Sample records for obtaining complementary information

  1. Complementary therapy use by women's health clinic clients.

    PubMed

    Pettigrew, Amy C; King, Margaret O'Brien; McGee, Karen; Rudolph, Connie

    2004-01-01

    While it is known that more women than men use complementary and alternative therapies, it is important to look at women who are pregnant or possibly receiving hormonal therapy, as side effects and consequences of these therapies may have a significant effect on their health status. To assess women's knowledge, perceived effectiveness and use of 20 complementary and alternative therapies. Descriptive four-page questionnaire to obtain data on the use, reason for use, knowledge, perceived effectiveness, and sources of information of twenty complementary and alternative therapies. Women's Health Center at a large Midwestern hospital. A convenience sample of 250 women waiting to be seen by either a nurse midwife or obstetrician/gynecologist at an outpatient clinic. Sixty-nine percent of the participants used one or more complementary therapy. The most frequently used therapies included prayer, vitamins, massage, diet, and aromatherapy. The best predictor of use of each therapy was the participant's knowledge of the therapy. Participants generally rated the efficacy of the therapies higher than their knowledge level. Frequently cited sources of information were popular media and family. The least common information sources were nurse-midwives, drug stores, Internet, and other professional healthcare providers. Women in this setting use complementary therapies at a rate greater than the general population. The participants obtained a great deal of their information about the therapies from popular press, media, friends, and family members rather than from licensed healthcare providers.

  2. Transcriptome analysis by strand-specific sequencing of complementary DNA

    PubMed Central

    Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

    2009-01-01

    High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online. PMID:19620212

  3. Transcriptome analysis by strand-specific sequencing of complementary DNA.

    PubMed

    Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

    2009-10-01

    High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online.

  4. Hairpin Bisulfite Sequencing: Synchronous Methylation Analysis on Complementary DNA Strands of Individual Chromosomes.

    PubMed

    Giehr, Pascal; Walter, Jörn

    2018-01-01

    The accurate and quantitative detection of 5-methylcytosine is of great importance in the field of epigenetics. The method of choice is usually bisulfite sequencing because of the high resolution and the possibility to combine it with next generation sequencing. Nevertheless, also this method has its limitations. Following the bisulfite treatment DNA strands are no longer complementary such that in a subsequent PCR amplification the DNA methylation patterns information of only one of the two DNA strand is preserved. Several years ago Hairpin Bisulfite sequencing was developed as a method to obtain the pattern information on complementary DNA strands. The method requires fragmentation (usually by enzymatic cleavage) of genomic DNA followed by a covalent linking of both DNA strands through ligation of a short DNA hairpin oligonucleotide to both strands. The ligated covalently linked dsDNA products are then subjected to a conventional bisulfite treatment during which all unmodified cytosines are converted to uracils. During the treatment the DNA is denatured forming noncomplementary ssDNA circles. These circles serve as a template for a locus specific PCR to amplify chromosomal patterns of the region of interest. As a result one ends up with a linearized product, which contains the methylation information of both complementary DNA strands.

  5. METABOLOMIC STUDIES OF ENDOCRINE DISRUPTION IN SMALL FISH MODELS

    EPA Science Inventory

    Metabolomics is now being widely used to obtain complementary information to genomic and proteomic studies. To better understand temporal, compensatory and dose responses to endocrine-disrupting chemicals (EDCs) within the hypothalamic-pituitary¬gonadal (HPG) axis, we have carrie...

  6. Levels of Evidence: Integrative Therapies Human Studies (PDQ®)—Health Professional Version

    Cancer.gov

    Levels of Evidence for Integrative, Alternative, and Complementary Therapies is about how to weigh the strength of the evidence obtained in cited research studies. Get detailed information this formal ranking system in this summary for clinicians.

  7. Complementary therapies for cancer patients: assessing information use and needs.

    PubMed

    Verhoef, M J; Trojan, L; Armitage, G D; Carlson, L; Hilsden, R J

    2009-01-01

    Many cancer patients seek complementary therapies (CTs) for cancer management; however, relatively little is known about patients' CT information seeking behaviour. Therefore, we assessed: 1) cancer patients' use of the types and sources of CT information; 2) their information preferences; and 3) their understanding of the phrase "scientific evidence or proof that a therapy works." We collected data from 404 patients attending the Tom Baker Cancer Centre (TBCC) in Calgary and 303 patients calling the Cancer Information Service (CIS) helpline. In most cases, patients wanted information on the safety of CTs, how CTs work and their potential side effects. Physicians and conventional cancer centres were the most desired sources of CT information, but relatively few patients obtained information via these sources. Although patients were aware of the meaning of scientific evidence, they often used information based on non-scientific evidence, such as patient testimonials. The creation of a supportive care environment in conventional cancer treatment centres, by providing CT information, may help address cancer patients' concerns and alleviate some of the stress that may have been caused by the cancer diagnosis.

  8. NMR-BASED METABOLOMIC STUDIES OF ENDOCRINE DISRUPTION IN SMALL FISH MODELS

    EPA Science Inventory

    Metabolomics is now being widely used to obtain complementary information to genomic and proteomic studies. Among the various approaches used in metabolomics, NMR spectroscopy is particularly powerful, in part because it is relatively non-selective, and is amenable to the study o...

  9. Atomic characterization of Si nanoclusters embedded in SiO2 by atom probe tomography

    PubMed Central

    2011-01-01

    Silicon nanoclusters are of prime interest for new generation of optoelectronic and microelectronics components. Physical properties (light emission, carrier storage...) of systems using such nanoclusters are strongly dependent on nanostructural characteristics. These characteristics (size, composition, distribution, and interface nature) are until now obtained using conventional high-resolution analytic methods, such as high-resolution transmission electron microscopy, EFTEM, or EELS. In this article, a complementary technique, the atom probe tomography, was used for studying a multilayer (ML) system containing silicon clusters. Such a technique and its analysis give information on the structure at the atomic level and allow obtaining complementary information with respect to other techniques. A description of the different steps for such analysis: sample preparation, atom probe analysis, and data treatment are detailed. An atomic scale description of the Si nanoclusters/SiO2 ML will be fully described. This system is composed of 3.8-nm-thick SiO layers and 4-nm-thick SiO2 layers annealed 1 h at 900°C. PMID:21711666

  10. Multimodal imaging of human cerebellum - merging X-ray phase microtomography, magnetic resonance microscopy and histology

    NASA Astrophysics Data System (ADS)

    Schulz, Georg; Waschkies, Conny; Pfeiffer, Franz; Zanette, Irene; Weitkamp, Timm; David, Christian; Müller, Bert

    2012-11-01

    Imaging modalities including magnetic resonance imaging and X-ray computed tomography are established methods in daily clinical diagnosis of human brain. Clinical equipment does not provide sufficient spatial resolution to obtain morphological information on the cellular level, essential for applying minimally or non-invasive surgical interventions. Therefore, generic data with lateral sub-micrometer resolution have been generated from histological slices post mortem. Sub-cellular spatial resolution, lost in the third dimension as a result of sectioning, is obtained using magnetic resonance microscopy and micro computed tomography. We demonstrate that for human cerebellum grating-based X-ray phase tomography shows complementary contrast to magnetic resonance microscopy and histology. In this study, the contrast-to-noise values of magnetic resonance microscopy and phase tomography were comparable whereas the spatial resolution in phase tomography is an order of magnitude better. The registered data with their complementary information permit the distinct segmentation of tissues within the human cerebellum.

  11. Resourcing the clinical complementary medicine information needs of Australian medical students: Results of a grounded theory study.

    PubMed

    Templeman, Kate; Robinson, Anske; McKenna, Lisa

    2016-09-01

    The aim of this study was to identify Australian medical students' complementary medicine information needs. Thirty medical students from 10 medical education faculties across Australian universities were recruited. Data were generated using in-depth semi-structured interviews and constructivist grounded theory method was used to analyze and construct data. Students sought complementary medicine information from a range of inadequate sources, such as pharmacological texts, Internet searches, peer-reviewed medical journals, and drug databases. The students identified that many complementary medicine resources may not be regarded as objective, reliable, differentiated, or comprehensive, leaving much that medical education needs to address. Most students sought succinct, easily accessible, evidence-based information to inform safe and appropriate clinical decisions about complementary medicines. A number of preferred resources were identified that can be recommended and actively promoted to medical students. Therefore, specific, evidence-based complementary medicine databases and secondary resources should be subscribed and recommended to medical schools and students, to assist meeting professional responsibilities regarding complementary medicines. These findings may help inform the development of appropriate medical information resources regarding complementary medicines. © 2016 John Wiley & Sons Australia, Ltd.

  12. Human eye haptics-based multimedia.

    PubMed

    Velandia, David; Uribe-Quevedo, Alvaro; Perez-Gutierrez, Byron

    2014-01-01

    Immersive and interactive multimedia applications offer complementary study tools in anatomy as users can explore 3D models while obtaining information about the organ, tissue or part being explored. Haptics increases the sense of interaction with virtual objects improving user experience in a more realistic manner. Common eye studying tools are books, illustrations, assembly models, and more recently these are being complemented with mobile apps whose 3D capabilities, computing power and customers are increasing. The goal of this project is to develop a complementary eye anatomy and pathology study tool using deformable models within a multimedia application, offering the students the opportunity for exploring the eye from up close and within with relevant information. Validation of the tool provided feedback on the potential of the development, along with suggestions on improving haptic feedback and navigation.

  13. Vitamin D toxicity of dietary origin in cats fed a natural complementary kitten food

    PubMed Central

    Crossley, Victoria J; Bovens, Catherine PV; Pineda, Carmen; Hibbert, Angie; Finch, Natalie C

    2017-01-01

    Case series summary This case series describes two young sibling cats and an additional unrelated cat, from two separate households, that developed hypercalcaemia associated with hypervitaminosis D. Excessive vitamin D concentrations were identified in a natural complementary tinned kitten food that was fed to all three cats as part of their diet. In one of the cases, there was clinical evidence of soft tissue mineralisation. The hypercalcaemia and soft tissue mineralisation resolved following withdrawal of the affected food and medical management of the hypercalcaemia. Relevance and novel information This case series demonstrates the importance of obtaining a thorough dietary history in patients presenting with hypercalcaemia and the measurement of vitamin D metabolites when investigating such cases. Complementary foods may have the potential to induce nutritional toxicity even when fed with complete, nutritionally balanced diets. PMID:29270305

  14. Use of complementary and alternative medicine by patients with arthritis.

    PubMed

    Unsal, Ayla; Gözüm, Sebahat

    2010-04-01

    The aims of this study were to determine the prevalence of complementary and alternative medicine use in patients with arthritis, the types of complementary and alternative medicine used, pertinent socio-demographic factors associated with complementary and alternative medicine use and its perceived efficacy. Arthritis is a major health issue, and the use of complementary and alternative medicine among patients with arthritis is common. This is a descriptive cross-sectional study. Data were obtained from 250 patients with arthritis at the physiotherapy and immunology clinics Atatürk University Hospital in eastern Turkey between May-July 2005 using a questionnaire developed specifically for this study. The instrument included questions on socio-demographic information, disease specifics and complementary and alternative medicine usage. Seventy-six per cent of participants reported use of at least one form of complementary and alternative medicine in the previous year. Complementary and alternative medicine users and non-users were not significantly different in most socio-demographic characteristics including age, gender, marital status and education level with the exception of economic status. We categorised treatment into six complementary and alternative medicine categories: 62.6% of patients used thermal therapies; 41.5% used oral herbal therapies; 40.5% used hot therapies; 32.6% used externally applied (skin) therapies; 28.4% used massage and 12.6% used cold therapies. All forms of complementary and alternative medicine except thermal and oral herbal therapies were perceived as very effective by more than half of study participants. Complementary and alternative medicine therapy is widely used by patients with arthritis and has perceived beneficial effects. It is important for nurses and other health care professionals to be knowledgeable about the use of complementary and alternative medicine therapies when providing care to patients with arthritis because of possible interactions with other treatments, delays in seeking care and the potential for poor quality products. It is also essential for health professionals to discuss treatment options with patients and to monitor treatment efficacy.

  15. Tools for Visualizing HIV in Cure Research.

    PubMed

    Niessl, Julia; Baxter, Amy E; Kaufmann, Daniel E

    2018-02-01

    The long-lived HIV reservoir remains a major obstacle for an HIV cure. Current techniques to analyze this reservoir are generally population-based. We highlight recent developments in methods visualizing HIV, which offer a different, complementary view, and provide indispensable information for cure strategy development. Recent advances in fluorescence in situ hybridization techniques enabled key developments in reservoir visualization. Flow cytometric detection of HIV mRNAs, concurrently with proteins, provides a high-throughput approach to study the reservoir on a single-cell level. On a tissue level, key spatial information can be obtained detecting viral RNA and DNA in situ by fluorescence microscopy. At total-body level, advancements in non-invasive immuno-positron emission tomography (PET) detection of HIV proteins may allow an encompassing view of HIV reservoir sites. HIV imaging approaches provide important, complementary information regarding the size, phenotype, and localization of the HIV reservoir. Visualizing the reservoir may contribute to the design, assessment, and monitoring of HIV cure strategies in vitro and in vivo.

  16. Artificial spatiotemporal touch inputs reveal complementary decoding in neocortical neurons.

    PubMed

    Oddo, Calogero M; Mazzoni, Alberto; Spanne, Anton; Enander, Jonas M D; Mogensen, Hannes; Bengtsson, Fredrik; Camboni, Domenico; Micera, Silvestro; Jörntell, Henrik

    2017-04-04

    Investigations of the mechanisms of touch perception and decoding has been hampered by difficulties in achieving invariant patterns of skin sensor activation. To obtain reproducible spatiotemporal patterns of activation of sensory afferents, we used an artificial fingertip equipped with an array of neuromorphic sensors. The artificial fingertip was used to transduce real-world haptic stimuli into spatiotemporal patterns of spikes. These spike patterns were delivered to the skin afferents of the second digit of rats via an array of stimulation electrodes. Combined with low-noise intra- and extracellular recordings from neocortical neurons in vivo, this approach provided a previously inaccessible high resolution analysis of the representation of tactile information in the neocortical neuronal circuitry. The results indicate high information content in individual neurons and reveal multiple novel neuronal tactile coding features such as heterogeneous and complementary spatiotemporal input selectivity also between neighboring neurons. Such neuronal heterogeneity and complementariness can potentially support a very high decoding capacity in a limited population of neurons. Our results also indicate a potential neuroprosthetic approach to communicate with the brain at a very high resolution and provide a potential novel solution for evaluating the degree or state of neurological disease in animal models.

  17. Artificial spatiotemporal touch inputs reveal complementary decoding in neocortical neurons

    PubMed Central

    Oddo, Calogero M.; Mazzoni, Alberto; Spanne, Anton; Enander, Jonas M. D.; Mogensen, Hannes; Bengtsson, Fredrik; Camboni, Domenico; Micera, Silvestro; Jörntell, Henrik

    2017-01-01

    Investigations of the mechanisms of touch perception and decoding has been hampered by difficulties in achieving invariant patterns of skin sensor activation. To obtain reproducible spatiotemporal patterns of activation of sensory afferents, we used an artificial fingertip equipped with an array of neuromorphic sensors. The artificial fingertip was used to transduce real-world haptic stimuli into spatiotemporal patterns of spikes. These spike patterns were delivered to the skin afferents of the second digit of rats via an array of stimulation electrodes. Combined with low-noise intra- and extracellular recordings from neocortical neurons in vivo, this approach provided a previously inaccessible high resolution analysis of the representation of tactile information in the neocortical neuronal circuitry. The results indicate high information content in individual neurons and reveal multiple novel neuronal tactile coding features such as heterogeneous and complementary spatiotemporal input selectivity also between neighboring neurons. Such neuronal heterogeneity and complementariness can potentially support a very high decoding capacity in a limited population of neurons. Our results also indicate a potential neuroprosthetic approach to communicate with the brain at a very high resolution and provide a potential novel solution for evaluating the degree or state of neurological disease in animal models. PMID:28374841

  18. Cancer and Complementary Health Approaches

    MedlinePlus

    ... Cancer Institute's activities in research on complementary health approaches. Toll-free in the U.S.: 1-800-4-CANCER (1-800-422-6237) Web ... complementary health approaches. Information on complementary health approaches in cancer treatment: ...

  19. Introduction of inappropriate complementary feeding in the first year of life and associated factors in children with low socioeconomic status.

    PubMed

    Dallazen, Camila; Silva, Sara Araújo da; Gonçalves, Vivian Siqueira Santos; Nilson, Eduardo Augusto Fernandes; Crispim, Sandra Patricia; Lang, Regina Maria Ferreira; Moreira, Júlia Dubois; Tietzmann, Daniela Cardoso; Vítolo, Márcia Regina

    2018-02-19

    The study aimed to identify factors associated with the introduction of inappropriate complementary feeding in the first year of life in children living in municipalities (counties) with low socioeconomic statusl. This was a cross-sectional multicenter study in 1,567 children 12 to 59 months of age in 48 municipalities participating in the Brazil Without Poverty plan in the South of Brazil. A structured questionnaire was applied to the children's parents to obtain socio-demographic information and the age at which inappropriate complementary foods were introduced for the first time in complementary feeding. Prevalence of introduction of sugar before four months of age was 35.5% (n = 497; 95%CI: 33.1-38.0). The prevalence rates for the introduction of cookies/crackers, creamy yogurt, and jelly before six months of age were 20.4% (n = 287; 95%CI: 18.3-22.3), 24.8% (n = 349; 95%CI: 22.4-27.1), and 13.8% (n = 192; 95%CI: 12.0-15.7), respectively. Associations were identified between low maternal schooling (PR = 1.25; 95%CI: 1.03-1.51) and low monthly family income (PR = 1.22; CI95%: 1.01-1.48) and the introduction of inappropriate complementary feeding. The study identified the introduction of inappropriate complementary feeding in the first year of life among children in municipalities with high socioeconomic vulnerability in the South of Brazil, associated with low maternal schooling and low monthly family income.

  20. Taiwanese adult cancer patients' reports of using complementary therapies.

    PubMed

    Lu, Jui-Hua; Tsay, Shiow-Luan; Sung, Su-Ching

    2010-01-01

    More information is needed by cancer clinicians regarding cancer patients' use of complementary and alternative medicine (CAM). In this qualitative study, in-depth interviews were used to obtain the reports of adult cancer patients regarding their use of CAM. Seven cancer patients (4 women, 3 men) who reported using CAM were recruited by snowball sampling. Content analysis was used to examine the interview transcriptions. Five themes and multiple categories were identified related to CAM use: (1) facing the challenges of cancer (I can't be defeated, need to cooperate with conventional medical treatment, rebuilding my confidence), (2) handling the physical and psychological distress of CAM use (extra loading due to the therapy, uncertainty and fear about the efficacy of CAM, being understood and supported, feeling guilty about being sick, (3) lifestyle disruption (altering social life, changing family living style), (4) having reasons for seeking other therapies (finding a way to cure the disease, boosting my immunity, improving my overall health status, and prolonging life and searching for peace of mind), and (5) unresolved practical concerns about CAM (finding an easy and effective way to practice CAM, needing CAM to be integrated into mainstream health care, and where to get the related information). Adult Taiwanese cancer patients who use CAM do experience burdens secondary to CAM use and prefer that oncology specialists be more informed about CAM. Oncology specialists who know where adult cancer patients could obtain helpful information about CAM would help to decrease the burdens that patients who use CAM experience.

  1. Utility of intravascular ultrasound examination during carotid stenting.

    PubMed

    Joan, M Mellado; Moya, B Gómez; Agustí, F Pañella; Vidal, R García; Arjona, Y Abril; Alija, M P Fariñas; Paredero, V Martín

    2009-01-01

    Intravascular ultrasound (IVUS) examination may provide useful information during endovascular procedures. However, its actual clinical utility for carotid stenting remains unclear. We evaluated the usefulness of IVUS as a complementary tool during endovascular procedures in the carotid arteries and its impact on the modification of the therapeutic strategy. Between April 2006 and April 2007, 18 symptomatic patients (nine with transient ischemic attack, nine with stroke) underwent angioplasty and stenting of >70% stenosis of the internal carotid artery (ICA). Target lesions were identified with preoperative duplex scanning and further confirmed at angiography. Intraoperative IVUS examination was performed in all patients. Multilevel measurement of the artery as well as virtual histology images, before and after stenting, were obtained. The technique was 100% successful. There were no complications at the femoral puncture site and no neurological or other events. Compared with angiography, IVUS findings showed an average arterial diameter that was greater than 1.64+/-0.22mm. Based on virtual histology information, endovascular treatment was excluded in two patients and carotid endarterectomy was performed. Type or size of the stent was modified after IVUS examination in eight cases. IVUS examination provides complementary information to that obtained using conventional diagnostic procedures. It may be useful for characterizing the composition and measurement of the target lesion, choosing the type and size of the stent, and evaluating the results after the procedure.

  2. Complementary analysis of tissue homogenates composition obtained by Vis and NIR laser excitations and Raman spectroscopy.

    PubMed

    Staniszewska-Slezak, Emilia; Malek, Kamilla; Baranska, Malgorzata

    2015-08-05

    Raman spectroscopy and four excitation lines in the visible (Vis: 488, 532, 633 nm) and near infrared (NIR: 785 nm) were used for biochemical analysis of rat tissue homogenates, i.e. myocardium, brain, liver, lung, intestine, and kidney. The Vis Raman spectra are very similar for some organs (brain/intestines and kidney/liver) and dominated by heme signals when tissues of lung and myocardium were investigated (especially with 532 nm excitation). On the other hand, the NIR Raman spectra are specific for each tissue and more informative than the corresponding ones collected with the Vis excitations. The spectra analyzed without any special pre-processing clearly illustrate different chemical composition of each tissue and give information about main components e.g. lipids or proteins, but also about the content of some specific compounds such as amino acid residues, nucleotides and nucleobases. However, in order to obtain the whole spectral information about tissues complex composition the spectra of Vis and NIR excitations should be collected and analyzed together. A good agreement of data gathered from Raman spectra of the homogenates and those obtained previously from Raman imaging of the tissue cross-sections indicates that the presented here approach can be a method of choice for an investigation of biochemical variation in animal tissues. Moreover, the Raman spectral profile of tissue homogenates is specific enough to be used for an investigation of potential pathological changes the organism undergoes, in particular when supported by the complementary FTIR spectroscopy. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Comparative higher-order structure analysis of antibody biosimilars using combined bottom-up and top-down hydrogen-deuterium exchange mass spectrometry.

    PubMed

    Pan, Jingxi; Zhang, Suping; Borchers, Christoph H

    2016-12-01

    Hydrogen/deuterium exchange (HDX) coupled with mass spectrometry (MS) is a powerful technique for higher-order structural characterization of antibodies. Although the peptide-based bottom-up HDX approach and the protein-based top-down HDX approach have complementary advantages, the work done so far on biosimilars has involved only one or the other approach. Herein we have characterized the structures of two bevacizumab (BEV) biosimilars and compared them to the reference BEV using both methods. A sequence coverage of 87% was obtained for the heavy chain and 74% for the light chain in the bottom-up approach. The deuterium incorporation behavior of the peptic peptides from the three BEVs were compared side by side and showed no differences at various HDX time points. Top-down experiments were carried out using subzero temperature LC-MS, and the deuterium incorporation of the intact light chain and heavy chain were obtained. Top-down ETD was also performed to obtain amino acid-level HDX information that covered 100% of the light chain, but only 50% coverage is possible for the heavy chain. Consistent with the intact subunit level data, no differences were observed in the amino acid level HDX data. All these results indicate that there are no differences between the three BEV samples with respect to their high-order structures. The peptide level information from the bottom-up approach, and the residue level and intact subunit level information from the top-down approach were complementary and covered the entire antibody. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. In crystallo optical spectroscopy (icOS) as a complementary tool on the macromolecular crystallography beamlines of the ESRF

    PubMed Central

    von Stetten, David; Giraud, Thierry; Carpentier, Philippe; Sever, Franc; Terrien, Maxime; Dobias, Fabien; Juers, Douglas H.; Flot, David; Mueller-Dieckmann, Christoph; Leonard, Gordon A.; de Sanctis, Daniele; Royant, Antoine

    2015-01-01

    The analysis of structural data obtained by X-ray crystallo­graphy benefits from information obtained from complementary techniques, especially as applied to the crystals themselves. As a consequence, optical spectroscopies in structural biology have become instrumental in assessing the relevance and context of many crystallographic results. Since the year 2000, it has been possible to record such data adjacent to, or directly on, the Structural Biology Group beamlines of the ESRF. A core laboratory featuring various spectrometers, named the Cryobench, is now in its third version and houses portable devices that can be directly mounted on beamlines. This paper reports the current status of the Cryobench, which is now located on the MAD beamline ID29 and is thus called the ID29S-Cryobench (where S stands for ‘spectroscopy’). It also reviews the diverse experiments that can be performed at the Cryobench, highlighting the various scientific questions that can be addressed. PMID:25615856

  5. Evaluation of programs to improve complementary feeding in infants and young children.

    PubMed

    Frongillo, Edward A

    2017-10-01

    Evaluation of complementary feeding programs is needed to enhance knowledge on what works, to document responsible use of resources, and for advocacy. Evaluation is done during program conceptualization and design, implementation, and determination of effectiveness. This paper explains the role of evaluation in the advancement of complementary feeding programs, presenting concepts and methods and illustrating them through examples. Planning and investments for evaluations should occur from the beginning of the project life cycle. Essential to evaluation is articulation of a program theory on how change would occur and what program actions are required for change. Analysis of program impact pathways makes explicit the dynamic connections in the program theory and accounts for contextual factors that could influence program effectiveness. Evaluating implementation functioning is done through addressing questions about needs, coverage, provision, and utilization using information obtained from process evaluation, operations research, and monitoring. Evaluating effectiveness is done through assessing impact, efficiency, coverage, process, and causality. Plausibility designs ask whether the program seemed to have an effect above and beyond external influences, often using a nonrandomized control group and baseline and end line measures. Probability designs ask whether there was an effect using a randomized control group. Evaluations may not be able to use randomization, particularly for programs implemented at a large scale. Plausibility designs, innovative designs, or innovative combinations of designs sometimes are best able to provide useful information. Further work is needed to develop practical designs for evaluation of large-scale country programs on complementary feeding. © 2017 John Wiley & Sons Ltd.

  6. The Use of Complementary and Alternative Medicine in a General Population in South Korea: Results from a National Survey in 2006

    PubMed Central

    Ock, Sun Myeong; Choi, Jun Yeong; Cha, Young Soo; Lee, JungBok; Huh, Chang Hun; Lee, Soon Young; Lee, Sung Jae

    2009-01-01

    The purpose of this survey was to obtain information on the prevalence, costs, and patterns of use of complementary and alternative medicine (CAM) in a general population in the Republic of Korea. In 2006, we conducted nationwide and population-weighted personal interviews with 6,021 adults ranging from 30 to 69 yr of age; the final sample consisted of 3,000 people with a 49.8% response rate. In addition to their general socio-demographics, the respondents were asked about their use of CAM during the previous 12-month period, costs, sources of information, and reasons for use. The prevalence of use overall was 74.8%, while biologically based CAM therapies were the most likely type of use (65.4%). The median annual out-of-pocket expenditures for CAM therapies was about US$203. The primary reason for using CAM was for disease prevention and health promotion (78.8%). The main source of advice about CAM therapies use was most likely to be from family and friends (66.9%). Our study suggests that CAM use has been and continues to be very popular in South Korea. Conventional western medical doctors and governments should obtain more evidence and become more interested in CAM therapies. PMID:19270805

  7. Evaluation of urban drainage network based geographycal information system (GIS) in Sumenep City

    NASA Astrophysics Data System (ADS)

    Agrianto, F.; Hadiani, R.; Purwana, Y. M.

    2017-02-01

    Sumenep City frequently hit by floods. Drainage network conditions greatly affect the performance of her maid, especially those aspects that affect the capacity of the drainage channel. Aspects that affect the capacity of the drainage channel in the form of sedimentation rate and complementary buildings on drainage channels, for example, the presence of street inlet and trash rack. The method used is a drainage channel capacity level approach that level assessment of each segment drainage network conditions by calculating the ratio of the channel cross-sectional area that is filled with sediment to the total cross-sectional area wet and the existence of complementary buildings. Having obtained the condition index value of each segment, the subsequent analysis is spatial analysis using ArcGIS applications to obtain a map of the drainage network information. The analysis showed that the level condition of drainage network in the city of Sumenep in 2016 that of the total 428 drainage network there are 43 sections belonging to the state level “Good”, 198 drainage network belong to the state level “Enough”, 115 drainage network belong to the state “Mild Damaged”, 50 sections belonging to the state “Heavy Damage” and 22 drainage network belong to the state of “Dysfunction”.

  8. Complementary medicine use among cancer patients receiving radiotherapy and chemotherapy: methods, sources of information and the need for counselling.

    PubMed

    Pihlak, R; Liivand, R; Trelin, O; Neissar, H; Peterson, I; Kivistik, S; Lilo, K; Jaal, J

    2014-03-01

    Complementary medicine (CM) use is common among cancer patients. However, little is known about CM products that are utilised during radiotherapy and/or chemotherapy. Out of 62 cancer patients who completed a specialised survey, 35 (56%) consumed some type of CM during active anti-cancer therapy. Cancer patients reported the use of herbal teas (52%), vitamins and other dietary supplements (45%), vegetables and juices (39%), special diets (19%), herbal medicines, including Chinese medicines (19%) and 'immunomodulators' (3%). Most of patients (86%) consumed CM products every day. However, nearly 47% of CM users did not admit this to their oncologists. Majority of CM users (85%) were convinced that supplementary products increase the efficacy of standard anti-cancer therapy and prolong their survival. Information about CM was mainly obtained through internet sources (36%), books and brochures (25%). Although most CM users (82%) trusted the received information, 73% of them admitted that additional information about CM methods would be necessary. Patients would like to receive additional information through a specialised consultation (60%), but also from brochures (44%) and the internet (20%). Adequate counselling of patients is of paramount importance since some CM methods may cause significant side effects and decrease the efficacy of radiotherapy and/or chemotherapy. © 2013 John Wiley & Sons Ltd.

  9. Introduction of new food textures during complementary feeding: Observations in France.

    PubMed

    Marduel Boulanger, A; Vernet, M

    2018-01-01

    Complementary feeding plays a crucial role in the development of infants and toddlers and studies suggest benefits specific to the introduction of food textures. Evaluate the recommendations given to parents, their practices, and their attitudes towards the introduction of food textures during complementary feeding in France. This was a cross-sectional pilot study conducted in 2013. One hundred and eighty-one parents with at least one child aged 6-36 months living in France completed an ad hoc questionnaire. Eighty-eight percent of the parents surveyed received oral information on complementary feeding, but only 46% received such information on the introduction of food textures. Pediatricians were the most frequently listed source of oral information on complementary feeding. More than half the parents also looked for additional information in books and on the internet. While oral recommendations matched parents' practices, they seemed to occur at a later age compared to infants' physiological ability to handle new textures. The quality of information on food texture advice available in paper and electronic formats evaluated using a 4-point scale was found to be limited. Introducing new food texture was spontaneously reported as the most common difficulty in complementary feeding (16%). Fear of choking when first introducing food pieces was reported by 54% of the parents. The parents' lack of information on the introduction of food textures, as well as their fear that their child may choke, should encourage providing new recommendations in France. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  10. Highly informative multiclass profiling of lipids by ultra-high performance liquid chromatography - Low resolution (quadrupole) mass spectrometry by using electrospray ionization and atmospheric pressure chemical ionization interfaces.

    PubMed

    Beccaria, Marco; Inferrera, Veronica; Rigano, Francesca; Gorynski, Krzysztof; Purcaro, Giorgia; Pawliszyn, Janusz; Dugo, Paola; Mondello, Luigi

    2017-08-04

    A simple, fast, and versatile method, using an ultra-high performance liquid chromatography system coupled with a low resolution (single quadrupole) mass spectrometer was optimized to perform multiclass lipid profiling of human plasma. Particular attention was made to develop a method suitable for both electrospray ionization and atmospheric pressure chemical ionization interfaces (sequentially in positive- and negative-ion mode), without any modification of the chromatographic conditions (mobile phase, flow-rate, gradient, etc.). Emphasis was given to the extrapolation of the structural information based on the fragmentation pattern obtained using atmospheric pressure chemical ionization interface, under each different ionization condition, highlighting the complementary information obtained using the electrospray ionization interface, of support for related molecule ions identification. Furthermore, mass spectra of phosphatidylserine and phosphatidylinositol obtained using the atmospheric pressure chemical ionization interface are reported and discussed for the first time. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Fringe pattern information retrieval using wavelets

    NASA Astrophysics Data System (ADS)

    Sciammarella, Cesar A.; Patimo, Caterina; Manicone, Pasquale D.; Lamberti, Luciano

    2005-08-01

    Two-dimensional phase modulation is currently the basic model used in the interpretation of fringe patterns that contain displacement information, moire, holographic interferometry, speckle techniques. Another way to look to these two-dimensional signals is to consider them as frequency modulated signals. This alternative interpretation has practical implications similar to those that exist in radio engineering for handling frequency modulated signals. Utilizing this model it is possible to obtain frequency information by using the energy approach introduced by Ville in 1944. A natural complementary tool of this process is the wavelet methodology. The use of wavelet makes it possible to obtain the local values of the frequency in a one or two dimensional domain without the need of previous phase retrieval and differentiation. Furthermore from the properties of wavelets it is also possible to obtain at the same time the phase of the signal with the advantage of a better noise removal capabilities and the possibility of developing simpler algorithms for phase unwrapping due to the availability of the derivative of the phase.

  12. Office of Cancer Complementary and Alternative Medicine

    MedlinePlus

    ... Information. Outreach. The Office of Cancer Complementary and Alternative Medicine (OCCAM) was established in October 1998 to coordinate ... Institute (NCI) in the arena of complementary and alternative medicine (CAM). More about us. CAM at the NCI ...

  13. Sensor fusion of range and reflectance data for outdoor scene analysis

    NASA Technical Reports Server (NTRS)

    Kweon, In SO; Hebvert, Martial; Kanade, Takeo

    1988-01-01

    In recognizing objects in an outdoor scene, range and reflectance (or color) data provide complementary information. Results of experiments in recognizing outdoor scenes containing roads, trees, and cars are presented. The recognition program uses range and reflectance data obtained by a scanning laser range finder, as well as color data from a color TV camera. After segmentation of each image into primitive regions, models of objects are matched using various properties.

  14. Study on the transient properties of amorphous solar cells

    NASA Astrophysics Data System (ADS)

    Smrity, Manu; Dhariwal, S. R.

    2016-05-01

    The transient response for the solar cell when switched off from steady-state can provide useful information about the quality of the material used for fabrication of the device. In this paper we shall discuss the photovoltaic transients of amorphous silicon solar cells when switched off from open circuit configuration and illuminated by electrical pulse. The open-circuit voltage (Voc) decay can be performed by two methods, by optical excitation and by electrical pulse. When one of carriers has a concentration much higher than the other the photoconductivity is dominated by majority carriers; in that case the Voc decay which depends on the np product can be used as complementary method for obtaining information about the minority carriers. Also the series resistance drop in an electrical Voc decay method can be used to obtain a IJ't product as an additional information regarding the material of the device.

  15. Different source image fusion based on FPGA

    NASA Astrophysics Data System (ADS)

    Luo, Xiao; Piao, Yan

    2016-03-01

    The fusion technology of video image is to make the video obtained by different image sensors complementary to each other by some technical means, so as to obtain the video information which is rich in information and suitable for the human eye system. Infrared cameras in harsh environments such as when smoke, fog and low light situations penetrating power, but the ability to obtain the details of the image is poor, does not meet the human visual system. Single visible light imaging can be rich in detail, high resolution images and for the visual system, but the visible image easily affected by the external environment. Infrared image and visible image fusion process involved in the video image fusion algorithm complexity and high calculation capacity, have occupied more memory resources, high clock rate requirements, such as software, c ++, c, etc. to achieve more, but based on Hardware platform less. In this paper, based on the imaging characteristics of infrared images and visible light images, the software and hardware are combined to obtain the registration parameters through software matlab, and the gray level weighted average method is used to implement the hardware platform. Information fusion, and finally the fusion image can achieve the goal of effectively improving the acquisition of information to increase the amount of information in the image.

  16. Association of Frontline Worker-Provided Services with Change in Block-Level Complementary Feeding Indicators: An Ecological Analysis from Bihar, India

    PubMed Central

    Das, Aritra; Mahapatra, Sanchita; Sai Mala, Guntur; Chaudhuri, Indrajit; Mahapatra, Tanmay

    2016-01-01

    Background Insufficiencies in complementary feeding put infants and young children at increased risk of undernutrition. Till now, most Indian studies have looked at the individual level determinants of complementary feeding practices. We aimed to evaluate the association of frontline worker (FLW) provided nutritional counselling services, with change in community level indicators of complementary feeding practices among 9–11 month old children over time. Methods The study data was obtained from five rounds of ‘Lot Quality Assurance Sampling’ survey in eight districts of Bihar, an impoverished Indian state. The surveys were conducted as evaluation exercises for the ‘Integrated Family Health Initiative (IFHI)’–a multi-faceted program aimed at improving the maternal and child health outcomes in Bihar. The main outcome indicators were—current breastfeeding, age-appropriate minimum frequency of semi-solid food, age-appropriate minimum quantity of semi-solid food, initiation of complementary feeding at the right age, and dietary diversity. Repeated measures analysis was performed to determine the association of changes in the outcome indicators with coverage of FLW-provided counselling services. Results Visits by FLW, advices on age-appropriate frequency and handwashing were significant predictors of receiving age-appropriate frequency of feeding. The determinants of receiving age-appropriate quantity were—advices on age appropriate frequency and advices on handwashing. Receiving food support from AWC and FLW visits were significantly associated with initiating complementary feeding at the right age. Conclusions The present study identified the critical elements among the different types of FLW-provided services. The study findings, from an economically and socially underdeveloped region of India, would inform the relevant programs about the nutritional counselling services that need to be emphasized upon for reducing the burden of childhood malnutrition. PMID:27832211

  17. Beyond simple small-angle X-ray scattering: developments in online complementary techniques and sample environments.

    PubMed

    Bras, Wim; Koizumi, Satoshi; Terrill, Nicholas J

    2014-11-01

    Small- and wide-angle X-ray scattering (SAXS, WAXS) are standard tools in materials research. The simultaneous measurement of SAXS and WAXS data in time-resolved studies has gained popularity due to the complementary information obtained. Furthermore, the combination of these data with non X-ray based techniques, via either simultaneous or independent measurements, has advanced understanding of the driving forces that lead to the structures and morphologies of materials, which in turn give rise to their properties. The simultaneous measurement of different data regimes and types, using either X-rays or neutrons, and the desire to control parameters that initiate and control structural changes have led to greater demands on sample environments. Examples of developments in technique combinations and sample environment design are discussed, together with a brief speculation about promising future developments.

  18. Beyond simple small-angle X-ray scattering: developments in online complementary techniques and sample environments

    PubMed Central

    Bras, Wim; Koizumi, Satoshi; Terrill, Nicholas J

    2014-01-01

    Small- and wide-angle X-ray scattering (SAXS, WAXS) are standard tools in materials research. The simultaneous measurement of SAXS and WAXS data in time-resolved studies has gained popularity due to the complementary information obtained. Furthermore, the combination of these data with non X-ray based techniques, via either simultaneous or independent measurements, has advanced understanding of the driving forces that lead to the structures and morphologies of materials, which in turn give rise to their properties. The simultaneous measurement of different data regimes and types, using either X-rays or neutrons, and the desire to control parameters that initiate and control structural changes have led to greater demands on sample environments. Examples of developments in technique combinations and sample environment design are discussed, together with a brief speculation about promising future developments. PMID:25485128

  19. Knowledge, Attitude and Practice of General Practitioners toward Complementary and Alternative Medicine: a Cross-Sectional Study.

    PubMed

    Barikani, Ameneh; Beheshti, Akram; Javadi, Maryam; Yasi, Marzieh

    2015-08-01

    Orientation of public and physicians to the complementary and alternative medicine (CAM) is one of the most prominent symbols of structural changes in the health service system. The aim of his study was a determination of knowledge, attitude, and practice of general practitioners in complementary and alternative medicine. This cross- sectional study was conducted in Qazvin, Iran in 2013. A self-administered questionnaire was used for collecting data including four information parts: population information, physicians' attitude and knowledge, methods of getting information and their function. A total of 228 physicians in Qazvin comprised the population of study according to the deputy of treatment's report of Qazvin University of Medical Sciences. A total of 150 physicians were selected randomly, and SPSS Statistical program was used to enter questionnaires' data. Results were analyzed as descriptive statistics and statistical analysis. Sixty percent of all responders were male. About sixty (59.4) percent of participating practitioners had worked less than 10 years.96.4 percent had a positive attitude towards complementary and alternative medicine. Knowledge of practitioners about traditional medicine in 11 percent was good, 36.3% and 52.7% had average and little information, respectively. 17.9% of practitioners offered their patients complementary and alternative medicine for treatment. Although there was little knowledge among practitioners about traditional medicine and complementary approaches, a significant percentage of them had attitude higher than the lower limit.

  20. ICFA Instrumentation Bulletin, Volume 21, Fall 2000 Issue (SLAC-J-ICFA-021)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Va'Vra, J.

    2003-10-22

    Cosmic ray experiments outside the Earth's atmosphere are subject to severe restrictions on the mass of the instruments. Therefore, it is important that the experimental information that can be obtained per unit detector mass is maximized. In this paper, tests are described of a thin (1.4 {lambda}{sub int}deep) hadron calorimeter that was designed with this goal in mind. This detector was equipped with two independent active media, which provided complementary information on the showering hadrons. It is shown that by combining the information from these media it was possible to reduce the effects of the dominant leakage fluctuations on themore » calorimeter performance.« less

  1. Characterization of Complementary and Alternative Medicine-Related Consultations in an Academic Drug Information Service.

    PubMed

    Gregory, Philip J; Jalloh, Mohamed A; Abe, Andrew M; Hu, James; Hein, Darren J

    2016-12-01

    To characterize requests received through an academic drug information consultation service related to complementary and alternative medicines. A retrospective review and descriptive analysis of drug information consultations was conducted. A total of 195 consultations related to complementary and alternative medicine were evaluated. All consultation requests involved questions about dietary supplements. The most common request types were related to safety and tolerability (39%), effectiveness (38%), and therapeutic use (34%). Sixty-eight percent of the requests were from pharmacists. The most frequent consultation requests from pharmacists were questions related to drug interactions (37%), therapeutic use (37%), or stability/compatibility/storage (34%). Nearly 60% of complementary and alternative medicine-related consultation requests were able to be completely addressed using available resources. Among review sources, Natural Medicines Comprehensive Database, Clinical Pharmacology, Micromedex, and Pharmacist's Letter were the most common resources used to address consultations. Utilization of a drug information service may be a viable option for health care professionals to help answer a complementary and alternative medicine-related question. Additionally, pharmacists and other health care professionals may consider acquiring resources identified to consistently answering these questions. © The Author(s) 2015.

  2. Multivariate classification of edible salts: Simultaneous Laser-Induced Breakdown Spectroscopy and Laser-Ablation Inductively Coupled Plasma Mass Spectrometry Analysis

    NASA Astrophysics Data System (ADS)

    Lee, Yonghoon; Nam, Sang-Ho; Ham, Kyung-Sik; Gonzalez, Jhanis; Oropeza, Dayana; Quarles, Derrick; Yoo, Jonghyun; Russo, Richard E.

    2016-04-01

    Laser-Induced Breakdown Spectroscopy (LIBS) and Laser-Ablation Inductively Coupled Plasma Mass Spectrometry (LA-ICP-MS), both based on laser ablation sampling, can be employed simultaneously to obtain different chemical fingerprints from a sample. We demonstrated that this analysis approach can provide complementary information for improved classification of edible salts. LIBS could detect several of the minor metallic elements along with Na and Cl, while LA-ICP-MS spectra were used to measure non-metallic and trace heavy metal elements. Principal component analysis using LIBS and LA-ICP-MS spectra showed that their major spectral variations classified the sample salts in different ways. Three classification models were developed by using partial least squares-discriminant analysis based on the LIBS, LA-ICP-MS, and their fused data. From the cross-validation performances and confusion matrices of these models, the minor metallic elements (Mg, Ca, and K) detected by LIBS and the non-metallic (I) and trace heavy metal (Ba, W, and Pb) elements detected by LA-ICP-MS provided complementary chemical information to distinguish particular salt samples.

  3. Parallel logic gates in synthetic gene networks induced by non-Gaussian noise.

    PubMed

    Xu, Yong; Jin, Xiaoqin; Zhang, Huiqing

    2013-11-01

    The recent idea of logical stochastic resonance is verified in synthetic gene networks induced by non-Gaussian noise. We realize the switching between two kinds of logic gates under optimal moderate noise intensity by varying two different tunable parameters in a single gene network. Furthermore, in order to obtain more logic operations, thus providing additional information processing capacity, we obtain in a two-dimensional toggle switch model two complementary logic gates and realize the transformation between two logic gates via the methods of changing different parameters. These simulated results contribute to improve the computational power and functionality of the networks.

  4. 15 CFR 784.2 - Obtaining consent or warrants to conduct complementary access.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... consents to a complementary access request, he or she is agreeing to provide the IAEA Team with the same... Team and Host Team to any area of the location, any item on the location, and any records that are necessary to comply with the APR and allow the IAEA Team to accomplish the purpose of complementary access...

  5. 15 CFR 784.2 - Obtaining consent or warrants to conduct complementary access.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... consents to a complementary access request, he or she is agreeing to provide the IAEA Team with the same... Team and Host Team to any area of the location, any item on the location, and any records that are necessary to comply with the APR and allow the IAEA Team to accomplish the purpose of complementary access...

  6. 15 CFR 784.2 - Obtaining consent or warrants to conduct complementary access.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... consents to a complementary access request, he or she is agreeing to provide the IAEA Team with the same... Team and Host Team to any area of the location, any item on the location, and any records that are necessary to comply with the APR and allow the IAEA Team to accomplish the purpose of complementary access...

  7. 15 CFR 784.2 - Obtaining consent or warrants to conduct complementary access.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... consents to a complementary access request, he or she is agreeing to provide the IAEA Team with the same... Team and Host Team to any area of the location, any item on the location, and any records that are necessary to comply with the APR and allow the IAEA Team to accomplish the purpose of complementary access...

  8. 15 CFR 784.2 - Obtaining consent or warrants to conduct complementary access.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... consents to a complementary access request, he or she is agreeing to provide the IAEA Team with the same... Team and Host Team to any area of the location, any item on the location, and any records that are necessary to comply with the APR and allow the IAEA Team to accomplish the purpose of complementary access...

  9. The polarimeter and the multispectral radiometer as remote probes of aerosols

    NASA Technical Reports Server (NTRS)

    Kuriyan, J. G.

    1975-01-01

    Attempts made to establish the viability of the polarimeter as a ground based remote probe of atmospheric aerosols under varying meteorological conditions are reported. Extension radiometer data are also given and a comparison was made with polarimeter data to determine if one could complement/supplement the other. The analyses show that the two instruments are complementary devices and any information obtained from one will greatly facilitate the analysis of the other. Detailed results are given in graphical form.

  10. 15 CFR 784.1 - Complementary access: General information on the purpose of complementary access, affected...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... may be conducted, on a selective basis, to verify the absence of undeclared nuclear material and nuclear related activities at reportable uranium hard-rock mines and ore beneficiation plants (see § 783.1... OF INDUSTRY AND SECURITY, DEPARTMENT OF COMMERCE ADDITIONAL PROTOCOL REGULATIONS COMPLEMENTARY ACCESS...

  11. Integrating multiple molecular sources into a clinical risk prediction signature by extracting complementary information.

    PubMed

    Hieke, Stefanie; Benner, Axel; Schlenl, Richard F; Schumacher, Martin; Bullinger, Lars; Binder, Harald

    2016-08-30

    High-throughput technology allows for genome-wide measurements at different molecular levels for the same patient, e.g. single nucleotide polymorphisms (SNPs) and gene expression. Correspondingly, it might be beneficial to also integrate complementary information from different molecular levels when building multivariable risk prediction models for a clinical endpoint, such as treatment response or survival. Unfortunately, such a high-dimensional modeling task will often be complicated by a limited overlap of molecular measurements at different levels between patients, i.e. measurements from all molecular levels are available only for a smaller proportion of patients. We propose a sequential strategy for building clinical risk prediction models that integrate genome-wide measurements from two molecular levels in a complementary way. To deal with partial overlap, we develop an imputation approach that allows us to use all available data. This approach is investigated in two acute myeloid leukemia applications combining gene expression with either SNP or DNA methylation data. After obtaining a sparse risk prediction signature e.g. from SNP data, an automatically selected set of prognostic SNPs, by componentwise likelihood-based boosting, imputation is performed for the corresponding linear predictor by a linking model that incorporates e.g. gene expression measurements. The imputed linear predictor is then used for adjustment when building a prognostic signature from the gene expression data. For evaluation, we consider stability, as quantified by inclusion frequencies across resampling data sets. Despite an extremely small overlap in the application example with gene expression and SNPs, several genes are seen to be more stably identified when taking the (imputed) linear predictor from the SNP data into account. In the application with gene expression and DNA methylation, prediction performance with respect to survival also indicates that the proposed approach might work well. We consider imputation of linear predictor values to be a feasible and sensible approach for dealing with partial overlap in complementary integrative analysis of molecular measurements at different levels. More generally, these results indicate that a complementary strategy for integrating different molecular levels can result in more stable risk prediction signatures, potentially providing a more reliable insight into the underlying biology.

  12. Introducing new reactivity descriptors: "Bond reactivity indices." Comparison of the new definitions and atomic reactivity indices.

    PubMed

    Sánchez-Márquez, Jesús

    2016-11-21

    A new methodology to obtain reactivity indices has been defined. This is based on reactivity functions such as the Fukui function or the dual descriptor and makes it possible to project the information of reactivity functions over molecular orbitals instead of the atoms of the molecule (atomic reactivity indices). The methodology focuses on the molecule's natural bond orbitals (bond reactivity indices) because these orbitals (with physical meaning) have the advantage of being very localized, allowing the reaction site of an electrophile or nucleophile to be determined within a very precise molecular region. This methodology gives a reactivity index for every Natural Bond Orbital (NBO), and we have verified that they have equivalent information to the reactivity functions. A representative set of molecules has been used to test the new definitions. Also, the bond reactivity index has been related with the atomic reactivity one, and complementary information has been obtained from the comparison. Finally, a new atomic reactivity index has been defined and compared with previous definitions.

  13. Coffee aroma: Chemometric comparison of the chemical information provided by three different samplings combined with GC-MS to describe the sensory properties in cup.

    PubMed

    Bressanello, Davide; Liberto, Erica; Cordero, Chiara; Rubiolo, Patrizia; Pellegrino, Gloria; Ruosi, Manuela R; Bicchi, Carlo

    2017-01-01

    This study is part of a wider project aiming to correlate the chemical composition of the coffee volatile fraction to its sensory properties with the end-goal of developing an instrumental analysis approach complementary to human sensory profiling. The proposed investigation strategy compares the chemical information concerning coffee aroma and flavor obtained with HS-SPME of the ground coffee and in-solution SBSE/SPME sampling combined with GC-MS to evaluate their compatibility with the cupping evaluation for quality control purposes. Roasted coffee samples with specific sensory properties were analyzed. The chemical results obtained by the three samplings were compared through multivariate analysis, and related to the samples' sensory attributes. Despite the differences between the three sampling approaches, data processing showed that the three methods provide the same kind of chemical information useful for sample discrimination, and that they could be used interchangeably to sample the coffee aroma and flavor. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Video approach to chemiluminescence detection using a low-cost complementary metal oxide semiconductor (CMOS)-based camera: determination of paracetamol in pharmaceutical formulations.

    PubMed

    Lahuerta-Zamora, Luis; Mellado-Romero, Ana M

    2017-06-01

    A new system for continuous flow chemiluminescence detection, based on the use of a simple and low-priced lens-free digital camera (with complementary metal oxide semiconductor technology) as a detector, is proposed for the quantitative determination of paracetamol in commercial pharmaceutical formulations. Through the camera software, AVI video files of the chemiluminescence emission are captured and then, using friendly ImageJ public domain software (from National Institutes for Health), properly processed in order to extract the analytical information. The calibration graph was found to be linear over the range 0.01-0.10 mg L -1 and over the range 1.0-100.0 mg L -1 of paracetamol, the limit of detection being 10 μg L -1 . No significative interferences were found. Paracetamol was determined in three different pharmaceutical formulations: Termalgin®, Efferalgan® and Gelocatil®. The obtained results compared well with those declared on the formulation label and with those obtained through the official analytical method of British Pharmacopoeia. Graphical abstract Abbreviated scheme of the new chemiluminescence detection system proposed in this paper.

  15. Complementary and alternative medicine in women's health. Developing a research agenda.

    PubMed

    Murphy, P A; Kronenberg, F; Wade, C

    1999-01-01

    Complementary and alternative medicine is becoming an established intervention modality within the contemporary health care system. Various forms of complementary and alternative medicine are used by patients and practitioners alike, including chiropractic, massage, botanical medicine, homeopathy, and energy therapies. The National Center for Complementary and Alternative Medicine was established within the National Institutes of Health to facilitate evaluation of these alternative therapies, establish an information clearinghouse, and promote research in the field. This article discusses several aspects of complementary and alternative medicine, relates them to women's health, and describes the need for a research agenda to evaluate the impact of the complementary and alternative medicine modalities used for important conditions affecting women.

  16. The use of Local Ecological Knowledge as a complementary approach to understand the temporal and spatial patterns of fishery resources distribution.

    PubMed

    Lima, Mauro Sergio Pinheiro; Oliveira, Jorge Eduardo Lins; de Nóbrega, Marcelo Francisco; Lopes, Priscila Fabiana Macedo

    2017-06-01

    Acquiring fast and accurate information on ecological patterns of fishery resources is a basic first step for their management. However, some countries may lack the technical and/or the financial means to undergo traditional scientific samplings to get such information; therefore affordable and reliable alternatives need to be sought. We compared two different approaches to identify occurrence patterns and catch for three main fish species caught with bottom-set gillnets used by artisanal fishers from northeast Brazil: (1) scientific on-board record data of small-scale fleet (n = 72 trips), and (2) interviews with small-scale fishers on Local Ecological Knowledge (LEK) (n = 32 interviews). We correlated (Pearson correlations) the months cited by fishers (LEK) as belonging to the rainy or to the dry season with observed periods of higher and lower precipitation (SK). The presence of the three main fish species at different depths was compared between LEK and SK by Spearman correlations. Spearman correlations were also used to compare the depths of greatest abundance (with the highest Capture per Unit Effort - CPUE) of these species; the CPUEs were descendly ordered. Both methods provided similar and complementary bathymetric patterns of species occurrence and catch. The largest catches occured in deeper areas, which also happened to be less intensively fished. The preference for fishing in shallower and less productive areas was mostly due to environmental factors, such as weaker currents and less drifting algae at such depths. Both on-board and interview methods were accurate and brought complementary information, even though fishers provided faster data when compared to scientific on-board observations. When time and funding are not limited, integrative approaches such as the one presented here are likely the best option to obtain information, otherwise fishers' LEK could be a better choice for when a compromise between speed, reliability and cost needs to be reached.

  17. Differential Epitope Mapping by STD NMR Spectroscopy To Reveal the Nature of Protein-Ligand Contacts.

    PubMed

    Monaco, Serena; Tailford, Louise E; Juge, Nathalie; Angulo, Jesus

    2017-11-27

    Saturation transfer difference (STD) NMR spectroscopy is extensively used to obtain epitope maps of ligands binding to protein receptors, thereby revealing structural details of the interaction, which is key to direct lead optimization efforts in drug discovery. However, it does not give information about the nature of the amino acids surrounding the ligand in the binding pocket. Herein, we report the development of the novel method differential epitope mapping by STD NMR (DEEP-STD NMR) for identifying the type of protein residues contacting the ligand. The method produces differential epitope maps through 1) differential frequency STD NMR and/or 2) differential solvent (D 2 O/H 2 O) STD NMR experiments. The two approaches provide different complementary information on the binding pocket. We demonstrate that DEEP-STD NMR can be used to readily obtain pharmacophore information on the protein. Furthermore, if the 3D structure of the protein is known, this information also helps in orienting the ligand in the binding pocket. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  18. Colloidal Silver Products

    MedlinePlus

    ... your health care providers about any complementary health approaches you use. Give them a full picture of ... information on NCCIH and complementary and integrative health approaches, including publications and searches of Federal databases of ...

  19. A hybrid LIBS-Raman system combined with chemometrics: an efficient tool for plastic identification and sorting.

    PubMed

    Shameem, K M Muhammed; Choudhari, Khoobaram S; Bankapur, Aseefhali; Kulkarni, Suresh D; Unnikrishnan, V K; George, Sajan D; Kartha, V B; Santhosh, C

    2017-05-01

    Classification of plastics is of great importance in the recycling industry as the littering of plastic wastes increases day by day as a result of its extensive use. In this paper, we demonstrate the efficacy of a combined laser-induced breakdown spectroscopy (LIBS)-Raman system for the rapid identification and classification of post-consumer plastics. The atomic information and molecular information of polyethylene terephthalate, polyethylene, polypropylene, and polystyrene were studied using plasma emission spectra and scattered signal obtained in the LIBS and Raman technique, respectively. The collected spectral features of the samples were analyzed using statistical tools (principal component analysis, Mahalanobis distance) to categorize the plastics. The analyses of the data clearly show that elemental information and molecular information obtained from these techniques are efficient for classification of plastics. In addition, the molecular information collected via Raman spectroscopy exhibits clearly distinct features for the transparent plastics (100% discrimination), whereas the LIBS technique shows better spectral feature differences for the colored samples. The study shows that the information obtained from these complementary techniques allows the complete classification of the plastic samples, irrespective of the color or additives. This work further throws some light on the fact that the potential limitations of any of these techniques for sample identification can be overcome by the complementarity of these two techniques. Graphical Abstract ᅟ.

  20. Neutron Crystallography for the Study of Hydrogen Bonds in Macromolecules.

    PubMed

    Oksanen, Esko; Chen, Julian C-H; Fisher, Suzanne Zoë

    2017-04-07

    Abstract : The hydrogen bond (H bond) is one of the most important interactions that form the foundation of secondary and tertiary protein structure. Beyond holding protein structures together, H bonds are also intimately involved in solvent coordination, ligand binding, and enzyme catalysis. The H bond by definition involves the light atom, H, and it is very difficult to study directly, especially with X-ray crystallographic techniques, due to the poor scattering power of H atoms. Neutron protein crystallography provides a powerful, complementary tool that can give unambiguous information to structural biologists on solvent organization and coordination, the electrostatics of ligand binding, the protonation states of amino acid side chains and catalytic water species. The method is complementary to X-ray crystallography and the dynamic data obtainable with NMR spectroscopy. Also, as it gives explicit H atom positions, it can be very valuable to computational chemistry where exact knowledge of protonation and solvent orientation can make a large difference in modeling. This article gives general information about neutron crystallography and shows specific examples of how the method has contributed to structural biology, structure-based drug design; and the understanding of fundamental questions of reaction mechanisms.

  1. Neutron crystallography for the study of hydrogen bonds in macromolecules

    DOE PAGES

    Oksanen, Esko; Chen, Julian C.; Fisher, Zoe

    2017-04-07

    The hydrogen bond (H bond) is one of the most important interactions that form the foundation of secondary and tertiary protein structure. Beyond holding protein structures together, H bonds are also intimately involved in solvent coordination, ligand binding, and enzyme catalysis. The H bond by definition involves the light atom, H, and it is very difficult to study directly, especially with X-ray crystallographic techniques, due to the poor scattering power of H atoms. Neutron protein crystallography provides a powerful, complementary tool that can give unambiguous information to structural biologists on solvent organization and coordination, the electrostatics of ligand binding, themore » protonation states of amino acid side chains and catalytic water species. The method is complementary to X-ray crystallography and the dynamic data obtainable with NMR spectroscopy. Also, as it gives explicit H atom positions, it can be very valuable to computational chemistry where exact knowledge of protonation and solvent orientation can make a large difference in modeling. Finally, this article gives general information about neutron crystallography and shows specific examples of how the method has contributed to structural biology, structure-based drug design; and the understanding of fundamental questions of reaction mechanisms.« less

  2. Neutron crystallography for the study of hydrogen bonds in macromolecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oksanen, Esko; Chen, Julian C.; Fisher, Zoe

    The hydrogen bond (H bond) is one of the most important interactions that form the foundation of secondary and tertiary protein structure. Beyond holding protein structures together, H bonds are also intimately involved in solvent coordination, ligand binding, and enzyme catalysis. The H bond by definition involves the light atom, H, and it is very difficult to study directly, especially with X-ray crystallographic techniques, due to the poor scattering power of H atoms. Neutron protein crystallography provides a powerful, complementary tool that can give unambiguous information to structural biologists on solvent organization and coordination, the electrostatics of ligand binding, themore » protonation states of amino acid side chains and catalytic water species. The method is complementary to X-ray crystallography and the dynamic data obtainable with NMR spectroscopy. Also, as it gives explicit H atom positions, it can be very valuable to computational chemistry where exact knowledge of protonation and solvent orientation can make a large difference in modeling. Finally, this article gives general information about neutron crystallography and shows specific examples of how the method has contributed to structural biology, structure-based drug design; and the understanding of fundamental questions of reaction mechanisms.« less

  3. European Mistletoe

    MedlinePlus

    ... Audio) NCCIH Clinical Digest A monthly newsletter with evidence-based information on complementary and integrative practices and a ... and gemcitabine in patients with advanced solid tumors. Evidence-Based Complementary and Alternative Medicine. 2013;2013:964592. National ...

  4. Butterbur

    MedlinePlus

    ... Audio) NCCIH Clinical Digest A monthly newsletter with evidence-based information on complementary and integrative practices and a ... 495. Holland S, Silberstein SD, Freitag F, et al. Evidence-based guideline update: NSAIDs and other complementary treatments for ...

  5. Between genetics and biology. Is ENMG useful in peripheral neuropathy diagnosis and management?

    PubMed

    Stålberg, E

    2016-10-01

    Neurography and EMG are complementary techniques used in the diagnosis and monitoring of neuropathies. Both assess function of the peripheral nervous system and provide clinically useful information regarding the functional status of peripheral nerves. This information is not readily obtainable using biochemical, genetic or imaging techniques. I will discuss the role of these techniques in the diagnosis and management of neuropathies and some limitations of these techniques. These methods are routinely used in an EMG lab. These are most useful when used in conjunction with clinical examination to answer a well-defined clinical question. Reference values are required for interpretation of the data. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  6. Translation and cross-cultural adaptation of a standardized international questionnaire on use of alternative and complementary medicine (I-CAM - Q) for Argentina.

    PubMed

    Esteban, Santiago; Vázquez Peña, Fernando; Terrasa, Sergio

    2016-03-31

    The widespread and growing use of alternative and complementary medicine (CAM) worldwide has been thoroughly described. In Argentina the limited information on the use of CAM has been reported between 40 and 55 %. However, the rate of use is extremely variable worldwide. For this purpose the international questionnaire on the use of complementary and alternative medicines (I-CAM - Q), was developed. The implementation of a translated and cross-culturally adapted version of the questionnaire would allow for a reliable and standardized evaluation of the rate of use of CAM in Argentina. It would be a great step towards improving what we know about the healing habits of our population. The forward and back-translation method was used. Four translators were involved. A committee was commissioned to reconcile the different versions. The process of cross-cultural adaptation was made by consulting 17 alternative and complementary medicine experts using the DELPHI method. The retrieved questionnaire was evaluated in 18 patients sampled by convenience (9 men, different educational and self-reported health levels). The interviews consisted of three parts: an initial demographics questionnaire; the administration of the I-CAM-Q and finally the cognitive interview, which included reviewing the questionnaire and reexamining questions that generated doubts during the interview. The comprehension of the questions was also evaluated. As a last step, using the information obtained from the interviews, the final version of the questionnaire was drafted. The questionnaire seems to have been accepted by most patients during the interviews. Conflictive elements that emerged did not seem to have an impact on its administration. The flexibility of the questionnaire allowed to add professionals and practices which contributed to a more accurate local adaptation. Further research should focus on assessing the questionnaire's psychometric performance and validity, which so far has not been done.

  7. Acupuncture (PDQ®)—Health Professional Version

    Cancer.gov

    Acupuncture is a complementary therapy used by cancer patients to manage cancer and treatment-related symptoms. Get detailed information about acupuncture and its use as a complementary therapy in cancer in this summary for clinicians.

  8. The Challenge of Educating Physicians about Complementary and Alternative Medicine.

    ERIC Educational Resources Information Center

    Konefal, Janet

    2002-01-01

    Asserts that most physicians are not prepared to respond knowledgeably about complementary/alternative medicine (CAM) modalities and suggests incorporating systematic presentation of CAM information into the curricula of medical schools. (EV)

  9. Experimental Test of Entropic Noise-Disturbance Uncertainty Relations for Spin-1/2 Measurements.

    PubMed

    Sulyok, Georg; Sponar, Stephan; Demirel, Bülent; Buscemi, Francesco; Hall, Michael J W; Ozawa, Masanao; Hasegawa, Yuji

    2015-07-17

    Information-theoretic definitions for noise and disturbance in quantum measurements were given in [Phys. Rev. Lett. 112, 050401 (2014)] and a state-independent noise-disturbance uncertainty relation was obtained. Here, we derive a tight noise-disturbance uncertainty relation for complementary qubit observables and carry out an experimental test. Successive projective measurements on the neutron's spin-1/2 system, together with a correction procedure which reduces the disturbance, are performed. Our experimental results saturate the tight noise-disturbance uncertainty relation for qubits when an optimal correction procedure is applied.

  10. Use of complementary and alternative medicine by patients with cancer in northern Turkey: analysis of cost and satisfaction.

    PubMed

    Aydin Avci, Ilknur; Koç, Zeliha; Sağlam, Zeynep

    2012-03-01

    The aims of this study were to determine (1) the prevalence of complementary and alternative medicine use among patients with cancer, (2) the method of use of the particular therapy, (3) the reasons for using complementary and alternative medicine therapies, (4) the benefits experienced by the use of complementary and alternative medicine, (5) the source of information about complementary and alternative medicine therapies and, (6) the satisfaction and cost of complementary and alternative medicine. Complementary and alternative medicine consists of diverse medical and healthcare systems, practices and products that are not considered at present to be a part of conventional medicine. The majority of patients who use complementary and alternative medicine use more than one method. Complementary and alternative medicine use is more common in cases of advanced disease or poor prognosis. This is a descriptive study of complementary and alternative medicine. This study was conducted in the Chemotherapy Unit at Ondokuz Mayıs University, Faculty of Medicine, Samsun, Turkey, between 18 March 2008-30 June 2008. Two hundred fifty-three patients with cancer, among 281 patients who applied to the chemotherapy clinic between these dates, agreed to take part in the study with whom contact could be made were included. A questionnaire including descriptive characteristics in collecting data, characteristics about diseases and their treatments, complementary and alternative medicine information and implementation situations and a control list about complementary and alternative medicine implementations were given. The collected data were evaluated by computer using descriptive statistics, the chi-square test and Student's t-test. In this study, 94·1% of the patients were content with medical treatment, 58·9% of them used complementary and alternative medicine treatments, 41·1% did not use any complementary and alternative medicine treatments. The satisfaction level of the patients with complementary and alternative medicine methods was slightly above mediocre (2·33 SD 0·64, on a scale of 1-3). The average cost per capita spent by the patients using complementary and alternative medicine for all the different methods was US$288·26. It was determined that although patients did not have enough knowledge about complementary and alternative medicine methods, the prevalence of complementary and alternative medicine and satisfaction levels are high that complementary and alternative medicine users spend substantial sums of money for these methods. To sustain medical treatment and prognosis of cancer, it is important for nurses to consult with their patients regarding the use and potential risks of some complementary and alternative medicine. © 2011 Blackwell Publishing Ltd.

  11. Development and utilization of complementary communication channels for treatment decision making and survivorship issues among cancer patients: The CIS Research Consortium Experience.

    PubMed

    Fleisher, Linda; Wen, Kuang Yi; Miller, Suzanne M; Diefenbach, Michael; Stanton, Annette L; Ropka, Mary; Morra, Marion; Raich, Peter C

    2015-11-01

    Cancer patients and survivors are assuming active roles in decision-making and digital patient support tools are widely used to facilitate patient engagement. As part of Cancer Information Service Research Consortium's randomized controlled trials focused on the efficacy of eHealth interventions to promote informed treatment decision-making for newly diagnosed prostate and breast cancer patients, and post-treatment breast cancer, we conducted a rigorous process evaluation to examine the actual use of and perceived benefits of two complementary communication channels -- print and eHealth interventions. The three Virtual Cancer Information Service (V-CIS) interventions were developed through a rigorous developmental process, guided by self-regulatory theory, informed decision-making frameworks, and health communications best practices. Control arm participants received NCI print materials; experimental arm participants received the additional V-CIS patient support tool. Actual usage data from the web-based V-CIS was also obtained and reported. Print materials were highly used by all groups. About 60% of the experimental group reported using the V-CIS. Those who did use the V-CIS rated it highly on improvements in knowledge, patient-provider communication and decision-making. The findings show that how patients actually use eHealth interventions either singularly or within the context of other communication channels is complex. Integrating rigorous best practices and theoretical foundations is essential and multiple communication approaches should be considered to support patient preferences.

  12. Complementary and alternative medicine use in patients presenting to a head and neck oncology clinic.

    PubMed

    Vyas, Tarren; Hart, Robert D; Trites, Jonathan R; Philips, Timothy J; Archibald, Kathleen E M; Phillips, Judith E; Taylor, S Mark

    2010-06-01

    The aim of this study was to determine the prevalence of complementary and alternative medicine (CAM) use among patients presenting to a head and neck oncology clinic prior to a diagnosis. The study was conducted by administering questionnaires to 102 patients after being seen in the Head and Neck Oncology clinic for their initial consultation. The questionnaire assessed the extent of CAM use, types of CAMs used, and their reasons for use. A total of 132 CAMs were currently being used among 56 patients. The most common CAMs in use were multivitamins (26/132) and vitamin D (21/132). Meditation and yoga were associated with the greatest perceived benefit. The majority of patients obtained their information from family and friends. Most patients were using CAMs for physical health and well-being. As CAM use among the population is widespread, it is important for clinicians to specifically address their use on initial presentation. (c) 2009 Wiley Periodicals, Inc. Head Neck, 2010.

  13. Rapid, low dose X-ray diffractive imaging of the malaria parasite Plasmodium falciparum.

    PubMed

    Jones, Michael W M; Dearnley, Megan K; van Riessen, Grant A; Abbey, Brian; Putkunz, Corey T; Junker, Mark D; Vine, David J; McNulty, Ian; Nugent, Keith A; Peele, Andrew G; Tilley, Leann

    2014-08-01

    Phase-diverse X-ray coherent diffractive imaging (CDI) provides a route to high sensitivity and spatial resolution with moderate radiation dose. It also provides a robust solution to the well-known phase-problem, making on-line image reconstruction feasible. Here we apply phase-diverse CDI to a cellular sample, obtaining images of an erythrocyte infected by the sexual stage of the malaria parasite, Plasmodium falciparum, with a radiation dose significantly lower than the lowest dose previously reported for cellular imaging using CDI. The high sensitivity and resolution allow key biological features to be identified within intact cells, providing complementary information to optical and electron microscopy. This high throughput method could be used for fast tomographic imaging, or to generate multiple replicates in two-dimensions of hydrated biological systems without freezing or fixing. This work demonstrates that phase-diverse CDI is a valuable complementary imaging method for the biological sciences and ready for immediate application. © 2013 Elsevier B.V. All rights reserved.

  14. Fusion of 4D echocardiography and cine cardiac magnetic resonance volumes using a salient spatio-temporal analysis

    NASA Astrophysics Data System (ADS)

    Atehortúa, Angélica; Garreau, Mireille; Romero, Eduardo

    2017-11-01

    An accurate left (LV) and right ventricular (RV) function quantification is important to support evaluation, diagnosis and prognosis of cardiac pathologies such as the cardiomyopathies. Currently, diagnosis by ultrasound is the most cost-effective examination. However, this modality is highly noisy and operator dependent, hence prone to errors. Therefore, fusion with other cardiac modalities may provide complementary information and improve the analysis of the specific pathologies like cardiomyopathies. This paper proposes an automatic registration between two complementary modalities, 4D echocardiography and Magnetic resonance images, by mapping both modalities to a common space of salience where an optimal registration between them is estimated. The obtained matrix transformation is then applied to the MRI volume which is superimposed to the 4D echocardiography. Manually selected marks in both modalities are used to evaluate the precision of the superimposition. Preliminary results, in three evaluation cases, show the distance between these marked points and the estimated with the transformation is about 2 mm.

  15. Complementary home mechanical ventilation techniques. SEPAR Year 2014.

    PubMed

    Chiner, Eusebi; Sancho-Chust, José N; Landete, Pedro; Senent, Cristina; Gómez-Merino, Elia

    2014-12-01

    This is a review of the different complementary techniques that are useful for optimizing home mechanical ventilation (HMV). Airway clearance is very important in patients with HMV and many patients, particularly those with reduced peak cough flow, require airway clearance (manual or assisted) or assisted cough techniques (manual or mechanical) and suctioning procedures, in addition to ventilation. In the case of invasive HMV, good tracheostomy cannula management is essential for success. HMV patients may have sleep disturbances that must be taken into account. Sleep studies including complete polysomnography or respiratory polygraphy are helpful for identifying patient-ventilator asynchrony. Other techniques, such as bronchoscopy or nutritional support, may be required in patients on HMV, particularly if percutaneous gastrostomy is required. Information on treatment efficacy can be obtained from HMV monitoring, using methods such as pulse oximetry, capnography or the internal programs of the ventilators themselves. Finally, the importance of the patient's subjective perception is reviewed, as this may potentially affect the success of the HMV. Copyright © 2014 SEPAR. Published by Elsevier Espana. All rights reserved.

  16. High Cholesterol and Complementary Health Practices: What the Science Says

    MedlinePlus

    ... in flaxseed and flaxseed oil) may benefit people with heart disease. But not enough reliable data are available to ... conventional oral medications or other dietary supplements. ... complementary health researchers, and disseminating authoritative information to ...

  17. A review of nurses' knowledge, attitudes, and ability to communicate the risks and benefits of complementary and alternative medicine.

    PubMed

    Chang, Hsiao-Yun; Chang, Huai-Lu

    2015-06-01

    This study reviewed existing literature to investigate how frequently nurses include complementary and alternative forms of medicine in their clinical practice. In so doing, we investigated nurses' knowledge of and attitudes towards complementary and alternative medicine as well as their ability to communicate the risks and benefits of these therapies with patients. Little information is available concerning nurses' knowledge and attitudes towards complementary and alternative medicine or how they incorporate these therapies into their practice. In addition, little is known about the ability of nurses to communicate the risks and benefits of complementary and alternative medicine to their patients. This study used a scoping review method to map and synthesise existing literature. Both electronic and manual searches were used to identify relevant studies published between January 2007 and January 2014. The review was conducted in five stages: (1) identification of research question(s), (2) locate studies, (3) selection of studies, (4) charting of data, and (5) collating, summarising, and reporting of results. Fifteen papers met the inclusion criteria for this review, among which 53·7% referenced how frequently nurses include complementary and alternative medicine in their practice. We found that 66·4% of nurses had positive attitudes towards complementary and alternative medicine; however, 77·4% did not possess a comprehensive understanding of the associated risks and benefits. In addition, nearly half of the respondents (47·3-67·7%) reported feeling uncomfortable discussing complementary and alternative medicine therapies with their patients. The lack of knowledge about complementary and alternative medicine among nurses is a cause for concern, particularly in light of its widespread application. Findings from this study suggest that health care professionals need to promote evidence informed decision-making in complementary and alternative medicine practice and be knowledgeable enough to discuss complementary and alternative medicine therapies. Without involvement of complementary and alternative medicine communication on the part of our profession, we may put our patients at risk of uninformed and without medical guidance. © 2015 John Wiley & Sons Ltd.

  18. Complementary and Alternative Medicine Use in Modern Obstetrics: A Survey of the Central Association of Obstetricians & Gynecologists Members.

    PubMed

    Babbar, Shilpa; Williams, Karen B; Maulik, Dev

    2016-10-05

    The use of complementary and alternative medicine during pregnancy is currently on the rise. A validated survey was conducted at the Central Association of Obstetrician and Gynecologists annual meeting to evaluate the knowledge, attitude, and practice of general obstetricians and gynecologists and maternal-fetal medicine specialists in America. We obtained 128 responses: 73 electronically (57%) and 55 via the paper survey (43%). Forty-five percent reported personally using complementary and alternative medicine and 9% of women respondents used complementary and alternative medicine during pregnancy. Overall, 62% had advised their patients to utilize some form of complementary and alternative medicine in pregnancy. Biofeedback, massage therapy, meditation, and yoga were considered the most effective modalities in pregnancy (median [semi-interquartile range] = 2 [0.5]). Maternal-fetal medicine specialists were significantly more likely to disagree on the use of complementary and alternative medicine for risk reduction of preterm birth compared to obstetricians and gynecologists (P = .03). As the use of complementary and alternative medicine continues to rise in reproductive-age women, obstetricians will play an integral role in incorporating complementary and alternative medicine use with conventional medicine. © The Author(s) 2016.

  19. Complementary and Alternative Medicine Use in Modern Obstetrics: A Survey of the Central Association of Obstetricians & Gynecologists Members

    PubMed Central

    Babbar, Shilpa; Williams, Karen B.; Maulik, Dev

    2016-01-01

    The use of complementary and alternative medicine during pregnancy is currently on the rise. A validated survey was conducted at the Central Association of Obstetrician and Gynecologists annual meeting to evaluate the knowledge, attitude, and practice of general obstetricians and gynecologists and maternal-fetal medicine specialists in America. We obtained 128 responses: 73 electronically (57%) and 55 via the paper survey (43%). Forty-five percent reported personally using complementary and alternative medicine and 9% of women respondents used complementary and alternative medicine during pregnancy. Overall, 62% had advised their patients to utilize some form of complementary and alternative medicine in pregnancy. Biofeedback, massage therapy, meditation, and yoga were considered the most effective modalities in pregnancy (median [semi-interquartile range] = 2 [0.5]). Maternal-fetal medicine specialists were significantly more likely to disagree on the use of complementary and alternative medicine for risk reduction of preterm birth compared to obstetricians and gynecologists (P = .03). As the use of complementary and alternative medicine continues to rise in reproductive-age women, obstetricians will play an integral role in incorporating complementary and alternative medicine use with conventional medicine. PMID:27707901

  20. Integrative, Alternative, and Complementary Therapies (PDQ®)—Patient Version

    Cancer.gov

    Topics in Integrative, Alternative, and Complementary Therapies gives a brief description of some of these therapies used by people with cancer. Learn more about these therapies and get links to additional information in this expert-reviewed summary.

  1. American Academy of Pediatrics. The use of complementary and alternative medicine in pediatrics.

    PubMed

    Kemper, Kathi J; Vohra, Sunita; Walls, Richard

    2008-12-01

    The American Academy of Pediatrics is dedicated to optimizing the well-being of children and advancing family-centered health care. Related to these goals, the American Academy of Pediatrics recognizes the increasing use of complementary and alternative medicine in children and, as a result, the need to provide information and support for pediatricians. From 2000 to 2002, the American Academy of Pediatrics convened and charged the Task Force on Complementary and Alternative Medicine to address issues related to the use of complementary and alternative medicine in children and to develop resources to educate physicians, patients, and families. One of these resources is this report describing complementary and alternative medicine services, current levels of utilization and financial expenditures, and associated legal and ethical considerations. The subject of complementary and alternative medicine is large and diverse, and consequently, an in-depth discussion of each method of complementary and alternative medicine is beyond the scope of this report. Instead, this report will define terms; describe epidemiology; outline common types of complementary and alternative medicine therapies; review medicolegal, ethical, and research implications; review education and training for complementary and alternative medicine providers; provide resources for learning more about complementary and alternative medicine; and suggest communication strategies to use when discussing complementary and alternative medicine with patients and families.

  2. Probing Lung Microstructure with Hyperpolarized 3He Gradient Echo MRI

    PubMed Central

    Sukstanskii, Alexander L; Quirk, James D; Yablonskiy, Dmitriy A

    2014-01-01

    In this paper we demonstrate that Gradient Echo MRI with hyperpolarized 3He gas can be used for simultaneously extracting in vivo information about lung ventilation properties, alveolar geometrical parameters, and blood vessel network structure. This new approach is based on multi-gradient-echo experimental measurements of hyperpolarized 3He gas MRI signal from human lungs and a proposed theoretical model of this signal. Based on computer simulations of 3He atoms diffusing in the acinar airway tree in the presence of an inhomogeneous magnetic field induced by the susceptibility differences between lung tissue (alveolar septa, blood vessels) and lung airspaces we derive analytical expressions relating the time-dependent MR signal to the geometrical parameters of acinar airways and blood vessel network. Data obtained on 8 healthy volunteers are in good agreement with literature values. This information is complementary to the information that is obtained by means of in vivo lung morphometry technique with hyperpolarized 3He diffusion MRI previously developed by our group and opens new opportunities to study lung microstructure in health and disease. PMID:24920182

  3. Use of complementary approaches in pregnant women with a history of miscarriage.

    PubMed

    Huberty, Jennifer; Matthews, Jeni; Leiferman, Jenn A; Lee, Chong

    2018-02-01

    To describe the use of complementary approaches in pregnant women with a history of miscarriage and to investigate whether a miscarriage is associated with the use of complementary approaches during their pregnancy. A cross-sectional survey was distributed to pregnant women residing in the United States (N=890). Women who had a history of miscarriage, were Caucasian, were college educated, reported a high income, had low depression scores, and had low anxiety scores (all P<0.001) were more likely to use complementary approaches. In pregnant women with a history of miscarriage (N=193), the most frequently reported complementary approaches used were prayer (22.3%), yoga (15%), massage (14.5%), chiropractic (13%), and meditation (11.4%). Finally, after adjustment for age, race, education, and income, the odds of using a complementary approach in women with a history of miscarriage was 1.8 (95% CI: 1.3, 2.5, P<0.001) as compared with women without a history of miscarriage (model 1). Associations persisted after additional adjustment for depression, anxiety, and stress; the odds of using a complementary approach in women with a history of miscarriage was 1.7 (95% CI: 1.2, 2.4, P<0.001) (model 2), compared with women without a history of miscarriage. Findings from this study may help inform future studies for pregnant women with a history of miscarriage and may also provide information about appropriate strategies in which health care providers can refer their patients. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Integrative, Alternative, and Complementary Therapies (PDQ®)—Health Professional Version

    Cancer.gov

    Topics in Integrative, Alternative, and Complementary Therapies gives a brief description of some of these therapies used by people with cancer. Links to additional information, references, and resources on the NCI website are provided in this summary for clinicians.

  5. Fully integrated reflection-mode photoacoustic, two-photon, and second harmonic generation microscopy in vivo

    NASA Astrophysics Data System (ADS)

    Song, Wei; Xu, Qiang; Zhang, Yang; Zhan, Yang; Zheng, Wei; Song, Liang

    2016-08-01

    The ability to obtain comprehensive structural and functional information from intact biological tissue in vivo is highly desirable for many important biomedical applications, including cancer and brain studies. Here, we developed a fully integrated multimodal microscopy that can provide photoacoustic (optical absorption), two-photon (fluorescence), and second harmonic generation (SHG) information from tissue in vivo, with intrinsically co-registered images. Moreover, using a delicately designed optical-acoustic coupling configuration, a high-frequency miniature ultrasonic transducer was integrated into a water-immersion optical objective, thus allowing all three imaging modalities to provide a high lateral resolution of ~290 nm with reflection-mode imaging capability, which is essential for studying intricate anatomy, such as that of the brain. Taking advantage of the complementary and comprehensive contrasts of the system, we demonstrated high-resolution imaging of various tissues in living mice, including microvasculature (by photoacoustics), epidermis cells, cortical neurons (by two-photon fluorescence), and extracellular collagen fibers (by SHG). The intrinsic image co-registration of the three modalities conveniently provided improved visualization and understanding of the tissue microarchitecture. The reported results suggest that, by revealing complementary tissue microstructures in vivo, this multimodal microscopy can potentially facilitate a broad range of biomedical studies, such as imaging of the tumor microenvironment and neurovascular coupling.

  6. Evaluation of complementary-alternative medicine (CAM) questionnaire development for Indonesian clinical psychologists: A pilot study.

    PubMed

    Liem, Andrian; Newcombe, Peter A; Pohlman, Annie

    2017-08-01

    This study aimed to evaluate questionnaire development to measure the knowledge of Complementary-Alternative Medicine (CAM), attitudes towards CAM, CAM experiences, and CAM educational needs of clinical psychologists in Indonesia. A 26-item questionnaire was developed through an extensive literature search. Data was obtained from provisional psychologists from the Master of Professional Clinical Psychology programs at two established public universities in urban areas of Indonesia. To validate the questionnaire, panel reviews by executive members of the Indonesian Clinical Psychology Association (ICPA), experts in health psychology, and experts in public health and CAM provided their professional judgements. The self-reporting questionnaire consisted of four scales including: knowledge of CAM (6 items), attitudes towards CAM (10 items), CAM experiences (4 items), and CAM educational needs (6 items). All scales, except CAM Experiences, were assessed on a 7-point Likert scale. Sixty provisional psychologists were eligible to complete the questionnaire with a response rate of 73% (N=44). The results showed that the CAM questionnaire was reliable (Cronbach's coefficient alpha range=0.62-0.96; item-total correlation range=0.14-0.92) and demonstrated content validity. Following further psychometric evaluation, the CAM questionnaire may provide the evidence-based information to inform the education and practice of Indonesian clinical psychologists. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. [In-depth interviews and the Kano model to determine user requirements in a burns unit].

    PubMed

    González-Revaldería, J; Holguín-Holgado, P; Lumbreras-Marín, E; Núñez-López, G

    To determine the healthcare requirements of patients in a Burns Unit, using qualitative techniques, such us in-depth personal interviews and Kano's methodology. Qualitative methodology using in-depth personal interviews (12 patients), Kano's conceptual model, and the SERVQHOS questionnaire (24 patients). All patients had been hospitalised in the last 12 months in the Burns Unit. Using Kano's methodology, service attributes were grouped by affinity diagrams, and classified as follows: must-be, attractive (unexpected, great satisfaction), and one-dimensional (linked to the degree of functionality of the service). The outcomes were compared with those obtained with SERVQHOS questionnaire. From the analysis of in-depth interviews, 11 requirements were obtained, referring to hotel aspects, information, need for closer staff relationship, and organisational aspects. The attributes classified as must-be were free television and automatic TV disconnection at midnight. Those classified as attractive were: individual room for more privacy, information about dressing change times in order to avoid anxiety, and additional staff for in-patients. The results were complementary to those obtained with the SERVQHOS questionnaire. In-depth personal interviews provide extra knowledge about patient requirements, complementing the information obtained with questionnaires. With this methodology, a more active patient participation is achieved and the companion's opinion is also taken into account. Copyright © 2016 SECA. Publicado por Elsevier España, S.L.U. All rights reserved.

  8. Assessment of corneal properties based on statistical modeling of OCT speckle.

    PubMed

    Jesus, Danilo A; Iskander, D Robert

    2017-01-01

    A new approach to assess the properties of the corneal micro-structure in vivo based on the statistical modeling of speckle obtained from Optical Coherence Tomography (OCT) is presented. A number of statistical models were proposed to fit the corneal speckle data obtained from OCT raw image. Short-term changes in corneal properties were studied by inducing corneal swelling whereas age-related changes were observed analyzing data of sixty-five subjects aged between twenty-four and seventy-three years. Generalized Gamma distribution has shown to be the best model, in terms of the Akaike's Information Criterion, to fit the OCT corneal speckle. Its parameters have shown statistically significant differences (Kruskal-Wallis, p < 0.001) for short and age-related corneal changes. In addition, it was observed that age-related changes influence the corneal biomechanical behaviour when corneal swelling is induced. This study shows that Generalized Gamma distribution can be utilized to modeling corneal speckle in OCT in vivo providing complementary quantified information where micro-structure of corneal tissue is of essence.

  9. Content-based Music Search and Recommendation System

    NASA Astrophysics Data System (ADS)

    Takegawa, Kazuki; Hijikata, Yoshinori; Nishida, Shogo

    Recently, the turn volume of music data on the Internet has increased rapidly. This has increased the user's cost to find music data suiting their preference from such a large data set. We propose a content-based music search and recommendation system. This system has an interface for searching and finding music data and an interface for editing a user profile which is necessary for music recommendation. By exploiting the visualization of the feature space of music and the visualization of the user profile, the user can search music data and edit the user profile. Furthermore, by exploiting the infomation which can be acquired from each visualized object in a mutually complementary manner, we make it easier for the user to search music data and edit the user profile. Concretely, the system gives to the user an information obtained from the user profile when searching music data and an information obtained from the feature space of music when editing the user profile.

  10. Age of Complementary Foods Introduction and Risk of Anemia in Children Aged 4-6 years: A Prospective Birth Cohort in China.

    PubMed

    Wang, Fenglei; Liu, Huijuan; Wan, Yi; Li, Jing; Chen, Yu; Zheng, Jusheng; Huang, Tao; Li, Duo

    2017-03-23

    Age of complementary foods introduction is associated with childhood anemia, but the ideal age for the introduction of complementary foods to infants is a continuing topic of debate. We examined the longitudinal association between complementary foods introduction age and risk of anemia in 18,446 children from the Jiaxing Birth Cohort, who had detailed complementary feeding records at 3 and 6 months of age and had hemoglobin concentrations measured at 4-6 years. Early introduction of complementary foods at 3-6 months of age was significantly associated with a higher risk of anemia (odds ratio = 1.14; 95% confidence interval: 1.01-1.28) and a lower hemoglobin concentration of -0.84 g/L (95% confidence interval: -1.33 to -0.35) in children aged 4-6 years, compared with those fed complementary foods starting at 6 months of age. When it comes to the specific type of complementary foods, early introduction of all plant-based foods was associated with increased anemia risks and lower hemoglobin concentrations, while early introduction of most animal-based foods was not. These findings may be informative regarding the appropriate time to introduce complementary foods in infants.

  11. Spectroscopic Investigations of Fragment Species in the Coma

    NASA Technical Reports Server (NTRS)

    Feldman, Paul D.; Cochran, Anita L.; Combi, Michael R.

    2004-01-01

    The content of the gaseous coma of a comet is dominated by fragment species produced by photolysis of the parent molecules issuing directly from the icy nucleus of the comet. Spectroscopy of these species provides complementary information on the physical state of the coma to that obtained from observations of the parent species. Extraction of physical parameters requires detailed molecular and atomic data together with reliable high-resolution spectra and absolute fluxes of the primary source of excitation, the Sun. The large database of observations, dating back more than a century, provides a means to assess the chemical and evolutionary diversity of comets.

  12. Traditional Chinese Medicine: An Introduction

    MedlinePlus

    ... comprehensive survey on the use of complementary health approaches by Americans, an estimated 3.1 million U.S. adults had used acupuncture in the ... information on NCCIH and complementary and integrative health approaches, including ... the U.S.: 1-888-644-6226 TTY (for deaf and hard- ...

  13. Comparison of Three Information Sources for Smoking Information in Electronic Health Records

    PubMed Central

    Wang, Liwei; Ruan, Xiaoyang; Yang, Ping; Liu, Hongfang

    2016-01-01

    OBJECTIVE The primary aim was to compare independent and joint performance of retrieving smoking status through different sources, including narrative text processed by natural language processing (NLP), patient-provided information (PPI), and diagnosis codes (ie, International Classification of Diseases, Ninth Revision [ICD-9]). We also compared the performance of retrieving smoking strength information (ie, heavy/light smoker) from narrative text and PPI. MATERIALS AND METHODS Our study leveraged an existing lung cancer cohort for smoking status, amount, and strength information, which was manually chart-reviewed. On the NLP side, smoking-related electronic medical record (EMR) data were retrieved first. A pattern-based smoking information extraction module was then implemented to extract smoking-related information. After that, heuristic rules were used to obtain smoking status-related information. Smoking information was also obtained from structured data sources based on diagnosis codes and PPI. Sensitivity, specificity, and accuracy were measured using patients with coverage (ie, the proportion of patients whose smoking status/strength can be effectively determined). RESULTS NLP alone has the best overall performance for smoking status extraction (patient coverage: 0.88; sensitivity: 0.97; specificity: 0.70; accuracy: 0.88); combining PPI with NLP further improved patient coverage to 0.96. ICD-9 does not provide additional improvement to NLP and its combination with PPI. For smoking strength, combining NLP with PPI has slight improvement over NLP alone. CONCLUSION These findings suggest that narrative text could serve as a more reliable and comprehensive source for obtaining smoking-related information than structured data sources. PPI, the readily available structured data, could be used as a complementary source for more comprehensive patient coverage. PMID:27980387

  14. Complementary Feeding: Review of Recommendations, Feeding Practices, and Adequacy of Homemade Complementary Food Preparations in Developing Countries – Lessons from Ethiopia

    PubMed Central

    Abeshu, Motuma Adimasu; Lelisa, Azeb; Geleta, Bekesho

    2016-01-01

    Breastfeeding provides the ideal food during the first 6 months of life. Complementary feeding starts when breast milk is no longer sufficient by itself, where the target age is for 6–23 months. The gap between nutritional requirement and amount obtained from breast milk increases with age. For energy, 200, 300, and 550 kcal per day is expected to be covered by complementary foods at 6–8, 9–11, and 12–23 months, respectively. In addition, the complementary foods must provide relatively large proportions of micronutrients such as iron, zinc, phosphorus, magnesium, calcium, and vitamin B6. In several parts of the developing world, complementary feeding continues as a challenge to good nutrition in children. In Ethiopia, only 4.2% of breastfed children of 6–23 months of age have a minimum acceptable diet. The gaps are mostly attributed to either poor dietary quality or poor feeding practices, if not both. Commercial fortified foods are often beyond the reach of the poor. Thus, homemade complementary foods remain commonly used. Even when based on an improved recipe, however, unfortified plant-based complementary foods provide insufficient key micronutrients (especially, iron, zinc, and calcium) during the age of 6–23 months. Thus, this review assessed complementary feeding practice and recommendation and reviewed the level of adequacy of homemade complementary foods. PMID:27800479

  15. Complementary medicine for cancer patients in general practice: qualitative interviews with german general practitioners.

    PubMed

    Dahlhaus, Anne; Siebenhofer, Andrea; Guethlin, Corina

    2015-01-01

    The aim of this study was to investigate how general practitioners react when their cancer patients show interest in complementary medicine, and how their reaction is related to their knowledge in the field. We conducted semi-structured interviews with 10 German general practitioners. Interviewees came from 5 different federal states and varied in terms of urban/rural setting, single/joint practice, additional certifications, gender and length of professional experience. Interviews were electronically recorded, transcribed and then analysed using qualitative content analysis according to Mayring. General practitioners feel largely responsible for providing information on complementary medicine to their cancer patients. However, uncertainty and a lack of knowledge concerning CAM lead mainly to reactive responses to patients' needs, and the general practitioners base their recommendations on personal experiences and attitudes. They wish to support their cancer patients and thus, in order to keep their patients' hopes up and maintain a trusting relationship, sometimes support complementary medicine, regardless of their own convictions. Although general practitioners see themselves as an important source of information on complementary medicine for their cancer patients, they also speak of their uncertainties and lack of knowledge. General practitioners would profit from training in complementary medicine enabling them to discuss this topic with their cancer patients in a proactive, open and honest manner. © 2015 S. Karger GmbH, Freiburg

  16. Monitoring of live cell cultures during apoptosis by phase imaging and Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Sharikova, Anna; Saide, George; Sfakis, Lauren; Park, Jun Yong; Desta, Habben; Maloney, Maxwell C.; Castracane, James; Mahajan, Supriya D.; Khmaladze, Alexander

    2017-02-01

    Non-invasive live cell measurements are an important tool in biomedical research. We present a combined digital holography/Raman spectroscopy technique to study live cell cultures during apoptosis. Digital holographic microscopy records an interference pattern between object and reference waves, so that the computationally reconstructed holographic image contains both amplitude and phase information about the sample. When the phase is mapped across the sample and converted into height information for each pixel, a three dimensional image is obtained. The measurement of live cell cultures by digital holographic microscopy yields information about cell shape and volume, changes to which are reflective of alterations in cell cycle and initiation of cell death mechanisms. Raman spectroscopy, on the other hand, is sensitive to rotational and vibrational molecular transitions, as well as intermolecular vibrations. Therefore, Raman spectroscopy provides complementary information about cells, such as protein, lipid and nucleic acid content, and, particularly, the spectral signatures associated with structural changes in molecules. The cell cultures are kept in the temperature-controlled environmental chamber during the experiment, which allows monitoring over multiple cell cycles. The DHM system combines a visible (red) laser source with conventional microscope base, and LabVIEW-run data processing. We analyzed and compared cell culture information obtained by these two methods.

  17. a Robust Descriptor Based on Spatial and Frequency Structural Information for Visible and Thermal Infrared Image Matching

    NASA Astrophysics Data System (ADS)

    Fu, Z.; Qin, Q.; Wu, C.; Chang, Y.; Luo, B.

    2017-09-01

    Due to the differences of imaging principles, image matching between visible and thermal infrared images still exist new challenges and difficulties. Inspired by the complementary spatial and frequency information of geometric structural features, a robust descriptor is proposed for visible and thermal infrared images matching. We first divide two different spatial regions to the region around point of interest, using the histogram of oriented magnitudes, which corresponds to the 2-D structural shape information to describe the larger region and the edge oriented histogram to describe the spatial distribution for the smaller region. Then the two vectors are normalized and combined to a higher feature vector. Finally, our proposed descriptor is obtained by applying principal component analysis (PCA) to reduce the dimension of the combined high feature vector to make our descriptor more robust. Experimental results showed that our proposed method was provided with significant improvements in correct matching numbers and obvious advantages by complementing information within spatial and frequency structural information.

  18. Use of Complementary and Alternative Medicine for Epileptic Children in Tehran: A Cross-Sectional Study (2009-2011)

    PubMed Central

    TONEKABONI, Seyed Hassan; JAFARI NAEINI, Sepideh; KHAJEH, Ali; YAGHINI, Omid; GHAZAVI, Ahad; ABDOLLAH GORJI, Fatemeh

    2014-01-01

    Objective Although the use of Complementary and Alternative Medicine (CAM) has been evaluated globally, there are few studies in our country on this subject. The purpose of this study was to determine the prevalence, pattern of use, parental sources of information, and benefits of CAM in epileptic children in Tehran. Materials & Methods One hundred thirty-three parents or relatives of epileptic children who were referred to outpatient clinics or admitted in neurologic ward of four major hospitals in Tehran, were interviewed by our researcher based on a structured questionnaire; from 2009 to 2010. The information obtained comprised the demographic data of patients and their parents, frequency and morphology of convulsions, the type and sources of CAM and finally, the benefits and adverse effects of this practice. Results Forty-four percent of the respondents had used CAM methods either alone or in combination with other methods. The most frequently used CAM was written prayers followed by oral herbs and special diets. CAM was mainly introduced to them by relatives. Only 16.7% of these parents had discussed this matter with their children’s physicians. No efficacy to control seizure was observed for most of these methods. Conclusion This study showed that use of CAM in our study group is relatively common and may have a potentially hazardous role in the treatment process. So, it is necessary for physicians to have enough information about CAM practice in their patients. PMID:24665324

  19. Attitudes of members of the German Society for Palliative Medicine toward complementary and alternative medicine for cancer patients.

    PubMed

    Conrad, A C; Muenstedt, K; Micke, O; Prott, F J; Muecke, R; Huebner, J

    2014-07-01

    A high proportion of cancer patients use complementary and alternative medicine (CAM). In oncology, risks of CAM are side effects and interactions. Our aim was to conduct a survey on professionals in palliative care regarding attitudes toward CAM. An internet-based survey with a standardized questionnaire was sent to all members of the German Society for Palliative Care. The questionnaire collected data on attitude toward CAM and experiences. Six hundred and ninety questionnaires (19 %) were returned (49 % physicians, 35 % nurses, 3 % psychologists). Acceptance of CAM is high (92 % for complementary and 54 % for alternative medicine). Most participants had already been asked on CAM by patients (95 %) and relatives (89 %). Forty-four percent already had used complementary methods and 5 % alternative methods. Only 21 % think themselves adequately informed. Seventy-four percent would use complementary methods in a patient with advanced tumor, and 62 % would use alternative therapy in patients if there was no other therapy. Even from those who are skeptical 45 % would treat a patient with alternative methods. In order to inform patients on CAM and to further patients' autonomy, evidence on benefits and harms of CAM must be provided. As awareness of risks from CAM is low and critical appraisal especially of alternative medicine missing, but interest on information on CAM is high, experts should provide evidence-based recommendations for CAM in palliative care to members of different professions. This could be done by a curriculum focusing on the most often used CAM methods.

  20. PDQ® Cancer Information

    Cancer.gov

    An NCI database that contains the latest information about cancer treatment, screening, prevention, genetics, supportive care, and complementary and alternative medicine, plus drug information and a dictionary of cancer terms.

  1. Kids These Days: Urine as a Home Remedy for Acne Vulgaris?

    PubMed Central

    Totri, Christine R.; Matiz, Catalina

    2015-01-01

    Complementary and alternative medicine therapies are gaining popularity among patients, aided by modern media outlets that facilitate easy and rapid dissemination of information. “Urine therapy” is one such complementary and alternative medicine and is described by its proponents as a wonder therapy for inflammatory conditions, such as acne vulgaris. As with other complementary and alternative medicines, healthcare providers should be mindful of the use of urine therapy and its potential implications for patients who may utilize it. PMID:26557221

  2. Multi-modal approach using Raman spectroscopy and optical coherence tomography for the discrimination of colonic adenocarcinoma from normal colon

    PubMed Central

    Ashok, Praveen C.; Praveen, Bavishna B.; Bellini, Nicola; Riches, Andrew; Dholakia, Kishan; Herrington, C. Simon

    2013-01-01

    We report a multimodal optical approach using both Raman spectroscopy and optical coherence tomography (OCT) in tandem to discriminate between colonic adenocarcinoma and normal colon. Although both of these non-invasive techniques are capable of discriminating between normal and tumour tissues, they are unable individually to provide both the high specificity and high sensitivity required for disease diagnosis. We combine the chemical information derived from Raman spectroscopy with the texture parameters extracted from OCT images. The sensitivity obtained using Raman spectroscopy and OCT individually was 89% and 78% respectively and the specificity was 77% and 74% respectively. Combining the information derived using the two techniques increased both sensitivity and specificity to 94% demonstrating that combining complementary optical information enhances diagnostic accuracy. These data demonstrate that multimodal optical analysis has the potential to achieve accurate non-invasive cancer diagnosis. PMID:24156073

  3. Discussion of "Representation of People's Decisions in Health Information Systems: A Complementary Approach for Understanding Health Care Systems and Population Health".

    PubMed

    Al-Shorbaji, Najeeb; Borycki, Elizabeth M; Kimura, Michio; Lehmann, Christoph U; Lorenzi, Nancy M; Moura, Lincoln A; Winter, Alfred

    2017-02-01

    This article is part of a For-Discussion-Section of Methods of Information in Medicine about the paper "Representation of People's Decisions in Health Information Systems: A Complementary Approach for Understanding Health Care Systems and Population Health" written by Fernan Gonzalez Bernaldo de Quiros, Adriana Ruth Dawidowski, and Silvana Figar. It is introduced by an editorial. This article contains the combined commentaries invited to independently comment on the paper of de Quiros, Dawidowski, and Figar. In subsequent issues the discussion can continue through letters to the editor.

  4. Use of complementary and alternative medicine in children and adolescents with autism spectrum disorder: A systematic review.

    PubMed

    Höfer, Juliana; Hoffmann, Falk; Bachmann, Christian

    2017-05-01

    Despite limited evidence, complementary and alternative medicine treatments are popular in autism spectrum disorder. The aim of this review was to summarize the available evidence on complementary and alternative medicine use frequency in autism spectrum disorder. A systematic search of three electronic databases was performed. All research studies in English or German reporting data on the frequency of complementary and alternative medicine use in individuals with autism spectrum disorder were included. Two independent reviewers searched the literature, extracted information on study design and results, and assessed study quality using an established quality assessment tool. Twenty studies with a total of 9540 participants were included. The prevalence of any complementary and alternative medicine use ranged from 28% to 95% (median: 54%). Special diets or dietary supplements (including vitamins) were the most frequent complementary and alternative medicine treatments, ranking first in 75% of studies. There was some evidence for a higher prevalence of complementary and alternative medicine use in autism spectrum disorder compared to other psychiatric disorders and the general population. Approximately half of children and adolescents with autism spectrum disorder use complementary and alternative medicine. Doctors should be aware of this and should discuss complementary and alternative medicine use with patients and their carers, especially as the evidence is mixed and some complementary and alternative medicine treatments are potentially harmful.

  5. Simultaneous Neutron and X-ray Tomography for Quantitative analysis of Geological Samples

    NASA Astrophysics Data System (ADS)

    LaManna, J.; Hussey, D. S.; Baltic, E.; Jacobson, D. L.

    2016-12-01

    Multiphase flow is a critical area of research for shale gas, oil recovery, underground CO2 sequestration, geothermal power, and aquifer management. It is critical to understand the porous structure of the geological formations in addition to the fluid/pore and fluid/fluid interactions. Difficulties for analyzing flow characteristics of rock cores are in obtaining 3D distribution information on the fluid flow and maintaining the cores in a state for other analysis methods. Two powerful non-destructive methods for obtaining 3D structural and compositional information are X-ray and neutron tomography. X-ray tomography produces information on density and structure while neutrons excel at acquiring the liquid phase and produces compositional information. These two methods can offer strong complementary information but are typically conducted at separate times and often at different facilities. This poses issues for obtaining dynamic and stochastic information as the sample will change between analysis modes. To address this, NIST has developed a system that allows for multimodal, simultaneous tomography using thermal neutrons and X-rays by placing a 90 keVp micro-focus X-ray tube 90° to the neutron beam. High pressure core holders that simulate underground conditions have been developed to facilitate simultaneous tomography. These cells allow for the control of confining pressure, axial load, temperature, and fluid flow through the core. This talk will give an overview the simultaneous neutron and x-ray tomography capabilities at NIST, the benefits of multimodal imaging, environmental equipment for geology studies, and several case studies that have been conducted at NIST.

  6. Complementary and Alternative Therapies: An Evidence-Based Framework

    ERIC Educational Resources Information Center

    Shaw, Steven R.

    2008-01-01

    Complementary and alternative medicine (CAM) has experienced a dramatic growth in use and acceptability over the last 20 years. CAM is a diverse collection of medical and healthcare systems, practices, and products that are not presently considered a component of conventional medicine. CAM traditionally has been practiced by informally educated…

  7. A combined positron emission tomography (PET)-electron paramagnetic resonance imaging (EPRI) system: initial evaluation of a prototype scanner

    NASA Astrophysics Data System (ADS)

    Tseytlin, Mark; Stolin, Alexander V.; Guggilapu, Priyaankadevi; Bobko, Andrey A.; Khramtsov, Valery V.; Tseytlin, Oxana; Raylman, Raymond R.

    2018-05-01

    The advent of hybrid scanners, combining complementary modalities, has revolutionized the application of advanced imaging technology to clinical practice and biomedical research. In this project, we investigated the melding of two complementary, functional imaging methods: positron emission tomography (PET) and electron paramagnetic resonance imaging (EPRI). PET radiotracers can provide important information about cellular parameters, such as glucose metabolism. While EPR probes can provide assessment of tissue microenvironment, measuring oxygenation and pH, for example. Therefore, a combined PET/EPRI scanner promises to provide new insights not attainable with current imagers by simultaneous acquisition of multiple components of tissue microenvironments. To explore the simultaneous acquisition of PET and EPR images, a prototype system was created by combining two existing scanners. Specifically, a silicon photomultiplier (SiPM)-based PET scanner ring designed as a portable scanner was combined with an EPRI scanner designed for the imaging of small animals. The ability of the system to obtain simultaneous images was assessed with a small phantom consisting of four cylinders containing both a PET tracer and EPR spin probe. The resulting images demonstrated the ability to obtain contemporaneous PET and EPR images without cross-modality interference. Given the promising results from this initial investigation, the next step in this project is the construction of the next generation pre-clinical PET/EPRI scanner for multi-parametric assessment of physiologically-important parameters of tissue microenvironments.

  8. Preliminary results of human PrPC protein studied by spectroscopic techniques

    NASA Astrophysics Data System (ADS)

    Nowakowski, Michał; Czapla-Masztafiak, Joanna; Kozak, Maciej; Zhukov, Igor; Zhukova, Lilia; Szlachetko, Jakub; Kwiatek, Wojciech M.

    2017-11-01

    Neurodegenerative diseases are one of the malfunctions of human nervous system, being a class of complex and prominent pathologies. The human prion Protease Resistant Protein (PrP) is protein regulating copper metabolism in mammalian cells through binding of Cu(II) ions to specific fragments. Nowadays misfolding of this protein is associated with development of prion diseases. Therefore, it is crucial to obtain structural information about coordination of Cu(II) by PrP protein. Herein, we report X-ray absorption spectroscopy (XAS) measurements, carried out on SuperXAS beamline (SLS, PSI Villigen) on PrPC-Cu(II) complexes. Obtained results were compared with theoretical predictions done by FEFF 9.6 software. Complementary to XAS data, Atomic Force Microscopy (AFM) measurements were conducted to obtain low resolution structural information about prepared sample that allow to develop protocol of fixing PrPC molecules on solid substrate used for further experiments. It has been established that folded C-terminal domain of PrPC protein has around 5 nm in diameter. Presented results showed that both XAS and AFM methods are useful tools in detailed examination of complexes of human PrPC either with Cu(II) or with other divalent metal ions.

  9. Quality of Rapeseed Bio-Fuel Waste: Optical Properties

    NASA Astrophysics Data System (ADS)

    Sujak, Agnieszka; Muszyñski, Siemowit; Kachel-Jakubowska, Magdalena

    2014-04-01

    The objective of the presented work was to examine the optical properties of selected bio-fuel waste. Three independent optical methods: UV-Vis spectroscopy, infrared spectroscopy and chromametric measurements were applied to establish the possible quality control test for the obtained substances. The following by-products were tested: distilled glycerine, technical glycerine and matter organic non glycerine fraction from rapeseed oil bio-fuel production. The results show that analysis of UV-Vis spectra can give rapid information about the purity of distilled glycerine, while no direct information can be obtained concerning the concentration and kind of impurities. Transmission mode is more useful as compared to absorption, concerning the detection abilities of average UV-Vis spectrometers. Infrared spectroscopy can be used as a complementary method for determining impurities/admixtures in samples. Measurements of chroma give the quickest data to compare the colour of biofuel by-products obtained by different producers. The condition is, however, that the products are received through the same or similar chemical processes. The other important factor is application of well defined measuring background. All the discussed analyses are quick, cheap and non-destructive, and can help to compare the quality of products.

  10. Complementary use of PIXE-alpha and XRF portable systems for the non-destructive and in situ characterization of gemstones in museums

    NASA Astrophysics Data System (ADS)

    Pappalardo, L.; Karydas, A. G.; Kotzamani, N.; Pappalardo, G.; Romano, F. P.; Zarkadas, Ch.

    2005-09-01

    Gemstones on gold Hellenistic (late 4th century BC, 1st AD) jewelry, exhibited at the Benaki Museum of Athens, were analyzed in situ by means of two non-destructive and portable analytical techniques. The composition of major and minor elements was determined using a new portable PIXE-alpha spectrometer. The analytical features of this spectrometer allow the determination of matrix elements from Na to Zn through the K-lines and the determination of higher atomic number elements via the L- or M-lines. The red stones analyzed were revealed as red garnets, displaying a compositional range from Mg-rich garnet to Fe-rich garnet. The complementary use of a portable XRF spectrometer provided additional information on some trace elements (Cr and Y), which are considered to be important for the chemical separation between different garnet groups. A comparison of our results with recent literature data offers useful indications about the possible geographical provenance of the stones. The analytical techniques, their complementarity and the results obtained are presented and discussed.

  11. Fragmentation study of iridoid glucosides through positive and negative electrospray ionization, collision-induced dissociation and tandem mass spectrometry.

    PubMed

    Es-Safi, Nour-Eddine; Kerhoas, Lucien; Ducrot, Paul-Henri

    2007-01-01

    Mass spectrometric methodology based on the combined use of positive and negative electrospray ionization, collision-induced dissociation (CID) and tandem mass spectrometry (MS/MS) has been applied to the mass spectral study of a series of six naturally occurring iridoids through in-source fragmentation of the protonated [M+H]+, deprotonated [M--H]- and sodiated [M+Na]+ ions. This led to the unambiguous determination of the molecular masses of the studied compounds and allowed CID spectra of the molecular ions to be obtained. Valuable structural information regarding the nature of both the glycoside and the aglycone moiety was thus obtained. Glycosidic cleavage and ring cleavages of both aglycone and sugar moieties were the major fragmentation pathways observed during CID, where the losses of small molecules, the cinnamoyl and the cinnamate parts were also observed. The formation of the ionized aglycones, sugars and their product ions was thus obtained giving information on their basic skeleton. The protonated, i.e. [M+H]+ and deprotonated [M--H]-, ions were found to fragment mainly by glycosidic cleavages. MS/MS spectra of the [M+Na]+ ions gave complementary information for the structural characterization of the studied compounds. Unlike the dissociation of protonated molecular ions, that of sodiated molecules also provided sodiated sugar fragments where the C0+ fragment corresponding to the glucose ion was obtained as base peak for all the studied compounds. Copyright (c) 2007 John Wiley & Sons, Ltd.

  12. Observations of z-dependent microbunching harmonic intensities using COTR in a SASE FEL.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lumpkin, A. H.; Biedron, S. G.; Dejus, R. J.

    The nonlinear generation of harmonics in a self-amplified spontaneous emission (SASE) free-electron laser (FEL) continues to be of interest. Complementary to such studies is the search for information on the electron beam microbunching harmonic components, which are revealed by coherent optical transition radiation (COTR) experiments. An initial z-dependent set of data has been obtained with the fundamental at 530 nm and the second harmonic at 265 nm. The latter data were collected after every other undulator in a nine-undulator string. These results are compared to estimates based on GINGER and an analytical model for nonlinear harmonic generation.

  13. Prevalence, Types and Determinants of Complementary and Alternative Medications among Health Clinic Clients

    ERIC Educational Resources Information Center

    Almousa, H.; Rabie, Faten M.; Alsamghan, Awad S.; Alsaluli, Mobarak; Albqami, Sultan; Almusa, Mona; Al-shahrani, Areej

    2015-01-01

    Complementary and Alternative Medicine (CAM) covers a wide range of over 100 healing approaches, philosophies and therapeutic modalities that are not provided by conventional medicine. Objectives: The study was aimed at identifying the prevalence, types and determinants of CAM use, sources of information about CAM that patients usually depend upon…

  14. Discussion of “Representation of People’s Decisions in Health Information Systems: A Complementary Approach for Understanding Health Care Systems and Population Health”

    PubMed Central

    2017-01-01

    Summary This article is part of a For-Discussion-Section of Methods of Information in Medicine about the paper “Representation of People’s Decisions in Health Information Systems: A Complementary Approach for Understanding Health Care Systems and Population Health” written by Fernan Gonzalez Bernaldo de Quiros, Adriana Ruth Dawidowski, and Silvana Figar. It is introduced by an editorial. This article contains the combined commentaries invited to independently comment on the paper of de Quiros, Dawidowski, and Figar. In subsequent issues the discussion can continue through letters to the editor. PMID:28144678

  15. Complementary and alternative medicine use in children with cystic fibrosis.

    PubMed

    Giangioppo, Sandra; Kalaci, Odion; Radhakrishnan, Arun; Fleischer, Erin; Itterman, Jennifer; Lyttle, Brian; Price, April; Radhakrishnan, Dhenuka

    2016-11-01

    To estimate the overall prevalence of complementary and alternative medicine use among children with cystic fibrosis, determine specific modalities used, predictors of use and subjective helpfulness or harm from individual modalities. Of 53 children attending the cystic fibrosis clinic in London, Ontario (100% recruitment), 79% had used complementary and alternative medicine. The most commonly used modalities were air purifiers, humidifiers, probiotics, and omega-3 fatty acids. Family complementary and alternative medicine use was the only independent predictor of overall use. The majority of patients perceived benefit from specific modalities for cystic fibrosis symptoms. Given the high frequency and number of modalities used and lack of patient and disease characteristics predicting use, we recommend that health care providers should routinely ask about complementary and alternative medicine among all pediatric cystic fibrosis patients and assist patients in understanding the potential benefits and risks to make informed decisions about its use. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Using Neutron Spectroscopy to Obtain Quantitative Composition Data of Ganymede's Surface from the Jupiter Ganymede Orbiter

    NASA Astrophysics Data System (ADS)

    Lawrence, D. J.; Maurice, S.; Patterson, G. W.; Hibbitts, C. A.

    2010-05-01

    Understanding the global composition of Ganymede's surface is a key goal of the Europa Jupiter System Mission (EJSM) that is being jointly planned by NASA and ESA. Current plans for obtaining surface information with the Jupiter Ganymede Orbiter (JGO) use spectral imaging measurements. While spectral imaging can provide good mineralogy-related information, quantitative data about elemental abundances can often be hindered by non-composition variations due to surface effects (e.g., space weathering, grain effects, temperature, etc.). Orbital neutron and gamma-ray spectroscopy can provide quantitative composition information that is complementary to spectral imaging measurements, as has been demonstrated with similar instrumental combinations at the Moon, Mars, and Mercury. Neutron and gamma-ray measurements have successfully returned abundance information in a hydrogen-rich environment on Mars. In regards to neutrons and gamma-rays, there are many similarities between the Mars and Ganymede hydrogen-rich environments. In this study, we present results of neutron transport models, which show that quantitative composition information from Ganymede's surface can be obtained in a realistic mission scenario. Thermal and epithermal neutrons are jointly sensitive to the abundances of hydrogen and neutron absorbing elements, such as iron and titanium. These neutron measurements can discriminate between regions that are rich or depleted in neutron absorbing elements, even in the presence of large amounts of hydrogen. Details will be presented about how the neutron composition parameters can be used to meet high-level JGO science objectives, as well as an overview of a neutron spectrometer than can meet various mission and stringent environmental requirements.

  17. Patient Use of Complementary and Alternative Medicines in an Outpatient Pediatric Neurology Clinic.

    PubMed

    Kenney, Daniel; Jenkins, Sarah; Youssef, Paul; Kotagal, Suresh

    2016-05-01

    This article describes the use of complementary and alternative medicines in an outpatient pediatric neurology clinic, and assesses family attitudes toward the efficacy of complementary and alternative medicines versus prescription medications. Complementary and alternative medicine is an important element of the modern health care landscape. There is limited information about whether, and to what extent, families perceive its utility in childhood neurological disorders. Surveys were distributed to 500 consecutive patients at a child neurology clinic in Rochester, Minnesota. Questions pertained to the child's diagnoses, use of complementary and alternative medicines, and the specific complementary and alternative medicine modalities that were used. Opinions were also gathered on the perceived efficacy of complementary and alternative medicines and prescription medications. Data were compared using χ(2) or Fisher exact tests as indicated. A total of 484 surveys were returned, of which 327 were usable. Only 17.4% admitted to use of complementary and alternative medicine to treat neurological problems. However, in follow-up questioning, actually 41.6% of patients recognized that they were using one or more types of complementary and alternative medicines. Disorders associated with a statistically significant increased prevalence of complementary and alternative medicine use were headache (50.8% with headache used complementary and alternative medicine versus 35.7% without headache; P = 0.008, Fisher exact test), chronic fatigue (63.2% vs 38.8%; P = 0.005, Fisher exact test), and sleep disorders (77.1% vs 37.3%; P < 0.0001, Fisher exact test). A large proportion of pediatric neurology patients in our clinic are also using complementary and alternative medicine. Only 38.5% of these recognize themselves as using complementary and alternative medicine, underlining the need to inquire in-depth about its use. Patients who are less satisfied with their prescription medications are more likely to use complementary and alternative medicine, perhaps reflecting the less tractable nature of their disorders. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Development and Translation of Hybrid Optoacoustic/Ultrasonic Tomography for Early Breast Cancer Detection

    DTIC Science & Technology

    2015-09-01

    OAT) and laser-induced ultrasound tomography (LUT) to obtain coregistered maps of tissue optical absorption and speed of sound , displayed within the...computed tomography (UST) can provide high-resolution anatomical images of breast lesions based on three complementary acoustic properties (speed-of- sound ...tomography (UST) can provide high-resolution anatomical images of breast lesions based on three complementary acoustic properties (speed-of- sound

  19. Dietary Protein Intake in Young Children in Selected Low-Income Countries Is Generally Adequate in Relation to Estimated Requirements for Healthy Children, Except When Complementary Food Intake Is Low.

    PubMed

    Arsenault, Joanne E; Brown, Kenneth H

    2017-05-01

    Background: Previous research indicates that young children in low-income countries (LICs) generally consume greater amounts of protein than published estimates of protein requirements, but this research did not account for protein quality based on the mix of amino acids and the digestibility of ingested protein. Objective: Our objective was to estimate the prevalence of inadequate protein and amino acid intake by young children in LICs, accounting for protein quality. Methods: Seven data sets with information on dietary intake for children (6-35 mo of age) from 6 LICs (Peru, Guatemala, Ecuador, Bangladesh, Uganda, and Zambia) were reanalyzed to estimate protein and amino acid intake and assess adequacy. The protein digestibility-corrected amino acid score of each child's diet was calculated and multiplied by the original (crude) protein intake to obtain an estimate of available protein intake. Distributions of usual intake were obtained to estimate the prevalence of inadequate protein and amino acid intake for each cohort according to Estimated Average Requirements. Results: The prevalence of inadequate protein intake was highest in breastfeeding children aged 6-8 mo: 24% of Bangladeshi and 16% of Peruvian children. With the exception of Bangladesh, the prevalence of inadequate available protein intake decreased by age 9-12 mo and was very low in all sites (0-2%) after 12 mo of age. Inadequate protein intake in children <12 mo of age was due primarily to low energy intake from complementary foods, not inadequate protein density. Conclusions: Overall, most children consumed protein amounts greater than requirements, except for the younger breastfeeding children, who were consuming low amounts of complementary foods. These findings reinforce previous evidence that dietary protein is not generally limiting for children in LICs compared with estimated requirements for healthy children, even after accounting for protein quality. However, unmeasured effects of infection and intestinal dysfunction on the children's protein requirements could modify this conclusion.

  20. Complementary and alternative medicine in pregnancy: a survey of North Carolina certified nurse-midwives.

    PubMed

    Allaire, A D; Moos, M K; Wells, S R

    2000-01-01

    To determine the prevalence and types of complementary and alternative medicine therapies used by certified nurse-midwives in North Carolina. Surveys were sent to all 120 licensed certified nurse-midwives in North Carolina requesting information concerning their recommendations for use of complementary and alternative medicine for their pregnant or postpartum patients. Eighty-two responses were received (68.3%). Seventy-seven (93.9%) reported recommending complementary and alternative medicine to their pregnant patients in the past year. Forty-seven (57.3%) reported recommending complementary and alternative medicine to more than 10% of patients. The percentage of nurse-midwives who recommended each type of complementary and alternative medicine was as follows: herbal therapy (73.2%), massage therapy (67.1%), chiropractic (57.3%), acupressure (52.4%), mind-body interventions (48.8%), aromatherapy (32.9%), homeopathy (30.5%), spiritual healing (23.2%), acupuncture (19.5%), and bioelectric or magnetic applications (14.6%). The 60 respondents who reported prescribing herbal therapies gave them for the following indications: nausea and vomiting, labor stimulation, perineal discomfort, lactation disorders, postpartum depression, preterm labor, postpartum hemorrhage, labor analgesia, and malpresentation. Complementary and alternative medicine, especially herbal therapy, is commonly prescribed to pregnant women by nurse-midwives in North Carolina.

  1. Application of infrared spectroscopy and pyrolysis gas chromatography for characterisation of adhesive tapes

    NASA Astrophysics Data System (ADS)

    Zięba-Palus, Janina; Nowińska, Sabina; Kowalski, Rafał

    2016-12-01

    Infrared spectroscopy and pyrolysis GC/MS were applied in the comparative analysis of adhesive tapes. By providing information about the polymer composition, it was possible to classify both backings and adhesives of tapes into defined chemical classes. It was found that samples of the same type (of backings and adhesives) and similar infrared spectra can in most cases be effectively differentiated using Py-GC/MS, sometimes based only on the presence of peaks of very low intensity originating from minor components. The results obtained enabled us to draw the conclusion that Py-GC/MS appears to be a valuable analytical technique for examining tapes, which is complementary to infrared spectroscopy. Identification of pyrolysis products enables discrimination of samples. Both methods also provide crucial information that is useful for identification of adhesive tapes found at the crime scene.

  2. Characterization of perovskite film prepared by pulsed laser deposition on ferritic stainless steel using microscopic and optical methods

    NASA Astrophysics Data System (ADS)

    Durda, E.; Jaglarz, J.; Kąc, S.; Przybylski, K.; El Kouari, Y.

    2016-06-01

    The perovskite La0.6Sr0.4Co0.2Fe0.8O3-δ (LSCF48) film was deposited on Crofer 22 APU ferritic stainless steel by pulsed laser deposition (PLD). Morphological studies of the sample were performed using scanning electron microscopy (SEM) and atomic force microscopy (AFM). Information about film thickness and surface topography of the film and the steel substrate were obtained using following optical methods: spectroscopic ellipsometry (SE), bidirectional reflection distribution function (BRDF) and total integrated reflectometry (TIS). In particular, the BRDF study, being complementary to atomic force microscopy, yielded information about surface topography. Using the previously mentioned methods, the following statistic surface parameters were determined: root-mean square (rms) roughness and autocorrelation length by determining the power spectral density (PSD) function of surface irregularities.

  3. An approach for representing sensor data to validate alerts in Ambient Assisted Living.

    PubMed

    Muñoz, Andrés; Serrano, Emilio; Villa, Ana; Valdés, Mercedes; Botía, Juan A

    2012-01-01

    The mainstream of research in Ambient Assisted Living (AAL) is devoted to developing intelligent systems for processing the data collected through artificial sensing. Besides, there are other elements that must be considered to foster the adoption of AAL solutions in real environments. In this paper we focus on the problem of designing interfaces among caregivers and AAL systems. We present an alert management tool that supports carers in their task of validating alarms raised by the system. It generates text-based explanations--obtained through an argumentation process--of the causes leading to alarm activation along with graphical sensor information and 3D models, thus offering complementary types of information. Moreover, a guideline to use the tool when validating alerts is also provided. Finally, the functionality of the proposed tool is demonstrated through two real cases of alert.

  4. Explicit Filtering Based Low-Dose Differential Phase Reconstruction Algorithm with the Grating Interferometry.

    PubMed

    Jiang, Xiaolei; Zhang, Li; Zhang, Ran; Yin, Hongxia; Wang, Zhenchang

    2015-01-01

    X-ray grating interferometry offers a novel framework for the study of weakly absorbing samples. Three kinds of information, that is, the attenuation, differential phase contrast (DPC), and dark-field images, can be obtained after a single scanning, providing additional and complementary information to the conventional attenuation image. Phase shifts of X-rays are measured by the DPC method; hence, DPC-CT reconstructs refraction indexes rather than attenuation coefficients. In this work, we propose an explicit filtering based low-dose differential phase reconstruction algorithm, which enables reconstruction from reduced scanning without artifacts. The algorithm adopts a differential algebraic reconstruction technique (DART) with the explicit filtering based sparse regularization rather than the commonly used total variation (TV) method. Both the numerical simulation and the biological sample experiment demonstrate the feasibility of the proposed algorithm.

  5. Explicit Filtering Based Low-Dose Differential Phase Reconstruction Algorithm with the Grating Interferometry

    PubMed Central

    Zhang, Li; Zhang, Ran; Yin, Hongxia; Wang, Zhenchang

    2015-01-01

    X-ray grating interferometry offers a novel framework for the study of weakly absorbing samples. Three kinds of information, that is, the attenuation, differential phase contrast (DPC), and dark-field images, can be obtained after a single scanning, providing additional and complementary information to the conventional attenuation image. Phase shifts of X-rays are measured by the DPC method; hence, DPC-CT reconstructs refraction indexes rather than attenuation coefficients. In this work, we propose an explicit filtering based low-dose differential phase reconstruction algorithm, which enables reconstruction from reduced scanning without artifacts. The algorithm adopts a differential algebraic reconstruction technique (DART) with the explicit filtering based sparse regularization rather than the commonly used total variation (TV) method. Both the numerical simulation and the biological sample experiment demonstrate the feasibility of the proposed algorithm. PMID:26089971

  6. Experiences in extraction of contact parameters from process-evaluation test-structures

    NASA Technical Reports Server (NTRS)

    Lieneweg, Udo

    1988-01-01

    Six-terminal-contact test structures are introduced for characterizing ohmic contacts between a metal and a heavily doped semiconductor layer. Specifically, the six-terminal test structure supplies the additional information needed in order to calculate the transmission length and eventual corrections to the characteristic resistance per unit width due to finite contact length. The essential feature of this test structure is a square contact with four taps in the lower (semiconductor) layer. Every other one of these taps is used for current injection ('front'). From the voltage drop at the opposite tap and the side taps, the 'end' resistance and the 'side' resistances are calculated. The test structures are shown to give valuable information complementary to the common front resistance measurements. The interfacial resistivity is obtained directly after proper correction for flange effects.

  7. Comparison of pharmaceutical, illicit drug, alcohol, nicotine and caffeine levels in wastewater with sale, seizure and consumption data for 8 European cities.

    PubMed

    Baz-Lomba, Jose Antonio; Salvatore, Stefania; Gracia-Lor, Emma; Bade, Richard; Castiglioni, Sara; Castrignanò, Erika; Causanilles, Ana; Hernandez, Felix; Kasprzyk-Hordern, Barbara; Kinyua, Juliet; McCall, Ann-Kathrin; van Nuijs, Alexander; Ort, Christoph; Plósz, Benedek G; Ramin, Pedram; Reid, Malcolm; Rousis, Nikolaos I; Ryu, Yeonsuk; de Voogt, Pim; Bramness, Jorgen; Thomas, Kevin

    2016-10-01

    Monitoring the scale of pharmaceuticals, illicit and licit drugs consumption is important to assess the needs of law enforcement and public health, and provides more information about the different trends within different countries. Community drug use patterns are usually described by national surveys, sales and seizure data. Wastewater-based epidemiology (WBE) has been shown to be a reliable approach complementing such surveys. This study aims to compare and correlate the consumption estimates of pharmaceuticals, illicit drugs, alcohol, nicotine and caffeine from wastewater analysis and other sources of information. Wastewater samples were collected in 2015 from 8 different European cities over a one week period, representing a population of approximately 5 million people. Published pharmaceutical sale, illicit drug seizure and alcohol, tobacco and caffeine use data were used for the comparison. High agreement was found between wastewater and other data sources for pharmaceuticals and cocaine, whereas amphetamines, alcohol and caffeine showed a moderate correlation. methamphetamine and 3,4-methylenedioxymethamphetamine (MDMA) and nicotine did not correlate with other sources of data. Most of the poor correlations were explained as part of the uncertainties related with the use estimates and were improved with other complementary sources of data. This work confirms the promising future of WBE as a complementary approach to obtain a more accurate picture of substance use situation within different communities. Our findings suggest further improvements to reduce the uncertainties associated with both sources of information in order to make the data more comparable.

  8. A multimodal approach to estimating vigilance using EEG and forehead EOG.

    PubMed

    Zheng, Wei-Long; Lu, Bao-Liang

    2017-04-01

    Covert aspects of ongoing user mental states provide key context information for user-aware human computer interactions. In this paper, we focus on the problem of estimating the vigilance of users using EEG and EOG signals. The PERCLOS index as vigilance annotation is obtained from eye tracking glasses. To improve the feasibility and wearability of vigilance estimation devices for real-world applications, we adopt a novel electrode placement for forehead EOG and extract various eye movement features, which contain the principal information of traditional EOG. We explore the effects of EEG from different brain areas and combine EEG and forehead EOG to leverage their complementary characteristics for vigilance estimation. Considering that the vigilance of users is a dynamic changing process because the intrinsic mental states of users involve temporal evolution, we introduce continuous conditional neural field and continuous conditional random field models to capture dynamic temporal dependency. We propose a multimodal approach to estimating vigilance by combining EEG and forehead EOG and incorporating the temporal dependency of vigilance into model training. The experimental results demonstrate that modality fusion can improve the performance compared with a single modality, EOG and EEG contain complementary information for vigilance estimation, and the temporal dependency-based models can enhance the performance of vigilance estimation. From the experimental results, we observe that theta and alpha frequency activities are increased, while gamma frequency activities are decreased in drowsy states in contrast to awake states. The forehead setup allows for the simultaneous collection of EEG and EOG and achieves comparative performance using only four shared electrodes in comparison with the temporal and posterior sites.

  9. A study on mastectomy samples to evaluate breast imaging quality and potential clinical relevance of differential phase contrast mammography.

    PubMed

    Hauser, Nik; Wang, Zhentian; Kubik-Huch, Rahel A; Trippel, Mafalda; Singer, Gad; Hohl, Michael K; Roessl, Ewald; Köhler, Thomas; van Stevendaal, Udo; Wieberneit, Nataly; Stampanoni, Marco

    2014-03-01

    Differential phase contrast and scattering-based x-ray mammography has the potential to provide additional and complementary clinically relevant information compared with absorption-based mammography. The purpose of our study was to provide a first statistical evaluation of the imaging capabilities of the new technique compared with digital absorption mammography. We investigated non-fixed mastectomy samples of 33 patients with invasive breast cancer, using grating-based differential phase contrast mammography (mammoDPC) with a conventional, low-brilliance x-ray tube. We simultaneously recorded absorption, differential phase contrast, and small-angle scattering signals that were combined into novel high-frequency-enhanced images with a dedicated image fusion algorithm. Six international, expert breast radiologists evaluated clinical digital and experimental mammograms in a 2-part blinded, prospective independent reader study. The results were statistically analyzed in terms of image quality and clinical relevance. The results of the comparison of mammoDPC with clinical digital mammography revealed the general quality of the images to be significantly superior (P < 0.001); sharpness, lesion delineation, as well as the general visibility of calcifications to be significantly more assessable (P < 0.001); and delineation of anatomic components of the specimens (surface structures) to be significantly sharper (P < 0.001). Spiculations were significantly better identified, and the overall clinically relevant information provided by mammoDPC was judged to be superior (P < 0.001). Our results demonstrate that complementary information provided by phase and scattering enhanced mammograms obtained with the mammoDPC approach deliver images of generally superior quality. This technique has the potential to improve radiological breast diagnostics.

  10. Adaptive multi-view clustering based on nonnegative matrix factorization and pairwise co-regularization

    NASA Astrophysics Data System (ADS)

    Zhang, Tianzhen; Wang, Xiumei; Gao, Xinbo

    2018-04-01

    Nowadays, several datasets are demonstrated by multi-view, which usually include shared and complementary information. Multi-view clustering methods integrate the information of multi-view to obtain better clustering results. Nonnegative matrix factorization has become an essential and popular tool in clustering methods because of its interpretation. However, existing nonnegative matrix factorization based multi-view clustering algorithms do not consider the disagreement between views and neglects the fact that different views will have different contributions to the data distribution. In this paper, we propose a new multi-view clustering method, named adaptive multi-view clustering based on nonnegative matrix factorization and pairwise co-regularization. The proposed algorithm can obtain the parts-based representation of multi-view data by nonnegative matrix factorization. Then, pairwise co-regularization is used to measure the disagreement between views. There is only one parameter to auto learning the weight values according to the contribution of each view to data distribution. Experimental results show that the proposed algorithm outperforms several state-of-the-arts algorithms for multi-view clustering.

  11. Assessment of corneal properties based on statistical modeling of OCT speckle

    PubMed Central

    Jesus, Danilo A.; Iskander, D. Robert

    2016-01-01

    A new approach to assess the properties of the corneal micro-structure in vivo based on the statistical modeling of speckle obtained from Optical Coherence Tomography (OCT) is presented. A number of statistical models were proposed to fit the corneal speckle data obtained from OCT raw image. Short-term changes in corneal properties were studied by inducing corneal swelling whereas age-related changes were observed analyzing data of sixty-five subjects aged between twenty-four and seventy-three years. Generalized Gamma distribution has shown to be the best model, in terms of the Akaike’s Information Criterion, to fit the OCT corneal speckle. Its parameters have shown statistically significant differences (Kruskal-Wallis, p < 0.001) for short and age-related corneal changes. In addition, it was observed that age-related changes influence the corneal biomechanical behaviour when corneal swelling is induced. This study shows that Generalized Gamma distribution can be utilized to modeling corneal speckle in OCT in vivo providing complementary quantified information where micro-structure of corneal tissue is of essence. PMID:28101409

  12. Photochemical Degradation of the Anticancer Drug Bortezomib by V-UV/UV (185/254 nm) Investigated by (1)H NMR Fingerprinting: A Way to Follow Aromaticity Evolution.

    PubMed

    Martignac, Marion; Balayssac, Stéphane; Gilard, Véronique; Benoit-Marquié, Florence

    2015-06-18

    We have investigated the removal of bortezomib, an anticancer drug prescribed in multiple myeloma, using the photochemical advanced oxidation process of V-UV/UV (185/254 nm). We used two complementary analytical techniques to follow the removal rate of bortezomib. Nuclear magnetic resonance (NMR) is a nonselective method requiring no prior knowledge of the structures of the byproducts and permits us to provide a spectral signature (fingerprinting approach). This untargeted method provides clues to the molecular structure changes and information on the degradation of the parent drug during the irradiation process. This holistic NMR approach could provide information for monitoring aromaticity evolution. We use liquid chromatography, coupled with high-resolution mass spectrometry (LC-MS), to correlate results obtained by (1)H NMR and for accurate identification of the byproducts, in order to understand the mechanistic degradation pathways of bortezomib. The results show that primary byproducts come from photoassisted deboronation of bortezomib at 254 nm. A secondary byproduct of pyrazinecarboxamide was also identified. We obtained a reliable correlation between these two analytical techniques.

  13. Women's Health and Complementary Approaches

    MedlinePlus

    ... Information Center Ongoing Medical Studies Find Active Medical Research Studies on Cranberry (ClinicalTrials.gov) Find Active Medical Research Studies on Menopause (ClinicalTrials.gov) Safety Information Dream Body ...

  14. A New Method for Obtaining Russell-Saunders Terms

    ERIC Educational Resources Information Center

    Liu, Ying; Liu, Yue; Liu, Bihui

    2011-01-01

    A new method for obtaining Russell-Saunders terms of atomic configurations is reported. This new method is significantly different from, while at the same time complementary to, previously published methods for obtaining atomic terms. This novel procedure is elicited by the method used to determine the splitting of S, P, D terms in weak ligand…

  15. Optimal joint measurements of complementary observables by a single trapped ion

    NASA Astrophysics Data System (ADS)

    Xiong, T. P.; Yan, L. L.; Ma, Z. H.; Zhou, F.; Chen, L.; Yang, W. L.; Feng, M.; Busch, P.

    2017-06-01

    The uncertainty relations, pioneered by Werner Heisenberg nearly 90 years ago, set a fundamental limitation on the joint measurability of complementary observables. This limitation has long been a subject of debate, which has been reignited recently due to new proposed forms of measurement uncertainty relations. The present work is associated with a new error trade-off relation for compatible observables approximating two incompatible observables, in keeping with the spirit of Heisenberg’s original ideas of 1927. We report the first direct test and confirmation of the tight bounds prescribed by such an error trade-off relation, based on an experimental realisation of optimal joint measurements of complementary observables using a single ultracold {}40{{{Ca}}}+ ion trapped in a harmonic potential. Our work provides a prototypical determination of ultimate joint measurement error bounds with potential applications in quantum information science for high-precision measurement and information security.

  16. Complementary studies of lipid membrane dynamics using iSCAT and super-resolved fluorescence correlation spectroscopy

    NASA Astrophysics Data System (ADS)

    Reina, Francesco; Galiani, Silvia; Shrestha, Dilip; Sezgin, Erdinc; de Wit, Gabrielle; Cole, Daniel; Lagerholm, B. Christoffer; Kukura, Philipp; Eggeling, Christian

    2018-06-01

    Observation techniques with high spatial and temporal resolution, such as single-particle tracking based on interferometric scattering (iSCAT) microscopy, and fluorescence correlation spectroscopy applied on a super-resolution STED microscope (STED-FCS), have revealed new insights of the molecular organization of membranes. While delivering complementary information, there are still distinct differences between these techniques, most prominently the use of fluorescent dye tagged probes for STED-FCS and a need for larger scattering gold nanoparticle tags for iSCAT. In this work, we have used lipid analogues tagged with a hybrid fluorescent tag–gold nanoparticle construct, to directly compare the results from STED-FCS and iSCAT measurements of phospholipid diffusion on a homogeneous supported lipid bilayer (SLB). These comparative measurements showed that while the mode of diffusion remained free, at least at the spatial (>40 nm) and temporal (50  ⩽  t  ⩽  100 ms) scales probed, the diffussion coefficient was reduced by 20- to 60-fold when tagging with 20 and 40 nm large gold particles as compared to when using dye tagged lipid analogues. These FCS measurements of hybrid fluorescent tag–gold nanoparticle labeled lipids also revealed that commercially supplied streptavidin-coated gold nanoparticles contain large quantities of free streptavidin. Finally, the values of apparent diffusion coefficients obtained by STED-FCS and iSCAT differed by a factor of 2–3 across the techniques, while relative differences in mobility between different species of lipid analogues considered were identical in both approaches. In conclusion, our experiments reveal that large and potentially cross-linking scattering tags introduce a significant slow-down in diffusion on SLBs but no additional bias, and our labeling approach creates a new way of exploiting complementary information from STED-FCS and iSCAT measurements.

  17. Balancing Hole and Electron Conduction in Ambipolar Split-Gate Thin-Film Transistors.

    PubMed

    Yoo, Hocheon; Ghittorelli, Matteo; Lee, Dong-Kyu; Smits, Edsger C P; Gelinck, Gerwin H; Ahn, Hyungju; Lee, Han-Koo; Torricelli, Fabrizio; Kim, Jae-Joon

    2017-07-10

    Complementary organic electronics is a key enabling technology for the development of new applications including smart ubiquitous sensors, wearable electronics, and healthcare devices. High-performance, high-functionality and reliable complementary circuits require n- and p-type thin-film transistors with balanced characteristics. Recent advancements in ambipolar organic transistors in terms of semiconductor and device engineering demonstrate the great potential of this route but, unfortunately, the actual development of ambipolar organic complementary electronics is currently hampered by the uneven electron (n-type) and hole (p-type) conduction in ambipolar organic transistors. Here we show ambipolar organic thin-film transistors with balanced n-type and p-type operation. By manipulating air exposure and vacuum annealing conditions, we show that well-balanced electron and hole transport properties can be easily obtained. The method is used to control hole and electron conductions in split-gate transistors based on a solution-processed donor-acceptor semiconducting polymer. Complementary logic inverters with balanced charging and discharging characteristics are demonstrated. These findings may open up new opportunities for the rational design of complementary electronics based on ambipolar organic transistors.

  18. Proposal of indicators to evaluate complementary feeding based on World Health Organization indicators.

    PubMed

    Saldan, Paula Chuproski; Venancio, Sonia Isoyama; Saldiva, Silvia Regina Dias Medici; de Mello, Débora Falleiros

    2016-09-01

    This study compares complementary feeding World Health Organization (WHO) indicators with those built in accordance with Brazilian recommendations (Ten Steps to Healthy Feeding). A cross-sectional study was carried out during the National Immunization Campaign against Poliomyelitis in Guarapuava-Paraná, Brazil, in 2012. Feeding data from 1,355 children aged 6-23 months were obtained through the 24 h diet recall. Based on five indicators, the proportion of adequacy was evaluated: introduction of solid, semi-solid, or soft foods; minimum dietary diversity; meal frequency; acceptable diet; and consumption of iron-rich foods. Complementary feeding showed adequacy higher than 85% in most WHO indicators, while review by the Ten Steps assessment method showed a less favorable circumstance and a high intake of unhealthy foods. WHO indicators may not reflect the complementary feeding conditions of children in countries with low malnutrition rates and an increased prevalence of overweight/obesity. The use of indicators according to the Ten Steps can be useful to identify problems and redirect actions aimed at promoting complementary feeding. © 2016 John Wiley & Sons Australia, Ltd.

  19. Experiment/Analytical Characterization of the RBCC Rocket-Ejector Mode

    NASA Technical Reports Server (NTRS)

    Ruf, J. H.; Lehman, M.; Pal, S.; Santoro, R. J.; West, J.; Turner, James E. (Technical Monitor)

    2000-01-01

    Experimental and complementary CFD results from the study of the rocket-ejector mode of a Rocket Based Combined Cycle (RBCC) engine are presented and discussed. The experiments involved systematic flowfield measurements in a two-dimensional, variable geometry rocket-ejector system. The rocket-ejector system utilizes a single two-dimensional, gaseous oxygen/gaseous hydrogen rocket as the ejector. To gain a thorough understanding of the rocket-ejector's internal fluid mechanic/combustion phenomena, experiments were conducted with both direct-connect and sea-level static configurations for a range of rocket operating conditions. Overall system performance was obtained through global measurements of wall static pressure profiles, heat flux profiles and engine thrust, whereas detailed mixing and combustion information was obtained through Raman spectroscopy measurements of major species (oxygen, hydrogen, nitrogen and water vapor). The experimental results for both the direct-connect and sea-level static configurations are compared with CFD predictions of the flowfield.

  20. Direct chemical profiling of olive (Olea europaea) fruit epicuticular waxes by direct electrospray-ultrahigh resolution mass spectrometry.

    PubMed

    Vichi, Stefania; Cortés-Francisco, Nuria; Romero, Agustí; Caixach, Josep

    2015-03-01

    In the present paper, an electrospray ionization (ESI)-Orbitrap method is proposed for the direct chemical profiling of epicuticular wax (EW) from Olea europaea fruit. It constitutes a rapid and efficient tool suitable for a wide-ranging screening of a large number of samples. In a few minutes, the method provides a comprehensive characterization of total EW extracts, based on the molecular formula of their components. Accurate mass measurements are obtained by ultrahigh resolution mass spectrometry, and compositional restrictions are set on the basis of the information available from previous studies of olive EW. By alternating positive and negative ESI modes within the same analysis, complementary results are obtained and a wide range of chemical species is covered. This provides a detailed compositional overview that otherwise would only be available by applying multiple analytical techniques. Copyright © 2015 John Wiley & Sons, Ltd.

  1. Quantitative evaluation of protein conformation in pharmaceuticals using cross-linking reactions coupled with LC-MS/MS analysis.

    PubMed

    Yamaguchi, Hideto; Hirakura, Yutaka; Shirai, Hiroki; Mimura, Hisashi; Toyo'oka, Toshimasa

    2011-06-01

    The need for a simple and high-throughput method for identifying the tertiary structure of protein pharmaceuticals has increased. In this study, a simple method for mapping the protein fold is proposed for use as a complementary quality test. This method is based on cross-linking a protein using a [bis(sulfosuccinimidyl)suberate (BS(3))], followed by peptide mapping by LC-MS. Consensus interferon (CIFN) was used as the model protein. The tryptic map obtained via liquid chromatography tandem mass spectroscopy (LC-MS/MS) and the mass mapping obtained via matrix-assisted laser desorption/ionization time-of-flight mass spectroscopy were used to identify cross-linked peptides. While LC-MS/MS analyses found that BS(3) formed cross-links in the loop region of the protein, which was regarded as the biologically active site, sodium dodecyl-sulfate polyacrylamide gel electrophoresis demonstrated that cross-linking occurred within a protein molecule, but not between protein molecules. The occurrence of cross-links at the active site depends greatly on the conformation of the protein, which is determined by the denaturing conditions. Quantitative evaluation of the tertiary structure of CIFN was thus possible by monitoring the amounts of cross-linked peptides generated. Assuming that background information is available at the development stage, this method may be applicable to process development as a complementary test for quality control. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Application of LANDSAT data to delimitation of avalanche hazards in Montane, Colorado

    NASA Technical Reports Server (NTRS)

    Knepper, D. H. (Principal Investigator); Summer, R.

    1976-01-01

    The author has identified the following significant results. With rare exceptions, avalanche areas cannot be identified on LANDSAT imagery. Avalanche hazard mapping on a regional scale is best conducted using LANDSAT imagery in conjunction with complementary data sources. Level of detail of such maps will be limited by the amount and completeness of the complementary information used.

  3. X-ray micro-CT and neutron CT as complementary imaging tools for non-destructive 3D imaging of rare silicified fossil plants

    NASA Astrophysics Data System (ADS)

    Karch, J.; Dudák, J.; Žemlička, J.; Vavřík, D.; Kumpová, I.; Kvaček, J.; Heřmanová, Z.; Šoltés, J.; Viererbl, L.; Morgano, M.; Kaestner, A.; Trtík, P.

    2017-12-01

    Computed tomography provides 3D information of inner structures of investigated objects. The obtained information is, however, strongly dependent on the used radiation type. It is known that as X-rays interact with electron cloud and neutrons with atomic nucleus, the obtained data often provide different contrast of sample structures. In this work we present a set of comparative radiographic and CT measurements of rare fossil plant samples using X-rays and thermal neutrons. The X-ray measurements were performed using large area photon counting detectors Timepix at IEAP CTU in Prague and Perkin Elmer flat-panel detector at Center of Excellence Telč. The neutron CT measurement was carried out at Paul Scherrer Institute using BOA beam-line. Furthermore, neutron radiography of fossil samples, provided by National Museum, were performed using a large-area Timepix detector with a neutron-sensitive converting 6LiF layer at Research Centre Rez, Czech Republic. The obtained results show different capabilities of both imaging approaches. While X-ray micro-CT provides very high resolution and enables visualization of fine cracks or small cavities in the samples neutron imaging provides high contrast of morphological structures of fossil plant samples, where X-ray imaging provides insufficient contrast.

  4. Miami University Information Manual.

    ERIC Educational Resources Information Center

    Miami Univ., Oxford, OH.

    The 1975 information manual is designed to provide current data on policies, procedures, services, facilities, organization and governance of Miami University and, through the extensive index, quick access to this information. The manual is complementary to the university catalog and directory. Information relating to students is in the Student…

  5. Resolving the morphology of niobium carbonitride nano-precipitates in steel using atom probe tomography.

    PubMed

    Breen, Andrew J; Xie, Kelvin Y; Moody, Michael P; Gault, Baptiste; Yen, Hung-Wei; Wong, Christopher C; Cairney, Julie M; Ringer, Simon P

    2014-08-01

    Atom probe is a powerful technique for studying the composition of nano-precipitates, but their morphology within the reconstructed data is distorted due to the so-called local magnification effect. A new technique has been developed to mitigate this limitation by characterizing the distribution of the surrounding matrix atoms, rather than those contained within the nano-precipitates themselves. A comprehensive chemical analysis enables further information on size and chemistry to be obtained. The method enables new insight into the morphology and chemistry of niobium carbonitride nano-precipitates within ferrite for a series of Nb-microalloyed ultra-thin cast strip steels. The results are supported by complementary high-resolution transmission electron microscopy.

  6. Characterisation of cytoplasmic DNA complementary to non-retroviral RNA viruses in human cells

    PubMed Central

    Shimizu, Akira; Nakatani, Yoko; Nakamura, Takako; Jinno-Oue, Atsushi; Ishikawa, Osamu; Boeke, Jef D.; Takeuchi, Yasuhiro; Hoshino, Hiroo

    2014-01-01

    The synthesis and subsequent genomic integration of DNA that is complementary to the genomes of non-retroviral RNA viruses are rarely observed. However, upon infection of various human cell lines and primary fibroblasts with the vesicular stomatitis virus (VSV), we detected DNA complementary to the VSV RNA. The VSV DNA was detected in the cytoplasm as single-stranded DNA fully complementary to the viral mRNA from the poly(A) region to the 7-methyl guanosine cap. The formation of this DNA was cell-dependent. Experimentally, we found that the transduction of cells that do not produce VSV DNA with the long interspersed nuclear element 1 and their infection with VSV could lead to the formation of VSV DNA. Viral DNA complementary to other RNA viruses was also detected in the respective infected human cells. Thus, the genetic information of the non-retroviral RNA virus genome can flow into the DNA of mammalian cells expressing LINE-1-like elements. PMID:24875540

  7. Use of complementary and alternative medicine in children with autism and other developmental disabilities: associations with ethnicity, child comorbid symptoms, and parental stress.

    PubMed

    Valicenti-McDermott, Maria; Burrows, Bethany; Bernstein, Leora; Hottinger, Kathryn; Lawson, Katharine; Seijo, Rosa; Schechtman, Merryl; Shulman, Lisa; Shinnar, Shlomo

    2014-03-01

    The use of complementary and alternative medicine by children with autism and the association of its use with child comorbid symptoms and parental stress was studied in an ethnically diverse population, in a cross-sectional study with structured interviews. The sample included 50 families of children with autism and 50 families of children with other developmental disabilities, matched by age/gender. Interview included the Complementary and Alternative Medicine Questionnaire, Gastrointestinal Questionnaire, Children's Sleep Habits Questionnaire, Aberrant Behavior Checklist, and Parenting Stress Index. In this ethnically diverse sample, the use of complementary and alternative medicine was significantly higher for the autism group. In the autism group, use was significantly related to child's irritability, hyperactivity, food allergies, and parental stress; in the developmental disabilities group, there was no association with child comorbid symptoms or parental stress. The results contribute information to health care providers about families of children with autism who are more likely to use complementary and alternative medicine.

  8. Optical Ptychographic Microscope for Quantitative Bio-Mechanical Imaging

    NASA Astrophysics Data System (ADS)

    Anthony, Nicholas; Cadenazzi, Guido; Nugent, Keith; Abbey, Brian

    The role that mechanical forces play in biological processes such as cell movement and death is becoming of significant interest to further develop our understanding of the inner workings of cells. The most common method used to obtain stress information is photoelasticity which maps a samples birefringence, or its direction dependent refractive indices, using polarized light. However this method only provides qualitative data and for stress information to be useful quantitative data is required. Ptychography is a method for quantitatively determining the phase of a samples complex transmission function. The technique relies upon the collection of multiple overlapping coherent diffraction patterns from laterally displaced points on the sample. The overlap of measurement points provides complementary information that significantly aids in the reconstruction of the complex wavefield exiting the sample and allows for quantitative imaging of weakly interacting specimens. Here we describe recent advances at La Trobe University Melbourne on achieving quantitative birefringence mapping using polarized light ptychography with applications in cell mechanics. Australian Synchrotron, ARC Centre of Excellence for Advanced Molecular Imaging.

  9. Perception of risk and communication among conventional and complementary health care providers involving cancer patients' use of complementary therapies: a literature review.

    PubMed

    Stub, Trine; Quandt, Sara A; Arcury, Thomas A; Sandberg, Joanne C; Kristoffersen, Agnete E; Musial, Frauke; Salamonsen, Anita

    2016-09-08

    Communication between different health care providers (conventional and complementary) and cancer patients about their use of complementary therapies affects the health and safety of the patients. The aim of this study was to examine the qualitative research literature on the perception of and communication about the risk of complementary therapies between different health care providers and cancer patients. Systematic searches in six medical databases covering literature from 2000 to 2015 were performed. The studies were accessed according to the level of evidence and summarized into different risk situations. Qualitative content analysis was used to analyze the text data, and the codes were defined before and during the data analysis. Twenty-nine papers were included in the primary analysis and five main themes were identified and discussed. The main risk situations identified were 1. Differences in treatment concepts and philosophical values among complementary and conventional health care providers. 2. Adverse effects from complementary products and herbs due to their contamination/toxicity and interactions with conventional cancer treatment. 3. Health care physicians and oncologists find it difficult to recommend many complementary modalities due to the lack of scientific evidence for their effect. 4. Lack of knowledge and information about complementary and conventional cancer treatments among different health care providers. The risk of consuming herbs and products containing high level of toxins is a considerable threat to patient safety (direct risk). At the same time, the lack of scientific evidence of effect for many complementary therapies and differences in treatment philosophy among complementary and conventional health care providers potentially hinder effective communication about these threats with mutual patients (indirect risk). As such, indirect risk may pose an additional risk to patients who want to combine complementary therapies with conventional treatment in cancer care. Health care providers who care for cancer patients should be aware of these risks.

  10. Integrating a DNA barcoding project with an ecological survey: a case study on temperate intertidal polychaete communities in Qingdao, China

    NASA Astrophysics Data System (ADS)

    Zhou, Hong; Zhang, Zhinan; Chen, Haiyan; Sun, Renhua; Wang, Hui; Guo, Lei; Pan, Haijian

    2010-07-01

    In this study, we integrated a DNA barcoding project with an ecological survey on intertidal polychaete communities and investigated the utility of CO1 gene sequence as a DNA barcode for the classification of the intertidal polychaetes. Using 16S rDNA as a complementary marker and combining morphological and ecological characterization, some of dominant and common polychaete species from Chinese coasts were assessed for their taxonomic status. We obtained 22 haplotype gene sequences of 13 taxa, including 10 CO1 sequences and 12 16S rDNA sequences. Based on intra- and inter-specific distances, we built phylogenetic trees using the neighbor-joining method. Our study suggested that the mitochondrial CO1 gene was a valid DNA barcoding marker for species identification in polychaetes, but other genes, such as 16S rDNA, could be used as a complementary genetic marker. For more accurate species identification and effective testing of species hypothesis, DNA barcoding should be incorporated with morphological, ecological, biogeographical, and phylogenetic information. The application of DNA barcoding and molecular identification in the ecological survey on the intertidal polychaete communities demonstrated the feasibility of integrating DNA taxonomy and ecology.

  11. Dual-Mode Gas Sensor Composed of a Silicon Nanoribbon Field Effect Transistor and a Bulk Acoustic Wave Resonator: A Case Study in Freons

    PubMed Central

    Chang, Ye; Hui, Zhipeng; Wang, Xiayu; Qu, Hemi; Pang, Wei

    2018-01-01

    In this paper, we develop a novel dual-mode gas sensor system which comprises a silicon nanoribbon field effect transistor (Si-NR FET) and a film bulk acoustic resonator (FBAR). We investigate their sensing characteristics using polar and nonpolar organic compounds, and demonstrate that polarity has a significant effect on the response of the Si-NR FET sensor, and only a minor effect on the FBAR sensor. In this dual-mode system, qualitative discrimination can be achieved by analyzing polarity with the Si-NR FET and quantitative concentration information can be obtained using a polymer-coated FBAR with a detection limit at the ppm level. The complementary performance of the sensing elements provides higher analytical efficiency. Additionally, a dual mixture of two types of freons (CFC-113 and HCFC-141b) is further analyzed with the dual-mode gas sensor. Owing to the small size and complementary metal-oxide semiconductor (CMOS)-compatibility of the system, the dual-mode gas sensor shows potential as a portable integrated sensing system for the analysis of gas mixtures in the future. PMID:29370109

  12. Dual-Mode Gas Sensor Composed of a Silicon Nanoribbon Field Effect Transistor and a Bulk Acoustic Wave Resonator: A Case Study in Freons.

    PubMed

    Chang, Ye; Hui, Zhipeng; Wang, Xiayu; Qu, Hemi; Pang, Wei; Duan, Xuexin

    2018-01-25

    In this paper, we develop a novel dual-mode gas sensor system which comprises a silicon nanoribbon field effect transistor (Si-NR FET) and a film bulk acoustic resonator (FBAR). We investigate their sensing characteristics using polar and nonpolar organic compounds, and demonstrate that polarity has a significant effect on the response of the Si-NR FET sensor, and only a minor effect on the FBAR sensor. In this dual-mode system, qualitative discrimination can be achieved by analyzing polarity with the Si-NR FET and quantitative concentration information can be obtained using a polymer-coated FBAR with a detection limit at the ppm level. The complementary performance of the sensing elements provides higher analytical efficiency. Additionally, a dual mixture of two types of freons (CFC-113 and HCFC-141b) is further analyzed with the dual-mode gas sensor. Owing to the small size and complementary metal-oxide semiconductor (CMOS)-compatibility of the system, the dual-mode gas sensor shows potential as a portable integrated sensing system for the analysis of gas mixtures in the future.

  13. Informed Consent (Clinical Trials)

    MedlinePlus

    ... Cancer Treatment Types of Cancer Treatment Side Effects Clinical Trials Information A to Z List of Cancer ... Staging Prognosis Treatment Types of Treatment Side Effects Clinical Trials Cancer Drugs Complementary & Alternative Medicine Coping Feelings & ...

  14. Inference of genetic diversity in popcorn S3 progenies.

    PubMed

    Pena, G F; do Amaral, A T; Ribeiro, R M; Ramos, H C C; Boechat, M S B; Santos, J S; Mafra, G S; Kamphorst, S H; de Lima, V J; Vivas, M; de Souza Filho, G A

    2016-05-09

    Molecular markers are a useful tool for identification of complementary heterotic groups in breeding programs aimed at the production of superior hybrids, particularly for crops such as popcorn in which heterotic groups are not well-defined. The objective of the present study was to analyze the genetic diversity of 47 genotypes of tropical popcorn to identify possible heterotic groups for the development of superior hybrids. Four genotypes of high genetic value were studied: hybrid IAC 125, strain P2, and varieties UENF 14 and BRS Angela. In addition, 43 endogamous S3 progenies obtained from variety UENF 14 were used. Twenty-five polymorphic SSR-EST markers were analyzed. A genetic distance matrix was obtained and the following molecular diversity parameters were estimated: number of alleles, number of effective alleles, polymorphism information content (PIC), observed and expected heterozygosities, Shannon diversity index, and coefficient of inbreeding. We found a moderate PIC and high diversity index, indicating that the studied population presents both good discriminatory ability and high informativeness for the utilized markers. The dendrogram built based on the dissimilarity matrix indicated six distinct groups. Our findings demonstrate the genetic diversity among the evaluated genotypes and provide evidence for heterotic groups in popcorn. Furthermore, the functional genetic diversity indicates that there are informative genetic markers for popcorn.

  15. Direct identification of antibiotic resistance genes on single plasmid molecules using CRISPR/Cas9 in combination with optical DNA mapping

    NASA Astrophysics Data System (ADS)

    Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik

    2016-12-01

    Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.

  16. Airborne Infrared and Visible Image Fusion Combined with Region Segmentation

    PubMed Central

    Zuo, Yujia; Liu, Jinghong; Bai, Guanbing; Wang, Xuan; Sun, Mingchao

    2017-01-01

    This paper proposes an infrared (IR) and visible image fusion method introducing region segmentation into the dual-tree complex wavelet transform (DTCWT) region. This method should effectively improve both the target indication and scene spectrum features of fusion images, and the target identification and tracking reliability of fusion system, on an airborne photoelectric platform. The method involves segmenting the region in an IR image by significance, and identifying the target region and the background region; then, fusing the low-frequency components in the DTCWT region according to the region segmentation result. For high-frequency components, the region weights need to be assigned by the information richness of region details to conduct fusion based on both weights and adaptive phases, and then introducing a shrinkage function to suppress noise; Finally, the fused low-frequency and high-frequency components are reconstructed to obtain the fusion image. The experimental results show that the proposed method can fully extract complementary information from the source images to obtain a fusion image with good target indication and rich information on scene details. They also give a fusion result superior to existing popular fusion methods, based on eithers subjective or objective evaluation. With good stability and high fusion accuracy, this method can meet the fusion requirements of IR-visible image fusion systems. PMID:28505137

  17. Airborne Infrared and Visible Image Fusion Combined with Region Segmentation.

    PubMed

    Zuo, Yujia; Liu, Jinghong; Bai, Guanbing; Wang, Xuan; Sun, Mingchao

    2017-05-15

    This paper proposes an infrared (IR) and visible image fusion method introducing region segmentation into the dual-tree complex wavelet transform (DTCWT) region. This method should effectively improve both the target indication and scene spectrum features of fusion images, and the target identification and tracking reliability of fusion system, on an airborne photoelectric platform. The method involves segmenting the region in an IR image by significance, and identifying the target region and the background region; then, fusing the low-frequency components in the DTCWT region according to the region segmentation result. For high-frequency components, the region weights need to be assigned by the information richness of region details to conduct fusion based on both weights and adaptive phases, and then introducing a shrinkage function to suppress noise; Finally, the fused low-frequency and high-frequency components are reconstructed to obtain the fusion image. The experimental results show that the proposed method can fully extract complementary information from the source images to obtain a fusion image with good target indication and rich information on scene details. They also give a fusion result superior to existing popular fusion methods, based on eithers subjective or objective evaluation. With good stability and high fusion accuracy, this method can meet the fusion requirements of IR-visible image fusion systems.

  18. Affinity-based biosensors in sport medicine and doping control analysis.

    PubMed

    Mazzei, Franco; Antiochia, Riccarda; Botrè, Francesco; Favero, Gabriele; Tortolini, Cristina

    2014-01-01

    Affinity-based biosensors (ABBs) have started to be considered in sport medicine and doping control analysis because they are cheap, easy to use and sufficiently selective analytical devices, characterized by a reversible interaction with the analyte under investigation allowing the use of the same sensor for multiple analyses. In this review we describe the main categories of substances reported in the World Anti-Doping Agency Prohibited List and how ABBs may contribute to their detection. Although several ABBs proposed in the last few years display limit of detections that are in principle matching the World Anti-Doping Agency requirements, their application in the framework of 'traditional' antidoping tests seems quite unlikely, mainly because of the still insufficient selectivity especially in the case of 'pseudo-endogenous' compounds, and on the lack of complete information regarding potential matrix effects in real samples and following their routine use. At the same time, ABBs could contribute to fill a significant information gap concerning complementary evidence that can be obtained from their use 'on the spot', as well as to preselect a risk population of individuals to be targeted for a full antidoping test; while in sport medicine they could contribute to obtaining analytical information of physiological relevance from the measurement of specific parameters or markers before, during and after physical exercise.

  19. Business News as a Source of Information Literacy in Marketing

    ERIC Educational Resources Information Center

    Fowler, Kendra; Bridges, Eileen

    2017-01-01

    Among the proficiencies that marketing students should acquire, information literacy, the ability to gather and apply pertinent information to aid in decision making, is commonly overlooked. In this article, information literacy is explored along four complementary dimensions: instrumental, conceptual, reflective, and symbolic. Furthermore, the…

  20. Tracking of Short Distance Transport Pathways in Biological Tissues by Ultra-Small Nanoparticles

    NASA Astrophysics Data System (ADS)

    Segmehl, Jana S.; Lauria, Alessandro; Keplinger, Tobias; Berg, John K.; Burgert, Ingo

    2018-03-01

    In this work, ultra-small europium-doped HfO2 nanoparticles were infiltrated into native wood and used as trackers for studying penetrability and diffusion pathways in the hierarchical wood structure. The high electron density, laser induced luminescence, and crystallinity of these particles allowed for a complementary detection of the particles in the cellular tissue. Confocal Raman microscopy and high-resolution synchrotron scanning wide-angle X-ray scattering (WAXS) measurements were used to detect the infiltrated particles in the native wood cell walls. This approach allows for simultaneously obtaining chemical information of the probed biological tissue and the spatial distribution of the integrated particles. The in-depth information about particle distribution in the complex wood structure can be used for revealing transport pathways in plant tissues, but also for gaining better understanding of modification treatments of plant scaffolds aiming at novel functionalized materials.

  1. Clinical feasibility study of combined opto-acoustic and ultrasonic imaging modality providing coregistered functional and anatomical maps of breast tumors

    NASA Astrophysics Data System (ADS)

    Zalev, Jason; Clingman, Bryan; Smith, Remie J.; Herzog, Don; Miller, Tom; Stavros, A. Thomas; Ermilov, Sergey; Conjusteau, André; Tsyboulski, Dmitri; Oraevsky, Alexander A.; Kist, Kenneth; Dornbluth, N. C.; Otto, Pamela

    2013-03-01

    We report on findings from the clinical feasibility study of the ImagioTM. Breast Imaging System, which acquires two-dimensional opto-acoustic (OA) images co-registered with conventional ultrasound using a specialized duplex hand-held probe. Dual-wavelength opto-acoustic technology is used to generate parametric maps based upon total hemoglobin and its oxygen saturation in breast tissues. This may provide functional diagnostic information pertaining to tumor metabolism and microvasculature, which is complementary to morphological information obtained with conventional gray-scale ultrasound. We present co-registered opto-acoustic and ultrasonic images of malignant and benign tumors from a recent clinical feasibility study. The clinical results illustrate that the technology may have the capability to improve the efficacy of breast tumor diagnosis. In doing so, it may have the potential to reduce biopsies and to characterize cancers that were not seen well with conventional gray-scale ultrasound alone.

  2. Discriminative segmentation of microscopic cellular images.

    PubMed

    Cheng, Li; Ye, Ning; Yu, Weimiao; Cheah, Andre

    2011-01-01

    Microscopic cellular images segmentation has become an important routine procedure in modern biological research, due to the rapid advancement of fluorescence probes and robotic microscopes in recent years. In this paper we advocate a discriminative learning approach for cellular image segmentation. In particular, three new features are proposed to capture the appearance, shape and context information, respectively. Experiments are conducted on three different cellular image datasets. Despite the significant disparity among these datasets, the proposed approach is demonstrated to perform reasonably well. As expected, for a particular dataset, some features turn out to be more suitable than others. Interestingly, we observe that a further gain can often be obtained on top of using the "good" features, by also retaining those features that perform poorly. This might be due to the complementary nature of these features, as well as the capacity of our approach to better integrate and exploit different sources of information.

  3. An Approach for Representing Sensor Data to Validate Alerts in Ambient Assisted Living

    PubMed Central

    Muñoz, Andrés; Serrano, Emilio; Villa, Ana; Valdés, Mercedes; Botía, Juan A.

    2012-01-01

    The mainstream of research in Ambient Assisted Living (AAL) is devoted to developing intelligent systems for processing the data collected through artificial sensing. Besides, there are other elements that must be considered to foster the adoption of AAL solutions in real environments. In this paper we focus on the problem of designing interfaces among caregivers and AAL systems. We present an alert management tool that supports carers in their task of validating alarms raised by the system. It generates text-based explanations—obtained through an argumentation process—of the causes leading to alarm activation along with graphical sensor information and 3D models, thus offering complementary types of information. Moreover, a guideline to use the tool when validating alerts is also provided. Finally, the functionality of the proposed tool is demonstrated through two real cases of alert. PMID:22778642

  4. Locating grey literature on communication disorders.

    PubMed

    Shpilko, Inna

    2005-01-01

    This article provides an overview of selected Web-based resources containing grey literature in the area of communication disorders. It is geared to practitioners, researchers, students, and consumers seeking reliable, freely available scientific information. Grey (or gray) literature has been defined as "that which is produced on all levels of government, academics, business, and industry in print and electronic formats, but which is not controlled by commercial publishers."1 This paper reviews various general reference sources potentially containing grey literature on communication disorders. This review includes identification of the methods specialists in this field use to obtain this valuable, yet often overlooked, literature. Access points and search tools for identifying grey literature on communication disorders are recommended. Commercial databases containing grey literature are not included. Conclusions presented in this article are considered complementary to traditionally published information resources on communication disorders, such as scholarly journals, online databases, etc.

  5. Complementary Speckle Patterns: Deterministic Interchange of Intrinsic Vortices and Maxima through Scattering Media.

    PubMed

    Gateau, Jérôme; Rigneault, Hervé; Guillon, Marc

    2017-01-27

    Intensity maxima and zeros of speckle patterns obtained behind a diffuser are experimentally interchanged by applying a spiral phase delay of charge ±1 to the impinging coherent beam. This transform arises from the expectation that tightly focused beams, which have a planar wave front around the focus, are so changed into vortex beams and vice versa. The statistics of extrema locations and the intensity distribution of the so-generated "complementary" patterns are characterized by numerical simulations. It is demonstrated experimentally that the incoherent superposition of the three "complementary speckle patterns" yield a synthetic speckle grain size enlarged by a factor of sqrt[3]. A cyclic permutation of optical vortices and intensity maxima is unexpectedly observed and discussed.

  6. Factors associated with the timing of introduction of complementary feeding: the Generation R Study.

    PubMed

    Tromp, I I M; Briedé, S; Kiefte-de Jong, J C; Renders, C M; Jaddoe, V W V; Franco, O H; Hofman, A; Raat, H; Moll, H A

    2013-06-01

    Many parents do not follow recommendations for the timing of introduction of complementary feeding. The aim of this study was to identify determinants associated with the timing of introduction of complementary feeding in a multiethnic birth cohort. Subjects were 3561 mothers and infants participating in a prospective cohort study. The timing of introduction of complementary feeding and maternal and infant characteristics were obtained by parent-derived questionnaires. Regression analyses were performed to identify determinants for the timing of introduction of complementary feeding (<3, 3-6 and ≥ 6 months). In total, 62% of infants were introduced to complementary feeding before the age of 6 months. Determinants for very early (<3 months) introduction were being a single parent and infant day care attendance. Determinants for early (3-6 months) introduction were young maternal age, multiple parities, no infant family history of asthma, atopy and no infant history of allergy to cow's milk. Determinants for both very early and early introduction were low educational level and not fully breastfeeding for 4 months. Maternal educational level was only significantly associated with the timing of introduction in mothers of Western origin. This study confirmed determinants for the timing of introduction of complementary feeding that have been identified by previous studies, which may be appropriate targets for education and guidance. Moreover, mothers whose infants attend day care and have a family history of asthma, atopy or allergy to cow's milk may need guidance to follow infant feeding recommendations.

  7. Comparative Evaluation of the Complementary and Alternative Medicine Therapy and Conventional Therapy Use for Musculoskeletal Disorders Management and Its Association with Job Satisfaction among Dentists of West India.

    PubMed

    Gupta, Devanand; Batra, Renu; Mahajan, Shveta; Bhaskar, Dara John; Jain, Ankita; Shiju, Mohammed; Yadav, Ankit; Chaturvedi, Mudita; Gill, Shruti; Verma, Renuka; Dalai, Deepak Ranjan; Gupta, Rajendra Kumar

    2014-10-01

    Musculoskeletal problems have become a significant issue in the profession of dentistry. There are currently no recommended effective disease-preventing and modifying remedies. High prevalence rates for musculoskeletal disorders (MSDs) among dentists have been reported in the literature. Complementary and alternative medicine can be helpful in managing and preventing the MSDs. The purpose of this study was to determine if dentists in the western part of India are using complementary and alternative medicine therapies for MSDs, and also to find if those who use complementary and alternative medicine therapies have greater job/career satisfaction compared to conventional therapy (CT) users. Dentists of western India registered under the Dental Council of India (N = 2166) were recruited for the study. Data were analyzed using univariate and bivariate analyses and logistic regression. A response rate of 73% (n = 1581) was obtained, of which 79% (n = 1249) was suffering from MSDs. The use of complementary and alternative medicine or CT was reported by 90% (n = 1124) of dentists with MSDs. Dentists using complementary and alternative medicine reported greater health (P < 0.001) and carrier satisfaction (P < 0.001) and were able to work as many hours they wanted (P < 0.001) compared to CT users. Complementary and alternative medicine therapies may improve the quality of life and enhance job satisfaction for a dentist who suffers from MSDs.

  8. Comparative Evaluation of the Complementary and Alternative Medicine Therapy and Conventional Therapy Use for Musculoskeletal Disorders Management and Its Association with Job Satisfaction among Dentists of West India

    PubMed Central

    Gupta, Devanand; Batra, Renu; Mahajan, Shveta; Bhaskar, Dara John; Jain, Ankita; Shiju, Mohammed; Yadav, Ankit; Chaturvedi, Mudita; Gill, Shruti; Verma, Renuka; Dalai, Deepak Ranjan; Gupta, Rajendra Kumar

    2014-01-01

    Musculoskeletal problems have become a significant issue in the profession of dentistry. There are currently no recommended effective disease-preventing and modifying remedies. High prevalence rates for musculoskeletal disorders (MSDs) among dentists have been reported in the literature. Complementary and alternative medicine can be helpful in managing and preventing the MSDs. The purpose of this study was to determine if dentists in the western part of India are using complementary and alternative medicine therapies for MSDs, and also to find if those who use complementary and alternative medicine therapies have greater job/career satisfaction compared to conventional therapy (CT) users. Dentists of western India registered under the Dental Council of India (N = 2166) were recruited for the study. Data were analyzed using univariate and bivariate analyses and logistic regression. A response rate of 73% (n = 1581) was obtained, of which 79% (n = 1249) was suffering from MSDs. The use of complementary and alternative medicine or CT was reported by 90% (n = 1124) of dentists with MSDs. Dentists using complementary and alternative medicine reported greater health (P < 0.001) and carrier satisfaction (P < 0.001) and were able to work as many hours they wanted (P < 0.001) compared to CT users. Complementary and alternative medicine therapies may improve the quality of life and enhance job satisfaction for a dentist who suffers from MSDs. PMID:25379469

  9. Queering Sex Education: Young Adult Literature with LGBT Content as Complementary Sources of Sex and Sexuality Education

    ERIC Educational Resources Information Center

    Bittner, Robert

    2012-01-01

    This article explores the nature of young adult texts as complementary sources of informal queer sex and sexuality education, along with a close reading of a sample of this young adult (YA) literature. LGBT teens are often left out of discussions in sex education classrooms in the United States because of discriminatory curricula, ignorance on the…

  10. Evaluation of a complementary cyber education program for a pathophysiology class.

    PubMed

    Yoo, Ji-Soo; Ryue, Sook-Hee; Lee, Jung Eun; Ahn, Jeong-Ah

    2009-12-01

    The goal of this study was to develop and evaluate a complementary cyber education program for a required pathophysiology class for nursing students. The cyber education program comprised electronic bulletin boards, correspondence material storage, an announcement section, a report submission section, reference sites, and statistics on learning rates. Twelve online lectures complemented five lectures in the classroom. To evaluate the course's educational effectiveness, we performed an online objective questionnaire and an open questionnaire survey anonymously, and compared the complementary cyber education program with traditional classroom education. The complementary cyber education program effected significant improvements in scores for importance with regard to major, clarity of goals and education plans for courses, professor readiness, preciseness and description of lectures, amount and efficiency of assignments, and fairness in appraisal standards compared with the traditional classroom education group. This study indicates that a complementary cyber education program provides nursing students with the flexibility of time and space, the newest information through updated lectures, efficient motivational aids through intimacy between the lecturer and students, and concrete and meaningful tasks. The complementary cyber education course also increased student effort toward studying and student satisfaction with the class.

  11. Automatic face naming by learning discriminative affinity matrices from weakly labeled images.

    PubMed

    Xiao, Shijie; Xu, Dong; Wu, Jianxin

    2015-10-01

    Given a collection of images, where each image contains several faces and is associated with a few names in the corresponding caption, the goal of face naming is to infer the correct name for each face. In this paper, we propose two new methods to effectively solve this problem by learning two discriminative affinity matrices from these weakly labeled images. We first propose a new method called regularized low-rank representation by effectively utilizing weakly supervised information to learn a low-rank reconstruction coefficient matrix while exploring multiple subspace structures of the data. Specifically, by introducing a specially designed regularizer to the low-rank representation method, we penalize the corresponding reconstruction coefficients related to the situations where a face is reconstructed by using face images from other subjects or by using itself. With the inferred reconstruction coefficient matrix, a discriminative affinity matrix can be obtained. Moreover, we also develop a new distance metric learning method called ambiguously supervised structural metric learning by using weakly supervised information to seek a discriminative distance metric. Hence, another discriminative affinity matrix can be obtained using the similarity matrix (i.e., the kernel matrix) based on the Mahalanobis distances of the data. Observing that these two affinity matrices contain complementary information, we further combine them to obtain a fused affinity matrix, based on which we develop a new iterative scheme to infer the name of each face. Comprehensive experiments demonstrate the effectiveness of our approach.

  12. Maximum Likelihood Estimation of Spectra Information from Multiple Independent Astrophysics Data Sets

    NASA Technical Reports Server (NTRS)

    Howell, Leonard W., Jr.; Six, N. Frank (Technical Monitor)

    2002-01-01

    The Maximum Likelihood (ML) statistical theory required to estimate spectra information from an arbitrary number of astrophysics data sets produced by vastly different science instruments is developed in this paper. This theory and its successful implementation will facilitate the interpretation of spectral information from multiple astrophysics missions and thereby permit the derivation of superior spectral information based on the combination of data sets. The procedure is of significant value to both existing data sets and those to be produced by future astrophysics missions consisting of two or more detectors by allowing instrument developers to optimize each detector's design parameters through simulation studies in order to design and build complementary detectors that will maximize the precision with which the science objectives may be obtained. The benefits of this ML theory and its application is measured in terms of the reduction of the statistical errors (standard deviations) of the spectra information using the multiple data sets in concert as compared to the statistical errors of the spectra information when the data sets are considered separately, as well as any biases resulting from poor statistics in one or more of the individual data sets that might be reduced when the data sets are combined.

  13. Change detection in synthetic aperture radar images based on image fusion and fuzzy clustering.

    PubMed

    Gong, Maoguo; Zhou, Zhiqiang; Ma, Jingjing

    2012-04-01

    This paper presents an unsupervised distribution-free change detection approach for synthetic aperture radar (SAR) images based on an image fusion strategy and a novel fuzzy clustering algorithm. The image fusion technique is introduced to generate a difference image by using complementary information from a mean-ratio image and a log-ratio image. In order to restrain the background information and enhance the information of changed regions in the fused difference image, wavelet fusion rules based on an average operator and minimum local area energy are chosen to fuse the wavelet coefficients for a low-frequency band and a high-frequency band, respectively. A reformulated fuzzy local-information C-means clustering algorithm is proposed for classifying changed and unchanged regions in the fused difference image. It incorporates the information about spatial context in a novel fuzzy way for the purpose of enhancing the changed information and of reducing the effect of speckle noise. Experiments on real SAR images show that the image fusion strategy integrates the advantages of the log-ratio operator and the mean-ratio operator and gains a better performance. The change detection results obtained by the improved fuzzy clustering algorithm exhibited lower error than its preexistences.

  14. Encoding of social signals in all three electrosensory pathways of Eigenmannia virescens.

    PubMed

    Stöckl, Anna; Sinz, Fabian; Benda, Jan; Grewe, Jan

    2014-11-01

    Extracting complementary features in parallel pathways is a widely used strategy for a robust representation of sensory signals. Weakly electric fish offer the rare opportunity to study complementary encoding of social signals in all of its electrosensory pathways. Electrosensory information is conveyed in three parallel pathways: two receptor types of the tuberous (active) system and one receptor type of the ampullary (passive) system. Modulations of the fish's own electric field are sensed by these receptors and used in navigation, prey detection, and communication. We studied the neuronal representation of electric communication signals (called chirps) in the ampullary and the two tuberous pathways of Eigenmannia virescens. We first characterized different kinds of chirps observed in behavioral experiments. Since Eigenmannia chirps simultaneously drive all three types of receptors, we studied their responses in in vivo electrophysiological recordings. Our results demonstrate that different electroreceptor types encode different aspects of the stimuli and each appears best suited to convey information about a certain chirp type. A decoding analysis of single neurons and small populations shows that this specialization leads to a complementary representation of information in the tuberous and ampullary receptors. This suggests that a potential readout mechanism should combine information provided by the parallel processing streams to improve chirp detectability. Copyright © 2014 the American Physiological Society.

  15. Catalytic Activity of a Binary Informational Macromolecule

    NASA Technical Reports Server (NTRS)

    Reader, John S.; Joyce, Gerald F.

    2003-01-01

    RNA molecules are thought to have played a prominent role in the early history of life on Earth based on their ability both to encode genetic information and to exhibit catalytic function. The modern genetic alphabet relies on two sets of complementary base pairs to store genetic information. However, due to the chemical instability of cytosine, which readily deaminates to uracil, a primitive genetic system composed of the bases A, U, G and C may have been difficult to establish. It has been suggested that the first genetic material instead contained only a single base-pairing unie'. Here we show that binary informational macromolecules, containing only two different nucleotide subunits, can act as catalysts. In vitro evolution was used to obtain ligase ribozymes composed of only 2,6-diaminopurine and uracil nucleotides, which catalyze the template-directed joining of two RNA molecules, one bearing a 5'-triphosphate and the other a 3'-hydroxyl. The active conformation of the fastest isolated ribozyme had a catalytic rate that was about 36,000-fold faster than the uncatalyzed rate of reaction. This ribozyme is specific for the formation of biologically relevant 3',5'-phosphodiester linkages.

  16. Scientific Results of Yoga for Health and Well-Being

    MedlinePlus Videos and Cool Tools

    ... What Is Complementary, Alternative or Integrative Health? Safety Information Know the Science For Health Care Professionals Clinical Practice Guidelines Literature Reviews All Health Information Research Research Results Results by Date Sponsored by ...

  17. Viability of in-house datamarting approaches for population genetics analysis of SNP genotypes

    PubMed Central

    Amigo, Jorge; Phillips, Christopher; Salas, Antonio; Carracedo, Ángel

    2009-01-01

    Background Databases containing very large amounts of SNP (Single Nucleotide Polymorphism) data are now freely available for researchers interested in medical and/or population genetics applications. While many of these SNP repositories have implemented data retrieval tools for general-purpose mining, these alone cannot cover the broad spectrum of needs of most medical and population genetics studies. Results To address this limitation, we have built in-house customized data marts from the raw data provided by the largest public databases. In particular, for population genetics analysis based on genotypes we have built a set of data processing scripts that deal with raw data coming from the major SNP variation databases (e.g. HapMap, Perlegen), stripping them into single genotypes and then grouping them into populations, then merged with additional complementary descriptive information extracted from dbSNP. This allows not only in-house standardization and normalization of the genotyping data retrieved from different repositories, but also the calculation of statistical indices from simple allele frequency estimates to more elaborate genetic differentiation tests within populations, together with the ability to combine population samples from different databases. Conclusion The present study demonstrates the viability of implementing scripts for handling extensive datasets of SNP genotypes with low computational costs, dealing with certain complex issues that arise from the divergent nature and configuration of the most popular SNP repositories. The information contained in these databases can also be enriched with additional information obtained from other complementary databases, in order to build a dedicated data mart. Updating the data structure is straightforward, as well as permitting easy implementation of new external data and the computation of supplementary statistical indices of interest. PMID:19344481

  18. Viability of in-house datamarting approaches for population genetics analysis of SNP genotypes.

    PubMed

    Amigo, Jorge; Phillips, Christopher; Salas, Antonio; Carracedo, Angel

    2009-03-19

    Databases containing very large amounts of SNP (Single Nucleotide Polymorphism) data are now freely available for researchers interested in medical and/or population genetics applications. While many of these SNP repositories have implemented data retrieval tools for general-purpose mining, these alone cannot cover the broad spectrum of needs of most medical and population genetics studies. To address this limitation, we have built in-house customized data marts from the raw data provided by the largest public databases. In particular, for population genetics analysis based on genotypes we have built a set of data processing scripts that deal with raw data coming from the major SNP variation databases (e.g. HapMap, Perlegen), stripping them into single genotypes and then grouping them into populations, then merged with additional complementary descriptive information extracted from dbSNP. This allows not only in-house standardization and normalization of the genotyping data retrieved from different repositories, but also the calculation of statistical indices from simple allele frequency estimates to more elaborate genetic differentiation tests within populations, together with the ability to combine population samples from different databases. The present study demonstrates the viability of implementing scripts for handling extensive datasets of SNP genotypes with low computational costs, dealing with certain complex issues that arise from the divergent nature and configuration of the most popular SNP repositories. The information contained in these databases can also be enriched with additional information obtained from other complementary databases, in order to build a dedicated data mart. Updating the data structure is straightforward, as well as permitting easy implementation of new external data and the computation of supplementary statistical indices of interest.

  19. A qualitative study of culturally embedded factors in complementary and alternative medicine use.

    PubMed

    Zörgő, Szilvia; Purebl, György; Zana, Ágnes

    2018-01-22

    Within the intercultural milieu of medical pluralism, a nexus of worldviews espousing distinct explanatory models of illness, our research aims at exploring factors leading to complementary and alternative medicine (CAM) use with special attention to their cultural context. The results are based on medical anthropological fieldwork (participant observation and in-depth interviews) spanning a period from January 2015 to May 2017 at four clinics of Traditional Chinese Medicine in Budapest, Hungary. Participant observation involved 105 patients (males N = 42); in-depth interviews were conducted with patients (N = 9) and practitioners (N = 9). The interviews were coded with Interpretative Phenomenological Analysis; all information was aggregated employing Atlas.ti software. In order to avoid the dichotomization of "push and pull factors," results obtained from the fieldwork and interviews were structured along milestones of the patient journey. These points of reference include orientation among sources of information, biomedical diagnosis, patient expectations and the physician-patient relationship, the biomedical treatment trajectory and reasons for non-adherence, philosophical congruence, and alternate routes of entry into the world of CAM. All discussed points which are a departure from the strictly western therapy, entail an underlying socio-cultural disposition and must be scrutinized in this context. The influence of one's culturally determined explanatory model is ubiquitous from the onset of the patient journey and exhibits a reciprocal relationship with subjective experience. Firsthand experience (or that of the Other) signifies the most reliable source of information in matters of illness and choice of therapy. Furthermore, the theme of (building and losing) trust is present throughout the patient journey, a determining factor in patient decision-making and dispositions toward both CAM and biomedicine.

  20. A multimodal approach to estimating vigilance using EEG and forehead EOG

    NASA Astrophysics Data System (ADS)

    Zheng, Wei-Long; Lu, Bao-Liang

    2017-04-01

    Objective. Covert aspects of ongoing user mental states provide key context information for user-aware human computer interactions. In this paper, we focus on the problem of estimating the vigilance of users using EEG and EOG signals. Approach. The PERCLOS index as vigilance annotation is obtained from eye tracking glasses. To improve the feasibility and wearability of vigilance estimation devices for real-world applications, we adopt a novel electrode placement for forehead EOG and extract various eye movement features, which contain the principal information of traditional EOG. We explore the effects of EEG from different brain areas and combine EEG and forehead EOG to leverage their complementary characteristics for vigilance estimation. Considering that the vigilance of users is a dynamic changing process because the intrinsic mental states of users involve temporal evolution, we introduce continuous conditional neural field and continuous conditional random field models to capture dynamic temporal dependency. Main results. We propose a multimodal approach to estimating vigilance by combining EEG and forehead EOG and incorporating the temporal dependency of vigilance into model training. The experimental results demonstrate that modality fusion can improve the performance compared with a single modality, EOG and EEG contain complementary information for vigilance estimation, and the temporal dependency-based models can enhance the performance of vigilance estimation. From the experimental results, we observe that theta and alpha frequency activities are increased, while gamma frequency activities are decreased in drowsy states in contrast to awake states. Significance. The forehead setup allows for the simultaneous collection of EEG and EOG and achieves comparative performance using only four shared electrodes in comparison with the temporal and posterior sites.

  1. Perceptions, opinions and knowledge of pharmacists towards the use of complementary medicines by people living with cancer.

    PubMed

    Harnett, Joanna; Le, Trong Quy; Smith, Lorraine; Krass, Ines

    2018-05-09

    Background Biologically-based complementary medicine (BB-CM) use is prevalent amongst people living with cancer. Pharmacists play an important role in the provision of standard treatments for cancer. Less is known about pharmacist's provision of BB-CM information. Objective This study investigated the opinions, perceptions and knowledge of pharmacists regarding the use of BB-CMs by people living with cancer and the facilitators and barriers to providing information and advice. Setting Australia. Method A cross-sectional 53-item survey was developed and the survey link distributed in two professional associations newsletters. The associations represent ~29,000 pharmacists. Questions were categories into pharmacist's perceptions, opinions, and knowledge towards the use of BB-CM in cancer. Main Outcome Measure Scores obtained from responses to perception, opinion and knowledge statements and responses to demographic questions Results Respondents (n=70) were predominantly female (73%), Caucasian (66%) and under 40 years of age (78%). Respondents estimated that 19% of daily inquiries related to BB-CMs. Seventy-two per cent of respondents believed they had a responsibility to advise about the concomitant use of BB-CM with standard cancer treatments despite 60% reporting a lack of confidence in their knowledge. There was a moderate positive association (Spearman's rho 0.41 p= 0.001) between a pharmacists confidence in their level of knowledge and their total knowledge scores. The main barriers to providing information about BB-CMs reported were inadequate training in BB-CMs (94%) and reservations about the evidence base for efficacy and safety (50%). Conclusion Pharmacists have a role to play in counselling people living with cancer about their use of BB-CMs and this role could be maximized with further training and education in this area.

  2. Information Literacy and Digital Literacy: Competing or Complementary?

    ERIC Educational Resources Information Center

    Cordell, Rosanne Marie

    2013-01-01

    Digital literacy is a more recent concept than information literacy and can relate to multiple categories of library users in multiple types of libraries. Determining the relationship between information literacy and digital literacy is essential before revision of the ACRL "Standards" can proceed.

  3. Complementary and Alternative Medicine in Cardiac Surgery: Prevalence and Modality of use.

    PubMed

    Dalmayrac, Emilie; Quignon, Anne; Baufreton, Christophe

    2016-07-01

    Complementary and alternative medicines are developing at a growing rate but their use in the hospital setting is little known, ignoring risk or benefit in practice. The objectives of the study were to quantify the prevalence of complementary and alternative medicines used by patients admitted to a cardiac surgery department. Patients and staff at the Cardiac Surgery unit of Angers University Hospital (France) were surveyed regarding their modality of complementary and alternative medicines use, between April 01, 2013, and April 18, 2014, by means of an anonymous questionnaire. Of 154 patients included in the study, 58% used a complementary and alternative medicine at least once in their lifetime, 38% during the preceding year, and 14% between the consultation and surgery. In all, 71% used them as a complement to their conventional medical treatment. Of those who used a complementary and alternative medicine during the year of their surgery procedure, only 29% informed their physicians and paramedical staff about it. Complementary and alternative medicines use among patients admitted to cardiac surgery units is common. Yet there is a real lack of knowledge regarding these health practices among physicians and paramedical staff. Copyright © 2016 Australian and New Zealand Society of Cardiac and Thoracic Surgeons (ANZSCTS) and the Cardiac Society of Australia and New Zealand (CSANZ). Published by Elsevier B.V. All rights reserved.

  4. Tai Chi and Qi Gong for Health and Well-Being

    MedlinePlus Videos and Cool Tools

    ... What Is Complementary, Alternative or Integrative Health? Safety Information Know the Science For Health Care Professionals Clinical Practice Guidelines Literature Reviews All Health Information Research Research Results Results by Date Sponsored by ...

  5. Finding and Evaluating Online Resources on Complementary Health Approaches

    MedlinePlus

    ... it selling something? Finding Health Information on the Internet: How To Start To find accurate health information, ... thousands of mobile apps (a software program you access using your phone or other mobile device) that ...

  6. The effect of traffic lights and regulatory statements on the choice between complementary and conventional medicines in Australia: results from a discrete choice experiment.

    PubMed

    Spinks, Jean; Mortimer, Duncan

    2015-01-01

    It has been suggested that complementary medicines are currently 'under-regulated' in some countries due to their potential for harm as a direct result from side-effects or interactions; from delaying more effective care; or from the economic cost of purchasing an ineffective or inappropriate treatment. The requirement of additional labelling on complementary medicine products has been suggested in Australia and may provide additional information to consumers at the point of purchase. This paper details a unique way of testing the potential effects on consumer behaviour of including either a traffic light logo or regulatory statement on labels. Using a discrete choice experiment, data were collected in 2012 in a sample of 521 Australians with either type 2 diabetes or cardiovascular disease. We find that additional labelling can affect consumer behaviour, but in unpredictable ways. The results of this experiment are informative to further the dialogue concerning possible regulatory mechanisms. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Informal Mentors and Education: Complementary or Compensatory Resources?*

    PubMed Central

    Erickson, Lance D.; McDonald, Steve; Elder, Glen H.

    2011-01-01

    Few studies have examined the impact that mentoring (i.e., developing a special relationship with a non-parental adult) has on educational achievement and attainment in the general population. In addition, prior research has yet to clarify the extent to which mentoring relationships reduce inequality by enabling disadvantaged youth to compensate for a lack of social resources or promote inequality by serving as a complementary resource for advantaged youth. Results from a nationally representative sample of youth show (1) a powerful net influence of mentors on the educational success of youth and (2) how social background, parental, peer, and personal resources condition the formation and effectiveness of mentoring relationships. The findings uncover an interesting paradox—that informal mentors may simultaneously represent compensatory and complementary resources. Youth with many resources are more likely than other young people to have mentors, but those with few resources are likely to benefit more from having a mentor—particularly teacher mentors—in their lives. PMID:21912440

  8. Direct Nanoscale Conversion of Biomolecular Signals into Electronic Information

    DTIC Science & Technology

    2008-09-22

    the electrode surface. In this experiment, the single free cysteine group featured in the GOx structure was exploited to demonstrate that orientation...first with GOx-ssDNA conjugates featuring a sequence complementary to the address strand, then with a non-complementary conjugate and finally with...fully-functional for an enzyme that features a free thiol group, or that can be engineered to incorporate a thiol onto its outer shell

  9. The relation of Complementary-Alternative Medicine use with glomerular filtration rate and depression in patients with chronic kidney disease at predialysis stage.

    PubMed

    Esen, Bennur; Atay, Ahmet Engin; Gokmen, Emel Saglam; Karakoc, Ayten; Sari, Hakan; Sarisakal, Samprie; Kahvecioglu, Serdar; Kayabasi, Hasan; Sit, Dede

    2015-05-08

    Complementary and alternative medicine is a broad field of health including all health care practices and methods; and their accompanying theories and beliefs. In the present study, we aimed to examine the frequency of complementary-alternative medicine use, and its relation with glomerular filtration rate and depression in patients with chronic kidney disease at predialysis stage. A total of 1053 predialysis patients; 518 female and 535 male, that were followed up with chronic kidney disease for at least 3 months were enrolled into the study. Demographic features, biochemical parameters and findings of physical examination were recorded. Their compliance to diet, and knowledge about disease were questioned. Beck depression inventory and questionnaire regarding to complementary-alternative medicine use were performed. The overall frequency of complementary-alternative medicine use was 40.3% . Total ratio of herbal products was 46%. Complementary-alternative medicine use was significantly more frequent in female or single patients, and patients that informed about chronic kidney disease or under strict diet (p:0.007, p:0.016, p:0.02, p:0.016; respectively). When glomerular filtration rate of participants were considered, complementary-alternative medicine use was similar in different stages of kidney disease. Depression was observed in 41.9% of patients and significantly frequent in patients with alternative method use (p:0.002). Depression score was higher as creatinine increases and glomerular filtration rate decreases (p:0.002; r: 0,093). We determined that complementary-alternative medicine use gradually increases at predialysis stage as glomerular filtration rate decreases and there is a strict relation between complementary-alternative medicine use and depression or female gender. Disorder related stressors may lead to seeking of alternative methods. This article is protected by copyright. All rights reserved.

  10. HUNT: launch of a full-length cDNA database from the Helix Research Institute.

    PubMed

    Yudate, H T; Suwa, M; Irie, R; Matsui, H; Nishikawa, T; Nakamura, Y; Yamaguchi, D; Peng, Z Z; Yamamoto, T; Nagai, K; Hayashi, K; Otsuki, T; Sugiyama, T; Ota, T; Suzuki, Y; Sugano, S; Isogai, T; Masuho, Y

    2001-01-01

    The Helix Research Institute (HRI) in Japan is releasing 4356 HUman Novel Transcripts and related information in the newly established HUNT database. The institute is a joint research project principally funded by the Japanese Ministry of International Trade and Industry, and the clones were sequenced in the governmental New Energy and Industrial Technology Development Organization (NEDO) Human cDNA Sequencing Project. The HUNT database contains an extensive amount of annotation from advanced analysis and represents an essential bioinformatics contribution towards understanding of the gene function. The HRI human cDNA clones were obtained from full-length enriched cDNA libraries constructed with the oligo-capping method and have resulted in novel full-length cDNA sequences. A large fraction has little similarity to any proteins of known function and to obtain clues about possible function we have developed original analysis procedures. Any putative function deduced here can be validated or refuted by complementary analysis results. The user can also extract information from specific categories like PROSITE patterns, PFAM domains, PSORT localization, transmembrane helices and clones with GENIUS structure assignments. The HUNT database can be accessed at http://www.hri.co.jp/HUNT.

  11. Comparison of HPLC/ESI-FTICR MS Versus MALDI-TOF/TOF MS for Glycopeptide Analysis of a Highly Glycosylated HIV Envelope Glycoprotein

    PubMed Central

    Irungu, Janet; Go, Eden P.; Zhang, Ying; Dalpathado, Dilusha S.; Liao, Hua-Xin; Haynes, Barton F.; Desaire, Heather

    2013-01-01

    Defining the structures and locations of the glycans attached on secreted proteins and virus envelope proteins is important in understanding how glycosylation affects their biological properties. Glycopeptide mass spectrometry (MS)-based analysis is a very powerful, emerging approach to characterize glycoproteins, in which glycosylation sites and the corresponding glycan structures are elucidated in a single MS experiment. However, to date there is not a consensus regarding which mass spectrometric platform provides the best glycosylation coverage information. Herein, we employ two of the most widely used MS approaches, online high performance liquid chromatography-electrospray ionization mass spectrometry (HPLC/ESI-MS) and offline HPLC followed by matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS), to determine which of the two approaches provides the best glycosylation coverage information of a complex glycoprotein, the group M consensus HIV-1 envelope, CON-S gp140ΔCFI, which has 31 potential glycosylation sites. Our results highlight differences in the informational content obtained between the two methods such as the overall number of glycosylation sites detected, the numbers of N-linked glycans present at each site, and the type of confirmatory information obtained about the glycopeptide using MS/MS experiments. The two approaches are quite complementary, both in their coverage of glycopeptides and in the information they provide in MS/MS experiments. The information in this study contributes to the field of mass spectrometry by demonstrating the strengths and limitations of two widely used MS platforms in glycoprotein analysis. PMID:18565761

  12. Active Laplacian electrode for the data-acquisition system of EHG

    NASA Astrophysics Data System (ADS)

    Li, G.; Wang, Y.; Lin, L.; Jiang, W.; Wang, L. L.; C-Y Lu, Stephen; Besio, Walter G.

    2005-01-01

    EHG (electrohysterogram) is the recording of uterine electromyogram with external electrodes located on the abdomen of pregnant woman. Derived from the electrical activity generated at the muscle fiber lever, it provides complementary information from the muscle, and appears to be a very promising technique for clinical or physiologic investigation of uterine activity, compared with current monitoring which can't give us complementary phase information of uterine activity. In this article we have shown the disadvantages of the conventional electrodes for EHG data-acquisition system and put forward a new type of electrode that is called active Laplacian electrode. It integrates concentric rings electrode with a bioelectricity preamplifier and is capable of acquiring localized information. We can localise the EHG signals source more easily by using this new electrode.

  13. Nurses' beliefs, experiences and practice regarding complementary and alternative medicine in Taiwan.

    PubMed

    Smith, Graeme D; Wu, Shu-Chen

    2012-09-01

    To gain an insight into this issue, this study used a qualitative approach and aims to explore and describe nurses' beliefs, experiences and practice regarding complementary and alternative medicine in Taiwan. The integration of complementary and alternative medicine with conventional medicine has become more common worldwide in recent years. An increase in patient use and an expansion of nurses using complementary and alternative medicine has spawned further investigation. Most published studies have concentrated on the usage of complementary and alternative medicine in western societies and have focused principally on physicians' attitudes and practice patterns in this regard. Despite the large amount of time and the unique relationship that nurses share with their patients, little research has investigated the nurse's attitudes and practice regarding complementary and alternative medicine. Moreover, there has been no previous research into understanding this issue from the Taiwanese nursing perspective. A qualitative research design. By using an exploratory, descriptive, qualitative approach, data were collected from 11 registered nurses. The methods of the data collection were in-depth, semi-structured interviews, field notes and memos and the data were analysed using the constant comparative method. Three major categories emerged from the data; namely, a 'lack of clear definition', 'limited experience' and 'high interest' towards complementary and alternative medicine. These results suggest that the definition of complementary and alternative medicine is often unclear for nurses in Taiwan. Due to the organisational policies and personal knowledge base, very few nurses integrate complementary and alternative medicine into their daily practice. However, the nurses in Taiwan show a great desire to participate in complementary and alternative medicine continuing education programmes. This study is not only significant in filling the gap in the existing literature, but is also important in understanding this issue from the nurses' perspective, to offer a series of recommendations for policy, nursing education, nursing practice and suggestions for further research. This study highlights the importance of nursing attitude in the use of complementary and alternative medicine. Clinical nurses have the potential to provide appropriate information to their patients to ensure safe complementary and alternative medicine use. © 2012 Blackwell Publishing Ltd.

  14. 15 CFR Supplement No. 1 to Part 783 - Deadlines for Submission of Reports and Amendments

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... Information Report Forms AP-1, AP-2, and AP-15 Within 15 calendar days of receiving notification from BIS. Amended Report:—Report information —Organization and location information —Complementary access letter... were no changes to previously “reported” activities or location information. Import Confirmation Report...

  15. 15 CFR Supplement No. 1 to Part 783 - Deadlines for Submission of Reports and Amendments

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... Information Report Forms AP-1, AP-2, and AP-15 Within 15 calendar days of receiving notification from BIS. Amended Report:—Report information —Organization and location information —Complementary access letter... were no changes to previously “reported” activities or location information. Import Confirmation Report...

  16. 15 CFR Supplement No. 1 to Part 783 - Deadlines for Submission of Reports and Amendments

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... Information Report Forms AP-1, AP-2, and AP-15 Within 15 calendar days of receiving notification from BIS. Amended Report:—Report information —Organization and location information —Complementary access letter... were no changes to previously “reported” activities or location information. Import Confirmation Report...

  17. 15 CFR Supplement No. 1 to Part 783 - Deadlines for Submission of Reports and Amendments

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... Information Report Forms AP-1, AP-2, and AP-15 Within 15 calendar days of receiving notification from BIS. Amended Report:—Report information —Organization and location information —Complementary access letter... were no changes to previously “reported” activities or location information. Import Confirmation Report...

  18. Study of the Au-Cr bilayer system using X-ray reflectivity, GDOES, and ToF-SIMS

    DOE PAGES

    Jonnard, Philippe; Modi, Mohammed H.; Le Guen, Karine; ...

    2018-04-17

    Here, we study a Au (25 nm)/Cr (10 nm) bilayer system as a model of mirror for the soft X–ray energy range. The Au and Cr thin films are a few nanometer thick and are deposited on a float glass substrate. The sample is characterized by using 3 complementary techniques: soft X–ray reflectivity, glow discharge optical emission spectrometry (GDOES), and time–of–flight secondary ion mass spectroscopy (ToF–SIMS). Soft X–ray reflectivity provides information about the thickness and roughness of the different layers, while GDOES is used to obtain the elemental depth profile of the stack and ToF–SIMS to obtain the elemental andmore » chemical depth profiles. GDOES and ToF–SIMS have both a nanometer depth resolution. A coherent description of the bilayer stack is obtained through the combination of these techniques. It consists in 5 layers namely a surface contamination layer, a principal gold layer, a Au–Cr mixed layer, a Cr layer, and another contamination layer at the top of the substrate.« less

  19. Study of the Au-Cr bilayer system using X-ray reflectivity, GDOES, and ToF-SIMS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jonnard, Philippe; Modi, Mohammed H.; Le Guen, Karine

    Here, we study a Au (25 nm)/Cr (10 nm) bilayer system as a model of mirror for the soft X–ray energy range. The Au and Cr thin films are a few nanometer thick and are deposited on a float glass substrate. The sample is characterized by using 3 complementary techniques: soft X–ray reflectivity, glow discharge optical emission spectrometry (GDOES), and time–of–flight secondary ion mass spectroscopy (ToF–SIMS). Soft X–ray reflectivity provides information about the thickness and roughness of the different layers, while GDOES is used to obtain the elemental depth profile of the stack and ToF–SIMS to obtain the elemental andmore » chemical depth profiles. GDOES and ToF–SIMS have both a nanometer depth resolution. A coherent description of the bilayer stack is obtained through the combination of these techniques. It consists in 5 layers namely a surface contamination layer, a principal gold layer, a Au–Cr mixed layer, a Cr layer, and another contamination layer at the top of the substrate.« less

  20. Use of complementary and alternative medicine for work related musculoskeletal disorders associated with job contentment in dental professionals: Indian outlook.

    PubMed

    Gupta, Devanand; Bhaskar, Dara John; Gupta, Kumar Rajendra; Karim, Bushra; Kanwar, Alpana; Jain, Ankita; Yadav, Ankit; Saini, Priya; Arya, Satya; Sachdeva, Neha

    2014-04-01

    High prevalence rates of work-related musculoskeletal disorders (WRMSD) among dentists have been reported. Complementary and alternative medicine (CAM) therapies can be helpful in managing and preventing work-related musculoskeletal disorders. The purpose of this study was to determine if dental professionals are using CAM for work-related musculoskeletal disorders. Who have greater job satisfaction: dentist who uses Complementary and alternative medicine (CAM) or conventional therapy (CT) as a treatment modality for WRMSD. Dentists who registered in Uttar Pradesh state, India under Indian Dental Council, Uttar Pradesh branch (n=1134) were surveyed. Data were analyzed using univariate and bivariate analyses and logistic regression. A response rate of 53% (n=601) was obtained, revealing that 82% (n=487) of the respondents suffered from work-related musculoskeletal disorders. The use of complementary and alternative medicine or conventional therapy was reported among 80% (n=390) of the dentists with work-related musculoskeletal disorders. Complementary and alternative medicine users reported greater overall health compared to conventional therapy users (P<0.001). Of those with work-related musculoskeletal disorders, 35.5% (n=172) considered a career change for once, and 4.0% (n=19) reported having left dentistry. Complementary and alternative medicine therapies may improve quality of life, reduce work disruptions and enhance job satisfaction for dentists who suffer from work-related musculoskeletal disorders. It is important that dentists incorporate complementary and alternative medicine strategies into practice to facilitate musculoskeletal health that will enable longer and healthier careers, increase productivity, provide safer workplace and prevent musculoskeletal disorders.

  1. Use of Complementary and Alternative Medicine for Work Related Musculoskeletal Disorders Associated With Job Contentment in Dental Professionals: Indian Outlook

    PubMed Central

    Gupta, Devanand; Bhaskar, Dara John; Gupta, Kumar Rajendra; Karim, Bushra; Kanwar, Alpana; Jain, Ankita; Yadav, Ankit; Saini, Priya; Arya, Satya; Sachdeva, Neha

    2014-01-01

    Background High prevalence rates of work-related musculoskeletal disorders (WRMSD) among dentists have been reported. Complementary and alternative medicine (CAM) therapies can be helpful in managing and preventing work-related musculoskeletal disorders. The purpose of this study was to determine if dental professionals are using CAM for work-related musculoskeletal disorders. Who have greater job satisfaction: dentist who uses Complementary and alternative medicine (CAM) or conventional therapy (CT) as a treatment modality for WRMSD Method Dentists who registered in Uttar Pradesh state, India under Indian Dental Council, Uttar Pradesh branch (n=1134) were surveyed. Data were analyzed using univariate and bivariate analyses and logistic regression. Result A response rate of 53% (n=601) was obtained, revealing that 82% (n=487) of the respondents suffered from work-related musculoskeletal disorders. The use of complementary and alternative medicine or conventional therapy was reported among 80% (n=390) of the dentists with work-related musculoskeletal disorders. Complementary and alternative medicine users reported greater overall health compared to conventional therapy users (P<0.001). Of those with work-related musculoskeletal disorders, 35.5% (n=172) considered a career change for once, and 4.0% (n=19) reported having left dentistry. Conclusion Complementary and alternative medicine therapies may improve quality of life, reduce work disruptions and enhance job satisfaction for dentists who suffer from work-related musculoskeletal disorders. It is important that dentists incorporate complementary and alternative medicine strategies into practice to facilitate musculoskeletal health that will enable longer and healthier careers, increase productivity, provide safer workplace and prevent musculoskeletal disorders. PMID:24795512

  2. Sensing of Streptococcus mutans by microscopic imaging ellipsometry

    NASA Astrophysics Data System (ADS)

    Khaleel, Mai Ibrahim; Chen, Yu-Da; Chien, Ching-Hang; Chang, Yia-Chung

    2017-05-01

    Microscopic imaging ellipsometry is an optical technique that uses an objective and sensing procedure to measure the ellipsometric parameters Ψ and Δ in the form of microscopic maps. This technique is well known for being noninvasive and label-free. Therefore, it can be used to detect and characterize biological species without any impact. Microscopic imaging ellipsometry was used to measure the optical response of dried Streptococcus mutans cells on a glass substrate. The ellipsometric Ψ and Δ maps were obtained with the Optrel Multiskop system for specular reflection in the visible range (λ=450 to 750 nm). The Ψ and Δ images at 500, 600, and 700 nm were analyzed using three different theoretical models with single-bounce, two-bounce, and multibounce light paths to obtain the optical constants and height distribution. The obtained images of the optical constants show different aspects when comparing the single-bounce analysis with the two-bounce or multibounce analysis in detecting S. mutans samples. Furthermore, the height distributions estimated by two-bounce and multibounce analyses of S. mutans samples were in agreement with the thickness values measured by AFM, which implies that the two-bounce and multibounce analyses can provide information complementary to that obtained by a single-bounce light path.

  3. Understanding the perceived need for complementary and alternative nutraceuticals: lifestyle issues.

    PubMed

    Whitman, M

    2001-01-01

    Nutraceuticals are biological therapies used to promote wellness, prevent malignant processes, and control symptoms. The use of complementary and alternative nutraceuticals increased dramatically after passage of the Dietary Supplement and Health Education Act of 1994. Motivations for use of these products include changes in eating patterns, concerns about adequacy of consumer food supply, and interactions with conventional healthcare providers that are perceived to be insensitive, too brief, or uncaring. By becoming knowledgeable about complementary and alternative nutraceuticals and the nutritional needs of people with cancer, communicating with empathy and patience, and involving dietitians, pharmacist, and other professional providers as needed, oncology nurses can provide accurate information and support for people with cancer and their families.

  4. Patterns of cultural consensus and intracultural diversity in Ghanaian complementary feeding practices.

    PubMed

    Kalra, Nikhila; Pelto, Gretel; Tawiah, Charlotte; Zobrist, Stephanie; Milani, Peiman; Manu, Grace; Laar, Amos; Parker, Megan

    2018-01-01

    Designing effective interventions to improve infant and young child (IYC) feeding requires knowledge about determinants of current practices, including cultural factors. Current approaches to obtaining and using research on culture tend to assume cultural homogeneity within a population. The purpose of this study was to examine the extent of cultural consensus (homogeneity) in communities where interventions to improve IYC feeding practices are needed to address undernutrition during the period of complementary feeding. A second, related objective was to identify the nature of intracultural variation, if such variation was evident. Selected protocols from the Focused Ethnographic Study for Infant and Young Child Feeding Manual were administered to samples of key informants and caregivers in a peri-urban and a rural area in Brong-Ahafo, Ghana. Cultural domain analysis techniques (free listing, caregiver assessment of culturally significant dimensions, and food ratings on these dimensions), as well as open-ended questions with exploratory probing, were used to obtain data on beliefs and related practices. Results reveal generally high cultural consensus on the 5 dimensions that were assessed (healthiness, appeal, child acceptance, convenience, and modernity) for caregiver decisions and on their ratings of individual foods. However, thematic analysis of caregiver narratives indicates that the meanings and content of the constructs connoted by the dimensions differed widely among individual mothers. These findings suggest that research on cultural factors that affect IYC practices, particularly cultural beliefs, should consider the nature and extent of cultural consensus and intracultural diversity, rather than assuming cultural homogeneity. © 2017 John Wiley & Sons Ltd.

  5. Multinuclear solid film state NMR studies of metal oxide catalysts and minerals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, R.S.; Stec, D.F.; Ellis, P.D.

    1996-10-01

    Several of our investigations of heterogeneous process by novel NMR experiments and analyses are reviewed and the utility and limitations of NMR spectroscopy for these areas discussed. Out studies have included the following: dynamics and arrangements of proton-containing adsorbates, primarily Bronsted acid sites and water, on the surface of zirconia and alumina catalysts; hydrogen dynamics and coordinates in synthetic aluminum oxyhydroxides; phase separation and crystallinity of synthetic minerals. In combination with the complementary results obtained in our laboratory via infrared spectroscopy, thermal analysis (primarily TGA and DSC), and catalytic activity measurements, these NMR data provide unique and valuable information onmore » atomic and molecular dynamics, identities, and structures without requiring pristine, single crystal specimens.« less

  6. Dietary Protein Intake in Young Children in Selected Low-Income Countries Is Generally Adequate in Relation to Estimated Requirements for Healthy Children, Except When Complementary Food Intake Is Low123

    PubMed Central

    Arsenault, Joanne E; Brown, Kenneth H

    2017-01-01

    Background: Previous research indicates that young children in low-income countries (LICs) generally consume greater amounts of protein than published estimates of protein requirements, but this research did not account for protein quality based on the mix of amino acids and the digestibility of ingested protein. Objective: Our objective was to estimate the prevalence of inadequate protein and amino acid intake by young children in LICs, accounting for protein quality. Methods: Seven data sets with information on dietary intake for children (6–35 mo of age) from 6 LICs (Peru, Guatemala, Ecuador, Bangladesh, Uganda, and Zambia) were reanalyzed to estimate protein and amino acid intake and assess adequacy. The protein digestibility–corrected amino acid score of each child’s diet was calculated and multiplied by the original (crude) protein intake to obtain an estimate of available protein intake. Distributions of usual intake were obtained to estimate the prevalence of inadequate protein and amino acid intake for each cohort according to Estimated Average Requirements. Results: The prevalence of inadequate protein intake was highest in breastfeeding children aged 6–8 mo: 24% of Bangladeshi and 16% of Peruvian children. With the exception of Bangladesh, the prevalence of inadequate available protein intake decreased by age 9–12 mo and was very low in all sites (0–2%) after 12 mo of age. Inadequate protein intake in children <12 mo of age was due primarily to low energy intake from complementary foods, not inadequate protein density. Conclusions: Overall, most children consumed protein amounts greater than requirements, except for the younger breastfeeding children, who were consuming low amounts of complementary foods. These findings reinforce previous evidence that dietary protein is not generally limiting for children in LICs compared with estimated requirements for healthy children, even after accounting for protein quality. However, unmeasured effects of infection and intestinal dysfunction on the children’s protein requirements could modify this conclusion. PMID:28202639

  7. Combined X-ray CT and mass spectrometry for biomedical imaging applications

    NASA Astrophysics Data System (ADS)

    Schioppa, E., Jr.; Ellis, S.; Bruinen, A. L.; Visser, J.; Heeren, R. M. A.; Uher, J.; Koffeman, E.

    2014-04-01

    Imaging technologies play a key role in many branches of science, especially in biology and medicine. They provide an invaluable insight into both internal structure and processes within a broad range of samples. There are many techniques that allow one to obtain images of an object. Different techniques are based on the analysis of a particular sample property by means of a dedicated imaging system, and as such, each imaging modality provides the researcher with different information. The use of multimodal imaging (imaging with several different techniques) can provide additional and complementary information that is not possible when employing a single imaging technique alone. In this study, we present for the first time a multi-modal imaging technique where X-ray computerized tomography (CT) is combined with mass spectrometry imaging (MSI). While X-ray CT provides 3-dimensional information regarding the internal structure of the sample based on X-ray absorption coefficients, MSI of thin sections acquired from the same sample allows the spatial distribution of many elements/molecules, each distinguished by its unique mass-to-charge ratio (m/z), to be determined within a single measurement and with a spatial resolution as low as 1 μm or even less. The aim of the work is to demonstrate how molecular information from MSI can be spatially correlated with 3D structural information acquired from X-ray CT. In these experiments, frozen samples are imaged in an X-ray CT setup using Medipix based detectors equipped with a CO2 cooled sample holder. Single projections are pre-processed before tomographic reconstruction using a signal-to-thickness calibration. In the second step, the object is sliced into thin sections (circa 20 μm) that are then imaged using both matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) and secondary ion (SIMS) mass spectrometry, where the spatial distribution of specific molecules within the sample is determined. The combination of two vastly different imaging approaches provides complementary information (i.e., anatomical and molecular distributions) that allows the correlation of distinct structural features with specific molecules distributions leading to unique insights in disease development.

  8. Hybrid imaging: Instrumentation and Data Processing

    NASA Astrophysics Data System (ADS)

    Cal-Gonzalez, Jacobo; Rausch, Ivo; Shiyam Sundar, Lalith K.; Lassen, Martin L.; Muzik, Otto; Moser, Ewald; Papp, Laszlo; Beyer, Thomas

    2018-05-01

    State-of-the-art patient management frequently requires the use of non-invasive imaging methods to assess the anatomy, function or molecular-biological conditions of patients or study subjects. Such imaging methods can be singular, providing either anatomical or molecular information, or they can be combined, thus, providing "anato-metabolic" information. Hybrid imaging denotes image acquisitions on systems that physically combine complementary imaging modalities for an improved diagnostic accuracy and confidence as well as for increased patient comfort. The physical combination of formerly independent imaging modalities was driven by leading innovators in the field of clinical research and benefited from technological advances that permitted the operation of PET and MR in close physical proximity, for example. This review covers milestones of the development of various hybrid imaging systems for use in clinical practice and small-animal research. Special attention is given to technological advances that helped the adoption of hybrid imaging, as well as to introducing methodological concepts that benefit from the availability of complementary anatomical and biological information, such as new types of image reconstruction and data correction schemes. The ultimate goal of hybrid imaging is to provide useful, complementary and quantitative information during patient work-up. Hybrid imaging also opens the door to multi-parametric assessment of diseases, which will help us better understand the causes of various diseases that currently contribute to a large fraction of healthcare costs.

  9. Modeling the Behavior of an Underwater Acoustic Relative Positioning System Based on Complementary Set of Sequences

    PubMed Central

    Aparicio, Joaquín; Jiménez, Ana; Álvarez, Fernando J.; Ureña, Jesús; De Marziani, Carlos; Diego, Cristina

    2011-01-01

    The great variability usually found in underwater media makes modeling a challenging task, but helpful for better understanding or predicting the performance of future deployed systems. In this work, an underwater acoustic propagation model is presented. This model obtains the multipath structure by means of the ray tracing technique. Using this model, the behavior of a relative positioning system is presented. One of the main advantages of relative positioning systems is that only the distances between all the buoys are needed to obtain their positions. In order to obtain the distances, the propagation times of acoustic signals coded by Complementary Set of Sequences (CSS) are used. In this case, the arrival instants are obtained by means of correlation processes. The distances are then used to obtain the position of the buoys by means of the Multidimensional Scaling Technique (MDS). As an early example of an application using this relative positioning system, a tracking of the position of the buoys at different times is performed. With this tracking, the surface current of a particular region could be studied. The performance of the system is evaluated in terms of the distance from the real position to the estimated one. PMID:22247661

  10. Electromagnetically induced transparency (EIT)-like transmission in side-coupled complementary split-ring resonators.

    PubMed

    Guo, Yinghui; Yan, Lianshan; Pan, Wei; Luo, Bin; Wen, Kunhua; Guo, Zhen; Luo, Xiangang

    2012-10-22

    We investigate a plasmonic waveguide system based on side-coupled complementary split-ring resonators (CSRR), which exhibits electromagnetically induced transparency (EIT)-like transmission. LC resonance model is utilized to explain the electromagnetic responses of CSRR, which is verified by simulation results of finite difference time domain method. The electromagnetic responses of CSRR can be flexible handled by changing the asymmetry degree of the structure and the width of the metallic baffles. Cascaded CSRRs also have been studied to obtain EIT-like transmission at visible and near-infrared region, simultaneously.

  11. Complementary Hand Responses Occur in Both Peri- and Extrapersonal Space.

    PubMed

    Faber, Tim W; van Elk, Michiel; Jonas, Kai J

    2016-01-01

    Human beings have a strong tendency to imitate. Evidence from motor priming paradigms suggests that people automatically tend to imitate observed actions such as hand gestures by performing mirror-congruent movements (e.g., lifting one's right finger upon observing a left finger movement; from a mirror perspective). Many observed actions however, do not require mirror-congruent responses but afford complementary (fitting) responses instead (e.g., handing over a cup; shaking hands). Crucially, whereas mirror-congruent responses don't require physical interaction with another person, complementary actions often do. Given that most experiments studying motor priming have used stimuli devoid of contextual information, this space or interaction-dependency of complementary responses has not yet been assessed. To address this issue, we let participants perform a task in which they had to mirror or complement a hand gesture (fist or open hand) performed by an actor depicted either within or outside of reach. In three studies, we observed faster reaction times and less response errors for complementary relative to mirrored hand movements in response to open hand gestures (i.e., 'hand-shaking') irrespective of the perceived interpersonal distance of the actor. This complementary effect could not be accounted for by a low-level spatial cueing effect. These results demonstrate that humans have a strong and automatic tendency to respond by performing complementary actions. In addition, our findings underline the limitations of manipulations of space in modulating effects of motor priming and the perception of affordances.

  12. Stages of Endometrial Cancer

    MedlinePlus

    ... information on cancer prevention, detection, genetics, treatment, supportive care, and complementary and alternative medicine. Most summaries come in two versions. The health professional versions ...

  13. Nutraceutical use in late-stage cancer

    PubMed Central

    Morris, Jay; Brown, Vondina; Ellis, Jane; Logothetis, Britt; Weber, Rebecca

    2012-01-01

    Access to a wealth of information on the internet has led many cancer patients to use complementary methods as an adjunct to traditional therapy for cancer, with, and more often, without informing their primary caregiver. Of the common complementary modalities, the use of dietary supplements appears to be highly prevalent in patients in active treatment for cancer, and later in cancer survivors. Emerging research suggests that some plant-based agents may, indeed, impact late-stage cancer, influencing molecular processes corrupted by tumor cells to evade detection, expand clonally, and invade surrounding tissues. The intent of this article is to review some of the current science underpinning the use of nutraceuticals in the latter stages of cancer. PMID:20714787

  14. Parental attitudes toward pediatric use of complementary/alternative medicine in Turkey.

    PubMed

    Ustuner Top, Fadime; Konuk Sener, Dilek; Cangur, Sengul

    2017-07-01

    This study was conducted to determine the pediatric usage of complementary/alternative medicine (CAM) by parents in Turkey, the incidence of using these methods, and the factors affecting their use. The sectional and relational design of the study included a sample of 497 parents who took children for treatment at the Maternity and Children's Hospital in Giresun, Turkey. Data for the study were collected via the Personal Information Form and the Evaluation Form for Complementary/Alternative Treatment Use. The data collection tools were filled out by the researchers during the face-to-face interviews. Data obtained from the study were analyzed by Pearson chi-square, Fisher-Freeman-Halton and Fisher's exact (posthoc Bonferroni) tests and Z-test. It was determined that 97.7% of the parents had used at least one CAM method. Moreover, the parents had used CAM methods mostly for respiratory complaints. The CAM methods were most commonly used for the symptoms of fever, diarrhea, and cough. It was observed that the most commonly used alternative methods in the past were vitamin/mineral remedies, cold treatments, and hodja (Islamic teacher) consultations, while the most common alternative methods currently used are massage, music, and cold treatment. In addition, the differences found between CAM users in terms of sociodemographic characteristics were not statistically significant. It is crucial for nurses to learn the characteristics of the health/disease treatments used by those with whom they work in order to increase the efficiency of the service they provide. Thus, it was recommended that nurses should be knowledgeable and aware of the benefits/side effects, treatment methods, and contraindications of CAM. © 2017 Wiley Periodicals, Inc.

  15. Desorption atmospheric pressure photoionization high-resolution mass spectrometry: a complementary approach for the chemical analysis of atmospheric aerosols.

    PubMed

    Parshintsev, Jevgeni; Vaikkinen, Anu; Lipponen, Katriina; Vrkoslav, Vladimir; Cvačka, Josef; Kostiainen, Risto; Kotiaho, Tapio; Hartonen, Kari; Riekkola, Marja-Liisa; Kauppila, Tiina J

    2015-07-15

    On-line chemical characterization methods of atmospheric aerosols are essential to increase our understanding of physicochemical processes in the atmosphere, and to study biosphere-atmosphere interactions. Several techniques, including aerosol mass spectrometry, are nowadays available, but they all suffer from some disadvantages. In this research, desorption atmospheric pressure photoionization high-resolution (Orbitrap) mass spectrometry (DAPPI-HRMS) is introduced as a complementary technique for the fast analysis of aerosol chemical composition without the need for sample preparation. Atmospheric aerosols from city air were collected on a filter, desorbed in a DAPPI source with a hot stream of toluene and nitrogen, and ionized using a vacuum ultraviolet lamp at atmospheric pressure. To study the applicability of the technique for ambient aerosol analysis, several samples were collected onto filters and analyzed, with the focus being on selected organic acids. To compare the DAPPI-HRMS data with results obtained by an established method, each filter sample was divided into two equal parts, and the second half of the filter was extracted and analyzed by liquid chromatography/mass spectrometry (LC/MS). The DAPPI results agreed with the measured aerosol particle number. In addition to the targeted acids, the LC/MS and DAPPI-HRMS methods were found to detect different compounds, thus providing complementary information about the aerosol samples. DAPPI-HRMS showed several important oxidation products of terpenes, and numerous compounds were tentatively identified. Thanks to the soft ionization, high mass resolution, fast analysis, simplicity and on-line applicability, the proposed methodology has high potential in the field of atmospheric research. Copyright © 2015 John Wiley & Sons, Ltd.

  16. Indigenous food ingredients for complementary food formulations to combat infant malnutrition in Benin: a review.

    PubMed

    Chadare, Flora J; Madode, Yann E; Fanou-Fogny, Nadia; Kindossi, Janvier M; Ayosso, Juvencio Og; Honfo, S Hermann; Kayodé, Ap Polycarpe; Linnemann, Anita R; Hounhouigan, D Joseph

    2018-01-01

    This paper reviews indigenous Beninese food resources as potential ingredients for complementary infant foods with the aim to develop affordable formulations for low-income households in each agro-ecological zone of the country. Potential ingredients were selected on their documented nutritional value. The selected foods encompass 347 food resources, namely 297 plant products from home gardens or collected from natural vegetation and 50 animals, either domesticated or from the wild. The compiled data reveal that the distribution of the available food resources was unbalanced between agro-ecological zones. Only a few animal ingredients are obtainable in northern Benin. Most resources are seasonal, but their availability may be extended. A high variation was observed in energy and nutrient contents. Antinutritional factors were identified in some resources, but processing techniques were reported to reduce their presence in meals. In general, ingredients from local tree foods (Adansonia digitata, Parkia biglobosa) were adequate as sources of nutrients for complementary infant foods. Based on this review, local foods for the development of complementary food formulas for Beninese infants and children may be selected for each agro-ecological zone. The approach used is exemplary for other sub-Saharan African countries in need of complementary infant foods. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  17. Perspectives of Oncology Nurses on Complementary and Alternative Medicine in Turkey: A Cross-Sectional Survey.

    PubMed

    Gok Metin, Zehra; Izgu, Nur; Karadas, Canan; Arikan Donmez, Ayse

    In Turkey, between 22.1% and 84.1% of patients with cancer use complementary and alternative medicine (CAM). However, few CAM-related studies have focused on the perspective of oncology nurses. This study aimed to determine the knowledge, attitudes, and practices of Turkish oncology nurses regarding CAM. A descriptive cross-sectional survey of 127 participants was conducted in Ankara, Turkey. A semistructured questionnaire including characteristics, knowledge, attitudes, and practices of oncology nurses toward CAM was administered to participants. We found that more than half of nurses (54.0%) surveyed had no information on CAM modalities. Most oncology nurses (81.1%) used audiovisual media sources to obtain CAM information. Many nurses (81.3%) reported not using any CAM in cancer care, and only 26.8% recommended CAM to patients. Most nurses used CAM to accelerate wound healing (19.7%) and to manage symptoms, including constipation and diarrhea (8.8%) and anxiety (7.9%). Music (52.8%), massage (49.6%), and exercise (48.8%) were stated to be beneficial. Important barriers to use CAM for patients with cancer involved a lack of knowledge (60.6%); needing physician approval to apply any CAM methods to patients (52.1%); legal and institutional issues (47.2%); and limited educational, training, or certificate programs (44.1%). There is a need for increased knowledge about CAM by oncology nurses, considering their vital role in symptom management of patients with cancer. This can be achieved through solving legal and institutional problems, structured and comprehensive education/training programs, and the integration of CAM therapy into cancer care guidelines.

  18. Heat Flow and Hydrologic Characteristics at the AND-1B borehole, ANDRILL McMurdo Ice Shelf Project, Antarctica

    USGS Publications Warehouse

    Morin, Roger H.; Williams, Trevor; Henry, Stuart; ,; Hansaraj, Dhiresh

    2010-01-01

    The Antarctic Drilling Program (ANDRILL) successfully drilled and cored a borehole, AND-1B, beneath the McMurdo Ice Shelf and into a flexural moat basin that surrounds Ross Island. Total drilling depth reached 1285 m below seafloor (mbsf) with 98 percent core recovery for the detailed study of glacier dynamics. With the goal of obtaining complementary information regarding heat flow and permeability, which is vital to understanding the nature of marine hydrogeologic systems, a succession of three temperature logs was recorded over a five-day span to monitor the gradual thermal recovery toward equilibrium conditions. These data were extrapolated to true, undisturbed temperatures, and they define a linear geothermal gradient of 76.7 K/km from the seafloor to 647 mbsf. Bulk thermal conductivities of the sedimentary rocks were derived from empirical mixing models and density measurements performed on core, and an average value of 1.5 W/mK ± 10 percent was determined. The corresponding estimate of heat flow at this site is 115 mW/m2. This value is relatively high but is consistent with other elevated heat-flow data associated with the Erebus Volcanic Province. Information regarding the origin and frequency of pathways for subsurface fluid flow is gleaned from drillers' records, complementary geophysical logs, and core descriptions. Only two prominent permeable zones are identified and these correspond to two markedly different features within the rift basin; one is a distinct lithostratigraphic subunit consisting of a thin lava flow and the other is a heavily fractured interval within a single thick subunit.

  19. Nurses’ Knowledge and Attitudes toward Complementary Therapies for Cancer: A Review of the Literature

    PubMed Central

    Christina, Juliana; Abigail, Wendy; Cuthbertson, Lesley A.

    2016-01-01

    Complementary therapies (CTs) are nonconventional supportive therapies, which are used by the patients with cancer. The use of CTs has been known to alleviate symptoms as a result of chemotherapy and to improve quality of life. However, if CTs are inappropriately used, there may be adverse reactions or no effect resulting in poor support of the cancer treatment. Nurses play an important role in supporting patients with cancer who often seek information regarding CTs. Within their scope of practice, it is expected that nurses have sufficient knowledge about the safety and effective use of CTs, and positive attitudes toward supporting patients who wish to use CTs. This review aims to examine existing literature regarding nurses’ knowledge and attitudes toward CTs for patients with cancer. English language articles obtained from recognized nursing and midwifery databases such as CINAHL, Google Scholar, Medline, ProQuest Central, and Scopus for the period between 2002 and 2015 were searched. A total of 96 articles were retrieved using the search terms with only 13 eligible articles meeting the inclusion criteria. Three major themes were identified by the thematic analysis of reviewed studies: nurses’ knowledge about CTs, nurses’ attitudes toward CTs, and sources information about CTs. The majority of studies investigating nurses’ knowledge and attitudes toward the use of CTs for oncology was conducted in developed countries. Overall, it was identified that nurses need to improve their knowledge and skills about CTs so that they were more confident to assist patients in integrating conventional treatment and CTs for cancer management. PMID:27981167

  20. Nurses' Knowledge and Attitudes toward Complementary Therapies for Cancer: A Review of the Literature.

    PubMed

    Christina, Juliana; Abigail, Wendy; Cuthbertson, Lesley A

    2016-01-01

    Complementary therapies (CTs) are nonconventional supportive therapies, which are used by the patients with cancer. The use of CTs has been known to alleviate symptoms as a result of chemotherapy and to improve quality of life. However, if CTs are inappropriately used, there may be adverse reactions or no effect resulting in poor support of the cancer treatment. Nurses play an important role in supporting patients with cancer who often seek information regarding CTs. Within their scope of practice, it is expected that nurses have sufficient knowledge about the safety and effective use of CTs, and positive attitudes toward supporting patients who wish to use CTs. This review aims to examine existing literature regarding nurses' knowledge and attitudes toward CTs for patients with cancer. English language articles obtained from recognized nursing and midwifery databases such as CINAHL, Google Scholar, Medline, ProQuest Central, and Scopus for the period between 2002 and 2015 were searched. A total of 96 articles were retrieved using the search terms with only 13 eligible articles meeting the inclusion criteria. Three major themes were identified by the thematic analysis of reviewed studies: nurses' knowledge about CTs, nurses' attitudes toward CTs, and sources information about CTs. The majority of studies investigating nurses' knowledge and attitudes toward the use of CTs for oncology was conducted in developed countries. Overall, it was identified that nurses need to improve their knowledge and skills about CTs so that they were more confident to assist patients in integrating conventional treatment and CTs for cancer management.

  1. Modelling large scale human activity in San Francisco

    NASA Astrophysics Data System (ADS)

    Gonzalez, Marta

    2010-03-01

    Diverse group of people with a wide variety of schedules, activities and travel needs compose our cities nowadays. This represents a big challenge for modeling travel behaviors in urban environments; those models are of crucial interest for a wide variety of applications such as traffic forecasting, spreading of viruses, or measuring human exposure to air pollutants. The traditional means to obtain knowledge about travel behavior is limited to surveys on travel journeys. The obtained information is based in questionnaires that are usually costly to implement and with intrinsic limitations to cover large number of individuals and some problems of reliability. Using mobile phone data, we explore the basic characteristics of a model of human travel: The distribution of agents is proportional to the population density of a given region, and each agent has a characteristic trajectory size contain information on frequency of visits to different locations. Additionally we use a complementary data set given by smart subway fare cards offering us information about the exact time of each passenger getting in or getting out of the subway station and the coordinates of it. This allows us to uncover the temporal aspects of the mobility. Since we have the actual time and place of individual's origin and destination we can understand the temporal patterns in each visited location with further details. Integrating two described data set we provide a dynamical model of human travels that incorporates different aspects observed empirically.

  2. Complexes of mismatched and complementary DNA with minor groove binders. Structures at nucleotide resolution via an improved hydroxyl radical cleavage methodology

    PubMed Central

    Bialonska, Dobroslawa; Song, Kenneth; Bolton, Philip H.

    2011-01-01

    Tumor cell lines can replicate faster than normal cells and many also have defective DNA repair pathways. This has lead to the investigation of the inhibition of DNA repair proteins as a means of therapeutic intervention. An alternative approach is to hide or mask damaged DNA from the repair systems. We have developed a protocol to investigate the structures of the complexes of damaged DNA with drug like molecules. Nucleotide resolution structural information can be obtained using an improved hydroxyl radical cleavage protocol. The use of a dTn tail increases the length of the smallest fragments of interest and allows efficient co-precipitation of the fragments with poly(A). The use of a fluorescent label, on the 5′ end of the dTn tail, in conjunction with modified cleavage reaction conditions, avoids the lifetime and other problems with 32P labeling. The structures of duplex DNAs containing AC and CC mismatches in the presence and absence of minor groove binders have been investigated as have those of the fully complementary DNA. The results indicate that the structural perturbations of the mismatches are localized, are sequence dependent and that the presence of a mismatch can alter the binding of drug like molecules. PMID:21893212

  3. Contour metrology using critical dimension atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Orji, Ndubuisi G.; Dixson, Ronald G.; Vladár, András E.; Ming, Bin; Postek, Michael T.

    2012-03-01

    The critical dimension atomic force microscope (CD-AFM), which is used as a reference instrument in lithography metrology, has been proposed as a complementary instrument for contour measurement and verification. Although data from CD-AFM is inherently three dimensional, the planar two-dimensional data required for contour metrology is not easily extracted from the top-down CD-AFM data. This is largely due to the limitations of the CD-AFM method for controlling the tip position and scanning. We describe scanning techniques and profile extraction methods to obtain contours from CD-AFM data. We also describe how we validated our technique, and explain some of its limitations. Potential sources of error for this approach are described, and a rigorous uncertainty model is presented. Our objective is to show which data acquisition and analysis methods could yield optimum contour information while preserving some of the strengths of CD-AFM metrology. We present comparison of contours extracted using our technique to those obtained from the scanning electron microscope (SEM), and the helium ion microscope (HIM).

  4. Probing the Conformational Landscape of Polyether Building Blocks in Supersonic Jets

    NASA Astrophysics Data System (ADS)

    Bocklitz, Sebastian; Hewett, Daniel M.; Zwier, Timothy S.; Suhm, Martin A.

    2016-06-01

    Polyethylene oxides (Polyethylene glycoles) and their phenoxy-capped analogs represent a prominent class of important polymers that are highly used as precursor molecules in supramolecular reactions. After a detailed study on the simplest representative (1,2-dimethoxyethane) [1], we present results on oligoethylene oxides with increasing chain lengths obtained by spontaneous Raman scattering in a supersonic jet. Through variation of stagnation pressure, carrier gas, nozzle distance and temperature we gain information on the conformational landscape as well as the mutual interconversion of low energy conformers. The obtained results are compared to state-of-the-art quantum chemical calculations. Additionally, we present UV as well as IR-UV and UV-UV double resonance studies on 1-methoxy-2-phenoxyethane in a supersonic jet. These complementary techniques allow for conformationally selective electronic and vibrational spectra in a closely related conformational landscape. [1] S. Bocklitz, M. A. Suhm, Constraining the Conformational Landscape of a Polyether Building Block by Raman Jet Spectroscopy, Z. Phys. Chem. 2015, 229, 1625-1648.

  5. Intraoperative assisting diagnosis of esophageal submucosal cancer using multiphoton microscopy

    NASA Astrophysics Data System (ADS)

    Zeng, Yaping; Xu, Jian; Zhou, Qun; Kang, Deyong; Zhuo, Shuangmu; Zhu, Xiaoqin; Lin, Jiangbo; Chen, Jianxin

    2018-07-01

    Multiphoton microscopy (MPM) based on two-photon excited fluorescence and second harmonic generation can achieve high-resolution images of biological tissues at the cellular and subcellular levels. In this work, we used MPM imaging of intraoperative hematoxylin and eosin (H&E)-stained frozen sections (FSs) of esophagus to explore whether MPM can provide complementary information to the auxiliary diagnosis of esophageal submucosal cancer during the intraoperative period. It was found that MPM has the ability not only to clearly reveal biological tissue microstructure and its morphological changes, but can reveal information not distinguishable in H&E-stained images. The complementary information of nonlinear spectral analysis, orientation and morphology changes in the collagen showed that MPM has important accessory diagnostic value for the differential diagnosis of submucosal carcinoma of the esophagus during the intraoperative period.

  6. 78 FR 5807 - Agency Information Collection Activities: Proposed Collection; Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-28

    ... employ the complementary quantitative and qualitative methods of previous research. The combination of... DEPARTMENT OF HEALTH AND HUMAN SERVICES Agency for Healthcare Research and Quality Agency Information Collection Activities: Proposed Collection; Comment Request AGENCY: Agency for Healthcare Research...

  7. Three dimensional-stacked complementary thin-film transistors using n-type Al:ZnO and p-type NiO thin-film transistors.

    PubMed

    Lee, Ching-Ting; Chen, Chia-Chi; Lee, Hsin-Ying

    2018-03-05

    The three dimensional inverters were fabricated using novel complementary structure of stacked bottom n-type aluminum-doped zinc oxide (Al:ZnO) thin-film transistor and top p-type nickel oxide (NiO) thin-film transistor. When the inverter operated at the direct voltage (V DD ) of 10 V and the input voltage from 0 V to 10 V, the obtained high performances included the output swing of 9.9 V, the high noise margin of 2.7 V, and the low noise margin of 2.2 V. Furthermore, the high performances of unskenwed inverter were demonstrated by using the novel complementary structure of the stacked n-type Al:ZnO thin-film transistor and p-type nickel oxide (NiO) thin-film transistor.

  8. Treatment Option Overview (Endometrial Cancer)

    MedlinePlus

    ... information on cancer prevention, detection, genetics, treatment, supportive care, and complementary and alternative medicine. Most summaries come in two versions. The health professional versions ...

  9. Linkage and Branch Analysis of High-Mannose Oligosaccharides Using Closed-Ring Labeling of 8-Aminopyrene-1,3,6-Trisulfonate and P-Aminobenzoic Ethyl Ester and Negative Ion Trap Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Chen, Shu-Ting; Her, Guor-Rong

    2012-08-01

    A strategy based on negative ion electrospray ionization tandem mass spectrometry and closed-ring labeling with both 8-aminopyrene-1,3,6-trisulfonate (APTS) and p-aminobenzoic acid ethyl ester (ABEE) was developed for linkage and branch determination of high-mannose oligosaccharides. X-type cross-ring fragment ions obtained from APTS-labeled oligosaccharides by charge remote fragmentation provided information on linkages near the non-reducing terminus. In contrast, A-type cross-ring fragment ions observed from ABEE-labeled oligosaccharides yielded information on linkages near the reducing terminus. This complementary information provided by APTS- and ABEE-labeled oligosaccharides was utilized to delineate the structures of the high-mannose oligosaccharides. As a demonstration of this approach, the linkages and branches of high-mannose oligosaccharides Man5GlcNAc2, Man6GlcNAc2, Man8GlcNAc2, and Man9GlcNAc2 cleaved from the ribonuclease B were assigned from MS2 spectra of ABEE- and APTS-labeled derivatives.

  10. GeneStoryTeller: a mobile app for quick and comprehensive information retrieval of human genes.

    PubMed

    Eleftheriou, Stergiani V; Bourdakou, Marilena M; Athanasiadis, Emmanouil I; Spyrou, George M

    2015-01-01

    In the last few years, mobile devices such as smartphones and tablets have become an integral part of everyday life, due to their software/hardware rapid development, as well as the increased portability they offer. Nevertheless, up to now, only few Apps have been developed in the field of bioinformatics, capable to perform fast and robust access to services. We have developed the GeneStoryTeller, a mobile application for Android platforms, where users are able to instantly retrieve information regarding any recorded human gene, derived from eight publicly available databases, as a summary story. Complementary information regarding gene-drugs interactions, functional annotation and disease associations for each selected gene is also provided in the gene story. The most challenging part during the development of the GeneStoryTeller was to keep balance between storing data locally within the app and obtaining the updated content dynamically via a network connection. This was accomplished with the implementation of an administrative site where data are curated and synchronized with the application requiring a minimum human intervention. © The Author(s) 2015. Published by Oxford University Press.

  11. Investigation of InP/InGaAs metamorphic co-integrated complementary doping-channel field-effect transistors for logic application

    NASA Astrophysics Data System (ADS)

    Tsai, Jung-Hui

    2014-01-01

    DC performance of InP/InGaAs metamorphic co-integrated complementary doping-channel field-effect transistors (DCFETs) grown on a low-cost GaAs substrate is first demonstrated. In the complementary DCFETs, the n-channel device was fabricated on the InxGa1-xP metamorphic linearly graded buffer layer and the p-channel field-effect transistor was stacked on the top of the n-channel device. Particularly, the saturation voltage of the n-channel device is substantially reduced to decrease the VOL and VIH values attributed that two-dimensional electron gas is formed and could be modulated in the n-InGaAs channel. Experimentally, a maximum extrinsic transconductance of 215 (17) mS/mm and a maximum saturation current density of 43 (-27) mA/mm are obtained in the n-channel (p-channel) device. Furthermore, the noise margins NMH and NML are up to 0.842 and 0.330 V at a supply voltage of 1.5 V in the complementary logic inverter application.

  12. Purification and characterization of complement-activating acidic polysaccharides from the fruits of Capsicum annuum.

    PubMed

    Paik, Soon-Young; Ra, Kyung Soo; Chang, In Seop; Park, Yoon Chang; Park, Hee Sung; Baik, Hyung Suk; Yun, Jong Won; Choi, Jang Won

    2003-03-31

    Hot water-soluble crude polysaccharide (HCAP-0) that was obtained from the fruits of Capsicum annuum showed potent anti-complementary activity. The activity was unchanged by pronase digestion, but decreased by periodate oxidation. The HCAP-0 was fractionated by DEAE ion-exchange chromatography to give two major fractions, HCAP-II and III. These two fractions were finally purified by gel filtration to give HCAP-IIa, HCAPIIIa1, and IIIa2 fractions that had high anti-complementary activities. The HCAP-IIIa1 and IIIa2 consisted of homogeneous polysaccharides. The anti-complementary activities were unaffected by treatment with polymyxin B, indicating that the modes of complement activation were not due to preexisting lipopolysaccharide. The molecular weight and sugar content of HCAP-IIIa2 had potent anti-complementary activity. The highest yields were 55 kDa and 75.9%, and the molar ratio of galactose (Ara:Gal, 1.0:4.6) was higher than other sugars. The crossed immuno-electrophoresis showed that both classical and alternative pathways were activated by HCAP-IIIa2.

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Timmermans, F. J.; Otto, C.

    New developments in the field of microscopy enable to acquire increasing amounts of information from large sample areas and at an increased resolution. Depending on the nature of the technique, the information may reveal morphological, structural, chemical, and still other sample characteristics. In research fields, such as cell biology and materials science, there is an increasing demand to correlate these individual levels of information and in this way to obtain a better understanding of sample preparation and specific sample properties. To address this need, integrated systems were developed that combine nanometer resolution electron microscopes with optical microscopes, which produce chemicallymore » or label specific information through spectroscopy. The complementary information from electron microscopy and light microscopy presents an opportunity to investigate a broad range of sample properties in a correlated fashion. An important part of correlating the differences in information lies in bridging the different resolution and image contrast features. The trend to analyse samples using multiple correlated microscopes has resulted in a new research field. Current research is focused, for instance, on (a) the investigation of samples with nanometer scale distribution of inorganic and organic materials, (b) live cell analysis combined with electron microscopy, and (c) in situ spectroscopic and electron microscopy analysis of catalytic materials, but more areas will benefit from integrated correlative microscopy.« less

  14. Contributed review: Review of integrated correlative light and electron microscopy.

    PubMed

    Timmermans, F J; Otto, C

    2015-01-01

    New developments in the field of microscopy enable to acquire increasing amounts of information from large sample areas and at an increased resolution. Depending on the nature of the technique, the information may reveal morphological, structural, chemical, and still other sample characteristics. In research fields, such as cell biology and materials science, there is an increasing demand to correlate these individual levels of information and in this way to obtain a better understanding of sample preparation and specific sample properties. To address this need, integrated systems were developed that combine nanometer resolution electron microscopes with optical microscopes, which produce chemically or label specific information through spectroscopy. The complementary information from electron microscopy and light microscopy presents an opportunity to investigate a broad range of sample properties in a correlated fashion. An important part of correlating the differences in information lies in bridging the different resolution and image contrast features. The trend to analyse samples using multiple correlated microscopes has resulted in a new research field. Current research is focused, for instance, on (a) the investigation of samples with nanometer scale distribution of inorganic and organic materials, (b) live cell analysis combined with electron microscopy, and (c) in situ spectroscopic and electron microscopy analysis of catalytic materials, but more areas will benefit from integrated correlative microscopy.

  15. Complementary feeding recommendations based on locally available foods in Indonesia.

    PubMed

    Fahmida, Umi; Santika, Otte; Kolopaking, Risatianti; Ferguson, Elaine

    2014-12-01

    Affordable, locally contextual complementary feeding recommendations (CFRs) that take into account cultural diversity and differences in food availability will be more likely to result in long-term improvements in complementary feeding practices than general recommendations. More objective approaches, such as linear programming (LP), have been recommended to identify optimal but CFRs to meet nutrient requirements given local food availability, food patterns, food portions, and cost. To present results of our previous studies in which we developed CFRs using LP and to provide an example of how these CFRs can be put into practice in a community intervention trial in Indonesia. Dietary data were obtained using single 24-hour dietary recall or 1-day weighed diet record combined with 1-day 24-hour recall and 5-day food intake tally. With the use of the LP approach, nutrient intakes were optimized while ensuring that a realistic diet was selected by using constraints such as the diet's energy content, food patterns, food portions, and cost. The price per 100 g of edible portion was obtained from market surveys in two or three local markets in each study area. LP analysis was performed using Super Solver in MS Excel or Optifood software. Iron, zinc, calcium, and niacin were problem nutrients in all age groups of children (6 to 8, 9 to 11, and 12 to 23 months) in both rural and periurban areas, except among children of higher socioeconomic status in urban areas. Thiamin and folate were also problem nutrients found in some settings. Animal-source foods (meat, fish, poultry, and eggs [MFPE] and fortified foods were the nutrient-dense foods identified by LP to fill the nutrient gaps of these problem nutrients. Iron, calcium, zinc, niacin, and potentially folate and thiamine are typical "problem nutrients" in complementary foods of Indonesian children. However, the extent of dietary inadequacy varies across age groups, area, and socioeconomic level. MFPE and fortified foods can improve micronutrient adequacy in complementary feeding diets and should be promoted in CFRs.

  16. Breastfeeding, Infant Formula, and Introduction to Complementary Foods-Comparing Data Obtained by Questionnaires and Health Visitors' Reports to Weekly Short Message Service Text Messages.

    PubMed

    Bruun, Signe; Buhl, Susanne; Husby, Steffen; Jacobsen, Lotte Neergaard; Michaelsen, Kim F; Sørensen, Jan; Zachariassen, Gitte

    2017-11-01

    Studies on prevalence and effects of breastfeeding call for reliable and precise data collection to optimize infant nutrition, growth, and health. Data on breastfeeding and infant nutrition are at risk of, for example, recall bias or social desirability bias. The aim of the present analysis was to compare data on infant nutrition, that is, breastfeeding, use of infant formula, and introduction to complementary foods, obtained by four different methods. We assumed that weekly short message service (SMS) questions were the most reliable method, to which the other methods were compared. The study population was part of the Odense Child Cohort. The four methods used were: (a) self-administered questionnaire 3 months postpartum, (b) self-administered questionnaire 18 months postpartum, (c) registrations from health visitors visiting the families several times within the first year of life, and (d) weekly SMS questions introduced shortly after birth. In total, 639 singleton mothers with data from all four methods were included. The proportion of mothers initiating breastfeeding varied from 86% to 97%, the mean duration of exclusive breastfeeding from 12 to 19 weeks, and the mean age when introduced to complementary foods from 19 to 21 weeks. The mean duration of any breastfeeding was 33 weeks across methods. Compared with the weekly SMS questions, the self-administered questionnaires and the health visitors' reports resulted in a greater proportion of mothers with an unknown breastfeeding status, a longer duration of exclusive breastfeeding and later introduction to complementary foods, while the duration of any breastfeeding did not differ.

  17. Treatment Options by Stage (Endometrial Cancer)

    MedlinePlus

    ... information on cancer prevention, detection, genetics, treatment, supportive care, and complementary and alternative medicine. Most summaries come in two versions. The health professional versions ...

  18. Complementary health insurance in France. Who pays? Why? Who will suffer from public disengagement?

    PubMed

    Saliba, Bérengère; Ventelou, Bruno

    2007-05-01

    The study is based on a rare database with information about health status, socioeconomic characteristics and the complementary health insurance choices of the French population. We intend to characterise a two-stage decision process: first, the decision to purchase complementary health insurance, and then the factors related to choice of policy quality. Our econometric study indicates that (i) income level has a strong and significant effect on the decision to purchase complementary insurance, whilst there is no evidence that health risk considerations affect this decision at all; (ii) the individual decision about quality is associated barely if at all with any rational explanatory variables. The population's concrete behaviour, revealed by the study, is consistent with an allocation of low-risk people to private insurance and high-risk people to public insurance. Complementary insurance is not especially relevant to patients with serious diseases, who depend much more on the public system. If the public insurance system were to disengage significantly from coverage of serious illness, a vacuum would be created that would leave people at high risk without full coverage. These results have broad implications for numerous national systems of social protection seeking a new mix between private and public insurance.

  19. Yoga as a Complementary Therapy for Children and Adolescents

    PubMed Central

    Peterson, John; Fischer, Colleen; Peterson, Emily

    2010-01-01

    Yoga is being used by a growing number of youth and adults as a means of improving overall health and fitness. There is also a progressive trend toward use of yoga as a mind-body complementary and alternative medicine intervention to improve specific physical and mental health conditions. To provide clinicians with therapeutically useful information about yoga, the evidence evaluating yoga as an effective intervention for children and adolescents with health problems is reviewed and summarized. A brief overview of yoga and yoga therapy is presented along with yoga resources and practical strategies for clinical practitioners to use with their patients. The majority of available studies with children and adolescents suggest benefits to using yoga as a therapeutic intervention and show very few adverse effects. These results must be interpreted as preliminary findings because many of the studies have methodological limitations that prevent strong conclusions from being drawn. Yoga appears promising as a complementary therapy for children and adolescents. Further information about how to apply it most effectively and more coordinated research efforts are needed. PMID:20877530

  20. Shape measurement of objects with large discontinuities and surface isolations using complementary grating projection

    NASA Astrophysics Data System (ADS)

    Hao, Yudong; Zhao, Yang; Li, Dacheng

    1999-11-01

    Grating projection 3D profilometry has three major problems that have to be handled with great care. They are local shadows, phase discontinuities and surface isolations. Carrying no information, shadow areas give us no clue about the profile there. Phase discontinuities often baffle phase unwrappers because they may be generated for several reasons difficult to distinguish. Spatial phase unwrapping will inevitably fail if the object under teste have surface isolations. In this paper, a complementary grating projection profilometry is reported, which attempts to tackle the three aforementioned problems simultaneously. This technique involves projecting two grating patterns form both sides of the CCD camera. Phase unwrapping is carried out pixel by pixel using the two phase maps based on the excess fraction method, which is immune to phase discontinuities or surface isolations. Complementary projection makes sure that no area in the visible volume of CCD is devoid of fringe information, although in some cases a small area of the reconstructed profile is of low accuracy compared with others. The system calibration procedures and measurement results are presented in detail, and possible improvement is discussed.

  1. Ground Characterization Studies in Canakkale Pilot Site of LIQUEFACT Project

    NASA Astrophysics Data System (ADS)

    Ozcep, F.; Oztoprak, S.; Aysal, N.; Bozbey, I.; Tezel, O.; Ozer, C.; Sargin, S.; Bekin, E.; Almasraf, M.; Cengiz Cinku, M.; Ozdemir, K.

    2017-12-01

    The our aim is to outline the ground characterisation studies in Canakkale test site. Study is based on the EU H2020 LIQUEFACT project entitled "Liquefact: Assessment and mitigation of liquefaction potential across Europe: a holistic approach to protect structures / infrastructures for improved resilience to earthquake-induced liquefaction disasters". Objectives and extent of ground characterization for Canakkale test site includes pre-existing soil investigation studies and complementary field studies. There were several SPT and geophysical tests carried out in the study area. Within the context of the complementary tests, six (6) study areas in the test site were chosen and complementary tests were carried out in these areas. In these areas, additional boreholes were opened and SPT tests were performed. It was decided that additional CPT (CPTU and SCPT) and Marchetti Dilatometer (DMT) tests should be carried out within the scope of the complementary testing. Seismic refraction, MASW and micro tremor measurements had been carried out in pre-existing studies. Shear wave velocities obtained from MASW measurements were evaluated to the most rigorous level. These tests were downhole seismic, PS-logging, seismic refraction, 2D-ReMi, MASW, micro tremor (H/V Nakamura method), 2D resistivity and resonance acoustic profiling (RAP). RAP is a new technique which will be explained briefly in the relevant section. Dynamic soil properties had not been measured in pre-existing studies, therefore these properties were investigated within the scope of the complementary tests. Selection of specific experimental tests of the complementary campaign was based on cost-benefit considerations Within the context of complementary field studies, dynamic soil properties were measured using resonant column and cyclic direct shear tests. Several sieve analyses and Atterberg Limits tests which were documented in the pre-existing studies were evaluated. In the complementary study carried out, additional sieve analyses and Atterberg Limit tests were carried out. It was aimed to make some correlations between geophysical measurements and other field measurements; such as SPT, blow count values.

  2. A general method for targeted quantitative cross-linking mass spectrometry

    USDA-ARS?s Scientific Manuscript database

    Chemical cross-linking mass spectrometry (XL-MS) provides protein structural information by identifying covalently linked proximal amino acid residues on protein surfaces. The information gained by this technique is complementary to other structural biology methods such as x-ray crystallography, NM...

  3. Resource Interdependence, Student Interactions and Performance in Cooperative Learning

    ERIC Educational Resources Information Center

    Buchs, Celine; Butera, Fabrizio; Mugny, Gabriel

    2004-01-01

    Two studies were carried out during university workshops, and analyzed the effects of resource interdependence on student-student interactions, and the impact of these interactions on performance. Students worked cooperatively, either on complementary information (positive resource interdependence) or on identical information (resource…

  4. Automatic registration of optical imagery with 3d lidar data using local combined mutual information

    NASA Astrophysics Data System (ADS)

    Parmehr, E. G.; Fraser, C. S.; Zhang, C.; Leach, J.

    2013-10-01

    Automatic registration of multi-sensor data is a basic step in data fusion for photogrammetric and remote sensing applications. The effectiveness of intensity-based methods such as Mutual Information (MI) for automated registration of multi-sensor image has been previously reported for medical and remote sensing applications. In this paper, a new multivariable MI approach that exploits complementary information of inherently registered LiDAR DSM and intensity data to improve the robustness of registering optical imagery and LiDAR point cloud, is presented. LiDAR DSM and intensity information has been utilised in measuring the similarity of LiDAR and optical imagery via the Combined MI. An effective histogramming technique is adopted to facilitate estimation of a 3D probability density function (pdf). In addition, a local similarity measure is introduced to decrease the complexity of optimisation at higher dimensions and computation cost. Therefore, the reliability of registration is improved due to the use of redundant observations of similarity. The performance of the proposed method for registration of satellite and aerial images with LiDAR data in urban and rural areas is experimentally evaluated and the results obtained are discussed.

  5. Rosacea Patient Perspectives on Homeopathic and Over-the-counter Therapies

    PubMed Central

    Lan, Lucy; Kuo, Sandy; Huang, Karen E.; Taylor, Sarah L.; Feldman, Steven R.

    2015-01-01

    Background: Rosacea patients commonly employ nonprescription therapies. The authors’ aim was to understand rosacea patients’ perceptions of over-the-counter products, complementary and alternative medicine, and homeopathic therapies. Method: A public, online discussion forum comprising 3,350 members and 27,051 posts provided a source of 346 posts on patient perceptions on alternative rosacea treatments. Results: Three major themes of nonprescription treatment were identified—motivation for use, patient-provider discussions, and experience with these treatments. Perceived medication failure, barriers to treatment, and distrust of physicians drive patients to seek nonprescription therapies. Still, patients prefer to consult a physician on incorporating nonprescription therapies into treatment. Complementary and alternative medicine natural products (19.4% of posts), complementary and alternative medicine practices (16.5%), and homeopathic medicine (3.8%) were commonly discussed. Conclusion: Physicians have an opportunity to be a trusted source of information on the strengths and weaknesses of skin care products and other complementary treatments for rosacea. PMID:26557217

  6. Legislation should support optimal breastfeeding practices and access to low-cost, high-quality complementary foods: Indonesia provides a case study.

    PubMed

    Soekarjo, Damayanti; Zehner, Elizabeth

    2011-10-01

    It is important to support women to exclusively breastfeed for 6 months and continue breastfeeding for 24 months and beyond. It is also necessary to provide the poor with access to affordable ways to improve the quality of complementary foods. Currently, many countries do not have the legal and policy environment necessary to support exclusive and continued breastfeeding. Legislative and policy changes are also necessary for introducing complementary food supplements, allowing them to be marketed to those who need them, and ensuring that marketing remains appropriate and in full compliance with the International Code of Marketing of Breastmilk Substitutes. This paper aims to illustrate the above with examples from Indonesia and to identify legislative requirements for supporting breastfeeding and enabling appropriate access to high-quality complementary food supplements for children 6-24 months of age. Requirements include improved information, training, monitoring and enforcement systems for the International Code of Marketing of Breastmilk Substitutes; implementation and monitoring of the Baby-Friendly Hospital Initiative; establishment of a registration category for complementary food supplements to enhance availability of high-quality, low-cost fortified products to help improve young child feeding; clear identification and marketing of these products as complementary food supplements for 6-24-month-olds so as to promote proper use and not interfere with breastfeeding. © 2011 Blackwell Publishing Ltd.

  7. Qualitative content analysis of complementary topical therapies used to manage diabetic foot in Jordan.

    PubMed

    Abu-Qamar, Ma'en Zaid; Wilson, Anne

    2012-01-01

    In order to alleviate diabetic foot problems, patients sometimes seek complementary therapies outside the professional context. This paper describes the use of complementary remedies as a topical treatment for diabetic foot ulcers among Jordanians. Qualitative content analysis was used to analyse written responses of 68 patients with diabetes who have used complementary therapies to treat diabetic foot problems. These 68 persons represented a subgroup of the study population surveyed using a questionnaire, to the effect of investigating diabetic foot treatments provided in Jordan. Informants were recruited from eight healthcare facilities established in the southern part of Jordan plus from one hospital established in the Jordanian capital. The study was approved by the Boards of Ethics of the participating healthcare facilities. Content analysis yielded the category "Complementary Therapies Used", which included a range of household items (olive oil, sesame oil, honey, and vinegar), and also some indigenous Jordanian herbs (Wormwood, Myrrh, Caper, and Henna among others). The remedies were used either as a monotherapy or as mixtures, to the common goal of treating diabetic foot problems. Other interventions like Al-cowy were also sought from traditional healers. Educational campaigns are required to increase the awareness of patients and their families on possible hazards of unwise complementary therapy use. The decisions on the use of such therapies should be made in agreement with the attending healthcare professionals.

  8. Complementary and alternative medicine use in children with thalassaemia.

    PubMed

    Efe, Emine; Işler, Ayşegül; Sarvan, Süreyya; Başer, Hayriye; Yeşilipek, Akif

    2013-03-01

    The aims of this study were to: (1) determine the types of complementary and alternative medicine use among children with thalassaemia as reported by parents and (2) describe sociodemographic and medical factors associated with the use of such treatments in families residing in southern Turkey. Thalassaemia is one of the most common human genetic diseases. Despite the therapeutic efforts, patients will encounter a variety of physical and psychological problems. Therefore, the use of complementary and alternative medicines among children thalassaemia is becoming increasingly popular. This is a descriptive study of complementary and alternative medicine. This study was conducted in the Hematology Outpatient Clinic at Akdeniz University Hospital and in the Thalassemia Centre at Ministry of Health Antalya Education and Research Hospital, Antalya, Turkey, between January 2010-December 2010. Parents of 97 paediatric patients, among 125 parents who applied to the haematology outpatient clinic and thalassaemia centre between these dates, agreed to take part in the study with whom contact could be made were included. Data were collected by using a questionnaire. The proportion of parents who reported using one or more of the complementary and alternative medicine methods was 82·5%. Of these parents, 61·8% were using prayer/spiritual practice, 47·4% were using nutritional supplements and 35·1% were using animal materials. It was determined that a significant portion of the parents using complementary and alternative medicine use it to treat their children's health problems, they were informed about complementary and alternative medicine by their paediatricians and family elders, and they have discussed the use of complementary and alternative medicine with healthcare professionals. To sustain medical treatment and prognosis of thalassaemia, it is important for nurses to consult with their patients and parents regarding the use and potential risks of some complementary and alternative medicine. © 2012 Blackwell Publishing Ltd.

  9. Social networks lack useful content for incontinence.

    PubMed

    Sajadi, Kamran P; Goldman, Howard B

    2011-10-01

    To assess the incontinence resources readily available for patients among social networks. Social networks allow users to connect with each other and share content and are a widely popular resource on the Internet. These sites attract millions of users; however, social media are underused in the healthcare industry. A search for "incontinence" was performed on Facebook, Twitter, and YouTube in September 2010. The first 30 results were reviewed for each. The results were evaluated as useful or not useful and additionally catalogued as healthcare professionals, commercial products, or complementary and alternative medicine resources. On Facebook, 4 results (13%) were informative, 12 (40%) advertised commercial incontinence products, and 14 (47%) had no usable information. Of the live "tweets" reviewed on Twitter, 18 (60%) linked to incontinence-related healthcare information (none were from, or referred one to, healthcare professionals), 9 (30%) advertised for commercial incontinence products, 1 (3%) advertised complementary and alternative medicine resources, and 2 (7%) were humorous. Of 4 Twitter user results, 1 was comic, 1 provided incontinence-related health information, and 2 were incontinence medical supply companies. There were 14 (47%) informational YouTube videos, of which 9 came from healthcare professionals or professional organizations. Of the remainder, 12 (40%) were commercial, 1 (3%) advertised complementary and alternative medicine resources, and the remaining 3 (10%) were not useful. The results of our study show that social networks have insufficient useful incontinence content, especially from healthcare professionals and incontinence organizations. Medical professionals and societies should target these avenues to reach and educate patients. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Complementary and alternative medicine and supportive care at leading cancer centers: a systematic analysis of websites.

    PubMed

    Brauer, Jeremy A; El Sehamy, Adam; Metz, James M; Mao, Jun J

    2010-02-01

    With increasing frequency, patients with cancer and their family members are turning to the Internet to educate themselves about their disease and treatment options, including complementary and alternative medicine (CAM) and supportive care. However, very little is known about how national leading cancer centers represent these therapies via their websites. Simulating the perspective of an information-seeking patient or family member, we performed a systematic analysis of the websites of 41 National Cancer Institute designated comprehensive cancer centers. Two researchers independently evaluated websites, recorded CAM information, and rated quality of the websites using a 4-item Likert scale (overall, information, presentation, and navigation) with Cronbach's alpha = 0.97. Rating was adequately correlated between the two raters (correlation coefficient 0.8). Of 41 centers, 12 (29%) did not have functional websites with regard to information related to CAM. The most common CAM approaches mentioned were: acupuncture (59%), meditation/nutrition/spiritual support/yoga (56% for each), massage therapy (54%), and music therapy (51%). Twenty-three (23; 56%) presented information on support groups, 19 (46%) on patient seminars, 18 (44%) on survivorship effort, and 17 (41%) on symptom management clinics. Twenty-nine (29) (71%) of these websites had a telephone number available, 22 (54%) mentioned at least one ongoing research opportunity, and 19 (46%) provided links to the National Center for Complementary and Alternative Medicine website. Median rating of the quality of websites was 50 of 100, with only 7 (17%) of centers receiving a composite score 80 (excellent) or better. While a growing number of leading cancer centers provide information about CAM and supportive oncology information for patients via their websites, the quality and ease of navigation of these sites remain highly variable. Effective development and redesign of many of the websites is needed to better inform and empower patients and families seeking CAM and supportive care information.

  11. Hybrid single-source online Fourier transform coherent anti-Stokes Raman scattering/optical coherence tomography.

    PubMed

    Kamali, Tschackad; Považay, Boris; Kumar, Sunil; Silberberg, Yaron; Hermann, Boris; Werkmeister, René; Drexler, Wolfgang; Unterhuber, Angelika

    2014-10-01

    We demonstrate a multimodal optical coherence tomography (OCT) and online Fourier transform coherent anti-Stokes Raman scattering (FTCARS) platform using a single sub-12 femtosecond (fs) Ti:sapphire laser enabling simultaneous extraction of structural and chemical ("morphomolecular") information of biological samples. Spectral domain OCT prescreens the specimen providing a fast ultrahigh (4×12  μm axial and transverse) resolution wide field morphologic overview. Additional complementary intrinsic molecular information is obtained by zooming into regions of interest for fast label-free chemical mapping with online FTCARS spectroscopy. Background-free CARS is based on a Michelson interferometer in combination with a highly linear piezo stage, which allows for quick point-to-point extraction of CARS spectra in the fingerprint region in less than 125 ms with a resolution better than 4  cm(-1) without the need for averaging. OCT morphology and CARS spectral maps indicating phosphate and carbonate bond vibrations from human bone samples are extracted to demonstrate the performance of this hybrid imaging platform.

  12. Wave-particle dualism and complementarity unraveled by a different mode

    PubMed Central

    Menzel, Ralf; Puhlmann, Dirk; Heuer, Axel; Schleich, Wolfgang P.

    2012-01-01

    The precise knowledge of one of two complementary experimental outcomes prevents us from obtaining complete information about the other one. This formulation of Niels Bohr’s principle of complementarity when applied to the paradigm of wave-particle dualism—that is, to Young’s double-slit experiment—implies that the information about the slit through which a quantum particle has passed erases interference. In the present paper we report a double-slit experiment using two photons created by spontaneous parametric down-conversion where we observe interference in the signal photon despite the fact that we have located it in one of the slits due to its entanglement with the idler photon. This surprising aspect of complementarity comes to light by our special choice of the TEM01 pump mode. According to quantum field theory the signal photon is then in a coherent superposition of two distinct wave vectors giving rise to interference fringes analogous to two mechanical slits. PMID:22628561

  13. Nematodes Relevance in Soil Quality Management and their Significance as Biomarkers in Aquatic Substrates: Review.

    PubMed

    Akpheokhai, Leonard I; Oribhabor, Blessing J

    2016-01-01

    The interaction of man with the ecosystem is a major factor causing environmental pollution and its attendant consequences such as climate change in our world today. Patents relating to nematodes' relevance in soil quality management and their significance as biomarkers in aquatic substrates were reviewed. Nematodes are useful in rapid, easy and inexpensive method for testing the toxicity of substance (e.g. aquatic substrates). This review paper sets out to examine and discuss the issue of soil pollution, functions of nematodes in soil and aquatic substrates as well as bio-indicators in soil health management in terrestrial ecology. The information used were on the basis of secondary sources from previous research. It is abundantly clear that the population dynamics of plant parasitic or free-living nematodes have useful potentials as biomonitor for soil health and other forms of environmental contamination through agricultural activities, industrial pollution and oil spillage, and the analysis of nematode community structure could be used as complementary information obtained from conventional soil testing approaches.

  14. The discrimination of colored acrylic, cotton, and wool textile fibers using micro-Raman spectroscopy. Part 1: in situ detection and characterization of dyes.

    PubMed

    Buzzini, Patrick; Massonnet, Genevieve

    2013-11-01

    Raman spectroscopy has been applied to characterize fiber dyes and determine the discriminating ability of the method. Black, blue, and red acrylic, cotton, and wool samples were analyzed. Four excitation sources were used to obtain complementary responses in the case of fluorescent samples. Fibers that did not provide informative spectra using a given laser were usually detected using another wavelength. For any colored acrylic, the 633-nm laser did not provide Raman information. The 514-nm laser provided the highest discrimination for blue and black cotton, but half of the blue cottons produced noninformative spectra. The 830-nm laser exhibited the highest discrimination for red cotton. Both visible lasers provided the highest discrimination for black and blue wool, and NIR lasers produced remarkable separation for red and black wool. This study shows that the discriminating ability of Raman spectroscopy depends on the fiber type, color, and the laser wavelength. © 2013 American Academy of Forensic Sciences.

  15. Passing messages between biological networks to refine predicted interactions.

    PubMed

    Glass, Kimberly; Huttenhower, Curtis; Quackenbush, John; Yuan, Guo-Cheng

    2013-01-01

    Regulatory network reconstruction is a fundamental problem in computational biology. There are significant limitations to such reconstruction using individual datasets, and increasingly people attempt to construct networks using multiple, independent datasets obtained from complementary sources, but methods for this integration are lacking. We developed PANDA (Passing Attributes between Networks for Data Assimilation), a message-passing model using multiple sources of information to predict regulatory relationships, and used it to integrate protein-protein interaction, gene expression, and sequence motif data to reconstruct genome-wide, condition-specific regulatory networks in yeast as a model. The resulting networks were not only more accurate than those produced using individual data sets and other existing methods, but they also captured information regarding specific biological mechanisms and pathways that were missed using other methodologies. PANDA is scalable to higher eukaryotes, applicable to specific tissue or cell type data and conceptually generalizable to include a variety of regulatory, interaction, expression, and other genome-scale data. An implementation of the PANDA algorithm is available at www.sourceforge.net/projects/panda-net.

  16. Accelerated life testing and temperature dependence of device characteristics in GaAs CHFET devices

    NASA Technical Reports Server (NTRS)

    Gallegos, M.; Leon, R.; Vu, D. T.; Okuno, J.; Johnson, A. S.

    2002-01-01

    Accelerated life testing of GaAs complementary heterojunction field effect transistors (CHFET) was carried out. Temperature dependence of single and synchronous rectifier CHFET device characteristics were also obtained.

  17. Complementarity and Correlations

    NASA Astrophysics Data System (ADS)

    Maccone, Lorenzo; Bruß, Dagmar; Macchiavello, Chiara

    2015-04-01

    We provide an interpretation of entanglement based on classical correlations between measurement outcomes of complementary properties: States that have correlations beyond a certain threshold are entangled. The reverse is not true, however. We also show that, surprisingly, all separable nonclassical states exhibit smaller correlations for complementary observables than some strictly classical states. We use mutual information as a measure of classical correlations, but we conjecture that the first result holds also for other measures (e.g., the Pearson correlation coefficient or the sum of conditional probabilities).

  18. Electronic and structural aspects of spin transitions observed by optical microscopy. The case of [Fe(ptz)6](BF4)2.

    PubMed

    Chong, Christian; Mishra, Haritosh; Boukheddaden, Kamel; Denise, Stéphane; Bouchez, Guillaume; Collet, Eric; Ameline, Jean-Claude; Naik, Anil D; Garcia, Yann; Varret, François

    2010-02-11

    The colorimetric analysis of images recorded with an optical microscope during the onset of the spin crossover transformation allows monitoring separately the involved electronic and structural aspects, through the separation of resonant absorption and scattering effects. Complementary information can also be obtained by using the polarized modes of the microscope. These potentialities are illustrated by the observation of [Fe(ptz)(6)](BF(4))(2) single crystals during the onset of the thermal transitions in the 110-140 K range. We characterized the interplay between the electronic (HS <--> LS) and structural (order <--> disorder) transformations. Elastic stresses and mechanical effects (hopping, self-cleavage) generated by the volume change upon electronic transition are also illustrated, with their impact on the photoswitching properties of the crystals.

  19. Complementary study of molecular dynamics and domain sizes in heterogenous nanocomposites PBT/DA-C{sub 60} and PBT/TCNEO-C{sub 60}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woźniak-Braszak, A., E-mail: abraszak@amu.edu.pl; Baranowski, M.; Jurga, K.

    2014-05-28

    A comprehensive study of molecular dynamics and structure in new heterogenous nanocomposites based on poly(butylene terephthalate) and nanoparticles C{sub 60} modified by n-decylamine or tetracyanoethylene oxide has been performed. The domain structure of new nanocomposites has been investigated by Fourier transform infrared spectroscopy, wide-angle X-ray scattering, and differential scanning calorimetry techniques. Solid-state {sup 1}H NMR techniques were used to study molecular dynamics and domain sizes in new nanocomposites. Information about the electronic properties of these nanocomposites was obtained by means of electron paramagnetic resonance method. It was shown that the structure and molecular dynamics of new nanocomposites were strongly dependentmore » on the properties and concentration of fullerene derivates.« less

  20. Using Imaging Methods to Interrogate Radiation-Induced Cell Signaling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shankaran, Harish; Weber, Thomas J.; Freiin von Neubeck, Claere H.

    2012-04-01

    There is increasing emphasis on the use of systems biology approaches to define radiation induced responses in cells and tissues. Such approaches frequently rely on global screening using various high throughput 'omics' platforms. Although these methods are ideal for obtaining an unbiased overview of cellular responses, they often cannot reflect the inherent heterogeneity of the system or provide detailed spatial information. Additionally, performing such studies with multiple sampling time points can be prohibitively expensive. Imaging provides a complementary method with high spatial and temporal resolution capable of following the dynamics of signaling processes. In this review, we utilize specific examplesmore » to illustrate how imaging approaches have furthered our understanding of radiation induced cellular signaling. Particular emphasis is placed on protein co-localization, and oscillatory and transient signaling dynamics.« less

  1. Experimental evidence of multimaterial jet formation with lasers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nicolaie, Ph.; Stenz, C.; Tikhonchuk, V.

    2010-11-15

    Laser-produced multimaterial jets have been investigated at the Prague Asterix Laser System laser [K. Jungwirth et al., Phys. Plasmas 8, 2495 (2001)]. The method of jet production is based on the laser-plasma ablation process and proved to be easy to set up and robust. The possibility of multimaterial laboratory jet production is demonstrated and complex hydrodynamic flows in the jet body are obtained. Two complementary diagnostics in the optical ray and x-ray ranges provide detailed information about jet characteristics. The latter are in agreement with estimates and two-dimensional radiation hydrodynamic simulation results. The experiment provides a proof of principle thatmore » a velocity field could be produced and controlled in the jet body. It opens a possibility of astrophysical jet structure modeling in laboratory.« less

  2. Double-charming Higgs boson identification using machine-learning assisted jet shapes

    NASA Astrophysics Data System (ADS)

    Lenz, Alexander; Spannowsky, Michael; Tetlalmatzi-Xolocotzi, Gilberto

    2018-01-01

    We study the possibility of identifying a boosted resonance that decays into a charm pair against different sources of background using QCD event shapes, which are promoted to jet shapes. Using a set of jet shapes as input to a boosted decision tree, we find that observables utilizing the simultaneous presence of two charm quarks can access complementary information compared to approaches relying on two independent charm tags. Focusing on Higgs associated production with subsequent H →c c ¯ decay and on a C P -odd scalar A with mA≤10 GeV we obtain the limits B r (H →c c ¯ )≤6.48 % and B r (H →A (→c c ¯ )Z )≤0.01 % at 95% C.L.

  3. On structure-exploiting trust-region regularized nonlinear least squares algorithms for neural-network learning.

    PubMed

    Mizutani, Eiji; Demmel, James W

    2003-01-01

    This paper briefly introduces our numerical linear algebra approaches for solving structured nonlinear least squares problems arising from 'multiple-output' neural-network (NN) models. Our algorithms feature trust-region regularization, and exploit sparsity of either the 'block-angular' residual Jacobian matrix or the 'block-arrow' Gauss-Newton Hessian (or Fisher information matrix in statistical sense) depending on problem scale so as to render a large class of NN-learning algorithms 'efficient' in both memory and operation costs. Using a relatively large real-world nonlinear regression application, we shall explain algorithmic strengths and weaknesses, analyzing simulation results obtained by both direct and iterative trust-region algorithms with two distinct NN models: 'multilayer perceptrons' (MLP) and 'complementary mixtures of MLP-experts' (or neuro-fuzzy modular networks).

  4. Finding My Needle in the Haystack: Effective Personalized Re-ranking of Search Results in Prospector

    NASA Astrophysics Data System (ADS)

    König, Florian; van Velsen, Lex; Paramythis, Alexandros

    This paper provides an overview of Prospector, a personalized Internet meta-search engine, which utilizes a combination of ontological information, ratings-based models of user interests, and complementary theme-oriented group models to recommend (through re-ranking) search results obtained from an underlying search engine. Re-ranking brings “closer to the top” those items that are of particular interest to a user or have high relevance to a given theme. A user-based, real-world evaluation has shown that the system is effective in promoting results of interest, but lags behind Google in user acceptance, possibly due to the absence of features popularized by said search engine. Overall, users would consider employing a personalized search engine to perform searches with terms that require disambiguation and / or contextualization.

  5. iHADAMAC: A complementary tool for sequential resonance assignment of globular and highly disordered proteins

    NASA Astrophysics Data System (ADS)

    Feuerstein, Sophie; Plevin, Michael J.; Willbold, Dieter; Brutscher, Bernhard

    2012-01-01

    An experiment, iHADAMAC, is presented that yields information on the amino-acid type of individual residues in a protein by editing the 1H- 15N correlations into seven different 2D spectra, each corresponding to a different class of amino-acid types. Amino-acid type discrimination is realized via a Hadamard encoding scheme based on four different spin manipulations as recently introduced in the context of the sequential HADAMAC experiment. Both sequential and intra-residue HADAMAC experiments yield highly complementary information that greatly facilitate resonance assignment of proteins with high frequency degeneracy, as demonstrated here for a 188-residue intrinsically disordered protein fragment of the hepatitis C virus protein NS5A.

  6. Nanocrystal-based complementary inverters constructed on flexible plastic substrates.

    PubMed

    Jang, Jaewon; Cho, Kyoungah; Yun, Junggwon; Kim, Sangsig

    2013-05-01

    We demonstrate a nanocrystal (NC)-based complementary inverter constructed on a flexible plastic substrate. The NC-based complementary inverter consists of n-type HgSe NC- and p-type HgTe NC-based thin-film transistors (TFTs). Solid films on a plastic substrate obtained from HgSe and HgTe nanocrystals by thermal transformation are utilized as the n- and p-channel layers in these TFTs, respectively. The electrical properties of these component TFTs on unstrained and strained substrates are characterized and the performance of the inverter on the flexible substrate is investigated. The inverter on the unstrained substrate exhibits a logic gain of about 8, a logic swing of 90%, and a noise margin of 2.0 V. The characteristics of the inverter are changed under tensile and compressive strains, but not very significantly. Moreover, a comparison of the electrical characteristics of the n- and p-channel TFTs and the inverter is made in this paper.

  7. Electron microscopic visualization of complementary labeled DNA with platinum-containing guanine derivative.

    PubMed

    Loukanov, Alexandre; Filipov, Chavdar; Mladenova, Polina; Toshev, Svetlin; Emin, Saim

    2016-04-01

    The object of the present report is to provide a method for a visualization of DNA in TEM by complementary labeling of cytosine with guanine derivative, which contains platinum as contrast-enhanced heavy element. The stretched single-chain DNA was obtained by modifying double-stranded DNA. The labeling method comprises the following steps: (i) stretching and adsorption of DNA on the support film of an electron microscope grid (the hydrophobic carbon film holding negative charged DNA); (ii) complementary labeling of the cytosine bases from the stretched single-stranded DNA pieces on the support film with platinum containing guanine derivative to form base-specific hydrogen bond; and (iii) producing a magnified image of the base-specific labeled DNA. Stretched single-stranded DNA on a support film is obtained by a rapid elongation of DNA pieces on the surface between air and aqueous buffer solution. The attached platinum-containing guanine derivative serves as a high-dense marker and it can be discriminated from the surrounding background of support carbon film and visualized by use of conventional TEM observation at 100 kV accelerated voltage. This method allows examination of specific nucleic macromolecules through atom-by-atom analysis and it is promising way toward future DNA-sequencing or molecular diagnostics of nucleic acids by electron microscopic observation. © 2016 Wiley Periodicals, Inc.

  8. Antagonistic Activity of Lactobacillus plantarum C11: Two New Two-Peptide Bacteriocins, Plantaricins EF and JK, and the Induction Factor Plantaricin A

    PubMed Central

    Anderssen, Erlend L.; Diep, Dzung Bao; Nes, Ingolf F.; Eijsink, Vincent G. H.; Nissen-Meyer, Jon

    1998-01-01

    Six bacteriocinlike peptides (plantaricin A [PlnA], PlnE, PlnF, PlnJ, PlnK, and PlnN) produced by Lactobacillus plantarum C11 were detected by amino acid sequencing and mass spectrometry. Since purification to homogeneity was problematic, all six peptides were obtained by solid-phase peptide synthesis and were tested for bacteriocin activity. It was found that L. plantarum C11 produces two two-peptide bacteriocins (PlnEF and PlnJK); a strain-specific antagonistic activity was detected at nanomolar concentrations when PlnE and PlnF were combined and when PlnJ and PlnK were combined. Complementary peptides were at least 103 times more active when they were combined than when they were present individually, and optimal activity was obtained when the complementary peptides were present in approximately equal amounts. The interaction between complementary peptides was specific, since neither PlnE nor PlnF could complement PlnJ or PlnK, and none of these peptides could complement the peptides constituting the two-peptide bacteriocin lactococcin G. Interestingly, PlnA, which acts as an extracellular signal (pheromone) that triggers bacteriocin production, also possessed a strain-specific antagonistic activity. No bacteriocin activity could be detected for PlnN. PMID:9603847

  9. Decoding 2D-PAGE complex maps: relevance to proteomics.

    PubMed

    Pietrogrande, Maria Chiara; Marchetti, Nicola; Dondi, Francesco; Righetti, Pier Giorgio

    2006-03-20

    This review describes two mathematical approaches useful for decoding the complex signal of 2D-PAGE maps of protein mixtures. These methods are helpful for interpreting the large amount of data of each 2D-PAGE map by extracting all the analytical information hidden therein by spot overlapping. Here the basic theory and application to 2D-PAGE maps are reviewed: the means for extracting information from the experimental data and their relevance to proteomics are discussed. One method is based on the quantitative theory of statistical model of peak overlapping (SMO) using the spot experimental data (intensity and spatial coordinates). The second method is based on the study of the 2D-autocovariance function (2D-ACVF) computed on the experimental digitised map. They are two independent methods that are able to extract equal and complementary information from the 2D-PAGE map. Both methods permit to obtain fundamental information on the sample complexity and the separation performance and to single out ordered patterns present in spot positions: the availability of two independent procedures to compute the same separation parameters is a powerful tool to estimate the reliability of the obtained results. The SMO procedure is an unique tool to quantitatively estimate the degree of spot overlapping present in the map, while the 2D-ACVF method is particularly powerful in simply singling out the presence of order in the spot position from the complexity of the whole 2D map, i.e., spot trains. The procedures were validated by extensive numerical computation on computer-generated maps describing experimental 2D-PAGE gels of protein mixtures. Their applicability to real samples was tested on reference maps obtained from literature sources. The review describes the most relevant information for proteomics: sample complexity, separation performance, overlapping extent, identification of spot trains related to post-translational modifications (PTMs).

  10. BMI, body fat and waist-to-height ratio of stunted v. non-stunted Indian children: a case-control study.

    PubMed

    Savanur, Mitravinda S; Ghugre, Padmini S

    2016-06-01

    To compare the BMI, body fat and waist-to-height ratio (WHtR) of stunted and non-stunted children following different growth trajectories from low socio-economic strata in Mumbai, India. Cross-sectional, case-control study. Weight, height, skinfold thicknesses and waist circumference were measured. Information regarding the duration of breast-feeding, age at initiation of complementary feeding and income was obtained. Birth weight was obtained from records. BMI, body fat, WHtR and change in weight sd were calculated. Children who were beneficiaries of anganwadis, Mumbai city, India. Three hundred and thirty children aged 2-4 years were selected in each of the stunted and non-stunted groups after matching for age and sex. After adjusting for birth weight, change in weight sd, duration of breast-feeding, age at complementary feeding initiation and income, stunted children had significantly higher body fat, WHtR and BMI than the non-stunted (P<0·01). The stunted and non-stunted children were classified based on their change in weight sd. Stunted children with no change in weight sd had higher mean body fat, BMI (P<0·01) and WHtR (P<0·05) than their non-stunted counterparts. In the catch-up growth group, stunted children had higher BMI and WHtR than the non-stunted (both P<0·001). In the catch-down growth group, stunted children had higher BMI than the non-stunted (P<0·001). Stunting was seen to increase the tendency of conserving body fat in young children. Such a tendency, if continued during later childhood and adolescence, can increase the risk of obesity and non-communicable diseases.

  11. A Management Information System Design for a General Museum. Museum Data Bank Research Report No. 12.

    ERIC Educational Resources Information Center

    Scholtz, Sandra

    A management information system (MIS) is applied to a medium sized general museum to reflect the actual curatorial/registration functions. The recordkeeping functions of loan and conservation activities are examined since they too can be effectively handled by computer and constitute a complementary data base to the accession/catalog information.…

  12. Reliable Fusion of Stereo Matching and Depth Sensor for High Quality Dense Depth Maps

    PubMed Central

    Liu, Jing; Li, Chunpeng; Fan, Xuefeng; Wang, Zhaoqi

    2015-01-01

    Depth estimation is a classical problem in computer vision, which typically relies on either a depth sensor or stereo matching alone. The depth sensor provides real-time estimates in repetitive and textureless regions where stereo matching is not effective. However, stereo matching can obtain more accurate results in rich texture regions and object boundaries where the depth sensor often fails. We fuse stereo matching and the depth sensor using their complementary characteristics to improve the depth estimation. Here, texture information is incorporated as a constraint to restrict the pixel’s scope of potential disparities and to reduce noise in repetitive and textureless regions. Furthermore, a novel pseudo-two-layer model is used to represent the relationship between disparities in different pixels and segments. It is more robust to luminance variation by treating information obtained from a depth sensor as prior knowledge. Segmentation is viewed as a soft constraint to reduce ambiguities caused by under- or over-segmentation. Compared to the average error rate 3.27% of the previous state-of-the-art methods, our method provides an average error rate of 2.61% on the Middlebury datasets, which shows that our method performs almost 20% better than other “fused” algorithms in the aspect of precision. PMID:26308003

  13. Factors influencing first-time mothers' introduction of complementary foods: a qualitative exploration.

    PubMed

    Walsh, Anne; Kearney, Lauren; Dennis, Nicole

    2015-09-22

    Optimal infant nutrition comprises exclusive breastfeeding, with complementary foods introduced from six months of age. How parents make decisions regarding this is poorly studied. This study begins to address the dearth of research into the decision-making processes used by first-time mothers relating to the introduction of complementary foods. This qualitative explorative study was conducted using interviews (13) and focus groups (3). A semi-structured interview guide based on the Theory of Planned Behaviour (TPB). The TPB, a well-validated decision-making model, identifies the key determinants of a behaviour through behavioural beliefs, subjective norms, and perceived behavioural control over the behaviour. It is purported that these beliefs predict behavioural intention to perform the behaviour, and performing the behaviour. A purposive, convenience, sample of 21 metropolitan parents recruited through advertising at local playgroups and childcare centres, and electronically through the University community email list self-selected to participate. Data were analysed thematically within the theoretical constructs: behavioural beliefs, subjective norms and perceived behavioural control. Data relating to sources of information about the introduction of complementary foods were also collected. Overall, first-time mothers found that waiting until six months was challenging despite knowledge of the WHO recommendations and an initial desire to comply with this guideline. Beliefs that complementary foods would assist the infants' weight gain, sleeping patterns and enjoyment at meal times were identified. Barriers preventing parents complying with the recommendations included subjective and group norms, peer influences, infant cues indicating early readiness and food labelling inconsistencies. The most valued information source was from peers who had recently introduced complementary foods. First-time mothers in this study did not demonstrate a good understanding of the rationale behind the WHO recommendations, nor did they understand fully the signs of readiness of infants to commence solid foods. Factors that assisted waiting until six months were a trusting relationship with a health professional whose practice and advice was consistent with the recommendations and/or when their infant was developmentally ready for complementary foods at six months and accepted them with ease and enthusiasm. Barriers preventing parents complying with the recommendations included subjective and group norms, peer influences, infant cues indicating early readiness and food labelling inconsistencies.

  14. The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

    PubMed Central

    2013-01-01

    Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

  15. Use of Complementary and Alternative Medicine in the United States

    MedlinePlus

    ... is Most Frequently Used Among Children (2007) Additional Reports NCCIH plans to collaborate with NCHS on further ... improving health and health care. To Obtain the Report The report's citation is Barnes PM, Bloom B, ...

  16. Comparing hospital staff and patient perceptions of customer service: a pilot study utilizing survey and focus group data.

    PubMed

    Fottler, Myron D; Dickson, Duncan; Ford, Robert C; Bradley, Kenneth; Johnson, Lee

    2006-02-01

    The measurement of patient satisfaction is crucial to enhancing customer service and competitive advantage in the health-care industry. While there are numerous approaches to such measurement, this paper provides a case study which compares and contrasts patient and staff perceptions of customer service using both survey and focus group data. Results indicate that there is a high degree of correlation between staff and patient perceptions of customer service based on both survey and focus group data. However, the staff and patient subgroups also provided complementary information regarding patient perceptions of their service experience. Staff members tended to have more negative perceptions of service attributes than did the patients themselves. The focus group results provide complementary information to survey results in terms of greater detail and more managerially relevant information. While these results are derived from a pilot study, they suggest that diversification of data sources beyond patient surveys may enhance the utility of customer service information. If further research can affirm these findings, they create exciting possibilities for gathering valid, reliable and cost-effective customer service information.

  17. Assessing the Performance of Sensor Fusion Methods: Application to Magnetic-Inertial-Based Human Body Tracking

    PubMed Central

    Ligorio, Gabriele; Bergamini, Elena; Pasciuto, Ilaria; Vannozzi, Giuseppe; Cappozzo, Aurelio; Sabatini, Angelo Maria

    2016-01-01

    Information from complementary and redundant sensors are often combined within sensor fusion algorithms to obtain a single accurate observation of the system at hand. However, measurements from each sensor are characterized by uncertainties. When multiple data are fused, it is often unclear how all these uncertainties interact and influence the overall performance of the sensor fusion algorithm. To address this issue, a benchmarking procedure is presented, where simulated and real data are combined in different scenarios in order to quantify how each sensor’s uncertainties influence the accuracy of the final result. The proposed procedure was applied to the estimation of the pelvis orientation using a waist-worn magnetic-inertial measurement unit. Ground-truth data were obtained from a stereophotogrammetric system and used to obtain simulated data. Two Kalman-based sensor fusion algorithms were submitted to the proposed benchmarking procedure. For the considered application, gyroscope uncertainties proved to be the main error source in orientation estimation accuracy for both tested algorithms. Moreover, although different performances were obtained using simulated data, these differences became negligible when real data were considered. The outcome of this evaluation may be useful both to improve the design of new sensor fusion methods and to drive the algorithm tuning process. PMID:26821027

  18. Assessing the Performance of Sensor Fusion Methods: Application to Magnetic-Inertial-Based Human Body Tracking.

    PubMed

    Ligorio, Gabriele; Bergamini, Elena; Pasciuto, Ilaria; Vannozzi, Giuseppe; Cappozzo, Aurelio; Sabatini, Angelo Maria

    2016-01-26

    Information from complementary and redundant sensors are often combined within sensor fusion algorithms to obtain a single accurate observation of the system at hand. However, measurements from each sensor are characterized by uncertainties. When multiple data are fused, it is often unclear how all these uncertainties interact and influence the overall performance of the sensor fusion algorithm. To address this issue, a benchmarking procedure is presented, where simulated and real data are combined in different scenarios in order to quantify how each sensor's uncertainties influence the accuracy of the final result. The proposed procedure was applied to the estimation of the pelvis orientation using a waist-worn magnetic-inertial measurement unit. Ground-truth data were obtained from a stereophotogrammetric system and used to obtain simulated data. Two Kalman-based sensor fusion algorithms were submitted to the proposed benchmarking procedure. For the considered application, gyroscope uncertainties proved to be the main error source in orientation estimation accuracy for both tested algorithms. Moreover, although different performances were obtained using simulated data, these differences became negligible when real data were considered. The outcome of this evaluation may be useful both to improve the design of new sensor fusion methods and to drive the algorithm tuning process.

  19. Ambiguities and completeness of SAS data analysis: investigations of apoferritin by SAXS/SANS EID and SEC-SAXS methods

    NASA Astrophysics Data System (ADS)

    Zabelskii, D. V.; Vlasov, A. V.; Ryzhykau, Yu L.; Murugova, T. N.; Brennich, M.; Soloviov, D. V.; Ivankov, O. I.; Borshchevskiy, V. I.; Mishin, A. V.; Rogachev, A. V.; Round, A.; Dencher, N. A.; Büldt, G.; Gordeliy, V. I.; Kuklin, A. I.

    2018-03-01

    The method of small angle scattering (SAS) is widely used in the field of biophysical research of proteins in aqueous solutions. Obtaining low-resolution structure of proteins is still a highly valuable method despite the advances in high-resolution methods such as X-ray diffraction, cryo-EM etc. SAS offers the unique possibility to obtain structural information under conditions close to those of functional assays, i.e. in solution, without different additives, in the mg/mL concentration range. SAS method has a long history, but there are still many uncertainties related to data treatment. We compared 1D SAS profiles of apoferritin obtained by X-ray diffraction (XRD) and SAS methods. It is shown that SAS curves for X-ray diffraction crystallographic structure of apoferritin differ more significantly than it might be expected due to the resolution of the SAS instrument. Extrapolation to infinite dilution (EID) method does not sufficiently exclude dimerization and oligomerization effects and therefore could not guarantee total absence of dimers account in the final SAS curve. In this study, we show that EID SAXS, EID SANS and SEC-SAXS methods give complementary results and when they are used all together, it allows obtaining the most accurate results and high confidence from SAS data analysis of proteins.

  20. The Role of Memory Consolidation in Generalisation of New Linguistic Information

    ERIC Educational Resources Information Center

    Tamminen, Jakke; Davis, Matthew H.; Merkx, Marjolein; Rastle, Kathleen

    2012-01-01

    Accounts of memory that postulate complementary learning systems (CLS) have become increasingly influential in the field of language learning. These accounts predict that generalisation of newly learnt linguistic information to untrained contexts requires offline memory consolidation. Such generalisation should not be observed immediately after…

  1. Teaching Multimedia Data Protection through an International Online Competition

    ERIC Educational Resources Information Center

    Battisti, F.; Boato, G.; Carli, M.; Neri, A.

    2011-01-01

    Low-cost personal computers, wireless access technologies, the Internet, and computer-equipped classrooms allow the design of novel and complementary methodologies for teaching digital information security in electrical engineering curricula. The challenges of the current digital information era require experts who are effectively able to…

  2. Evaluating hydrological model performance using information theory-based metrics

    USDA-ARS?s Scientific Manuscript database

    The accuracy-based model performance metrics not necessarily reflect the qualitative correspondence between simulated and measured streamflow time series. The objective of this work was to use the information theory-based metrics to see whether they can be used as complementary tool for hydrologic m...

  3. Evaluating the consistency of gene sets used in the analysis of bacterial gene expression data.

    PubMed

    Tintle, Nathan L; Sitarik, Alexandra; Boerema, Benjamin; Young, Kylie; Best, Aaron A; Dejongh, Matthew

    2012-08-08

    Statistical analyses of whole genome expression data require functional information about genes in order to yield meaningful biological conclusions. The Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) are common sources of functionally grouped gene sets. For bacteria, the SEED and MicrobesOnline provide alternative, complementary sources of gene sets. To date, no comprehensive evaluation of the data obtained from these resources has been performed. We define a series of gene set consistency metrics directly related to the most common classes of statistical analyses for gene expression data, and then perform a comprehensive analysis of 3581 Affymetrix® gene expression arrays across 17 diverse bacteria. We find that gene sets obtained from GO and KEGG demonstrate lower consistency than those obtained from the SEED and MicrobesOnline, regardless of gene set size. Despite the widespread use of GO and KEGG gene sets in bacterial gene expression data analysis, the SEED and MicrobesOnline provide more consistent sets for a wide variety of statistical analyses. Increased use of the SEED and MicrobesOnline gene sets in the analysis of bacterial gene expression data may improve statistical power and utility of expression data.

  4. Development of a ginkgo biloba fingerprint chromatogram with UV and evaporative light scattering detection and optimization of the evaporative light scattering detector operating conditions.

    PubMed

    van Nederkassel, A M; Vijverman, V; Massart, D L; Vander Heyden, Y

    2005-09-02

    A fingerprint chromatogram of a standardized Ginkgo biloba extract is developed on a monolithic silica column using a ternary gradient containing water, iso-propanol and tetrahydrofuran. For the detection, UV and evaporative light scattering (ELS) detectors are used, the latter allowing detection of the poor UV absorbing compounds as ginkgolides (A-C and J) and bilobalide in the extract. The complementary information between the UV and ELS fingerprint is evaluated. The ELS detector used in this study can operate in an impactor 'on' or 'off' mode. For each mode, the operating conditions such as the nebulizing gas flow rate, the drift tube temperature and the gain are optimized by use of three-level screening designs to obtain the best signal-to-noise (S/N) ratio in the final ELS fingerprint chromatogram. In both impactor modes, very similar S/N ratios are obtained for the nominal levels of the design. However, optimization of the operating conditions resulted, for both impactor modes, in a significant increase in S/N ratios compared to the initial evaluated conditions, obtained from the detector software.

  5. Complementary and alternative medicine (CAM) in obstetrics and gynaecology: a survey of office-based obstetricians and gynaecologists regarding attitudes towards CAM, its provision and cooperation with other CAM providers in the state of Hesse, Germany.

    PubMed

    Münstedt, K; Maisch, M; Tinneberg, H R; Hübner, J

    2014-12-01

    Whereas we have some information on complementary medicine in the field of oncology, little is known about complementary medicine in the field of obstetrics and gynaecology especially outside of hospitals. All office-based obstetricians and gynaecologists in the state of Hesse, Germany, were contacted and asked to fill in an assessment form regarding cooperation in the field of complementary and alternative medicine (CAM), as well as the perceived efficacy of various CAM methods for a number of pathological conditions in the field of obstetrics and gynaecology. It was found that more than half of Hessian office-based obstetricians and gynaecologists had existing cooperation regarding CAM, especially with colleagues, but also midwives, pharmacists, physiotherapists, and health practitioners. The probability of cooperation was significantly inversely associated with age. It was found that the probability for advising CAM differed between various health problems. The following CAM methods were considered reasonable for the treatment of different conditions: phytotherapy for climacteric complaints and premenstrual syndrome; homoeopathy for puerperal problems; acupuncture and traditional Chinese medicine for complaints during pregnancy; and dietary supplements for the side effects of cancer therapy. The analysis shows that there is much cooperation in the field of CAM. Comparison between physicians' perceived efficacy of CAM methods and objective findings shows that there is a need for the provision of valid information in the field.

  6. Perceptions, use and attitudes of pharmacy customers on complementary medicines and pharmacy practice.

    PubMed

    Braun, Lesley A; Tiralongo, Evelin; Wilkinson, Jenny M; Spitzer, Ondine; Bailey, Michael; Poole, Susan; Dooley, Michael

    2010-07-20

    Complementary medicines (CMs) are popular amongst Australians and community pharmacy is a major supplier of these products. This study explores pharmacy customer use, attitudes and perceptions of complementary medicines, and their expectations of pharmacists as they relate to these products. Pharmacy customers randomly selected from sixty large and small, metropolitan and rural pharmacies in three Australian states completed an anonymous, self administered questionnaire that had been pre-tested and validated. 1,121 customers participated (response rate 62%). 72% had used CMs within the previous 12 months, 61% used prescription medicines daily and 43% had used both concomitantly. Multivitamins, fish oils, vitamin C, glucosamine and probiotics were the five most popular CMs. 72% of people using CMs rated their products as 'very effective' or 'effective enough'. CMs were as frequently used by customers aged 60 years or older as younger customers (69% vs. 72%) although the pattern of use shifted with older age. Most customers (92%) thought pharmacists should provide safety information about CMs, 90% thought they should routinely check for interactions, 87% thought they should recommend effective CMs, 78% thought CMs should be recorded in customer's medication profile and 58% thought pharmacies stocking CMs should also employ a complementary medicine practitioner. Of those using CMs, 93% thought it important for pharmacists to be knowledgeable about CMs and 48% felt their pharmacist provides useful information about CMs. CMs are widely used by pharmacy customers of all ages who want pharmacists to be more involved in providing advice about these products.

  7. Cancer Information Summaries

    Cancer.gov

    Peer-reviewed, evidence-based summaries on topics including adult and pediatric cancer treatment, supportive and palliative care, screening, prevention, genetics, and complementary and alternative medicine. References to published literature are included.

  8. The pituitary gland under infrared light - in search of a representative spectrum for homogeneous regions.

    PubMed

    Banas, A; Banas, K; Furgal-Borzych, A; Kwiatek, W M; Pawlicki, B; Breese, M B H

    2015-04-07

    The pituitary gland is a small but vital organ in the human body. It is located at the base of the brain and is often described as the master gland due to its multiple functions. The pituitary gland secretes and stores hormones, such as the thyroid-stimulating hormone (TSH), adrenocorticotropic hormone (ACTH), growth hormone (hGH), prolactin, gonadotropins, and luteinizing hormones, as well as the antidiuretic hormone (ADH). A proper diagnosis of pituitary disorders is of utmost importance as this organ participates in regulating a variety of body functions. Typical histopathological analysis provides much valuable information, but it gives no insight into the biochemical background of the changes that occur within the gland. One approach that could be used to evaluate the biochemistry of tissue sections obtained from pituitary disorders is Fourier Transform Infra-Red (FTIR) spectromicroscopy. In order to collect diagnostically valuable information large areas of tissue must be investigated. This work focuses on obtaining a unique and representative FTIR spectrum characteristic of one type of cell architecture within a sample. The idea presented is based on using hierarchical cluster analysis (HCA) for data evaluation to search for uniform patterns within samples from the perspective of FTIR spectra. The results obtained demonstrate that FTIR spectromicroscopy, combined with proper statistical evaluation, can be treated as a complementary method for histopathological analysis and ipso facto can increase the sensitivity and specificity for detecting various disorders not only for the pituitary gland, but also for other human tissues.

  9. Clinical severity score system in dogs with degenerative mitral valve disease.

    PubMed

    López-Alvarez, J; Elliott, J; Pfeiffer, D; Chang, Y-M; Mattin, M; Moonarmart, W; Hezzell, M J; Boswood, A

    2015-01-01

    Several risk factors already have been determined for dogs with degenerative mitral valve disease (DMVD). Risk factors often have been considered in isolation and have not always taken into account additional information provided by the history and physical examination (PE). Data obtained from history and PE of dogs with DMVD provide prognostic information and can be used for risk stratification. Client-owned dogs (n = 244) with DMVD recruited from first opinion practice. Prospective longitudinal follow-up of dogs with DMVD. History and PE data were obtained at 6-month intervals and analyzed with time-dependent Cox models to derive relative risk of cardiac death. Independent hazard ratios were used to derive a clinical severity score (CSS), the prognostic value of which was evaluated by analyzing the median survival times for different risk groups and ROC analysis. Analysis of the progression of CSS over time also was undertaken. History of cough, exercise intolerance, decreased appetite, breathlessness (difficulty breathing) and syncope with PE findings of heart murmur intensity louder than III/VI and absence of respiratory sinus arrhythmia were independently associated with outcome and allowed development of the CSS. Clinical severity score distinguished groups of dogs with significantly different outcomes. Routinely obtained clinical findings allow risk stratification of dogs with DMVD. Results of ancillary diagnostic tests may be complementary to history and PE findings and always should be interpreted in conjunction with these findings. Copyright © 2015 by the American College of Veterinary Internal Medicine.

  10. Text mining for traditional Chinese medical knowledge discovery: a survey.

    PubMed

    Zhou, Xuezhong; Peng, Yonghong; Liu, Baoyan

    2010-08-01

    Extracting meaningful information and knowledge from free text is the subject of considerable research interest in the machine learning and data mining fields. Text data mining (or text mining) has become one of the most active research sub-fields in data mining. Significant developments in the area of biomedical text mining during the past years have demonstrated its great promise for supporting scientists in developing novel hypotheses and new knowledge from the biomedical literature. Traditional Chinese medicine (TCM) provides a distinct methodology with which to view human life. It is one of the most complete and distinguished traditional medicines with a history of several thousand years of studying and practicing the diagnosis and treatment of human disease. It has been shown that the TCM knowledge obtained from clinical practice has become a significant complementary source of information for modern biomedical sciences. TCM literature obtained from the historical period and from modern clinical studies has recently been transformed into digital data in the form of relational databases or text documents, which provide an effective platform for information sharing and retrieval. This motivates and facilitates research and development into knowledge discovery approaches and to modernize TCM. In order to contribute to this still growing field, this paper presents (1) a comparative introduction to TCM and modern biomedicine, (2) a survey of the related information sources of TCM, (3) a review and discussion of the state of the art and the development of text mining techniques with applications to TCM, (4) a discussion of the research issues around TCM text mining and its future directions. Copyright 2010 Elsevier Inc. All rights reserved.

  11. The use of complementary and alternative medicine by pregnant women: a literature review.

    PubMed

    Hall, Helen G; Griffiths, Debra L; McKenna, Lisa G

    2011-12-01

    The use of complementary and alternative medicine (CAM) has become increasingly prevalent in industrialised countries, with women being the most prolific users. Some women continue to consume these therapies when they become pregnant. To review the literature exploring prevalence and motivation for use of complementary and alternative medicine by pregnant women. A search for relevant literature published from 2001 was undertaken using a range of databases and by examining relevant bibliographies. Although the estimates vary widely from 1% to 87%, the general trend indicates that a significant number of pregnant women use complementary and alternative medicine. Common modalities used include massage, vitamin and mineral supplements, herbal medicine, relaxation therapies and aromatherapy. Reasons for use are varied and include the belief that these therapies offer safe alternatives to pharmaceuticals, they allow greater choice and control over the childbearing experiences, and they are congruent with their holistic health beliefs. The influence of traditional cultural practices on the use of these therapies is unclear. Most expectant women rely on advice from family and friends, and many do not disclose their use to their pregnancy care providers. Many women use complementary and alternative medicine when they are pregnant. Further research is needed to gain a greater understanding of the true prevalence and expectant women's motivation for the use of complementary and alternative medicine. Health-care professionals are encouraged to ask women about their use of these treatments and seek out relevant information. Copyright © 2010 Elsevier Ltd. All rights reserved.

  12. [Diversity, relative abundance and activity patterns of medium and large mammals in a tropical deciduous forest in the Isthmus of Tehuantepec, Oaxaca, Mexico].

    PubMed

    Cortés-Marcial, Malinalli; Briones-Salas, Miguel

    2014-12-01

    The use of camera traps and mammal track search are complementary methods to monitoring species of which is not well documented their natural history, as in the case of medium and large mammals. To ensure its conservation and good management, it is necessary to generate information about the structure of the community and their populations. The objective of the present study was to estimate the diversity, relative abundance and activity patterns of medium and large mammals in a tropical deciduous forest located in the Isthmus of Tehuantepec, Oaxaca, Mexico. Samplings were conducted in three month intervals, from September 2011 to May 2013. We used photographic-sampling and track search, two complementary sampling methods. For photographic-sampling, 12 camera traps were placed covering an area of 60 km2, while for the tracks search a monthly tour of four line-transect surveys of three kilometers length each was undertaken. We obtained a total of 344 pictures with 5292 trap-days total sampling effort; in addition, 187 track records in a total of 144 km. With both methods we registered 21 species of mammals, in 13 families and seven orders, and five species resulted in new records to the area. The diversity index of Shannon-Wiener obtained with the method of tracks was H' = 2.41, while the most abundant species were Urocyon cinereoargen- teus (IAR = 0.23) and Pecari tajacu (IAR = 0.20). By the method of trap the most abundant species were P. tajacu (IAR = 2.62) and Nasua narica (IAR = 1.28). In terms of patterns of activity P. tajacu, N. narica and Odocoileus virginianus were primarily diurnal species; Canis latrans and Leopardus pardalis did not show preference for any schedule in particular, and Didelphis virginiana and Dasypus novemcinctus preferred to have nocturnal activity. This information can be of help to the creation of programs of management and conservation of mam- mals of medium and large in the Isthmus of Tehuantepec, Oaxaca, México.

  13. Micro-electro-mechanically switchable near infrared complementary metamaterial absorber

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pitchappa, Prakash; Pei Ho, Chong; Institute of Microelectronics

    2014-05-19

    We experimentally demonstrate a micro-electro-mechanically switchable near infrared complementary metamaterial absorber by integrating the metamaterial layer to be the out of plane movable microactuator. The metamaterial layer is electrostatically actuated by applying voltage across the suspended complementary metamaterial layer and the stationary bottom metallic reflector. Thus, the effective spacing between the metamaterial layer and bottom metal reflector is varied as a function of applied voltage. With the reduction of effective spacing between the metamaterial and reflector layers, a strong spectral blue shift in the peak absorption wavelength can be achieved. With spacing change of 300 nm, the spectral shift of 0.7 μmmore » in peak absorption wavelength was obtained for near infrared spectral region. The electro-optic switching performance of the device was characterized, and a striking switching contrast of 1500% was achieved at 2.1 μm. The reported micro-electro-mechanically tunable complementary metamaterial absorber device can potentially enable a wide range of high performance electro-optical devices, such as continuously tunable filters, modulators, and electro-optic switches that form the key components to facilitate future photonic circuit applications.« less

  14. Optical remote sensing of asteroid surfaces from spacecraft

    NASA Technical Reports Server (NTRS)

    Mccord, T. B.

    1978-01-01

    Reflectance spectroscopy and multispectral mapping are the techniques likely to be most useful for determining asteroid surfaces. Several other techniques should be considered for providing complementary information.

  15. DNA Repair Mechanism Gene, XRCC1A ( Arg194Trp) but not XRCC3 ( Thr241Met) Polymorphism Increased the Risk of Breast Cancer in Premenopausal Females: A Case-Control Study in Northeastern Region of India.

    PubMed

    Devi, K Rekha; Ahmed, Jishan; Narain, Kanwar; Mukherjee, Kaustab; Majumdar, Gautam; Chenkual, Saia; Zonunmawia, Jason C

    2017-12-01

    X-ray repair cross complementary group gene is one of the most studied candidate gene involved in different types of cancers. Studies have shown that X-ray repair cross complementary genes are significantly associated with increased risk of breast cancer in females. Moreover, studies have revealed that X-ray repair cross complementary gene polymorphism significantly varies between and within different ethnic groups globally. The present case-control study was aimed to investigate the association of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer in females from northeastern region of India. The present case-control study includes histopathologically confirmed and newly diagnosed 464 cases with breast cancer and 534 apparently healthy neighborhood community controls. Information on sociodemographic factors and putative risk factors were collected from each study participant by conducting face-to-face interviews. Genotyping of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) was carried out by polymerase chain reaction-restriction fragment length polymorphism. For statistical analysis, both univariate and multivariate logistic regression analyses were performed. We also performed stratified analysis to find out the association of X-ray repair cross complementary genes with the risk of breast cancer stratified based on menstrual status. This study revealed that tryptophan allele (R/W-W/W genotype) in X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer (adjusted odds ratio = 1.44, 95% confidence interval = 1.06-1.97, P < .05 for R/W-W/W genotype). Moreover, it was found that tryptophan allele (W/W genotype) at codon 194 of X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer in premenopausal females (crude odds ratio = 1.66, 95% confidence interval = 1.11-2.46, P < .05 for R/W-W/W genotype). The present study did not reveal any significant association of X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer. The present study has explored that X-ray repair cross complementary 1A (Arg194Trp) gene polymorphism is significantly associated with the increased risk of breast cancer in premenopausal females from northeastern region of India which may be beneficial for prognostic purposes.

  16. DNA Repair Mechanism Gene, XRCC1A (Arg194Trp) but not XRCC3 (Thr241Met) Polymorphism Increased the Risk of Breast Cancer in Premenopausal Females: A Case–Control Study in Northeastern Region of India

    PubMed Central

    Ahmed, Jishan; Narain, Kanwar; Mukherjee, Kaustab; Majumdar, Gautam; Chenkual, Saia; Zonunmawia, Jason C.

    2017-01-01

    X-ray repair cross complementary group gene is one of the most studied candidate gene involved in different types of cancers. Studies have shown that X-ray repair cross complementary genes are significantly associated with increased risk of breast cancer in females. Moreover, studies have revealed that X-ray repair cross complementary gene polymorphism significantly varies between and within different ethnic groups globally. The present case–control study was aimed to investigate the association of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer in females from northeastern region of India. The present case–control study includes histopathologically confirmed and newly diagnosed 464 cases with breast cancer and 534 apparently healthy neighborhood community controls. Information on sociodemographic factors and putative risk factors were collected from each study participant by conducting face-to-face interviews. Genotyping of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) was carried out by polymerase chain reaction-restriction fragment length polymorphism. For statistical analysis, both univariate and multivariate logistic regression analyses were performed. We also performed stratified analysis to find out the association of X-ray repair cross complementary genes with the risk of breast cancer stratified based on menstrual status. This study revealed that tryptophan allele (R/W-W/W genotype) in X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer (adjusted odds ratio = 1.44, 95% confidence interval = 1.06-1.97, P < .05 for R/W-W/W genotype). Moreover, it was found that tryptophan allele (W/W genotype) at codon 194 of X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer in premenopausal females (crude odds ratio = 1.66, 95% confidence interval = 1.11-2.46, P < .05 for R/W-W/W genotype). The present study did not reveal any significant association of X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer. The present study has explored that X-ray repair cross complementary 1A (Arg194Trp) gene polymorphism is significantly associated with the increased risk of breast cancer in premenopausal females from northeastern region of India which may be beneficial for prognostic purposes. PMID:29332455

  17. 76 FR 22364 - Proposed Information Collection; Comment Request; Survey of Income and Program Participation...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-21

    ... of 2012. The SIPP is a household-based survey designed as a continuous series of national panels. The... DEPARTMENT OF COMMERCE Census Bureau Proposed Information Collection; Comment Request; Survey of... with questions designed to address specific needs in complementary subject areas. The 2012 SIPP- EHC...

  18. 77 FR 34338 - Proposed Information Collection; Comment Request; Survey of Income and Program Participation...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-11

    ... Calendar (SIPP-EHC) from January to March of 2013. The SIPP is a household-based survey designed as a... DEPARTMENT OF COMMERCE Census Bureau Proposed Information Collection; Comment Request; Survey of... questions that are supplemented with questions designed to address specific needs in complementary subject...

  19. Planetary Surface Analysis Using Fast Laser Spectroscopic Techniques: Combined Microscopic Raman, LIBS, and Fluorescence Spectroscopy

    NASA Astrophysics Data System (ADS)

    Blacksberg, J.; Rossman, G. R.; Maruyama, Y.; Charbon, E.

    2011-12-01

    In situ exploration of planetary surfaces has to date required multiple techniques that, when used together, yield important information about their formation histories and evolution. We present a time-resolved laser spectroscopic technique that could potentially collect complementary sets of data providing information on mineral structure, composition, and hydration state. Using a picosecond-scale pulsed laser and a fast time-resolved detector we can simultaneously collect spectra from Raman, Laser Induced Breakdown Spectroscopy (LIBS), and fluorescence emissions that are separated in time due to the unique decay times of each process. The use of a laser with high rep rate (40 KHz) and low pulse energy (1 μJ/pulse) allows us to rapidly collect high signal to noise Raman spectra while minimizing sample damage. Increasing the pulse energy by about an order of magnitude creates a microscopic plasma near the surface and enables the collection of LIBS spectra at an unusually high rep rate and low pulse energy. Simultaneously, broader fluorescence peaks can be detected with lifetimes varying from nanosecond to microsecond. We will present Raman, LIBS, and fluorescence spectra obtained on natural mineral samples such as sulfates, clays, pyroxenes and carbonates that are of interest for Mars mineralogy. We demonstrate this technique using a photocathode-based streak camera detector as well as a newly-developed solid state Single Photon Avalanche Diode (SPAD) sensor array based on Complementary Metal-Oxide Semiconductor (CMOS) technology. We will discuss the impact of system design and detector choice on science return of a potential planetary surface mission, with a specific focus on size, weight, power, and complexity. The research described here was carried out at the Jet Propulsion Laboratory, California Institute of Technology, under a contract with the National Aeronautics and Space Administration (NASA).

  20. Perception of patients with cancer towards support management services and use of complementary alternative medicine--a single institution hospital-based study in Saudi Arabia.

    PubMed

    Sait, Khalid Hussain; Anfinan, Nisrin Mohammad; Eldeek, Basem; Al-Ahmadi, Jawher; Al-Attas, Maha; Sait, Hesham Khalid; Basalamah, Hussain Abdullah; Al-Ama, Nabeel; El-Sayed, Mohamed Eid

    2014-01-01

    To evaluate the perception of cancer patients toward treatment services and influencing factors and to inquire about the use of complementary alternative medicine (CAM). Information was obtained through pre-tested structured questionnaires completed by cancer patients during treatment at King Abdulaziz University Hospital, Jeddah, Saudi Arabia. Of 242 patients, 137 (64.6%) accepted to enter this study. Most were Saudi (n=93, 68%), female (n= 80, 58%), educated at university (n=71, 52%), married (n=97, 72%) and with breast cancer (n=36, 26%). One-hundred (73%) patients were satisfied with the services provided; 61% were Saudi. Ninety-four (68%) respondents were satisfied with the explanation of their cancer. Twenty-eight (21.6%) patients received CAM, of them 54.0% received herbal followed by rakia (21.0%), nutritional supplements/vitamins (7.0%) and Zamam water (18.0%), with significant differences among them (p =0.004). Seven (5%) patients believed this therapy could be used alone; 34 (25%) patients believed it could be used with other treatments, regardless of whether they themselves used this therapy. Fifty-three (53%) satisfied patients felt they received enough support; 31 (58%) patients received support from family and friends; 22 (41.6%) patients received support from the health-care team. Patients who received information about their disease from their physicians and those who felt they had enough support were more satisfied. The patients who took alternative treatment were older age, mostly female and highly educated but values did not reach significance. We stress enhancing the educational and supportive aspects of cancer-patient services to improve their treatment satisfaction and emphasize the need for increasing the educational and awareness programs offered to these patients.

  1. Identification of Alzheimer's disease and mild cognitive impairment using multimodal sparse hierarchical extreme learning machine.

    PubMed

    Kim, Jongin; Lee, Boreom

    2018-05-07

    Different modalities such as structural MRI, FDG-PET, and CSF have complementary information, which is likely to be very useful for diagnosis of AD and MCI. Therefore, it is possible to develop a more effective and accurate AD/MCI automatic diagnosis method by integrating complementary information of different modalities. In this paper, we propose multi-modal sparse hierarchical extreme leaning machine (MSH-ELM). We used volume and mean intensity extracted from 93 regions of interest (ROIs) as features of MRI and FDG-PET, respectively, and used p-tau, t-tau, and Aβ42 as CSF features. In detail, high-level representation was individually extracted from each of MRI, FDG-PET, and CSF using a stacked sparse extreme learning machine auto-encoder (sELM-AE). Then, another stacked sELM-AE was devised to acquire a joint hierarchical feature representation by fusing the high-level representations obtained from each modality. Finally, we classified joint hierarchical feature representation using a kernel-based extreme learning machine (KELM). The results of MSH-ELM were compared with those of conventional ELM, single kernel support vector machine (SK-SVM), multiple kernel support vector machine (MK-SVM) and stacked auto-encoder (SAE). Performance was evaluated through 10-fold cross-validation. In the classification of AD vs. HC and MCI vs. HC problem, the proposed MSH-ELM method showed mean balanced accuracies of 96.10% and 86.46%, respectively, which is much better than those of competing methods. In summary, the proposed algorithm exhibits consistently better performance than SK-SVM, ELM, MK-SVM and SAE in the two binary classification problems (AD vs. HC and MCI vs. HC). © 2018 Wiley Periodicals, Inc.

  2. Isoscapes of tree-ring carbon-13 perform like meteorological networks in predicting regional precipitation patterns

    NASA Astrophysics Data System (ADS)

    del Castillo, Jorge; Aguilera, Mònica; Voltas, Jordi; Ferrio, Juan Pedro

    2013-03-01

    isotopes in tree rings provide climatic information with annual resolution dating back for centuries or even millennia. However, deriving spatially explicit climate models from isotope networks remains challenging. Here we propose a methodology to model regional precipitation from carbon isotope discrimination (Δ13C) in tree rings by (1) building regional spatial models of Δ13C (isoscapes) and (2) deriving precipitation maps from Δ13C-isoscapes, taking advantage of the response of Δ13C to precipitation in seasonally dry climates. As a case study, we modeled the spatial distribution of mean annual precipitation (MAP) in the northeastern Iberian Peninsula, a region with complex topography and climate (MAP = 303-1086 mm). We compiled wood Δ13C data for two Mediterranean species that exhibit complementary responses to seasonal precipitation (Pinus halepensis Mill., N = 38; Quercus ilex L.; N = 44; pooling period: 1975-2008). By combining multiple regression and geostatistical interpolation, we generated one Δ13 C-isoscape for each species. A spatial model of MAP was then built as the sum of two complementary maps of seasonal precipitation, each one derived from the corresponding Δ13C-isoscape (September-November from Q. ilex; December-August from P. halepensis). Our approach showed a predictive power for MAP (RMSE = 84 mm) nearly identical to that obtained by interpolating data directly from a similarly dense network of meteorological stations (RMSE = 80-83 mm, N = 65), being only outperformed when using a much denser meteorological network (RMSE = 56-57 mm, N = 340). This method offers new avenues for modeling spatial variability of past precipitation, exploiting the large amount of information currently available from tree-ring networks.

  3. Quantum information density scaling and qubit operation time constraints of CMOS silicon-based quantum computer architectures

    NASA Astrophysics Data System (ADS)

    Rotta, Davide; Sebastiano, Fabio; Charbon, Edoardo; Prati, Enrico

    2017-06-01

    Even the quantum simulation of an apparently simple molecule such as Fe2S2 requires a considerable number of qubits of the order of 106, while more complex molecules such as alanine (C3H7NO2) require about a hundred times more. In order to assess such a multimillion scale of identical qubits and control lines, the silicon platform seems to be one of the most indicated routes as it naturally provides, together with qubit functionalities, the capability of nanometric, serial, and industrial-quality fabrication. The scaling trend of microelectronic devices predicting that computing power would double every 2 years, known as Moore's law, according to the new slope set after the 32-nm node of 2009, suggests that the technology roadmap will achieve the 3-nm manufacturability limit proposed by Kelly around 2020. Today, circuital quantum information processing architectures are predicted to take advantage from the scalability ensured by silicon technology. However, the maximum amount of quantum information per unit surface that can be stored in silicon-based qubits and the consequent space constraints on qubit operations have never been addressed so far. This represents one of the key parameters toward the implementation of quantum error correction for fault-tolerant quantum information processing and its dependence on the features of the technology node. The maximum quantum information per unit surface virtually storable and controllable in the compact exchange-only silicon double quantum dot qubit architecture is expressed as a function of the complementary metal-oxide-semiconductor technology node, so the size scale optimizing both physical qubit operation time and quantum error correction requirements is assessed by reviewing the physical and technological constraints. According to the requirements imposed by the quantum error correction method and the constraints given by the typical strength of the exchange coupling, we determine the workable operation frequency range of a silicon complementary metal-oxide-semiconductor quantum processor to be within 1 and 100 GHz. Such constraint limits the feasibility of fault-tolerant quantum information processing with complementary metal-oxide-semiconductor technology only to the most advanced nodes. The compatibility with classical complementary metal-oxide-semiconductor control circuitry is discussed, focusing on the cryogenic complementary metal-oxide-semiconductor operation required to bring the classical controller as close as possible to the quantum processor and to enable interfacing thousands of qubits on the same chip via time-division, frequency-division, and space-division multiplexing. The operation time range prospected for cryogenic control electronics is found to be compatible with the operation time expected for qubits. By combining the forecast of the development of scaled technology nodes with operation time and classical circuitry constraints, we derive a maximum quantum information density for logical qubits of 2.8 and 4 Mqb/cm2 for the 10 and 7-nm technology nodes, respectively, for the Steane code. The density is one and two orders of magnitude less for surface codes and for concatenated codes, respectively. Such values provide a benchmark for the development of fault-tolerant quantum algorithms by circuital quantum information based on silicon platforms and a guideline for other technologies in general.

  4. Toward Greater Cooperation? FM 100-5 and AFDD 1

    DTIC Science & Technology

    1997-05-22

    complementary with respect to technological superiority, information dominance , and asymmetric force application. Both the Army and the Air Force are...Force have the same understanding of technology superiority, information dominance and asymmetric force application. Differences in emphasis on the...for military operations while the Air Force views technology as the driving factor for military capability. Both services understand that information

  5. Through Increasing "Information Literacy" Capital and Habitus (Agency): The Complementary Impact on Composition Skills When Appropriately Sequenced

    ERIC Educational Resources Information Center

    Karas, Timothy

    2017-01-01

    Through a case study approach of a cohort of community college students at a single community college, the impact on success rates in composition courses was analyzed based on the sequence of completing an information literacy course. Two student cohorts were sampled based on completing an information literacy course prior to, or concurrently with…

  6. [Introduction of an accreditation system for hospital informed consent forms].

    PubMed

    López-Picazo, J J; Tomás-Garcia, N; Calle-Urra, J E; Parra-Hidalgo, P; Valverde-Iniesta, J J

    2015-01-01

    To describe an accreditation system for informed consent forms (ICF) in a tertiary hospital, as an intervention to improve their quality, and to check the improvements achieved. Following an external evaluation of the ICF quality in a public hospital in Murcia (Spain), an accreditation committee set the ICF requirements and associated procedures. Effectiveness is assessed by comparing two external evaluations carried out by the EMCA Program (2011 and 2013) and based on 19 criteria and a sample of 60 ICF for every public hospital in Murcia Region. To be accredited, every ICF must meet the 19 external criteria plus 5 based on legibility, readability and scientific and technical validity. A form to fill in the contents of every ICF was agreed, which would be reviewed, approved and validated for five years. Before the implementation, 8.2 defects/ICF were detected. The accreditation system obtained an 89% improvement (0.9 defects/ICF) and achieved significant improvements in 18 criteria, 16 of which are benchmarked. The accreditation system achieved a substantial improvement in the ICF (obtaining a better result in external evaluations) and guarantees their contents, legibility and readability. This system needs to be extended to other hospitals, since it is not clear whether common ICFs would be suitable. However, this improvement is structural and does not guarantee that the overall information/consent procedure is done properly, thus complementary strategies for measurement and improvement are required. Copyright © 2014 SECA. Published by Elsevier Espana. All rights reserved.

  7. Paying for Complementary Health Approaches

    MedlinePlus

    ... you, not an employer, establish this kind of account. For more information, see Internal Revenue Service (IRS) Publication 969, Health Savings Accounts and Other Tax-Favored Health Plans (2.1MB ...

  8. Complementary and alternative medicine in multiple sclerosis

    PubMed Central

    Moawad, Heidi; Shepard, Katie M.; Satya-Murti, Saty

    2015-01-01

    Summary This article identifies payment policy perspectives of the American Academy of Neurology's guideline on complementary and alternative medicine (CAM) in multiple sclerosis (MS). The guideline is a reliable repository of information for advocating or not recommending certain CAM treatments in MS. It eases the burden of searching for information on each separate CAM treatment. It frequently emphasizes the need for patient counseling. To provide such generally undervalued, but needed, cognitive services, neurologists could use advanced practice providers and patient-friendly visual aids during or between visits. They should also rely on evaluation and management codes that recognize time spent predominantly on counseling or coordination of care. The guideline's categorization of probable effectiveness of certain therapies will not influence coverage decisions because payers do not generally cover CAM therapies. PMID:29443184

  9. What's cooking with garlic: is this complementary and alternative medicine for hypertension?

    PubMed

    Edwards, Quannetta T; Colquist, Stephanie; Maradiegue, Ann

    2005-09-01

    To define complementary and alternative medicine (CAM); describe one type of CAM, garlic (Allium sativum L); and discuss its effects on blood pressure as a treatment for hypertension. Literature review from professional journals, abstracts, natural therapy books, and the World Wide Web (Internet). Information from the following professional organizations and agencies: The World Health Organization, Agency of Healthcare Research and Quality, National Cancer Institute, National Center for Complementary and Alternative Medicine, American Botanical Council, and Joint National Committee on Prevention, Detection, Evaluation and Treatment of High Blood Pressure. Garlic is widely used throughout the world as a CAM. It is one of the most popular herbal products sold in the United States. However, while some studies have shown small positive effects in reducing blood pressure, there are insufficient scientific data to draw conclusions regarding its efficacy on clinical blood pressure outcomes. Thus, healthcare providers should be cautious in recommending this herbal product as an antihypertensive CAM. CAMs may be used by clients for a variety of conditions including hypertension. Healthcare providers must be cognizant of the use, efficacy, adverse affects, and scientific evidence concerning CAM in order to provide safe and effective practice as well as appropriate and accurate information to their clients.

  10. Temperature induced complementary switching in titanium oxide resistive random access memory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Panda, D., E-mail: dpanda@nist.edu; Department of Electronics Engineering and Institute of Electronics, National Chiao Tung University, Hsinchu 30010, Taiwan; Simanjuntak, F. M.

    2016-07-15

    On the way towards high memory density and computer performance, a considerable development in energy efficiency represents the foremost aspiration in future information technology. Complementary resistive switch consists of two antiserial resistive switching memory (RRAM) elements and allows for the construction of large passive crossbar arrays by solving the sneak path problem in combination with a drastic reduction of the power consumption. Here we present a titanium oxide based complementary RRAM (CRRAM) device with Pt top and TiN bottom electrode. A subsequent post metal annealing at 400°C induces CRRAM. Forming voltage of 4.3 V is required for this device tomore » initiate switching process. The same device also exhibiting bipolar switching at lower compliance current, Ic <50 μA. The CRRAM device have high reliabilities. Formation of intermediate titanium oxi-nitride layer is confirmed from the cross-sectional HRTEM analysis. The origin of complementary switching mechanism have been discussed with AES, HRTEM analysis and schematic diagram. This paper provides valuable data along with analysis on the origin of CRRAM for the application in nanoscale devices.« less

  11. Reveal quantum correlation in complementary bases

    PubMed Central

    Wu, Shengjun; Ma, Zhihao; Chen, Zhihua; Yu, Sixia

    2014-01-01

    An essential feature of genuine quantum correlation is the simultaneous existence of correlation in complementary bases. We reveal this feature of quantum correlation by defining measures based on invariance under a basis change. For a bipartite quantum state, the classical correlation is the maximal correlation present in a certain optimum basis, while the quantum correlation is characterized as a series of residual correlations in the mutually unbiased bases. Compared with other approaches to quantify quantum correlation, our approach gives information-theoretical measures that directly reflect the essential feature of quantum correlation. PMID:24503595

  12. Complexes of mismatched and complementary DNA with minor groove binders. Structures at nucleotide resolution via an improved hydroxyl radical cleavage methodology.

    PubMed

    Bialonska, Dobroslawa; Song, Kenneth; Bolton, Philip H

    2011-11-27

    Tumor cell lines can replicate faster than normal cells and many also have defective DNA repair pathways. This has lead to the investigation of the inhibition of DNA repair proteins as a means of therapeutic intervention. An alternative approach is to hide or mask damaged DNA from the repair systems. We have developed a protocol to investigate the structures of the complexes of damaged DNA with drug like molecules. Nucleotide resolution structural information can be obtained using an improved hydroxyl radical cleavage protocol. The use of a dT(n) tail increases the length of the smallest fragments of interest and allows efficient co-precipitation of the fragments with poly(A). The use of a fluorescent label, on the 5' end of the dT(n) tail, in conjunction with modified cleavage reaction conditions, avoids the lifetime and other problems with (32)P labeling. The structures of duplex DNAs containing AC and CC mismatches in the presence and absence of minor groove binders have been investigated as have those of the fully complementary DNA. The results indicate that the structural perturbations of the mismatches are localized, are sequence dependent and that the presence of a mismatch can alter the binding of drug like molecules. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. Application of process analytical technology for monitoring freeze-drying of an amorphous protein formulation: use of complementary tools for real-time product temperature measurements and endpoint detection.

    PubMed

    Schneid, Stefan C; Johnson, Robert E; Lewis, Lavinia M; Stärtzel, Peter; Gieseler, Henning

    2015-05-01

    Process analytical technology (PAT) and quality by design have gained importance in all areas of pharmaceutical development and manufacturing. One important method for monitoring of critical product attributes and process optimization in laboratory scale freeze-drying is manometric temperature measurement (MTM). A drawback of this innovative technology is that problems are encountered when processing high-concentrated amorphous materials, particularly protein formulations. In this study, a model solution of bovine serum albumin and sucrose was lyophilized at both conservative and aggressive primary drying conditions. Different temperature sensors were employed to monitor product temperatures. The residual moisture content at primary drying endpoints as indicated by temperature sensors and batch PAT methods was quantified from extracted sample vials. The data from temperature probes were then used to recalculate critical product parameters, and the results were compared with MTM data. The drying endpoints indicated by the temperature sensors were not suitable for endpoint indication, in contrast to the batch methods endpoints. The accuracy of MTM Pice data was found to be influenced by water reabsorption. Recalculation of Rp and Pice values based on data from temperature sensors and weighed vials was possible. Overall, extensive information about critical product parameters could be obtained using data from complementary PAT tools. © 2015 Wiley Periodicals, Inc. and the American Pharmacists Association.

  14. Somatic association of telocentric chromosomes carrying homologous centromeres in common wheat.

    PubMed

    Mello-Sampayo, T

    1973-01-01

    Measurements of distances between telocentric chromosomes, either homologous or representing the opposite arms of a metacentric chromosome (complementary telocentrics), were made at metaphase in root tip cells of common wheat carrying two homologous pairs of complementary telocentrics of chromosome 1 B or 6 B (double ditelosomic 1 B or 6 B). The aim was to elucidate the relative locations of the telocentric chromosomes within the cell. The data obtained strongly suggest that all four telocentrics of chromosome 1 B or 6 B are spacially and simultaneously co-associated. In plants carrying two complementary (6 B (S) and 6 B (L)) and a non-related (5 B (L)) telocentric, only the complementary chromosomes were found to be somatically associated. It is thought, therefore, that the somatic association of chromosomes may involve more than two chromosomes in the same association and, since complementary telocentrics are as much associated as homologous, that the homology between centromeres (probably the only homologous region that exists between complementary telocentrics) is a very important condition for somatic association of chromosomes. The spacial arrangement of chromosomes was studied at anaphase and prophase and the polar orientation of chromosomes at prophase was found to resemble anaphase orientation. This was taken as good evidence for the maintenance of the chromosome arrangement - the Rabl orientation - and of the peripheral location of the centromere and its association with the nuclear membrane. Within this general arrangement homologous telocentric chromosomes were frequently seen to have their centromeres associated or directed towards each other. The role of the centromere in somatic association as a spindle fibre attachment and chromosome binder is discussed. It is suggested that for non-homologous chromosomes to become associated in root tips, the only requirement needed should be the homology of centromeres such as exists between complementary telocentrics, or, as a possible alternative, common repeated sequences of DNA molecules around the centromere region.

  15. Feverfew

    MedlinePlus

    ... Audio) NCCIH Clinical Digest A monthly newsletter with evidence-based information on complementary and integrative practices and a ... migraine headaches, but results have been mixed. However, evidence-based guidelines from the American Academy of Neurology and ...

  16. Ephedra

    MedlinePlus

    ... Audio) NCCIH Clinical Digest A monthly newsletter with evidence-based information on complementary and integrative practices and a ... Kim EJ, Chen Y, Huang JQ, et al. Evidence-based toxicity evaluation and scheduling of Chinese herbal medicines. ...

  17. Determinants of inappropriate timing of introducing solid, semi-solid or soft food to infants in Pakistan: secondary data analysis of Demographic and Health Survey 2006-2007.

    PubMed

    Hazir, Tabish; Senarath, Upul; Agho, Kingsley; Akram, Dure-Samin; Kazmi, Narjis; Abbasi, Saleem; Dibley, Michael J

    2012-01-01

    Inappropriate timing of introducing complementary food deprives the infant of optimum nutrition, leading to undernutrition, and increased mortality and morbidity. The aim of this analysis was to identify determinants of inappropriate timing of introduction of solid, semi-solid and soft foods in Pakistan. Data on 941 infants 3.00 to 8.99 months were obtained from the Pakistan Demographic and Health Survey 2006-2007. The prevalence of introduction of foods among infants aged 3.00-5.99 months and 6.00-8.99 months was examined against a set of individual, household and community level variables using univariate analysis. Adjusted odds ratio (AOR) for early introduction in age 3.00-5.99 months and non-introduction in 6.00-8.99 months of age were calculated using backward stepwise logistic regression models. The prevalence of early introduction of complementary foods among 3.00- to 5.99-month-old and timely introduction among 6.00- to 8.99-month-old infants were 10.6% and 39.2%, respectively. Multivariate analyses revealed that mothers who had four or more antenatal clinic visits (AOR=2.68) and who lived in the provinces of Sindh (AOR=2.89) and Baluchistan (AOR=6.75) were more likely to introduce complementary foods early. Mothers from middle-level households (AOR=7.82), poorer households (AOR=4.84) and poorest households (AOR=5.72) were significantly more likely to delay introduction of complementary foods. In conclusion more than half (60.8%) of Pakistani infants do not receive complementary foods at recommended time. Public health interventions to improve the timing of introduction of complementary food are needed at national level with special focus on high risk groups. © 2011 Blackwell Publishing Ltd.

  18. A combined confocal and magnetic resonance microscope for biological studies

    NASA Astrophysics Data System (ADS)

    Majors, Paul D.; Minard, Kevin R.; Ackerman, Eric J.; Holtom, Gary R.; Hopkins, Derek F.; Parkinson, Christopher I.; Weber, Thomas J.; Wind, Robert A.

    2002-12-01

    Complementary data acquired with different microscopy techniques provide a basis for establishing a more comprehensive understanding of cell function in health and disease, particularly when results acquired with different methodologies can be correlated in time and space. In this article, a novel microscope is described for studying live cells simultaneously with both confocal scanning laser fluorescence optical microscopy and magnetic resonance microscopy. The various design considerations necessary for integrating these two complementary techniques are discussed, the layout and specifications of the instrument are given, and examples of confocal and magnetic resonance images of large frog cells and model tumor spheroids obtained with the compound microscope are presented.

  19. Complementary frequency shifter based on polarization modulator used for generation of a high-quality frequency-locked multicarrier.

    PubMed

    Li, Jianping; Yu, Changyuan; Li, Zhaohui

    2014-03-15

    A novel polarization-modulator-based complementary frequency shifter (PCFS) has been proposed and then used to implement the generation of a frequency-locked multicarrier with single- and dual-recirculating frequency shifting loops, respectively. The transfer functions and output properties of PCFS and PCFS-based multicarrier generator have been studied theoretically. Based on our simulation results through VPItransmissionMaker software, 100 stable carriers have been obtained with acceptable flatness while no DC bias control is required. The results show that the proposed PCFS has the potential to become a commercial product and then used in various scenarios.

  20. Complementary uses of small angle X-ray scattering and X-ray crystallography.

    PubMed

    Pillon, Monica C; Guarné, Alba

    2017-11-01

    Most proteins function within networks and, therefore, protein interactions are central to protein function. Although stable macromolecular machines have been extensively studied, dynamic protein interactions remain poorly understood. Small-angle X-ray scattering probes the size, shape and dynamics of proteins in solution at low resolution and can be used to study samples in a large range of molecular weights. Therefore, it has emerged as a powerful technique to study the structure and dynamics of biomolecular systems and bridge fragmented information obtained using high-resolution techniques. Here we review how small-angle X-ray scattering can be combined with other structural biology techniques to study protein dynamics. This article is part of a Special Issue entitled: Biophysics in Canada, edited by Lewis Kay, John Baenziger, Albert Berghuis and Peter Tieleman. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. EAS Cerenkov measurements of the composition of the cosmic ray flux around 10 to the 16th power eV

    NASA Technical Reports Server (NTRS)

    Dawson, B. R.; Prescott, J. R.; Clay, R. W.

    1985-01-01

    Information can be obtained about the nature of a primary cosmic ray by looking at the way in which an extensive air shower (EAS) develops in the atmosphere. Heavy nuclei give rise to showers that develop high in the atmosphere and the depth of maximum development is subjected to much smaller fluctuations than is the case for showers originating from protons. This development is followed by optical methods based on the observations of Cerenkov light or fluorescence light. The Cerenkov observations have two complementary techniques: measurement of the time profile of the Cerenkov pulse with resolution of a few nanoseconds and measurement of the lateral distribution of the Cerenkov light. In each case the measured quantities must be related to some characteristic development parameters.

  2. Arctic Research NASA's Cryospheric Sciences Program

    NASA Technical Reports Server (NTRS)

    Waleed, Abdalati; Zukor, Dorothy J. (Technical Monitor)

    2001-01-01

    Much of NASA's Arctic Research is run through its Cryospheric Sciences Program. Arctic research efforts to date have focused primarily on investigations of the mass balance of the largest Arctic land-ice masses and the mechanisms that control it, interactions among sea ice, polar oceans, and the polar atmosphere, atmospheric processes in the polar regions, energy exchanges in the Arctic. All of these efforts have been focused on characterizing, understanding, and predicting, changes in the Arctic. NASA's unique vantage from space provides an important perspective for the study of these large scale processes, while detailed process information is obtained through targeted in situ field and airborne campaigns and models. An overview of NASA investigations in the Arctic will be presented demonstrating how the synthesis of space-based technology, and these complementary components have advanced our understanding of physical processes in the Arctic.

  3. The Complementary Therapies for Labour and Birth Study making sense of labour and birth - Experiences of women, partners and midwives of a complementary medicine antenatal education course.

    PubMed

    Levett, K M; Smith, C A; Bensoussan, A; Dahlen, H G

    2016-09-01

    to gain insight into the experiences of women, partners and midwives who participated in the Complementary Therapies for Labour and Birth Study, an evidence based complementary medicine (CM) antenatal education course. qualitative in-depth interviews and a focus group as part of the Complementary Therapies for Labour and Birth Study. thirteen low risk primiparous women and seven partners who had participated in the study group of a randomised controlled trial of the complementary therapies for labour and birth study, and 12 midwives caring for these women. The trial was conducted at two public hospitals, and through the Western Sydney University in Sydney, Australia. the Complementary Therapies for Labour and Birth (CTLB) protocol, based on the She Births® course and the Acupressure for labour and birth protocol, incorporated six evidence-based complementary medicine (CM) techniques; acupressure, relaxation, visualisation, breathing, massage, yoga techniques and incorporated facilitated partner support. Randomisation to the trial occurred at 24-36 weeks' gestation, and participants attended a two-day antenatal education programme, plus standard care, or standard care alone. the overarching theme identified in the qualitative data was making sense of labour and birth. Women used information about normal birth physiology from the course to make sense of labour, and to utilise the CM techniques to support normal birth and reduce interventions in labour. Women's, partners' and midwives' experience of the course and its use during birth gave rise to supporting themes such as: working for normal; having a toolkit; and finding what works. the Complementary Therapies for Labour and Birth Study provided women and their partners with knowledge to understand the physiology of normal labour and birth and enabled them to use evidence-based CM tools to support birth and reduce interventions. the Complementary Therapies for Labour and Birth Study introduces concepts of what constitutes normal birth and provides skills to support women, partners and midwives. It appears to be an effective form of antenatal education that supports normal birth, and maternity services need to consider how they can reform current antenatal education in line with this evidence. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.

  4. Acai

    MedlinePlus

    ... Audio) NCCIH Clinical Digest A monthly newsletter with evidence-based information on complementary and integrative practices and a ... What Have We Learned? There’s no definitive scientific evidence based on studies in people to support the use ...

  5. Online Hierarchical Sparse Representation of Multifeature for Robust Object Tracking

    PubMed Central

    Qu, Shiru

    2016-01-01

    Object tracking based on sparse representation has given promising tracking results in recent years. However, the trackers under the framework of sparse representation always overemphasize the sparse representation and ignore the correlation of visual information. In addition, the sparse coding methods only encode the local region independently and ignore the spatial neighborhood information of the image. In this paper, we propose a robust tracking algorithm. Firstly, multiple complementary features are used to describe the object appearance; the appearance model of the tracked target is modeled by instantaneous and stable appearance features simultaneously. A two-stage sparse-coded method which takes the spatial neighborhood information of the image patch and the computation burden into consideration is used to compute the reconstructed object appearance. Then, the reliability of each tracker is measured by the tracking likelihood function of transient and reconstructed appearance models. Finally, the most reliable tracker is obtained by a well established particle filter framework; the training set and the template library are incrementally updated based on the current tracking results. Experiment results on different challenging video sequences show that the proposed algorithm performs well with superior tracking accuracy and robustness. PMID:27630710

  6. Conventions and nomenclature for double diffusion encoding NMR and MRI.

    PubMed

    Shemesh, Noam; Jespersen, Sune N; Alexander, Daniel C; Cohen, Yoram; Drobnjak, Ivana; Dyrby, Tim B; Finsterbusch, Jurgen; Koch, Martin A; Kuder, Tristan; Laun, Fredrik; Lawrenz, Marco; Lundell, Henrik; Mitra, Partha P; Nilsson, Markus; Özarslan, Evren; Topgaard, Daniel; Westin, Carl-Fredrik

    2016-01-01

    Stejskal and Tanner's ingenious pulsed field gradient design from 1965 has made diffusion NMR and MRI the mainstay of most studies seeking to resolve microstructural information in porous systems in general and biological systems in particular. Methods extending beyond Stejskal and Tanner's design, such as double diffusion encoding (DDE) NMR and MRI, may provide novel quantifiable metrics that are less easily inferred from conventional diffusion acquisitions. Despite the growing interest on the topic, the terminology for the pulse sequences, their parameters, and the metrics that can be derived from them remains inconsistent and disparate among groups active in DDE. Here, we present a consensus of those groups on terminology for DDE sequences and associated concepts. Furthermore, the regimes in which DDE metrics appear to provide microstructural information that cannot be achieved using more conventional counterparts (in a model-free fashion) are elucidated. We highlight in particular DDE's potential for determining microscopic diffusion anisotropy and microscopic fractional anisotropy, which offer metrics of microscopic features independent of orientation dispersion and thus provide information complementary to the standard, macroscopic, fractional anisotropy conventionally obtained by diffusion MR. Finally, we discuss future vistas and perspectives for DDE. © 2015 Wiley Periodicals, Inc.

  7. Combining fibre optic Raman spectroscopy and tactile resonance measurement for tissue characterization

    NASA Astrophysics Data System (ADS)

    Candefjord, Stefan; Nyberg, Morgan; Jalkanen, Ville; Ramser, Kerstin; Lindahl, Olof A.

    2010-12-01

    Tissue characterization is fundamental for identification of pathological conditions. Raman spectroscopy (RS) and tactile resonance measurement (TRM) are two promising techniques that measure biochemical content and stiffness, respectively. They have potential to complement the golden standard--histological analysis. By combining RS and TRM, complementary information about tissue content can be obtained and specific drawbacks can be avoided. The aim of this study was to develop a multivariate approach to compare RS and TRM information. The approach was evaluated on measurements at the same points on porcine abdominal tissue. The measurement points were divided into five groups by multivariate analysis of the RS data. A regression analysis was performed and receiver operating characteristic (ROC) curves were used to compare the RS and TRM data. TRM identified one group efficiently (area under ROC curve 0.99). The RS data showed that the proportion of saturated fat was high in this group. The regression analysis showed that stiffness was mainly determined by the amount of fat and its composition. We concluded that RS provided additional, important information for tissue identification that was not provided by TRM alone. The results are promising for development of a method combining RS and TRM for intraoperative tissue characterization.

  8. GeneStoryTeller: a mobile app for quick and comprehensive information retrieval of human genes

    PubMed Central

    Eleftheriou, Stergiani V.; Bourdakou, Marilena M.; Athanasiadis, Emmanouil I.; Spyrou, George M.

    2015-01-01

    In the last few years, mobile devices such as smartphones and tablets have become an integral part of everyday life, due to their software/hardware rapid development, as well as the increased portability they offer. Nevertheless, up to now, only few Apps have been developed in the field of bioinformatics, capable to perform fast and robust access to services. We have developed the GeneStoryTeller, a mobile application for Android platforms, where users are able to instantly retrieve information regarding any recorded human gene, derived from eight publicly available databases, as a summary story. Complementary information regarding gene–drugs interactions, functional annotation and disease associations for each selected gene is also provided in the gene story. The most challenging part during the development of the GeneStoryTeller was to keep balance between storing data locally within the app and obtaining the updated content dynamically via a network connection. This was accomplished with the implementation of an administrative site where data are curated and synchronized with the application requiring a minimum human intervention. Database URL: http://bioserver-3.bioacademy.gr/Bioserver/GeneStoryTeller/. PMID:26055097

  9. Hot flashes severity, complementary and alternative medicine use, and self-rated health in women with breast cancer.

    PubMed

    Chandwani, Kavita D; Heckler, Charles E; Mohile, Supriya G; Mustian, Karen M; Janelsins, Michelle; Peppone, Luke J; Bushunow, Peter; Flynn, Patrick J; Morrow, Gary R

    2014-01-01

    Hot flashes (HF) are a common distressing symptom in women with breast cancer (BC). Current pharmacologic options are moderately effective and are associated with bothersome side effects. Complementary and alternative medicine is commonly used by cancer patients. However, information on the association of hot flashes severity with such use and self-rated health is lacking. To examine the hot flashes severity in women with breast cancer and its association with complementary and alternative medicine use and self-rated health (SRH). Longitudinal multicenter study to assess information needs of cancer outpatients. Patients with a diagnosis of breast cancer who were scheduled to undergo chemotherapy and/or radiotherapy. Hot flashes severity (0 = not present and 10 = as bad as you can imagine), use of complementary and alternative medicine (yes/no), and self-rating of health (SRH) status post-treatment and six-months thereafter (1-5, higher score = better SRH). The majority of women with HF (mean age = 54.4 years) were Caucasian and married, with higher education, and 93% had received surgical treatment for BC. At the end of treatment, 79% women reported experiencing HF [mean severity = 5.87, standard deviation (SD) = 2.9]; significantly more severe HF were reported by younger women with poor SRH, poor performance status, and those reporting doing spiritual practices. At follow-up, 73% had HF (mean severity = 4.86, SD = 3.0), and more severe HF were reported by younger women with poor self-rated health who had undergone chemotherapy plus radiotherapy, used vitamins, and did not exercise. A high percentage of women experienced hot flashes at the end of treatment and at six-month follow-up. A significant association of hot flashes severity with spiritual practice, increased vitamin use, and reduced exercise emphasize the need for future studies to confirm the results. This can facilitate safe use of complementary and alternative medicine and favorable outcomes while managing cancer-related hot flashes. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Loopedia, a database for loop integrals

    NASA Astrophysics Data System (ADS)

    Bogner, C.; Borowka, S.; Hahn, T.; Heinrich, G.; Jones, S. P.; Kerner, M.; von Manteuffel, A.; Michel, M.; Panzer, E.; Papara, V.

    2018-04-01

    Loopedia is a new database at loopedia.org for information on Feynman integrals, intended to provide both bibliographic information as well as results made available by the community. Its bibliometry is complementary to that of INSPIRE or arXiv in the sense that it admits searching for integrals by graph-theoretical objects, e.g. its topology.

  11. Mapping out the Transition toward Information Societies: Social Nature, Growth, and Policies

    ERIC Educational Resources Information Center

    Hilbert, Martin

    2012-01-01

    This research thesis sheds lights on different aspects of the transition toward information societies. It consists of a collection of interrelated studies that analyze in more rigorous terms three main and complementary aspects of the transition (see Figure below). After and "introductory" CHAPTER ONE, the consecutive CHAPTER TWO of this…

  12. Mental "Space" Travel: Damage to Posterior Parietal Cortex Prevents Egocentric Navigation and Reexperiencing of Remote Spatial Memories

    ERIC Educational Resources Information Center

    Ciaramelli, Elisa; Rosenbaum, R. Shayna; Solcz, Stephanie; Levine, Brian; Moscovitch, Morris

    2010-01-01

    The ability to navigate in a familiar environment depends on both an intact mental representation of allocentric spatial information and the integrity of systems supporting complementary egocentric representations. Although the hippocampus has been implicated in learning new allocentric spatial information, converging evidence suggests that the…

  13. Is a Partner's Competence Threatening during Dyadic Cooperative Work? It Depends on Resource Interdependence

    ERIC Educational Resources Information Center

    Buchs, Celine; Butera, Fabrizio

    2009-01-01

    Previous studies with university students have shown that resource interdependence during cooperative dyadic work on texts produces two different dynamics in student interaction and learning. Working on complementary information produces positive interactions, but a good quality of information transmission is needed to foster student learning.…

  14. Magnetic resonance imaging for the study of mummies.

    PubMed

    Giovannetti, Giulio; Guerrini, Andrea; Carnieri, Emiliano; Salvadori, Piero A

    2016-07-01

    Nondestructive diagnostic imaging for mummies study has a long tradition and high-resolution images of the samples morphology have been extensively acquired by using computed tomography (CT). However, although in early reports no signal or image was obtained because of the low water content, mummy magnetic resonance imaging (MRI) was demonstrated able to generate images of such ancient specimens by using fast imaging techniques. Literature demonstrated the general feasibility of nonclinical MRI for visualizing historic human tissues, which is particularly interesting for archeology. More recently, multinuclear magnetic resonance spectroscopy (MRS) was demonstrated able to detect numerous organic biochemicals from such remains. Although the quality of these images is not yet comparable to that of clinical magnetic resonance (MR) images, and further research will be needed for determining the full capacity of MR in this topic, the information obtained with MR can be viewed as complementary to the one provided by CT and useful for paleoradiological studies of mummies. This work contains an overview of the state of art of the emerging uses of MRI in paleoradiology. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Comprehensive sample analysis using high performance liquid chromatography with multi-detection.

    PubMed

    Pravadali, Sercan; Bassanese, Danielle N; Conlan, Xavier A; Francis, Paul S; Smith, Zoe M; Terry, Jessica M; Shalliker, R Andrew

    2013-11-25

    Herein we assess the separation space offered by a liquid chromatography system with an optimised uni-dimensional separation for the determination of the key chemical entities in the highly complex matrix of a tobacco leaf extract. Multiple modes of detection, including UV-visible absorbance, chemiluminescence (acidic potassium permanganate, manganese(IV), and tris(2,2'-bipyridine)ruthenium(III)), mass spectrometry and DPPH radical scavenging were used in an attempt to systematically reduce the data complexity of the sample whilst obtaining a greater degree of molecule-specific information. A large amount of chemical data was obtained, but several limitations in the ability to assign detector responses to particular compounds, even with the aid of complementary detection systems, were observed. Thirty-three compounds were detected via MS on the tobacco extract and 12 out of 32 compounds gave a peak height ratio (PHR) greater than 0.33 on one or more detectors. This paper serves as a case study of these limitations, illustrating why multidimensional chromatography is an important consideration when developing a comprehensive chemical detection system. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Useful surface parameters for biomaterial discrimination.

    PubMed

    Etxeberria, Marina; Escuin, Tomas; Vinas, Miquel; Ascaso, Carlos

    2015-01-01

    Topographical features of biomaterials' surfaces are determinant when addressing their application site. Unfortunately up to date there has not been an agreement regarding which surface parameters are more representative in discriminating between materials. Discs (n = 16) of different currently used materials for implant prostheses fabrication, such as cast cobalt-chrome, direct laser metal soldered (DLMS) cobalt-chrome, titanium grade V, zirconia (Y-TZP), E-glass fiber-reinforced composite and polyetheretherketone (PEEK) were manufactured. Nanoscale topographical surface roughness parameters generated by atomic force microscopy (AFM), microscale surface roughness parameters obtained by white light interferometry (WLI) and water angle values obtained by the sessile-water-drop method were analyzed in order to assess which parameter provides the best optimum surface characterization method. Correlations between nanoroughness, microroughness, and hydrophobicity data were performed to achieve the best parameters giving the highest discriminatory power. A subset of six parameters for surface characterization were proposed. AFM and WLI techniques gave complementary information. Wettability did not correlate with any of the nanoroughness parameters while it however showed a weak correlation with microroughness parameters. © Wiley Periodicals, Inc.

  17. Microanalysis (micro-XRF, micro-XANES, and micro-XRD) of a tertiary sediment using microfocused synchrotron radiation.

    PubMed

    Denecke, Melissa A; Somogyi, Andrea; Janssens, Koen; Simon, Rolf; Dardenne, Kathy; Noseck, Ulrich

    2007-06-01

    Micro-focused synchrotron radiation techniques to investigate actinide elements in geological samples are becoming an increasingly used tool in nuclear waste disposal research. In this article, results using mu-focus techniques are presented from a bore core section of a U-rich tertiary sediment collected from Ruprechtov, Czech Republic, a natural analog to nuclear waste repository scenarios in deep geological formations. Different methods are applied to obtain various, complementary information. Elemental and element chemical state distributions are obtained from micro-XRF measurements, oxidation states of As determined from micro-XANES, and the crystalline structure of selected regions are studied by means of micro-XRD. We find that preparation of the thin section created an As oxidation state artifact; it apparently changed the As valence in some regions of the sample. Results support our previously proposed hypothesis of the mechanism for U-enrichment in the sediment. AsFeS coating on framboid Fe nodules in the sediment reduced mobile groundwater-dissolved U(VI) to less-soluble U(IV), thereby immobilizing the uranium in the sediment.

  18. Network gatekeeping: complementary medicine information on the websites of medical institutions.

    PubMed

    Keshet, Yael

    2012-03-01

    Integrative medicine - complementary and alternative medicine (CAM) practised in mainstream healthcare organizations - combines medical treatments based on incommensurable paradigms. As the Internet has been portrayed as a crucial pathway to CAM and sites administered by reputable organizations are considered to be relatively reliable sources of medical information, the research sought to explore and compare the ways in which CAM is presented on the Internet websites of diverse medical institutions. The contents of the websites of the Ministry of Health, the Israeli Medical Association and Israeli healthcare organizations were analysed, using an interdisciplinary theory of network gatekeeping. The websites were analysed not only according to the degree to which they are considered to be informative, but also with regard to the perceptions of integration that they convey. Comparison of the websites of community healthcare organizations and hospitals indicates that while the former display CAM treatments as an attractive commodity, the latter convey a message stressing the need to subject CAM to bio-medical scrutiny. Little or no information was provided concerning a number of important issues, such as research findings about efficacy and safety, risks and ethical considerations.

  19. Symptoms Experienced and Information Needs of Women Receiving Chemotherapy.

    PubMed

    Uysal, Neşe; Toprak, Filiz Ünal; Kutlutsürkan, Sevinç; Erenel, Ayten Şentürk

    2018-01-01

    This study is carried out to determine the symptoms and information necessity on chemotherapy (CT) treatment of the women with breast cancer. A total of 170 women older than 18 years old, who receive CT with breast cancer diagnosis, are volunteered to participate in the study. Mixed method was used in the study. Data are collected using Descriptive Data Form, Interview Form and Memorial Symptom Assessment Scale. As a result of the cluster analysis, four clusters and the symptoms within have been obtained. These are: pain, lack of energy, feeling drowsy, sweat, swelling of hands, and feet in the first cluster; feeling nervous, difficulty sleeping, feeling sad, worrying in the second cluster; nausea, feeling bloating, change in the way food tastes, hair loss, constipation in the third cluster; vomiting, diarrhea, problems with sexual interest, lack of appetite, dizziness, and weight loss in the forth cluster. Women's information necessity related to the CT are follows: the effects of CT, other treatment options beyond CT, complementary methods, the effect of the CT treatment on reproductive health and sexuality, nutrition, and symptom control. The results of this study will enable determination of symptom clusters, which health professionals are easier to focus on these symptoms. An understanding information need of patients can help to ensure that individual's coping strategies and self-management.

  20. A compilation of technology spinoffs from the US Space Shuttle Program

    NASA Technical Reports Server (NTRS)

    Jackson, David Jeff

    1993-01-01

    As the successful transfer of NASA-developed technology is a stated mission of NASA, the documentation of such transfer is vital in support of the program. The purpose of this report is to document technology transfer, i.e. 'spinoffs', from the U.S. Space Shuttle Program to the commercial sector. These spinoffs have their origin in the many scientific and engineering fields associated with the shuttle program and, as such, span many diverse commercial applications. These applications include, but are not limited to, consumer products, medicine, industrial productivity, manufacturing technology, public safety, resources management, materials processing, transportation, energy, computer technology, construction, and environmental applications. To aide to the generation of this technology spinoff list, significant effort was made to establish numerous and complementary sources of information. The primary sources of information used in compiling this list include: the NASA 'Spinoff' publication, NASA Tech Briefs, the Marshall Space Flight Center (MSFC) Technology Utilization (TU) Office, the NASA Center for Aerospace Information (CASI), the NASA COSMIC Software Center, and MSFC laboratory and contractor personnel. A complete listing of resources may be found in the bibliography of this report. Additionally, effort was made to insure that the obtained information was placed in electronic database form to insure that the subsequent updating would be feasible with minimal effort.

  1. Experimental MRI-SPECT insert system with Hybrid Semiconductor detectors Timepix for MR animal scanner Bruker 47/20

    NASA Astrophysics Data System (ADS)

    Zajicek, J.; Burian, M.; Soukup, P.; Novak, V.; Macko, M.; Jakubek, J.

    2017-01-01

    Multimodal medical imaging based on Magnetic Resonance is mainly combinated with one of the scintigraphic method like PET or SPECT. These methods provide functional information whereas magnetic resonance imaging provides high spatial resolution of anatomical information or complementary functional information. Fusion of imaging modalities allows researchers to obtain complimentary information in a single measurement. The combination of MRI with SPECT is still relatively new and challenging in many ways. The main complication of using SPECT in MRI systems is the presence of a high magnetic field therefore (ferro)magnetic materials have to be eliminated. Furthermore the application of radiofrequency fields within the MR gantry does not allow for the use of conductive structures such as the common heavy metal collimators. This work presents design and construction of an experimental MRI-SPECT insert system and its initial tests. This unique insert system consists of an MR-compatible SPECT setup with CdTe pixelated sensors Timepix tungsten collimators and a radiofrequency coil. Measurements were performed on a gelatine and tissue phantom with an embedded radioisotopic source (57Co 122 keV γ ray) inside the RF coil by the Bruker BioSpec 47/20 (4.7 T) MR animal scanner. The project was performed in the framework of the Medipix Collaboration.

  2. Perceptions, use and attitudes of pharmacy customers on complementary medicines and pharmacy practice

    PubMed Central

    2010-01-01

    Background Complementary medicines (CMs) are popular amongst Australians and community pharmacy is a major supplier of these products. This study explores pharmacy customer use, attitudes and perceptions of complementary medicines, and their expectations of pharmacists as they relate to these products. Methods Pharmacy customers randomly selected from sixty large and small, metropolitan and rural pharmacies in three Australian states completed an anonymous, self administered questionnaire that had been pre-tested and validated. Results 1,121 customers participated (response rate 62%). 72% had used CMs within the previous 12 months, 61% used prescription medicines daily and 43% had used both concomitantly. Multivitamins, fish oils, vitamin C, glucosamine and probiotics were the five most popular CMs. 72% of people using CMs rated their products as 'very effective' or 'effective enough'. CMs were as frequently used by customers aged 60 years or older as younger customers (69% vs. 72%) although the pattern of use shifted with older age. Most customers (92%) thought pharmacists should provide safety information about CMs, 90% thought they should routinely check for interactions, 87% thought they should recommend effective CMs, 78% thought CMs should be recorded in customer's medication profile and 58% thought pharmacies stocking CMs should also employ a complementary medicine practitioner. Of those using CMs, 93% thought it important for pharmacists to be knowledgeable about CMs and 48% felt their pharmacist provides useful information about CMs. Conclusions CMs are widely used by pharmacy customers of all ages who want pharmacists to be more involved in providing advice about these products. PMID:20646290

  3. TU-H-CAMPUS-IeP3-01: Simultaneous PET Restoration and PET/CT Co-Segmentation Using a Variational Method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, L; Tan, S; Lu, W

    Purpose: PET images are usually blurred due to the finite spatial resolution, while CT images suffer from low contrast. Segment a tumor from either a single PET or CT image is thus challenging. To make full use of the complementary information between PET and CT, we propose a novel variational method for simultaneous PET image restoration and PET/CT images co-segmentation. Methods: The proposed model was constructed based on the Γ-convergence approximation of Mumford-Shah (MS) segmentation model for PET/CT co-segmentation. Moreover, a PET de-blur process was integrated into the MS model to improve the segmentation accuracy. An interaction edge constraint termmore » over the two modalities were specially designed to share the complementary information. The energy functional was iteratively optimized using an alternate minimization (AM) algorithm. The performance of the proposed method was validated on ten lung cancer cases and five esophageal cancer cases. The ground truth were manually delineated by an experienced radiation oncologist using the complementary visual features of PET and CT. The segmentation accuracy was evaluated by Dice similarity index (DSI) and volume error (VE). Results: The proposed method achieved an expected restoration result for PET image and satisfactory segmentation results for both PET and CT images. For lung cancer dataset, the average DSI (0.72) increased by 0.17 and 0.40 than single PET and CT segmentation. For esophageal cancer dataset, the average DSI (0.85) increased by 0.07 and 0.43 than single PET and CT segmentation. Conclusion: The proposed method took full advantage of the complementary information from PET and CT images. This work was supported in part by the National Cancer Institute Grants R01CA172638. Shan Tan and Laquan Li were supported in part by the National Natural Science Foundation of China, under Grant Nos. 60971112 and 61375018.« less

  4. Use of complementary and alternative medicine by patients with hematological diseases experience at a university hospital in northeast Mexico.

    PubMed

    Jaime-Pérez, José Carlos; Chapa-Rodríguez, Adrián; Rodríguez-Martínez, Marisol; Colunga-Pedraza, Perla Rocío; Marfil-Rivera, Luis Javier; Gómez-Almaguer, David

    2012-01-01

    Complementary and alternative medicine includes a diverse group of medical and healthcare systems, practices and products not considered part of conventional medicine. Although there is information on unconventional practices in oncological diseases, specific data regarding the use of complementary and alternative medicine by hematology patients is scarce. The aim of this study is to document the prevalence of this modality of unconventional therapy in patients with malignant and benign hematological diseases, particularly children with acute lymphoblastic leukemia. An observational study of adult patients and guardians of children with malignant or benign hematological diseases was carried out by applying a structured questionnaire detailing the use and results of the most prevalent complementary and alternative medicine practices. One hundred and twenty patients were included; 104 had malignant and 16 had benign hematological diseases. The use of complementary and alternative medicine was greater in benign diseases but the difference was not statistically significant (64.7% versus 41.7%; p-value = 0.08). Patients and guardians with high school or college educations used these alternative practices more than patients with less schooling (60.7% versus 54.7%; p-value = 0.032). The use of folk remedies was most prevalent followed by herbal preparations and spiritual healing. Sixty-four percent of patients that used these unconventional practices reported improvement in their symptoms and increased capacity to perform daily activities. No significant difference was documented between patients with malignant or benign hematological diseases using these alternative practices. The majority of complementary and alternative medicine users reported improvement of the disease or chemotherapy-related symptoms.

  5. Methodological Issues in Trials of Complementary and Alternative Medicine Interventions

    PubMed Central

    Sikorskii, Alla; Wyatt, Gwen; Victorson, David; Faulkner, Gwen; Rahbar, Mohammad Hossein

    2010-01-01

    Background Complementary and alternative medicine (CAM) use is widespread among cancer patients. Information on safety and efficacy of CAM therapies is needed for both patients and health care providers. Well-designed randomized clinical trials (RCTs) of CAM therapy interventions can inform both clinical research and practice. Objectives To review important issues that affect the design of RCTs for CAM interventions. Methods Using the methods component of the Consolidated Standards for Reporting Trials (CONSORT) as a guiding framework, and a National Cancer Institute-funded reflexology study as an exemplar, methodological issues related to participants, intervention, objectives, outcomes, sample size, randomization, blinding, and statistical methods were reviewed. Discussion Trials of CAM interventions designed and implemented according to appropriate methodological standards will facilitate the needed scientific rigor in CAM research. Interventions in CAM can be tested using proposed methodology, and the results of testing will inform nursing practice in providing safe and effective supportive care and improving the well-being of patients. PMID:19918155

  6. The Current Studies of Education for a Traditional and Complementary Medicine in Malaysia

    PubMed Central

    Kim, Yun Jin

    2017-01-01

    The aim of this study is to understand the current tradition and complementary medicine (T&CM) education in Malaysia. We referred to literature regarding to traditional medicine education in Malaysia, and collected the information via website or interview with faculty of T&CM in universities/colleges and Division of T&CM, Ministry of Health, Malaysia. T&CM education in Malaysia has been following China’s T&CM systems for 50 years. Currently, Division of T&CM, Ministry of Health; and Ministry of Higher Education has approved 11 institutions to offer T&CM education. Students may major in Chinese herbal medicine, acupuncture, or other T&CM subjects. Generally, clinical training programs in China, Taiwan, or Australia include substantial proportion of clinical training. We report on the general information of T&CM education in Malaysia. This result would be the first-stage information for the establishment of a strategy regarding the enhancement of T&CM education in Malaysia. PMID:28853309

  7. NGSI student activities in open source information analysis in support of the training program of the U.S. DOE laboratories for the entry into force of the additional protocol

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sandoval, M Analisa; Uribe, Eva C; Sandoval, Marisa N

    2009-01-01

    In 2008 a joint team from Los Alamos National Laboratory (LANL) and Brookhaven National Laboratory (BNL) consisting of specialists in training of IAEA inspectors in the use of complementary access activities formulated a training program to prepare the U.S. Doe laboratories for the entry into force of the Additional Protocol. As a major part of the support of the activity, LANL summer interns provided open source information analysis to the LANL-BNL mock inspection team. They were a part of the Next Generation Safeguards Initiative's (NGSI) summer intern program aimed at producing the next generation of safeguards specialists. This paper describesmore » how they used open source information to 'backstop' the LANL-BNL team's effort to construct meaningful Additional Protocol Complementary Access training scenarios for each of the three DOE laboratories, Lawrence Livermore National Laboratory, Idaho National Laboratory, and Oak Ridge National Laboratory.« less

  8. Integration of complementary and alternative medicine information and advice in chronic disease management guidelines.

    PubMed

    Team, Victoria; Canaway, Rachel; Manderson, Lenore

    2011-01-01

    The growing evidence on the benefits and risks of complementary and alternative medicine (CAM) and its high rate of use (69% of Australians) - particularly for chronic or recurrent conditions - means increasing attention on CAM. However, few people disclose CAM use to their GP, and health professionals tend to inadequately discuss CAM-related issues with their patients, partly due to insufficient knowledge. As clinical and non-clinical chronic condition management guidelines are a means to educate primary health care practitioners, we undertook a content analysis of guidelines relevant to two common chronic conditions - cardiovascular disease (CVD) and type 2 diabetes mellitus (T2DM) - to assess their provision of CAM-related information. Ten current Australian guidelines were reviewed, revealing scant CAM content. When available, the CAM-relevant information was brief, in some cases unclear, inconclusive and lacking in direction to the GP or health care provider. Although we focus on CVD and T2DM, we argue the value of all chronic condition management guidelines integrating relevant evidence-informed information and advice on CAM risks, benefits and referrals, to increase GP awareness and knowledge of appropriate CAM therapies, and potentially to facilitate doctor-client discussion about CAM.

  9. Numerical approach to describe complementary drying of banana slices osmotically dehydrated

    NASA Astrophysics Data System (ADS)

    da Silva Júnior, Aluízio Freire; da Silva, Wilton Pereira; de Farias Aires, Juarez Everton; Farias Aires, Kalina Lígia C. A.

    2018-02-01

    In this work, diffusion model was used to describe the water loss in the complementary drying process of cylindrical slices of banana pretreated by osmotic dehydration. A numerical solution has been proposed for the diffusion equation in cylindrical coordinates, which was obtained through the Finite Volume Method. The diffusion equation was discretized assuming that the effective water diffusivity and the dimensions of a finite cylinder may vary; also considering the boundary condition of the third kind. The banana slices were cut in length of about 1.00 cm and average radius 1.70 cm before osmotic pretreatment, and completed the pretreatment with length of about 0.74 cm and average radius 1.40 cm. The complementary drying was carried out in a kiln with circulation and air exchange. Drying temperatures were the same as used in the osmotic pretreatment (40 to 70 °C). The proposed model described well the water loss, with good statistical indicators for all fits.

  10. A Source-based Measurement Database for Occupational Exposure Assessment of Electromagnetic Fields in the INTEROCC Study: A Literature Review Approach

    PubMed Central

    Vila, Javier; Bowman, Joseph D.; Richardson, Lesley; Kincl, Laurel; Conover, Dave L.; McLean, Dave; Mann, Simon; Vecchia, Paolo; van Tongeren, Martie; Cardis, Elisabeth

    2016-01-01

    Introduction: To date, occupational exposure assessment of electromagnetic fields (EMF) has relied on occupation-based measurements and exposure estimates. However, misclassification due to between-worker variability remains an unsolved challenge. A source-based approach, supported by detailed subject data on determinants of exposure, may allow for a more individualized exposure assessment. Detailed information on the use of occupational sources of exposure to EMF was collected as part of the INTERPHONE-INTEROCC study. To support a source-based exposure assessment effort within this study, this work aimed to construct a measurement database for the occupational sources of EMF exposure identified, assembling available measurements from the scientific literature. Methods: First, a comprehensive literature search was performed for published and unpublished documents containing exposure measurements for the EMF sources identified, a priori as well as from answers of study subjects. Then, the measurements identified were assessed for quality and relevance to the study objectives. Finally, the measurements selected and complementary information were compiled into an Occupational Exposure Measurement Database (OEMD). Results: Currently, the OEMD contains 1624 sets of measurements (>3000 entries) for 285 sources of EMF exposure, organized by frequency band (0 Hz to 300 GHz) and dosimetry type. Ninety-five documents were selected from the literature (almost 35% of them are unpublished technical reports), containing measurements which were considered informative and valid for our purpose. Measurement data and complementary information collected from these documents came from 16 different countries and cover the time period between 1974 and 2013. Conclusion: We have constructed a database with measurements and complementary information for the most common sources of exposure to EMF in the workplace, based on the responses to the INTERPHONE-INTEROCC study questionnaire. This database covers the entire EMF frequency range and represents the most comprehensive resource of information on occupational EMF exposure. It is available at www.crealradiation.com/index.php/en/databases. PMID:26493616

  11. Willingness to Pay for Complementary Health Care Insurance in Iran.

    PubMed

    Nosratnejad, Shirin; Rashidian, Arash; Akbari Sari, Ali; Moradi, Najme

    2017-09-01

    Complementary health insurance is increasingly used to remedy the limitations and shortcomings of the basic health insurance benefit packages. Hence, it is essential to gather reliable information about the amount of Willingness to Pay (WTP) for health insurance. We assessed the WTP for health insurance in Iran in order to suggest an affordable complementary health insurance. The study sample consisted of 300 household heads all over provinces of Iran in 2013. The method applied was double bounded dichotomous choice and open-ended question approach of contingent valuation. The average WTP for complementary health insurance per person per month by double bounded dichotomous choice and open-ended question method respectively was 199000 and 115300 Rials (8 and 4.6 USD, respectively). Household's heads with higher levels of income and those who worked had more WTP for the health insurance. Besides, the WTP increased in direct proportion to the number of insured members of each household and in inverse proportion to the family size. The WTP value can be used as a premium in a society. As an important finding, the study indicated that the households were willing to pay higher premiums than currently collected for the complementary health insurance coverage in Iran. This offers the policy makers the opportunity to increase the premium and provide good benefits package for insured people of country then better risk pooling.

  12. Advanced traveler information service (ATIS) : "Who are ATIS customers?

    DOT National Transportation Integrated Search

    2000-01-01

    This paper offers answers to "Who are ATIS Customers?" using different, complementary research and evaluation approaches. The first section, entitled External Factors Influencing Customer Demand, offers an empirical assessment of external conditions ...

  13. Risks of Liver (Hepatocellular) Cancer Screening

    MedlinePlus

    ... rare, but serious, side effects : Hemorrhage . Trouble breathing. Leakage of bile , which can cause an infection of ... of the latest published information on cancer prevention, detection, genetics, treatment, supportive care, and complementary and alternative ...

  14. Older Adults and Food Safety

    MedlinePlus

    ... bodies are less able to combat bacteria. For example, there is a decrease in stomach acid secretion, ... Civil Rights | No FEAR | Information Quality Complementary Content ${title} ${loading} ${title} ${loading} ibmCfg.controllers.navigation true true ...

  15. Cat's Claw

    MedlinePlus

    ... Audio) NCCIH Clinical Digest A monthly newsletter with evidence-based information on complementary and integrative practices and a ... What Have We Learned? There’s no conclusive scientific evidence based on studies in people that supports using cat’s ...

  16. The Grassmannian Atlas: A General Framework for Exploring Linear Projections of High-Dimensional Data

    DOE PAGES

    Liu, S.; Bremer, P. -T; Jayaraman, J. J.; ...

    2016-06-04

    Linear projections are one of the most common approaches to visualize high-dimensional data. Since the space of possible projections is large, existing systems usually select a small set of interesting projections by ranking a large set of candidate projections based on a chosen quality measure. However, while highly ranked projections can be informative, some lower ranked ones could offer important complementary information. Therefore, selection based on ranking may miss projections that are important to provide a global picture of the data. Here, the proposed work fills this gap by presenting the Grassmannian Atlas, a framework that captures the global structuresmore » of quality measures in the space of all projections, which enables a systematic exploration of many complementary projections and provides new insights into the properties of existing quality measures.« less

  17. Upgrade of the Surface Spectrometer at NEPOMUC for PAES, XPS and STM Investigations

    NASA Astrophysics Data System (ADS)

    Zimnik, S.; Lippert, F.; Hugenschmidt, C.

    2014-04-01

    The characterization of the elemental composition of surfaces is of great importance for the understanding of many surface processes, such as surface segregation or oxidation. Positron-annihilation-induced Auger Electron Spectroscopy (PAES) is a powerful technique for gathering information about the elemental composition of only the topmost atomic layer of a sample. The upgraded surface spectrometer at NEPOMUC (NEtron induced POsitron source MUniCh) enables a comprehensive surface analysis with the complementary techniques STM, XPS and PAES. A new X-ray source for X-ray induced photoelectron spectroscopy (XPS) was installed to gather additional information on oxidation states. A new scanning tunneling microscope (STM) is used as a complementary method to investigate with atomic resolution the surface electron density. The combination of PAES, XPS and STM allows the characterization of both the elemental composition, and the surface topology.

  18. Phenol-enriched olive oils improve HDL antioxidant content in hypercholesterolemic subjects. A randomized, double-blind, cross-over, controlled trial.

    PubMed

    Farràs, Marta; Fernández-Castillejo, Sara; Rubió, Laura; Arranz, Sara; Catalán, Úrsula; Subirana, Isaac; Romero, Mari-Paz; Castañer, Olga; Pedret, Anna; Blanchart, Gemma; Muñoz-Aguayo, Daniel; Schröder, Helmut; Covas, Maria-Isabel; de la Torre, Rafael; Motilva, Maria-José; Solà, Rosa; Fitó, Montserrat

    2018-01-01

    At present, high-density lipoprotein (HDL) function is thought to be more relevant than HDL cholesterol quantity. Consumption of olive oil phenolic compounds (PCs) has beneficial effects on HDL-related markers. Enriched food with complementary antioxidants could be a suitable option to obtain additional protective effects. Our aim was to ascertain whether virgin olive oils (VOOs) enriched with (a) their own PC (FVOO) and (b) their own PC plus complementary ones from thyme (FVOOT) could improve HDL status and function. Thirty-three hypercholesterolemic individuals ingested (25 ml/day, 3 weeks) (a) VOO (80 ppm), (b) FVOO (500 ppm) and (c) FVOOT (500 ppm) in a randomized, double-blind, controlled, crossover trial. A rise in HDL antioxidant compounds was observed after both functional olive oil interventions. Nevertheless, α-tocopherol, the main HDL antioxidant, was only augmented after FVOOT versus its baseline. In conclusion, long-term consumption of phenol-enriched olive oils induced a better HDL antioxidant content, the complementary phenol-enriched olive oil being the one which increased the main HDL antioxidant, α-tocopherol. Complementary phenol-enriched olive oil could be a useful dietary tool for improving HDL richness in antioxidants. Copyright © 2017. Published by Elsevier Inc.

  19. Privatization in a public leadership mixed duopoly

    NASA Astrophysics Data System (ADS)

    Ferreira, Fernanda A.; Ferreira, Flávio

    2016-06-01

    We consider domestic and international competitions with one public leader firm and one follower private firm, producing complementary goods and competing on prices. We compare the results obtained in both models. Furthermore, we examine the impacts of privatization on consumer surplus and on social welfare.

  20. Correlated Imaging – A Grand Challenge in Chemical Analysis

    PubMed Central

    Masyuko, Rachel; Lanni, Eric; Sweedler, Jonathan V.; Bohn, Paul W.

    2013-01-01

    Correlated chemical imaging is an emerging strategy for acquisition of images by combining information from multiplexed measurement platforms to track, visualize, and interpret in situ changes in the structure, organization, and activities of interesting chemical systems, frequently spanning multiple decades in space and time. Acquiring and correlating information from complementary imaging experiments has the potential to expose complex chemical behavior in ways that are simply not available from single methods applied in isolation, thereby greatly amplifying the information gathering power of imaging experiments. However, in order to correlate image information across platforms, a number of issues must be addressed. First, signals are obtained from disparate experiments with fundamentally different figures of merit, including pixel size, spatial resolution, dynamic range, and acquisition rates. In addition, images are often acquired on different instruments in different locations, so the sample must be registered spatially so that the same area of the sample landscape is addressed. The signals acquired must be correlated in both spatial and temporal domains, and the resulting information has to be presented in a way that is readily understood. These requirements pose special challenges for image cross-correlation that go well beyond those posed in single technique imaging approaches. The special opportunities and challenges that attend correlated imaging are explored by specific reference to correlated mass spectrometric and Raman imaging, a topic of substantial and growing interest. PMID:23431559

  1. Electron-beam-induced-current and active secondary-electron voltage-contrast with aberration-corrected electron probes

    DOE PAGES

    Han, Myung-Geun; Garlow, Joseph A.; Marshall, Matthew S. J.; ...

    2017-03-23

    The ability to map out electrostatic potentials in materials is critical for the development and the design of nanoscale electronic and spintronic devices in modern industry. Electron holography has been an important tool for revealing electric and magnetic field distributions in microelectronics and magnetic-based memory devices, however, its utility is hindered by several practical constraints, such as charging artifacts and limitations in sensitivity and in field of view. In this article, we report electron-beam-induced-current (EBIC) and secondary-electron voltage-contrast (SE-VC) with an aberration-corrected electron probe in a transmission electron microscope (TEM), as complementary techniques to electron holography, to measure electric fieldsmore » and surface potentials, respectively. These two techniques were applied to ferroelectric thin films, multiferroic nanowires, and single crystals. Electrostatic potential maps obtained by off-axis electron holography were compared with EBIC and SE-VC to show that these techniques can be used as a complementary approach to validate quantitative results obtained from electron holography analysis.« less

  2. Patients' perspectives in health technology assessment: a route to robust evidence and fair deliberation.

    PubMed

    Facey, Karen; Boivin, Antoine; Gracia, Javier; Hansen, Helle Ploug; Lo Scalzo, Alessandra; Mossman, Jean; Single, Ann

    2010-07-01

    There is increasing emphasis on providing patient-focused health care and ensuring patient involvement in the design of health services. As health technology assessment (HTA) is meant to be a multidisciplinary, wide-ranging policy analysis that informs decision making, it would be expected that patients' views should be incorporated into the assessment. However, HTA is still driven by collection of quantitative evidence to determine the clinical and cost effectiveness of a health technology. Patients' perspectives about their illness and the technology are rarely included, perhaps because they are seen as anecdotal, biased views. There are two distinct but complementary ways in which HTAs can be strengthened by: (i) gathering robust evidence about the patients' perspectives, and (ii) ensuring effective engagement of patients in the HTA process from scoping, through evidence gathering, assessment of value, development of recommendations and dissemination of findings. Robust evidence eliciting patients' perspectives can be obtained through social science research that is well conducted, critically appraised and carefully reported, either through meta-synthesis of existing studies or new primary research. Engagement with patients can occur at several levels and we propose that HTA should seek to support effective patient participation to create a fair deliberative process. This should allow two-way flow of information, so that the views of patients are obtained in a supportive way and fed into decision-making processes in a transparent manner.

  3. Higgs constraints from vector boson fusion and scattering

    DOE PAGES

    Campbell, John M.; Ellis, R. Keith

    2015-04-07

    We present results on 4-lepton + 2-jet production, the partonic processes most commonly described as vector boson pair production in the Vector Boson Fusion (VBF) mode. That final state contains diagrams that are mediated by Higgs boson exchange. We focus particularly on the high-mass behaviour of the Higgs boson mediated diagrams, which unlike on-shell production, gives information about the Higgs couplings without assumptions on the Higgs boson total width. We assess the sensitivity of the high-mass region to Higgs coupling strengths, considering all vector boson pair channels, W - W +, W ± W ±, W ± Z and ZZ.more » Because of the small background, the most promising mode is W + W + which has sensitivity to Higgs couplings because of Higgs boson exchange in the t-channel. Furthermore, using the Caola-Melnikov (CM) method, the off-shell couplings can be interpreted as bounds on the Higgs boson total width. We estimate the bound that can be obtained with current data, as well as the bounds that could be obtained at √s=13 TeV in the VBF channel for data samples of 100 and 300 fb -1. The CM method has already been successfully applied in the gluon fusion (GGF) production channel. The VBF production channel gives important complementary information, because both production and decay of the Higgs boson occur already at tree graph level.« less

  4. Composition of Renaissance paint layers: simultaneous particle induced X-ray emission and backscattering spectrometry.

    PubMed

    de Viguerie, L; Beck, L; Salomon, J; Pichon, L; Walter, Ph

    2009-10-01

    Particle induced X-ray emission spectroscopy (PIXE) is now routinely used in the field of cultural heritage. Various setups have been developed to investigate the elemental composition of wood/canvas paintings or of cross-section samples. However, it is not possible to obtain information concerning the quantity of organic binder. Backscattering spectrometry (BS) can be a useful complementary method to overcome this limitation. In the case of paint layers, PIXE brings the elemental composition (major elements to traces) and the BS spectrum can give access to the proportion of pigment and binder. With the use of 3 MeV protons for PIXE and BS simultaneously, it was possible to perform quantitative analysis including C and O for which the non-Rutherford cross sections are intense. Furthermore, with the use of the same conditions for PIXE and BS, the experiment time and the potential damage by the ion beam were reduced. The results obtained with the external beam of the Accélérateur Grand Louvre pour l'Analyse Elementaire (AGLAE) facility on various test painting samples and on cross sections from Italian Renaissance masterpieces are shown. Simultaneous combination of PIXE and BS leads to a complete characterization of the paint layers: elemental composition and proportion of the organic binder have been determined and thus provide useful information about ancient oil painting recipes.

  5. Interferometric inverse synthetic aperture radar imaging for space targets based on wideband direct sampling using two antennas

    NASA Astrophysics Data System (ADS)

    Tian, Biao; Liu, Yang; Xu, Shiyou; Chen, Zengping

    2014-01-01

    Interferometric inverse synthetic aperture radar (InISAR) imaging provides complementary information to monostatic inverse synthetic aperture radar (ISAR) imaging. This paper proposes a new InISAR imaging system for space targets based on wideband direct sampling using two antennas. The system is easy to realize in engineering since the motion trajectory of space targets can be known in advance, which is simpler than that of three receivers. In the preprocessing step, high speed movement compensation is carried out by designing an adaptive matched filter containing speed that is obtained from the narrow band information. Then, the coherent processing and keystone transform for ISAR imaging are adopted to reserve the phase history of each antenna. Through appropriate collocation of the system, image registration and phase unwrapping can be avoided. Considering the situation not to be satisfied, the influence of baseline variance is analyzed and compensation method is adopted. The corresponding size can be achieved by interferometric processing of the two complex ISAR images. Experimental results prove the validity of the analysis and the three-dimensional imaging algorithm.

  6. Passing Messages between Biological Networks to Refine Predicted Interactions

    PubMed Central

    Glass, Kimberly; Huttenhower, Curtis; Quackenbush, John; Yuan, Guo-Cheng

    2013-01-01

    Regulatory network reconstruction is a fundamental problem in computational biology. There are significant limitations to such reconstruction using individual datasets, and increasingly people attempt to construct networks using multiple, independent datasets obtained from complementary sources, but methods for this integration are lacking. We developed PANDA (Passing Attributes between Networks for Data Assimilation), a message-passing model using multiple sources of information to predict regulatory relationships, and used it to integrate protein-protein interaction, gene expression, and sequence motif data to reconstruct genome-wide, condition-specific regulatory networks in yeast as a model. The resulting networks were not only more accurate than those produced using individual data sets and other existing methods, but they also captured information regarding specific biological mechanisms and pathways that were missed using other methodologies. PANDA is scalable to higher eukaryotes, applicable to specific tissue or cell type data and conceptually generalizable to include a variety of regulatory, interaction, expression, and other genome-scale data. An implementation of the PANDA algorithm is available at www.sourceforge.net/projects/panda-net. PMID:23741402

  7. Visualizing 3-D microscopic specimens

    NASA Astrophysics Data System (ADS)

    Forsgren, Per-Ola; Majlof, Lars L.

    1992-06-01

    The confocal microscope can be used in a vast number of fields and applications to gather more information than is possible with a regular light microscope, in particular about depth. Compared to other three-dimensional imaging devices such as CAT, NMR, and PET, the variations of the objects studied are larger and not known from macroscopic dissections. It is therefore important to have several complementary ways of displaying the gathered information. We present a system where the user can choose display techniques such as extended focus, depth coding, solid surface modeling, maximum intensity and other techniques, some of which may be combined. A graphical user interface provides easy and direct control of all input parameters. Motion and stereo are available options. Many three- dimensional imaging devices give recordings where one dimension has different resolution and sampling than the other two which requires interpolation to obtain correct geometry. We have evaluated algorithms with interpolation in object space and in projection space. There are many ways to simplify the geometrical transformations to gain performance. We present results of some ways to simplify the calculations.

  8. Evaluation of target acquisition difficulty using recognition distance to measure required retinal area

    NASA Astrophysics Data System (ADS)

    Nilsson, Thomy H.

    2001-09-01

    The psychophysical method of limits was used to measure the distance at which observers could distinguish military vehicles photographed in natural landscapes. Obtained from the TNO-TM Search_2 dataset, these pictures either were rear-projected 35-mm slides or were presented on a computer monitor. Based on the rationale that more difficult vehicle targets would require more visual pathways for recognition, difficult of acquisition was defined in terms of the relative retinal area required for recognition. Relative retinal area was derived from the inverse square of the recognition distance of a particular vehicle relative to the distance of the vehicle that could be seen furthest away. Results are compared with data on the time required to find the vehicles in these pictures. These comparison indicate recognition distance thresholds can be a suitable means of defining standards for the effectiveness of vital graphic information; and the two methods are complementary with respect to distinguishing different degrees of acquisition difficulty, and together may provide a means to measure the total information processing required for recognition.

  9. Biomedical surface analysis: Evolution and future directions (Review)

    PubMed Central

    Castner, David G.

    2017-01-01

    This review describes some of the major advances made in biomedical surface analysis over the past 30–40 years. Starting from a single technique analysis of homogeneous surfaces, it has been developed into a complementary, multitechnique approach for obtaining detailed, comprehensive information about a wide range of surfaces and interfaces of interest to the biomedical community. Significant advances have been made in each surface analysis technique, as well as how the techniques are combined to provide detailed information about biological surfaces and interfaces. The driving force for these advances has been that the surface of a biomaterial is the interface between the biological environment and the biomaterial, and so, the state-of-the-art in instrumentation, experimental protocols, and data analysis methods need to be developed so that the detailed surface structure and composition of biomedical devices can be determined and related to their biological performance. Examples of these advances, as well as areas for future developments, are described for immobilized proteins, complex biomedical surfaces, nanoparticles, and 2D/3D imaging of biological materials. PMID:28438024

  10. Capsule endoscope localization based on computer vision technique.

    PubMed

    Liu, Li; Hu, Chao; Cai, Wentao; Meng, Max Q H

    2009-01-01

    To build a new type of wireless capsule endoscope with interactive gastrointestinal tract examination, a localization and orientation system is needed for tracking 3D location and 3D orientation of the capsule movement. The magnetic localization and orientation method produces only 5 DOF, but misses the information of rotation angle along capsule's main axis. In this paper, we presented a complementary orientation approach for the capsule endoscope, and the 3D rotation can be determined by applying computer vision technique on the captured endoscopic images. The experimental results show that the complementary orientation method has good accuracy and high feasibility.

  11. Analysis of material flow in a utillzation technology of low grade manganese ore and sulphur coal complementary

    NASA Astrophysics Data System (ADS)

    Wang, Bo-Zhi; Deng, Biao; Su, Shi-Jun; Ding, Sang-Lan; Sun, Wei-Yi

    2018-03-01

    Electrolytic manganese is conventionally produced through low-grade manganese ore leaching in SO2, with the combustion of high sulfur coal. Subsequently the coal ash and manganese slag, produced by the combustion of high sulfur coal and preparation of electrolytic manganese, can be used as raw ingredients for the preparation of sulphoaluminate cement. In order to realize the `coal-electricity-sulfur-manganese-building material' system of complementary resource utilization, the conditions of material inflow and outflow in each process were determined using material flow analysis. The material flow models in each unit and process can be obtained by analyzed of material flow for new technology, and the input-output model could be obtained. Through the model, it is possible to obtain the quantity of all the input and output material in the condition of limiting the quantity of a substance. Taking one ton electrolytic manganese as a basis, the quantity of other input material and cements can be determined with the input-output model. The whole system had thusly achieved a cleaner production level. Therefore, the input-output model can be used for guidance in practical production.

  12. Infrared spectroscopy and microscopy in cancer research and diagnosis

    PubMed Central

    Bellisola, Giuseppe; Sorio, Claudio

    2012-01-01

    Since the middle of 20th century infrared (IR) spectroscopy coupled to microscopy (IR microspectroscopy) has been recognized as a non destructive, label free, highly sensitive and specific analytical method with many potential useful applications in different fields of biomedical research and in particular cancer research and diagnosis. Although many technological improvements have been made to facilitate biomedical applications of this powerful analytical technique, it has not yet properly come into the scientific background of many potential end users. Therefore, to achieve those fundamental objectives an interdisciplinary approach is needed with basic scientists, spectroscopists, biologists and clinicians who must effectively communicate and understand each other's requirements and challenges. In this review we aim at illustrating some principles of Fourier transform (FT) Infrared (IR) vibrational spectroscopy and microscopy (microFT-IR) as a useful method to interrogate molecules in specimen by mid-IR radiation. Penetrating into basics of molecular vibrations might help us to understand whether, when and how complementary information obtained by microFT-IR could become useful in our research and/or diagnostic activities. MicroFT-IR techniques allowing to acquire information about the molecular composition and structure of a sample within a micrometric scale in a matter of seconds will be illustrated as well as some limitations will be discussed. How biochemical, structural, and dynamical information about the systems can be obtained by bench top microFT-IR instrumentation will be also presented together with some methods to treat and interpret IR spectral data and applicative examples. The mid-IR absorbance spectrum is one of the most information-rich and concise way to represent the whole “… omics” of a cell and, as such, fits all the characteristics for the development of a clinically useful biomarker. PMID:22206042

  13. Invited Reaction: Influences of Formal Learning, Personal Learning Orientation, and Supportive Learning Environment on Informal Learning

    ERIC Educational Resources Information Center

    Cseh, Maria; Manikoth, Nisha N.

    2011-01-01

    As the authors of the preceding article (Choi and Jacobs, 2011) have noted, the workplace learning literature shows evidence of the complementary and integrated nature of formal and informal learning in the development of employee competencies. The importance of supportive learning environments in the workplace and of employees' personal learning…

  14. The Influence of Informal Science Education Experiences on the Development of Two Beginning Teachers' Science Classroom Teaching Identity

    ERIC Educational Resources Information Center

    Katz, Phyllis; McGinnis, J. Randy; Riedinger, Kelly; Marbach-Ad, Gili; Dai, Amy

    2013-01-01

    In case studies of two first-year elementary classroom teachers, we explored the influence of informal science education (ISE) they experienced in their teacher education program. Our theoretical lens was identity development, delimited to classroom science teaching. We used complementary data collection methods and analysis, including interviews,…

  15. High-order distance-based multiview stochastic learning in image classification.

    PubMed

    Yu, Jun; Rui, Yong; Tang, Yuan Yan; Tao, Dacheng

    2014-12-01

    How do we find all images in a larger set of images which have a specific content? Or estimate the position of a specific object relative to the camera? Image classification methods, like support vector machine (supervised) and transductive support vector machine (semi-supervised), are invaluable tools for the applications of content-based image retrieval, pose estimation, and optical character recognition. However, these methods only can handle the images represented by single feature. In many cases, different features (or multiview data) can be obtained, and how to efficiently utilize them is a challenge. It is inappropriate for the traditionally concatenating schema to link features of different views into a long vector. The reason is each view has its specific statistical property and physical interpretation. In this paper, we propose a high-order distance-based multiview stochastic learning (HD-MSL) method for image classification. HD-MSL effectively combines varied features into a unified representation and integrates the labeling information based on a probabilistic framework. In comparison with the existing strategies, our approach adopts the high-order distance obtained from the hypergraph to replace pairwise distance in estimating the probability matrix of data distribution. In addition, the proposed approach can automatically learn a combination coefficient for each view, which plays an important role in utilizing the complementary information of multiview data. An alternative optimization is designed to solve the objective functions of HD-MSL and obtain different views on coefficients and classification scores simultaneously. Experiments on two real world datasets demonstrate the effectiveness of HD-MSL in image classification.

  16. Mode I analysis of a cracked circular disk subject to a couple and a force

    NASA Technical Reports Server (NTRS)

    Gross, B.

    1978-01-01

    Mode I stress intensity coefficients were obtained for an edge-cracked disk (round compact specimen). Results for this plane elastostatic problem, obtained by a boundary collocation analysis are presented for A/D ratios of 0.35 to 1, where A is the crack length and D is the disk diameter. The results presented are for two complementary types of loading. By superposition of these results the stress intensity factor for any practical load line location of a pin-loaded round compact specimen can be obtained.

  17. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  18. Analysis of bacterial populations in the environment using two-dimensional gel electrophoresis of genomic DNA and complementary DNA.

    PubMed

    Liu, Guo-Hua; Nakamura, Tatsuo; Amemiya, Takashi; Rajendran, Narasimmalu; Itoh, Kiminori

    2011-01-01

    Two-dimensional gel electrophoresis (2-DGE) mapping of genomic DNA and complementary DNA (cDNA) amplicons was attempted to analyze total and active bacterial populations within soil and activated sludge samples. Distinct differences in the number and species of bacterial populations and those that were metabolically active at the time of sampling were visually observed especially for the soil community. Statistical analyses and sequencing based on the 2-DGE data further revealed the relationships between total and active bacterial populations within each community. This high-resolution technique would be useful for obtaining a better understanding of bacterial population structures in the environment.

  19. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

    PubMed

    Yeo, Hyun Koo; Lee, Jae Young

    2010-05-01

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

  20. Compact ultra wide band microstrip bandpass filter based on multiple-mode resonator and modified complementary split ring resonator.

    PubMed

    Marcotegui, J Antonio; Illescas, Jesús Miguel; Estevez, Aritz; Falcone, Francisco

    2013-01-01

    A new class of broadband microstrip filters for Ultra Wide Band (UWB) applications is proposed. In the design, different stages of parallel-coupled microstrip line and other stages with a Modified Complementary Split Ring Resonator (MCSRR)-a concept proposed here for the first time-are adjusted to obtain the desired response with broadband, sharp rejection, low insertion loss, and low return loss. Full wave simulation results as well as measurement results from fabricated prototypes are presented, showing good agreement. The proposed technique offers a new alternative to implement low-cost high-performance filter devices, applicable to a wide range of communication systems.

  1. Compact Ultra Wide Band Microstrip Bandpass Filter Based on Multiple-Mode Resonator and Modified Complementary Split Ring Resonator

    PubMed Central

    Marcotegui, J. Antonio; Illescas, Jesús Miguel; Estevez, Aritz

    2013-01-01

    A new class of broadband microstrip filters for Ultra Wide Band (UWB) applications is proposed. In the design, different stages of parallel-coupled microstrip line and other stages with a Modified Complementary Split Ring Resonator (MCSRR)—a concept proposed here for the first time—are adjusted to obtain the desired response with broadband, sharp rejection, low insertion loss, and low return loss. Full wave simulation results as well as measurement results from fabricated prototypes are presented, showing good agreement. The proposed technique offers a new alternative to implement low-cost high-performance filter devices, applicable to a wide range of communication systems. PMID:24319366

  2. Evaluating Complementary and Alternative Therapies

    MedlinePlus

    ... t Work Drug Information Resources Side Effects Dating, Sex, and Reproduction Advanced Cancer For Children For Teens For Young Adults For Older Adults Prevention and Healthy Living Cancer.Net Videos Coping With Cancer Research and Advocacy Survivorship Blog ...

  3. Image denoising by a direct variational minimization

    NASA Astrophysics Data System (ADS)

    Janev, Marko; Atanacković, Teodor; Pilipović, Stevan; Obradović, Radovan

    2011-12-01

    In this article we introduce a novel method for the image de-noising which combines a mathematically well-posdenes of the variational modeling with the efficiency of a patch-based approach in the field of image processing. It based on a direct minimization of an energy functional containing a minimal surface regularizer that uses fractional gradient. The minimization is obtained on every predefined patch of the image, independently. By doing so, we avoid the use of an artificial time PDE model with its inherent problems of finding optimal stopping time, as well as the optimal time step. Moreover, we control the level of image smoothing on each patch (and thus on the whole image) by adapting the Lagrange multiplier using the information on the level of discontinuities on a particular patch, which we obtain by pre-processing. In order to reduce the average number of vectors in the approximation generator and still to obtain the minimal degradation, we combine a Ritz variational method for the actual minimization on a patch, and a complementary fractional variational principle. Thus, the proposed method becomes computationally feasible and applicable for practical purposes. We confirm our claims with experimental results, by comparing the proposed method with a couple of PDE-based methods, where we get significantly better denoising results specially on the oscillatory regions.

  4. Rediscovering ancient glass technologies through the examination of opacifier crystals

    NASA Astrophysics Data System (ADS)

    Lahlil, S.; Biron, I.; Galoisy, L.; Morin, G.

    2008-07-01

    The aim of the study is to understand how antimonate opacifying crystals were obtained throughout history. Two archaeological glass productions opacified with calcium and lead antimonates are studied in this paper, in order to rediscover ancient opaque glass technologies: Roman mosaic tesserae (1st cent. B.C. 4th cent. A.D.) and Nevers lampworking glass (18th cent. A.D.). The fine examination of crystalline phases and of the vitreous matrix is undertaken using various and complementary techniques. Results are compared with a modern reference production, for which the technological process is well known. We demonstrate that Ca-antimonate opacifiers in Roman mosaic tesserae, as well as in Nevers lampworking glass, were obtained by in situ crystallization. Nevertheless, Roman and Nevers glass would have undergone different firing processes. We propose that the addition of previously synthesized crystals or the use of “anime” could be the process used to obtain Pb-antimonate opacified glass, for both productions studied. We demonstrate that CaO, PbO and Sb2O3 concentrations in the bulk compositions and in the matrices, and their evolution with the crystallinity ratio, offer robust criteria for the distinction of the opacification process used. Also, the different crystalline structures help to provide information on the experimental conditions.

  5. Influence of apical enlargement and complementary canal preparation with the Self-Adjusting File on endotoxin reduction in retreatment cases.

    PubMed

    Silva, E J N L; Ferreira, V M; Silva, C C; Herrera, D R; De-Deus, G; Gomes, B P

    2017-07-01

    To compare the effectiveness of large apical preparations and complementary canal preparation with the Self-Adjusting File (SAF) in removing endotoxins from the root canal of teeth with apical periodontitis. Ten single-rooted and single-canaled teeth with post-treatment apical periodontitis were selected. Endotoxin samples were taken after removal of the root filling (S1), after chemomechanical preparation (CMP) using 2.5% NaOCl and an R25 file (S2), after CMP using 2.5% NaOCl and an R40 file (S3) and after complementary CMP using the SAF system (S4). Limulus amebocyte lysate (LAL) was used to measure endotoxin levels. The Friedman and Wilcoxon tests were used to compare endotoxin levels at each clinical intervention (P < 0.05). After root filling removal, endotoxin was detected in 100% of the root canals (S1, 4.84 EU mL -1 ). CMP with the R25 file was able to significantly reduce endotoxin levels (P < 0.05). Increased levels of endotoxin removal were achieved by apical preparation with the R40 file (P < 0.05). Complementary CMP with SAF did not significantly reduce endotoxin levels (P > 0.05) following the use of the R40 instrument. Apical enlargement protocols were effective in significantly reducing endotoxin levels. Complementary preparation with the SAF system failed to eliminate residual endotoxin contents beyond those obtained with the R40 instrument. © 2016 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  6. Use of complementary and alternative medicine by patients with hematological diseases experience at a university hospital in northeast Mexico

    PubMed Central

    Jaime-Pérez, José Carlos; Chapa-Rodríguez, Adrián; Rodríguez-Martínez, Marisol; Colunga-Pedraza, Perla Rocío; Marfil-Rivera, Luis Javier; Gómez-Almaguer, David

    2012-01-01

    Background Complementary and alternative medicine includes a diverse group of medical and healthcare systems, practices and products not considered part of conventional medicine. Although there is information on unconventional practices in oncological diseases, specific data regarding the use of complementary and alternative medicine by hematology patients is scarce. Objective The aim of this study is to document the prevalence of this modality of unconventional therapy in patients with malignant and benign hematological diseases, particularly children with acute lymphoblastic leukemia. Methods An observational study of adult patients and guardians of children with malignant or benign hematological diseases was carried out by applying a structured questionnaire detailing the use and results of the most prevalent complementary and alternative medicine practices. Results One hundred and twenty patients were included; 104 had malignant and 16 had benign hematological diseases. The use of complementary and alternative medicine was greater in benign diseases but the difference was not statistically significant (64.7% versus 41.7%; p-value = 0.08). Patients and guardians with high school or college educations used these alternative practices more than patients with less schooling (60.7% versus 54.7%; p-value = 0.032). The use of folk remedies was most prevalent followed by herbal preparations and spiritual healing. Sixty-four percent of patients that used these unconventional practices reported improvement in their symptoms and increased capacity to perform daily activities. Conclusion No significant difference was documented between patients with malignant or benign hematological diseases using these alternative practices. The majority of complementary and alternative medicine users reported improvement of the disease or chemotherapy-related symptoms. PMID:23049401

  7. Foodomics and Food Safety: Where We Are.

    PubMed

    Andjelković, Uroš; Šrajer Gajdošik, Martina; Gašo-Sokač, Dajana; Martinović, Tamara; Josić, Djuro

    2017-09-01

    The power of foodomics as a discipline that is now broadly used for quality assurance of food products and adulteration identification, as well as for determining the safety of food, is presented. Concerning sample preparation and application, maintenance of highly sophisticated instruments for both high-performance and high-throughput techniques, and analysis and data interpretation, special attention has to be paid to the development of skilled analysts. The obtained data shall be integrated under a strong bioinformatics environment. Modern mass spectrometry is an extremely powerful analytical tool since it can provide direct qualitative and quantitative information about a molecule of interest from only a minute amount of sample. Quality of this information is influenced by the sample preparation procedure, the type of mass spectrometer used and the analyst's skills. Technical advances are bringing new instruments of increased sensitivity, resolution and speed to the market. Other methods presented here give additional information and can be used as complementary tools to mass spectrometry or for validation of obtained results. Genomics and transcriptomics, as well as affinity-based methods, still have a broad use in food analysis. Serious drawbacks of some of them, especially the affinity-based methods, are the cross-reactivity between similar molecules and the influence of complex food matrices. However, these techniques can be used for pre-screening in order to reduce the large number of samples. Great progress has been made in the application of bioinformatics in foodomics. These developments enabled processing of large amounts of generated data for both identification and quantification, and for corresponding modeling.

  8. Foodomics and Food Safety: Where We Are

    PubMed Central

    Andjelković, Uroš

    2017-01-01

    Summary The power of foodomics as a discipline that is now broadly used for quality assurance of food products and adulteration identification, as well as for determining the safety of food, is presented. Concerning sample preparation and application, maintenance of highly sophisticated instruments for both high-performance and high-throughput techniques, and analysis and data interpretation, special attention has to be paid to the development of skilled analysts. The obtained data shall be integrated under a strong bioinformatics environment. Modern mass spectrometry is an extremely powerful analytical tool since it can provide direct qualitative and quantitative information about a molecule of interest from only a minute amount of sample. Quality of this information is influenced by the sample preparation procedure, the type of mass spectrometer used and the analyst’s skills. Technical advances are bringing new instruments of increased sensitivity, resolution and speed to the market. Other methods presented here give additional information and can be used as complementary tools to mass spectrometry or for validation of obtained results. Genomics and transcriptomics, as well as affinity-based methods, still have a broad use in food analysis. Serious drawbacks of some of them, especially the affinity-based methods, are the cross-reactivity between similar molecules and the influence of complex food matrices. However, these techniques can be used for pre-screening in order to reduce the large number of samples. Great progress has been made in the application of bioinformatics in foodomics. These developments enabled processing of large amounts of generated data for both identification and quantification, and for corresponding modeling. PMID:29089845

  9. A Content Analysis of Infant and Toddler Food Advertisements in Taiwanese Popular Pregnancy and Early Parenting Magazines.

    PubMed

    Chen, Yi-Chun; Chang, Jung-Su; Gong, Yu-Tang

    2015-08-01

    Mothers who are exposed to formula advertisements (ads) are less likely to initiate breastfeeding and more likely to breastfeed for a shorter duration than other mothers. The purpose of this study was to examine infant and toddler food ads in pregnancy and early parenting magazines. A content analysis of infant and toddler food ads printed in 12 issues of 4 magazines published in 2011 was performed. Coding categories of ads included product category, advertisement category, marketing information, and advertising appeal. The target age and health-related message of each product were coded. The researchers identified 756 infant and toddler food ads in the magazines. Compared with complementary food ads, formula product ads used more marketing strategies such as antenatal classes and baby contests to influence consumers and promote products. Nutritional quality and child health benefits were the two most frequently used advertising appeals. In addition, this study identified 794 formula products and 400 complementary food products; 42.8% of the complementary food products were intended for 4-month-old infants. Furthermore, 91.9% of the ads for formula products and 81% of the ads for complementary food products contained claims concerning health function or nutrient content. Taiwanese pregnancy and early parenting magazines contain numerous infant and toddler food ads. These ads generally use health-related claims regarding specific nutrient content and health functions to promote infant and toddler foods. Health professionals should provide more information to parents on the differences between breast milk and formula milk, and they should be aware of the potential effect of infant and toddler food ads on parents' infant feeding decisions. © The Author(s) 2015.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Kuangcai; Lin, Chia -Cheng; Vela, Javier

    In this study, three-layer core–shell plasmonic nanorods (Au/Ag/SiO 2–NRs), consisting of a gold nanorod core, a thin silver shell, and a thin silica layer, were synthesized and used as optical imaging probes under a differential interference contrast microscope for single particle orientation and rotational tracking. The localized surface plasmon resonance modes were enhanced upon the addition of the silver shell, and the anisotropic optical properties of gold nanorods were maintained. The silica coating enables surface functionalization with silane coupling agents and provides enhanced stability and biocompatibility. Taking advantage of the longitudinal LSPR enhancement, the orientation and rotational information of themore » hybrid nanorods on synthetic lipid bilayers and on live cell membranes were obtained with millisecond temporal resolution using a scientific complementary metal-oxide-semiconductor camera. The results demonstrate that the as-synthesized hybrid nanorods are promising imaging probes with improved sensitivity and good biocompatibility for single plasmonic particle tracking experiments in biological systems.« less

  11. Geologic mapping of the Bauru Group in Sao Paulo state by LANDSAT images. [Brazil

    NASA Technical Reports Server (NTRS)

    Parada, N. D. J. (Principal Investigator); Godoy, A. M.

    1983-01-01

    The occurrence of the Bauru Group in Sao Paulo State was studied, with emphasis on the western plateau. Regional geological mapping was carried out on a 1:250.000 scale with the help of MSS/LANDSAT images. The visual interpretation of images consisted basically of identifying different spectral characteristics of the geological units using channels 5 and 7. Complementary studies were made for treatment of data with an Interative Image (I-100) analyser in order to facilitate the extraction of information, particularly for areas where visual interpretation proved to be difficult. Regional characteristics provided by MSS/LANDSAT images, coupled with lithostratigraphic studies carried out in the areas of occurrence of Bauru Group sediments, enabled the homogenization of criteria for the subdivision of this group. A spatial distribution of the mapped units was obtained for the entire State of Sao Paulo and results were correlated with proposed stratigraphic divisions.

  12. MR Image Based Approach for Metal Artifact Reduction in X-Ray CT

    PubMed Central

    2013-01-01

    For decades, computed tomography (CT) images have been widely used to discover valuable anatomical information. Metallic implants such as dental fillings cause severe streaking artifacts which significantly degrade the quality of CT images. In this paper, we propose a new method for metal-artifact reduction using complementary magnetic resonance (MR) images. The method exploits the possibilities which arise from the use of emergent trimodality systems. The proposed algorithm corrects reconstructed CT images. The projected data which is affected by dental fillings is detected and the missing projections are replaced with data obtained from a corresponding MR image. A simulation study was conducted in order to compare the reconstructed images with images reconstructed through linear interpolation, which is a common metal-artifact reduction technique. The results show that the proposed method is successful in reducing severe metal artifacts without introducing significant amount of secondary artifacts. PMID:24302860

  13. Modal parameter identification using the log decrement method and band-pass filters

    NASA Astrophysics Data System (ADS)

    Liao, Yabin; Wells, Valana

    2011-10-01

    This paper presents a time-domain technique for identifying modal parameters of test specimens based on the log-decrement method. For lightly damped multidegree-of-freedom or continuous systems, the conventional method is usually restricted to identification of fundamental-mode parameters only. Implementation of band-pass filters makes it possible for the proposed technique to extract modal information of higher modes. The method has been applied to a polymethyl methacrylate (PMMA) beam for complex modulus identification in the frequency range 10-1100 Hz. Results compare well with those obtained using the Least Squares method, and with those previously published in literature. Then the accuracy of the proposed method has been further verified by experiments performed on a QuietSteel specimen with very low damping. The method is simple and fast. It can be used for a quick estimation of the modal parameters, or as a complementary approach for validation purposes.

  14. Evaluation of ionic liquid stationary phases for one dimensional gas chromatography-mass spectrometry and comprehensive two dimensional gas chromatographic analyses of fatty acids in marine biota.

    PubMed

    Gu, Qun; David, Frank; Lynen, Frédéric; Vanormelingen, Pieter; Vyverman, Wim; Rumpel, Klaus; Xu, Guowang; Sandra, Pat

    2011-05-20

    Ionic liquid stationary phases were tested for one dimensional gas chromatography-mass spectrometry (GC-MS) and comprehensive two dimensional gas chromatography (GC×GC) of fatty acid methyl esters from algae. In comparison with polyethylene glycol and cyanopropyl substituted polar stationary phases, ionic liquid stationary phases SLB-IL 82 and SLB-IL 100 showed comparable resolution, but lower column bleeding with MS detection, resulting in better sensitivity. The selectivity and polarity of the ionic liquid phases are similar to a highly polar biscyanopropyl-silicone phase (e.g. HP-88). In GC×GC, using an apolar polydimethyl siloxane×polar ionic liquid column combination, an excellent group-type separation of fatty acids with different carbon numbers and number of unsaturations was obtained, providing information that is complementary to GC-MS identification. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Application of SEM and EDX in studying biomineralization in plant tissues.

    PubMed

    He, Honghua; Kirilak, Yaowanuj

    2014-01-01

    This chapter describes protocols using formalin-acetic acid-alcohol (FAA) to fix plant tissues for studying biomineralization by means of scanning electron microscopy (SEM) and qualitative energy-dispersive X-ray microanalysis (EDX). Specimen preparation protocols for SEM and EDX mainly include fixation, dehydration, critical point drying (CPD), mounting, and coating. Gold-coated specimens are used for SEM imaging, while gold- and carbon-coated specimens are prepared for qualitative X-ray microanalyses separately to obtain complementary information on the elemental compositions of biominerals. During the specimen preparation procedure for SEM, some biominerals may be dislodged or scattered, making it difficult to determine their accurate locations, and light microscopy is used to complement SEM studies. Specimen preparation protocols for light microscopy generally include fixation, dehydration, infiltration and embedding with resin, microtome sectioning, and staining. In addition, microwave processing methods are adopted here to speed up the specimen preparation process for both SEM and light microscopy.

  16. Local conductance: A means to extract polarization and depolarizing fields near domain walls in ferroelectrics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Douglas, A. M.; Kumar, A.; Gregg, J. M.

    Conducting atomic force microscopy images of bulk semiconducting BaTiO{sub 3} surfaces show clear stripe domain contrast. High local conductance correlates with strong out-of-plane polarization (mapped independently using piezoresponse force microscopy), and current-voltage characteristics are consistent with dipole-induced alterations in Schottky barriers at the metallic tip-ferroelectric interface. Indeed, analyzing current-voltage data in terms of established Schottky barrier models allows relative variations in the surface polarization, and hence the local domain structure, to be determined. Fitting also reveals the signature of surface-related depolarizing fields concentrated near domain walls. Domain information obtained from mapping local conductance appears to be more surface-sensitive than thatmore » from piezoresponse force microscopy. In the right materials systems, local current mapping could therefore represent a useful complementary technique for evaluating polarization and local electric fields with nanoscale resolution.« less

  17. Kinetics of copper nanoparticle precipitation in phosphate glass: an isothermal plasmonic approach.

    PubMed

    Sendova, Mariana; Jiménez, José A; Smith, Robert; Rudawski, Nicholas

    2015-01-14

    The kinetics of copper nanoparticle (NP) precipitation in melt-quenched barium-phosphate glass has been studied by in situ isothermal optical micro-spectroscopy. A spectroscopically based approximation technique is proposed to obtain information about the activation energies of nucleation and growth in a narrow temperature range (530-570 °C). Pre-plasmonic and plasmonic NP precipitation stages are identified separated in time. The process as a whole is discussed employing classical nucleation/growth theory and the Kolmogorov-Johnson-Mehl-Avrami phase change model. Activation energies of 3.9(7) eV and 2.6(5) eV have been estimated for the pre-plasmonic and plasmonic spectroscopically assessed stages, respectively. High resolution transmission electron microscopy, differential scanning calorimetry, and Raman spectroscopy were used as complementary techniques for studying the nanoparticulate phase and glass host structure. An empirical linear dependence of the diffusion activation energy on the glass transition temperature with broad applicability is suggested.

  18. Integrated photoacoustic, ultrasound and fluorescence platform for diagnostic medical imaging-proof of concept study with a tissue mimicking phantom.

    PubMed

    James, Joseph; Murukeshan, Vadakke Matham; Woh, Lye Sun

    2014-07-01

    The structural and molecular heterogeneities of biological tissues demand the interrogation of the samples with multiple energy sources and provide visualization capabilities at varying spatial resolution and depth scales for obtaining complementary diagnostic information. A novel multi-modal imaging approach that uses optical and acoustic energies to perform photoacoustic, ultrasound and fluorescence imaging at multiple resolution scales from the tissue surface and depth is proposed in this paper. The system comprises of two distinct forms of hardware level integration so as to have an integrated imaging system under a single instrumentation set-up. The experimental studies show that the system is capable of mapping high resolution fluorescence signatures from the surface, optical absorption and acoustic heterogeneities along the depth (>2cm) of the tissue at multi-scale resolution (<1µm to <0.5mm).

  19. Fingerprinting redox and ligand states in haemprotein crystal structures using resonance Raman spectroscopy.

    PubMed

    Kekilli, Demet; Dworkowski, Florian S N; Pompidor, Guillaume; Fuchs, Martin R; Andrew, Colin R; Antonyuk, Svetlana; Strange, Richard W; Eady, Robert R; Hasnain, S Samar; Hough, Michael A

    2014-05-01

    It is crucial to assign the correct redox and ligand states to crystal structures of proteins with an active redox centre to gain valid functional information and prevent the misinterpretation of structures. Single-crystal spectroscopies, particularly when applied in situ at macromolecular crystallography beamlines, allow spectroscopic investigations of redox and ligand states and the identification of reaction intermediates in protein crystals during the collection of structural data. Single-crystal resonance Raman spectroscopy was carried out in combination with macromolecular crystallography on Swiss Light Source beamline X10SA using cytochrome c' from Alcaligenes xylosoxidans. This allowed the fingerprinting and validation of different redox and ligand states, identification of vibrational modes and identification of intermediates together with monitoring of radiation-induced changes. This combined approach provides a powerful tool to obtain complementary data and correctly assign the true oxidation and ligand state(s) in redox-protein crystals.

  20. Assessment of Transition Element Speciation in Glasses Using a Portable Transmission Ultraviolet-Visible-Near-Infrared (UV-Vis-NIR) Spectrometer.

    PubMed

    Hunault, Myrtille; Lelong, Gérald; Gauthier, Michel; Gélébart, Frédéric; Ismael, Saindou; Galoisy, Laurence; Bauchau, Fanny; Loisel, Claudine; Calas, Georges

    2016-05-01

    A new low-cost experimental setup based on two compact dispersive optical spectrometers has been developed to measure optical absorption transmission spectra over the 350-2500 nm energy range. We demonstrate how near-infrared (NIR) data are essential to identify the coloring species in addition to ultraviolet visible data. After calibration with reference glasses, the use of an original sample stage that maintains the window panel in the vertical position enables the comparison of ancient and modern glasses embedded in a panel from the Sainte-Chapelle of Paris, without any sampling. The spectral resolution enables to observe fine resonances arising in the absorption bands of Cr(3+), and the complementary information obtained in the NIR enables to determine the contribution of Fe(2+), a key indicator of glassmaking conditions. © The Author(s) 2016.

  1. Simultaneous use of multiplex ligation-dependent probe amplification assay and flow cytometric DNA ploidy analysis in patients with acute leukemia.

    PubMed

    Reyes-Núñez, Virginia; Galo-Hooker, Evelyn; Pérez-Romano, Beatriz; Duque, Ricardo E; Ruiz-Arguelles, Alejandro; Garcés-Eisele, Javier

    2018-01-01

    The aim of this work was to simultaneously use multiplex ligation-dependent probe amplification (MLPA) assay and flow cytometric DNA ploidy analysis (FPA) to detect aneuploidy in patients with newly diagnosed acute leukemia. MLPA assay and propidium iodide FPA were used to test samples from 53 consecutive patients with newly diagnosed acute leukemia referred to our laboratory for immunophenotyping. Results were compared by nonparametric statistics. The combined use of both methods significantly increased the rate of detection of aneuploidy as compared to that obtained by each method alone. The limitations of one method are somehow countervailed by the other and vice versa. MPLA and FPA yield different yet complementary information concerning aneuploidy in acute leukemia. The simultaneous use of both methods might be recommended in the clinical setting. © 2017 International Clinical Cytometry Society. © 2017 International Clinical Cytometry Society.

  2. Analyzing the Heterogeneous Hierarchy of Cultural Heritage Materials: Analytical Imaging.

    PubMed

    Trentelman, Karen

    2017-06-12

    Objects of cultural heritage significance are created using a wide variety of materials, or mixtures of materials, and often exhibit heterogeneity on multiple length scales. The effective study of these complex constructions thus requires the use of a suite of complementary analytical technologies. Moreover, because of the importance and irreplaceability of most cultural heritage objects, researchers favor analytical techniques that can be employed noninvasively, i.e., without having to remove any material for analysis. As such, analytical imaging has emerged as an important approach for the study of cultural heritage. Imaging technologies commonly employed, from the macroscale through the micro- to nanoscale, are discussed with respect to how the information obtained helps us understand artists' materials and methods, the cultures in which the objects were created, how the objects may have changed over time, and importantly, how we may develop strategies for their preservation.

  3. Carboxyhaemoglobin and plasma thiocyanate: complementary indicators of smoking behaviour?

    PubMed Central

    Saloojee, Y; Vesey, C J; Cole, P V; Russell, M A

    1982-01-01

    Carboxyhaemoglobin and plasma thiocyanate concentrations were measured in 79 non-smokers and 360 cigarette smokers. The mean levels were 0.73% and 7.09% carboxyhaemoglobin and 40 . 2 and 133 . 8 mumol thiocyanate/1 plasma respectively. With 1 . 6% carboxyhaemoglobin and 73 . 0 mumol thiocyanate/1 plasma as critical values the concentrations of carboxyhaemoglobin in 96.6% of subjects and of thiocyanate in 93.4% were compatible with reported smoking status. This difference between the two tests is significant (p less than 0 . 005). Statistical combination of the carboxyhaemoglobin and thiocyanate results, with the use of linear discrimination analysis, only marginally improved their diagnostic efficiency (96.8% of subjects were grouped correctly). This analysis did, however, successfully regroup 21 of 26 individuals with contradictory carboxyhaemoglobin and thiocyanate classifications. It is concluded that in this study determination of thiocyanate added little to the information obtained from carboxyhaemoglobin measurements alone. PMID:7135293

  4. Electronic entanglement in late transition metal oxides.

    PubMed

    Thunström, Patrik; Di Marco, Igor; Eriksson, Olle

    2012-11-02

    We present a study of the entanglement in the electronic structure of the late transition metal monoxides--MnO, FeO, CoO, and NiO--obtained by means of density-functional theory in the local density approximation combined with dynamical mean-field theory. The impurity problem is solved through exact diagonalization, which grants full access to the thermally mixed many-body ground state density operator. The quality of the electronic structure is affirmed through a direct comparison between the calculated electronic excitation spectrum and photoemission experiments. Our treatment allows for a quantitative investigation of the entanglement in the electronic structure. Two main sources of entanglement are explicitly resolved through the use of a fidelity based geometrical entanglement measure, and additional information is gained from a complementary entropic entanglement measure. We show that the interplay of crystal field effects and Coulomb interaction causes the entanglement in CoO to take a particularly intricate form.

  5. Application of the Ramanujan Fourier Transform for the analysis of secondary structure content in amino acid sequences.

    PubMed

    Mainardi, L T; Pattini, L; Cerutti, S

    2007-01-01

    A novel method is presented for the investigation of protein properties of sequences using Ramanujan Fourier Transform (RFT). The new methodology involves the preprocessing of protein sequence data by numerically encoding it and then applying the RFT. The RFT is based on projecting the obtained numerical series on a set of basis functions constituted by Ramanujan sums (RS). In RS components, periodicities of finite integer length, rather than frequency, (as in classical harmonic analysis) are considered. The potential of the new approach is documented by a few examples in the analysis of hydrophobic profiles of proteins in two classes including abundance of alpha-helices (group A) or beta-strands (group B). Different patterns are provided as evidence. RFT can be used to characterize the structural properties of proteins and integrate complementary information provided by other signal processing transforms.

  6. Studying the Structure and Dynamics of Biomolecules by Using Soluble Paramagnetic Probes

    PubMed Central

    Hocking, Henry G; Zangger, Klaus; Madl, Tobias

    2013-01-01

    Characterisation of the structure and dynamics of large biomolecules and biomolecular complexes by NMR spectroscopy is hampered by increasing overlap and severe broadening of NMR signals. As a consequence, the number of available NMR spectroscopy data is often sparse and new approaches to provide complementary NMR spectroscopy data are needed. Paramagnetic relaxation enhancements (PREs) obtained from inert and soluble paramagnetic probes (solvent PREs) provide detailed quantitative information about the solvent accessibility of NMR-active nuclei. Solvent PREs can be easily measured without modification of the biomolecule; are sensitive to molecular structure and dynamics; and are therefore becoming increasingly powerful for the study of biomolecules, such as proteins, nucleic acids, ligands and their complexes in solution. In this Minireview, we give an overview of the available solvent PRE probes and discuss their applications for structural and dynamic characterisation of biomolecules and biomolecular complexes. PMID:23836693

  7. 3D nanoscale imaging of the yeast, Schizosaccharomyces pombe, by full-field transmission X-ray microscopy at 5.4 keV.

    PubMed

    Chen, Jie; Yang, Yunhao; Zhang, Xiaobo; Andrews, Joy C; Pianetta, Piero; Guan, Yong; Liu, Gang; Xiong, Ying; Wu, Ziyu; Tian, Yangchao

    2010-07-01

    Three-dimensional (3D) nanoscale structures of the fission yeast, Schizosaccharomyces pombe, can be obtained by full-field transmission hard X-ray microscopy with 30 nm resolution using synchrotron radiation sources. Sample preparation is relatively simple and the samples are portable across various imaging environments, allowing for high-throughput sample screening. The yeast cells were fixed and double-stained with Reynold's lead citrate and uranyl acetate. We performed both absorption contrast and Zernike phase contrast imaging on these cells in order to test this method. The membranes, nucleus, and subcellular organelles of the cells were clearly visualized using absorption contrast mode. The X-ray images of the cells could be used to study the spatial distributions of the organelles in the cells. These results show unique structural information, demonstrating that hard X-ray microscopy is a complementary method for imaging and analyzing biological samples.

  8. Appendix C demand elasticities for highway travel.

    DOT National Transportation Integrated Search

    2000-04-12

    An elasticity summarizes a large amount of information in a single number. Levels and : distribution of incomes, price levels of the specific good and of substitute and complementary : goods, preferences and tastes, transaction costs, etc., can, cete...

  9. Safe Use of Complementary Health Products and Practices

    MedlinePlus

    ... Mind and Body Practices for Children and Teens Dietary Supplement Safety Information Using Dietary Supplements Wisely Dietary Supplement ... Homeopathic Drugs Dietary Supplements—Adverse Event Reporting ( FDA ) Dietary Supplement Alerts and Advisories Alerts and Advisories Clinical Practice ...

  10. Doing quantum theory at a liberal arts college

    NASA Astrophysics Data System (ADS)

    Schumacher, Benjamin

    2012-02-01

    An academic career at a liberal arts college poses some challenges for a researcher in quantum information and quantum foundations, most notably the lack of local collaborators and graduate students. Are there also complementary advantages and opportunities?

  11. Menopausal Symptoms and Complementary Health Practices

    MedlinePlus

    ... symptoms of liver trouble, such as abdominal pain, dark urine, or jaundice, while taking black cohosh should stop using it and consult a health care provider. See NCCIH’s Web site on black cohosh for more information. DHEA ...

  12. Complementary stable carbon isotope ratio and amount of substance measurements in sports anti-doping.

    PubMed

    Cawley, Adam T; George, Adrian V

    2012-12-01

    The detection of steroids originating from synthetic precursors against a background of their chemically identical natural analogues has proven to be a significant challenge for doping control laboratories accredited by the World Anti-Doping Agency (WADA). The complementary application of gas chromatography-mass spectrometry (GC-MS) and gas chromatography-combustion-isotope ratio mass spectrometry (GC-C-IRMS) has been demonstrated to provide specific detection of endogenous steroid misuse for improved anti-doping analysis. Markers of synthetically derived steroids are reviewed on the basis of abnormal urinary excretions and low (13)C content. A combinatorial approach is presented for the interpretation of GC-MS and GC-C-IRMS data in the anti-doping context. This methodology can allow all relevant information concerning an individual's metabolism to be assessed in order to make an informed decision with respect to a doping violation. Copyright © 2012 John Wiley & Sons, Ltd.

  13. The risks associated with consumer magazines giving advice on complementary therapies.

    PubMed

    Mantle, Fiona

    The increased popularity of complementary and alternative medicine (CAM) has led to increased demand for information on it, giving rise to the concept of "new experts". However, there is concern about the quality and accuracy of this information, much of which is published in popular magazines and written by contributors with no medical qualifications. To examine the extent of CAM product advice in women's and health magazines, and the potential for adverse drug/herbal interaction. Fifteen women's magazines were examined over one month. A total of 150 articles were identified, of which 131 were written by non-medically qualified contributors, mainly journalists. Out of the 150, 95 discussed ingested herbs which had the potential for adverse interactions and are contraindicated for certain groups. The findings have legal and ethical implications. The re-evaluation of the journalists' code of conduct to reflect this development in journalism should be considered.

  14. Hair: a complementary source of bioanalytical information in forensic toxicology.

    PubMed

    Barroso, Mário; Gallardo, Eugenia; Vieira, Duarte Nuno; López-Rivadulla, Manuel; Queiroz, João António

    2011-01-01

    Hair has been used for years in the assessment and documentation of human exposure to drugs, as it presents characteristics that make it extremely valuable for this purpose, namely the fact that sample collection is performed in a noninvasive manner, under close supervision, the possibility of collecting a specimen reflecting a similar timeline in the case of claims or suspicion of a leak in the chain of custody, and the increased window of detection for the drugs. For these reasons, testing for drugs in hair provides unique and useful information in several fields of toxicology, from which the most prominent is the possibility of studying individual drug use histories by means of segmental analysis. This paper will review the unique role of hair as a complementary sample in documenting human exposure to drugs in the fields of clinical and forensic toxicology and workplace drug testing.

  15. Plasmonic-resonance-based ternary composite complementary enhancement of the performance of dye-sensitized solar cells

    NASA Astrophysics Data System (ADS)

    Bai, Lihua; Li, Meiya; Liu, Xiaolian; Luoshan, Mengdai; Zhang, Feng; Guo, Kaimo; Zhu, Yongdan; Sun, Beilei; Zhao, Xingzhong

    2016-10-01

    Graphene (G), TiO2 fusiform nanorods (TiO2NRs) adsorbed with Au nanoparticles (AuNPs) are prepared and blended as multifunctional materials into TiO2 nanocrystalline film to form a novel ternary (G-TiO2NRs-Au) composite photoanode in dye-sensitized solar cells (DSSCs). The effects of G-TiO2NRs-Au on the properties of the photoanode and DSSC are investigated. Results show that, by blending G-TiO2NRs-Au, the light absorption and scattering of the photoanode are obviously improved, and the charge transfer resistance R2 and electron recombination are decreased, resulting in a significant enhancement in the short-circuit current density (J sc) and the photoelectric conversion efficiency (PCE) of the DSSCs. The maximum J sc of 17.66 mA cm-2 and PCE of 8.56% are obtained in the optimal G-TiO2NRs-Au-based DSSC, about 33.6% and 35.0% higher than that obtained in the conventional TiO2-based DSSC. This significant improvement in the performance of the DSSC can be attributed to the ternary composite complementary effects of multi-functions from the surface plasmon resonance of AuNPs, light scattering of TiO2NRs, and the improved dye loading and fast electron transmission channel from graphene. This study provides an effective way of ternary composite complementary enhancement of the J sc and PCE of the DSSCs.

  16. Comparison of impedimetric detection of DNA hybridization on the various biosensors based on modified glassy carbon electrodes with PANHS and nanomaterials of RGO and MWCNTs.

    PubMed

    Benvidi, Ali; Tezerjani, Marzieh Dehghan; Jahanbani, Shahriar; Mazloum Ardakani, Mohammad; Moshtaghioun, Seyed Mohammad

    2016-01-15

    In this research, we have developed lable free DNA biosensors based on modified glassy carbon electrodes (GCE) with reduced graphene oxide (RGO) and carbon nanotubes (MWCNTs) for detection of DNA sequences. This paper compares the detection of BRCA1 5382insC mutation using independent glassy carbon electrodes (GCE) modified with RGO and MWCNTs. A probe (BRCA1 5382insC mutation detection (ssDNA)) was then immobilized on the modified electrodes for a specific time. The immobilization of the probe and its hybridization with the target DNA (Complementary DNA) were performed under optimum conditions using different electrochemical techniques such as cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The proposed biosensors were used for determination of complementary DNA sequences. The non-modified DNA biosensor (1-pyrenebutyric acid-N- hydroxysuccinimide ester (PANHS)/GCE), revealed a linear relationship between ∆Rct and logarithm of the complementary target DNA concentration ranging from 1.0×10(-16)molL(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.992, for DNA biosensors modified with multi-wall carbon nanotubes (MWCNTs) and reduced graphene oxide (RGO) wider linear range and lower detection limit were obtained. For ssDNA/PANHS/MWCNTs/GCE a linear range 1.0×10(-17)mol L(-1)-1.0×10(-10)mol L(-1) with a correlation coefficient of 0.993 and for ssDNA/PANHS/RGO/GCE a linear range from 1.0×10(-18)mol L(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.985 were obtained. In addition, the mentioned biosensors were satisfactorily applied for discriminating of complementary sequences from noncomplementary sequences, so the mentioned biosensors can be used for the detection of BRCA1-associated breast cancer. Copyright © 2015. Published by Elsevier B.V.

  17. Understanding cancer survivors' information needs and information-seeking behaviors for complementary and alternative medicine from short- to long-term survival: a mixed-methods study.

    PubMed

    Scarton, Lou Ann; Del Fiol, Guilherme; Oakley-Girvan, Ingrid; Gibson, Bryan; Logan, Robert; Workman, T Elizabeth

    2018-01-01

    The research examined complementary and alternative medicine (CAM) information-seeking behaviors and preferences from short- to long-term cancer survival, including goals, motivations, and information sources. A mixed-methods approach was used with cancer survivors from the "Assessment of Patients' Experience with Cancer Care" 2004 cohort. Data collection included a mail survey and phone interviews using the critical incident technique (CIT). Seventy survivors from the 2004 study responded to the survey, and eight participated in the CIT interviews. Quantitative results showed that CAM usage did not change significantly between 2004 and 2015. The following themes emerged from the CIT: families' and friends' provision of the initial introduction to a CAM, use of CAM to manage the emotional and psychological impact of cancer, utilization of trained CAM practitioners, and online resources as a prominent source for CAM information. The majority of participants expressed an interest in an online information-sharing portal for CAM. Patients continue to use CAM well into long-term cancer survivorship. Finding trustworthy sources for information on CAM presents many challenges such as reliability of source, conflicting information on efficacy, and unknown interactions with conventional medications. Study participants expressed interest in an online portal to meet these needs through patient testimonials and linkage of claims to the scientific literature. Such a portal could also aid medical librarians and clinicians in locating and evaluating CAM information on behalf of patients.

  18. Understanding cancer survivors’ information needs and information-seeking behaviors for complementary and alternative medicine from short- to long-term survival: a mixed-methods study

    PubMed Central

    Scarton, Lou Ann; Del Fiol, Guilherme; Oakley-Girvan, Ingrid; Gibson, Bryan; Logan, Robert; Workman, T. Elizabeth

    2018-01-01

    Objective The research examined complementary and alternative medicine (CAM) information-seeking behaviors and preferences from short- to long-term cancer survival, including goals, motivations, and information sources. Methods A mixed-methods approach was used with cancer survivors from the “Assessment of Patients’ Experience with Cancer Care” 2004 cohort. Data collection included a mail survey and phone interviews using the critical incident technique (CIT). Results Seventy survivors from the 2004 study responded to the survey, and eight participated in the CIT interviews. Quantitative results showed that CAM usage did not change significantly between 2004 and 2015. The following themes emerged from the CIT: families’ and friends’ provision of the initial introduction to a CAM, use of CAM to manage the emotional and psychological impact of cancer, utilization of trained CAM practitioners, and online resources as a prominent source for CAM information. The majority of participants expressed an interest in an online information-sharing portal for CAM. Conclusion Patients continue to use CAM well into long-term cancer survivorship. Finding trustworthy sources for information on CAM presents many challenges such as reliability of source, conflicting information on efficacy, and unknown interactions with conventional medications. Study participants expressed interest in an online portal to meet these needs through patient testimonials and linkage of claims to the scientific literature. Such a portal could also aid medical librarians and clinicians in locating and evaluating CAM information on behalf of patients. PMID:29339938

  19. Educational interventions for improving primary caregiver complementary feeding practices for children aged 24 months and under.

    PubMed

    Arikpo, Dachi; Edet, Ededet Sewanu; Chibuzor, Moriam T; Odey, Friday; Caldwell, Deborah M

    2018-05-18

    Although complementary feeding is a universal practice, the methods and manner in which it is practiced vary between cultures, individuals and socioeconomic classes. The period of complementary feeding is a critical time of transition in the life of an infant, and inappropriate complementary feeding practices, with their associated adverse health consequences, remain a significant global public health problem. Educational interventions are widely acknowledged as effective in promoting public health strategy, and those aimed at improving complementary feeding practices provide information about proper complementary feeding practices to caregivers of infants/children. It is therefore important to summarise evidence on the effectiveness of educational interventions to improve the complementary feeding practices of caregivers of infants. To assess the effectiveness of educational interventions for improving the complementary feeding (weaning) practices of primary caregivers of children of complementary feeding age, and related health and growth outcomes in infants. In November 2017, we searched CENTRAL, MEDLINE, Embase, 10 other databases and two trials registers. We also searched the reference lists of relevant studies and reviews to identify any additional studies. We did not limit the searches by date, language or publication status. Randomised controlled trials (RCTs), comparing educational interventions to no intervention, usual practice, or educational interventions provided in conjunction with another intervention, so long as the educational intervention was only available in the experimental group and the adjunctive intervention was available to the control group. Study participants included caregivers of infants aged 4 to 24 months undergoing complementary feeding. Pregnant women who were expected to give birth and commence complementary feeding during the period of the study were also included. Two review authors independently extracted data on participants, settings, interventions, methodology and outcomes using a specifically-developed and piloted data extraction form. We calculated risk ratios (RR) and 95% confidence intervals (CIs) for dichotomous data, and mean differences (MD) and 95% CIs for continuous data. Where data permitted, we conducted a meta-analysis using a random-effects model. We assessed the included studies for risk of bias and also assessed the quality of evidence using the GRADE approach. We included 23 studies (from 35 reports) with a total of 11,170 caregiver-infant pairs who were randomly assigned to receive an educational intervention delivered to the caregiver or usual care. Nineteen of the included studies were community-based studies while four were facility-based studies. In addition, 13 of the included studies were cluster-randomised while the others were individually randomised. Generally, the interventions were focused on the introduction of complementary feeding at the appropriate time, the types and amount of complementary foods to be fed to infants, and hygiene. Using the GRADE criteria, we assessed the quality of the evidence as moderate, mostly due to inadequate allocation concealment and insufficient blinding.Educational interventions led to improvements in complementary feeding practices for age at introduction of complementary foods (average RR 0.88, 95% CI 0.83 to 0.94; 4 studies, 1738 children; moderate-quality evidence) and hygiene practices (average RR 1.38, 95% CI 1.23 to 1.55; 4 studies, 2029 participants; moderate-quality evidence). For duration of exclusive breastfeeding, pooled results were compatible with both a reduction and an increase in the outcome (average RR 1.58, 95% CI 0.77 to 3.22; 3 studies, 1544 children; very low-quality evidence). There was limited (low to very low-quality) evidence of an effect for all growth outcomes.Quality of evidenceThere is moderate to very low-quality evidence that educational interventions can improve complementary feeding practices but insufficient evidence to conclude that it impacts growth outcomes. Overall, we found evidence that education improves complementary feeding practices.

  20. Fluorescence correlation spectroscopy study of the complexation of DNA hybrids, IgG antibody, and a chimeric protein of IgG-binding ZZ domains fused with a carbohydrate binding module.

    PubMed

    Rosa, A M M; Prazeres, D M F; Paulo, P M R

    2017-06-28

    Fluorescence correlation spectroscopy (FCS) was used to characterize the molecular interactions between the four components of a DNA recognition system. A fluorescent DNA probe was used to assess: (i) the hybridization with a complementary biotin-labeled target, (ii) the complexation of the resulting hybrid and an anti-biotin antibody, and (iii) the binding of the latter complex to a ZZ-CBM fusion protein that combines small synthetic IgG Fc-binding Z domains with a carbohydrate binding module (CBM). These binding interactions were monitored by exposing the fluorescent DNA probe to different amounts and combinations of the other molecules in solution. Through the analysis of FCS autocorrelation curves, an association constant (K a ) of 2.9 × 10 7 M -1 was estimated for DNA·DNA hybridization, and the presence of (non-) complementary target DNA in solution could be discriminated. The specific capture of biotinylated DNA hybrids by anti-biotin IgG was verified, with an apparent K a of 2.5 × 10 6 M -1 . The increment in the diffusion time measured when the DNA·DNA:antibody complexes were in contact with the ZZ-CBM fusion protein suggested that the binding occurs at a stoichiometric ratio of DNA/antibody complex to fusion larger than 1 : 1. The FCS-derived information obtained is useful to gain insight into molecular interactions involved in diagnostic assays.

  1. Studies of Mineral-Water Surfaces

    NASA Astrophysics Data System (ADS)

    Ross, Nancy L.; Spencer, Elinor C.; Levchenko, Andrey A.; Kolesnikov, Alexander I.; Wesolowski, David J.; Cole, David R.; Mamontov, Eugene; Vlcek, Lukas

    In this chapter we discuss the application of inelastic and quasielastic neutron scattering to the elucidation of the structure, energetics, and dynamics of water confined on the surfaces of mineral oxide nanoparticles. We begin by highlighting recent advancements in this active field of research before providing a brief review of the theory underpinning inelastic neutron scattering (INS) and quasielastic neutron scattering (QENS) techniques. We then discuss examples illustrating the use of neutron scattering methods for studying hydration layers that are an integral part of the nanoparticle structure. The first investigation of this kind, namely the INS analysis of hydrated ZrO2 nanoparticles, is described, as well as a later, complementary QENS study that allowed for the dynamics of diffusion of the water molecules within the hydration layer to be examined in detail. The diverse range of information available from INS experiments is illustrated by a recent study combining INS with calorimetric experiments that elucidated the thermodynamic properties of adsorbed water on anatase (TiO2) nanoparticles. To emphasize the importance of molecular dynamics (MD) simulations for deconvoluting complex QENS spectra, we describe both the MD and the QENS analysis of rutile (TiO2) and cassiterite (SnO2) nanoparticle systems and show that, when combined, data obtained by these two complementary methods can provide a complete description of the motion of the water molecules on the nanoparticle surface. We close with a glimpse into the future for this thriving field of research.

  2. Relationship between the caregiver's report on the patient's spontaneous-speech and the Brief Aphasia Evaluation.

    PubMed

    Vigliecca, Nora Silvana

    2017-11-09

    To study the relationship between the caregiver's perception about the patient's impairment in spontaneous speech, according to an item of four questions administered by semi-structured interview, and the patient's performance in the Brief Aphasia Evaluation (BAE). 102 right-handed patients with focal brain lesions of different types and location were examined. BAE is a valid and reliable instrument to assess aphasia. The caregiver's perception was correlated with the item of spontaneous speech, the total score and the three main factors of the BAE: Expression, Comprehension and Complementary factors. The precision (sensitivity/ specificity) about the caregiver's perception of the patient's spontaneous speech was analyzed with reference to the presence or absence of disorder, according to the professional, on the BAE item of spontaneous speech. The studied correlation was satisfactory, being greater (higher than 80%) for the following indicators: the item of spontaneous speech, the Expression factor and the total score of the scale; the correlation was a little smaller (higher than 70%) for the Comprehension and Complementary factors. Comparing two cut-off points that evaluated the precision of the caregiver's perception, satisfactory results were observed in terms of sensitivity and specificity (>70%) with likelihood ratios higher than three. By using the median as the cut-off point, more satisfactory diagnostic discriminations were obtained. Interviewing the caregiver specifically on the patient's spontaneous speech, in an abbreviated form, provides relevant information for the aphasia diagnosis.

  3. geneCommittee: a web-based tool for extensively testing the discriminatory power of biologically relevant gene sets in microarray data classification.

    PubMed

    Reboiro-Jato, Miguel; Arrais, Joel P; Oliveira, José Luis; Fdez-Riverola, Florentino

    2014-01-30

    The diagnosis and prognosis of several diseases can be shortened through the use of different large-scale genome experiments. In this context, microarrays can generate expression data for a huge set of genes. However, to obtain solid statistical evidence from the resulting data, it is necessary to train and to validate many classification techniques in order to find the best discriminative method. This is a time-consuming process that normally depends on intricate statistical tools. geneCommittee is a web-based interactive tool for routinely evaluating the discriminative classification power of custom hypothesis in the form of biologically relevant gene sets. While the user can work with different gene set collections and several microarray data files to configure specific classification experiments, the tool is able to run several tests in parallel. Provided with a straightforward and intuitive interface, geneCommittee is able to render valuable information for diagnostic analyses and clinical management decisions based on systematically evaluating custom hypothesis over different data sets using complementary classifiers, a key aspect in clinical research. geneCommittee allows the enrichment of microarrays raw data with gene functional annotations, producing integrated datasets that simplify the construction of better discriminative hypothesis, and allows the creation of a set of complementary classifiers. The trained committees can then be used for clinical research and diagnosis. Full documentation including common use cases and guided analysis workflows is freely available at http://sing.ei.uvigo.es/GC/.

  4. Physicochemical study of natural fractionated biocolloid by asymmetric flow field-flow fractionation in tandem with various complementary techniques using biologically synthesized silver nanocomposites.

    PubMed

    Railean-Plugaru, Viorica; Pomastowski, Pawel; Kowalkowski, Tomasz; Sprynskyy, Myroslav; Buszewski, Boguslaw

    2018-04-01

    Asymmetric flow field-flow fractionation coupled with use of ultraviolet-visible, multiangle light scattering (MALLS), and dynamic light scattering (DLS) detectors was used for separation and characterization of biologically synthesized silver composites in two liquid compositions. Moreover, to supplement the DLS/MALLS information, various complementary techniques such as transmission electron spectroscopy, Fourier transform infrared spectroscopy, and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) were used. The hydrodynamic diameter and the radius of gyration of silver composites were slightly larger than the sizes obtained by transmission electron microscopy (TEM). Moreover, the TEM results revealed the presence of silver clusters and even several morphologies, including multitwinned. Additionally, MALDI-TOF MS examination showed that the particles have an uncommon cluster structure. It can be described as being composed of two or more silver clusters. The organic surface of the nanoparticles can modify their dispersion. We demonstrated that the variation of the silver surface coating directly influenced the migration rate of biologically synthesized silver composites. Moreover, this study proves that the fractionation mechanism of silver biocolloids relies not only on the particle size but also on the type and mass of the surface coatings. Because silver nanoparticles typically have size-dependent cytotoxicity, this behavior is particularly relevant for biomedical applications. Graphical abstract Workflow for asymmetric flow field-flow fractionation of natural biologically synthesized silver nanocomposites.

  5. Simulations Using Random-Generated DNA and RNA Sequences

    ERIC Educational Resources Information Center

    Bryce, C. F. A.

    1977-01-01

    Using a very simple computer program written in BASIC, a very large number of random-generated DNA or RNA sequences are obtained. Students use these sequences to predict complementary sequences and translational products, evaluate base compositions, determine frequencies of particular triplet codons, and suggest possible secondary structures.…

  6. Nurses' Needs for Education on Cancer and End-of-life Care.

    ERIC Educational Resources Information Center

    Meraviglia, Martha G.; McGuire, Catherine; Chesley, Dorothy A.

    2003-01-01

    From a random sample of Texas registered nurses, 352 respondents (8.3%) primarily obtained continuing education from workshops, inservice education, and independent studies, citing cost, location, content, and length of course as influencing factors. Their cancer educational needs included clinical trials, genetics, complementary therapies, and…

  7. Studying Epigenetic DNA Modifications in Undergraduate Laboratories Using Complementary Bioinformatic and Molecular Approaches

    ERIC Educational Resources Information Center

    Militello, Kevin T.

    2013-01-01

    Epigenetic inheritance is the inheritance of genetic information that is not based on DNA sequence alone. One type of epigenetic information that has come to the forefront in the last few years is modified DNA bases. The most common modified DNA base in nature is 5-methylcytosine. Herein, we describe a laboratory experiment that combines…

  8. Efficient transfer of information from hexitol nucleic acids to RNA during nonenzymatic oligomerization

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; De Bouvere, B.; Van Aerschot, A.; Herdewijn, P.; Orgel, L. E.

    1999-01-01

    Hexitol nucleic acids (HNAs) are DNA analogues that contain the standard nucleoside bases attached to a phosphorylated 1,5-anhydrohexitol backbone. We find that HNAs support efficient information transfer in nonensymatic template-directed reactions. HNA heterosequences appeared to be superior to the corresponding DNA heterosequences in facilitating synthesis of complementary oligonucleotides from nucleoside-5'-phosphoro-2-methyl imidazolides.

  9. Ranking streamflow model performance based on Information theory metrics

    NASA Astrophysics Data System (ADS)

    Martinez, Gonzalo; Pachepsky, Yakov; Pan, Feng; Wagener, Thorsten; Nicholson, Thomas

    2016-04-01

    The accuracy-based model performance metrics not necessarily reflect the qualitative correspondence between simulated and measured streamflow time series. The objective of this work was to use the information theory-based metrics to see whether they can be used as complementary tool for hydrologic model evaluation and selection. We simulated 10-year streamflow time series in five watersheds located in Texas, North Carolina, Mississippi, and West Virginia. Eight model of different complexity were applied. The information-theory based metrics were obtained after representing the time series as strings of symbols where different symbols corresponded to different quantiles of the probability distribution of streamflow. The symbol alphabet was used. Three metrics were computed for those strings - mean information gain that measures the randomness of the signal, effective measure complexity that characterizes predictability and fluctuation complexity that characterizes the presence of a pattern in the signal. The observed streamflow time series has smaller information content and larger complexity metrics than the precipitation time series. Watersheds served as information filters and and streamflow time series were less random and more complex than the ones of precipitation. This is reflected the fact that the watershed acts as the information filter in the hydrologic conversion process from precipitation to streamflow. The Nash Sutcliffe efficiency metric increased as the complexity of models increased, but in many cases several model had this efficiency values not statistically significant from each other. In such cases, ranking models by the closeness of the information-theory based parameters in simulated and measured streamflow time series can provide an additional criterion for the evaluation of hydrologic model performance.

  10. Effective communication about the use of complementary and integrative medicine in cancer care.

    PubMed

    Frenkel, Moshe; Cohen, Lorenzo

    2014-01-01

    Complementary and integrative medicine (CIM) is becoming an increasingly popular and visible component of oncology care. Many patients affected by cancer and their family members are looking for informed advice and desire communication with their physicians about CIM use. Patients affected by cancer come to discuss CIM use with intense emotions and are experiencing an existential crisis that cannot be ignored. Effective communication is crucial in establishing trust with these patients and their families. Communication is now recognized as a core clinical skill in medicine, including cancer care, and is important to the delivery of high-quality care. The quality of communication affects patient satisfaction, decision-making, patient distress and well-being, compliance, and even malpractice litigation. The communication process about CIM use requires a very sensitive approach that depends on effective communication skills, such as experience in listening, encouraging hope, and ability to convey empathy and compassion. This process can be divided into two parts: the "how" and the "what". The "how" relates to the change in clinician attitude, the process of gathering information, addressing patients' unmet needs and emotions, and dealing with uncertainty. The "what" relates to the process of information exchange while assisting patients in decisions about CIM use by using reliable information sources, leading to informed decision-making.

  11. DSCOVR EPIC L2 Atmospheric Correction (MAIAC) Data Release Announcement

    Atmospheric Science Data Center

    2018-06-22

    ... several atmospheric quantities including cloud mask and aerosol optical depth (AOD) required for atmospheric correction. The parameters ... is a useful complementary dataset to MODIS and VIIRS global aerosol products.   Information about the DSCOVR EPIC Atmospheric ...

  12. Why Current Statistics of Complementary Alternative Medicine Clinical Trials is Invalid.

    PubMed

    Pandolfi, Maurizio; Carreras, Giulia

    2018-06-07

    It is not sufficiently known that frequentist statistics cannot provide direct information on the probability that the research hypothesis tested is correct. The error resulting from this misunderstanding is compounded when the hypotheses under scrutiny have precarious scientific bases, which, generally, those of complementary alternative medicine (CAM) are. In such cases, it is mandatory to use inferential statistics, considering the prior probability that the hypothesis tested is true, such as the Bayesian statistics. The authors show that, under such circumstances, no real statistical significance can be achieved in CAM clinical trials. In this respect, CAM trials involving human material are also hardly defensible from an ethical viewpoint.

  13. Visualization and characterization of engineered nanoparticles in complex environmental and food matrices using atmospheric scanning electron microscopy.

    PubMed

    Luo, P; Morrison, I; Dudkiewicz, A; Tiede, K; Boyes, E; O'Toole, P; Park, S; Boxall, A B

    2013-04-01

    Imaging and characterization of engineered nanoparticles (ENPs) in water, soils, sediment and food matrices is very important for research into the risks of ENPs to consumers and the environment. However, these analyses pose a significant challenge as most existing techniques require some form of sample manipulation prior to imaging and characterization, which can result in changes in the ENPs in a sample and in the introduction of analytical artefacts. This study therefore explored the application of a newly designed instrument, the atmospheric scanning electron microscope (ASEM), which allows the direct characterization of ENPs in liquid matrices and which therefore overcomes some of the limitations associated with existing imaging methods. ASEM was used to characterize the size distribution of a range of ENPs in a selection of environmental and food matrices, including supernatant of natural sediment, test medium used in ecotoxicology studies, bovine serum albumin and tomato soup under atmospheric conditions. The obtained imaging results were compared to results obtained using conventional imaging by transmission electron microscope (TEM) and SEM as well as to size distribution data derived from nanoparticle tracking analysis (NTA). ASEM analysis was found to be a complementary technique to existing methods that is able to visualize ENPs in complex liquid matrices and to provide ENP size information without extensive sample preparation. ASEM images can detect ENPs in liquids down to 30 nm and to a level of 1 mg L(-1) (9×10(8) particles mL(-1) , 50 nm Au ENPs). The results indicate ASEM is a highly complementary method to existing approaches for analyzing ENPs in complex media and that its use will allow those studying to study ENP behavior in situ, something that is currently extremely challenging to do. © 2013 The Authors Journal of Microscopy © 2013 Royal Microscopical Society.

  14. Electron Capture Dissociation of Divalent Metal-adducted Sulfated N-Glycans Released from Bovine Thyroid Stimulating Hormone

    NASA Astrophysics Data System (ADS)

    Zhou, Wen; Håkansson, Kristina

    2013-11-01

    Sulfated N-glycans released from bovine thyroid stimulating hormone (bTSH) were ionized with the divalent metal cations Ca2+, Mg2+, and Co by electrospray ionization (ESI). These metal-adducted species were subjected to infrared multiphoton dissociation (IRMPD) and electron capture dissociation (ECD) and the corresponding fragmentation patterns were compared. IRMPD generated extensive glycosidic and cross-ring cleavages, but most product ions suffered from sulfonate loss. Internal fragments were also observed, which complicated the spectra. ECD provided complementary structural information compared with IRMPD, and all observed product ions retained the sulfonate group, allowing sulfonate localization. To our knowledge, this work represents the first application of ECD towards metal-adducted sulfated N-glycans released from a glycoprotein. Due to the ability of IRMPD and ECD to provide complementary structural information, the combination of the two strategies is a promising and valuable tool for glycan structural characterization. The influence of different metal ions was also examined. Calcium adducts appeared to be the most promising species because of high sensitivity and ability to provide extensive structural information.

  15. What do evaluation instruments tell us about the quality of complementary medicine information on the internet?

    PubMed

    Breckons, Matthew; Jones, Ray; Morris, Jenny; Richardson, Janet

    2008-01-22

    Developers of health information websites aimed at consumers need methods to assess whether their website is of "high quality." Due to the nature of complementary medicine, website information is diverse and may be of poor quality. Various methods have been used to assess the quality of websites, the two main approaches being (1) to compare the content against some gold standard, and (2) to rate various aspects of the site using an assessment tool. We aimed to review available evaluation instruments to assess their performance when used by a researcher to evaluate websites containing information on complementary medicine and breast cancer. In particular, we wanted to see if instruments used the same criteria, agreed on the ranking of websites, were easy to use by a researcher, and if use of a single tool was sufficient to assess website quality. Bibliographic databases, search engines, and citation searches were used to identify evaluation instruments. Instruments were included that enabled users with no subject knowledge to make an objective assessment of a website containing health information. The elements of each instrument were compared to nine main criteria defined by a previous study. Google was used to search for complementary medicine and breast cancer sites. The first six results and a purposive six from different origins (charities, sponsored, commercial) were chosen. Each website was assessed using each tool, and the percentage of criteria successfully met was recorded. The ranking of the websites by each tool was compared. The use of the instruments by others was estimated by citation analysis and Google searching. A total of 39 instruments were identified, 12 of which met the inclusion criteria; the instruments contained between 4 and 43 questions. When applied to 12 websites, there was agreement of the rank order of the sites with 10 of the instruments. Instruments varied in the range of criteria they assessed and in their ease of use. Comparing the content of websites against a gold standard is time consuming and only feasible for very specific advice. Evaluation instruments offer gateway providers a method to assess websites. The checklist approach has face validity when results are compared to the actual content of "good" and "bad" websites. Although instruments differed in the range of items assessed, there was fair agreement between most available instruments. Some were easier to use than others, but these were not necessarily the instruments most widely used to date. Combining some of the better features of instruments to provide fewer, easy-to-use methods would be beneficial to gateway providers.

  16. Multiview three-dimensional display with continuous motion parallax through planar aligned OLED microdisplays.

    PubMed

    Teng, Dongdong; Xiong, Yi; Liu, Lilin; Wang, Biao

    2015-03-09

    Existing multiview three-dimensional (3D) display technologies encounter discontinuous motion parallax problem, due to a limited number of stereo-images which are presented to corresponding sub-viewing zones (SVZs). This paper proposes a novel multiview 3D display system to obtain continuous motion parallax by using a group of planar aligned OLED microdisplays. Through blocking partial light-rays by baffles inserted between adjacent OLED microdisplays, transitional stereo-image assembled by two spatially complementary segments from adjacent stereo-images is presented to a complementary fusing zone (CFZ) which locates between two adjacent SVZs. For a moving observation point, the spatial ratio of the two complementary segments evolves gradually, resulting in continuously changing transitional stereo-images and thus overcoming the problem of discontinuous motion parallax. The proposed display system employs projection-type architecture, taking the merit of full display resolution, but at the same time having a thin optical structure, offering great potentials for portable or mobile 3D display applications. Experimentally, a prototype display system is demonstrated by 9 OLED microdisplays.

  17. Regional input to joint European space weather service

    NASA Astrophysics Data System (ADS)

    Stanislawska, I.; Belehaki, A.; Jansen, F.; Heynderickx, D.; Lilensten, J.; Candidi, M.

    The basis for elaborating within COST 724 Action Developing the scientific basis for monitoring modeling and predicting Space Weather European space weather service is rich by many national and international activities which provide instruments and tools for global as well as regional monitoring and modeling COST 724 stimulates coordinates and supports Europe s goals of development and global cooperation by providing standards for timely and high quality information and knowledge in space weather Existing local capabilities are taken into account to develop synergies and avoid duplication The enhancement of environment monitoring networks and associated instruments technology yields mutual advantages for European service and regional services specialized for local users needs It structurally increases the integration of limited-area services generates a platform employing the same approach to each task differing mostly in input and output data In doing so it also provides complementary description of the environmental state within issued information A general scheme of regional services concept within COST 724 activity can be the processing chain from measurements trough algorithms to operational knowledge It provides the platform for interaction among the local end users who define what kind of information they need system providers who elaborate tools necessary to obtain required information and local service providers who do the actual processing of data and tailor it to specific user s needs Such initiative creates a unique possibility for small

  18. Characteristics and Outcomes of Female Infertility Treatment Programs Using Traditional Medicine in Korea: A Multisite Analysis.

    PubMed

    Kim, Kyeong Han; Jang, Soobin; Lee, Ju Ah; Go, Ho-Yeon; Jung, Jeeyoun; Park, Sunju; Lee, Myeong Soo; Ko, Seong-Gyu

    2018-03-22

    Infertility has long been recognized as a treatable disease, and complementary and alternative medicine treatments, such as acupuncture and moxibustion, have been used in Korea and China. This study describes female infertility treatment programs that used traditional Korean medicine (TKM) and were conducted by local governments in Korea and evaluates its effectiveness and safety. The authors officially requested related information from the report of the infertility treatment programs and related sources from 2006 to 2016 from the Health & Welfare Ministry of Korea and the Association of Korean Medicine (AKOM). Additional information was obtained from six Korean databases. Data including basic information about the programs, participant information, interventions, and outcomes were abstracted. A total of 9 reports, including multiple years of data from 6 programs (total 13 programs), were identified. In these 13 programs, a total of 1023 female subjects participated, and 205 of the 887 subjects who completed the program reported a successful pregnancy, indicating a 23.1% pregnancy rate. The programs lasted 3-9 months, and interventional elements, such as herbal medicine, acupuncture, fumigation, and massage, were identified. Significant adverse effects were not reported. This study suggests that infertility treatment programs with TKM interventions exhibited a positive effect on pregnancy in females with infertility. Thus, the infertility treatment programs with TKM interventions are expected to be useful and might serve as the primary treatment before assisted reproduction techniques.

  19. Visualizing the anatomical-functional correlation of the human brain

    NASA Astrophysics Data System (ADS)

    Chang, YuKuang; Rockwood, Alyn P.; Reiman, Eric M.

    1995-04-01

    Three-dimensional tomographic images obtained from different modalities or from the same modality at different times provide complementary information. For example, while PET shows brain function, images from MRI identify anatomical structures. In this paper, we investigate the problem of displaying available information about structures and function together. Several steps are described to achieve our goal. These include segmentation of the data, registration, resampling, and display. Segmentation is used to identify brain tissue from surrounding tissues, especially in the MRI data. Registration aligns the different modalities as closely as possible. Resampling arises from the registration since two data sets do not usually correspond and the rendering method is most easily achieved if the data correspond to the same grid used in display. We combine several techniques to display the data. MRI data is reconstructed from 2D slices into 3D structures from which isosurfaces are extracted and represented by approximating polygonalizations. These are then displayed using standard graphics pipelines including shaded and transparent images. PET data measures the qualitative rates of cerebral glucose utilization or oxygen consumption. PET image is best displayed as a volume of luminous particles. The combination of both display methods allows the viewer to compare the functional information contained in the PET data with the anatomically more precise MRI data.

  20. Concurrent initialization for Bearing-Only SLAM.

    PubMed

    Munguía, Rodrigo; Grau, Antoni

    2010-01-01

    Simultaneous Localization and Mapping (SLAM) is perhaps the most fundamental problem to solve in robotics in order to build truly autonomous mobile robots. The sensors have a large impact on the algorithm used for SLAM. Early SLAM approaches focused on the use of range sensors as sonar rings or lasers. However, cameras have become more and more used, because they yield a lot of information and are well adapted for embedded systems: they are light, cheap and power saving. Unlike range sensors which provide range and angular information, a camera is a projective sensor which measures the bearing of images features. Therefore depth information (range) cannot be obtained in a single step. This fact has propitiated the emergence of a new family of SLAM algorithms: the Bearing-Only SLAM methods, which mainly rely in especial techniques for features system-initialization in order to enable the use of bearing sensors (as cameras) in SLAM systems. In this work a novel and robust method, called Concurrent Initialization, is presented which is inspired by having the complementary advantages of the Undelayed and Delayed methods that represent the most common approaches for addressing the problem. The key is to use concurrently two kinds of feature representations for both undelayed and delayed stages of the estimation. The simulations results show that the proposed method surpasses the performance of previous schemes.

  1. A prototype hand-held tri-modal instrument for in vivo ultrasound, photoacoustic, and fluorescence imaging

    NASA Astrophysics Data System (ADS)

    Kang, Jeeun; Chang, Jin Ho; Wilson, Brian C.; Veilleux, Israel; Bai, Yanhui; DaCosta, Ralph; Kim, Kang; Ha, Seunghan; Lee, Jong Gun; Kim, Jeong Seok; Lee, Sang-Goo; Kim, Sun Mi; Lee, Hak Jong; Ahn, Young Bok; Han, Seunghee; Yoo, Yangmo; Song, Tai-Kyong

    2015-03-01

    Multi-modality imaging is beneficial for both preclinical and clinical applications as it enables complementary information from each modality to be obtained in a single procedure. In this paper, we report the design, fabrication, and testing of a novel tri-modal in vivo imaging system to exploit molecular/functional information from fluorescence (FL) and photoacoustic (PA) imaging as well as anatomical information from ultrasound (US) imaging. The same ultrasound transducer was used for both US and PA imaging, bringing the pulsed laser light into a compact probe by fiberoptic bundles. The FL subsystem is independent of the acoustic components but the front end that delivers and collects the light is physically integrated into the same probe. The tri-modal imaging system was implemented to provide each modality image in real time as well as co-registration of the images. The performance of the system was evaluated through phantom and in vivo animal experiments. The results demonstrate that combining the modalities does not significantly compromise the performance of each of the separate US, PA, and FL imaging techniques, while enabling multi-modality registration. The potential applications of this novel approach to multi-modality imaging range from preclinical research to clinical diagnosis, especially in detection/localization and surgical guidance of accessible solid tumors.

  2. An Innovative Approach for The Integration of Proteomics and Metabolomics Data In Severe Septic Shock Patients Stratified for Mortality.

    PubMed

    Cambiaghi, Alice; Díaz, Ramón; Martinez, Julia Bauzá; Odena, Antonia; Brunelli, Laura; Caironi, Pietro; Masson, Serge; Baselli, Giuseppe; Ristagno, Giuseppe; Gattinoni, Luciano; de Oliveira, Eliandre; Pastorelli, Roberta; Ferrario, Manuela

    2018-04-27

    In this work, we examined plasma metabolome, proteome and clinical features in patients with severe septic shock enrolled in the multicenter ALBIOS study. The objective was to identify changes in the levels of metabolites involved in septic shock progression and to integrate this information with the variation occurring in proteins and clinical data. Mass spectrometry-based targeted metabolomics and untargeted proteomics allowed us to quantify absolute metabolites concentration and relative proteins abundance. We computed the ratio D7/D1 to take into account their variation from day 1 (D1) to day 7 (D7) after shock diagnosis. Patients were divided into two groups according to 28-day mortality. Three different elastic net logistic regression models were built: one on metabolites only, one on metabolites and proteins and one to integrate metabolomics and proteomics data with clinical parameters. Linear discriminant analysis and Partial least squares Discriminant Analysis were also implemented. All the obtained models correctly classified the observations in the testing set. By looking at the variable importance (VIP) and the selected features, the integration of metabolomics with proteomics data showed the importance of circulating lipids and coagulation cascade in septic shock progression, thus capturing a further layer of biological information complementary to metabolomics information.

  3. Weighted similarity-based clustering of chemical structures and bioactivity data in early drug discovery.

    PubMed

    Perualila-Tan, Nolen Joy; Shkedy, Ziv; Talloen, Willem; Göhlmann, Hinrich W H; Moerbeke, Marijke Van; Kasim, Adetayo

    2016-08-01

    The modern process of discovering candidate molecules in early drug discovery phase includes a wide range of approaches to extract vital information from the intersection of biology and chemistry. A typical strategy in compound selection involves compound clustering based on chemical similarity to obtain representative chemically diverse compounds (not incorporating potency information). In this paper, we propose an integrative clustering approach that makes use of both biological (compound efficacy) and chemical (structural features) data sources for the purpose of discovering a subset of compounds with aligned structural and biological properties. The datasets are integrated at the similarity level by assigning complementary weights to produce a weighted similarity matrix, serving as a generic input in any clustering algorithm. This new analysis work flow is semi-supervised method since, after the determination of clusters, a secondary analysis is performed wherein it finds differentially expressed genes associated to the derived integrated cluster(s) to further explain the compound-induced biological effects inside the cell. In this paper, datasets from two drug development oncology projects are used to illustrate the usefulness of the weighted similarity-based clustering approach to integrate multi-source high-dimensional information to aid drug discovery. Compounds that are structurally and biologically similar to the reference compounds are discovered using this proposed integrative approach.

  4. Surface-Induced Dissociation of Protein Complexes in a Hybrid Fourier Transform Ion Cyclotron Resonance Mass Spectrometer.

    PubMed

    Yan, Jing; Zhou, Mowei; Gilbert, Joshua D; Wolff, Jeremy J; Somogyi, Árpád; Pedder, Randall E; Quintyn, Royston S; Morrison, Lindsay J; Easterling, Michael L; Paša-Tolić, Ljiljana; Wysocki, Vicki H

    2017-01-03

    Mass spectrometry continues to develop as a valuable tool in the analysis of proteins and protein complexes. In protein complex mass spectrometry studies, surface-induced dissociation (SID) has been successfully applied in quadrupole time-of-flight (Q-TOF) instruments. SID provides structural information on noncovalent protein complexes that is complementary to other techniques. However, the mass resolution of Q-TOF instruments can limit the information that can be obtained for protein complexes by SID. Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR MS) provides ultrahigh resolution and ultrahigh mass accuracy measurements. In this study, an SID device was designed and successfully installed in a hybrid FT-ICR instrument in place of the standard gas collision cell. The SID-FT-ICR platform has been tested with several protein complex systems (homooligomers, a heterooligomer, and a protein-ligand complex, ranging from 53 to 85 kDa), and the results are consistent with data previously acquired on Q-TOF platforms, matching predictions from known protein interface information. SID fragments with the same m/z but different charge states are well-resolved based on distinct spacing between adjacent isotope peaks, and the addition of metal cations and ligands can also be isotopically resolved with the ultrahigh mass resolution available in FT-ICR.

  5. Identifying Complementary and Alternative Medicine Usage Information from Internet Resources. A Systematic Review.

    PubMed

    Sharma, Vivekanand; Holmes, John H; Sarkar, Indra N

    2016-08-05

    Identify and highlight research issues and methods used in studying Complementary and Alternative Medicine (CAM) information needs, access, and exchange over the Internet. A literature search was conducted using Preferred Reporting Items for Systematic Reviews and Meta-Analysis guidelines from PubMed to identify articles that have studied Internet use in the CAM context. Additional searches were conducted at Nature.com and Google Scholar. The Internet provides a major medium for attaining CAM information and can also serve as an avenue for conducting CAM related surveys. Based on the literature analyzed in this review, there seems to be significant interest in developing methodologies for identifying CAM treatments, including the analysis of search query data and social media platform discussions. Several studies have also underscored the challenges in developing approaches for identifying the reliability of CAM-related information on the Internet, which may not be supported with reliable sources. The overall findings of this review suggest that there are opportunities for developing approaches for making available accurate information and developing ways to restrict the spread and sale of potentially harmful CAM products and information. Advances in Internet research are yet to be used in context of understanding CAM prevalence and perspectives. Such approaches may provide valuable insights into the current trends and needs in context of CAM use and spread.

  6. IDENTIFYING COMPLEMENTARY AND ALTERNATIVE MEDICINE USAGE INFORMATION FROM INTERNET RESOURCES: A SYSTEMATIC REVIEW

    PubMed Central

    Sharma, V.; Holmes, J.H.; Sarkar, I.N.

    2016-01-01

    SUMMARY Objective Identify and highlight research issues and methods used in studying Complementary and Alternative Medicine (CAM) information needs, access, and exchange over the Internet. Methods A literature search was conducted using Preferred Reporting Items for Systematic Reviews and Meta-Analysis guidelines from PubMed to identify articles that have studied Internet use in the CAM context. Additional searches were conducted at Nature.com and Google Scholar. Results The Internet provides a major medium for attaining CAM information and can also serve as an avenue for conducting CAM related surveys. Based on the literature analyzed in this review, there seems to be significant interest in developing methodologies for identifying CAM treatments, including the analysis of search query data and social media platform discussions. Several studies have also underscored the challenges in developing approaches for identifying the reliability of CAM-related information on the Internet, which may not be supported with reliable sources. The overall findings of this review suggest that there are opportunities for developing approaches for making available accurate information and developing ways to restrict the spread and sale of potentially harmful CAM products and information. Conclusions Advances in Internet research are yet to be used in context of understanding CAM prevalence and perspectives. Such approaches may provide valuable insights into the current trends and needs in context of CAM use and spread. PMID:27352304

  7. Mode I analysis of a cracked circular disk subject to a couple and a force

    NASA Technical Reports Server (NTRS)

    Gross, B.

    1977-01-01

    Mode 1 stress intensity coefficients were obtained for an edge-cracked disk (round compact specimen). Results for this plane elastostatic problem, obtained by a boundary collocation analysis are presented for ratios 0.35 less than A/D less than 1, where A is the crack length and D is the disk diameter. The results presented are for two complementary types of loading. By superposition of these results the stress intensity factor K sub I for any practical load line location of a pin-loaded round compact specimen can be obtained.

  8. The Virtual Institute of Integrated Climate and Landscape Evolution Analyses - ICLEA

    NASA Astrophysics Data System (ADS)

    Schwab, Markus; Brauer, Achim; Błaszkiewicz, Mirosław; Raab, Thomas; Wilmking, Martin; Blume, Theresa; Iclea Team

    2014-05-01

    The GFZ, Greifswald University and the Brandenburg University of Technology together with their partner the Polish Academy of Sciences strive for focusing their research capacities and expertise in a Helmholtz Virtual Institute for Integrated Climate and Landscape Evolution Analyses (ICLEA). The Coordination Team is based at the GFZ in Potsdam and consists of a permanent scientific manager and administrative personnel. ICLEA offers young researchers an interdisciplinary and structured education and promote their early independence through coaching and mentoring. Postdoctoral rotation positions at the ICLEA partner institutions ensure mobility of young researchers and promote dissemination of information and expertise between disciplines. Training, Research and Analytical workshops between research partners of the ICLEA virtual institute are another important measure to qualify young researchers. The long-term mission of the Virtual Institute is to provide a substantiated data basis for sustained environmental maintenance based on a profound process understanding at all relevant time scales. Aim is to explore processes of climate and landscape evolution in an historical cultural landscape extending from northeastern Germany into northwestern Poland. The northern-central European lowlands will be facilitated as a natural laboratory providing an ideal case for utilizing a systematic and holistic approach. In ICLEA five complementary work packages (WP) are established according to the key research aspects. WP 1 focus on monitoring mainly hydrology and soil moisture as well as meteorological parameters. WP 2 is linking present day and future monitoring data with the most recent past through analysing satellite images. This WP will further provide larger spatial scales. WP 3-5 focus on different natural archives to obtain a broad variety of high quality proxy data. Tree rings provide sub-seasonal data for the last centuries up to few millennia, varved lake sediments cover the entire research time interval at seasonal to decadal resolution and palaeosoils and geomorphological features also cover the entire period but not continuously and with lower resolution. Complementary information, like climate, tree ecophysiological and limnological data etc., are provided by cooperation with associated partners. Further information about ICLEA: www.iclea.de

  9. Complementary and alternative medicine in pulmonology.

    PubMed

    Mark, John D; Chung, Youngran

    2015-06-01

    To provide a comprehensive review of complementary and alternative medicine (CAM) therapies for the treatment of pulmonary disorders in children. The use of complementary medicine (CAM) is commonly used by both children and adults with breathing problems, and especially in chronic pulmonary disorders such as asthma and cystic fibrosis. Many clinics and hospitals now offer CAM, even though most of the conventionally trained health practitioners have little knowledge or education regarding CAM therapies. Research in CAM that demonstrates overall benefit is lacking, especially in children. Often parents do not report CAM use to their child's healthcare provider and this could compromise their overall quality of care. Although many research studies evaluating CAM therapies have methodological flaws, data exist to support CAM therapies in treating children with pulmonary disorders. This review examines the latest evidence of CAM use and effectiveness in children with pulmonary disorders. Physicians should be aware of the many CAM therapy options and the research surrounding them in order to provide their patients with the most current and accurate information available.

  10. Patterns and determinants of breastfeeding and complementary feeding practices in urban informal settlements, Nairobi Kenya

    PubMed Central

    2011-01-01

    Background The World Health Organisation (WHO) recommends exclusive breastfeeding during the first six months of life for optimal growth, development and health. Breastfeeding should continue up to two years or more and nutritionally adequate, safe, and appropriately-fed complementary foods should be introduced at the age of six months to meet the evolving needs of the growing infant. Little evidence exists on breastfeeding and infant feeding practices in urban slums in sub-Saharan Africa. Our aim was to assess breastfeeding and infant feeding practices in Nairobi slums with reference to WHO recommendations. Methods Data from a longitudinal study conducted in two Nairobi slums are used. The study used information on the first year of life of 4299 children born between September 2006 and January 2010. All women who gave birth during this period were interviewed on breastfeeding and complementary feeding practices at recruitment and this information was updated twice, at four-monthly intervals. Cox proportional hazard analysis was used to determine factors associated with cessation of breastfeeding in infancy and early introduction of complementary foods. Results There was universal breastfeeding with almost all children (99%) having ever been breastfed. However, more than a third (37%) were not breastfed in the first hour following delivery, and 40% were given something to drink other than the mothers' breast milk within 3 days after delivery. About 85% of infants were still breastfeeding by the end of the 11th month. Exclusive breastfeeding for the first six months was rare as only about 2% of infants were exclusively breastfed for six months. Factors associated with sub-optimal infant breastfeeding and feeding practices in these settings include child's sex; perceived size at birth; mother's marital status, ethnicity; education level; family planning (pregnancy desirability); health seeking behaviour (place of delivery) and; neighbourhood (slum of residence). Conclusions The study indicates poor adherence to WHO recommendations for breastfeeding and infant feeding practices. Interventions and further research should pay attention to factors such as cultural practices, access to and utilization of health care facilities, child feeding education, and family planning. PMID:21615957

  11. Patterns and determinants of breastfeeding and complementary feeding practices in urban informal settlements, Nairobi Kenya.

    PubMed

    Kimani-Murage, Elizabeth W; Madise, Nyovani J; Fotso, Jean-Christophe; Kyobutungi, Catherine; Mutua, Martin K; Gitau, Tabither M; Yatich, Nelly

    2011-05-26

    The World Health Organisation (WHO) recommends exclusive breastfeeding during the first six months of life for optimal growth, development and health. Breastfeeding should continue up to two years or more and nutritionally adequate, safe, and appropriately-fed complementary foods should be introduced at the age of six months to meet the evolving needs of the growing infant. Little evidence exists on breastfeeding and infant feeding practices in urban slums in sub-Saharan Africa. Our aim was to assess breastfeeding and infant feeding practices in Nairobi slums with reference to WHO recommendations. Data from a longitudinal study conducted in two Nairobi slums are used. The study used information on the first year of life of 4299 children born between September 2006 and January 2010. All women who gave birth during this period were interviewed on breastfeeding and complementary feeding practices at recruitment and this information was updated twice, at four-monthly intervals. Cox proportional hazard analysis was used to determine factors associated with cessation of breastfeeding in infancy and early introduction of complementary foods. There was universal breastfeeding with almost all children (99%) having ever been breastfed. However, more than a third (37%) were not breastfed in the first hour following delivery, and 40% were given something to drink other than the mothers' breast milk within 3 days after delivery. About 85% of infants were still breastfeeding by the end of the 11th month. Exclusive breastfeeding for the first six months was rare as only about 2% of infants were exclusively breastfed for six months. Factors associated with sub-optimal infant breastfeeding and feeding practices in these settings include child's sex; perceived size at birth; mother's marital status, ethnicity; education level; family planning (pregnancy desirability); health seeking behaviour (place of delivery) and; neighbourhood (slum of residence). The study indicates poor adherence to WHO recommendations for breastfeeding and infant feeding practices. Interventions and further research should pay attention to factors such as cultural practices, access to and utilization of health care facilities, child feeding education, and family planning.

  12. Mineral content of complementary foods.

    PubMed

    Jani, Rati; Udipi, S A; Ghugre, P S

    2009-01-01

    To document mineral contents iron, zinc, calcium, energy contents and nutrient densities in complementary foods commonly given to young urban slum children. Information on dietary intake was collected from 892 mothers of children aged 13-24 months, using 24 hour dietary recall and standardized measures. Three variations of 27 most commonly prepared recipes were analyzed and their energy (Kcal/g) and nutrient densities (mg/100 Kcal) were calculated. Considerable variations were observed in preparation of all items fed to the children. Cereal-based items predominated their diets with only small amount of vegetables/fruits. Fenugreek was the only leafy vegetable included, but was given to only 1-2% of children. Iron, calcium, zinc contents of staple complementary foods ranged from: 0.33 mg to 3.73 mg, 4 mg to 64 mg, and 0.35 mg to 2.99 mg/100 respectively. Recipes diluted with less water and containing vegetables, spices had higher mineral content. Minerals densities were higher for dals, fenugreek vegetable, khichdi and chapatti. Using the median amounts of the various recipes fed to children, intakes of all nutrients examined especially calcium and iron was low. There is an urgent need to educate mothers about consistency, dilution, quantity, frequency, method of preparation, inclusion of micronutrient-rich foods, energy-dense complementary foods and gender equality.

  13. Systematic reviews of complementary therapies – an annotated bibliography. Part 3: Homeopathy

    PubMed Central

    Linde, Klaus; Hondras, Maria; Vickers, Andrew; Riet, Gerben ter; Melchart, Dieter

    2001-01-01

    Background Complementary therapies are widespread but controversial. We aim to provide a comprehensive collection and a summary of systematic reviews of clinical trials in three major complementary therapies (acupuncture, herbal medicine, homeopathy). This article is dealing with homeopathy. Potentially relevant reviews were searched through the register of the Cochrane Complementary Medicine Field, the Cochrane Library, Medline, and bibliographies of articles and books. To be included articles had to review prospective clinical trials of homeopathy; had to describe review methods explicitly; had to be published; and had to focus on treatment effects. Information on conditions, interventions, methods, results and conclusions was extracted using a pretested form and summarized descriptively. Results Eighteen out of 22 potentially relevant reviews preselected in the screening process met the inclusion criteria. Six reviews addressed the question whether homeopathy is effective across conditions and interventions. The majority of available trials seem to report positive results but the evidence is not convincing. For isopathic nosodes for allergic conditions, oscillococcinum for influenza-like syndromes and galphimia for pollinosis the evidence is promising while in other areas reviewed the results are equivocal. Interpretation Reviews on homeopathy often address general questions. While the evidence is promising for some topics the findings of the available reviews are unlikely to end the controversy on this therapy. PMID:11527508

  14. Evaluation of Recent Technologies of Nonvolatile RAM

    NASA Astrophysics Data System (ADS)

    Nuns, Thierry; Duzellier, Sophie; Bertrand, Jean; Hubert, Guillaume; Pouget, Vincent; Darracq, FrÉdÉric; David, Jean-Pierre; Soonckindt, Sabine

    2008-08-01

    Two types of recent nonvolatile random access memories (NVRAM) were evaluated for radiation effects: total dose and single event upset and latch-up under heavy ions and protons. Complementary irradiation with a laser beam provides information on sensitive areas of the devices.

  15. Comparison of prognostic and diagnostic approached to modeling evapotranspiration in the Nile river basin

    USDA-ARS?s Scientific Manuscript database

    Actual evapotranspiration (ET) can be estimated using both prognostic and diagnostic modeling approaches, providing independent yet complementary information for hydrologic applications. Both approaches have advantages and disadvantages. When provided with temporally continuous atmospheric forcing d...

  16. Teaching Evidence-Based Medicine at Complementary and Alternative Medicine Institutions: Strategies, Competencies, and Evaluation

    PubMed Central

    Schiffke, Heather; Fleishman, Susan; Haas, Mitch; Cruser, des Anges; LeFebvre, Ron; Sullivan, Barbara; Taylor, Barry; Gaster, Barak

    2014-01-01

    Abstract Background: As evidence-based medicine (EBM) becomes a standard in health care, it is essential that practitioners of complementary and alternative medicine (CAM) become experts in searching and evaluating the research literature. In support of this goal, the National Institutes of Health (NIH) National Center for Complementary and Alternative Medicine (NCCAM) provided R25 funding to nine CAM colleges to develop individual programs focused on teaching EBM. An overarching goal of these research education grants has been to provide CAM faculty and students with the skills they need to apply a rigorous evidence-based perspective to their training and practice. Methods/Results: This paper reviews the competencies and teaching strategies developed and implemented to enhance research literacy at all nine R25-funded institutions. While each institution designed approaches suitable for its research culture, the guiding principles were similar: to develop evidence-informed skills and knowledge, thereby helping students and faculty to critically appraise evidence and then use that evidence to guide their clinical practice. Curriculum development and assessment included faculty-driven learning activities and longitudinal curricular initiatives to encourage skill reinforcement and evaluate progress. Conclusion: As the field of integrative medicine matures, the NIH-NCCAM research education grants provide essential training for future clinicians and clinician-researchers. Building this workforce will facilitate multidisciplinary collaborations that address the unique needs for research that informs integrative clinical practice. PMID:25380144

  17. Summary Report Panel 4: Communication and Interpretation: Presenting Information to the General Public.

    PubMed

    Scowcroft, Gail

    2016-01-01

    Complex scientific information is often difficult to communicate to nonscience audiences who may not have the foundational knowledge to understand the content. Scientists are called on with increasing frequency to share the results of their research for the purposes of education, outreach, and popular media stories. These three spheres of activity, represented in Fig. 1, are geared toward different but complementary goals.

  18. Characterization of Homopolymer and Polymer Blend Films by Phase Sensitive Acoustic Microscopy

    NASA Astrophysics Data System (ADS)

    Ngwa, Wilfred; Wannemacher, Reinhold; Grill, Wolfgang

    2003-03-01

    CHARACTERIZATION OF HOMOPOLYMER AND POLYMER BLEND FILMS BY PHASE SENSITIVE ACOUSTIC MICROSCOPY W Ngwa, R Wannemacher, W Grill Institute of Experimental Physics II, University of Leipzig, 04103 Leipzig, Germany Abstract We have used phase sensitive acoustic microscopy (PSAM) to study homopolymer thin films of polystyrene (PS) and poly (methyl methacrylate) (PMMA), as well as PS/PMMA blend films. We show from our results that PSAM can be used as a complementary and highly valuable technique for elucidating the three-dimensional (3D) morphology and micromechanical properties of thin films. Three-dimensional image acquisition with vector contrast provides the basis for: complex V(z) analysis (per image pixel), 3D image processing, height profiling, and subsurface image analysis of the polymer films. Results show good agreement with previous studies. In addition, important new information on the three dimensional structure and properties of polymer films is obtained. Homopolymer film structure analysis reveals (pseudo-) dewetting by retraction of droplets, resulting in a morphology that can serve as a starting point for the analysis of polymer blend thin films. The outcome of confocal laser scanning microscopy studies, performed on the same samples are correlated with the obtained results. Advantages and limitations of PSAM are discussed.

  19. Investigation of the spatially anisotropic component of the laterally averaged molecular Hydrogen/Ag(111) physisorption potential

    NASA Astrophysics Data System (ADS)

    Whaley, K. B.; Yu, C. F.; Hogg, C. S.; Light, J. C.; Sibener, S. J.

    1985-08-01

    A detailed investigation of the spatially anisotropic component of the laterally averaged molecular hydrogen/Ag(111) physisorption potential is presented. Experimentally derived rotationally inelastic transition probabilities for H2, D2, and HD, taken as a function of collision energy, are compared with those resulting from close-coupled quantum scattering calculations. These calculations utilize exponential-3 and variable exponent parameterizations of the laterally averaged isotropic potential which reproduce the experimental bound state resonance spectra for p-H2 and o-D2 on Ag(111). Complementary information is obtained by analyzing the magnetic sub-level splittings for physisorbed J = 1 n-H2, using diffractive selective adsorption resonance energies calculated with first order perturbation theory. Theoretical predictions for HD/Ag(111) rotationally mediated selective adsorption resonances are also compared with previously reported experimental results, which show well resolved J-dependent energy shifts resulting in part from the orientational anisotropy of the potential. The results obtained in this study indicate that both the attractive and repulsive parts of the anisotropic potential exhibit only a weak orientation dependence, in agreement with recent theoretical predictions for this system.

  20. Investigation of the spatially anisotropic component of the laterally averaged molecular hydrogen/Ag(111) physisorption potential

    NASA Astrophysics Data System (ADS)

    Whaley, K. Birgitta; Yu, Chien-fan; Hogg, C. S.; Light, John C.; Sibener, S. J.

    1985-10-01

    A detailed investigation of the spatially anisotropic component of the laterally averaged molecular hydrogen/Ag(111) physisorption potential is presented. Experimentally derived rotationally inelastic transition probabilities for H2, D2, and HD, taken as a function of collision energy, are compared with those resulting from close-coupled quantum scattering calculations. These calculations utilize exponential-3 and variable exponent parametrizations of the laterally averaged isotropic potential which reproduce the experimental bound state resonance spectra for p-H2 and o-D2 on Ag(111). Complementary information is obtained by analyzing the magnetic sublevel splittings for physisorbed J=1 n-H2, using diffractive selective adsorption resonance energies calculated with first order perturbation theory. Theoretical predictions for HD/Ag(111) rotationally mediated selective adsorption resonances are also compared with previously reported experimental results, which show well resolved J-dependent energy shifts resulting in part from the orientational anisotropy of the potential. The results obtained in this study indicate that both the attractive and repulsive parts of the anisotropic potential exhibit only a weak orientation dependence, in agreement with recent theoretical predictions for this system.

  1. Crystalline cellulose elastic modulus predicted by atomistic models of uniform deformation and nanoscale indentation

    Treesearch

    Xiawa Wu; Robert J. Moon; Ashlie Martini

    2013-01-01

    The elastic modulus of cellulose Iß in the axial and transverse directions was obtained from atomistic simulations using both the standard uniform deformation approach and a complementary approach based on nanoscale indentation. This allowed comparisons between the methods and closer connectivity to experimental measurement techniques. A reactive...

  2. A Smart Itsy Bitsy Spider for the Web.

    ERIC Educational Resources Information Center

    Chen, Hsinchun; Chung, Yi-Ming; Ramsey, Marshall; Yang, Christopher C.

    1998-01-01

    This study tested two Web personal spiders (i.e., agents that take users' requests and perform real-time customized searches) based on best first-search and genetic-algorithm techniques. Both results were comparable and complementary, although the genetic algorithm obtained higher recall value. The Java-based interface was found to be necessary…

  3. Use of combined biogeochemical model approaches and empirical data to assess critical loads of nitrogen

    Treesearch

    Mark Fenn; Charles Driscoll; Quingtao Zhou; Leela Rao; Thomas Meixner; Edith Allen; Fengming Yuan; Timothy Sullivan

    2015-01-01

    Empirical and dynamic biogeochemical modelling are complementary approaches for determining the critical load (CL) of atmospheric nitrogen (N) or other constituent deposition that an ecosystem can tolerate without causing ecological harm. The greatest benefits are obtained when these approaches are used in combination. Confounding environmental factors can complicate...

  4. Approaches for Combining Multiple Measures of Teacher Performance: Reliability, Validity, and Implications for Evaluation Policy

    ERIC Educational Resources Information Center

    Martínez, José Felipe; Schweig, Jonathan; Goldschmidt, Pete

    2016-01-01

    A key question facing teacher evaluation systems is how to combine multiple measures of complex constructs into composite indicators of performance. We use data from the Measures of Effective Teaching (MET) study to investigate the measurement properties of composite indicators obtained under various conjunctive, disjunctive (or complementary),…

  5. Nanoparticle Solutions for Printed Electronics

    DTIC Science & Technology

    2013-09-19

    the printed semiconductor materials and their nanoparticle and colloidal precursors. Without this basic knowledge, further development and the...titania, silica ) were investigated in the production of complementary inks for complex devices. These were either obtained commercially in...layers were also deposited on borosilicate glass and silicon wafers. In the photovoltaic program, hybrid inorganic-organic semiconductor combinations

  6. Chip-scale pattern modification method for equalizing residual layer thickness in nanoimprint lithography

    NASA Astrophysics Data System (ADS)

    Youn, Sung-Won; Suzuki, Kenta; Hiroshima, Hiroshi

    2018-06-01

    A software program for modifying a mold design to obtain a uniform residual layer thickness (RLT) distribution has been developed and its validity was verified by UV-nanoimprint lithography (UV-NIL) simulation. First, the effects of granularity (G) on both residual layer uniformity and filling characteristics were characterized. For a constant complementary pattern depth and a granularity that was sufficiently larger than the minimum pattern width, filling time decreased with the decrease in granularity. For a pattern design with a wide density range and an irregular distribution, the choice of a small granularity was not always a good strategy since the etching depth required for a complementary pattern occasionally exceptionally increased with the decrease in granularity. On basis of the results obtained, the automated method was applied to a chip-scale pattern modification. Simulation results showed a marked improvement in residual layer thickness uniformity for a capacity-equalized (CE) mold. For the given conditions, the standard deviation of RLT decreased in the range from 1/3 to 1/5 in accordance with pattern designs.

  7. Structure and properties of carbon black particles

    NASA Astrophysics Data System (ADS)

    Xu, Wei

    Structure and properties of carbon black particles were investigated using atomic force microscopy, gas adsorption, Raman spectroscopy, and X-ray diffraction. Supplementary information was obtained using TEM and neutron scattering. The AFM imaging of carbon black aggregates provided qualitative visual information on their morphology, complementary to that obtained by 3-D modeling based on TEM images. Our studies showed that carbon black aggregates were relatively flat. The surface of all untreated carbon black particles was found to be rough and its fractal dimension was 2.2. Heating reduced the roughness and fractal dimension for all samples heat treated at above 1300 K to 2.0. Once the samples were heat treated rapid cooling did not affect the surface roughness. However, rapid cooling reduced crystallite sizes, and different Raman spectra were obtained for carbon blacks of various history of heat treatment. By analyzing the Raman spectra we determined the crystallite sizes and identified amorphous carbon. The concentration of amorphous carbon depends on hydrogen content. Once hydrogen was liberated at increased temperature, the concentration of amorphous carbon was reduced and crystallites started to grow. Properties of carbon blacks at high pressure were also studied. Hydrostatic pressure did not affect the size of the crystallites in carbon black particles. The pressure induced shift in Raman frequency of the graphitic component was a result of increased intermolecular forces and not smaller crystallites. Two methods of determining the fractal dimension, the FHH model and the yardstick technique based on the BET theory were used in the literature. Our study proved that the FHH model is sensitive to numerous assumptions and leads to wrong conclusions. On the other hand the yardstick method gave correct results, which agreed with the AFM results.

  8. Integrated Approaches On Archaeo-Geophysical Data

    NASA Astrophysics Data System (ADS)

    Kucukdemirci, M.; Piro, S.; Zamuner, D.; Ozer, E.

    2015-12-01

    Key words: Ground Penetrating Radar (GPR), Magnetometry, Geophysical Data Integration, Principal Component Analyse (PCA), Aizanoi Archaeological Site An application of geophysical integration methods which often appealed are divided into two classes as qualitative and quantitative approaches. This work focused on the application of quantitative integration approaches, which involve the mathematical and statistical integration techniques, on the archaeo-geophysical data obtained in Aizanoi Archaeological Site,Turkey. Two geophysical methods were applied as Ground Penetrating Radar (GPR) and Magnetometry for archaeological prospection on the selected archaeological site. After basic data processing of each geophysical method, the mathematical approaches of Sums and Products and the statistical approach of Principal Component Analysis (PCA) have been applied for the integration. These integration approches were first tested on synthetic digital images before application to field data. Then the same approaches were applied to 2D magnetic maps and 2D GPR time slices which were obtained on the same unit grids in the archaeological site. Initially, the geophysical data were examined individually by referencing with archeological maps and informations obtained from archaeologists and some important structures as possible walls, roads and relics were determined. The results of all integration approaches provided very important and different details about the anomalies related to archaeological features. By using all those applications, integrated images can provide complementary informations as well about the archaeological relics under the ground. Acknowledgements The authors would like to thanks to Scientific and Technological Research Council of Turkey (TUBITAK), Fellowship for Visiting Scientists Programme for their support, Istanbul University Scientific Research Project Fund, (Project.No:12302) and archaeologist team of Aizanoi Archaeological site for their support during the field work.

  9. In-line and real-time process monitoring of a freeze drying process using Raman and NIR spectroscopy as complementary process analytical technology (PAT) tools.

    PubMed

    De Beer, T R M; Vercruysse, P; Burggraeve, A; Quinten, T; Ouyang, J; Zhang, X; Vervaet, C; Remon, J P; Baeyens, W R G

    2009-09-01

    The aim of the present study was to examine the complementary properties of Raman and near infrared (NIR) spectroscopy as PAT tools for the fast, noninvasive, nondestructive and in-line process monitoring of a freeze drying process. Therefore, Raman and NIR probes were built in the freeze dryer chamber, allowing simultaneous process monitoring. A 5% (w/v) mannitol solution was used as model for freeze drying. Raman and NIR spectra were continuously collected during freeze drying (one Raman and NIR spectrum/min) and the spectra were analyzed using principal component analysis (PCA) and multivariate curve resolution (MCR). Raman spectroscopy was able to supply information about (i) the mannitol solid state throughout the entire process, (ii) the endpoint of freezing (endpoint of mannitol crystallization), and (iii) several physical and chemical phenomena occurring during the process (onset of ice nucleation, onset of mannitol crystallization). NIR spectroscopy proved to be a more sensitive tool to monitor the critical aspects during drying: (i) endpoint of ice sublimation and (ii) monitoring the release of hydrate water during storage. Furthermore, via NIR spectroscopy some Raman observations were confirmed: start of ice nucleation, end of mannitol crystallization and solid state characteristics of the end product. When Raman and NIR monitoring were performed on the same vial, the Raman signal was saturated during the freezing step caused by reflected NIR light reaching the Raman detector. Therefore, NIR and Raman measurements were done on a different vial. Also the importance of the position of the probes (Raman probe above the vial and NIR probe at the bottom of the sidewall of the vial) in order to obtain all required critical information is outlined. Combining Raman and NIR spectroscopy for the simultaneous monitoring of freeze drying allows monitoring almost all critical freeze drying process aspects. Both techniques do not only complement each other, they also provided mutual confirmation of specific conclusions.

  10. Non-contact detection of myocardium's mechanical activity by ultrawideband RF-radar and interpretation applying electrocardiography

    NASA Astrophysics Data System (ADS)

    Thiel, F.; Kreiseler, D.; Seifert, F.

    2009-11-01

    Electromagnetic waves can propagate through the body and are reflected at interfaces between materials with different dielectric properties. Therefore the reason for using ultrawideband (UWB) radar for probing the human body in the frequency range from 100 MHz up to 10 GHz is obvious and suggests an ability to monitor the motion of organs within the human body as well as obtaining images of internal structures. The specific advantages of UWB sensors are high temporal and spatial resolutions, penetration into object, low integral power, and compatibility with established narrowband systems. The sensitivity to ultralow power signals makes them suitable for human medical applications including mobile and continuous noncontact supervision of vital functions. Since no ionizing radiation is used, and due to the ultralow specific absorption rate applied, UWB techniques permit noninvasive sensing with no potential risks. This research aims at the synergetic use of UWB sounding combined with magnetic resonance imaging (MRI) to gain complementary information for improved functional diagnosis and imaging, especially to accelerate and enhance cardiac MRI by applying UWB radar as a noncontact navigator of myocardial contraction. To this end a sound understanding of how myocardial's mechanic is rendered by reflected and postprocessed UWB radar signals must be achieved. Therefore, we have executed the simultaneous acquisition and evaluation of radar signals with signals from a high-resolution electrocardiogram. The noncontact UWB illumination was done from several radiographic standard positions to monitor selected superficial myocardial areas during the cyclic physiological myocardial deformation in three different respiratory states. From our findings we could conclude that UWB radar can serve as a navigator technique for high and ultrahigh field magnetic resonance imaging and can be beneficial preserving the high resolution capability of this imaging modality. Furthermore it can potentially be used to support standard electrocardiography (ECG) analysis by complementary information where sole ECG analysis fails, e.g., electromechanical dissociation.

  11. Isoscapes of tree-ring carbon-13 perform like meteorological networks in predicting regional precipitation patterns

    NASA Astrophysics Data System (ADS)

    del Castillo, Jorge; Aguilera, Mònica; Voltas, Jordi; Ferrio, Juan Pedro

    2013-04-01

    Stable isotopes in tree rings provide climatic information with annual resolution dating back for centuries or even millennia. However, deriving spatially explicit climate models from isotope networks remains challenging. Here we propose a methodology to model regional precipitation from carbon isotope discrimination (Δ13C) in tree rings by (1) building regional spatial models of Δ13C (isoscapes), and (2) deriving precipitation maps from 13C-isoscapes, taking advantage of the response of Δ13C to precipitation in seasonally-dry climates. As a case study, we modeled the spatial distribution of mean annual precipitation (MAP) in the northeastern Iberian Peninsula, a region with complex orography and climate (MAP=303-1086 mm). We compiled wood Δ13C data for two Mediterranean species that exhibit complementary responses to seasonal precipitation (Pinus halepensis Mill., N=38; Quercus ilex L.; N=44; pooling period: 1975-2008). By combining multiple regression and geostatistical interpolation, we generated one 13C-isoscape for each species. A spatial model of MAP was then built as the sum of two complementary maps of seasonal precipitation, each one derived from the corresponding 13C-isoscape (September-November from Q. ilex; December-August from P. halepensis). Our approach showed a predictive power for MAP (RMSE=84 mm) nearly identical to that obtained by interpolating data directly from a similarly dense network of meteorological stations (RMSE=80-83 mm, N=65), being only outperformed when using a much denser meteorological network (RMSE=56-57 mm, N=340). This method offers new avenues for modeling spatial variability of past precipitation, exploiting the large amount of information currently available from tree-ring networks. Acknowledgements: This work was funded by MC-ERG-246725 (FP7, EU) and AGL 2012-40039-C02-02 (MINECO, Spain). JdC and JPF are supported by FPI fellowship (MCINN) and Ramón y Cajal programme (RYC-2008-02050, MINECO), respectively.

  12. Non-contact detection of myocardium's mechanical activity by ultrawideband RF-radar and interpretation applying electrocardiography.

    PubMed

    Thiel, F; Kreiseler, D; Seifert, F

    2009-11-01

    Electromagnetic waves can propagate through the body and are reflected at interfaces between materials with different dielectric properties. Therefore the reason for using ultrawideband (UWB) radar for probing the human body in the frequency range from 100 MHz up to 10 GHz is obvious and suggests an ability to monitor the motion of organs within the human body as well as obtaining images of internal structures. The specific advantages of UWB sensors are high temporal and spatial resolutions, penetration into object, low integral power, and compatibility with established narrowband systems. The sensitivity to ultralow power signals makes them suitable for human medical applications including mobile and continuous noncontact supervision of vital functions. Since no ionizing radiation is used, and due to the ultralow specific absorption rate applied, UWB techniques permit noninvasive sensing with no potential risks. This research aims at the synergetic use of UWB sounding combined with magnetic resonance imaging (MRI) to gain complementary information for improved functional diagnosis and imaging, especially to accelerate and enhance cardiac MRI by applying UWB radar as a noncontact navigator of myocardial contraction. To this end a sound understanding of how myocardial's mechanic is rendered by reflected and postprocessed UWB radar signals must be achieved. Therefore, we have executed the simultaneous acquisition and evaluation of radar signals with signals from a high-resolution electrocardiogram. The noncontact UWB illumination was done from several radiographic standard positions to monitor selected superficial myocardial areas during the cyclic physiological myocardial deformation in three different respiratory states. From our findings we could conclude that UWB radar can serve as a navigator technique for high and ultrahigh field magnetic resonance imaging and can be beneficial preserving the high resolution capability of this imaging modality. Furthermore it can potentially be used to support standard electrocardiography (ECG) analysis by complementary information where sole ECG analysis fails, e.g., electromechanical dissociation.

  13. Recoverable information and emergent conservation laws in fracton stabilizer codes

    NASA Astrophysics Data System (ADS)

    Schmitz, A. T.; Ma, Han; Nandkishore, Rahul M.; Parameswaran, S. A.

    2018-04-01

    We introduce a new quantity that we term recoverable information, defined for stabilizer Hamiltonians. For such models, the recoverable information provides a measure of the topological information as well as a physical interpretation, which is complementary to topological entanglement entropy. We discuss three different ways to calculate the recoverable information and prove their equivalence. To demonstrate its utility, we compute recoverable information for fracton models using all three methods where appropriate. From the recoverable information, we deduce the existence of emergent Z2 Gauss-law-type constraints, which in turn imply emergent Z2 conservation laws for pointlike quasiparticle excitations of an underlying topologically ordered phase.

  14. Cost and results of information systems for health and poverty indicators in the United Republic of Tanzania.

    PubMed Central

    Rommelmann, Vanessa; Setel, Philip W.; Hemed, Yusuf; Angeles, Gustavo; Mponezya, Hamisi; Whiting, David; Boerma, Ties

    2005-01-01

    OBJECTIVE: To examine the costs of complementary information generation activities in a resource-constrained setting and compare the costs and outputs of information subsystems that generate the statistics on poverty, health and survival required for monitoring, evaluation and reporting on health programmes in the United Republic of Tanzania. METHODS: Nine systems used by four government agencies or ministries were assessed. Costs were calculated from budgets and expenditure data made available by information system managers. System coverage, quality assurance and information production were reviewed using questionnaires and interviews. Information production was characterized in terms of 38 key sociodemographic indicators required for national programme monitoring. FINDINGS: In 2002-03 approximately US$ 0.53 was spent per Tanzanian citizen on the nine information subsystems that generated information on 37 of the 38 selected indicators. The census and reporting system for routine health service statistics had the largest participating populations and highest total costs. Nationally representative household surveys and demographic surveillance systems (which are not based on nationally representative samples) produced more than half the indicators and used the most rigorous quality assurance. Five systems produced fewer than 13 indicators and had comparatively high costs per participant. CONCLUSION: Policy-makers and programme planners should be aware of the many trade-offs with respect to system costs, coverage, production, representativeness and quality control when making investment choices for monitoring and evaluation. In future, formal cost-effectiveness studies of complementary information systems would help guide investments in the monitoring, evaluation and planning needed to demonstrate the impact of poverty-reduction and health programmes. PMID:16184275

  15. Information management and complementary alternative medicine: the anatomy of information about CAMs through PubMed.

    PubMed

    Corrao, Salvatore; Argano, Christiano; Colomba, Daniela; Ippolito, Calogero; Gargano, Vincenzo; Arcoraci, Vincenzo; Licata, Giuseppe

    2013-10-01

    In recent years, there has been a growing interest about complementary and alternative medicine (CAM), and the use of CAM interventions has become more common among people. For these reasons, health professionals must be able to effectively manage information in this field of knowledge according to an evidence-based point of view. This study assessed the anatomy of the available information about CAMs using PubMed, to give practical instructions to manage information in this field. We also analyzed the anatomy of information according to each alternative medicine branch, narrow and broad search methods, subset filters for indexed-for-Medline and non-indexed citations, and different publication types including randomized controlled trials (RCTs) and meta-analyses. Our results demonstrated that the use of CAMs subset (supplied by PubMed search engine) leads to a great number of citations determining an information overload. Our data reveal that it would be more useful to search for the CAM separately, identifying specific items and study design. Moreover, we found the largest number of randomized clinical trials and meta-analyses related to herbal medicine and acupuncture, neither RCTs nor meta-analyses were available for bach and flower remedies, auriculoacupuncture, iridology, and pranotherapy. For the first time, our study gives a comprehensive view of the anatomy of information regarding CAMs and each branch of them. We suggest a methodological approach to face with searching information about this emerging issue from an evidence-based point of view. Finally, our data pointed out some "grey zones" since neither RCTs nor meta-analyses were available for some CAMs.

  16. Estimation of the genome sizes of the chigger mites Leptotrombidium pallidum and Leptotrombidium scutellare based on quantitative PCR and k-mer analysis

    PubMed Central

    2014-01-01

    Background Leptotrombidium pallidum and Leptotrombidium scutellare are the major vector mites for Orientia tsutsugamushi, the causative agent of scrub typhus. Before these organisms can be subjected to whole-genome sequencing, it is necessary to estimate their genome sizes to obtain basic information for establishing the strategies that should be used for genome sequencing and assembly. Method The genome sizes of L. pallidum and L. scutellare were estimated by a method based on quantitative real-time PCR. In addition, a k-mer analysis of the whole-genome sequences obtained through Illumina sequencing was conducted to verify the mutual compatibility and reliability of the results. Results The genome sizes estimated using qPCR were 191 ± 7 Mb for L. pallidum and 262 ± 13 Mb for L. scutellare. The k-mer analysis-based genome lengths were estimated to be 175 Mb for L. pallidum and 286 Mb for L. scutellare. The estimates from these two independent methods were mutually complementary and within a similar range to those of other Acariform mites. Conclusions The estimation method based on qPCR appears to be a useful alternative when the standard methods, such as flow cytometry, are impractical. The relatively small estimated genome sizes should facilitate whole-genome analysis, which could contribute to our understanding of Arachnida genome evolution and provide key information for scrub typhus prevention and mite vector competence. PMID:24947244

  17. Selecting an Informative/Discriminating Multivariate Response for Inverse Prediction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thomas, Edward V.; Lewis, John. R.; Anderson-Cook, Christine Michaela

    The inverse prediction is important in a variety of scientific and engineering applications, such as to predict properties/characteristics of an object by using multiple measurements obtained from it. Inverse prediction can be accomplished by inverting parameterized forward models that relate the measurements (responses) to the properties/characteristics of interest. Sometimes forward models are computational/science based; but often, forward models are empirically based response surface models, obtained by using the results of controlled experimentation. For empirical models, it is important that the experiments provide a sound basis to develop accurate forward models in terms of the properties/characteristics (factors). And while nature dictatesmore » the causal relationships between factors and responses, experimenters can control the complexity, accuracy, and precision of forward models constructed via selection of factors, factor levels, and the set of trials that are performed. Recognition of the uncertainty in the estimated forward models leads to an errors-in-variables approach for inverse prediction. The forward models (estimated by experiments or science based) can also be used to analyze how well candidate responses complement one another for inverse prediction over the range of the factor space of interest. Furthermore, one may find that some responses are complementary, redundant, or noninformative. Simple analysis and examples illustrate how an informative and discriminating subset of responses could be selected among candidates in cases where the number of responses that can be acquired during inverse prediction is limited by difficulty, expense, and/or availability of material.« less

  18. [Influence of an observer in the haemolysis produced during the extraction of blood samples in primary care].

    PubMed

    Bel-Peña, N; Mérida-de la Torre, F J

    2015-01-01

    To check whether an intervention based on direct observation and complementary information to nurses helps reduce haemolysis when drawing blood specimens. Random sampling study in primary care centres in the serrania de Málaga health management area, using a cross-sectional, longitudinal pre- and post-intervention design. The study period was from August 2012 to January 2015. The level of free haemoglobin was measured by direct spectrophotometry in the specimens extracted. It was then checked whether the intervention influenced the level of haemolysis, and if this was maintained over time. The mean haemolysis measured pre-intervention was 17%, and after intervention it was 6.1%. A year later and under the same conditions, the frequency of haemolysis was measured again the samples analysed, and the percentage was 9% These results are low when compared to the level obtained pre-intervention, but are higher when compared to the levels obtained immediately after the intervention. The transport and analysis conditions were the same. An intervention based on a direct and informative observation in the process of collecting blood samples contributes significantly to reduce the level of haemolysis. This effect is maintained in time. This intervention needs to be repeated to maintain its effectiveness. Audits and continuing education programs are useful for quality assurance procedures, and maintain the level of care needed for a good quality of care. Copyright © 2015 SECA. Published by Elsevier Espana. All rights reserved.

  19. Chemical Mapping of Essential Oils, Flavonoids and Carotenoids in Citrus Peels by Raman Microscopy.

    PubMed

    Yang, Ying; Wang, Xiaohe; Zhao, Chengying; Tian, Guifang; Zhang, Hua; Xiao, Hang; He, Lili; Zheng, Jinkai

    2017-12-01

    Citrus peels, by-products in large quantity, are rich in various functional and beneficial components which have wide applications. Chemical analysis of these components in citrus peels is an important step to determine the usefulness of the by-products for further applications. In this study, we explored Raman microscopy for rapid, nondestructive, and in situ chemical mapping of multiple main functional components from citrus peels. The relative amount and distribution in different locations (flavedo, albedo, and longitudinal section) of 3 main functional components (essential oils, carotenoids, and flavonoids) in citrus peels were systematically investigated. The distribution profiles of these components were heterogeneous on the peels and varied between different species of citrus peels. Essential oil was found mainly existed in the oil glands, while carotenoids were in the complementary location. Some flavonoids were observed in the oil glands. This study showed the capability of Raman microscopy for rapid and nondestructive analysis of multiple bio-components without extraction from plants. The information obtained from this study would assist the better production and application of the functional and beneficial components from citrus by products in an effective and sustainable manner. This study indicated the capability of Raman microscopy for rapid and nondestructive analysis of multiple bioactive components in plant tissues. The information obtained from the study would be valuable for developing effective and sustainable strategy of utilization of citrus peels for further applications. © 2017 Institute of Food Technologists®.

  20. Selecting an Informative/Discriminating Multivariate Response for Inverse Prediction

    DOE PAGES

    Thomas, Edward V.; Lewis, John. R.; Anderson-Cook, Christine Michaela; ...

    2017-07-01

    The inverse prediction is important in a variety of scientific and engineering applications, such as to predict properties/characteristics of an object by using multiple measurements obtained from it. Inverse prediction can be accomplished by inverting parameterized forward models that relate the measurements (responses) to the properties/characteristics of interest. Sometimes forward models are computational/science based; but often, forward models are empirically based response surface models, obtained by using the results of controlled experimentation. For empirical models, it is important that the experiments provide a sound basis to develop accurate forward models in terms of the properties/characteristics (factors). And while nature dictatesmore » the causal relationships between factors and responses, experimenters can control the complexity, accuracy, and precision of forward models constructed via selection of factors, factor levels, and the set of trials that are performed. Recognition of the uncertainty in the estimated forward models leads to an errors-in-variables approach for inverse prediction. The forward models (estimated by experiments or science based) can also be used to analyze how well candidate responses complement one another for inverse prediction over the range of the factor space of interest. Furthermore, one may find that some responses are complementary, redundant, or noninformative. Simple analysis and examples illustrate how an informative and discriminating subset of responses could be selected among candidates in cases where the number of responses that can be acquired during inverse prediction is limited by difficulty, expense, and/or availability of material.« less

  1. Soil moisture mapping for aquarius

    USDA-ARS?s Scientific Manuscript database

    Aquarius is the first satellite to provide both passive and active L-band observations of the Earth. In addition, the instruments on Satelite de Aplicaciones Cientificas-D (SAC-D) provide complementary information for analysis and retrieval algorithms. Our research focuses on the retrieval of soil m...

  2. Quality of Information Assurance - Assessment, Management and Use (QIAAMU)

    DTIC Science & Technology

    2013-04-01

    106 4.7.3.1 University authentication infrastructure ...Authentication infrastructure ..................................................................................... 107 Figure 49: Complementary...X X X X Architecture & Infrastructure Quality AIQ X X X X X X Deviation from Configuration (Services) SERV STAT X X X X X Deviation from

  3. Time To Talk with Your Health Care Providers: 4 Tips to Start the Conversation

    MedlinePlus

    ... Y Z 4 Tips: Start Talking With Your Health Care Providers About Complementary Health Approaches Share: When patients ... fully informed and can help patients make wise health care decisions. Here are 4 tips to help you ...

  4. Exploring barriers and enablers for scaling up a community-based grain bank intervention for improved infant and young child feeding in Ethiopia: A qualitative process evaluation.

    PubMed

    Sako, Binta; Leerlooijer, Joanne N; Lelisa, Azeb; Hailemariam, Abebe; Brouwer, Inge D; Tucker Brown, Amal; Osendarp, Saskia J M

    2018-04-01

    Child malnutrition remains high in Ethiopia, and inadequate complementary feeding is a contributing factor. In this context, a community-based intervention was designed to provide locally made complementary food for children 6-23 months, using a bartering system, in four Ethiopian regions. After a pilot phase, the intervention was scaled up from 8 to 180 localities. We conducted a process evaluation to determine enablers and barriers for the scaling up of this intervention. Eight study sites were selected to perform 52 key informant interviews and 31 focus group discussions with purposely selected informants. For analysis, we used a framework describing six elements of successful scaling up: socio-political context, attributes of the intervention, attributes of the implementers, appropriate delivery strategy, the adopting community, and use of research to inform the scale-up process. A strong political will, alignment of the intervention with national priorities, and integration with the health care system were instrumental in the scaling up. The participatory approach in decision-making reinforced ownership at community level, and training about complementary feeding motivated mothers and women's groups to participate. However, the management of the complex intervention, limited human resources, and lack of incentives for female volunteers proved challenging. In the bartering model, the barter rate was accepted, but the bartering was hindered by unavailability of cereals and limited financial and material resources to contribute, threatening the project's sustainability. Scaling up strategies for nutrition interventions require sufficient time, thorough planning, and assessment of the community's capacity to contribute human, financial, and material resources. © 2017 The Authors. Maternal and Child Nutrition Published by John Wiley & Sons, Ltd.

  5. Exploring barriers and enablers for scaling up a community‐based grain bank intervention for improved infant and young child feeding in Ethiopia: A qualitative process evaluation

    PubMed Central

    Sako, Binta; Leerlooijer, Joanne N.; Lelisa, Azeb; Hailemariam, Abebe; Brouwer, Inge D.; Tucker Brown, Amal

    2017-01-01

    Abstract Child malnutrition remains high in Ethiopia, and inadequate complementary feeding is a contributing factor. In this context, a community‐based intervention was designed to provide locally made complementary food for children 6–23 months, using a bartering system, in four Ethiopian regions. After a pilot phase, the intervention was scaled up from 8 to 180 localities. We conducted a process evaluation to determine enablers and barriers for the scaling up of this intervention. Eight study sites were selected to perform 52 key informant interviews and 31 focus group discussions with purposely selected informants. For analysis, we used a framework describing six elements of successful scaling up: socio‐political context, attributes of the intervention, attributes of the implementers, appropriate delivery strategy, the adopting community, and use of research to inform the scale‐up process. A strong political will, alignment of the intervention with national priorities, and integration with the health care system were instrumental in the scaling up. The participatory approach in decision‐making reinforced ownership at community level, and training about complementary feeding motivated mothers and women's groups to participate. However, the management of the complex intervention, limited human resources, and lack of incentives for female volunteers proved challenging. In the bartering model, the barter rate was accepted, but the bartering was hindered by unavailability of cereals and limited financial and material resources to contribute, threatening the project's sustainability. Scaling up strategies for nutrition interventions require sufficient time, thorough planning, and assessment of the community's capacity to contribute human, financial, and material resources. PMID:29063698

  6. Modeling additive and non-additive effects in a hybrid population using genome-wide genotyping: prediction accuracy implications

    PubMed Central

    Bouvet, J-M; Makouanzi, G; Cros, D; Vigneron, Ph

    2016-01-01

    Hybrids are broadly used in plant breeding and accurate estimation of variance components is crucial for optimizing genetic gain. Genome-wide information may be used to explore models designed to assess the extent of additive and non-additive variance and test their prediction accuracy for the genomic selection. Ten linear mixed models, involving pedigree- and marker-based relationship matrices among parents, were developed to estimate additive (A), dominance (D) and epistatic (AA, AD and DD) effects. Five complementary models, involving the gametic phase to estimate marker-based relationships among hybrid progenies, were developed to assess the same effects. The models were compared using tree height and 3303 single-nucleotide polymorphism markers from 1130 cloned individuals obtained via controlled crosses of 13 Eucalyptus urophylla females with 9 Eucalyptus grandis males. Akaike information criterion (AIC), variance ratios, asymptotic correlation matrices of estimates, goodness-of-fit, prediction accuracy and mean square error (MSE) were used for the comparisons. The variance components and variance ratios differed according to the model. Models with a parent marker-based relationship matrix performed better than those that were pedigree-based, that is, an absence of singularities, lower AIC, higher goodness-of-fit and accuracy and smaller MSE. However, AD and DD variances were estimated with high s.es. Using the same criteria, progeny gametic phase-based models performed better in fitting the observations and predicting genetic values. However, DD variance could not be separated from the dominance variance and null estimates were obtained for AA and AD effects. This study highlighted the advantages of progeny models using genome-wide information. PMID:26328760

  7. Comparison of static and dynamic sensory product characterizations based on check-all-that-apply questions with consumers.

    PubMed

    Alcaire, Florencia; Antúnez, Lucía; Vidal, Leticia; Zorn, Shari; Giménez, Ana; Castura, John C; Ares, Gastón

    2017-07-01

    The aim of the present work was to compare static and dynamic sensory product characterizations based on check-all-that-apply (CATA) questions with consumers. Three studies involving a total of 310 consumers were carried out. In each study, a between-subjects experimental design was used to compare static sensory characterizations obtained using CATA questions with dynamic characterizations over a relatively short time period using temporal CATA (TCATA). Three different product categories were evaluated (orange juice, strawberry yogurt, and vanilla milk desserts) using 6-11 sensory terms. TCATA data were analysed as CATA considering fixed time periods throughout the evaluation. CATA and TCATA were compared in terms of frequency of use of the terms, sample discrimination, and sample and term configurations. Asking consumers to continuously select the attributes that applied to describe a product and to deselect those that no longer applied during the evaluation period did not substantially modify the average citation proportion of terms or the maximum citation proportion for individual terms for liquid and semi-solid products with a relatively fast oral preparatory phase. Although both methodologies provided similar information, additional insights on how similarities and differences among samples evolved during consumption were obtained with TCATA in the case of products that experience large temporal changes or attributes with strong time-dependency. CATA provided similar information as TCATA for sensory attributes that did not change substantially during the evaluation period. Results from the present work suggest that static and dynamic product sensory characterizations using CATA questions with consumers provide complementary information about consumer experiences with food products. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. [The patient's right to information: influence of socio-professional factors in primary care].

    PubMed

    Pérez-Cárceles, M D; Pereñíguez-Barranco, J E; Osuna-Carrillo de Albornoz, E; Luna-Maldonado, A

    2006-02-15

    To describe the information provided by primary care doctors to their patients in different phases of the care provision process and to analyse any relationships with socio-professional factors. Descriptive, cross-sectional study based on postal questionnaire. Primary care centres in Murcia, Spain. 227 family physicians. Distribution of a questionnaire which includes: a) socio-professional variables (age, sex, marital status, years in practice, years in present post, work environment, previous training, number of patients on list, number of patients seen daily); b) an evaluation of job satisfaction (Likert scale) related to salary, career choice, immediate superiors and daily surgery; and c) the frequency with which information is provided to patients concerning diagnosis, prognosis, treatment, complementary examinations and personal, professional and family impact. The reply rate was 59%. The percentages of doctors who always provided information concerning diagnosis, prognosis, treatment, complementary examinations and person, professional and family impact was, 23.3%, 7%, 64.3%, 40.5%, and 9.7%, respectively. There was a direct and statistically significant relationship between job satisfaction and the information provided to patients, the doctors feeling most satisfaction providing the most information on the different phases of the care process. On the other hand, there was an inverse and statistically significant relationship between the number of patients on the doctors' lists and the information provided. The degree of fulfillment of the patient's right to information is low. Doctors should realise the practical importance of clinical information in their work. There is a general feeling of discontent amongst family doctors, which has a negative impact on their professional activity. A lighter workload would significantly improve the extent to which doctors provide patients with information and mechanisms should be put in place to improve working conditions to avoid the non-fulfillment of the patient's right to information.

  9. Assessing the role of evidence in patients' evaluation of complementary therapies: a quality study.

    PubMed

    Verhoef, Marja J; Mulkins, Andrea; Carlson, Linda E; Hilsden, Robert J; Kania, Anna

    2007-12-01

    Making the decision to use complementary and alternative medicine (CAM) for cancer treatment is difficult in light of the limited available evidence for these treatments. It is unclear how patients use evidence to make these decisions. (1) Describe the type of information about CAM that cancer patients use in their decision making; (2) understand why certain types of information about CAM are accepted as evidence by cancer patients; and (3) explore the role of scientific evidence in treatment decision making. A qualitative study design using in-depth semistructured interviews with cancer patients attending 4 conventional and integrative health care institutions in Alberta and British Columbia, Canada, was used. Twenty-seven patients were interviewed. Patients sought CAM information from a range of sources, including the Internet, health care providers, friends, relatives, and newspapers. Many expressed frustration about the overwhelming amount of available information and found it difficult to identify reliable information. Information was described as reliable if it supported them in arriving at a decision about CAM. Types of information participants identified included anecdotes, expert opinion, gut feeling, popular literature, scientific evidence, testimonials, advertising and trial and error. Profound differences were found between new CAM users, experienced CAM users, and users with late-stage cancer in type of information sought, the role of scientific evidence in decision making, and overall information needs. Although this was a relatively small qualitative study, the results suggest that (1) many patients do not value scientific evidence as highly as conventional providers and (2) it is important for clinicians and other information providers to be aware of the different types of information that patients seek out and access when making choices and decisions regarding CAM treatments and why they seek out these sources.

  10. Curriculum Development of a Research Laboratory Methodology Course for Complementary and Integrative Medicine Students

    PubMed Central

    Vasilevsky, Nicole; Schafer, Morgan; Tibbitts, Deanne; Wright, Kirsten; Zwickey, Heather

    2015-01-01

    Training in fundamental laboratory methodologies is valuable to medical students because it enables them to understand the published literature, critically evaluate clinical studies, and make informed decisions regarding patient care. It also prepares them for research opportunities that may complement their medical practice. The National College of Natural Medicine's (NCNM) Master of Science in Integrative Medicine Research (MSiMR) program has developed an Introduction to Laboratory Methods course. The objective of the course it to train clinical students how to perform basic laboratory skills, analyze and manage data, and judiciously assess biomedical studies. Here we describe the course development and implementation as it applies to complementary and integrative medicine students. PMID:26500806

  11. Artificial Informational Polymers and Nanomaterials from Ring-Opening Metathesis Polymerization

    NASA Astrophysics Data System (ADS)

    James, Carrie Rae

    Inspired by naturally occurring polymers (DNA, polypeptides, polysaccharides, etc.) that can self-assemble on the nanoscale into complex, information-rich architectures, we have synthesized nucleic acid based polymers using ROMP. These polymers were synthesized using a graft-through strategy, whereby nucleic acids bearing a strained cyclic olefin were directly polymerized. This is the first example of the graft-through polymerization of nucleic acids. Our approach takes advantage of non-charged peptide nucleic acids (PNAs) as elements to incorporate into ROMP polymer backbones. PNA is a synthetic nucleic acid analogue known for its increased affinity and specificity for complementary DNA or RNA. To accomplish the graft-through polymerization of PNA, we conjugated PNA to strained cyclic olefins using solid phase peptide conjugation chemistry. These PNA monomers were then directly polymerized into homo and block copolymers forming brushes, or comb-like arrangements, of information. Block copolymer amphiphiles of these materials, where the PNA brush served as the hydrophilic portion, were capable of self-assembly into spherical nanoparticles (PNA NPs). These PNA NPs were then studied with respect to their ability to hybridize complementary DNA sequences, as well as their ability to undergo cellular internalization. PNA NPs consisting of densely packed brushes of nucleic acids possessed increased thermal stability when mixed with their complementary DNA sequence, indicating a greater DNA binding affinity over their unpolymerized PNA counterparts. In addition, by arranging the PNA into dense brushes at the surface of the nanoparticle, Cy5.5 labeled PNA NPs were able to undergo cellular internalization into HeLa cells without the need for an additional cellular delivery device. Importantly, cellular internalization of PNA has remained a significant challenge in the literature due to the neutrally charged amino-ethyl glycine backbone of PNA. Therefore, this represents a novel way of facilitating cellular uptake of PNA. This materials strategy represents the first direct polymerization of nucleic acids, and presents a novel method for arranging biological information on the nanoscale at high density in order to confer novel attributes.

  12. Multispectral detection of cutaneous lesions using spectroscopy and microscopy approaches

    NASA Astrophysics Data System (ADS)

    Borisova, E.; Genova-Hristova, Ts.; Troyanova, P.; Pavlova, E.; Terziev, I.; Semyachkina-Glushkovskaya, O.; Lomova, M.; Genina, E.; Stanciu, G.; Tranca, D.; Avramov, L.

    2018-02-01

    Autofluorescence, diffuse-reflectance and transmission spectral, and microscopic measurements were made on different cutaneous neoplastic lesions, namely basal cell carcinoma, squamous cell carcinoma, malignant melanoma, and dysplastic and benign lesions related. Spectroscopic measurements were made on ex vivo tissue samples, and confocal microscopy investigations were made on thin tissue slices. Fluorescence spectra obtained reveal statistically significant differences between the different benign, dysplastic and malignant lesions by the level of emission intensity, as well by spectral shape, which are fingerprints applicable for differentiation algorithms. In reflectance mode the most significant differences are related to the influence of skin pigments - melanin and hemoglobin. Transmission spectroscopy mode gave complementary optical properties information about the tissue samples investigated to that one of reflectance and absorption spectroscopy. Using autofluorescence detection of skin lesions we obtain very good diagnostic performance for distinguishing of nonmelanoma lesions. Using diffuse reflectance and transmission spectroscopy we obtain significant tool for pigmented pathologies differentiation, but it is a tool with moderate sensitivity for non-melanoma lesions detection. One could rapidly increase the diagnostic accuracy of the received combined "optical biopsy" method when several spectral detection techniques are applied in common algorithm for lesions' differentiation. Specific spectral features observed in each type of lesion investigated on micro and macro level would be presented and discussed. Correlation between the spectral data received and the microscopic features observed would be discussed in the report.

  13. Pathophysiology, prognostic significance and clinical utility of B-type natriuretic peptide in acute coronary syndromes.

    PubMed

    Wiviott, Stephen D; de Lemos, James A; Morrow, David A

    2004-08-16

    The natriuretic hormones are a family of vasoactive peptides that can be measured circulating in the blood. Because they serve as markers of hemodynamic stress, the major focus of the use of natriuretic peptide levels [predominantly B-type natriuretic peptide (BNP) and N-terminal (NT)-pro-BNP] has been as an aid to the clinical diagnosis and management of congestive heart failure (CHF). Recently, however, the measurement of natriuretic peptides in the acute coronary syndromes (ACS) has been shown to provide information complementary to traditional biomarkers (of necrosis) such as cardiac troponins and creatine kinase (CK). Studies in several types of acute coronary syndromes [ST-segment elevation myocardial infarction (STEMI), non-ST elevation MI (NSTEMI) and unstable angina (UA)] have shown that elevated levels of natriuretic peptides are independently associated with adverse outcomes, particularly mortality. Additional information is obtained from the use natriuretic peptides in combination with other markers of risk including biomarkers of necrosis and inflammation. This review will summarize the scientific rationale and clinical evidence supporting measurement of natriuretic peptides for risk stratification in acute coronary syndromes. Future research is needed to identify therapies of particular benefit for patients with ACS and natriuretic peptide elevation.

  14. In-Depth View of the Structure and Growth of SnO2 Nanowires and Nanobrushes.

    PubMed

    Stuckert, Erin P; Geiss, Roy H; Miller, Christopher J; Fisher, Ellen R

    2016-08-31

    Strategic application of an array of complementary imaging and diffraction techniques is critical to determine accurate structural information on nanomaterials, especially when also seeking to elucidate structure-property relationships and their effects on gas sensors. In this work, SnO2 nanowires and nanobrushes grown via chemical vapor deposition (CVD) displayed the same tetragonal SnO2 structure as revealed via powder X-ray diffraction bulk crystallinity data. Additional characterization using a range of electron microscopy imaging and diffraction techniques, however, revealed important structure and morphology distinctions between the nanomaterials. Tailoring scanning transmission electron microscopy (STEM) modes combined with transmission electron backscatter diffraction (t-EBSD) techniques afforded a more detailed view of the SnO2 nanostructures. Indeed, upon deeper analysis of individual wires and brushes, we discovered that, despite a similar bulk structure, wires and brushes grew with different crystal faces and lattice spacings. Had we not utilized multiple STEM diffraction modes in conjunction with t-EBSD, differences in orientation related to bristle density would have been overlooked. Thus, it is only through a methodical combination of several structural analysis techniques that precise structural information can be reliably obtained.

  15. H2O-CH4 and H2S-CH4 complexes: a direct comparison through molecular beam experiments and ab initio calculations.

    PubMed

    Cappelletti, David; Bartocci, Alessio; Frati, Federica; Roncaratti, Luiz F; Belpassi, Leonardo; Tarantelli, Francesco; Lakshmi, Prabha Aiswarya; Arunan, Elangannan; Pirani, Fernando

    2015-11-11

    New molecular beam scattering experiments have been performed to measure the total (elastic plus inelastic) cross sections as a function of the velocity in collisions between water and hydrogen sulfide projectile molecules and the methane target. Measured data have been exploited to characterize the range and strength of the intermolecular interaction in such systems, which are of relevance as they drive the gas phase molecular dynamics and the clathrate formation. Complementary information has been obtained by rotational spectra, recorded for the hydrogen sulfide-methane complex, with a pulsed nozzle Fourier transform microwave spectrometer. Extensive ab initio calculations have been performed to rationalize all the experimental findings. The combination of experimental and theoretical information has established the ground for the understanding of the nature of the interaction and allows for its basic components to be modelled, including charge transfer, in these weakly bound systems. The intermolecular potential for H2S-CH4 is significantly less anisotropic than for H2O-CH4, although both of them have potential minima that can be characterized as 'hydrogen bonded'.

  16. Computational imaging with a balanced detector.

    PubMed

    Soldevila, F; Clemente, P; Tajahuerce, E; Uribe-Patarroyo, N; Andrés, P; Lancis, J

    2016-06-29

    Single-pixel cameras allow to obtain images in a wide range of challenging scenarios, including broad regions of the electromagnetic spectrum and through scattering media. However, there still exist several drawbacks that single-pixel architectures must address, such as acquisition speed and imaging in the presence of ambient light. In this work we introduce balanced detection in combination with simultaneous complementary illumination in a single-pixel camera. This approach enables to acquire information even when the power of the parasite signal is higher than the signal itself. Furthermore, this novel detection scheme increases both the frame rate and the signal-to-noise ratio of the system. By means of a fast digital micromirror device together with a low numerical aperture collecting system, we are able to produce a live-feed video with a resolution of 64 × 64 pixels at 5 Hz. With advanced undersampling techniques, such as compressive sensing, we can acquire information at rates of 25 Hz. By using this strategy, we foresee real-time biological imaging with large area detectors in conditions where array sensors are unable to operate properly, such as infrared imaging and dealing with objects embedded in turbid media.

  17. Computational imaging with a balanced detector

    NASA Astrophysics Data System (ADS)

    Soldevila, F.; Clemente, P.; Tajahuerce, E.; Uribe-Patarroyo, N.; Andrés, P.; Lancis, J.

    2016-06-01

    Single-pixel cameras allow to obtain images in a wide range of challenging scenarios, including broad regions of the electromagnetic spectrum and through scattering media. However, there still exist several drawbacks that single-pixel architectures must address, such as acquisition speed and imaging in the presence of ambient light. In this work we introduce balanced detection in combination with simultaneous complementary illumination in a single-pixel camera. This approach enables to acquire information even when the power of the parasite signal is higher than the signal itself. Furthermore, this novel detection scheme increases both the frame rate and the signal-to-noise ratio of the system. By means of a fast digital micromirror device together with a low numerical aperture collecting system, we are able to produce a live-feed video with a resolution of 64 × 64 pixels at 5 Hz. With advanced undersampling techniques, such as compressive sensing, we can acquire information at rates of 25 Hz. By using this strategy, we foresee real-time biological imaging with large area detectors in conditions where array sensors are unable to operate properly, such as infrared imaging and dealing with objects embedded in turbid media.

  18. Computational imaging with a balanced detector

    PubMed Central

    Soldevila, F.; Clemente, P.; Tajahuerce, E.; Uribe-Patarroyo, N.; Andrés, P.; Lancis, J.

    2016-01-01

    Single-pixel cameras allow to obtain images in a wide range of challenging scenarios, including broad regions of the electromagnetic spectrum and through scattering media. However, there still exist several drawbacks that single-pixel architectures must address, such as acquisition speed and imaging in the presence of ambient light. In this work we introduce balanced detection in combination with simultaneous complementary illumination in a single-pixel camera. This approach enables to acquire information even when the power of the parasite signal is higher than the signal itself. Furthermore, this novel detection scheme increases both the frame rate and the signal-to-noise ratio of the system. By means of a fast digital micromirror device together with a low numerical aperture collecting system, we are able to produce a live-feed video with a resolution of 64 × 64 pixels at 5 Hz. With advanced undersampling techniques, such as compressive sensing, we can acquire information at rates of 25 Hz. By using this strategy, we foresee real-time biological imaging with large area detectors in conditions where array sensors are unable to operate properly, such as infrared imaging and dealing with objects embedded in turbid media. PMID:27353733

  19. Paloma: In-Situ Measurement of the Isotopic Composition of Mars Atmosphere

    NASA Astrophysics Data System (ADS)

    Jambon, A.; Quemerais, E.; Chassiefiere, E.; Berthelier, J. J.; Agrinier, P.; Cartigny, P.; Javoy, M.; Moreira, M.; Sabroux, J. -C.; Sarda, P.; Pineau, J. -F.

    2000-07-01

    Scientific objectives for an atmospheric analysis of Mars are presented in the DREAM project. Among the information presently available most are fragmentary or limited in their precision for both major element (H, C, O, N) and noble gas isotopes. These data are necessary for the understanding and modelling of Mars atmospheric formation and evolution, and consequently for other planets, particularly the Earth. To fulfill the above requirements, two approaches can be envisonned: 1) analysis of a returned sample (DREAM project) or 2) in situ analysis, e.g. PALOMA project presented here. Among the advantages of in situ analysis, we notice: the minimal terrestrial contamination, the unlimited availability of gas to be analyzed and the possibility of multiple analyses (replicates, daynight... ). Difficulties specific to in situ analyses are of a very different kind to those of returned samples. In situ analysis could also be viewed as a preparation to future analysis of returned samples. Finally, some of the measurements will not be possible on Earth: for instance, radon and its short lived decay products, will provide complementary information to 4-He analysis and can only be obtained in situ, independently of analytical capabilities.

  20. Determinants of breast-feeding within the first 6 months post-partum in rural Vietnam.

    PubMed

    Duong, Dat V; Lee, Andy H; Binns, Colin W

    2005-07-01

    This study explored the determinants of breast-feeding practices within the first 6 months post-partum among women residing in rural Vietnam. The study was conducted in Quang Xuong district, in the Thanh Hoa Province of Vietnam. In the first phase, 463 women were prospectively studied at weeks 1, 16 and 24 post-partum. During the second phase, 16 focus group discussions were undertaken to obtain complementary information. Exclusive breast-feeding dropped from 83.6% at week 1 to 43.6% at week 16 and by week 24, no infant was exclusively breast-fed. A logistic regression analysis found 'mother's education level', 'mother's decision-making on breast-feeding', 'mother's comfort to breast-feed in public places', 'father's occupation', 'feeding preference of father' and 'having sufficient food for the family' significantly influenced the exclusive breast-feeding practice. Qualitative data provided in-depth information on factors relating to mother, infant, close relatives and providers. Providing appropriate training and supportive supervision on breast-feeding counselling to health workers and supporting working mothers to exclusively breast-feed their infants through community mobilization were recommended to improve breast-feeding in rural Vietnam.

Top