drylands, such as biocrust-forming mosses, will regulate the responses of microbial communities to expected increases in aridity with climate change. Here we report results from a cross-continental (North America, Europe and Australia) survey of 39 locations from arid to humid ecosystems, where we evaluated how biocrust-forming mosses regulate the relationship between aridity and the community composition and diversity of soil bacteria and fungi in dryland ecosystems. Increasing aridity was negatively related to the richness of fungi, and either positively or negatively related to the relative abundance of selected microbial phyla, when biocrust-forming mosses were absent. Conversely, we found an overall lack of relationship between aridity and the relative abundance and richness of microbial communities under biocrust-forming mosses. Our results suggest that biocrust-forming mosses mitigate the impact of aridity on the community composition of globally distributed microbial taxa, and the diversity of fungi. They emphasize the importance of maintaining biocrusts as a sanctuary for soil microbes in drylands. © 2018 The Authors. New Phytologist © 2018 New Phytologist Trust.

  1. Programmable diffractive optical elements for extending the depth of focus in ophthalmic optics

    NASA Astrophysics Data System (ADS)

    Romero, Lenny A.; Millán, María. S.; Jaroszewicz, Zbigniew; Kołodziejczyk, Andrzej

    2015-01-01

    The depth of focus (DOF) defines the axial range of high lateral resolution in the image space for object position. Optical devices with a traditional lens system typically have a limited DOF. However, there are applications such as in ophthalmology, which require a large DOF in comparison to a traditional optical system, this is commonly known as extended DOF (EDOF). In this paper we explore Programmable Diffractive Optical Elements (PDOEs), with EDOF, as an alternative solution to visual impairments, especially presbyopia. These DOEs were written onto a reflective liquid cystal on silicon (LCoS) spatial light modulator (SLM). Several designs of the elements are analyzed: the Forward Logarithmic Axicon (FLAX), the Axilens (AXL), the Light sword Optical Element (LSOE), the Peacock Eye Optical Element (PE) and Double Peacock Eye Optical Element (DPE). These elements focus an incident plane wave into a segment of the optical axis. The performances of the PDOEs are compared with those of multifocal lenses. In all cases, we obtained the point spread function and the image of an extended object. The results are presented and discussed.

  2. Non-Parametric Blur Map Regression for Depth of Field Extension.

    PubMed

    D'Andres, Laurent; Salvador, Jordi; Kochale, Axel; Susstrunk, Sabine

    2016-04-01

    Real camera systems have a limited depth of field (DOF) which may cause an image to be degraded due to visible misfocus or too shallow DOF. In this paper, we present a blind deblurring pipeline able to restore such images by slightly extending their DOF and recovering sharpness in regions slightly out of focus. To address this severely ill-posed problem, our algorithm relies first on the estimation of the spatially varying defocus blur. Drawing on local frequency image features, a machine learning approach based on the recently introduced regression tree fields is used to train a model able to regress a coherent defocus blur map of the image, labeling each pixel by the scale of a defocus point spread function. A non-blind spatially varying deblurring algorithm is then used to properly extend the DOF of the image. The good performance of our algorithm is assessed both quantitatively, using realistic ground truth data obtained with a novel approach based on a plenoptic camera, and qualitatively with real images.

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Unseren, M.A.

    This report proposes a method for resolving the kinematic redundancy of a serial link manipulator moving in a three-dimensional workspace. The underspecified problem of solving for the joint velocities based on the classical kinematic velocity model is transformed into a well-specified problem. This is accomplished by augmenting the original model with additional equations which relate a new vector variable quantifying the redundant degrees of freedom (DOF) to the joint velocities. The resulting augmented system yields a well specified solution for the joint velocities. Methods for selecting the redundant DOF quantifying variable and the transformation matrix relating it to the jointmore » velocities are presented so as to obtain a minimum Euclidean norm solution for the joint velocities. The approach is also applied to the problem of resolving the kinematic redundancy at the acceleration level. Upon resolving the kinematic redundancy, a rigid body dynamical model governing the gross motion of the manipulator is derived. A control architecture is suggested which according to the model, decouples the Cartesian space DOF and the redundant DOF.« less

  4. Input relegation control for gross motion of a kinematically redundant manipulator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Unseren, M.A.

    1992-10-01

    This report proposes a method for resolving the kinematic redundancy of a serial link manipulator moving in a three-dimensional workspace. The underspecified problem of solving for the joint velocities based on the classical kinematic velocity model is transformed into a well-specified problem. This is accomplished by augmenting the original model with additional equations which relate a new vector variable quantifying the redundant degrees of freedom (DOF) to the joint velocities. The resulting augmented system yields a well specified solution for the joint velocities. Methods for selecting the redundant DOF quantifying variable and the transformation matrix relating it to the jointmore » velocities are presented so as to obtain a minimum Euclidean norm solution for the joint velocities. The approach is also applied to the problem of resolving the kinematic redundancy at the acceleration level. Upon resolving the kinematic redundancy, a rigid body dynamical model governing the gross motion of the manipulator is derived. A control architecture is suggested which according to the model, decouples the Cartesian space DOF and the redundant DOF.« less

  5. State-space control of prosthetic hand shape.

    PubMed

    Velliste, M; McMorland, A J C; Diril, E; Clanton, S T; Schwartz, A B

    2012-01-01

    In the field of neuroprosthetic control, there is an emerging need for simplified control of high-dimensional devices. Advances in robotic technology have led to the development of prosthetic arms that now approach the look and number of degrees of freedom (DoF) of a natural arm. These arms, and especially hands, now have more controllable DoFs than the number of control DoFs available in many applications. In natural movements, high correlations exist between multiple joints, such as finger flexions. Therefore, discrepancy between the number of control and effector DoFs can be overcome by a control scheme that maps low-DoF control space to high-DoF joint space. Imperfect effectors, sensor noise and interactions with external objects require the use of feedback controllers. The incorporation of feedback in a system where the command is in a different space, however, is challenging, requiring a potentially difficult inverse high-DoF to low-DoF transformation. Here we present a solution to this problem based on the Extended Kalman Filter.

  6. Design and development of biomimetic quadruped robot for behavior studies of rats and mice.

    PubMed

    Ishii, Hiroyuki; Masuda, Yuichi; Miyagishima, Syunsuke; Fumino, Shogo; Takanishi, Atsuo; Laschi, Cecilia; Mazzolai, Barbara; Mattoli, Virgilio; Dario, Paolo

    2009-01-01

    This paper presents the design and development of a novel biomimetic quadruped robot for behavior studies of rats and mice. Many studies have been performed using these animals for the purpose of understanding human mind in psychology, pharmacology and brain science. In these fields, several experiments on social interactions have been performed using rats as basic studies of mental disorders or social learning. However, some researchers mention that the experiments on social interactions using animals are poorly-reproducible. Therefore, we consider that reproducibility of these experiments can be improved by using a robotic agent that interacts with an animal subject. Thus, we developed a small quadruped robot WR-2 (Waseda Rat No. 2) that behaves like a real rat. Proportion and DOF arrangement of WR-2 are designed based on those of a mature rat. This robot has four 3-DOF legs, a 2-DOF waist and a 1-DOF neck. A microcontroller and a wireless communication module are implemented on it. A battery is also implemented. Thus, it can walk, rear by limbs and groom its body.

  7. A study on model fidelity for model predictive control-based obstacle avoidance in high-speed autonomous ground vehicles

    NASA Astrophysics Data System (ADS)

    Liu, Jiechao; Jayakumar, Paramsothy; Stein, Jeffrey L.; Ersal, Tulga

    2016-11-01

    This paper investigates the level of model fidelity needed in order for a model predictive control (MPC)-based obstacle avoidance algorithm to be able to safely and quickly avoid obstacles even when the vehicle is close to its dynamic limits. The context of this work is large autonomous ground vehicles that manoeuvre at high speed within unknown, unstructured, flat environments and have significant vehicle dynamics-related constraints. Five different representations of vehicle dynamics models are considered: four variations of the two degrees-of-freedom (DoF) representation as lower fidelity models and a fourteen DoF representation with combined-slip Magic Formula tyre model as a higher fidelity model. It is concluded that the two DoF representation that accounts for tyre nonlinearities and longitudinal load transfer is necessary for the MPC-based obstacle avoidance algorithm in order to operate the vehicle at its limits within an environment that includes large obstacles. For less challenging environments, however, the two DoF representation with linear tyre model and constant axle loads is sufficient.

  8. Communication: importance sampling including path correlation in semiclassical initial value representation calculations for time correlation functions.

    PubMed

    Pan, Feng; Tao, Guohua

    2013-03-07

    Full semiclassical (SC) initial value representation (IVR) for time correlation functions involves a double phase space average over a set of two phase points, each of which evolves along a classical path. Conventionally, the two initial phase points are sampled independently for all degrees of freedom (DOF) in the Monte Carlo procedure. Here, we present an efficient importance sampling scheme by including the path correlation between the two initial phase points for the bath DOF, which greatly improves the performance of the SC-IVR calculations for large molecular systems. Satisfactory convergence in the study of quantum coherence in vibrational relaxation has been achieved for a benchmark system-bath model with up to 21 DOF.

  9. A kinematic analysis of the modified flight telerobotic servicer manipulator system

    NASA Technical Reports Server (NTRS)

    Crane, Carl; Carnahan, Tim; Duffy, Joseph

    1992-01-01

    A reverse kinematic analysis is presented of a six-DOF subchain of a modified seven-DOF flight telerobotic servicer manipulator system. The six-DOF subchain is designated as a TR-RT chain, which describes the sequence of manipulator joints beginning with the first grounded hook joint (universal joint) T, where the sequence R-R designates a pair of revolute joints with parallel axes. At the outset, it had been thought that the reverse kinematic analysis would be similar to a TTT manipulator previously analyzed, in which the third and fourth joints intersected at a finite point. However, this is shown not the case, and a 16th-degree tan-half-angle polynomial is derived for the TR-RT manipulator.

  10. [Clinical forms of major depressive states observed in the Ivory Coast. Classification trial].

    PubMed

    Megglé, D; Série, E; Veillon, F; Delafosse, J; Hazera, M

    1989-12-01

    After a previous analysis of African depressions in studies based on the use of D.S.M. III as a preliminary tool, the authors are now seeking to understand more directly the different ways for depressed Ivorians to express the lowering of self-esteem, as well as the various meanings of agitation observed among them. An attempt of nosographic classification, closely linked with local reality, has been extracted from this material by the authors.

  11. Urban forms, physical activity and body mass index: a cross-city examination using ISS Earth Observation photographs

    NASA Technical Reports Server (NTRS)

    Lin, Ge

    2005-01-01

    Johnson Space Center has archived thousands of astronauts acquired Earth images. Some spectacular images have been widely used in news media and in k-12 class room, but their potential utilizations in health promotion and disease prevention have relatively untapped. The project uses daytime ISS photographs to define city forms and links them to city or metropolitan level health data in a multicity context. Road connectivity, landuse mix and Shannon's information indices were used in the classification of photographs. In contrast to previous remote-sensing studies, which tend to focus on a single city or a portion of a city, this project utilized photographs of 39 U.S. cities. And in contrast to previous health-promotion studies on the built environment, which tend to rely on survey respondents' responses to evaluate road connectivity or mixed land use for a single study site, the project examined the built environments of multiple cities based on ISS photos. It was found that road connectivity and landuse mix were not statistically significant by themselves, but the composite measure of the Shannon index was significantly associated with physical activity, but not BMI. Consequently, leisure-time physical activity seems to be positively associated with the urban complexity scale. It was also concluded that unless they are planned or designed in advance, photographs taken by astronauts generally are not appropriate for a study of a single-site built environment nor are they appropriate for a study of infectious diseases at a local scale. To link urban built environment with city-wide health indicators, both the traditional nadir view and oblique views should be emphasized in future astronauts' earth observation photographs.

  12. The Duke of Edinburgh's Award: A "Simply Brilliant" Program

    ERIC Educational Resources Information Center

    Lico, Abner

    2008-01-01

    While speaking to Gold Award Achievers in Toronto in 2002, Tony Comper, past President and Chief Executive Officer of the BMO Financial Group, referred to the Duke of Edinburgh's (DofE) Award as a program "so brilliantly simple, it's simply brilliant." This ironic statement has echoed in the Ontario division of the DofE Award ever since.…

  13. CSI related dynamics and control issues in space robotics

    NASA Technical Reports Server (NTRS)

    Schmitz, Eric; Ramey, Madison

    1993-01-01

    The research addressed includes: (1) CSI issues in space robotics; (2) control of elastic payloads, which includes 1-DOF example, and 3-DOF harmonic drive arm with elastic beam; and (3) control of large space arms with elastic links, which includes testbed description, modeling, and experimental implementation of colocated PD and end-point tip position controllers.

  14. 76 FR 61725 - Agency Information Collection Activities: Case Submission Form, Case Assistance Form; (Form DHS...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-05

    ..., Case Assistance Form; (Form DHS-7001), Online Ombudsman Form DHS-7001 AGENCY: Office of the Citizenship... System'' to ``Online Ombudsman Form DHS-7001''. The instructions have been updated to reflect the... Services Ombudsman--001 Virtual Ombudsman System (March 2010) to reflect the name change to Online...

  15. Piezoelectrically Actuated Robotic System for MRI-Guided Prostate Percutaneous Therapy

    PubMed Central

    Su, Hao; Shang, Weijian; Cole, Gregory; Li, Gang; Harrington, Kevin; Camilo, Alexander; Tokuda, Junichi; Tempany, Clare M.; Hata, Nobuhiko; Fischer, Gregory S.

    2014-01-01

    This paper presents a fully-actuated robotic system for percutaneous prostate therapy under continuously acquired live magnetic resonance imaging (MRI) guidance. The system is composed of modular hardware and software to support the surgical workflow of intra-operative MRI-guided surgical procedures. We present the development of a 6-degree-of-freedom (DOF) needle placement robot for transperineal prostate interventions. The robot consists of a 3-DOF needle driver module and a 3-DOF Cartesian motion module. The needle driver provides needle cannula translation and rotation (2-DOF) and stylet translation (1-DOF). A custom robot controller consisting of multiple piezoelectric motor drivers provides precision closed-loop control of piezoelectric motors and enables simultaneous robot motion and MR imaging. The developed modular robot control interface software performs image-based registration, kinematics calculation, and exchanges robot commands and coordinates between the navigation software and the robot controller with a new implementation of the open network communication protocol OpenIGTLink. Comprehensive compatibility of the robot is evaluated inside a 3-Tesla MRI scanner using standard imaging sequences and the signal-to-noise ratio (SNR) loss is limited to 15%. The image deterioration due to the present and motion of robot demonstrates unobservable image interference. Twenty-five targeted needle placements inside gelatin phantoms utilizing an 18-gauge ceramic needle demonstrated 0.87 mm root mean square (RMS) error in 3D Euclidean distance based on MRI volume segmentation of the image-guided robotic needle placement procedure. PMID:26412962

  16. Novel Door-opening Method for Six-legged Robots Based on Only Force Sensing

    NASA Astrophysics Data System (ADS)

    Chen, Zhi-Jun; Gao, Feng; Pan, Yang

    2017-09-01

    Current door-opening methods are mainly developed on tracked, wheeled and biped robots by applying multi-DOF manipulators and vision systems. However, door-opening methods for six-legged robots are seldom studied, especially using 0-DOF tools to operate and only force sensing to detect. A novel door-opening method for six-legged robots is developed and implemented to the six-parallel-legged robot. The kinematic model of the six-parallel-legged robot is established and the model of measuring the positional relationship between the robot and the door is proposed. The measurement model is completely based on only force sensing. The real-time trajectory planning method and the control strategy are designed. The trajectory planning method allows the maximum angle between the sagittal axis of the robot body and the normal line of the door plane to be 45º. A 0-DOF tool mounted to the robot body is applied to operate. By integrating with the body, the tool has 6 DOFs and enough workspace to operate. The loose grasp achieved by the tool helps release the inner force in the tool. Experiments are carried out to validate the method. The results show that the method is effective and robust in opening doors wider than 1 m. This paper proposes a novel door-opening method for six-legged robots, which notably uses a 0-DOF tool and only force sensing to detect and open the door.

  17. Alternative High-Performance Ceramic Waste Forms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sundaram, S. K.

    This final report (M5NU-12-NY-AU # 0202-0410) summarizes the results of the project titled “Alternative High-Performance Ceramic Waste Forms,” funded in FY12 by the Nuclear Energy University Program (NEUP Project # 12-3809) being led by Alfred University in collaboration with Savannah River National Laboratory (SRNL). The overall focus of the project is to advance fundamental understanding of crystalline ceramic waste forms and to demonstrate their viability as alternative waste forms to borosilicate glasses. We processed single- and multiphase hollandite waste forms based on simulated waste streams compositions provided by SRNL based on the advanced fuel cycle initiative (AFCI) aqueous separation process developed in the Fuel Cycle Research and Development (FCR&D). For multiphase simulated waste forms, oxide and carbonate precursors were mixed together via ball milling with deionized water using zirconia media in a polyethylene jar for 2 h. The slurry was dried overnight and then separated from the media. The blended powders were then subjected to melting or spark plasma sintering (SPS) processes. Microstructural evolution and phase assemblages of these samples were studied using x-ray diffraction (XRD), scanning electron microscopy (SEM), energy dispersion analysis of x-rays (EDAX), wavelength dispersive spectrometry (WDS), transmission electron spectroscopy (TEM), selective area x-ray diffraction (SAXD), and electron backscatter diffraction (EBSD). These results showed that the processing methods have significant effect on the microstructure and thus the performance of these waste forms. The Ce substitution into zirconolite and pyrochlore materials was investigated using a combination of experimental (in situ XRD and x-ray absorption near edge structure (XANES)) and modeling techniques to study these single phases independently. In zirconolite materials, a transition from the 2M to the 4M polymorph was observed with increasing Ce content. The resulting

  18. A European Humus Forms Reference Base

    NASA Astrophysics Data System (ADS)

    Zanella, A.; Englisch, M.; Ponge, J.-F.; Jabiol, B.; Sartori, G.; Gardi, C.

    2012-04-01

    the European Geosciences Union with the aim to stimulate members' curiosity. Interested people are invited to test the classification system in various field areas and to collaborate with the Humus group. Critical observations and field data/impressions are welcome as every other suggestions which can help in elaborating the 2013 version of the European humus forms classification.

  19. Alternate Forms Reliability of the Behavioral Relaxation Scale: Preliminary Results

    ERIC Educational Resources Information Center

    Lundervold, Duane A.; Dunlap, Angel L.

    2006-01-01

    Alternate forms reliability of the Behavioral Relaxation Scale (BRS; Poppen,1998), a direct observation measure of relaxed behavior, was examined. A single BRS score, based on long duration observation (5-minute), has been found to be a valid measure of relaxation and is correlated with self-report and some physiological measures. Recently,…

  20. Multivariable Dynamic Ankle Mechanical Impedance With Relaxed Muscles

    PubMed Central

    Lee, Hyunglae; Krebs, Hermano Igo; Hogan, Neville

    2015-01-01

    Neurological or biomechanical disorders may distort ankle mechanical impedance and thereby impair locomotor function. This paper presents a quantitative characterization of multivariable ankle mechanical impedance of young healthy subjects when their muscles were relaxed, to serve as a baseline to compare with pathophysiological ankle properties of biomechanically and/or neurologically impaired patients. Measurements using a highly backdrivable wearable ankle robot combined with multi-input multi-output stochastic system identification methods enabled reliable characterization of ankle mechanical impedance in two degrees-of-freedom (DOFs) simultaneously, the sagittal and frontal planes. The characterization included important ankle properties unavailable from single DOF studies: coupling between DOFs and anisotropy as a function of frequency. Ankle impedance in joint coordinates showed responses largely consistent with a second-order system consisting of inertia, viscosity, and stiffness in both seated (knee flexed) and standing (knee straightened) postures. Stiffness in the sagittal plane was greater than in the frontal plane and furthermore, was greater when standing than when seated, most likely due to the stretch of bi-articular muscles (medial and lateral gastrocnemius). Very low off-diagonal partial coherences implied negligible coupling between dorsiflexion-plantarflexion and inversion-eversion. The directions of principal axes were tilted slightly counterclockwise from the original joint coordinates. The directional variation (anisotropy) of ankle impedance in the 2-D space formed by rotations in the sagittal and frontal planes exhibited a characteristic “peanut” shape, weak in inversion-eversion over a wide range of frequencies from the stiffness dominated region up to the inertia dominated region. Implications for the assessment of neurological and biomechanical impairments are discussed. PMID:24686292

  1. Newly Formed Dust in the Core-Collapse Supernova Remnant E0102

    NASA Astrophysics Data System (ADS)

    Ludwig, Bethany; Sandstrom, Karin; Bolatto, Alberto

    2018-01-01

    The mechanism of interstellar dust formation is a matter of continuing debate. In the very early universe, some high redshift galaxies are observed to have a substantial amount of dust. This has led to the suggestion that core collapse supernovae must be the producers of much of the dust in the universe. However, most observed supernova remnants (SNRs) in the local universe have measured dust yields far below the necessary levels. Cassiopeia A and SN 1987A are exceptions--in these young remnants, Herschel Space Observatory observations found large quantities of newly-formed dust. In these two cases, the SNR is young enough that the reverse shock has not yet interacted with most of the newly formed dust. To study supernova dust production, we observe SNR 1E0102.2-7219, which is approximately 1000 years old with a reverse shock that has only reached into a small part of its ejecta making it an excellent candidate to search for newly formed dust that has not yet been destroyed by those shocks. Using Herschel data, we carefully model the background around the remnant to remove emission that is unrelated to the SNR. We then measure the mass, temperature, and chemical composition of the dust by fitting the spectral energy distribution. Our findings reveal a substantial amount of previously undetected cold dust in the remnant, suggesting that indeed core collapse supernovae may host substantial amounts of newly formed dust, at least prior to the passage of the reverse shock.

  2. Super-Quantum Mechanics in the Integral Form Formalism

    NASA Astrophysics Data System (ADS)

    Castellani, L.; Catenacci, R.; Grassi, P. A.

    2018-05-01

    We reformulate Super Quantum Mechanics in the context of integral forms. This framework allows to interpolate between different actions for the same theory, connected by different choices of Picture Changing Operators (PCO). In this way we retrieve component and superspace actions, and prove their equivalence. The PCO are closed integral forms, and can be interpreted as super Poincar\\'e duals of bosonic submanifolds embedded into a supermanifold.. We use them to construct Lagrangians that are top integral forms, and therefore can be integrated on the whole supermanifold. The $D=1, ~N=1$ and the $D=1,~ N=2$ cases are studied, in a flat and in a curved supermanifold. In this formalism we also consider coupling with gauge fields, Hilbert space of quantum states and observables.

  3. Protein particulates: another generic form of protein aggregation?

    PubMed

    Krebs, Mark R H; Devlin, Glyn L; Donald, A M

    2007-02-15

    Protein aggregation is a problem with a multitude of consequences, ranging from affecting protein expression to its implication in many diseases. Of recent interest is the specific form of aggregation leading to the formation of amyloid fibrils, structures associated with diseases such as Alzheimer's disease. The ability to form amyloid fibrils is now regarded as a property generic to all polypeptide chains. Here we show that around the isoelectric point a different generic form of aggregation can also occur by studying seven widely different, nonrelated proteins that are also all known to form amyloid fibrils. Under these conditions gels consisting of relatively monodisperse spherical particulates are formed. Although these gels have been described before for beta-lactoglobulin, our results suggest that the formation of particulates in the regime where charge on the molecules is minimal is a common property of all proteins. Because the proteins used here also form amyloid fibrils, we further propose that protein misfolding into clearly defined aggregates is a generic process whose outcome depends solely on the general properties of the state the protein is in when aggregation occurs, rather than the specific amino acid sequence. Thus under conditions of high net charge, amyloid fibrils form, whereas under conditions of low net charge, particulates form. This observation furthermore suggests that the rules of soft matter physics apply to these systems.

  4. 77 FR 22834 - Reports, Forms, and Recordkeeping Requirements

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-17

    ... through one of the following methods: Federal eRulemaking Portal: Go to http://www.regulations.gov... INFORMATION CONTACT: Lisandra Garay-Vega, 202-366-1412, Vehicle Safety Research, National Highway Traffic... of human subjects for observational experiments to test auditory perception of vehicle sounds. Form...

  5. Distributions of Dusty Star Forming Region in Local Starburst Galaxies

    NASA Astrophysics Data System (ADS)

    Tateuchi, K.; Motohara, K.; Konishi, M.; Takahashi, H.; Kato, N.; Kitagawa, Y.; Yoshii, Y.; Doi, M.; Kohno, K.; Kawara, K.; Tanaka, M.; Miyata, T.; Tanabe, T.; Minezaki, T.; Sako, S.; Morokuma, T.; Tamura, Y.; Aoki, T.; Soyano, T.; Tarusawa, K.; Koshida, S.; Kamizuka, T.; Asano, K.; Uchiyama, M.; Okada, K.

    2013-10-01

    Since the first light observation of ANIR in June 2009, we have been carrying out a Paα narrow-band imaging survey of nearby luminous infrared galaxies (LIRGs). Because Paα is the strongest hydrogen recombination line in the infrared wavelength ranges, it is a good and direct tracer of dust-enshrouded star forming regions, and enables us to probe the star formation activities in LIRGs. We find that LIRGs have two star-forming modes. The origin of the two modes probably come from differences between merging stage and/or star-forming process.

  6. The structure of the nucleon: Elastic electromagnetic form factors

    DOE PAGES

    Punjabi, V.; Perdrisat, C. F.; Jones, M. K.; ...

    2015-07-10

    Precise proton and neutron form factor measurements at Jefferson Lab, using spin observables, have recently made a significant contribution to the unraveling of the internal structure of the nucleon. Accurate experimental measurements of the nucleon form factors are a test-bed for understanding how the nucleon's static properties and dynamical behavior emerge from QCD, the theory of the strong interactions between quarks. There has been enormous theoretical progress, since the publication of the Jefferson Lab proton form factor ratio data, aiming at reevaluating the picture of the nucleon. We will review the experimental and theoretical developments in this field and discussmore » the outlook for the future.« less

  7. Membrane triangles with corner drilling freedoms. I - The EFF element

    NASA Technical Reports Server (NTRS)

    Alvin, Ken; De La Fuente, Horacio M.; Haugen, Bjorn; Felippa, Carlos A.

    1992-01-01

    The formulation of 3-node 9-DOF membrane elements with normal-to-element-plane rotations (drilling freedoms) is examined in the context of parametrized variational principles. In particular, attention is given to the application of the extended free formulation (EFF) to the construction of a triangular membrane element with drilling freedoms that initially has complete quadratic polynomial expansions in each displacement component. The main advantage of the EFF over the free formulation triangle is that an explicit form is obtained for the higher-order stiffness.

  8. Evaluation of Barrier Treatments on Native Vegetation in a Southern California Desert Habitat

    DTIC Science & Technology

    2009-01-01

    B . LOTHROP,3 MELISSA SNELLING,3 ARTURO GUTIERREZ3 AND HUGH D...OF PAGES 10 19a. NAME OF RESPONSIBLE PERSON a. REPORT unclassified b . ABSTRACT unclassified c. THIS PAGE unclassified Standard Form 298 (Rev...treatment of artificial surfacesT a b le 2 . C u le x ta rs a li s co ll ec te d in m o sq u it o tr a p s in th e 9 st u d y p lo ts . C o u n ts a

  9. Learning by Observing a Peer's Teaching Situation

    ERIC Educational Resources Information Center

    Hendry, Graham D.; Bell, Amani; Thomson, Kate

    2014-01-01

    This article reports on a study of academics who observed their colleagues' teaching at a large research-intensive university in Australia. These academics had completed peer observation as part of a foundations programme designed for those new to teaching or new to the university. Survey responses and interview transcripts form the basis of an…

  10. A Study on Ganui-Dae's External Form and Its Modeling for Ganui-Dae's External Form and Its Modeling for Restoration

    NASA Astrophysics Data System (ADS)

    Lee, Min-Soo; Lee, Yong Sam; Jeon, Jun Hyeok; Kim, Sang Hyuk

    2013-12-01

    Ganui-Dae, built in the reign of King Sejong, Joseon Dynasty, is a comprehensive observatory. It has various instruments for observation and time signal such as Ganui, Gyupyo(Gnomon), water-hammering type Honui and Honsang, and so on. Studying on Ganui-Dae has been focused on its location, history, criterion, etc, so far. However, studying on its external form and construction method has been conducted insufficiently. This study suggests the model for restoration of Ganui-Dae. The model is based on the analysis about external form of Ganui-Dae in various antique maps, and its construction method in those days.

  11. High-fidelity cluster state generation for ultracold atoms in an optical lattice.

    PubMed

    Inaba, Kensuke; Tokunaga, Yuuki; Tamaki, Kiyoshi; Igeta, Kazuhiro; Yamashita, Makoto

    2014-03-21

    We propose a method for generating high-fidelity multipartite spin entanglement of ultracold atoms in an optical lattice in a short operation time with a scalable manner, which is suitable for measurement-based quantum computation. To perform the desired operations based on the perturbative spin-spin interactions, we propose to actively utilize the extra degrees of freedom (DOFs) usually neglected in the perturbative treatment but included in the Hubbard Hamiltonian of atoms, such as, (pseudo-)charge and orbital DOFs. Our method simultaneously achieves high fidelity, short operation time, and scalability by overcoming the following fundamental problem: enhancing the interaction strength for shortening the operation time breaks the perturbative condition of the interaction and inevitably induces unwanted correlations among the spin and extra DOFs.

  12. Six degree of freedom sensor

    DOEpatents

    Vann, Charles S.

    1999-01-01

    This small, non-contact optical sensor increases the capability and flexibility of computer controlled machines by detecting its relative position to a workpiece in all six degrees of freedom (DOF). At a fraction of the cost, it is over 200 times faster and up to 25 times more accurate than competing 3-DOF sensors. Applications range from flexible manufacturing to a 6-DOF mouse for computers. Until now, highly agile and accurate machines have been limited by their inability to adjust to changes in their tasks. By enabling them to sense all six degrees of position, these machines can now adapt to new and complicated tasks without human intervention or delay--simplifying production, reducing costs, and enhancing the value and capability of flexible manufacturing.

  13. Six degree of freedom sensor

    DOEpatents

    Vann, C.S.

    1999-03-16

    This small, non-contact optical sensor increases the capability and flexibility of computer controlled machines by detecting its relative position to a workpiece in all six degrees of freedom (DOF). At a fraction of the cost, it is over 200 times faster and up to 25 times more accurate than competing 3-DOF sensors. Applications range from flexible manufacturing to a 6-DOF mouse for computers. Until now, highly agile and accurate machines have been limited by their inability to adjust to changes in their tasks. By enabling them to sense all six degrees of position, these machines can now adapt to new and complicated tasks without human intervention or delay--simplifying production, reducing costs, and enhancing the value and capability of flexible manufacturing. 3 figs.

  14. Bedforms formed by experimental supercritical density flows

    NASA Astrophysics Data System (ADS)

    Naruse, Hajime; Izumi, Norihiro; Yokokawa, Miwa; Muto, Tetsuji

    2014-05-01

    This study reveals characteristics and formative conditions of bedforms produced by saline density flows in supercritical flow conditions, especially focusing on the mechanism of the formation of plane bed. The motion of sediment particles forming bedforms was resolved by high-speed cameras (1/1000 frame/seconds). Experimental density flows were produced by mixtures of salt water (1.01-1.04 in density) and plastic particles (1.5 in specific density, 140 or 240 mm in diameter). Salt water and plastic particles are analogue materials of muddy water and sand particles in turbidity currents respectively. Acrylic flume (4.0 m long, 2.0 cm wide and 0.5 m deep) was submerged in an experimental tank (6.0 m long, 1.8 m wide and 1.2 m deep) that was filled by clear water. Features of bedforms were observed when the bed state in the flume reached equilibrium condition. The experimental conditions range 1.5-4.2 in densimetric Froude number and 0.2-0.8 in Shields dimensionless stress. We report the two major discoveries as a result of the flume experiments: (1) Plane bed under Froude-supercritical flows and (2) Geometrical characteristics of cyclic steps formed by density flows. (1) Plane bed was formed under the condition of supercritical flow regime. In previous studies, plane bed has been known to be formed by subcritical unidirectional flows (ca. 0.8 in Froude number). However, this study implies that plane bed can also be formed by supercritical conditions with high Shields dimensionless stress (>0.4) and very high Froude number (> 4.0). This discovery may suggest that previous estimations of paleo-hydraulic conditions of parallel lamination in turbidites should be reconsidered. The previous experimental studies and data from high-speed camera suggest that the region of plane bed formation coincides with the region of the sheet flow developments. The particle transport in sheet flow (thick bedload layer) induces transform of profile of flow shear stress, which may be

  15. The APOGEE-2 Survey of the Orion Star-forming Complex. I. Target Selection and Validation with Early Observations

    NASA Astrophysics Data System (ADS)

    Cottle, J.’Neil; Covey, Kevin R.; Suárez, Genaro; Román-Zúñiga, Carlos; Schlafly, Edward; Downes, Juan Jose; Ybarra, Jason E.; Hernandez, Jesus; Stassun, Keivan; Stringfellow, Guy S.; Getman, Konstantin; Feigelson, Eric; Borissova, Jura; Kim, J. Serena; Roman-Lopes, A.; Da Rio, Nicola; De Lee, Nathan; Frinchaboy, Peter M.; Kounkel, Marina; Majewski, Steven R.; Mennickent, Ronald E.; Nidever, David L.; Nitschelm, Christian; Pan, Kaike; Shetrone, Matthew; Zasowski, Gail; Chambers, Ken; Magnier, Eugene; Valenti, Jeff

    2018-06-01

    The Orion Star-forming Complex (OSFC) is a central target for the APOGEE-2 Young Cluster Survey. Existing membership catalogs span limited portions of the OSFC, reflecting the difficulty of selecting targets homogeneously across this extended, highly structured region. We have used data from wide-field photometric surveys to produce a less biased parent sample of young stellar objects (YSOs) with infrared (IR) excesses indicative of warm circumstellar material or photometric variability at optical wavelengths across the full 420 square degree extent of the OSFC. When restricted to YSO candidates with H < 12.4, to ensure S/N ∼ 100 for a six-visit source, this uniformly selected sample includes 1307 IR excess sources selected using criteria vetted by Koenig & Liesawitz (2014) and 990 optical variables identified in the Pan-STARRS1 3π survey: 319 sources exhibit both optical variability and evidence of circumstellar disks through IR excess. Objects from this uniformly selected sample received the highest priority for targeting, but required fewer than half of the fibers on each APOGEE-2 plate. We filled the remaining fibers with previously confirmed and new color–magnitude selected candidate OSFC members. Radial velocity measurements from APOGEE-1 and new APOGEE-2 observations taken in the survey’s first year indicate that ∼90% of the uniformly selected targets have radial velocities consistent with Orion membership. The APOGEE-2 Orion survey will include >1100 bona fide YSOs whose uniform selection function will provide a robust sample for comparative analyses of the stellar populations and properties across all sub-regions of Orion.

  16. A comparison of form processing involved in the perception of biological and nonbiological movements

    PubMed Central

    Thurman, Steven M.; Lu, Hongjing

    2016-01-01

    Although there is evidence for specialization in the human brain for processing biological motion per se, few studies have directly examined the specialization of form processing in biological motion perception. The current study was designed to systematically compare form processing in perception of biological (human walkers) to nonbiological (rotating squares) stimuli. Dynamic form-based stimuli were constructed with conflicting form cues (position and orientation), such that the objects were perceived to be moving ambiguously in two directions at once. In Experiment 1, we used the classification image technique to examine how local form cues are integrated across space and time in a bottom-up manner. By comparing with a Bayesian observer model that embodies generic principles of form analysis (e.g., template matching) and integrates form information according to cue reliability, we found that human observers employ domain-general processes to recognize both human actions and nonbiological object movements. Experiments 2 and 3 found differential top-down effects of spatial context on perception of biological and nonbiological forms. When a background does not involve social information, observers are biased to perceive foreground object movements in the direction opposite to surrounding motion. However, when a background involves social cues, such as a crowd of similar objects, perception is biased toward the same direction as the crowd for biological walking stimuli, but not for rotating nonbiological stimuli. The model provided an accurate account of top-down modulations by adjusting the prior probabilities associated with the internal templates, demonstrating the power and flexibility of the Bayesian approach for visual form perception. PMID:26746875

  17. Maass Forms and Quantum Modular Forms

    NASA Astrophysics Data System (ADS)

    Rolen, Larry

    This thesis describes several new results in the theory of harmonic Maass forms and related objects. Maass forms have recently led to a flood of applications throughout number theory and combinatorics in recent years, especially following their development by the work of Bruinier and Funke the modern understanding Ramanujan's mock theta functions due to Zwegers. The first of three main theorems discussed in this thesis concerns the integrality properties of singular moduli. These are well-known to be algebraic integers, and they play a beautiful role in complex multiplication and explicit class field theory for imaginary quadratic fields. One can also study "singular moduli" for special non-holomorphic functions, which are algebraic but are not necessarily algebraic integers. Here we will explain the phenomenon of integrality properties and provide a sharp bound on denominators of symmetric functions in singular moduli. The second main theme of the thesis concerns Zagier's recent definition of a quantum modular form. Since their definition in 2010 by Zagier, quantum modular forms have been connected to numerous different topics such as strongly unimodal sequences, ranks, cranks, and asymptotics for mock theta functions. Motivated by Zagier's example of the quantum modularity of Kontsevich's "strange" function F(q), we revisit work of Andrews, Jimenez-Urroz, and Ono to construct a natural vector-valued quantum modular form whose components. The final chapter of this thesis is devoted to a study of asymptotics of mock theta functions near roots of unity. In his famous deathbed letter, Ramanujan introduced the notion of a mock theta function, and he offered some alleged examples. The theory of mock theta functions has been brought to fruition using the framework of harmonic Maass forms, thanks to Zwegers. Despite this understanding, little attention has been given to Ramanujan's original definition. Here we prove that Ramanujan's examples do indeed satisfy his

  18. [Comparison of induction L-form of Staphylococcus epidermidis, Staphylococcus haemolyticus by cefazolin].

    PubMed

    Wróblewska, Joanna; Gospodarek, Eugenia; Sekowska, Alicja; Mikołajczyk, Dorota; Janicka, Grazyna

    2008-12-01

    The L-forms of bacteria have not been studied carefully yet, because it is difficult to detect them in Gram stain reactions by light microscopy. They can be cultured on specialized hypertonic medium. We don't find any reports about intentional in vitro induction and assessment of frequency of L-forms of S. epidermidis and S. haemolyticus on the medium. to evaluate the frequency of induction of L-forms by Coagulase Negative Staphylococci. This thesis examines, if the source of isolation from clinical materials has an influence on the frequency of occurrence of cell-wall deficient bacteria. 52 strains of S. epidermidis, 52 strains of S. haemolyticus were analysed. After 13 S. epidermidis and S. haemolyticus strains were isolated from blood, urine, biomaterials, changed surface skin from patients of University Hospital in Bydgoszcz. S. epidermidis and S. haemolyticus strains were tested for induction of L-forms the methods of Owens (1988). It was observed that four (7.7%) strains of and S. haemolyticus transformed into L-forms. S. epidermidis strains isolated from blood induced L-forms (two strains), from urine and biomaterial (one strain). It was observed that strains of S. haemolyticus which have been isolated from blood and urine induced L-forms (three strains and one respectively). This study suggest that L-form induction in S. epidermidis and of S. haemolyticus strains is not correlated with sample origin from which the strains had been isolated. S. epidermidis and S. haemolyticus strains produce L-forms rarely.

  19. Phosphorus forms in Alabama decatur silt loam with upland cotton production

    USDA-ARS?s Scientific Manuscript database

    Alabama was historically known as "The Cotton State." It ranks 4th with 10.1% of U.S. cotton production. We assessed the forms and labile P in the Alabama Decatur silt loam cotton soils, and evaluated the impact of management practices on the soil P forms. We observed that manure and inorganic ferti...

  20. FormTracer. A mathematica tracing package using FORM

    NASA Astrophysics Data System (ADS)

    Cyrol, Anton K.; Mitter, Mario; Strodthoff, Nils

    2017-10-01

    We present FormTracer, a high-performance, general purpose, easy-to-use Mathematica tracing package which uses FORM. It supports arbitrary space and spinor dimensions as well as an arbitrary number of simple compact Lie groups. While keeping the usability of the Mathematica interface, it relies on the efficiency of FORM. An additional performance gain is achieved by a decomposition algorithm that avoids redundant traces in the product tensors spaces. FormTracer supports a wide range of syntaxes which endows it with a high flexibility. Mathematica notebooks that automatically install the package and guide the user through performing standard traces in space-time, spinor and gauge-group spaces are provided. Program Files doi:http://dx.doi.org/10.17632/7rd29h4p3m.1 Licensing provisions: GPLv3 Programming language: Mathematica and FORM Nature of problem: Efficiently compute traces of large expressions Solution method: The expression to be traced is decomposed into its subspaces by a recursive Mathematica expansion algorithm. The result is subsequently translated to a FORM script that takes the traces. After FORM is executed, the final result is either imported into Mathematica or exported as optimized C/C++/Fortran code. Unusual features: The outstanding features of FormTracer are the simple interface, the capability to efficiently handle an arbitrary number of Lie groups in addition to Dirac and Lorentz tensors, and a customizable input-syntax.

  1. Performance analysis of two-degree of freedom fractional order PID controllers for robotic manipulator with payload.

    PubMed

    Sharma, Richa; Gaur, Prerna; Mittal, A P

    2015-09-01

    The robotic manipulators are multi-input multi-output (MIMO), coupled and highly nonlinear systems. The presence of external disturbances and time-varying parameters adversely affects the performance of these systems. Therefore, the controller designed for these systems should effectively deal with such complexities, and it is an intriguing task for control engineers. This paper presents two-degree of freedom fractional order proportional-integral-derivative (2-DOF FOPID) controller scheme for a two-link planar rigid robotic manipulator with payload for trajectory tracking task. The tuning of all controller parameters is done using cuckoo search algorithm (CSA). The performance of proposed 2-DOF FOPID controllers is compared with those of their integer order designs, i.e., 2-DOF PID controllers, and with the traditional PID controllers. In order to show effectiveness of proposed scheme, the robustness testing is carried out for model uncertainties, payload variations with time, external disturbance and random noise. Numerical simulation results indicate that the 2-DOF FOPID controllers are superior to their integer order counterparts and the traditional PID controllers. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

  2. Forward kinematic analysis of in-vivo robot for stomach biopsy.

    PubMed

    Sutar, Mihir Kumar; Pathak, P M; Sharma, A K; Mehta, N K; Gupta, V K

    2013-09-01

    The introduction of robotic medical assistance in biopsy and stomach cavity exploration is one of the most important milestones in the field of medical science. The research is still in its infancy and many issues like limitations in dexterity, control, and abdominal cavity vision are the main concerns of many researchers around the globe. This paper presents the design aspects and the kinematic analysis of a 4 degrees of freedom (DOF) hyper-redundant in-vivo robot for stomach biopsy. The proposed robot will be inserted through the tool channel of a conventional 4-DOF endoscope and this will increase the dexterity and ease in reaching the furthest parts of the stomach beyond the duodenum. Unlike the traditional biopsy tool, the present design will enhance dexterity due to its 4 DOF in addition to the endoscope's DOF. The endoscope will be positioned at the entrance to the stomach in the esophagus and the robot will move to the desired position inside the stomach for biopsy and exploration. The current robot is wire-actuated and possesses better maneuverability. The forward kinematic analysis of the proposed robot is presented in this paper.

  3. Analyzing Aeroelastic Stability of a Tilt-Rotor Aircraft

    NASA Technical Reports Server (NTRS)

    Kvaternil, Raymond G.

    2006-01-01

    Proprotor Aeroelastic Stability Analysis, now at version 4.5 (PASTA 4.5), is a FORTRAN computer program for analyzing the aeroelastic stability of a tiltrotor aircraft in the airplane mode of flight. The program employs a 10-degree- of-freedom (DOF), discrete-coordinate, linear mathematical model of a rotor with three or more blades and its drive system coupled to a 10-DOF modal model of an airframe. The user can select which DOFs are included in the analysis. Quasi-steady strip-theory aerodynamics is employed for the aerodynamic loads on the blades, a quasi-steady representation is employed for the aerodynamic loads acting on the vibrational modes of the airframe, and a stability-derivative approach is used for the aerodynamics associated with the rigid-body DOFs of the airframe. Blade parameters that vary with the blade collective pitch can be obtained by interpolation from a user-defined table. Stability is determined by examining the eigenvalues that are obtained by solving the coupled equations of motions as a matrix eigenvalue problem. Notwithstanding the relative simplicity of its mathematical foundation, PASTA 4.5 and its predecessors have played key roles in a number of engineering investigations over the years.

  4. Numerical approach of collision avoidance and optimal control on robotic manipulators

    NASA Technical Reports Server (NTRS)

    Wang, Jyhshing Jack

    1990-01-01

    Collision-free optimal motion and trajectory planning for robotic manipulators are solved by a method of sequential gradient restoration algorithm. Numerical examples of a two degree-of-freedom (DOF) robotic manipulator are demonstrated to show the excellence of the optimization technique and obstacle avoidance scheme. The obstacle is put on the midway, or even further inward on purpose, of the previous no-obstacle optimal trajectory. For the minimum-time purpose, the trajectory grazes by the obstacle and the minimum-time motion successfully avoids the obstacle. The minimum-time is longer for the obstacle avoidance cases than the one without obstacle. The obstacle avoidance scheme can deal with multiple obstacles in any ellipsoid forms by using artificial potential fields as penalty functions via distance functions. The method is promising in solving collision-free optimal control problems for robotics and can be applied to any DOF robotic manipulators with any performance indices and mobile robots as well. Since this method generates optimum solution based on Pontryagin Extremum Principle, rather than based on assumptions, the results provide a benchmark against which any optimization techniques can be measured.

  5. Aerial cooperative transporting and assembling control using multiple quadrotor-manipulator systems

    NASA Astrophysics Data System (ADS)

    Qi, Yuhua; Wang, Jianan; Shan, Jiayuan

    2018-02-01

    In this paper, a fully distributed control scheme for aerial cooperative transporting and assembling is proposed using multiple quadrotor-manipulator systems with each quadrotor equipped with a robotic manipulator. First, the kinematic and dynamic models of a quadrotor with multi-Degree of Freedom (DOF) robotic manipulator are established together using Euler-Lagrange equations. Based on the aggregated dynamic model, the control scheme consisting of position controller, attitude controller and manipulator controller is presented. Regarding cooperative transporting and assembling, multiple quadrotor-manipulator systems should be able to form a desired formation without collision among quadrotors from any initial position. The desired formation is achieved by the distributed position controller and attitude controller, while the collision avoidance is guaranteed by an artificial potential function method. Then, the transporting and assembling tasks request the manipulators to reach the desired angles cooperatively, which is achieved by the distributed manipulator controller. The overall stability of the closed-loop system is proven by a Lyapunov method and Matrosov's theorem. In the end, the proposed control scheme is simplified for the real application and then validated by two formation flying missions of four quadrotors with 2-DOF manipulators.

  6. Neuro-fuzzy control of structures using acceleration feedback

    NASA Astrophysics Data System (ADS)

    Schurter, Kyle C.; Roschke, Paul N.

    2001-08-01

    This paper described a new approach for the reduction of environmentally induced vibration in constructed facilities by way of a neuro-fuzzy technique. The new control technique is presented and tested in a numerical study that involves two types of building models. The energy of each building is dissipated through magnetorheological (MR) dampers whose damping properties are continuously updated by a fuzzy controller. This semi-active control scheme relies on the development of a correlation between the accelerations of the building (controller input) and the voltage applied to the MR damper (controller output). This correlation forms the basis for the development of an intelligent neuro-fuzzy control strategy. To establish a context for assessing the effectiveness of the semi-active control scheme, responses to earthquake excitation are compared with passive strategies that have similar authority for control. According to numerical simulation, MR dampers are less effective control mechanisms than passive dampers with respect to a single degree of freedom (DOF) building model. On the other hand, MR dampers are predicted to be superior when used with multiple DOF structures for reduction of lateral acceleration.

  7. Development of technology for modeling of a 1/8-scale dynamic model of the shuttle Solid Rocket Booster (SRB)

    NASA Technical Reports Server (NTRS)

    Levy, A.; Zalesak, J.; Bernstein, M.; Mason, P. W.

    1974-01-01

    A NASTRAN analysis of the solid rocket booster (SRB) substructure of the space shuttle 1/8-scale structural dynamics model. The NASTRAN finite element modeling capability was first used to formulate a model of a cylinder 10 in. radius by a 200 in. length to investigate the accuracy and adequacy of the proposed grid point spacing. Results were compared with a shell analysis and demonstrated relatively accurate results for NASTRAN for the lower modes, which were of primary interest. A finite element model of the full SRB was then formed using CQUAD2 plate elements containing membrane and bending stiffness and CBAR offset bar elements to represent the longerons and frames. Three layers of three-dimensional CHEXAI elements were used to model the propellant. This model, consisting of 4000 degrees of freedom (DOF) initially, was reduced to 176 DOF using Guyan reduction. The model was then submitted for complex Eigenvalue analysis. After experiencing considerable difficulty with attempts to run the complete model, it was split into two substructres. These were run separately and combined into a single 116 degree of freedom A set which was successfully run. Results are reported.

  8. Earth Observation from Space: Competition or Cooperation?

    DTIC Science & Technology

    1992-04-01

    or remote sensing from space (2). Earth observations or remote sensing includes all forms of observation by sensors borne by a space object including...3). The capabilities of remote sensing are as varied as the sensors that are built and put in orbit, but =- • I •1 capabilities fall into two...adversary or ally. For example, the ability of one nation to observe and study another through space-borne sensors permits strategic assessment of a

  9. COLONIAL GROWTH OF MYCOPLASMA GALLISEPTICUM OBSERVED WITH THE ELECTRON MICROSCOPE

    PubMed Central

    Shifrine, Moshe; Pangborn, Jack; Adler, Henry E.

    1962-01-01

    Shifrine, Moshe (University of California, Davis), Jack Pangborn, and Henry E. Adler. Colonial growth of Mycoplasma gallisepticum observed with the electron microscope. J. Bacteriol. 83:187–192. 1962.—Mycoplasma gallisepticum strain S6 was grown on collodion film on solid medium. Samples were removed every few hours, fixed, washed, shadowed, and observed with the electron microscope. Three distinct forms of growth were observed: elementary cells (hexagonally shaped), platycytes, and exoblasts. A tentative mode of growth was postulated. The significance of the angular morphology to the relation between mycoplasmas and L-forms of bacteria is discussed. Images PMID:13911868

  10. Astronomical observations of solid phase carbon

    NASA Technical Reports Server (NTRS)

    Jura, M.

    1990-01-01

    In the outer envelopes of red giants, when the gas cools sufficiently, molecules and solids form. Thermodynamically, the most stable molecule is CO, and it is usually assumed that all the available carbon and oxygen are consumed in the formation of this molecule (Salpeter 1977). If the carbon abundance is greater than the oxygen abundance, then the carbon left over after the formation of CO is available for solid grains. Because carbon is by far the most abundant species available for making solids in these environments, researchers anticipate that the grains are composed of nearly pure carbon in some form. The observations which can be used to infer the nature of this solid phase carbon are discussed. The observations of the dust around carbon-rich red giants are discussed. These results are then placed into their broader astrophysical context.

  11. [Alternate form of the test de aprendizaje verbal España-Complutense (TAVEC)].

    PubMed

    Nieto, Antonieta; Hernández-Rodríguez, Edith; Hernández-Torres, Atteneri; Velasco Rodríguez-Solís, Pedro; Hess-Medler, Stephany; Machado-Fernández, Alejandra; Molina-Rodríguez, Yaiza; Barroso, José

    2014-05-01

    Parallel forms of neuropsychological tests are scarce. Practice effects associated to repeated testing with the same test confound the interpretation of observed changes in serial assessments. Practice effects are especially likely with memory testing. To develop an alternate form to the test de aprendizaje verbal España-Complutense (TAVEC), one of the most common memory tests used for Spanish speaking population. Participants in the normative study were 110 undergraduates. Participants in the study of the alternate vs original forms were 70 neurologically normal volunteers ranged in age from 18 to 89 years. Forms were administered in counterbalanced order, with a test-retest interval of 15-20 days. Multivariate analyses showed that none of the effects for form, order of administration or session achieved significance. Interactions also failed to reach significance. Aforementioned results were observed in the total sample and the different age groups: young adults (18-29 years), middle-age (30-59 years) and older (60-89 years). Correlational analyses supported the validity and internal consistence of the alternate form. Results indicate the equivalence between the original TAVEC and the form elaborated in this study. This alternate form may be used in serial assessment of learning and memory deterioration.

  12. Observing the epoch of galaxy formation

    PubMed Central

    Steidel, Charles C.

    1999-01-01

    Significant observational progress in addressing the question of the origin and early evolution of galaxies has been made in the past few years, allowing for direct comparison of the epoch when most of the stars in the universe were forming to prevailing theoretical models. There is currently broad consistency between theoretical expectations and the observations, but rapid improvement in the data will provide much more critical tests of theory in the coming years. PMID:10200244

  13. Observing the epoch of galaxy formation.

    PubMed

    Steidel, C C

    1999-04-13

    Significant observational progress in addressing the question of the origin and early evolution of galaxies has been made in the past few years, allowing for direct comparison of the epoch when most of the stars in the universe were forming to prevailing theoretical models. There is currently broad consistency between theoretical expectations and the observations, but rapid improvement in the data will provide much more critical tests of theory in the coming years.

  14. Septal Junctions in Filamentous Heterocyst-Forming Cyanobacteria.

    PubMed

    Flores, Enrique; Herrero, Antonia; Forchhammer, Karl; Maldener, Iris

    2016-02-01

    In the filaments of heterocyst-forming cyanobacteria, septal junctions that traverse the septal peptidoglycan join adjacent cells, allowing intercellular communication. Perforations in the septal peptidoglycan have been observed, and proteins involved in the formation of such perforations and putative protein components of the septal junctions have been identified, but their relationships are debated. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Lattice QCD and the timelike pion form factor.

    PubMed

    Meyer, Harvey B

    2011-08-12

    We present a formula that allows one to calculate the pion form factor in the timelike region 2m(π) ≤ √(s) ≤ 4m(π) in lattice QCD. The form factor quantifies the contribution of two-pion states to the vacuum polarization. It must be known very accurately in order to reduce the theoretical uncertainty on the anomalous magnetic moment of the muon. At the same time, the formula constitutes a rare example where, in a restricted kinematic regime, the spectral function of a conserved current can be determined from Euclidean observables without an explicit analytic continuation.

  16. Performance Test on Polymer Waste Form - 12137

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Se Yup

    , biodegradation testing and water immersion testing, no degradation was observed in the waste forms. Also, by measuring the compressive strength after these tests, it was confirmed that the structural integrity was still retained. A leach test was performed by using non radioactive cobalt, cesium and strontium. The leaching of cobalt, cesium and strontium from the polymer waste forms was very low. Also, the polymer waste forms were found to possess adequate fire resistance. From the results of the performance tests, it is believed that the polymer waste form is very stable and can satisfy the acceptance criteria for permanent disposal. At present, Performance tests with full scale polymer waste forms are on-going in order to obtain qualification certificate by the regulatory institute in Korea. (authors)« less

  17. Stereo-hologram in discrete depth of field (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Lee, Kwanghoon; Park, Min-Chul

    2017-05-01

    In holographic space, continuous object space can be divided as several discrete spaces satisfied each of same depth of field (DoF). In the environment of wearable device using holography, specially, this concept can be applied to macroscopy filed in contrast of the field of microscopy. Since the former has not need to high depth resolution because perceiving power of eye in human visual system, it can distinguish clearly among the objects in depth space, has lower than optical power of microscopic field. Therefore continuous but discrete depth of field (DDoF) for whole object space can present the number of planes included sampled space considered its DoF. Each DoF plane has to consider the occlusion among the object's areas in its region to show the occluded phenomenon inducing by the visual axis around the eye field of view. It makes natural scene in recognition process even though the combined discontinuous DoF regions are altered to the continuous object space. Thus DDoF pull out the advantages such as saving consuming time of the calculation process making the hologram and the reconstruction. This approach deals mainly the properties of several factors required in stereo hologram HMD such as stereoscopic DoF according to the convergence, least number of DDoFs planes in normal visual circumstance (within to 10,000mm), the efficiency of saving time for taking whole holographic process under the our method compared to the existing. Consequently this approach would be applied directly to the stereo-hologram HMD field to embody a real-time holographic imaging.

  18. Dual-element transducer with phase-inversion for wide depth of field in high-frequency ultrasound imaging.

    PubMed

    Jeong, Jong Seob

    2014-08-05

    In high frequency ultrasound imaging (HFUI), the quality of focusing is deeply related to the length of the depth of field (DOF). In this paper, a phase-inversion technique implemented by a dual-element transducer is proposed to enlarge the DOF. The performance of the proposed method was numerically demonstrated by using the ultrasound simulation program called Field-II. A simulated dual-element transducer was composed of a disc- and an annular-type elements, and its aperture was concavely shaped to have a confocal point at 6 mm. The area of each element was identical in order to provide same intensity at the focal point. The outer diameters of the inner and the outer elements were 2.1 mm and 3 mm, respectively. The center frequency of each element was 40 MHz and the f-number (focal depth/aperture size) was two. When two input signals with 0° and 180° phases were applied to inner and outer elements simultaneously, a multi-focal zone was generated in the axial direction. The total -6 dB DOF, i.e., sum of two -6 dB DOFs in the near and far field lobes, was 40% longer than that of the conventional single element transducer. The signal to noise ratio (SNR) was increased by about two times, especially in the far field. The point and cyst phantom simulation were conducted and their results were identical to that of the beam pattern simulation. Thus, the proposed scheme may be a potential method to improve the DOF and SNR in HFUI.

  19. An affordable compact humanoid robot for Autism Spectrum Disorder interventions in children.

    PubMed

    Dickstein-Fischer, Laurie; Alexander, Elizabeth; Yan, Xiaoan; Su, Hao; Harrington, Kevin; Fischer, Gregory S

    2011-01-01

    Autism Spectrum Disorder impacts an ever-increasing number of children. The disorder is marked by social functioning that is characterized by impairment in the use of nonverbal behaviors, failure to develop appropriate peer relationships and lack of social and emotional exchanges. Providing early intervention through the modality of play therapy has been effective in improving behavioral and social outcomes for children with autism. Interacting with humanoid robots that provide simple emotional response and interaction has been shown to improve the communication skills of autistic children. In particular, early intervention and continuous care provide significantly better outcomes. Currently, there are no robots capable of meeting these requirements that are both low-cost and available to families of autistic children for in-home use. This paper proposes the piloting the use of robotics as an improved diagnostic and early intervention tool for autistic children that is affordable, non-threatening, durable, and capable of interacting with an autistic child. This robot has the ability to track the child with its 3 degree of freedom (DOF) eyes and 3-DOF head, open and close its 1-DOF beak and 1-DOF each eyelids, raise its 1-DOF each wings, play sound, and record sound. These attributes will give it the ability to be used for the diagnosis and treatment of autism. As part of this project, the robot and the electronic and control software have been developed, and integrating semi-autonomous interaction, teleoperation from a remote healthcare provider and initiating trials with children in a local clinic are in progress.

  20. Change of a motor synergy for dampening hand vibration depending on a task difficulty.

    PubMed

    Togo, Shunta; Kagawa, Takahiro; Uno, Yoji

    2014-10-01

    The present study investigated the relationship between the number of usable degrees of freedom (DOFs) and joint coordination during a human-dampening hand vibration task. Participants stood on a platform generating an anterior-posterior directional oscillation and held a water-filled cup. Their usable DOFs were changed under the following conditions of limb constraint: (1) no constraint; (2) ankle constrained; and (3) ankle-knee constrained. Kinematic whole-body data were recorded using a three-dimensional position measurement system. The jerk of each body part was evaluated as an index of oscillation intensity. To quantify joint coordination, an uncontrolled manifold (UCM) analysis was applied and the variance of joints related to hand jerk divided into two components: a UCM component that did not affect hand jerk and an orthogonal (ORT) component that directly affected hand jerk. The results showed that hand jerk when the task used a cup filled with water was significantly smaller than when a cup containing stones was used, regardless of limb constraint condition. Thus, participants dampened their hand vibration utilizing usable joint DOFs. According to UCM analysis, increasing the oscillation velocity and the decrease in usable DOFs by the limb constraints led to an increase of total variance of the joints and the UCM component, indicating that a synergy-dampening hand vibration was enhanced. These results show that the variance of usable joint DOFs is more fitted to the UCM subspace when the joints are varied by increasing the velocity and limb constraints and suggest that humans adopt enhanced synergies to achieve more difficult tasks.