Optical-diffraction method for determining crystal orientation

DOEpatents

Sopori, B.L.

1982-05-07

Disclosed is an optical diffraction technique for characterizing the three-dimensional orientation of a crystal sample. An arbitrary surface of the crystal sample is texture etched so as to generate a pseudo-periodic diffraction grating on the surface. A laser light beam is then directed onto the etched surface, and the reflected light forms a farfield diffraction pattern in reflection. Parameters of the diffraction pattern, such as the geometry and angular dispersion of the diffracted beam are then related to grating shape of the etched surface which is in turn related to crystal orientation. This technique may be used for examining polycrystalline silicon for use in solar cells.

Phase modulation due to crystal diffraction by ptychographic imaging

DOE Office of Scientific and Technical Information (OSTI.GOV)

Civita, M.; Diaz, A.; Bean, R. J.

Solving the phase problem in x-ray crystallography has occupied a considerable scientific effort in the 20th century and led to great advances in structural science. Here we use x-ray ptychography to demonstrate an interference method which measures the phase of the beam transmitted through a crystal, relative to the incoming beam, when diffraction takes place. The observed phase change of the direct beam through a small gold crystal is found to agree with both a quasikinematical model and full dynamical theories of diffraction. Our discovery of a diffraction contrast mechanism will enhance the interpretation of data obtained from crystalline samplesmore » using the ptychography method, which provides some of the most accurate x-ray phase-contrast images.« less

Phase modulation due to crystal diffraction by ptychographic imaging

DOE PAGES

Civita, M.; Diaz, A.; Bean, R. J.; ...

2018-03-06

Solving the phase problem in x-ray crystallography has occupied a considerable scientific effort in the 20th century and led to great advances in structural science. Here we use x-ray ptychography to demonstrate an interference method which measures the phase of the beam transmitted through a crystal, relative to the incoming beam, when diffraction takes place. The observed phase change of the direct beam through a small gold crystal is found to agree with both a quasikinematical model and full dynamical theories of diffraction. Our discovery of a diffraction contrast mechanism will enhance the interpretation of data obtained from crystalline samplesmore » using the ptychography method, which provides some of the most accurate x-ray phase-contrast images.« less

A new method to evaluate the quality of single crystal Cu by an X-ray diffraction butterfly pattern method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu Zhenming; Guo Zhenqi; Li Jianguo

2004-12-15

A new method for the evaluation of the quality of an Ohno continuous cast (OCC) Cu single crystal by X-ray diffraction (XRD) butterfly pattern was brought forward. Experimental results show that the growth direction of single crystal Cu is inclined from both sides of the single crystal Cu rod to the axis and is axially symmetric. The degree of deviation from the [100] orientation from the crystal axis is less than 5 deg. with a casting speed 10-40 mm/min. The orientation of single crystal Cu does not have a fixed direction but is in a regular range. Moreover, the orientationmore » of stray grains in the single crystal Cu is random from continuous casting.« less

Purification, crystallization and preliminary X-ray diffraction studies of parakeet (Psittacula krameri) haemoglobin.

PubMed

Jaimohan, S M; Naresh, M D; Arumugam, V; Mandal, A B

2009-10-01

Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemoglobins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 A resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 A, beta = 109.35 degrees . Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

Crystallization of PTP Domains.

PubMed

Levy, Colin; Adams, James; Tabernero, Lydia

2016-01-01

Protein crystallography is the most powerful method to obtain atomic resolution information on the three-dimensional structure of proteins. An essential step towards determining the crystallographic structure of a protein is to produce good quality crystals from a concentrated sample of purified protein. These crystals are then used to obtain X-ray diffraction data necessary to determine the 3D structure by direct phasing or molecular replacement if the model of a homologous protein is available. Here, we describe the main approaches and techniques to obtain suitable crystals for X-ray diffraction. We include tools and guidance on how to evaluate and design the protein construct, how to prepare Se-methionine derivatized protein, how to assess the stability and quality of the sample, and how to crystallize and prepare crystals for diffraction experiments. While general strategies for protein crystallization are summarized, specific examples of the application of these strategies to the crystallization of PTP domains are discussed.

Three-dimensional reconstruction for coherent diffraction patterns obtained by XFEL.

PubMed

Nakano, Miki; Miyashita, Osamu; Jonic, Slavica; Song, Changyong; Nam, Daewoong; Joti, Yasumasa; Tama, Florence

2017-07-01

The three-dimensional (3D) structural analysis of single particles using an X-ray free-electron laser (XFEL) is a new structural biology technique that enables observations of molecules that are difficult to crystallize, such as flexible biomolecular complexes and living tissue in the state close to physiological conditions. In order to restore the 3D structure from the diffraction patterns obtained by the XFEL, computational algorithms are necessary as the orientation of the incident beam with respect to the sample needs to be estimated. A program package for XFEL single-particle analysis based on the Xmipp software package, that is commonly used for image processing in 3D cryo-electron microscopy, has been developed. The reconstruction program has been tested using diffraction patterns of an aerosol nanoparticle obtained by tomographic coherent X-ray diffraction microscopy.

Crystallographic analysis of ground and space thermostable T1 lipase crystal obtained via counter diffusion method approach.

PubMed

Mohamad Aris, Sayangku Nor Ariati; Thean Chor, Adam Leow; Mohamad Ali, Mohd Shukuri; Basri, Mahiran; Salleh, Abu Bakar; Raja Abd Rahman, Raja Noor Zaliha

2014-01-01

Three-dimensional structure of thermostable lipase is much sought after nowadays as it is important for industrial application mainly found in the food, detergent, and pharmaceutical sectors. Crystallization utilizing the counter diffusion method in space was performed with the aim to obtain high resolution diffracting crystals with better internal order to improve the accuracy of the structure. Thermostable T1 lipase enzyme has been crystallized in laboratory on earth and also under microgravity condition aboard Progress spacecraft to the ISS in collaboration with JAXA (Japanese Aerospace Exploration Agency). This study is conducted with the aims of improving crystal packing and structure resolution. The diffraction data set for ground grown crystal was collected to 1.3 Å resolution and belonged to monoclinic C2 space group with unit cell parameters a = 117.40 Å, b = 80.95 Å, and c = 99.81 Å, whereas the diffraction data set for space grown crystal was collected to 1.1 Å resolution and belonged to monoclinic C2 space group with unit cell parameters a = 117.31 Å, b = 80.85 Å, and c = 99.81 Å. The major difference between the two crystal growth systems is the lack of convection and sedimentation in microgravity environment resulted in the growth of much higher quality crystals of T1 lipase.

Diffraction and Imaging Study of Imperfections of Protein Crystals with Coherent X-rays

NASA Technical Reports Server (NTRS)

Hu, Z. W.; Thomas, B. R.; Chernov, A. A.; Chu, Y. S.; Lai, B.

2004-01-01

High angular-resolution x-ray diffraction and phase contrast x-ray imaging were combined to study defects and perfection of protein crystals. Imperfections including line defects, inclusions and other microdefects were observed in the diffraction images of a uniformly grown lysozyme crystal. The observed line defects carry distinct dislocation features running approximately along the <110> growth front and have been found to originate mostly in a central growth area and occasionally in outer growth regions. Slow dehydration led to the broadening of a fairly symmetric 4 4 0 rocking curve by a factor of approximately 2.6, which was primarily attributed to the dehydration-induced microscopic effects that are clearly shown in diffraction images. X-ray imaging and diffraction characterization of the quality of apoferritin crystals will also be discussed in the presentation.

High Resolution X-Ray Diffraction of Macromolecules with Synchrotron Radiation

NASA Technical Reports Server (NTRS)

Stojanoff, Vivian; Boggon, Titus; Helliwell, John R.; Judge, Russell; Olczak, Alex; Snell, Edward H.; Siddons, D. Peter; Rose, M. Franklin (Technical Monitor)

2000-01-01

We recently combined synchrotron-based monochromatic X-ray diffraction topography methods with triple axis diffractometry and rocking curve measurements: high resolution X-ray diffraction imaging techniques, to better understand the quality of protein crystals. We discuss these methods in the light of results obtained on crystals grown under different conditions. These non destructive techniques are powerful tools in the characterization of the protein crystals and ultimately will allow to improve, develop, and understand protein crystal growth. High resolution X-ray diffraction imaging methods will be discussed in detail in light of recent results obtained on Hen Egg White Lysozyme crystals and other proteins.

Maximizing Macromolecule Crystal Size for Neutron Diffraction Experiments

NASA Technical Reports Server (NTRS)

Judge, R. A.; Kephart, R.; Leardi, R.; Myles, D. A.; Snell, E. H.; vanderWoerd, M.; Curreri, Peter A. (Technical Monitor)

2002-01-01

A challenge in neutron diffraction experiments is growing large (greater than 1 cu mm) macromolecule crystals. In taking up this challenge we have used statistical experiment design techniques to quickly identify crystallization conditions under which the largest crystals grow. These techniques provide the maximum information for minimal experimental effort, allowing optimal screening of crystallization variables in a simple experimental matrix, using the minimum amount of sample. Analysis of the results quickly tells the investigator what conditions are the most important for the crystallization. These can then be used to maximize the crystallization results in terms of reducing crystal numbers and providing large crystals of suitable habit. We have used these techniques to grow large crystals of Glucose isomerase. Glucose isomerase is an industrial enzyme used extensively in the food industry for the conversion of glucose to fructose. The aim of this study is the elucidation of the enzymatic mechanism at the molecular level. The accurate determination of hydrogen positions, which is critical for this, is a requirement that neutron diffraction is uniquely suited for. Preliminary neutron diffraction experiments with these crystals conducted at the Institute Laue-Langevin (Grenoble, France) reveal diffraction to beyond 2.5 angstrom. Macromolecular crystal growth is a process involving many parameters, and statistical experimental design is naturally suited to this field. These techniques are sample independent and provide an experimental strategy to maximize crystal volume and habit for neutron diffraction studies.

Purification, crystallization and preliminary X-ray diffraction studies of parakeet (Psittacula krameri) haemoglobin

PubMed Central

Jaimohan, S. M.; Naresh, M. D.; Arumugam, V.; Mandal, A. B.

2009-01-01

Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemo­globins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 Å resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 Å, β = 109.35°. Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit. PMID:19851014

Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals

DOE PAGES

Dao, E. Han; Sierra, Raymond G.; Laksmono, Hartawan; ...

2015-04-30

In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS) using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecondmore » X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.« less

Crystallization, X-ray diffraction analysis and SIRAS/molecular-replacenent phasing of three crystal forms of Anabaena sensory rhodopsin transducer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vogeley, Lutz; Luecke, Hartmut, E-mail: hudel@uci.edu

2006-04-01

Crystals of Anabaena sensory rhodopsin transducer, the transducer for the cyanobacterial photosensor Anabaena sensory rhodopsin, obtained in the space groups P4, C2 and P2{sub 1}2{sub 1}2{sub 1} diffract to 1.8, 2.1 and 2.0 Å, respectively. Phases for these crystal forms were obtained by SIRAS phasing using an iodide quick-soak derivative (P4) and molecular replacement (C2 and P2{sub 1}2{sub 1}2{sub 1}). Anabaena sensory rhodopsin transducer (ASRT) is a 14.7 kDa soluble signaling protein associated with the membrane-embedded light receptor Anabaena sensory rhodopsin (ASR) from Anabaena sp., a freshwater cyanobacterium. Crystals of ASRT were obtained in three different space groups, P4, C2more » and P2{sub 1}2{sub 1}2{sub 1}, which diffract to 1.8, 2.1 and 2.0 Å, respectively. Phases for one of these crystal forms (P4) were obtained by SIRAS phasing using an iodide quick-soak derivative and a partial model was built. Phases for the remaining crystal forms were obtained by molecular replacement using the partial model from the P4 crystal form.« less

Colloidal crystal growth monitored by Bragg diffraction interference fringes.

PubMed

Bohn, Justin J; Tikhonov, Alexander; Asher, Sanford A

2010-10-15

We monitored the crystal growth kinetics of crystallization of a shear melted crystalline colloidal array (CCA). The fcc CCA heterogeneously nucleates at the flow cell wall surface. We examined the evolution of the (1 1 1) Bragg diffraction peak, and, for the first time, quantitatively monitored growth by measuring the temporal evolution of the Bragg diffraction interference fringes. Modeling of the evolution of the fringe patterns exposes the time dependence of the increasing crystal thickness. The initial diffusion-driven linear growth is followed by ripening-driven growth. Between 80 and 90 microM NaCl concentrations the fcc crystals first linearly grow at rates between 1.9 and 4.2 microm/s until they contact homogeneously nucleated crystals in the bulk. At lower salt concentrations interference fringes are not visible because the strong electrostatic interactions between particles result in high activation barriers, preventing defect annealing and leading to a lower crystal quality. The fcc crystals melt to a liquid phase at >90 microM NaCl concentrations. Increasing NaCl concentrations slow the fcc CCA growth rate consistent with the expectation of the classical Wilson-Frenkel growth theory. The final thickness of wall-nucleated CCA, that is determined by the competition between growth of heterogeneously and homogenously nucleated CCA, increases with higher NaCl concentrations. Copyright 2010 Elsevier Inc. All rights reserved.

Femtosecond X-ray Diffraction From Two-Dimensional Protein Crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frank, Matthias; Carlson, David B.; Hunter, Mark

2014-02-28

Here we present femtosecond x-ray diffraction patterns from two-dimensional (2-D) protein crystals using an x-ray free electron laser (XFEL). To date it has not been possible to acquire x-ray diffraction from individual 2-D protein crystals due to radiation damage. However, the intense and ultrafast pulses generated by an XFEL permits a new method of collecting diffraction data before the sample is destroyed. Utilizing a diffract-before-destroy methodology at the Linac Coherent Light Source, we observed Bragg diffraction to better than 8.5 Å resolution for two different 2-D protein crystal samples that were maintained at room temperature. These proof-of-principle results show promisemore » for structural analysis of both soluble and membrane proteins arranged as 2-D crystals without requiring cryogenic conditions or the formation of three-dimensional crystals.« less

Phase-Shifting Liquid Crystal Point-Diffraction Interferometry

NASA Technical Reports Server (NTRS)

Griffin, DeVon W.; Marshall, Kenneth L.; Mercer, Carolyn R.

2000-01-01

, the limited spatial resolution and the methods required for data reduction suggest that a more useful instrument needs to be developed. The category of interferometers known as common path interferometers can eliminate much of the vibration sensitivity associated with traditional interferometry as described above. In these devices, division of the amplitude of the wavefront following the test section produces the reference beam. Examples of these instruments include shearing and point diffraction interferometers. In the latter case, shown schematically, a lens focuses light passing through the test section onto a small diffracting object. Such objects are typically either a circle of material on a high quality glass plate or a small sphere in a glass cell. The size of the focused spot is several times larger than the object so that the light not intercepted by the diffracting object forms the test beam while the diffracted light generates a spherical reference beam. While this configuration is mechanically stable, phase shifting one beam with respect to the other is difficult due to the common path. Phase shifting enables extremely accurate measurements of the phase of the interferogram using only gray scale intensity measurements and is the de facto standard of industry. Mercer and Creath 2 demonstrated phase shifting in a point diffraction interferometer using a spherical spacer in a liquid crystal cell as the diffracting object. By changing the voltage across the cell, they were able to shift the phase of the undiffracted beam relative to the reference beam generated by diffraction from the sphere. While they applied this technology to fluid measurements, the device shifted phase so slowly that it was not useful for studying transient phenomena. We have identified several technical problems that precluded operation of the device at video frame rates and intend to solve them to produce a phase-shifting liquid crystal point-diffraction interferometer operating at

Improving the Quality of Protein Crystals Using Stirring Crystallization

NASA Astrophysics Data System (ADS)

Adachi, Hiroaki; Matsumura, Hiroyoshi; Niino, Ai; Takano, Kazufumi; Kinoshita, Takayoshi; Warizaya, Masaichi; Inoue, Tsuyoshi; Mori, Yusuke; Sasaki, Takatomo

2004-04-01

Recent reports state that a high magnetic field improves the crystal quality of bovine adenosine deaminase (ADA) with an inhibitor [Kinoshita et al.: Acta Cryst. D59 (2003) 1333]. In this paper, we examine the effect of stirring solution on ADA crystallization using a vapor-diffusion technique with rotary and figure-eight motion shakers. The probability of obtaining high-quality crystals is increased with stirring in a figure-eight pattern. Furthermore, rotary stirring greatly increased the probability of obtaining high-quality crystals, however, nucleation time was also increased. The crystal structure with the inhibitor was determined at a high resolution using a crystal obtained from a stirred solution. These results indicate that stirring with simple equipment is as useful as the high magnetic field technique for protein crystallization.

LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kusakizako, Tsukasa; Tanaka, Yoshiki; Hipolito, Christopher J.

A V. cholerae MATE transporter was crystallized using the lipidic cubic phase (LCP) method. X-ray diffraction data sets were collected from single crystals obtained in a sandwich plate and a sitting-drop plate to resolutions of 2.5 and 2.2 Å, respectively. Multidrug and toxic compound extrusion (MATE) transporters, one of the multidrug exporter families, efflux xenobiotics towards the extracellular side of the membrane. Since MATE transporters expressed in bacterial pathogens contribute to multidrug resistance, they are important therapeutic targets. Here, a MATE-transporter homologue from Vibrio cholerae, VcmN, was overexpressed in Escherichia coli, purified and crystallized in lipidic cubic phase (LCP). X-raymore » diffraction data were collected to 2.5 Å resolution from a single crystal obtained in a sandwich plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.3, b = 93.7, c = 100.2 Å. As a result of further LCP crystallization trials, crystals of larger size were obtained using sitting-drop plates. X-ray diffraction data were collected to 2.2 Å resolution from a single crystal obtained in a sitting-drop plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.9, b = 91.8, c = 100.9 Å. The present work provides valuable insights into the atomic resolution structure determination of membrane transporters.« less

Spherical quartz crystals investigated with synchrotron radiation

DOE PAGES

Pereira, N. R.; Macrander, A. T.; Hill, K. W.; ...

2015-10-27

The quality of x-ray spectra and images obtained from plasmas with spherically bent crystals depends in part on the crystal's x-ray diffraction across the entire crystal surface. We employ the energy selectivity and high intensity of synchrotron radiation to examine typical spherical crystals from alpha-quartz for their diffraction quality, in a perpendicular geometry that is particularly convenient to examine sagittal focusing. The crystal's local diffraction is not ideal: the most noticeable problems come from isolated regions that so far have failed to correlate with visible imperfections. In conclusion, excluding diffraction from such problem spots has little effect on the focusmore » beyond a decrease in background.« less

Crystallization and preliminary X-ray diffraction analysis of restriction endonuclease EcoRII

NASA Technical Reports Server (NTRS)

Karpova, E. A.; Meehan, E.; Pusey, M. L.; Chen, L.

1999-01-01

Crystals of the restriction endonuclease EcoRII have been obtained by the vapor-diffusion technique in the presence of ammonium sulfate or polyethylene glycol. The best crystals were grown with ammonium sulfate as a precipitant. Crystals with dimensions of up to 0.6 x 0. 6 x 0.6 mm have been observed. The crystals diffract to about 4.0 A resolution at a cryo-temperature of 100 K using a rotating-anode X-ray source and a Rigaku R-AXIS IV imaging-plate detector. The space group has been determined to be either I23 or I2(1)3, with unit-cell parameters a = b = c = 160.3 A, alpha = beta = gamma = 90 degrees. The crystal asymmetric unit contains two protein molecules, and self-rotation function analysis shows a pseudo-twofold symmetry relating the two monomers. Attempts to improve the resolution of crystal diffraction and to search for heavy-atom derivatives are under way.

DIFFRACTION FROM MODEL CRYSTALS

USDA-ARS?s Scientific Manuscript database

Although calculating X-ray diffraction patterns from atomic coordinates of a crystal structure is a widely available capability, calculation from non-periodic arrays of atoms has not been widely applied to cellulose. Non-periodic arrays result from modeling studies that, even though started with at...

In situ high-pressure measurement of crystal solubility by using neutron diffraction

NASA Astrophysics Data System (ADS)

Chen, Ji; Hu, Qiwei; Fang, Leiming; He, Duanwei; Chen, Xiping; Xie, Lei; Chen, Bo; Li, Xin; Ni, Xiaolin; Fan, Cong; Liang, Akun

2018-05-01

Crystal solubility is one of the most important thermo-physical properties and plays a key role in industrial applications, fundamental science, and geoscientific research. However, high-pressure in situ measurements of crystal solubility remain very challenging. Here, we present a method involving high-pressure neutron diffraction for making high-precision in situ measurements of crystal solubility as a function of pressure over a wide range of pressures. For these experiments, we designed a piston-cylinder cell with a large chamber volume for high-pressure neutron diffraction. The solution pressures are continuously monitored in situ based on the equation of state of the sample crystal. The solubility at a high pressure can be obtained by applying a Rietveld quantitative multiphase analysis. To evaluate the proposed method, we measured the high-pressure solubility of NaCl in water up to 610 MPa. At a low pressure, the results are consistent with the previous results measured ex situ. At a higher pressure, more reliable data could be provided by using an in situ high-pressure neutron diffraction method.

Free-falling Crystals: Biological Macromolecular Crystal Growth Studies in Low Earth Orbit

NASA Technical Reports Server (NTRS)

Judge, Russell A.; Snell, E. H.; Pusey, M. L.; Whitaker, Ann F. (Technical Monitor)

2001-01-01

Spacecraft orbiting the earth experience a reduced acceleration environment due to being in a state of continuous free-fall. This state colloquially termed microgravity, has produced improved X-ray diffraction quality crystals of biological macromolecules. Improvements in X-ray diffraction resolution (detail) or signal to noise, provide greater detail in the three-dimensional molecular structure providing information about the molecule, how it works, how to improve its function or how to impede it. Greater molecular detail obtained by crystallization in microgravity, has important implications for structural biology. In this article we examine the theories behind macromolecule crystal quality improvement in microgravity using results obtained from studies with the model protein, chicken egg white lysozyme.

Macromolecule Crystal Quality Improvement in Microgravity: The Role of Impurities

NASA Technical Reports Server (NTRS)

Judge, Russell A.; Snell, Edward H.; Pusey, Marc L.; Sportiello, Michael G.; Todd, Paul; Bellamy, Henry; Borgstahl, Gloria E.; Pokros, Matt; Cassanto, John M.

2000-01-01

While macromolecule impurities may affect crystal size and morphology the over-riding question is; "How do macromolecule impurities effect crystal X-ray quality and diffraction resolution?" In the case of chicken egg white lysozyme, crystals can be grown in the presence of a number of impurities without affecting diffraction resolution. One impurity however, the lysozyme dimer, does negatively impact the X-ray crystal properties. Crystal quality improvement as a result of better partitioning of this impurity during crystallization in microgravity has been reported'. In our recent experimental work dimer partitioning was found to be not significantly different between the two environments. Mosaicity analysis of pure crystals showed a reduced mosaicity and increased signal to noise for the microgravity grown crystals. Dimer incorporation however, did greatly reduce the resolution limit in both ground and microgravity grown crystals. These results indicate that impurity effects in microgravity are complex and may rely on the conditions or techniques employed.

Simulations of X-ray diffraction of shock-compressed single-crystal tantalum with synchrotron undulator sources.

PubMed

Tang, M X; Zhang, Y Y; E, J C; Luo, S N

2018-05-01

Polychromatic synchrotron undulator X-ray sources are useful for ultrafast single-crystal diffraction under shock compression. Here, simulations of X-ray diffraction of shock-compressed single-crystal tantalum with realistic undulator sources are reported, based on large-scale molecular dynamics simulations. Purely elastic deformation, elastic-plastic two-wave structure, and severe plastic deformation under different impact velocities are explored, as well as an edge release case. Transmission-mode diffraction simulations consider crystallographic orientation, loading direction, incident beam direction, X-ray spectrum bandwidth and realistic detector size. Diffraction patterns and reciprocal space nodes are obtained from atomic configurations for different loading (elastic and plastic) and detection conditions, and interpretation of the diffraction patterns is discussed.

Simulations of X-ray diffraction of shock-compressed single-crystal tantalum with synchrotron undulator sources

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, M. X.; Zhang, Y. Y.; E, J. C.

Polychromatic synchrotron undulator X-ray sources are useful for ultrafast single-crystal diffraction under shock compression. Here, simulations of X-ray diffraction of shock-compressed single-crystal tantalum with realistic undulator sources are reported, based on large-scale molecular dynamics simulations. Purely elastic deformation, elastic–plastic two-wave structure, and severe plastic deformation under different impact velocities are explored, as well as an edge release case. Transmission-mode diffraction simulations consider crystallographic orientation, loading direction, incident beam direction, X-ray spectrum bandwidth and realistic detector size. Diffraction patterns and reciprocal space nodes are obtained from atomic configurations for different loading (elastic and plastic) and detection conditions, and interpretation of themore » diffraction patterns is discussed.« less

Grazing-incidence X-ray diffraction from a crystal with subsurface defects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gaevskii, A. Yu., E-mail: transilv@mail.ru; Golentus, I. E.

2015-03-15

The diffraction of X rays incident on a crystal surface under grazing angles under conditions of total external reflection has been investigated. An approach is proposed in which exact solutions to the dynamic problem of grazing-incidence diffraction in an ideal crystal are used as initial functions to calculate the diffuse component of diffraction in a crystal with defects. The diffuse component of diffraction is calculated for a crystal with surface defects of a dilatation-center type. Exact formulas of the continuum theory which take into account the mirror-image forces are used for defect-induced atomic displacements. Scattering intensity maps near Bragg peaksmore » are constructed for different scan modes, and the conditions for detecting primarily the diffuse component are determined. The results of dynamic calculations of grazing-incidence diffraction in defect-containing crystals are compared with calculations in the kinematic approximation.« less

Three-dimensional Bragg coherent diffraction imaging of an extended ZnO crystal.

PubMed

Huang, Xiaojing; Harder, Ross; Leake, Steven; Clark, Jesse; Robinson, Ian

2012-08-01

A complex three-dimensional quantitative image of an extended zinc oxide (ZnO) crystal has been obtained using Bragg coherent diffraction imaging integrated with ptychography. By scanning a 2.5 µm-long arm of a ZnO tetrapod across a 1.3 µm X-ray beam with fine step sizes while measuring a three-dimensional diffraction pattern at each scan spot, the three-dimensional electron density and projected displacement field of the entire crystal were recovered. The simultaneously reconstructed complex wavefront of the illumination combined with its coherence properties determined by a partial coherence analysis implemented in the reconstruction process provide a comprehensive characterization of the incident X-ray beam.

Expression, purification, crystallization and preliminary X-ray diffraction analysis of α-11 giardin from Giardia lamblia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pathuri, Puja; Nguyen, Emily Tam; Luecke, Hartmut, E-mail: hudel@uci.edu

2006-11-01

α-11 giardin from the intestinal protozoan parasite, G. lamblia has been cloned, expressed, purified and crystallized under two different conditions and in two different space groups. Crystals from the first condition diffracted to 1.1 Å and belong to a primitive orthorhombic space group and crystals obtained in the second condition diffracted to 2.93 Å and belong to a primitive monoclinic space group. α-11 Giardin, a protein from the annexin superfamily, is a 35.0 kDa protein from the intestinal protozoan parasite Giardia lamblia which triggers a form of diarrhea called giardiasis. Here, the cloning, expression, purification and the crystallization of α-11more » giardin under two different conditions and in two different space groups is reported. Crystals from the first condition diffracted to 1.1 Å and belong to a primitive orthorhombic space group, while crystals from the second condition, which included calcium in the crystallization solution, diffracted to 2.93 Å and belong to a primitive monoclinic space group. Determination of the detailed atomic structure of α-11 giardin will provide a better insight into its biological function and might establish whether this class of proteins is a potential drug target against giardiasis.« less

Optical properties and diffraction effects in opal photonic crystals.

PubMed

Balestreri, Alessandra; Andreani, Lucio Claudio; Agio, Mario

2006-09-01

Optical properties of fcc opals oriented along the [111] direction are calculated by means of a scattering-matrix approach based on approximating each sphere with cylindrical slices. The use of a plane-wave basis in each layer allows distinguishing zero-order reflection and transmission from higher-order (diffraction) spectra. Optical spectra at large values of the angle of incidence indicate the presence of diffraction effects and of polarization mixing along the LW orientation. Reflectance and transmittance in the high-energy region show a rich spectral dependence and compare reasonably well with recent experimental observations on polystyrene opals. Diffraction spectra as a function of the number of layers display an oscillatory behavior, pointing to the existence of a Pendellösung phenomenon, related to the exchange of energy between two propagating modes in the investigated three-dimensional photonic crystal. This phenomenon could be observed in transmittance experiments on high-quality opals with controlled thickness.

Purification, crystallization and preliminary X-ray diffraction analysis of royal palm tree (Roystonea regia) peroxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, Leandra; Nascimento, Alessandro S.; Zamorano, Laura S.

2007-09-01

The purification, crystallization, X-ray diffraction data acquisition and molecular-replacement results of royal palm tree (R. regia) peroxidase are described. Royal palm tree peroxidase (RPTP), which was isolated from Roystonea regia leaves, has an unusually high stability that makes it a promising candidate for diverse applications in industry and analytical chemistry [Caramyshev et al. (2005 ▶), Biomacromolecules, 6, 1360–1366]. Here, the purification and crystallization of this plant peroxidase and its X-ray diffraction data collection are described. RPTP crystals were obtained by the hanging-drop vapour-diffusion method and diffraction data were collected to a resolution of 2.8 Å. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 116.83, c = 92.24 Å, and contain one protein molecule per asymmetric unit. The V{sub M} value and solvent content are 4.07 Å{sup 3} Da{sup −1} and 69.8%, respectively.« less

Feasibility of one-shot-per-crystal structure determination using Laue diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cornaby, Sterling; CHESS; Szebenyi, Doletha M. E.

Structure determination was successfully carried out using single Laue exposures from a group of lysozyme crystals. The Laue method may be a viable option for collection of one-shot-per-crystal data from microcrystals. Crystal size is an important factor in determining the number of diffraction patterns which may be obtained from a protein crystal before severe radiation damage sets in. As crystal dimensions decrease this number is reduced, eventually falling to one, at which point a complete data set must be assembled using data from multiple crystals. When only a single exposure is to be collected from each crystal, the polychromatic Lauemore » technique may be preferable to monochromatic methods owing to its simultaneous recording of a large number of fully recorded reflections per image. To assess the feasibility of solving structures using single Laue images from multiple crystals, data were collected using a ‘pink’ beam at the CHESS D1 station from groups of lysozyme crystals with dimensions of the order of 20–30 µm mounted on MicroMesh grids. Single-shot Laue data were used for structure determination by molecular replacement and correct solutions were obtained even when as few as five crystals were used.« less

Use of a miniature diamond-anvil cell in high-pressure single-crystal neutron Laue diffraction

PubMed Central

Binns, Jack; Kamenev, Konstantin V.; McIntyre, Garry J.; Moggach, Stephen A.; Parsons, Simon

2016-01-01

The first high-pressure neutron diffraction study in a miniature diamond-anvil cell of a single crystal of size typical for X-ray diffraction is reported. This is made possible by modern Laue diffraction using a large solid-angle image-plate detector. An unexpected finding is that even reflections whose diffracted beams pass through the cell body are reliably observed, albeit with some attenuation. The cell body does limit the range of usable incident angles, but the crystallographic completeness for a high-symmetry unit cell is only slightly less than for a data collection without the cell. Data collections for two sizes of hexamine single crystals, with and without the pressure cell, and at 300 and 150 K, show that sample size and temperature are the most important factors that influence data quality. Despite the smaller crystal size and dominant parasitic scattering from the diamond-anvil cell, the data collected allow a full anisotropic refinement of hexamine with bond lengths and angles that agree with literature data within experimental error. This technique is shown to be suitable for low-symmetry crystals, and in these cases the transmission of diffracted beams through the cell body results in much higher completeness values than are possible with X-rays. The way is now open for joint X-ray and neutron studies on the same sample under identical conditions. PMID:27158503

SdsA polymorph isolation and improvement of their crystal quality using nonconventional crystallization techniques

DOE Office of Scientific and Technical Information (OSTI.GOV)

De la Mora, Eugenio; Flores-Hernández, Edith; Jakoncic, Jean

SdsA, a sodium dodecyl sulfate hydrolase, from Pseudomonas aeruginosa was crystallized in three different crystal polymorphs and their three-dimensional structure was determined. The different polymorphs present different crystal packing habits. One of the polymorphs suggests the existence of a tetramer, an oligomeric state not observed previously, while the crystal packing of the remaining two polymorphs obstructs the active site entrance but stabilizes flexible regions of the protein. Nonconventional crystallization methods that minimize convection, such as counterdiffusion in polyvinyl alcohol gel coupled with the influence of a 500 MHz (10.2 T) magnetic field, were necessary to isolate the poorest diffracting polymorphmore » and increase its internal order to determine its structure by X-ray diffraction. In conclusion, the results obtained show the effectiveness of nonconventional crystallographic methods to isolate different crystal polymorphs.« less

Crystallization of Mitochondrial Respiratory Complex II from Chicken Heart: a Membrane Protein Complex Diffracting to 2.0 Å.

PubMed Central

Huang, Li-shar; Borders, Toni M.; Shen, John T.; Wang, Chung-Jen; Berry, Edward

2006-01-01

Synopsis A multi-subunit mitochondrial membrane protein complex involved in the Krebs Cycle and respiratory chain has been crystallized in a form suitable for near-atomic resolution structure determination. A procedure is presented for preparation of diffraction-quality crystals of a vertebrate mitochondrial respiratory Complex II. The crystals have the potential to diffract to at least 2.0 Å with optimization of post-crystal-growth treatment and cryoprotection. This should allow determination of the structure of this important and medically relevant membrane protein complex at near-atomic resolution and provide great detail of the mode of binding of substrates and inhibitors at the two substrate-binding sites. PMID:15805592

Ultra-fast switching blue phase liquid crystals diffraction grating stabilized by chiral monomer

NASA Astrophysics Data System (ADS)

Manda, Ramesh; Pagidi, Srinivas; Sarathi Bhattacharya, Surjya; Yoo, Hyesun; T, Arun Kumar; Lim, Young Jin; Lee, Seung Hee

2018-05-01

We have demonstrated an ultra-fast switching and efficient polymer stabilized blue phase liquid crystal (PS-BPLC) diffraction grating utilizing a chiral monomer. We have obtained a 0.5 ms response time by a novel polymer stabilization method which is three times faster than conventional PS-BPLC. In addition, the diffraction efficiency was improved 2% with a much wider phase range and the driving voltage to switch the device is reduced. The polarization properties of the diffracted beam are unaffected by this novel polymer stabilization. This device can be useful for future photonic applications.

Crystallization Dynamics of Organolead Halide Perovskite by Real-Time X-ray Diffraction.

PubMed

Miyadera, Tetsuhiko; Shibata, Yosei; Koganezawa, Tomoyuki; Murakami, Takurou N; Sugita, Takeshi; Tanigaki, Nobutaka; Chikamatsu, Masayuki

2015-08-12

We analyzed the crystallization process of the CH3NH3PbI3 perovskite by observing real-time X-ray diffraction immediately after combining a PbI2 thin film with a CH3NH3I solution. A detailed analysis of the transformation kinetics demonstrated the fractal diffusion of the CH3NH3I solution into the PbI2 film. Moreover, the perovskite crystal was found to be initially oriented based on the PbI2 crystal orientation but to gradually transition to a random orientation. The fluctuating characteristics of the crystallization process of perovskites, such as fractal penetration and orientational transformation, should be controlled to allow the fabrication of high-quality perovskite crystals. The characteristic reaction dynamics observed in this study should assist in establishing reproducible fabrication processes for perovskite solar cells.

Purification, crystallization and preliminary X-ray diffraction studies of N-acetylglucosamine-phosphate mutase from Candida albicans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishitani, Yuichi; Maruyama, Daisuke; Nonaka, Tsuyoshi

2006-04-01

Preliminary X-ray diffraction studies on N-acetylglucosamine-phosphate mutase from C. albicans are reported. N-acetylglucosamine-phosphate mutase (AGM1) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine (UDP-GlcNAc) in eukaryotes and belongs to the α-d-phosphohexomutase superfamily. AGM1 from Candida albicans (CaAGM1) was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals obtained belong to the primitive monoclinic space group P2{sub 1}, with unit-cell parameters a = 60.2, b = 130.2, c = 78.0 Å, β = 106.7°. The crystals diffract X-rays to beyond 1.8 Å resolution using synchrotron radiation.

Crystallization of human nicotinamide phosphoribosyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takahashi, Ryo; Nakamura, Shota; Yoshida, Takuya

2007-05-01

Human nicotinamide phosphoribosyltransferase has been crystallized using microseeding methods and X-ray diffraction data have been collected at 2.0 Å resolution. In the NAD biosynthetic pathway, nicotinamide phosphoribosyltransferase (NMPRTase; EC 2.4.2.12) plays an important role in catalyzing the synthesis of nicotinamide mononucleotide from nicotinamide and 5′-phosphoribosyl-1′-pyrophosphate. Because the diffraction pattern of the initally obtained crystals was not suitable for structure analysis, the crystal quality was improved by successive use of the microseeding technique. The resultant crystals diffracted to 2.0 Å resolution. These crystals belonged to space group P21, with unit-cell parameters a = 60.56, b = 106.40, c = 82.78 Å.more » Here, the crystallization of human NMPRTase is reported in the free form; the crystals should be useful for inhibitor-soaking experiments on the enzyme.« less

Data Exploration Toolkit for serial diffraction experiments

DOE PAGES

Zeldin, Oliver B.; Brewster, Aaron S.; Hattne, Johan; ...

2015-01-23

Ultrafast diffraction at X-ray free-electron lasers (XFELs) has the potential to yield new insights into important biological systems that produce radiation-sensitive crystals. An unavoidable feature of the 'diffraction before destruction' nature of these experiments is that images are obtained from many distinct crystals and/or different regions of the same crystal. Combined with other sources of XFEL shot-to-shot variation, this introduces significant heterogeneity into the diffraction data, complicating processing and interpretation. To enable researchers to get the most from their collected data, a toolkit is presented that provides insights into the quality of, and the variation present in, serial crystallography datamore » sets. These tools operate on the unmerged, partial intensity integration results from many individual crystals, and can be used on two levels: firstly to guide the experimental strategy during data collection, and secondly to help users make informed choices during data processing.« less

Crystallization and X-ray diffraction of crystals formed in water-plasticized amorphous lactose.

PubMed

Jouppila, K; Kansikas, J; Roos, Y H

1998-01-01

Effects of storage time and relative humidity on crystallization and crystal forms produced from amorphous lactose were investigated. Crystallization was observed from time-dependent loss of sorbed water and increasing intensities of peaks in X-ray diffraction patterns. The rate of crystallization increased with increasing storage relative humidity. Lactose crystallized mainly as alpha-lactose monohydrate and anhydrous crystals with alpha- and beta-lactose in a molar ratio of 5:3. The results suggested that the crystal form was defined by the early nucleation process. The crystallization data are important in modeling of crystallization phenomena and prediction of stability of lactose-containing food and pharmaceutical materials.

Neutron and X-ray single-crystal diffraction from protein microcrystals via magnetically oriented microcrystal arrays in gels.

PubMed

Tsukui, Shu; Kimura, Fumiko; Kusaka, Katsuhiro; Baba, Seiki; Mizuno, Nobuhiro; Kimura, Tsunehisa

2016-07-01

Protein microcrystals magnetically aligned in D2O hydrogels were subjected to neutron diffraction measurements, and reflections were observed for the first time to a resolution of 3.4 Å from lysozyme microcrystals (∼10 × 10 × 50 µm). This result demonstrated the possibility that magnetically oriented microcrystals consolidated in D2O gels may provide a promising means to obtain single-crystal neutron diffraction from proteins that do not crystallize at the sizes required for neutron diffraction structure determination. In addition, lysozyme microcrystals aligned in H2O hydrogels allowed structure determination at a resolution of 1.76 Å at room temperature by X-ray diffraction. The use of gels has advantages since the microcrystals are measured under hydrated conditions.

Preliminary neutron diffraction analysis of challenging human manganese superoxide dismutase crystals

DOE PAGES

Azadmanesh, Jahaun; Trickel, Scott R.; Weiss, Kevin L.; ...

2017-03-29

Superoxide dismutases (SODs) are enzymes that protect against oxidative stress by dismutation of superoxide into oxygen and hydrogen peroxide through cyclic reduction and oxidation of the active-site metal. The complete enzymatic mechanisms of SODs are unknown since data on the positions of hydrogen are limited. Here, we present, methods for large crystal growth and neutron data collection of human manganese SOD (MnSOD) using perdeuteration and the MaNDi beamline at Oak Ridge National Laboratory. Furthermore, The crystal from which the human MnSOD data set was obtained is the crystal with the largest unit-cell edge (240 Å) from which data have beenmore » collectedvianeutron diffraction to sufficient resolution (2.30 Å) where hydrogen positions can be observed.« less

Preliminary neutron diffraction analysis of challenging human manganese superoxide dismutase crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Azadmanesh, Jahaun; Trickel, Scott R.; Weiss, Kevin L.

Superoxide dismutases (SODs) are enzymes that protect against oxidative stress by dismutation of superoxide into oxygen and hydrogen peroxide through cyclic reduction and oxidation of the active-site metal. The complete enzymatic mechanisms of SODs are unknown since data on the positions of hydrogen are limited. Here, we present, methods for large crystal growth and neutron data collection of human manganese SOD (MnSOD) using perdeuteration and the MaNDi beamline at Oak Ridge National Laboratory. Furthermore, The crystal from which the human MnSOD data set was obtained is the crystal with the largest unit-cell edge (240 Å) from which data have beenmore » collectedvianeutron diffraction to sufficient resolution (2.30 Å) where hydrogen positions can be observed.« less

Synchrotron Bragg diffraction imaging characterization of synthetic diamond crystals for optical and electronic power device applications1 1

PubMed Central

Tran Thi, Thu Nhi; Morse, J.; Caliste, D.; Fernandez, B.; Eon, D.; Härtwig, J.; Mer-Calfati, C.; Tranchant, N.; Arnault, J. C.; Lafford, T. A.; Baruchel, J.

2017-01-01

Bragg diffraction imaging enables the quality of synthetic single-crystal diamond substrates and their overgrown, mostly doped, diamond layers to be characterized. This is very important for improving diamond-based devices produced for X-ray optics and power electronics applications. The usual first step for this characterization is white-beam X-ray diffraction topography, which is a simple and fast method to identify the extended defects (dislocations, growth sectors, boundaries, stacking faults, overall curvature etc.) within the crystal. This allows easy and quick comparison of the crystal quality of diamond plates available from various commercial suppliers. When needed, rocking curve imaging (RCI) is also employed, which is the quantitative counterpart of monochromatic Bragg diffraction imaging. RCI enables the local determination of both the effective misorientation, which results from lattice parameter variation and the local lattice tilt, and the local Bragg position. Maps derived from these parameters are used to measure the magnitude of the distortions associated with polishing damage and the depth of this damage within the volume of the crystal. For overgrown layers, these maps also reveal the distortion induced by the incorporation of impurities such as boron, or the lattice parameter variations associated with the presence of growth-incorporated nitrogen. These techniques are described, and their capabilities for studying the quality of diamond substrates and overgrown layers, and the surface damage caused by mechanical polishing, are illustrated by examples. PMID:28381981

A microcrystal selection technique in protein crystallization

NASA Astrophysics Data System (ADS)

Han, Qing; Lin, Sheng-Xiang

1996-10-01

The goal of protein crystallization is to obtain high quality single crystals for X-ray diffraction analysis. A new and easy technique was employed to control the number and quality of crystals by eliminating poor microcrystals after the spontaneous nucleation. The process was carried out with two samples: human 17β-hydroxysteroid dehydrogenase (17β-HSD) and hen egg white lysozyme. The present study suggests a useful method for the successful crystal growth of biomacromolecules.

Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishimura, Mitsuhiro; Protein Research Group, RIKEN Yokohama Institute, RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045; Kaminishi, Tatsuya

2007-11-01

A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to spacemore » group P3{sub 1}21 or P3{sub 2}21.« less

Preliminary morphological and X-ray diffraction studies of the crystals of the DNA cetyltrimethylammonium salt.

PubMed

Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y

1977-04-01

Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained.

Preliminary morphological and X-ray diffraction studies of the crystals of the DNA cetyltrimethylammonium salt.

PubMed Central

Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y

1977-01-01

Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained. Images PMID:866188

Optical devices combining an organic semiconductor crystal with a two-dimensional inorganic diffraction grating

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kitazawa, Takenori; Yamao, Takeshi, E-mail: yamao@kit.ac.jp; Hotta, Shu

2016-02-01

We have fabricated optical devices using an organic semiconductor crystal as an emission layer in combination with a two-dimensional (2D) inorganic diffraction grating used as an optical cavity. We formed the inorganic diffraction grating by wet etching of aluminum-doped zinc oxide (AZO) under a 2D cyclic olefin copolymer (COC) diffraction grating used as a mask. The COC diffraction grating was fabricated by nanoimprint lithography. The AZO diffraction grating was composed of convex prominences arranged in a triangular lattice. The organic crystal placed on the AZO diffraction grating indicated narrowed peaks in its emission spectrum under ultraviolet light excitation. These aremore » detected parallel to the crystal plane. The peaks were shifted by rotating the optical devices around the normal to the crystal plane, which reflected the rotational symmetries of the triangular lattice through 60°.« less

Crystallization and X-ray diffraction analysis of a putative bacterial class I labdane-related diterpene synthase.

PubMed

Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia; Stojanoff, Vivian; Rodríguez-Sanoja, Romina; Rudiño-Piñera, Enrique; Sánchez, Sergio

2015-09-01

Labdane-related diterpenoids are natural products with potential pharmaceutical applications that are rarely found in bacteria. Here, a putative class I labdane-related diterpene synthase (LrdC) identified by genome mining in a streptomycete was successfully crystallized using the microbatch method. Crystals of the LrdC enzyme were obtained in a holo form with its natural cofactor Mg(2+) (LrdC-Mg(2+)) and in complex with inorganic pyrophosphate (PPi) (LrdC-Mg(2+)-PPi). Crystals of native LrdC-Mg(2+) diffracted to 2.50 Å resolution and belonged to the trigonal space group P3221, with unit-cell parameters a = b = 107.1, c = 89.2 Å. Crystals of the LrdC-Mg(2+)-PPi complex grown in the same conditions as the native enzyme with PEG 8000 diffracted to 2.36 Å resolution and also belonged to the trigonal space group P3221. Crystals of the LrdC-Mg(2+)-PPi complex grown in a second crystallization condition with PEG 3350 diffracted to 2.57 Å resolution and belonged to the monoclinic space group P21, with unit-cell parameters a = 49.9, b = 104.1, c = 66.5 Å, β = 111.4°. The structure was determined by the single-wavelength anomalous dispersion (SAD) technique using the osmium signal from a potassium hexachloroosmate (IV) derivative.

High resolution synchrotron X-radiation diffraction imaging of crystals grown in microgravity and closely related terrestrial crystals

NASA Technical Reports Server (NTRS)

Steiner, Bruce; Dobbyn, Ronald C.; Black, David; Burdette, Harold; Kuriyama, Masao; Fripp, Archibald; Simchik, Richard

1991-01-01

Irregularities in three crystals grown in space and in four terrestrial crystals grown under otherwise comparable conditions have been observed in high resolution diffraction imaging. The images provide important new clues to the nature and origins of irregularities in each crystal. For two of the materials, mercuric iodide and lead tin telluride, more than one phase (an array of non-diffracting inclusions) was observed in terrestrial samples; but the formation of these multiple phases appears to have been suppressed in directly comparable crystals grown in microgravity. The terrestrial seed crystal of triglycine sulfate displayed an unexpected layered structure, which propagated during directly comparable space growth. Terrestrial Bridgman regrowth of gallium arsenide revealed a mesoscopic structure substantially different from that of the original Czochralski material. A directly comparable crystal is to be grown shortly in space.

Dynamical effects in Bragg coherent x-ray diffraction imaging of finite crystals

NASA Astrophysics Data System (ADS)

Shabalin, A. G.; Yefanov, O. M.; Nosik, V. L.; Bushuev, V. A.; Vartanyants, I. A.

2017-08-01

We present simulations of Bragg coherent x-ray diffractive imaging (CXDI) data from finite crystals in the frame of the dynamical theory of x-ray diffraction. The developed approach is based on a numerical solution of modified Takagi-Taupin equations and can be applied for modeling of a broad range of x-ray diffraction experiments with finite three-dimensional crystals of arbitrary shape also in the presence of strain. We performed simulations for nanocrystals of a cubic and hemispherical shape of different sizes and provided a detailed analysis of artifacts in the Bragg CXDI reconstructions introduced by the dynamical diffraction. Based on our theoretical analysis we developed an analytical procedure to treat effects of refraction and absorption in the reconstruction. Our results elucidate limitations for the kinematical approach in the Bragg CXDI and suggest a natural criterion to distinguish between kinematical and dynamical cases in coherent x-ray diffraction on a finite crystal.

Rietveld analysis using powder diffraction data with anomalous scattering effect obtained by focused beam flat sample method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, Masahiko, E-mail: masahiko@spring8.or.jp; Katsuya, Yoshio, E-mail: katsuya@spring8.or.jp; Sakata, Osami, E-mail: SAKATA.Osami@nims.go.jp

2016-07-27

Focused-beam flat-sample method (FFM) is a new trial for synchrotron powder diffraction method, which is a combination of beam focusing optics, flat shape powder sample and area detectors. The method has advantages for X-ray diffraction experiments applying anomalous scattering effect (anomalous diffraction), because of 1. Absorption correction without approximation, 2. High intensity X-rays of focused incident beams and high signal noise ratio of diffracted X-rays 3. Rapid data collection with area detectors. We applied the FFM to anomalous diffraction experiments and collected synchrotron X-ray powder diffraction data of CoFe{sub 2}O{sub 4} (inverse spinel structure) using X-rays near Fe K absorptionmore » edge, which can distinguish Co and Fe by anomalous scattering effect. We conducted Rietveld analyses with the obtained powder diffraction data and successfully determined the distribution of Co and Fe ions in CoFe{sub 2}O{sub 4} crystal structure.« less

Room-temperature serial crystallography using a kinetically optimized microfluidic device for protein crystallization and on-chip X-ray diffraction

PubMed Central

Heymann, Michael; Opthalage, Achini; Wierman, Jennifer L.; Akella, Sathish; Szebenyi, Doletha M. E.; Gruner, Sol M.; Fraden, Seth

2014-01-01

An emulsion-based serial crystallographic technology has been developed, in which nanolitre-sized droplets of protein solution are encapsulated in oil and stabilized by surfactant. Once the first crystal in a drop is nucleated, the small volume generates a negative feedback mechanism that lowers the supersaturation. This mechanism is exploited to produce one crystal per drop. Diffraction data are measured, one crystal at a time, from a series of room-temperature crystals stored on an X-ray semi-transparent microfluidic chip, and a 93% complete data set is obtained by merging single diffraction frames taken from different unoriented crystals. As proof of concept, the structure of glucose isomerase was solved to 2.1 Å, demonstrating the feasibility of high-throughput serial X-ray crystallography using synchrotron radiation. PMID:25295176

Crystal structures of carbonates up to Mbar pressures determined by single crystal synchrotron radiation diffraction

NASA Astrophysics Data System (ADS)

Merlini, M.

2013-12-01

The recent improvements at synchrotron beamlines, currently allow single crystal diffraction experiments at extreme pressures and temperatures [1,2] on very small single crystal domains. We successfully applied such technique to determine the crystal structure adopted by carbonates at mantle pressures. The knowledge of carbon-bearing phases is in fact fundamental for any quantitative modelling of global carbon cycle. The major technical difficulty arises after first order transitions or decomposition reactions, since original crystal (apx. 10x10x5 μm3) is transformed in much smaller crystalline domains often with random orientation. The use of 3D reciprocal space visualization software and the improved resolution of new generation flat panel detectors, however, allow both identification and integration of each single crystal domain, with suitable accuracy for ab-initio structure solution, performed with direct and charge-flipping methods and successive structure refinements. The results obtained on carbonates, indicate two major crystal-chemistry trends established at high pressures. The CO32- units, planar and parallel in ambient pressure calcite and dolomite structures, becomes non parallel in calcite- and dolomite-II and III phases, allowing more flexibility in the structures with possibility to accommodate strain arising from different cation sizes (Ca and Mg in particular). Dolomite-III is therefore also observed to be thermodynamically stable at lower mantle pressures and temperatures, differently from dolomite, which undergoes decomposition into pure end-members in upper mantle. At higher pressure, towards Mbar (lowermost mantle and D'' region) in agreement with theoretical calculations [3,4] and other experimental results [5], carbon coordination transform into 4-fold CO4 units, with different polymerisation in the structure depending on carbonate composition. The second important crystal chemistry feature detected is related to Fe2+ in Fe

Crystal structure of human tooth enamel studied by neutron diffraction

NASA Astrophysics Data System (ADS)

Ouladdiaf, Bachir; Rodriguez-Carvajal, Juan; Goutaudier, Christelle; Ouladdiaf, Selma; Grosgogeat, Brigitte; Pradelle, Nelly; Colon, Pierre

2015-02-01

Crystal structure of human tooth enamel was investigated using high-resolution neutron powder diffraction. Excellent agreement between observed and refined patterns is obtained, using the hexagonal hydroxyapatite model for the tooth enamel, where a large hydroxyl deficiency ˜70% is found in the 4e site. Rietveld refinements method combined with the difference Fourier maps have revealed, however, that the hydroxyl ions are not only disordered along the c-axis but also within the basal plane. Additional H ions located at the 6h site and forming HPO42- anions were found.

Comparative Analysis of Thaumatin Crystals Grown on Earth and in Microgravity. Experiment 23

NASA Technical Reports Server (NTRS)

Ng, Joseph D.; Lorber, Bernard; Giege, Richard; Koszelak, Stanley; Day, John; Greenwood, Aaron; McPherson, Alexander

1998-01-01

The protein thaumatin was studied as a model macromolecule for crystallization in microgravity environment experiments conducted on two U.S. Space Shuttle missions (second United States Microgravity Laboratory (USML-2) and Life and Microgravity Spacelab (LMS)). In this investigation we evaluated and compared the quality of space- and Earth-grown thaumatin crystals using x-ray diffraction analysis and characterized them according to crystal size, diffraction resolution limit, and mosaicity. Two different approaches for growing thaumatin crystals in the microgravity environment, dialysis and liquid-liquid diffusion, were employed as a joint experiment by our two investigative teams. Thaumatin crystals grown under a microgravity environment were generally larger in volume with fewer total crystals. They diffracted to significantly higher resolution and with improved diffraction properties as judged by relative Wilson plots. The mosaicity for space-grown crystals was significantly less than for those grown on Earth. Increasing concentrations of protein in the crystallization chambers under microgravity lead to larger crystals. The data presented here lend further support to the idea that protein crystals of improved quality can be obtained in a microgravity environment.

Measuring the x-ray resolving power of bent potassium acid phthalate diffraction crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haugh, M. J., E-mail: haughmj@nv.doe.gov; Jacoby, K. D.; Wu, M.

2014-11-15

This report presents the results from measuring the X-ray resolving power of a curved potassium acid phthalate (KAP(001)) spectrometer crystal using two independent methods. It is part of a continuing effort to measure the fundamental diffraction properties of bent crystals that are used to study various characteristics of high temperature plasmas. Bent crystals like KAP(001) do not usually have the same diffraction properties as corresponding flat crystals. Models that do exist to calculate the effect of bending the crystal on the diffraction properties have simplifying assumptions and their accuracy limits have not been adequately determined. The type of crystals thatmore » we measured is being used in a spectrometer on the Z machine at Sandia National Laboratories in Albuquerque, New Mexico. The first technique for measuring the crystal resolving power measures the X-ray spectral line width of the characteristic lines from several metal anodes. The second method uses a diode X-ray source and a double crystal diffractometer arrangement to measure the reflectivity curve of the KAP(001) crystal. The width of that curve is inversely proportional to the crystal resolving power. The measurement results are analyzed and discussed.« less

Effect of leucine-to-methionine substitutions on the diffraction quality of histone chaperone SET/TAF-Ibeta/INHAT crystals.

PubMed

Senda, Miki; Muto, Shinsuke; Horikoshi, Masami; Senda, Toshiya

2008-10-01

One of the most frequent problems in crystallization is poor quality of the crystals. In order to overcome this obstacle several methods have been utilized, including amino-acid substitutions of the target protein. Here, an example is presented of crystal-quality improvement by leucine-to-methionine substitutions. A variant protein with three amino-acid substitutions enabled improvement of the crystal quality of the histone chaperone SET/TAF-Ibeta/INHAT when combined with optimization of the cryoconditions. This procedure improved the resolution of the SET/TAF-Ibeta/INHAT crystals from around 5.5 to 2.3 A without changing the crystallization conditions.

Generation of Protein Crystals Using a Solution-Stirring Technique

NASA Astrophysics Data System (ADS)

Adachi, Hiroaki; Niino, Ai; Matsumura, Hiroyoshi; Takano, Kazufumi; Kinoshita, Takayoshi; Warizaya, Masaichi; Inoue, Tsuyoshi; Mori, Yusuke; Sasaki, Takatomo

2004-06-01

Crystals of bovine adenosine deaminase (ADA) were grown over a two week period in the presence of an inhibitor, whereas ADA crystals did not form using conventional crystallization methods when the inhibitor was excluded. To obtain ADA crystals in the absence of the inhibitor, a solution-stirring technique was used. The crystals obtained using this technique were found to be of high quality and were shown to have high structural resolution for X-ray diffraction analysis. The results of this study indicate that the stirring technique is a useful method for obtaining crystals of proteins that do not crystallize using conventional techniques.

A phase-stepped point diffraction interferometer using liquid crystals

NASA Technical Reports Server (NTRS)

Mercer, Carolyn R.; Creath, Katherine; Rashidnia, Nasser

1995-01-01

A new instrument, the liquid crystal point diffraction interferometer (LCPDI), has been developed for the measurement of phase objects. This instrument maintains the compact, robust design of Linnik's point diffraction interferometer (PDI) and adds to it phase stepping capability for quantitative interferogram analysis. The result is a compact, simple to align, environmentally insensitive interferometer capable of accurately measuring optical wavefronts with high data density and with automated data reduction. The design of the LCPDI is briefly discussed. An algorithm is presented for eliminating phase measurement error caused by object beam intensity variation from frame-to-frame. The LCPDI is demonstrated by measuring the temperature distribution across a heated chamber filled with silicone oil. The measured results are compared to independently measured results and show excellent agreement with them. It is expected that this instrument will have application in the fluid sciences as a diagnostic tool, particularly in space based applications where autonomy, robustness, and compactness are desirable qualities. It should also be useful for the testing of optical elements, provided a master is available for comparison.

Crystallization and preliminary X-ray diffraction studies of the ferredoxin reductase component in the Rieske nonhaem iron oxygenase system carbazole 1,9a-dioxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ashikawa, Yuji; Uchimura, Hiromasa; Fujimoto, Zui

2007-06-01

The NAD(P)H:ferredoxin oxidoreductase in carbazole 1,9a-dioxygenase from Janthinobacterium sp. J3 was crystallized and diffraction data were collected to 2.60 Å resolution. Carbazole 1,9a-dioxygenase (CARDO), which consists of an oxygenase component (CARDO-O) and the electron-transport components ferredoxin (CARDO-F) and ferredoxin reductase (CARDO-R), catalyzes dihydroxylation at the C1 and C9a positions of carbazole. CARDO-R was crystallized at 277 K using the hanging-drop vapour-diffusion method with the precipitant PEG 8000. Two crystal types (types I and II) were obtained. The type I crystal diffracted to a maximum resolution of 2.80 Å and belonged to space group P4{sub 2}2{sub 1}2, with unit-cell parameters amore » = b = 158.7, c = 81.4 Å. The type II crystal was obtained in drops from which type I crystals had been removed; it diffracted to 2.60 Å resolution and belonged to the same space group, with unit-cell parameters a = b = 161.8, c = 79.5 Å.« less

Measuring the X-ray Resolving Power of Bent Potassium Acid Phthalate Diffraction Crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haugh, M. J.; Wu, M.; Jacoby, K. D.

2014-11-01

This report presents the results from measuring the X-ray resolving power of a curved potassium acid phthalate (KAP(001)) spectrometer crystal using two independent methods. It is part of a continuing effort to measure the fundamental diffraction properties of bent crystals that are used to study various characteristics of high temperature plasmas. Bent crystals like KAP(001) do not usually have the same diffraction properties as corresponding flat crystals. Models that do exist to calculate the effect of bending the crystal on the diffraction properties have simplifying assumptions and their accuracy limits have not been adequately determined. The type of crystals thatmore » we measured is being used in a spectrometer on the Z machine at Sandia National Laboratories (SNL) in Albuquerque, NM. The first technique for measuring the crystal resolving power measures the X-ray spectral line width of the characteristic lines from several metal anodes. The second method uses a diode X-ray source and a dual goniometer arrangement to measure the reflectivity curve of the KAP(001) crystal. The width of that curve is inversely proportional to the crystal resolving power. The measurement results are analyzed and discussed.« less

High resolution diffraction imaging of crystals grown in microgravity and closely related terrestrial crystals

NASA Technical Reports Server (NTRS)

Steiner, B.; Dobbyn, R.; Black, D.; Burdette, H.; Kuriyama, M.; Spal, R.; Vandenberg, L.; Fripp, A.; Simchick, R.; Lal, R.

1991-01-01

Irregularities found in three crystals grown in space, in four crystals grown entirely on the ground were examined and compared. Irregularities were observed in mercuric iodide, lead tin telluride, triglycine sulfate, and gallium arsenide by high resolution synchrotron x radiation diffraction imaging. Radiation detectors made from mercuric iodide crystals grown in microgravity were reported to perform far better than conventional detectors grown from the same material under full gravity. Effort is now underway to reproduce these 'space' crystals, optimize their properties, and extend comparable superiority to other types of materials.

Trapezoidal diffraction grating beam splitters in single crystal diamond

NASA Astrophysics Data System (ADS)

Kiss, Marcell; Graziosi, Teodoro; Quack, Niels

2018-02-01

Single Crystal Diamond has been recognized as a prime material for optical components in high power applications due to low absorption and high thermal conductivity. However, diamond microstructuring remains challenging. Here, we report on the fabrication and characterization of optical diffraction gratings exhibiting a symmetric trapezoidal profile etched into a single crystal diamond substrate. The optimized grating geometry diffracts the transmitted optical power into precisely defined proportions, performing as an effective beam splitter. We fabricate our gratings in commercially available single crystal CVD diamond plates (2.6mm x 2.6mm x 0.3mm). Using a sputter deposited hard mask and patterning by contact lithography, the diamond is etched in an inductively coupled oxygen plasma with zero platen power. The etch process effectively reveals the characteristic {111} diamond crystal planes, creating a precisely defined angled (54.7°) profile. SEM and AFM measurements of the fabricated gratings evidence the trapezoidal shape with a pitch of 3.82μm, depth of 170 nm and duty cycle of 35.5%. Optical characterization is performed in transmission using a 650nm laser source perpendicular to the sample. The recorded transmitted optical power as function of detector rotation angle shows a distribution of 21.1% in the 0th order and 23.6% in each +/-1st order (16.1% reflected, 16.6% in higher orders). To our knowledge, this is the first demonstration of diffraction gratings with trapezoidal profile in single crystal diamond. The fabrication process will enable beam splitter gratings of custom defined optical power distribution profiles, while antireflection coatings can increase the efficiency.

Crystallization and preliminary X-ray diffraction analysis of mouse 3(17)α-hydroxysteroid dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

El-Kabbani, Ossama, E-mail: ossama.el-kabbani@vcp.monash.edu.au; Ishikura, Syuhei; Wagner, Armin

2005-07-01

Orthorhombic crystals of mouse 3(17)α-hydroxysteroid dehydrogenase were obtained from buffered polyethylene glycol solutions. The crystals diffracted to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA. The 3(17)α-hydroxysteroid dehydrogenase from mouse is involved in the metabolism of oestrogens, androgens, neurosteroids and xenobiotic compounds. The enzyme was crystallized by the hanging-drop vapour-diffusion method in space group P222{sub 1}, with unit-cell parameters a = 84.91, b = 84.90, c = 95.83 Å. The Matthews coefficient (V{sub M}) and the solvent content were 2.21 Å{sup 3} Da{sup −1} and 44.6%, respectively, assuming the presence of two molecules in the asymmetricmore » unit. Diffraction data were collected to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA using a MAR CCD area detector and gave a data set with an overall R{sub merge} of 6.8% and a completeness of 91.1%.« less

Diffractive-refractive optics: (+,-,-,+) X-ray crystal monochromator with harmonics separation.

PubMed

Hrdý, Jaromír; Mikulík, Petr; Oberta, Peter

2011-03-01

A new kind of two channel-cut crystals X-ray monochromator in dispersive (+,-,-,+) position which spatially separates harmonics is proposed. The diffracting surfaces are oriented so that the diffraction is inclined. Owing to refraction the diffracted beam is sagittally deviated. The deviation depends on wavelength and is much higher for the first harmonics than for higher harmonics. This leads to spatial harmonics separation. The idea is supported by ray-tracing simulation.

Radiation damage in a micron-sized protein crystal studied via reciprocal space mapping and Bragg coherent diffractive imaging.

PubMed

Coughlan, H D; Darmanin, C; Phillips, N W; Hofmann, F; Clark, J N; Harder, R J; Vine, D J; Abbey, B

2015-07-01

For laboratory and synchrotron based X-ray sources, radiation damage has posed a significant barrier to obtaining high-resolution structural data from biological macromolecules. The problem is particularly acute for micron-sized crystals where the weaker signal often necessitates the use of higher intensity beams to obtain the relevant data. Here, we employ a combination of techniques, including Bragg coherent diffractive imaging to characterise the radiation induced damage in a micron-sized protein crystal over time. The approach we adopt here could help screen for potential protein crystal candidates for measurement at X-ray free election laser sources.

Radiation damage in a micron-sized protein crystal studied via reciprocal space mapping and Bragg coherent diffractive imaging

PubMed Central

Coughlan, H. D.; Darmanin, C.; Phillips, N. W.; Hofmann, F.; Clark, J. N.; Harder, R. J.; Vine, D. J.; Abbey, B.

2015-01-01

For laboratory and synchrotron based X-ray sources, radiation damage has posed a significant barrier to obtaining high-resolution structural data from biological macromolecules. The problem is particularly acute for micron-sized crystals where the weaker signal often necessitates the use of higher intensity beams to obtain the relevant data. Here, we employ a combination of techniques, including Bragg coherent diffractive imaging to characterise the radiation induced damage in a micron-sized protein crystal over time. The approach we adopt here could help screen for potential protein crystal candidates for measurement at X-ray free election laser sources. PMID:26798804

Radiation damage in a micron-sized protein crystal studied via reciprocal space mapping and Bragg coherent diffractive imaging

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coughlan, H. D.; Darmanin, C.; Phillips, N. W.

For laboratory and synchrotron based X-ray sources, radiation damage has posed a significant barrier to obtaining high-resolution structural data from biological macromolecules. The problem is particularly acute for micron-sized crystals where the weaker signal often necessitates the use of higher intensity beams to obtain the relevant data. Here, we employ a combination of techniques, including Bragg coherent diffractive imaging to characterise the radiation induced damage in a micron-sized protein crystal over time. The approach we adopt here could help screen for potential protein crystal candidates for measurement at X-ray free election laser sources.

Radiation damage in a micron-sized protein crystal studied via reciprocal space mapping and Bragg coherent diffractive imaging

DOE PAGES

Coughlan, H. D.; Darmanin, C.; Phillips, N. W.; ...

2015-04-29

For laboratory and synchrotron based X-ray sources, radiation damage has posed a significant barrier to obtaining high-resolution structural data from biological macromolecules. The problem is particularly acute for micron-sized crystals where the weaker signal often necessitates the use of higher intensity beams to obtain the relevant data. Here, we employ a combination of techniques, including Bragg coherent diffractive imaging to characterise the radiation induced damage in a micron-sized protein crystal over time. The approach we adopt here could help screen for potential protein crystal candidates for measurement at X-ray free election laser sources.

The Question of Impurities in Macromolecule Crystal Quality Improvement in Microgravity

NASA Technical Reports Server (NTRS)

Judge, Russell A.; Snell, Edward H.; Pusey, Marc L.; Sportiello, Michael G.; Todd, Paul; Bellamy, Henry; Borgstahl, Gloria E.; Pokros, Matthew; Cassanto, John M.

2000-01-01

While macromolecule impurities may affect crystal size and morphology the over-riding question is how do macromolecule impurities effect crystal X-ray quality and diffraction resolution. In the case of chicken egg white lysozyme previous researchers have reported that crystals grown in the presence of ovalbumin, ovotransferrin, and turkey egg white lysozyme show no difference in diffraction resolution compared to those grown in pure solutions. One impurity however, a naturally occurring lysozyme dimer, does negatively impact the X-ray crystal properties. For this impurity it has been reported that crystal quality improvement in microgravity may be due to improved impurity partitioning during crystallization. In this study we have examined the incorporation of the dimer into lysozyme crystals, both on the ground and in microgravity experiments, and have performed detailed X-ray analysis of the crystals using a new technique for finely probing the mosaicity of the crystal at the Stanford Synchrotron Radiation Laboratory. Dimer partitioning was not significantly different in microgravity compared to the ground based experiments, although it is significantly better than that previously reported in microgravity. Mosaicity analysis of pure crystals, 1422 indexed reflections (microgravity) and 752 indexed reflections (ground), gave average results of 0.0066 and 0.0092 degrees (FWHM) respectively. The microgravity crystals also provided an increased signal to noise. Dimer incorporation increased the average mosaicity in microgravity but not on the ground. However, dimer incorporation did greatly reduce the resolution limit in both ground and microgravity grown crystals. The data is being treated anisotropically to explore these effects. These results indicate that impurity effects in microgravity are complex and that the conditions or techniques employed may greatly affect the role of impurities.

Monochromatic X-ray sources based on a mechanism of real and virtual photon diffraction in crystals

NASA Astrophysics Data System (ADS)

Wagner, A. R.; Kuznetsov, S. I.; Potylitsyn, A. P.; Razin, S. V.; Uglov, S. R.; Zabaev, V. N.

2008-09-01

A source of monochromatic X-ray radiation is wanted in industry, science, medicine and so on. Many ways of making such a source are known. The present work describes two mechanisms for the creation of a monochromatic X-ray beam, which are parametric X-ray radiation (PXR) and bremsstrahlung diffraction (DBS). Both the experiments were carried out using an electron beam at a microtron. During the first experiment, the DBS process was investigated as a scattering of the Bremsstrahlung (BS) beam on the crystallographic surfaces of tungsten and pyrolytic graphite crystals. The second experiment consisted in the registration of the PXR and DBS yield during the passage of the electrons through the same crystals as in the first experiment. The spectral and orientation radiation characteristics and simulation results obtained for the DBS and PXR processes are presented. It is shown that the usage of mosaic crystalline targets is rather useful in order to obtain a monochromatic X-ray source based on bremsstrahlung diffraction from moderately relativistic electrons.

High Pressure Single Crystal Diffraction at PX 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Dongzhou; Dera, Przemyslaw K.; Eng, Peter J.

2017-01-01

In this report, we describe detailed procedures for carrying out single crystal X-ray diffraction experiments with a diamond anvil cell at the GSECARS 13-BM-C beamline at the Advanced Photon Source. ATREX and RSV programs are used to analyze the data.

Crystallization and preliminary X-ray diffraction analysis of West Nile virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaufmann, Barbel; Plevka, Pavel; Kuhn, Richard J.

2010-05-25

West Nile virus, a human pathogen, is closely related to other medically important flaviviruses of global impact such as dengue virus. The infectious virus was purified from cell culture using polyethylene glycol (PEG) precipitation and density-gradient centrifugation. Thin amorphously shaped crystals of the lipid-enveloped virus were grown in quartz capillaries equilibrated by vapor diffusion. Crystal diffraction extended at best to a resolution of about 25 {angstrom} using synchrotron radiation. A preliminary analysis of the diffraction images indicated that the crystals had unit-cell parameters a {approx_equal} b {approx_equal} 480 {angstrom}, {gamma} = 120{sup o}, suggesting a tight hexagonal packing of onemore » virus particle per unit cell.« less

Optical Anisotropy of Photonic Crystals of Cubic Symmetry Induced by Multiple Diffraction of Light

NASA Astrophysics Data System (ADS)

Ukleev, T. A.; Shevchenko, N. N.; Iurasova, D. I.; Sel'kin, A. V.

2018-05-01

The optical spectra of Bragg reflection from opal-like photonic crystals under conditions of the resonant enhancement of the multiple diffraction of light have been studied experimentally and theoretically using the photonic crystal structures prepared of monodisperse polystyrene globules. It is shown that the reflection signal registered in mutually orthogonal configurations of the polarizer and analyzer is related to the intrinsic optical anisotropy of the crystals and is a specific manifestation of the multiple Bragg diffraction in three-dimensional photonic crystals.

Study of structural and optical properties of YAG and Nd:YAG single crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kostić, S.; Lazarević, Z.Ž., E-mail: lzorica@yahoo.com; Radojević, V.

2015-03-15

Highlights: • Transparent YAG and pale pink Nd:YAG single crystals were produced by the Czochralski technique. • Growth mechanisms and shape of the liquid/solid interface and incorporation of Nd{sup 3+} were studied. • The structure of the crystals was investigated by X-ray diffraction, Raman and IR spectroscopy. • The 15 Raman and 17 IR modes were observed. • The obtained YAG and Nd:YAG single crystals were without core and of good optical quality. - Abstract: Yttrium aluminum garnet (YAG, Y{sub 3}Al{sub 5}O{sub 12}) and yttrium aluminum garnet doped with neodymium (Nd:YAG) single crystals were grown by the Czochralski technique. Themore » critical diameter and the critical rate of rotation were calculated. Suitable polishing and etching solutions were determined. As a result of our experiments, the transparent YAG and pale pink Nd:YAG single crystals were produced. The obtained crystals were studied by X-ray diffraction, Raman and IR spectroscopy. The crystal structure was confirmed by XRD. The 15 Raman and 17 IR modes were observed. The Raman and IR spectroscopy results are in accordance with X-ray diffraction analysis. The obtained YAG and Nd:YAG single crystals were without core and of good optical quality. The absence of a core was confirmed by viewing polished crystal slices. Also, it is important to emphasize that the obtained Nd:YAG single crystal has a concentration of 0.8 wt.% Nd{sup 3+} that is characteristic for laser materials.« less

Crystal Structure of Hydrazinium Iodide by Neutron Diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Campbell, Eric V.; Wang, Xiaoping; Miller, Joel S.

The structure of hydrazinium iodide, [H 5N 2] +·I -, at 100 K has monoclinic (P2 1/n) symmetry from single crystal neutron diffraction with a = 7.4599(7) Å, b = 5.3185(6) Å, c = 10.1628(11) Å, β = 103.150(10)°, V = 392.64(7) Å 3, Z = 4. The refinement converged to R = 0.0575, wR 2 = 0.1602, S = 1.022. Data for the crystal structure was collected on the SNS TOPAZ single-crystal time-of-flight Laue diffractometer. The compound has a one-dimensional structure which displays N–H···N hydrogen bonding. Finally, accurate intra- and intermolecular N–H distances have been determined.

Crystal Structure of Hydrazinium Iodide by Neutron Diffraction

DOE PAGES

Campbell, Eric V.; Wang, Xiaoping; Miller, Joel S.

2017-10-31

The structure of hydrazinium iodide, [H 5N 2] +·I -, at 100 K has monoclinic (P2 1/n) symmetry from single crystal neutron diffraction with a = 7.4599(7) Å, b = 5.3185(6) Å, c = 10.1628(11) Å, β = 103.150(10)°, V = 392.64(7) Å 3, Z = 4. The refinement converged to R = 0.0575, wR 2 = 0.1602, S = 1.022. Data for the crystal structure was collected on the SNS TOPAZ single-crystal time-of-flight Laue diffractometer. The compound has a one-dimensional structure which displays N–H···N hydrogen bonding. Finally, accurate intra- and intermolecular N–H distances have been determined.

Observing the overall rocking motion of a protein in a crystal

NASA Astrophysics Data System (ADS)

Ma, Peixiang; Xue, Yi; Coquelle, Nicolas; Haller, Jens D.; Yuwen, Tairan; Ayala, Isabel; Mikhailovskii, Oleg; Willbold, Dieter; Colletier, Jacques-Philippe; Skrynnikov, Nikolai R.; Schanda, Paul

2015-10-01

The large majority of three-dimensional structures of biological macromolecules have been determined by X-ray diffraction of crystalline samples. High-resolution structure determination crucially depends on the homogeneity of the protein crystal. Overall `rocking' motion of molecules in the crystal is expected to influence diffraction quality, and such motion may therefore affect the process of solving crystal structures. Yet, so far overall molecular motion has not directly been observed in protein crystals, and the timescale of such dynamics remains unclear. Here we use solid-state NMR, X-ray diffraction methods and μs-long molecular dynamics simulations to directly characterize the rigid-body motion of a protein in different crystal forms. For ubiquitin crystals investigated in this study we determine the range of possible correlation times of rocking motion, 0.1-100 μs. The amplitude of rocking varies from one crystal form to another and is correlated with the resolution obtainable in X-ray diffraction experiments.

Purification, crystallization and preliminary X-ray diffraction analysis of GatD, a glutamine amidotransferase-like protein from Staphylococcus aureus peptidoglycan

PubMed Central

Vieira, Diana; Figueiredo, Teresa A.; Verma, Anil; Sobral, Rita G.; Ludovice, Ana M.; de Lencastre, Hermínia; Trincao, Jose

2014-01-01

Amidation of peptidoglycan is an essential feature in Staphylococcus aureus that is necessary for resistance to β-lactams and lysozyme. GatD, a 27 kDa type I glutamine amidotransferase-like protein, together with MurT ligase, catalyses the amidation reaction of the glutamic acid residues of the peptidoglycan of S. aureus. The native and the selenomethionine-derivative proteins were crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol, sodium acetate and calcium acetate. The crystals obtained diffracted beyond 1.85 and 2.25 Å, respectively, and belonged to space group P212121. X-ray diffraction data sets were collected at Diamond Light Source (on beamlines I02 and I04) and were used to obtain initial phases. PMID:24817726

Characterization of CuCl quantum dots grown in NaCl single crystals via optical measurements, X-ray diffraction, and transmission electron microscopy

NASA Astrophysics Data System (ADS)

Miyajima, Kensuke; Akatsu, Tatsuro; Itoh, Ken

2018-05-01

We evaluated the crystal size, shape, and alignment of the lattice planes of CuCl quantum dots (QDs) embedded in NaCl single crystals by optical measurements, X-ray diffraction (XRD) patterns, and transmission electron microscopy (TEM). We obtained, for the first time, an XRD pattern and TEM images for CuCl QDs in NaCl crystals. The XRD pattern showed that the lattice planes of the CuCl QDs were parallel to those of the NaCl crystals. In addition, the size of the QDs was estimated from the diffraction width. It was apparent from the TEM images that almost all CuCl QDs were polygonal, although some cubic QDs were present. The mean size and size distribution of the QDs were also obtained. The dot size obtained from optical measurements, XRD, and TEM image were almost consistent. Our new findings can help to reveal the growth mechanism of semiconductor QDs embedded in a crystallite matrix. In addition, this work will play an important role in progressing the study of optical phenomena originating from assembled semiconductor QDs.

In situ neutron diffraction study of twin reorientation and pseudoplastic strain in Ni-Mn-Ga single crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stoica, Alexandru Dan

2011-01-01

Twin variant reorientation in single-crystal Ni-Mn-Ga during quasi-static mechanical compression was studied using in situ neutron diffraction. The volume fraction of reoriented twin variants for different stress amplitudes were obtained from the changes in integrated intensities of high-order neutron diffraction peaks. It is shown that, during compressive loading, {approx}85% of the twins were reoriented parallel to the loading direction resulting in a maximum pseudoplasticstrain of {approx}5.5%, which is in agreement with measured macroscopic strain.

Calculations of single crystal elastic constants for yttria partially stabilised zirconia from powder diffraction data

NASA Astrophysics Data System (ADS)

Lunt, A. J. G.; Xie, M. Y.; Baimpas, N.; Zhang, S. Y.; Kabra, S.; Kelleher, J.; Neo, T. K.; Korsunsky, A. M.

2014-08-01

Yttria Stabilised Zirconia (YSZ) is a tough, phase-transforming ceramic that finds use in a wide range of commercial applications from dental prostheses to thermal barrier coatings. Micromechanical modelling of phase transformation can deliver reliable predictions in terms of the influence of temperature and stress. However, models must rely on the accurate knowledge of single crystal elastic stiffness constants. Some techniques for elastic stiffness determination are well-established. The most popular of these involve exploiting frequency shifts and phase velocities of acoustic waves. However, the application of these techniques to YSZ can be problematic due to the micro-twinning observed in larger crystals. Here, we propose an alternative approach based on selective elastic strain sampling (e.g., by diffraction) of grain ensembles sharing certain orientation, and the prediction of the same quantities by polycrystalline modelling, for example, the Reuss or Voigt average. The inverse problem arises consisting of adjusting the single crystal stiffness matrix to match the polycrystal predictions to observations. In the present model-matching study, we sought to determine the single crystal stiffness matrix of tetragonal YSZ using the results of time-of-flight neutron diffraction obtained from an in situ compression experiment and Finite Element modelling of the deformation of polycrystalline tetragonal YSZ. The best match between the model predictions and observations was obtained for the optimized stiffness values of C11 = 451, C33 = 302, C44 = 39, C66 = 82, C12 = 240, and C13 = 50 (units: GPa). Considering the significant amount of scatter in the published literature data, our result appears reasonably consistent.

X-ray plane-wave diffraction effects in a crystal with third-order nonlinearity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balyan, M. K., E-mail: mbalyan@ysu.am

The two-wave dynamical diffraction in the Laue geometry has been theoretically considered for a plane X-ray wave in a crystal with a third-order nonlinear response to the external field. An analytical solution to the problem stated is found for certain diffraction conditions. A nonlinear pendulum effect is analyzed. The nonlinear extinction length is found to depend on the incident-wave intensity. A pendulum effect of a new type is revealed: the intensities of the transmitted and diffracted waves periodically depend on the incidentwave intensity at a fixed crystal thickness. The rocking curves and Borrmann nonlinear effect are numerically calculated.

Observation of divergent-beam X-ray diffraction from a crystal of diamond using synchrotron radiation.

PubMed

Glazer, A M; Collins, S P; Zekria, D; Liu, J; Golshan, M

2004-03-01

In 1947 Kathleen Lonsdale conducted a series of experiments on X-ray diffraction using a divergent beam external to a crystal sample. Unlike the Kossel technique, where divergent X-rays are excited by the presence of fluorescing atoms within the crystal, the use of an external divergent source made it possible to study non-fluorescing crystals. The resulting photographs not only illustrated the complexity of X-ray diffraction from crystals in a truly beautiful way, but also demonstrated unprecedented experimental precision. This long-forgotten work is repeated here using a synchrotron radiation source and, once again, considerable merit is found in Lonsdale's technique. The results of this experiment suggest that, through the use of modern 'third-generation' synchrotron sources, divergent-beam diffraction could soon enjoy a renaissance for high-precision lattice-parameter determination and the study of crystal perfection.

Three-dimensional reconstruction of the size and shape of protein microcrystals using Bragg coherent diffractive imaging

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coughlan, H. D.; Darmanin, C.; Kirkwood, H. J.

2016-03-14

Three-dimensional imaging of protein crystals during X-ray diffraction experiments opens up a range of possibilities for optimising crystal quality and gaining new insights into the fundamental processes that drive radiation damage. Obtaining this information at the appropriate lengthscales however is extremely challenging. One approach that has been recently demonstrated as a promising avenue for charactering the size and shape of protein crystals at nanometre lengthscales is Bragg Coherent Diffractive Imaging (BCDI). BCDI is a recently developed technique that is able to recover the phase of the continuous diffraction intensity signal around individual Bragg peaks. When data is collected at multiplemore » points on a rocking curve a Reciprocal Space Map (RSM) can be assembled and then inverted using BCDI to obtain a three-dimensional image of the crystal. The first demonstration of two-dimensional BCDI of protein crystals was reported by Boutet at al., recently this work was extended to the study of radiation damage of micron-sized crystals. Here we present the first three-dimensional reconstructions of a Lysozyme protein crystal using BDI. The results are validated against RSM and TEM data and have implications for both radiation damage studies and for developing new approaches to structure retrieval from micron-sized protein crystals.« less

Diffraction and imaging study of imperfections of crystallized lysozyme with coherent X-rays

NASA Technical Reports Server (NTRS)

Hu, Z. W.; Chu, Y. S.; Lai, B.; Thomas, B. R.; Chernov, A. A.

2004-01-01

Phase-contrast X-ray diffraction imaging and high-angular-resolution diffraction combined with phase-contrast radiographic imaging were employed to characterize defects and perfection of a uniformly grown tetragonal lysozyme crystal in the symmetric Laue case. The full-width at half-maximum (FWHM) of a 4 4 0 rocking curve measured from the original crystal was approximately 16.7 arcsec and imperfections including line defects, inclusions and other microdefects were observed in the diffraction images of the crystal. The observed line defects carry distinct dislocation features running approximately along the <1 1 0> growth front and have been found to originate mostly in a central growth area and occasionally in outer growth regions. Inclusions of impurities or formations of foreign particles in the central growth region are resolved in the images with high sensitivity to defects. Slow dehydration led to the broadening of a fairly symmetric 4 4 0 rocking curve by a factor of approximately 2.6, which was primarily attributed to the dehydration-induced microscopic effects that are clearly shown in X-ray diffraction images. The details of the observed defects and the significant change in the revealed microstructures with drying provide insight into the nature of imperfections, nucleation and growth, and the properties of protein crystals.

Growth of high quality and large-sized Rb 0.3MoO 3 single crystals by molten salt electrolysis method

NASA Astrophysics Data System (ADS)

Wang, Junfeng; Xiong, Rui; Yi, Fan; Yin, Di; Ke, Manzhu; Li, Changzhen; Liu, Zhengyou; Shi, Jing

2005-05-01

High quality and large-sized Rb 0.3MoO 3 single crystals were synthesized by molten salt electrolysis method. X-ray diffraction (XRD) patterns and rocking curves, as well as the white beam Laue diffraction of X-ray images show the crystals grown by this method have high quality. The lattice constants evaluated from XRD patterns are a0=1.87 nm, b0=0.75 nm, c0=1.00 nm, β=118.83∘. The in situ selected area electron diffraction (SAED) patterns along the [101¯], [11¯1¯] and [103¯] zone axes at room temperature indicate that the Rb 0.3MoO 3 crystal possess perfect C-centered symmetry. Temperature dependence of the resistivity shows this compound undergoes a metal to semiconductor transition at 183 K.

Image processing for grazing incidence fast atom diffraction

NASA Astrophysics Data System (ADS)

Debiossac, Maxime; Roncin, Philippe

2016-09-01

Grazing incidence fast atom diffraction (GIFAD, or FAD) has developed as a surface sensitive technique. Compared with thermal energies helium diffraction (TEAS or HAS), GIFAD is less sensitive to thermal decoherence but also more demanding in terms of surface coherence, the mean distance between defects. Such high quality surfaces can be obtained from freshly cleaved crystals or in a molecular beam epitaxy (MBE) chamber where a GIFAD setup has been installed allowing in situ operation. Based on recent publications by Atkinson et al. (2014) and Debiossac et al. (2014), the paper describes in detail the basic steps needed to measure the relative intensities of the diffraction spots. Care is taken to outline the underlying physical assumptions.

Yes, one can obtain better quality structures from routine X-ray data collection.

PubMed

Sanjuan-Szklarz, W Fabiola; Hoser, Anna A; Gutmann, Matthias; Madsen, Anders Østergaard; Woźniak, Krzysztof

2016-01-01

Single-crystal X-ray diffraction structural results for benzidine dihydrochloride, hydrated and protonated N,N,N,N-peri(dimethylamino)naphthalene chloride, triptycene, dichlorodimethyltriptycene and decamethylferrocene have been analysed. A critical discussion of the dependence of structural and thermal parameters on resolution for these compounds is presented. Results of refinements against X-ray data, cut off to different resolutions from the high-resolution data files, are compared to structural models derived from neutron diffraction experiments. The Independent Atom Model (IAM) and the Transferable Aspherical Atom Model (TAAM) are tested. The average differences between the X-ray and neutron structural parameters (with the exception of valence angles defined by H atoms) decrease with the increasing 2θmax angle. The scale of differences between X-ray and neutron geometrical parameters can be significantly reduced when data are collected to the higher, than commonly used, 2θmax diffraction angles (for Mo Kα 2θmax > 65°). The final structural and thermal parameters obtained for the studied compounds using TAAM refinement are in better agreement with the neutron values than the IAM results for all resolutions and all compounds. By using TAAM, it is still possible to obtain accurate results even from low-resolution X-ray data. This is particularly important as TAAM is easy to apply and can routinely be used to improve the quality of structural investigations [Dominiak (2015 ▸). LSDB from UBDB. University of Buffalo, USA]. We can recommend that, in order to obtain more adequate (more accurate and precise) structural and displacement parameters during the IAM model refinement, data should be collected up to the larger diffraction angles, at least, for Mo Kα radiation to 2θmax = 65° (sin θmax/λ < 0.75 Å(-1)). The TAAM approach is a very good option to obtain more adequate results even using data collected to the lower 2θmax angles. Also

Correlation between protein sequence similarity and x-ray diffraction quality in the protein data bank.

PubMed

Lu, Hui-Meng; Yin, Da-Chuan; Ye, Ya-Jing; Luo, Hui-Min; Geng, Li-Qiang; Li, Hai-Sheng; Guo, Wei-Hong; Shang, Peng

2009-01-01

As the most widely utilized technique to determine the 3-dimensional structure of protein molecules, X-ray crystallography can provide structure of the highest resolution among the developed techniques. The resolution obtained via X-ray crystallography is known to be influenced by many factors, such as the crystal quality, diffraction techniques, and X-ray sources, etc. In this paper, the authors found that the protein sequence could also be one of the factors. We extracted information of the resolution and the sequence of proteins from the Protein Data Bank (PDB), classified the proteins into different clusters according to the sequence similarity, and statistically analyzed the relationship between the sequence similarity and the best resolution obtained. The results showed that there was a pronounced correlation between the sequence similarity and the obtained resolution. These results indicate that protein structure itself is one variable that may affect resolution when X-ray crystallography is used.

Purification, crystallization and preliminary X-ray diffraction studies of D-tagatose 3-epimerase from Pseudomonas cichorii.

PubMed

Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro

2007-02-01

D-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of D-psicose has not been reported with epimerases other than P. cichorii D-TE and D-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 A, beta = 102.82 degrees . Diffraction data were collected to 2.5 A resolution. The asymmetric unit is expected to contain four molecules.

Increasing reconstruction quality of diffractive optical elements displayed with LC SLM

NASA Astrophysics Data System (ADS)

Cheremkhin, Pavel A.; Evtikhiev, Nikolay N.; Krasnov, Vitaly V.; Rodin, Vladislav G.; Starikov, Sergey N.

2015-03-01

Phase liquid crystal (LC) spatial light modulators (SLM) are actively used in various applications. However, majority of scientific applications require stable phase modulation which might be hard to achieve with commercially available SLM due to its consumer origin. The use of digital voltage addressing scheme leads to phase temporal fluctuations, which results in lower diffraction efficiency and reconstruction quality of displayed diffractive optical elements (DOE). Due to high periodicity of fluctuations it should be possible to use knowledge of these fluctuations during DOE synthesis to minimize negative effect. We synthesized DOE using accurately measured phase fluctuations of phase LC SLM "HoloEye PLUTO VIS" to minimize its negative impact on displayed DOE reconstruction. Synthesis was conducted with versatile direct search with random trajectory (DSRT) method in the following way. Before DOE synthesis begun, two-dimensional dependency of SLM phase shift on addressed signal level and time from frame start was obtained. Then synthesis begins. First, initial phase distribution is created. Second, random trajectory of consecutive processing of all DOE elements is generated. Then iterative process begins. Each DOE element sequentially has its value changed to one that provides better value of objective criterion, e.g. lower deviation of reconstructed image from original one. If current element value provides best objective criterion value then it left unchanged. After all elements are processed, iteration repeats until stagnation is reached. It is demonstrated that application of SLM phase fluctuations knowledge in DOE synthesis with DSRT method leads to noticeable increase of DOE reconstruction quality.

A Low Voltage Liquid Crystal Phase Grating with Switchable Diffraction Angles

PubMed Central

Chen, Haiwei; Tan, Guanjun; Huang, Yuge; Weng, Yishi; Choi, Tae-Hoon; Yoon, Tae-Hoon; Wu, Shin-Tson

2017-01-01

We demonstrate a simple yet high performance phase grating with switchable diffraction angles using a fringe field switching (FFS) liquid crystal (LC) cell. The LC rubbing angle is parallel to the FFS electrodes (i.e. α = 0°), leading to symmetric LC director distribution in a voltage-on state. Such a grating exhibits three unique features: 1) Two grating periods can be formed by controlling the applied voltage, resulting in switchable diffraction angles. In our design, the 1st diffraction order occurs at 4.3°, while the 2nd order appears at 8.6°. 2) The required voltage to achieve peak diffraction efficiency (η~32%) for the 1st order is only 4.4 V at λ = 633 nm as compared to 70 V for a conventional FFS-based phase grating in which α ≈ 7°, while the 2nd order (η~27%) is 15 V. 3). The measured rise and decay time for the 1st order is 7.62 ms and 6.75 ms, and for the 2nd order is 0.75 ms and 3.87 ms, respectively. To understand the physical mechanisms, we also perform device simulations. Good agreement between experiment and simulation is obtained. PMID:28054592

Crystallization screening test for the whole-cell project on Thermus thermophilus HB8

PubMed Central

Iino, Hitoshi; Naitow, Hisashi; Nakamura, Yuki; Nakagawa, Noriko; Agari, Yoshihiro; Kanagawa, Mayumi; Ebihara, Akio; Shinkai, Akeo; Sugahara, Mitsuaki; Miyano, Masashi; Kamiya, Nobuo; Yokoyama, Shigeyuki; Hirotsu, Ken; Kuramitsu, Seiki

2008-01-01

It was essential for the structural genomics of Thermus thermophilus HB8 to efficiently crystallize a number of proteins. To this end, three conventional robots, an HTS-80 (sitting-drop vapour diffusion), a Crystal Finder (hanging-drop vapour diffusion) and a TERA (modified microbatch) robot, were subjected to a crystallization condition screening test involving 18 proteins from T. thermophilus HB8. In addition, a TOPAZ (microfluidic free-interface diffusion) designed specifically for initial screening was also briefly examined. The number of diffraction-quality crystals and the time of appearance of crystals increased in the order HTS-80, Crystal Finder, TERA. With the HTS-80 and Crystal Finder, the time of appearance was short and the rate of salt crystallization was low. With the TERA, the number of diffraction-quality crystals was high, while the time of appearance was long and the rate of salt crystallization was relatively high. For the protein samples exhibiting low crystallization success rates, there were few crystallization conditions that were common to the robots used. In some cases, the success rate depended greatly on the robot used. The TOPAZ showed the shortest time of appearance and the highest success rate, although the crystals obtained were too small for diffraction studies. These results showed that the combined use of different robots significantly increases the chance of obtaining crystals, especially for proteins exhibiting low crystallization success rates. The structures of 360 of 944 purified proteins have been successfully determined through the combined use of an HTS-80 and a TERA. PMID:18540056

Liquid-Crystal Point-Diffraction Interferometer for Wave-Front Measurements

NASA Technical Reports Server (NTRS)

Mercer, Carolyn R.; Creath, Katherine

1996-01-01

A new instrument, the liquid-crystal point-diffraction interferometer (LCPDI), is developed for the measurement of phase objects. This instrument maintains the compact, robust design of Linnik's point-diffraction interferometer and adds to it a phase-stepping capability for quantitative interferogram analysis. The result is a compact, simple to align, environmentally insensitive interferometer capable of accurately measuring optical wave fronts with very high data density and with automated data reduction. We describe the theory and design of the LCPDI. A focus shift was measured with the LCPDI, and the results are compared with theoretical results,

Femtosecond time-resolved MeV electron diffraction

DOE PAGES

Zhu, Pengfei; Zhu, Y.; Hidaka, Y.; ...

2015-06-02

We report the experimental demonstration of femtosecond electron diffraction using high-brightness MeV electron beams. High-quality, single-shot electron diffraction patterns for both polycrystalline aluminum and single-crystal 1T-TaS 2 are obtained utilizing a 5 fC (~3 × 10 4 electrons) pulse of electrons at 2.8 MeV. The high quality of the electron diffraction patterns confirms that electron beam has a normalized emittance of ~50 nm rad. The transverse and longitudinal coherence length is ~11 and ~2.5 nm, respectively. The timing jitter between the pump laser and probe electron beam was found to be ~100 fs (rms). The temporal resolution is demonstrated bymore » observing the evolution of Bragg and superlattice peaks of 1T-TaS 2 following an 800 nm optical pump and was found to be 130 fs. Lastly, our results demonstrate the advantages of MeV electrons, including large elastic differential scattering cross-section and access to high-order reflections, and the feasibility of ultimately realizing below 10 fs time-resolved electron diffraction.« less

Crystallization and initial X-ray diffraction studies of scaffolding protein (gp7) of bacteriophage ϕ29

DOE Office of Scientific and Technical Information (OSTI.GOV)

Badasso, Mohammed O., E-mail: badas001@umn.edu; Anderson, Dwight L.; Department of Oral Science, University of Minnesota, Minneapolis, MN 55455

2005-04-01

ϕ29 bacteriophage scaffolding protein (gp7) has been overproduced in E. coli, purified, crystallized and characterized by X-ray diffraction. Two distinct crystal forms were obtained and a diffraction data set was collected to 1.8 Å resolution. The Bacillus subtilis bacteriophage ϕ29 scaffolding protein (gp7) has been crystallized by the hanging-drop vapour-diffusion method at 293 K. Two new distinct crystal forms that both differed from a previously crystallized and solved scaffolding protein were grown under the same conditions. Form I belongs to the primitive tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 77.13, c = 37.12 Å.more » Form II crystals exhibit an orthorhombic crystal form, with space group C222 and unit-cell parameters a = 107.50, b = 107. 80, c = 37.34 Å. Complete data sets have been collected to 1.78 and 1.80 Å for forms I and II, respectively, at 100 K using Cu Kα X-rays from a rotating-anode generator. Calculation of a V{sub M} value of 2.46 Å{sup 3} Da{sup −1} for form I suggests the presence of one molecule in the asymmetric unit, corresponding to a solvent content of 50.90%, whereas form II has a V{sub M} of 4.80 Å{sup 3} Da{sup −1} with a solvent content of 48.76% and two molecules in the asymmetric unit. The structures of both crystal forms are being determined by the molecular-replacement method using the coordinates of the published crystal structure of gp7.« less

Multi-level diffractive optics for single laser exposure fabrication of telecom-band diamond-like 3-dimensional photonic crystals.

PubMed

Chanda, Debashis; Abolghasemi, Ladan E; Haque, Moez; Ng, Mi Li; Herman, Peter R

2008-09-29

We present a novel multi-level diffractive optical element for diffractive optic near-field lithography based fabrication of large-area diamond-like photonic crystal structure in a single laser exposure step. A multi-level single-surface phase element was laser fabricated on a thin polymer film by two-photon polymerization. A quarter-period phase shift was designed into the phase elements to generate a 3D periodic intensity distribution of double basis diamond-like structure. Finite difference time domain calculation of near-field diffraction patterns and associated isointensity surfaces are corroborated by definitive demonstration of a diamond-like woodpile structure formed inside thick photoresist. A large number of layers provided a strong stopband in the telecom band that matched predictions of numerical band calculation. SEM and spectral observations indicate good structural uniformity over large exposure area that promises 3D photonic crystal devices with high optical quality for a wide range of motif shapes and symmetries. Optical sensing is demonstrated by spectral shifts of the Gamma-Zeta stopband under liquid emersion.

Structural analysis of bacteriophage-encoded peptidoglycan hydrolase domain KMV36C: crystallization and preliminary X-ray diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van Hecke, Kristof, E-mail: kristof.vanhecke@chem.kuleuven.be; Briers, Yves; Derua, Rita

2008-04-01

Crystallization and X-ray data collection of the C-terminus of gp36 from bacteriophage ϕKMV (KMV36C) are reported. The C-terminus of gp36 of bacteriophage ϕKMV (KMV36C) functions as a particle-associated muramidase, presumably as part of the injection needle of the ϕKMV genome during infection. Crystals of KMV36C were obtained by hanging-drop vapour diffusion and diffracted to a resolution of 1.6 Å. The crystals belong to the cubic space group P432, with unit-cell parameters a = b = c = 102.52 Å. KMV36C shows 30% sequence identity to T4 lysozyme (PDB code)

Calculations of single crystal elastic constants for yttria partially stabilised zirconia from powder diffraction data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lunt, A. J. G., E-mail: alexander.lunt@eng.ox.ac.uk; Xie, M. Y.; Baimpas, N.

2014-08-07

Yttria Stabilised Zirconia (YSZ) is a tough, phase-transforming ceramic that finds use in a wide range of commercial applications from dental prostheses to thermal barrier coatings. Micromechanical modelling of phase transformation can deliver reliable predictions in terms of the influence of temperature and stress. However, models must rely on the accurate knowledge of single crystal elastic stiffness constants. Some techniques for elastic stiffness determination are well-established. The most popular of these involve exploiting frequency shifts and phase velocities of acoustic waves. However, the application of these techniques to YSZ can be problematic due to the micro-twinning observed in larger crystals.more » Here, we propose an alternative approach based on selective elastic strain sampling (e.g., by diffraction) of grain ensembles sharing certain orientation, and the prediction of the same quantities by polycrystalline modelling, for example, the Reuss or Voigt average. The inverse problem arises consisting of adjusting the single crystal stiffness matrix to match the polycrystal predictions to observations. In the present model-matching study, we sought to determine the single crystal stiffness matrix of tetragonal YSZ using the results of time-of-flight neutron diffraction obtained from an in situ compression experiment and Finite Element modelling of the deformation of polycrystalline tetragonal YSZ. The best match between the model predictions and observations was obtained for the optimized stiffness values of C11 = 451, C33 = 302, C44 = 39, C66 = 82, C12 = 240, and C13 = 50 (units: GPa). Considering the significant amount of scatter in the published literature data, our result appears reasonably consistent.« less

Expression, crystallization and preliminary X-ray diffraction studies of recombinant Clostridium perfringens β2-toxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gurjar, Abhijit A.; Yennawar, Neela H.; Yennawar, Hemant P.

2007-06-01

The cloning, expression, purification and crystallization of recombinant Clostridium perfringens β2-toxin is described. The crystals diffracted to 2.9 Å resolution. Clostridium perfringens is a Gram-positive sporulating anaerobic bacterium that is responsible for a wide spectrum of diseases in animals, birds and humans. The virulence of C. perfringens is associated with the production of several enterotoxins and exotoxins. β2-toxin is a 28 kDa exotoxin produced by C. perfringens. It is implicated in necrotic enteritis in animals and humans, a disease characterized by a sudden acute onset with lethal hemorrhagic mucosal ulceration. The recombinant expression, purification and crystallization of β2-toxin using themore » batch-under-oil technique are reported here. Native X-ray diffraction data were obtained to 2.9 Å resolution on a synchrotron beamline at the F2 station at Cornell High Energy Synchrotron Source (CHESS) using an ADSC Quantum-210 CCD detector. The crystals belong to space group R3, with a dimer in the asymmetric unit; the unit-cell parameters are a = b = 103.71, c = 193.48 Å, α = β = 90, γ = 120° using the hexagonal axis setting. A self-rotation function shows that the two molecules are related by a noncrystallographic twofold axis with polar angles ω = 90.0, ϕ = 210.3°.« less

Anisotropic light diffraction in crystals with a large acoustic-energy walk-off

NASA Astrophysics Data System (ADS)

Balakshy, V. I.; Voloshin, A. S.; Molchanov, V. Ya.

2014-11-01

The influence of energy walk-off in an acoustic beam on the characteristic of anisotropic Bragg diffraction of light has been investigated by the example of paratellurite crystal. The angular and frequency characteristics of acousto-optic diffraction have been calculated in wide ranges of ultrasound frequencies and Bragg angles using the modified Raman-Nath equations. It is shown that the walk-off of an acoustic beam may change (either widen or narrow) significantly the frequency and angular ranges. The calculation results have been experimentally checked on an acousto-optic cell made of 10.5°-cut paratellurite crystal.

Liquid crystal devices especially for use in liquid crystal point diffraction interferometer systems

NASA Technical Reports Server (NTRS)

Marshall, Kenneth L. (Inventor)

2009-01-01

Liquid crystal point diffraction interferometer (LCPDI) systems that can provide real-time, phase-shifting interferograms that are useful in the characterization of static optical properties (wavefront aberrations, lensing, or wedge) in optical elements or dynamic, time-resolved events (temperature fluctuations and gradients, motion) in physical systems use improved LCPDI cells that employ a "structured" substrate or substrates in which the structural features are produced by thin film deposition or photo resist processing to provide a diffractive element that is an integral part of the cell substrate(s). The LC material used in the device may be doped with a "contrast-compensated" mixture of positive and negative dichroic dyes.

Liquid crystal devices especially for use in liquid crystal point diffraction interferometer systems

DOEpatents

Marshall, Kenneth L [Rochester, NY

2009-02-17

Liquid crystal point diffraction interferometer (LCPDI) systems that can provide real-time, phase-shifting interferograms that are useful in the characterization of static optical properties (wavefront aberrations, lensing, or wedge) in optical elements or dynamic, time-resolved events (temperature fluctuations and gradients, motion) in physical systems use improved LCPDI cells that employ a "structured" substrate or substrates in which the structural features are produced by thin film deposition or photo resist processing to provide a diffractive element that is an integral part of the cell substrate(s). The LC material used in the device may be doped with a "contrast-compensated" mixture of positive and negative dichroic dyes.

High-throughput crystallization screening.

PubMed

Skarina, Tatiana; Xu, Xiaohui; Evdokimova, Elena; Savchenko, Alexei

2014-01-01

Protein structure determination by X-ray crystallography is dependent on obtaining a single protein crystal suitable for diffraction data collection. Due to this requirement, protein crystallization represents a key step in protein structure determination. The conditions for protein crystallization have to be determined empirically for each protein, making this step also a bottleneck in the structure determination process. Typical protein crystallization practice involves parallel setup and monitoring of a considerable number of individual protein crystallization experiments (also called crystallization trials). In these trials the aliquots of purified protein are mixed with a range of solutions composed of a precipitating agent, buffer, and sometimes an additive that have been previously successful in prompting protein crystallization. The individual chemical conditions in which a particular protein shows signs of crystallization are used as a starting point for further crystallization experiments. The goal is optimizing the formation of individual protein crystals of sufficient size and quality to make them suitable for diffraction data collection. Thus the composition of the primary crystallization screen is critical for successful crystallization.Systematic analysis of crystallization experiments carried out on several hundred proteins as part of large-scale structural genomics efforts allowed the optimization of the protein crystallization protocol and identification of a minimal set of 96 crystallization solutions (the "TRAP" screen) that, in our experience, led to crystallization of the maximum number of proteins.

High-quality bulk hybrid perovskite single crystals within minutes by inverse temperature crystallization

NASA Astrophysics Data System (ADS)

Saidaminov, Makhsud I.; Abdelhady, Ahmed L.; Murali, Banavoth; Alarousu, Erkki; Burlakov, Victor M.; Peng, Wei; Dursun, Ibrahim; Wang, Lingfei; He, Yao; Maculan, Giacomo; Goriely, Alain; Wu, Tom; Mohammed, Omar F.; Bakr, Osman M.

2015-07-01

Single crystals of methylammonium lead trihalide perovskites (MAPbX3; MA=CH3NH3+, X=Br- or I-) have shown remarkably low trap density and charge transport properties; however, growth of such high-quality semiconductors is a time-consuming process. Here we present a rapid crystal growth process to obtain MAPbX3 single crystals, an order of magnitude faster than previous reports. The process is based on our observation of the substantial decrease of MAPbX3 solubility, in certain solvents, at elevated temperatures. The crystals can be both size- and shape-controlled by manipulating the different crystallization parameters. Despite the rapidity of the method, the grown crystals exhibit transport properties and trap densities comparable to the highest quality MAPbX3 reported to date. The phenomenon of inverse or retrograde solubility and its correlated inverse temperature crystallization strategy present a major step forward for advancing the field on perovskite crystallization.

Single crystal X-ray diffraction study of the HgBa2CuO4+δ superconducting compound

NASA Astrophysics Data System (ADS)

Bordet, P.; Duc, F.; Lefloch, S.; Capponi, J. J.; Alexandre, E.; Rosa-Nunes, M.; Antipov, E. V.; Putilin, S.

1996-02-01

A high precision X-ray diffraction analysis up to sin θ/λ = 1.15 of a HgBa2CuO4+δ single crystal having a Tc of ~ 90 K is presented. The cell parameters are a = 3.8815(4), c = 9.485 (7) Å. The refinements indicate the existence of a split barium site due to the presence of excess oxygen in the mercury layer. The position of this excess oxygen might be slightly displaced from the (1/2 1/2 0) position. A 6% mercury deficiency is observed. Models, including mercury defects, substitution by copper cations, or carbonate groups, are compared. However, we obtain no definite evidence for either of the three models. A possible disorder of the Hg position, due to the formation of chemical bonds with neighbouring extra oxygen anions, could correlate to the refinements of mixed species at the Hg site. A low temperature single crystal x-ray diffraction study, and comparison of refinements for the same single crystal with different extra oxygen contents, are in progress to help clarify this problem.

Preparation and Analysis of RNA Crystals

NASA Technical Reports Server (NTRS)

Todd, Paul

2000-01-01

The crystallization of RiboNucleic Acids (RNA) was studied from the standpoint of mechanisms of crystal growth in three tasks: (1) preparation of high-quality crystals of oligonuclotides for X-ray diffraction, (2) finding pathways to the growth of high-quality crystals for X-ray diffraction and (3) investigation of mechanisms of action of inertial acceleration on crystal growth. In these tasks: (1) RNA crystals were prepared and studied by X-ray diffraction; (2) a pathway to high-quality crystals was discovered and characterized; a combination of kinetic and equilibrium factors could be optimized as described below; and (3) an interplay between purity and gravity was found in a combination of space and ground experiments with nucleic acids and proteins. Most significantly, the rate of concentration of precipitant and RNA can be controlled by membrane-based methods of water removal or by diffusion of multivalent cations across an interface stabilized by a membrane. Oligonucleotide solutions are electrokinetically stabilized colloids, and crystals can form by the controlled addition of multivalent cations.

Purification, crystallization and preliminary diffraction studies of an ectromelia virus glutaredoxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bacik, John-Paul; Brigley, Angela M.; Channon, Lisa D.

2005-06-01

Ectromelia virus glutaredoxin has been crystallized in the presence of the reducing agent DTT. A diffraction data set has been collected and processed to 1.8 Å resolution. Ectromelia, vaccinia, smallpox and other closely related viruses of the orthopoxvirus genus encode a glutaredoxin gene that is not present in poxviruses outside of this genus. The vaccinia glutaredoxin O2L has been implicated as the reducing agent for ribonucleotide reductase and may thus play an important role in viral deoxyribonucleotide synthesis. As part of an effort to understand nucleotide metabolism by poxviruses, EVM053, the O2L ortholog of the ectromelia virus, has been crystallized.more » EVM053 crystallizes in space group C222{sub 1}, with unit-cell parameters a = 61.98, b = 67.57, c = 108.55 Å. Diffraction data have been processed to 1.8 Å resolution and a self-rotation function indicates that there are two molecules per asymmetric unit.« less

Magnetic Control of Convection during Protein Crystallization

NASA Technical Reports Server (NTRS)

Ramachandran, N.; Leslie, F. W.

2004-01-01

An important component in biotechnology, particularly in the area of protein engineering and rational drug design is the knowledge of the precise three-dimensional molecular structure of proteins. The quality of structural information obtained from X-ray diffraction methods is directly dependent on the degree of perfection of the protein crystals. As a consequence, the growth of high quality macromolecular Crystals for diffraction analyses has been the central focus for bio-chemists, biologists, and bioengineers. Macromolecular crystals are obtained from solutions that contain the crystallizing species in equilibrium with higher aggregates, ions, precipitants, other possible phases of the protein, foreign particles, the walls of container, and a likely host of other impurities. By changing transport modes in general, i.e., reduction of convection and Sedimentation as is achieved in "microgravity", we have been able to dramatically affect the movement and distribution of macromolecules in the fluid, and thus their transport, f o d o n of crystal nuclei, and adsorption to the crystal surface. While a limited number of high quality crystals from space flights have been obtained, as the recent National Research Council (NRC) review of the NASA microgravity crystallization program pointed out, the scientific approach and research in crystallization of proteins has been mainly empirical yielding inconclusive results. We postulate that we can reduce convection in ground-based experiments and we can understand the different aspects of convection control through the use of strong magnetic fields and field gradients. We postulate that limited convection in a magnetic field will provide the environment for the growth of high quality crystals. The approach exploits the variation of fluid magnetic susceptibility with counteracts on for this purpose and the convective damping is realized by appropriately positioning the crystal growth cell so that the magnetic susceptibility

Purification, crystallization and preliminary X-ray diffraction experiment of nattokinase from Bacillus subtilis natto.

PubMed

Yanagisawa, Yasuhide; Chatake, Toshiyuki; Chiba-Kamoshida, Kaori; Naito, Sawa; Ohsugi, Tadanori; Sumi, Hiroyuki; Yasuda, Ichiro; Morimoto, Yukio

2010-12-01

Nattokinase is a single polypeptide chain composed of 275 amino acids (molecular weight 27,724) which displays strong fibrinolytic activity. Moreover, it can activate other fibrinolytic enzymes such as pro-urokinase and tissue plasminogen activator. In the present study, native nattokinase from Bacillus subtilis natto was purified using gel-filtration chromatography and crystallized to give needle-like crystals which could be used for X-ray diffraction experiments. The crystals belonged to space group C2, with unit-cell parameters a=74.3, b=49.9, c=56.3 Å, β=95.2°. Diffraction images were processed to a resolution of 1.74 Å with an Rmerge of 5.2% (15.3% in the highest resolution shell) and a completeness of 69.8% (30.0% in the highest resolution shell). This study reports the first X-ray diffraction analysis of nattokinase.

Crystallization and x-ray diffraction analysis of a putative bacterial class I labdane-related diterpene synthase [Crysallization and preliminary x-ray diffraction analysis of a bacterial class I labdane-related diterpene synthase

DOE PAGES

Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia; ...

2015-08-25

Here, labdane-related diterpenoids are natural products with potential pharmaceutical applications that are rarely found in bacteria. Here, a putative class I labdane-related diterpene synthase (LrdC) identified by genome mining in a streptomycete was successfully crystallized using the microbatch method. Crystals of the LrdC enzyme were obtained in a holo form with its natural cofactor Mg 2+ (LrdC-Mg 2+) and in complex with inorganic pyrophosphate (PP i) (LrdC-Mg 2+–PP i). Crystals of native LrdC-Mg 2+ diffracted to 2.50 Å resolution and belonged to the trigonal space group P3 221, with unit-cell parameters a = b = 107.1, c = 89.2 Å.more » Crystals of the LrdC-Mg 2+–PP i complex grown in the same conditions as the native enzyme with PEG 8000 diffracted to 2.36 Å resolution and also belonged to the trigonal space group P3 221. Crystals of the LrdC-Mg 2+–PP i complex grown in a second crystallization condition with PEG 3350 diffracted to 2.57 Å resolution and belonged to the monoclinic space group P2 1, with unit-cell parameters a = 49.9, b = 104.1, c = 66.5 Å, β = 111.4°. The structure was determined by the single-wavelength anomalous dispersion (SAD) technique using the osmium signal from a potassium hexachloroosmate (IV) derivative.« less

Purification, crystallization and preliminary X-ray diffraction studies of d-tagatose 3-epimerase from Pseudomonas cichorii

PubMed Central

Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro

2007-01-01

d-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of d-­psicose has not been reported with epimerases other than P. cichorii D-­TE and d-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P21, with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 Å, β = 102.82°. Diffraction data were collected to 2.5 Å resolution. The asymmetric unit is expected to contain four molecules. PMID:17277456

The use of a mini-κ goniometer head in macromolecular crystallography diffraction experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brockhauser, Sandor; UJF–EMBL–CNRS UMI 3265, 6 Rue Jules Horowitz, 38043 Grenoble; Ravelli, Raimond B. G.

2013-07-01

Hardware and software solutions for MX data-collection strategies using the EMBL/ESRF miniaturized multi-axis goniometer head are presented. Most macromolecular crystallography (MX) diffraction experiments at synchrotrons use a single-axis goniometer. This markedly contrasts with small-molecule crystallography, in which the majority of the diffraction data are collected using multi-axis goniometers. A novel miniaturized κ-goniometer head, the MK3, has been developed to allow macromolecular crystals to be aligned. It is available on the majority of the structural biology beamlines at the ESRF, as well as elsewhere. In addition, the Strategy for the Alignment of Crystals (STAC) software package has been developed to facilitatemore » the use of the MK3 and other similar devices. Use of the MK3 and STAC is streamlined by their incorporation into online analysis tools such as EDNA. The current use of STAC and MK3 on the MX beamlines at the ESRF is discussed. It is shown that the alignment of macromolecular crystals can result in improved diffraction data quality compared with data obtained from randomly aligned crystals.« less

Quantitative performance of a polarization diffraction grating polarimeter encoded onto two liquid-crystal-on-silicon displays

NASA Astrophysics Data System (ADS)

Cofré, Aarón; Vargas, Asticio; Torres-Ruiz, Fabián A.; Campos, Juan; Lizana, Angel; del Mar Sánchez-López, María; Moreno, Ignacio

2017-11-01

We present a quantitative analysis of the performance of a complete snapshot polarimeter based on a polarization diffraction grating (PDGr). The PDGr is generated in a common path polarization interferometer with a Z optical architecture that uses two liquid-crystal on silicon (LCoS) displays to imprint two different phase-only diffraction gratings onto two orthogonal linear states of polarization. As a result, we obtain a programmable PDGr capable to act as a simultaneous polarization state generator (PSG), yielding diffraction orders with different states of polarization. The same system is also shown to operate as a polarization state analyzer (PSA), therefore useful for the realization of a snapshot polarimeter. We analyze its performance using quantitative metrics such as the conditional number, and verify its reliability for the detection of states of polarization.

Lab-on-a-Chip Based Protein Crystallization

NASA Technical Reports Server (NTRS)

vanderWoerd, Mark J.; Brasseur, Michael M.; Spearing, Scott F.; Whitaker, Ann F. (Technical Monitor)

2001-01-01

We are developing a novel technique with which we will grow protein crystals in very small volumes, utilizing chip-based, microfluidic ("LabChip") technology. This development, which is a collaborative effort between NASA's Marshall Space Flight Center and Caliper Technologies Corporation, promises a breakthrough in the field of protein crystal growth. Our initial results obtained from two model proteins, Lysozyme and Thaumatin, show that it is feasible to dispense and adequately mix protein and precipitant solutions on a nano-liter scale. The mixtures have shown crystal growth in volumes in the range of 10 nanoliters to 5 microliters. In addition, large diffraction quality crystals were obtained by this method. X-ray data from these crystals were shown to be of excellent quality. Our future efforts will include the further development of protein crystal growth with LabChip(trademark) technology for more complex systems. We will initially address the batch growth method, followed by the vapor diffusion method and the liquid-liquid diffusion method. The culmination of these chip developments is to lead to an on orbit protein crystallization facility on the International Space Station. Structural biologists will be invited to utilize the on orbit Iterative Biological Crystallization facility to grow high quality macromolecular crystals in microgravity.

Membrane Protein Crystallization Using Laser Irradiation

NASA Astrophysics Data System (ADS)

Adachi, Hiroaki; Murakami, Satoshi; Niino, Ai; Matsumura, Hiroyoshi; Takano, Kazufumi; Inoue, Tsuyoshi; Mori, Yusuke; Yamaguchi, Akihito; Sasaki, Takatomo

2004-10-01

We demonstrate the crystallization of a membrane protein using femtosecond laser irradiation. This method, which we call the laser irradiated growth technique (LIGHT), is useful for producing AcrB crystals in a solution of low supersaturation range. LIGHT is characterized by reduced nucleation times. This feature is important for crystallizing membrane proteins because of their labile properties when solubilized as protein-detergent micelles. Using LIGHT, high-quality crystals of a membrane transporter protein, AcrB, were obtained. The resulting crystals were found to be of sufficiently high resolution for X-ray diffraction. The results reported here indicate that LIGHT is a powerful tool for membrane protein crystallization, as well as for the growth of soluble proteins.

Purification, crystallization and preliminary X-ray diffraction experiment of nattokinase from Bacillus subtilis natto

PubMed Central

Yanagisawa, Yasuhide; Chatake, Toshiyuki; Chiba-Kamoshida, Kaori; Naito, Sawa; Ohsugi, Tadanori; Sumi, Hiroyuki; Yasuda, Ichiro; Morimoto, Yukio

2010-01-01

Nattokinase is a single polypeptide chain composed of 275 amino acids (molecular weight 27 724) which displays strong fibrinolytic activity. Moreover, it can activate other fibrinolytic enzymes such as pro-urokinase and tissue plasminogen activator. In the present study, native nattokinase from Bacillus subtilis natto was purified using gel-filtration chromatography and crystallized to give needle-like crystals which could be used for X-ray diffraction experiments. The crystals belonged to space group C2, with unit-cell parameters a = 74.3, b = 49.9, c = 56.3 Å, β = 95.2°. Diffraction images were processed to a resolution of 1.74 Å with an R merge of 5.2% (15.3% in the highest resolution shell) and a completeness of 69.8% (30.0% in the highest resolution shell). This study reports the first X-ray diffraction analysis of nattokinase. PMID:21139221

3D coherent X-ray diffractive imaging of an Individual colloidal crystal grain

NASA Astrophysics Data System (ADS)

Shabalin, A.; Meijer, J.-M.; Sprung, M.; Petukhov, A. V.; Vartanyants, I. A.

Self-assembled colloidal crystals represent an important model system to study nucleation phenomena and solid-solid phase transitions. They are attractive for applications in photonics and sensorics. We present results of a coherent x-ray diffractive imaging experiment performed on a single colloidal crystal grain. The full three-dimensional (3D) reciprocal space map measured by an azimuthal rotational scan contained several orders of Bragg reflections together with the coherent interference signal between them. Applying the iterative phase retrieval approach, the 3D structure of the crystal grain was reconstructed and positions of individual colloidal particles were resolved. We identified an exact stacking sequence of hexagonal close-packed layers including planar and linear defects. Our results open up a breakthrough in applications of coherent x-ray diffraction for visualization of the inner 3D structure of different mesoscopic materials, such as photonic crystals. Present address: University of California - San Diego, USA.

Crystallization and diffraction analysis of [beta]-N-acetylhexosaminidase from Aspergillus oryzae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vanek, Ondrej; Brynd, Jirí; Hofbauerová, Katerina

2012-05-08

Fungal {beta}-N-acetylhexosaminidases are enzymes that are used in the chemoenzymatic synthesis of biologically interesting oligosaccharides. The enzyme from Aspergillus oryzae was produced and purified from its natural source and crystallized using the hanging-drop vapor-diffusion method. Diffraction data from two crystal forms (primitive monoclinic and primitive tetragonal) were collected to resolutions of 3.2 and 2.4 {angstrom}, respectively. Electrophoretic and quantitative N-terminal protein-sequencing analyses confirmed that the crystals are formed by a complete biologically active enzyme consisting of a glycosylated catalytic unit and a noncovalently attached propeptide.

Crystallization of the carboxy-terminal region of the bacteriophage T4 proximal long tail fibre protein gp34

DOE Office of Scientific and Technical Information (OSTI.GOV)

Granell, Meritxell; Namura, Mikiyoshi; Alvira, Sara

2014-06-19

The crystallization of three C-terminal fragments of the bacteriophage T4 protein gp34 is reported. Diffraction data have been obtained for three native crystal forms and two selenomethionine derivatives, one of which contained high-quality anomalous signal.

Crystallization and preliminary X-ray diffraction analysis of the periplasmic domain of the Escherichia coli aspartate receptor Tar and its complex with aspartate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mise, Takeshi; Matsunami, Hideyuki; Samatey, Fadel A.

The periplasmic domain of the E. coli aspartate receptor Tar was cloned, expressed, purified and crystallized with and without bound ligand. The crystals obtained diffracted to resolutions of 1.58 and 1.95 Å, respectively. The cell-surface receptor Tar mediates bacterial chemotaxis toward an attractant, aspartate (Asp), and away from a repellent, Ni{sup 2+}. To understand the molecular mechanisms underlying the induction of Tar activity by its ligands, the Escherichia coli Tar periplasmic domain with and without bound aspartate (Asp-Tar and apo-Tar, respectively) were each crystallized in two different forms. Using ammonium sulfate as a precipitant, crystals of apo-Tar1 and Asp-Tar1 weremore » grown and diffracted to resolutions of 2.10 and 2.40 Å, respectively. Alternatively, using sodium chloride as a precipitant, crystals of apo-Tar2 and Asp-Tar2 were grown and diffracted to resolutions of 1.95 and 1.58 Å, respectively. Crystals of apo-Tar1 and Asp-Tar1 adopted space group P4{sub 1}2{sub 1}2, while those of apo-Tar2 and Asp-Tar2 adopted space groups P2{sub 1}2{sub 1}2{sub 1} and C2, respectively.« less

Microseed matrix screening for optimization in protein crystallization: what have we learned?

PubMed

D'Arcy, Allan; Bergfors, Terese; Cowan-Jacob, Sandra W; Marsh, May

2014-09-01

Protein crystals obtained in initial screens typically require optimization before they are of X-ray diffraction quality. Seeding is one such optimization method. In classical seeding experiments, the seed crystals are put into new, albeit similar, conditions. The past decade has seen the emergence of an alternative seeding strategy: microseed matrix screening (MMS). In this strategy, the seed crystals are transferred into conditions unrelated to the seed source. Examples of MMS applications from in-house projects and the literature include the generation of multiple crystal forms and different space groups, better diffracting crystals and crystallization of previously uncrystallizable targets. MMS can be implemented robotically, making it a viable option for drug-discovery programs. In conclusion, MMS is a simple, time- and cost-efficient optimization method that is applicable to many recalcitrant crystallization problems.

Microseed matrix screening for optimization in protein crystallization: what have we learned?

PubMed Central

D’Arcy, Allan; Bergfors, Terese; Cowan-Jacob, Sandra W.; Marsh, May

2014-01-01

Protein crystals obtained in initial screens typically require optimization before they are of X-ray diffraction quality. Seeding is one such optimization method. In classical seeding experiments, the seed crystals are put into new, albeit similar, conditions. The past decade has seen the emergence of an alternative seeding strategy: microseed matrix screening (MMS). In this strategy, the seed crystals are transferred into conditions unrelated to the seed source. Examples of MMS applications from in-house projects and the literature include the generation of multiple crystal forms and different space groups, better diffracting crystals and crystallization of previously uncrystallizable targets. MMS can be implemented robotically, making it a viable option for drug-discovery programs. In conclusion, MMS is a simple, time- and cost-efficient optimization method that is applicable to many recalcitrant crystallization problems. PMID:25195878

Highly efficient acousto-optic diffraction in Sn2P2S6 crystals.

PubMed

Martynyuk-Lototska, I Yu; Mys, O G; Grabar, A A; Stoika, I M; Vysochanskii, Yu M; Vlokh, R O

2008-01-01

We have studied the acousto-optic (AO) diffraction in Sn2P2S6 crystals and found that they manifest high values of an AO figure of merit. The above crystals may therefore be used as highly efficient materials in different AO applications.

Preparation, crystallization and preliminary X-ray diffraction analysis of two intestinal fatty-acid binding proteins in the presence of 11-(dansylamino)undecanoic acid

PubMed Central

Laguerre, Aisha; Wielens, Jerome; Parker, Michael W.; Porter, Christopher J. H.; Scanlon, Martin J.

2011-01-01

Fatty-acid binding proteins (FABPs) are abundantly expressed proteins that bind a range of lipophilic molecules. They have been implicated in the import and intracellular distribution of their ligands and have been linked with metabolic and inflammatory responses in the cells in which they are expressed. Despite their high sequence identity, human intestinal FABP (hIFABP) and rat intestinal FABP (rIFABP) bind some ligands with different affinities. In order to address the structural basis of this differential binding, diffraction-quality crystals have been obtained of hIFABP and rIFABP in complex with the fluorescent fatty-acid analogue 11-(dansylamino)undecanoic acid. PMID:21301109

Flux growth of high-quality CoFe 2O 4 single crystals and their characterization

NASA Astrophysics Data System (ADS)

Wang, W. H.; Ren, X.

2006-04-01

We report the growth of high-quality CoFe 2O 4 single crystals using a borax flux method. The crystals were characterized by powder X-ray diffraction, electron probe microanalysis and Raman spectroscopy. We found the crystals are flux-free and highly homogeneous in composition. X-ray rocking curves of the CoFe 2O 4 single crystals showed a full-width at half-maximum of 0.15°. The saturation magnetization of the CoFe 2O 4 single crystals was measured to be 90 emu/g or equivalently 3.65 μ B/f.u. at 5 K.

Crystallization and preliminary X-ray diffraction study of the protealysin precursor belonging to the peptidase family M4

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gromova, T. Yu., E-mail: duk@img.ras.ru; Demidyuk, I. V.; Kostrov, S. V.

2008-09-15

A protealysin precursor (the enzyme of the peptidase family M4) was crystallized for the first time. The crystal-growth conditions were found, and single crystals of the protein with dimensions of 0.3-0.5 mm were grown. The preliminary X-ray diffraction study of the enzyme was performed. The protealysin precursor was shown to crystallize in two crystal modifications suitable for the X-ray diffraction study of the three-dimensional structure of the protein molecule at atomic resolution.

Novel diamond cells for neutron diffraction using multi-carat CVD anvils.

PubMed

Boehler, R; Molaison, J J; Haberl, B

2017-08-01

Traditionally, neutron diffraction at high pressure has been severely limited in pressure because low neutron flux required large sample volumes and therefore large volume presses. At the high-flux Spallation Neutron Source at the Oak Ridge National Laboratory, we have developed new, large-volume diamond anvil cells for neutron diffraction. The main features of these cells are multi-carat, single crystal chemical vapor deposition diamonds, very large diffraction apertures, and gas membranes to accommodate pressure stability, especially upon cooling. A new cell has been tested for diffraction up to 40 GPa with an unprecedented sample volume of ∼0.15 mm 3 . High quality spectra were obtained in 1 h for crystalline Ni and in ∼8 h for disordered glassy carbon. These new techniques will open the way for routine megabar neutron diffraction experiments.

A Medipix quantum area detector allows rotation electron diffraction data collection from submicrometre three-dimensional protein crystals

PubMed Central

Nederlof, Igor; van Genderen, Eric; Li, Yao-Wang; Abrahams, Jan Pieter

2013-01-01

When protein crystals are submicrometre-sized, X-ray radiation damage precludes conventional diffraction data collection. For crystals that are of the order of 100 nm in size, at best only single-shot diffraction patterns can be collected and rotation data collection has not been possible, irrespective of the diffraction technique used. Here, it is shown that at a very low electron dose (at most 0.1 e− Å−2), a Medipix2 quantum area detector is sufficiently sensitive to allow the collection of a 30-frame rotation series of 200 keV electron-diffraction data from a single ∼100 nm thick protein crystal. A highly parallel 200 keV electron beam (λ = 0.025 Å) allowed observation of the curvature of the Ewald sphere at low resolution, indicating a combined mosaic spread/beam divergence of at most 0.4°. This result shows that volumes of crystal with low mosaicity can be pinpointed in electron diffraction. It is also shown that strategies and data-analysis software (MOSFLM and SCALA) from X-ray protein crystallography can be used in principle for analysing electron-diffraction data from three-dimensional nanocrystals of proteins. PMID:23793148

Validation of molecular crystal structures from powder diffraction data with dispersion-corrected density functional theory (DFT-D).

PubMed

van de Streek, Jacco; Neumann, Marcus A

2014-12-01

In 2010 we energy-minimized 225 high-quality single-crystal (SX) structures with dispersion-corrected density functional theory (DFT-D) to establish a quantitative benchmark. For the current paper, 215 organic crystal structures determined from X-ray powder diffraction (XRPD) data and published in an IUCr journal were energy-minimized with DFT-D and compared to the SX benchmark. The on average slightly less accurate atomic coordinates of XRPD structures do lead to systematically higher root mean square Cartesian displacement (RMSCD) values upon energy minimization than for SX structures, but the RMSCD value is still a good indicator for the detection of structures that deserve a closer look. The upper RMSCD limit for a correct structure must be increased from 0.25 Å for SX structures to 0.35 Å for XRPD structures; the grey area must be extended from 0.30 to 0.40 Å. Based on the energy minimizations, three structures are re-refined to give more precise atomic coordinates. For six structures our calculations provide the missing positions for the H atoms, for five structures they provide corrected positions for some H atoms. Seven crystal structures showed a minor error for a non-H atom. For five structures the energy minimizations suggest a higher space-group symmetry. For the 225 SX structures, the only deviations observed upon energy minimization were three minor H-atom related issues. Preferred orientation is the most important cause of problems. A preferred-orientation correction is the only correction where the experimental data are modified to fit the model. We conclude that molecular crystal structures determined from powder diffraction data that are published in IUCr journals are of high quality, with less than 4% containing an error in a non-H atom.

Validation of molecular crystal structures from powder diffraction data with dispersion-corrected density functional theory (DFT-D)

PubMed Central

van de Streek, Jacco; Neumann, Marcus A.

2014-01-01

In 2010 we energy-minimized 225 high-quality single-crystal (SX) structures with dispersion-corrected density functional theory (DFT-D) to establish a quantitative benchmark. For the current paper, 215 organic crystal structures determined from X-ray powder diffraction (XRPD) data and published in an IUCr journal were energy-minimized with DFT-D and compared to the SX benchmark. The on average slightly less accurate atomic coordinates of XRPD structures do lead to systematically higher root mean square Cartesian displacement (RMSCD) values upon energy minimization than for SX structures, but the RMSCD value is still a good indicator for the detection of structures that deserve a closer look. The upper RMSCD limit for a correct structure must be increased from 0.25 Å for SX structures to 0.35 Å for XRPD structures; the grey area must be extended from 0.30 to 0.40 Å. Based on the energy minimizations, three structures are re-refined to give more precise atomic coordinates. For six structures our calculations provide the missing positions for the H atoms, for five structures they provide corrected positions for some H atoms. Seven crystal structures showed a minor error for a non-H atom. For five structures the energy minimizations suggest a higher space-group symmetry. For the 225 SX structures, the only deviations observed upon energy minimization were three minor H-atom related issues. Preferred orientation is the most important cause of problems. A preferred-orientation correction is the only correction where the experimental data are modified to fit the model. We conclude that molecular crystal structures determined from powder diffraction data that are published in IUCr journals are of high quality, with less than 4% containing an error in a non-H atom. PMID:25449625

Dynamical electron diffraction simulation for non-orthogonal crystal system by a revised real space method.

PubMed

Lv, C L; Liu, Q B; Cai, C Y; Huang, J; Zhou, G W; Wang, Y G

2015-01-01

In the transmission electron microscopy, a revised real space (RRS) method has been confirmed to be a more accurate dynamical electron diffraction simulation method for low-energy electron diffraction than the conventional multislice method (CMS). However, the RRS method can be only used to calculate the dynamical electron diffraction of orthogonal crystal system. In this work, the expression of the RRS method for non-orthogonal crystal system is derived. By taking Na2 Ti3 O7 and Si as examples, the correctness of the derived RRS formula for non-orthogonal crystal system is confirmed by testing the coincidence of numerical results of both sides of Schrödinger equation; moreover, the difference between the RRS method and the CMS for non-orthogonal crystal system is compared at the accelerating voltage range from 40 to 10 kV. Our results show that the CMS method is almost the same as the RRS method for the accelerating voltage above 40 kV. However, when the accelerating voltage is further lowered to 20 kV or below, the CMS method introduces significant errors, not only for the higher-order Laue zone diffractions, but also for zero-order Laue zone. These indicate that the RRS method for non-orthogonal crystal system is necessary to be used for more accurate dynamical simulation when the accelerating voltage is low. Furthermore, the reason for the increase of differences between those diffraction patterns calculated by the RRS method and the CMS method with the decrease of the accelerating voltage is discussed. © 2015 The Authors Journal of Microscopy © 2015 Royal Microscopical Society.

Crystallization and preliminary X-ray diffraction analysis of central structure domains from mumps virus F protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Yueyong; Xu, Yanhui; Zhu, Jieqing

2005-09-01

Single crystals of the central structure domains from mumps virus F protein have been obtained by the hanging-drop vapour-diffusion method. A diffraction data set has been collected to 2.2 Å resolution. Fusion of members of the Paramyxoviridae family involves two glycoproteins: the attachment protein and the fusion protein. Changes in the fusion-protein conformation were caused by binding of the attachment protein to the cellular receptor. In the membrane-fusion process, two highly conserved heptad-repeat (HR) regions, HR1 and HR2, are believed to form a stable six-helix coiled-coil bundle. However, no crystal structure has yet been determined for this state in themore » mumps virus (MuV, a member of the Paramyxoviridae family). In this study, a single-chain protein consisting of two HR regions connected by a flexible amino-acid linker (named 2-Helix) was expressed, purified and crystallized by the hanging-drop vapour-diffusion method. A complete X-ray data set was obtained in-house to 2.2 Å resolution from a single crystal. The crystal belongs to space group C2, with unit-cell parameters a = 161.2, b = 60.8, c = 40.1 Å, β = 98.4°. The crystal structure will help in understanding the molecular mechanism of Paramyxoviridae family membrane fusion.« less

Protein crystal growth in microgravity: Temperature induced large scale crystallization of insulin

NASA Technical Reports Server (NTRS)

Long, Marianna M.; Delucas, Larry J.; Smith, C.; Carson, M.; Moore, K.; Harrington, Michael D.; Pillion, D. J.; Bishop, S. P.; Rosenblum, W. M.; Naumann, R. J.

1994-01-01

One of the major stumbling blocks that prevents rapid structure determination using x-ray crystallography is macro-molecular crystal growth. There are many examples where crystallization takes longer than structure determination. In some cases, it is impossible to grow useful crystals on earth. Recent experiments conducted in conjuction with NASA on various Space Shuttle missions have demonstrated that protein crystals often grow larger and display better internal molecular order than their earth-grown counterparts. This paper reports results from three Shuttle flights using the Protein Crystallization Facility (PCF). The PCF hardware produced large, high-quality insulin crystals by using a temperature change as the sole means to affect protein solubility and thus, crystallization. The facility consists of cylinders/containers with volumes of 500, 200, 100, and 50 ml. Data from the three Shuttle flights demonstrated that larger, higher resolution crystals (as evidenced by x-ray diffraction data) were obtained from the microgravity experiments when compared to earth-grown crystals.

Crystallization of multiple forms of bovine seminal ribonuclease in the liganded and unliganded state

NASA Astrophysics Data System (ADS)

Sica, F.; Adinolfi, S.; Berisio, R.; De Lorenzo, C.; Mazzarella, L.; Piccoli, R.; Vitagliano, L.; Zagari, A.

1999-01-01

Bovine seminal ribonuclease (BS-RNase) is an intriguing homodimeric enzyme which exists as two conformational isomers, characterized by distinct catalytic and biological properties, referred to as M×M and M=M. Reduction of inter-chain disulfide bridges produces a stable monomeric derivative (M) which is still active. This paper reports the screening and optimization of crystallization conditions for growing single diffraction-quality crystals for the various BS-RNase forms. The crystallization trials were performed using both the vapor diffusion and microbatch methods. The M×M dimer was crystallized in the free form from polyethylene glycol (PEG) 4000 at pH 8.5 and as a complex with the substrate analog uridylyl(2'- 5')guanosine (UpG) from an unbuffered ammonium sulfate (AS) solution. These two crystal types diffract X-rays to 2.5 and 1.9 Å resolution, respectively. Two different crystal types were obtained both for the M=M dimer and for the monomeric derivative. (M=M)a crystals, grown from PEG 4000 (8% w/v) at pH 5.6, diffract X-rays to 4.0 Å. At higher PEG concentration (15% w/v) a different crystal type was obtained, (M=M)b, which showed a better diffraction limit (2.5 Å). For the monomer, type (M)a and (M)b crystals, diffracting X-rays to 2.5 Å resolution, were obtained from AS at pH 6.5 and from PEG 4000 at pH 8.5, respectively. A comparison with previously crystallized forms of the dimer M×M and its complexes with uridylyl(2'-5')adenosine and 2'-deoxycytidylyl(3'-5')-2'-deoxyadenosine is also presented. The three-dimensional structure analysis of (M×M)·UpG and (M=M)b is in progress.

High-throughput crystal-optimization strategies in the South Paris Yeast Structural Genomics Project: one size fits all?

PubMed

Leulliot, Nicolas; Trésaugues, Lionel; Bremang, Michael; Sorel, Isabelle; Ulryck, Nathalie; Graille, Marc; Aboulfath, Ilham; Poupon, Anne; Liger, Dominique; Quevillon-Cheruel, Sophie; Janin, Joël; van Tilbeurgh, Herman

2005-06-01

Crystallization has long been regarded as one of the major bottlenecks in high-throughput structural determination by X-ray crystallography. Structural genomics projects have addressed this issue by using robots to set up automated crystal screens using nanodrop technology. This has moved the bottleneck from obtaining the first crystal hit to obtaining diffraction-quality crystals, as crystal optimization is a notoriously slow process that is difficult to automatize. This article describes the high-throughput optimization strategies used in the Yeast Structural Genomics project, with selected successful examples.

Simulating Picosecond X-ray Diffraction from shocked crystals by Post-processing Molecular Dynamics Calculations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kimminau, G; Nagler, B; Higginbotham, A

2008-06-19

Calculations of the x-ray diffraction patterns from shocked crystals derived from the results of Non-Equilibrium-Molecular-Dynamics (NEMD) simulations are presented. The atomic coordinates predicted by the NEMD simulations combined with atomic form factors are used to generate a discrete distribution of electron density. A Fast-Fourier-Transform (FFT) of this distribution provides an image of the crystal in reciprocal space, which can be further processed to produce quantitative simulated data for direct comparison with experiments that employ picosecond x-ray diffraction from laser-irradiated crystalline targets.

Crystallization and X-ray diffraction analysis of a catalytic domain of hyperthermophilic chitinase from Pyrococcus furiosus

PubMed Central

Mine, Shouhei; Nakamura, Tsutomu; Hirata, Kunio; Ishikawa, Kazuhiko; Hagihara, Yoshihisa; Uegaki, Koichi

2006-01-01

The crystallization and preliminary X-ray diffraction analysis of a catalytic domain of chitinase (PF1233 gene) from the hyperthermophilic archaeon Pyrococcus furiosus is reported. The recombinant protein, prepared using an Escherichia coli expression system, was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected at the undulator beamline BL44XU at SPring-8 to a resolution of 1.50 Å. The crystals belong to space group P212121, with unit-cell parameters a = 90.0, b = 92.8, c = 107.2 Å. PMID:16880559

Study of Fluid Flow Control In Protein Crystallization Using Strong Magnetic Fields

NASA Technical Reports Server (NTRS)

Ramachandran, N.; Leslie, F.; Ciszak, E.; Curreri, Peter A. (Technical Monitor)

2002-01-01

An important component in biotechnology, particularly in the area of protein engineering and rational drug design is the knowledge of the precise three-dimensional molecular structure of proteins. The quality of structural information obtained from X-ray diffraction methods is directly dependent on the degree of perfection of the protein crystals. As a consequence, the growth of high quality macromolecular crystals for diffraction analyses has been the central focus for biochemists, biologists, and bioengineers. Macromolecular crystals are obtained from solutions that contain the crystallizing species in equilibrium with higher aggregates, ions, precipitants, other possible phases of the protein, foreign particles, the walls of the container, and a likely host of other impurities. By changing transport modes in general, i.e., reduction of convection and sedimentation, as is achieved in 'microgravity', researchers have been able to dramatically affect the movement and distribution of macromolecules in the fluid, and thus their transport, formation of crystal nuclei, and adsorption to the crystal surface. While a limited number of high quality crystals from space flights have been obtained, as the recent National Research Council (NRC) review of the NASA microgravity crystallization program pointed out, the scientific approach and research in crystallization of proteins has been mainly empirical yielding inconclusive results. We postulate that we can reduce convection in ground-based experiments and we can understand the different aspects of convection control through the use of strong magnetic fields and field gradients. Whether this limited convection in a magnetic field will provide the environment for the growth of high quality crystals is still a matter of conjecture that our research will address. The approach exploits the variation of fluid magnetic susceptibility with concentration for this purpose and the convective damping is realized by appropriately

Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of the VP8* carbohydrate-binding protein of the human rotavirus strain Wa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kraschnefski, Mark J.; Scott, Stacy A.; Holloway, Gavan

2005-11-01

The carbohydrate-binding component (VP8*{sub 64–223}) of the human Wa rotavirus spike protein has been overexpressed in E. coli, purified and crystallized in two different crystal forms. X-ray diffraction data have been collected that have enabled determination of the Wa VP8*{sub 64–223} structure by molecular replacement. Rotaviruses exhibit host-specificity and the first crystallographic information on a rotavirus strain that infects humans is reported here. Recognition and attachment to host cells, leading to invasion and infection, is critically linked to the function of the outer capsid spike protein of the rotavirus particle. In some strains the VP8* component of the spike proteinmore » is implicated in recognition and binding of sialic-acid-containing cell-surface carbohydrates, thereby enabling infection by the virus. The cloning, expression, purification, crystallization and initial X-ray diffraction analysis of the VP8* core from human Wa rotavirus is reported. Two crystal forms (trigonal P3{sub 2}21 and monoclinic P2{sub 1}) have been obtained and X-ray diffraction data have been collected, enabling determination of the VP8*{sub 64–223} structure by molecular replacement.« less

Microfluidic Chips for In Situ Crystal X-ray Diffraction and In Situ Dynamic Light Scattering for Serial Crystallography.

PubMed

Gicquel, Yannig; Schubert, Robin; Kapis, Svetlana; Bourenkov, Gleb; Schneider, Thomas; Perbandt, Markus; Betzel, Christian; Chapman, Henry N; Heymann, Michael

2018-04-24

This protocol describes fabricating microfluidic devices with low X-ray background optimized for goniometer based fixed target serial crystallography. The devices are patterned from epoxy glue using soft lithography and are suitable for in situ X-ray diffraction experiments at room temperature. The sample wells are lidded on both sides with polymeric polyimide foil windows that allow diffraction data collection with low X-ray background. This fabrication method is undemanding and inexpensive. After the sourcing of a SU-8 master wafer, all fabrication can be completed outside of a cleanroom in a typical research lab environment. The chip design and fabrication protocol utilize capillary valving to microfluidically split an aqueous reaction into defined nanoliter sized droplets. This loading mechanism avoids the sample loss from channel dead-volume and can easily be performed manually without using pumps or other equipment for fluid actuation. We describe how isolated nanoliter sized drops of protein solution can be monitored in situ by dynamic light scattering to control protein crystal nucleation and growth. After suitable crystals are grown, complete X-ray diffraction datasets can be collected using goniometer based in situ fixed target serial X-ray crystallography at room temperature. The protocol provides custom scripts to process diffraction datasets using a suite of software tools to solve and refine the protein crystal structure. This approach avoids the artefacts possibly induced during cryo-preservation or manual crystal handling in conventional crystallography experiments. We present and compare three protein structures that were solved using small crystals with dimensions of approximately 10-20 µm grown in chip. By crystallizing and diffracting in situ, handling and hence mechanical disturbances of fragile crystals is minimized. The protocol details how to fabricate a custom X-ray transparent microfluidic chip suitable for in situ serial crystallography

Characterization of monoclinic crystals in tablets by pattern-fitting procedure using X-ray powder diffraction data.

PubMed

Yamamura, Shigeo; Momose, Yasunori

2003-06-18

The purpose of this study is to characterize the monoclinic crystals in tablets by using X-ray powder diffraction data and to evaluate the deformation feature of crystals during compression. The monoclinic crystals of acetaminophen and benzoic acid were used as the samples. The observed X-ray diffraction intensities were fitted to the analytic expression, and the fitting parameters, such as the lattice parameters, the peak-width parameters, the preferred orientation parameter and peak asymmetric parameter were optimized by a non-linear least-squares procedure. The Gauss and March distribution functions were used to correct the preferred orientation of crystallites in the tablet. The March function performed better in correcting the modification of diffraction intensity by preferred orientation of crystallites, suggesting that the crystallites in the tablets had fiber texture with axial orientation. Although a broadening of diffraction peaks was observed in acetaminophen tablets with an increase of compression pressure, little broadening was observed in the benzoic tablets. These results suggest that "acetaminophen is a material consolidating by fragmentation of crystalline particles and benzoic acid is a material consolidating by plastic deformation then occurred rearrangement of molecules during compression". A pattern-fitting procedure is the superior method for characterizing the crystalline drugs of monoclinic crystals in the tablets, as well as orthorhombic isoniazid and mannitol crystals reported in the previous paper.

Common path point diffraction interferometer using liquid crystal phase shifting

NASA Technical Reports Server (NTRS)

Mercer, Carolyn R. (Inventor)

1997-01-01

A common path point diffraction interferometer uses dyed, parallel nematic liquid crystals which surround an optically transparent microsphere. Coherent, collimated and polarized light is focused on the microsphere at a diameter larger than that of the microsphere. A portion of the focused light passes through the microsphere to form a spherical wavefront reference beam and the rest of the light is attenuated by the dyed liquid crystals to form an object beam. The two beams form an interferogram which is imaged by a lens onto an electronic array sensor and into a computer which determines the wavefront of the object beam. The computer phase shifts the interferogram by stepping up an AC voltage applied across the liquid crystals without affecting the reference beam.

Diffraction of real and virtual photons in a pyrolytic graphite crystal as source of intensive quasimonochromatic X-ray beam

NASA Astrophysics Data System (ADS)

Bogomazova, E. A.; Kalinin, B. N.; Naumenko, G. A.; Padalko, D. V.; Potylitsyn, A. P.; Sharafutdinov, A. F.; Vnukov, I. E.

2003-01-01

A series of experiments on the parametric X-rays radiation (PXR) generation and radiation soft component diffraction of relativistic electrons in pyrolytic graphite (PG) crystals have been carried out at the Tomsk synchrotron. It is shown that the experimental results with PG crystals are explained by the kinematic PXR theory if we take into account a contribution of the real photons diffraction (transition radiation, bremsstrahlung and PXR photons as well). The measurements of the emission spectrum of channeled electrons in the photon energy range much smaller than the characteristic energy of channeling radiation have been performed with a crystal-diffraction spectrometer. For electrons incident along the <1 1 0> axis of a silicon crystal, the radiation intensity in the energy range 30⩽ ω⩽360 keV exceeds the bremsstrahlung one almost by an order of magnitude. Different possibilities to create an effective source of the monochromatic X-ray beam based on the real and virtual photons diffraction in the PG crystals have been considered.

Structural properties of a family of hydrogen-bonded co-crystals formed between gemfibrozil and hydroxy derivatives of t-butylamine, determined directly from powder X-ray diffraction data

NASA Astrophysics Data System (ADS)

Cheung, Eugene Y.; David, Sarah E.; Harris, Kenneth D. M.; Conway, Barbara R.; Timmins, Peter

2007-03-01

We report the formation and structural properties of co-crystals containing gemfibrozil and hydroxy derivatives of t-butylamine H 2NC(CH 3) 3-n(CH 2OH) n, with n=0, 1, 2 and 3. In each case, a 1:1 co-crystal is formed, with transfer of a proton from the carboxylic acid group of gemfibrozil to the amino group of the t-butylamine derivative. All of the co-crystal materials prepared are polycrystalline powders, and do not contain single crystals of suitable size and/or quality for single crystal X-ray diffraction studies. Structure determination of these materials has been carried out directly from powder X-ray diffraction data, using the direct-space Genetic Algorithm technique for structure solution followed by Rietveld refinement. The structural chemistry of this series of co-crystal materials reveals well-defined structural trends within the first three members of the family ( n=0, 1, 2), but significantly contrasting structural properties for the member with n=3.

X-Ray Diffraction and Imaging Study of Imperfections of Crystallized Lysozyme with Coherent X-Rays

NASA Technical Reports Server (NTRS)

Hu, Zheng-Wei; Chu, Y. S.; Lai, B.; Cai, Z.; Thomas, B. R.; Chernov, A. A.

2003-01-01

Phase-sensitive x-ray diffraction imaging and high angular-resolution diffraction combined with phase contrast radiographic imaging are employed to characterize defects and perfection of a uniformly grown tetragonal lysozyme crystal in symmetric Laue case. The fill width at half-maximum (FWHM) of a 4 4 0 rocking curve measured from the original crystal is approximately 16.7 arcseconds, and defects, which include point defects, line defects, and microscopic domains, have been clearly observed in the diffraction images of the crystal. The observed line defects carry distinct dislocation features running approximately along the <110> growth front, and they have been found to originate mostly at a central growth area and occasionally at outer growth regions. Individual point defects trapped at a crystal nucleus are resolved in the images of high sensitivity to defects. Slow dehydration has led to the broadening of the 4 4 0 rocking curve by a factor of approximately 2.4. A significant change of the defect structure and configuration with drying has been revealed, which suggests the dehydration induced migration and evolution of dislocations and lattice rearrangements to reduce overall strain energy. The sufficient details of the observed defects shed light upon perfection, nucleation and growth, and properties of protein crystals.

Purification, crystallization and X-ray diffraction analysis of the C-terminal protease domain of Venezuelan equine encephalitis virus nsP2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Russo, Andrew T.; Watowich, Stanley J., E-mail: watowich@xray.utmb.edu

2006-06-01

The C-terminal protease domain of Venezuelan equine encephalitis virus (VEEV) nsP2 has been overexpressed in E. coli, purified and successfully crystallized. Native crystals diffract to beyond 2.5 Å resolution and isomorphous heavy-atom derivatives suitable for phase analysis have been identified. The C-terminal region of Venezuelan equine encephalitis virus (VEEV) nsP2 is responsible for proteolytic processing of the VEEV polyprotein replication complex. This action regulates the activity of the replication complex and is essential for viral replication, thus making nsP2 a very attractive target for development of VEEV therapeutics. The 338-amino-acid C-terminal region of VEEV nsP2 has been overexpressed in Escherichiamore » coli, purified and crystallized. Crystals diffract to beyond 2.5 Å resolution and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}. Isomorphous heavy-atom derivatives suitable for phase analysis have been obtained and work on building a complete structural model is under way.« less

Optical pendulum effect in one-dimensional diffraction-thick porous silicon based photonic crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Novikov, V. B., E-mail: vb.novikov@physics.msu.ru; Svyakhovskiy, S. E.; Maydykovskiy, A. I.

We present the realization of the multiperiodic optical pendulum effect in 1D porous silicon photonic crystals (PhCs) under dynamical Bragg diffraction in the Laue scheme. The diffraction-thick PhC contained 360 spatial periods with a large variation of the refractive index of adjacent layers of 0.4. The experiments reveal switching of the light leaving the PhC between the two spatial directions, which correspond to Laue diffraction maxima, as the fundamental wavelength or polarization of the incident light is varied. A similar effect can be achieved when the temperature of the sample or the intensity of the additional laser beam illuminating themore » crystal are changed. We show that in our PhC structures, the spectral period of the pendulum effect is down to 5 nm, while the thermal period is about 10 °C.« less

Novel diamond cells for neutron diffraction using multi-carat CVD anvils

DOE PAGES

Boehler, R.; Molaison, J. J.; Haberl, B.

2017-08-17

Traditionally, neutron diffraction at high pressure has been severely limited in pressure because low neutron flux required large sample volumes and therefore large volume presses. At the high-flux Spallation Neutron Source at the Oak Ridge National Laboratory, we have developed in this paper new, large-volume diamond anvil cells for neutron diffraction. The main features of these cells are multi-carat, single crystal chemical vapor deposition diamonds, very large diffraction apertures, and gas membranes to accommodate pressure stability, especially upon cooling. A new cell has been tested for diffraction up to 40 GPa with an unprecedented sample volume of ~0.15 mm 3.more » High quality spectra were obtained in 1 h for crystalline Ni and in ~8 h for disordered glassy carbon. Finally, these new techniques will open the way for routine megabar neutron diffraction experiments.« less

Energy resolution of the CdTe-XPAD detector: calibration and potential for Laue diffraction measurements on protein crystals.

PubMed

Medjoubi, Kadda; Thompson, Andrew; Bérar, Jean-François; Clemens, Jean-Claude; Delpierre, Pierre; Da Silva, Paulo; Dinkespiler, Bernard; Fourme, Roger; Gourhant, Patrick; Guimaraes, Beatriz; Hustache, Stéphanie; Idir, Mourad; Itié, Jean-Paul; Legrand, Pierre; Menneglier, Claude; Mercere, Pascal; Picca, Frederic; Samama, Jean-Pierre

2012-05-01

The XPAD3S-CdTe, a CdTe photon-counting pixel array detector, has been used to measure the energy and the intensity of the white-beam diffraction from a lysozyme crystal. A method was developed to calibrate the detector in terms of energy, allowing incident photon energy measurement to high resolution (approximately 140 eV), opening up new possibilities in energy-resolved X-ray diffraction. In order to demonstrate this, Laue diffraction experiments were performed on the bending-magnet beamline METROLOGIE at Synchrotron SOLEIL. The X-ray energy spectra of diffracted spots were deduced from the indexed Laue patterns collected with an imaging-plate detector and then measured with both the XPAD3S-CdTe and the XPAD3S-Si, a silicon photon-counting pixel array detector. The predicted and measured energy of selected diffraction spots are in good agreement, demonstrating the reliability of the calibration method. These results open up the way to direct unit-cell parameter determination and the measurement of high-quality Laue data even at low resolution. Based on the success of these measurements, potential applications in X-ray diffraction opened up by this type of technology are discussed.

Crystallization and preliminary X-ray diffraction study of recombinant ribokinase from Thermus Species 2.9

NASA Astrophysics Data System (ADS)

Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Esipov, R. S.; Kuranova, I. P.

2016-11-01

Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P1211 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, β = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.

The amino-terminal structure of human fragile X mental retardation protein obtained using precipitant-immobilized imprinted polymers

NASA Astrophysics Data System (ADS)

Hu, Yufeng; Chen, Zhenhang; Fu, Yanjun; He, Qingzhong; Jiang, Lun; Zheng, Jiangge; Gao, Yina; Mei, Pinchao; Chen, Zhongzhou; Ren, Xueqin

2015-03-01

Flexibility is an intrinsic property of proteins and essential for their biological functions. However, because of structural flexibility, obtaining high-quality crystals of proteins with heterogeneous conformations remain challenging. Here, we show a novel approach to immobilize traditional precipitants onto molecularly imprinted polymers (MIPs) to facilitate protein crystallization, especially for flexible proteins. By applying this method, high-quality crystals of the flexible N-terminus of human fragile X mental retardation protein are obtained, whose absence causes the most common inherited mental retardation. A novel KH domain and an intermolecular disulfide bond are discovered, and several types of dimers are found in solution, thus providing insights into the function of this protein. Furthermore, the precipitant-immobilized MIPs (piMIPs) successfully facilitate flexible protein crystal formation for five model proteins with increased diffraction resolution. This highlights the potential of piMIPs for the crystallization of flexible proteins.

High resolution x-ray and gamma ray imaging using diffraction lenses with mechanically bent crystals

DOEpatents

Smither, Robert K [Hinsdale, IL

2008-12-23

A method for high spatial resolution imaging of a plurality of sources of x-ray and gamma-ray radiation is provided. High quality mechanically bent diffracting crystals of 0.1 mm radial width are used for focusing the radiation and directing the radiation to an array of detectors which is used for analyzing their addition to collect data as to the location of the source of radiation. A computer is used for converting the data to an image. The invention also provides for the use of a multi-component high resolution detector array and for narrow source and detector apertures.

Investigation of Renal Stones by X-ray and Neutron Diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baeva, M.; Boianova, A.; Beskrovnyi, A. I.

2007-04-23

Renal stones were investigated by X-ray diffraction. The obtained results showed only one crystal phase in every sample. With the aim to verify eventual availability of second phase (under 3 volume %) the same renal stones were investigated by neutron diffraction. The neutron spectra proved that additional crystal phase was absent in the renal stones. The obtained results are scientific-practical, in aid of the medicine, especially in the case of renal stone disease.

7 Å resolution in protein two-dimensional-crystal X-ray diffraction at Linac Coherent Light Source

PubMed Central

Pedrini, Bill; Tsai, Ching-Ju; Capitani, Guido; Padeste, Celestino; Hunter, Mark S.; Zatsepin, Nadia A.; Barty, Anton; Benner, W. Henry; Boutet, Sébastien; Feld, Geoffrey K.; Hau-Riege, Stefan P.; Kirian, Richard A.; Kupitz, Christopher; Messerschmitt, Marc; Ogren, John I.; Pardini, Tommaso; Segelke, Brent; Williams, Garth J.; Spence, John C. H.; Abela, Rafael; Coleman, Matthew; Evans, James E.; Schertler, Gebhard F. X.; Frank, Matthias; Li, Xiao-Dan

2014-01-01

Membrane proteins arranged as two-dimensional crystals in the lipid environment provide close-to-physiological structural information, which is essential for understanding the molecular mechanisms of protein function. Previously, X-ray diffraction from individual two-dimensional crystals did not represent a suitable investigational tool because of radiation damage. The recent availability of ultrashort pulses from X-ray free-electron lasers (XFELs) has now provided a means to outrun the damage. Here, we report on measurements performed at the Linac Coherent Light Source XFEL on bacteriorhodopsin two-dimensional crystals mounted on a solid support and kept at room temperature. By merging data from about a dozen single crystal diffraction images, we unambiguously identified the diffraction peaks to a resolution of 7 Å, thus improving the observable resolution with respect to that achievable from a single pattern alone. This indicates that a larger dataset will allow for reliable quantification of peak intensities, and in turn a corresponding increase in the resolution. The presented results pave the way for further XFEL studies on two-dimensional crystals, which may include pump–probe experiments at subpicosecond time resolution. PMID:24914166

Crystal Growth Rate Dispersion: A Predictor of Crystal Quality in Microgravity?

NASA Technical Reports Server (NTRS)

Kephart, Richard D.; Judge, Russell A.; Snell, Edward H.; vanderWoerd, Mark J.

2003-01-01

In theory macromolecular crystals grow through a process involving at least two transport phenomena of solute to the crystal surface: diffusion and convection. In absence of standard gravitational forces, the ratio of these two phenomena can change and explain why crystal growth in microgravity is different from that on Earth. Experimental evidence clearly shows, however, that crystal growth of various systems is not equally sensitive to reduction in gravitational forces, leading to quality improvement in microgravity for some crystals but not for others. We hypothesize that the differences in final crystal quality are related to crystal growth rate dispersion. If growth rate dispersion exists on Earth, decreases in microgravity, and coincides with crystal quality improvements then this dispersion is a predictor for crystal quality improvement. In order to test this hypothesis, we will measure growth rate dispersion both in microgravity and on Earth and will correlate the data with previously established data on crystal quality differences for the two environments. We present here the first crystal growth rate measurement data for three proteins (lysozyme, xylose isomerase and human recombinant insulin), collected on Earth, using hardware identical to the hardware to be used in microgravity and show how these data correlate with crystal quality improvements established in microgravity.

Study of the spectra of silica colloidal crystals with assembled silver obtained from a photolysis method

NASA Astrophysics Data System (ADS)

Li, Wenjiang; He, Jinglong; He, Sailing

2005-02-01

The colorful artificial 3D silica colloidal crystals (opal) were prepared through self-assembly of silica spheres in the visible frequency range. We directly synthesized nano silver particles in the void of the silica artificial opal film using the photolysis of silver nitrate under UV light, nano silver particles were self-deposited around the surface of silica sphere. The shifts of the stop band of the artificial crystals after exposing different time under UV light were studied. Synthetic silica opal with three-dimensional (3D) structure is potentially useful for the development of diffractive optical devices, micro mechanical systems, and sensory elements because photonic band gaps obtained from self-assembled closely packed periodic structures.

Powder diffraction and crystal structure prediction identify four new coumarin polymorphs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shtukenberg, Alexander G.; Zhu, Qiang; Carter, Damien J.

Coumarin, a simple, commodity chemical isolated from beans in 1820, has, to date, only yielded one solid state structure. Here, we report a rich polymorphism of coumarin grown from the melt. Four new metastable forms were identified and their crystal structures were solved using a combination of computational crystal structure prediction algorithms and X-ray powder diffraction. With five crystal structures, coumarin has become one of the few rigid molecules showing extensive polymorphism at ambient conditions. We demonstrate the crucial role of advanced electronic structure calculations including many-body dispersion effects for accurate ranking of the stability of coumarin polymorphs and themore » need to account for anharmonic vibrational contributions to their free energy. As such, coumarin is a model system for studying weak intermolecular interactions, crystallization mechanisms, and kinetic effects.« less

Powder diffraction and crystal structure prediction identify four new coumarin polymorphs

DOE PAGES

Shtukenberg, Alexander G.; Zhu, Qiang; Carter, Damien J.; ...

2017-05-15

Coumarin, a simple, commodity chemical isolated from beans in 1820, has, to date, only yielded one solid state structure. Here, we report a rich polymorphism of coumarin grown from the melt. Four new metastable forms were identified and their crystal structures were solved using a combination of computational crystal structure prediction algorithms and X-ray powder diffraction. With five crystal structures, coumarin has become one of the few rigid molecules showing extensive polymorphism at ambient conditions. We demonstrate the crucial role of advanced electronic structure calculations including many-body dispersion effects for accurate ranking of the stability of coumarin polymorphs and themore » need to account for anharmonic vibrational contributions to their free energy. As such, coumarin is a model system for studying weak intermolecular interactions, crystallization mechanisms, and kinetic effects.« less

Crystal-Site-Selective Spectrum of Fe3BO6 by Synchrotron Mössbauer Diffraction with Pure Nuclear Bragg Scattering

NASA Astrophysics Data System (ADS)

Nakamura, Shin; Mitsui, Takaya; Fujiwara, Kosuke; Ikeda, Naoshi; Kurokuzu, Masayuki; Shimomura, Susumu

2017-08-01

We have succeeded in obtaining the crystal-site-selective spectra of the collinear antiferromagnet Fe3BO6 using a synchrotron Mössbauer diffractometer with pure nuclear Bragg scattering at SPring-8 BL11XU. Well-resolved 300, 500, and 700 reflection spectra, having asymmetric line shapes owing to the higher-order interference effect between the nuclear energy levels, were quantitatively analyzed using a formula based on the dynamical theory of diffraction. Reasonable hyperfine parameters were obtained. The intensity ratio of Fe1 to Fe2 subspectra is in accordance with the nuclear structure factor. However, when the spectrum is measured at the peak position of the rocking curve (very near the Bragg position), the value of the center shift deviates from its intrinsic value. This is also due to the dynamical effect of γ-ray diffraction. To avoid this problem, it is necessary to use diffraction angles near the foot of the rocking curve, approximately 0.02° apart from the peak position.

Reconstructing three-dimensional protein crystal intensities from sparse unoriented two-axis X-ray diffraction patterns

PubMed Central

Lan, Ti-Yen; Wierman, Jennifer L.; Tate, Mark W.; Philipp, Hugh T.; Elser, Veit

2017-01-01

Recently, there has been a growing interest in adapting serial microcrystallography (SMX) experiments to existing storage ring (SR) sources. For very small crystals, however, radiation damage occurs before sufficient numbers of photons are diffracted to determine the orientation of the crystal. The challenge is to merge data from a large number of such ‘sparse’ frames in order to measure the full reciprocal space intensity. To simulate sparse frames, a dataset was collected from a large lysozyme crystal illuminated by a dim X-ray source. The crystal was continuously rotated about two orthogonal axes to sample a subset of the rotation space. With the EMC algorithm [expand–maximize–compress; Loh & Elser (2009). Phys. Rev. E, 80, 026705], it is shown that the diffracted intensity of the crystal can still be reconstructed even without knowledge of the orientation of the crystal in any sparse frame. Moreover, parallel computation implementations were designed to considerably improve the time and memory scaling of the algorithm. The results show that EMC-based SMX experiments should be feasible at SR sources. PMID:28808431

Coherent X-ray diffraction imaging of zinc oxide crystals

NASA Astrophysics Data System (ADS)

Leake, S. J.

Zinc Oxide (ZnO) exhibits a plethora of physical properties potentially advantageous in many roles and is why it one of the most studied semiconductor compounds. When doped or in its intrinsic state ZnO demonstrates a multitude of electronic, optical and magnetic properties in a large variety of manufacturable morphologies. Thus it is inherently important to understand why these properties arise and the impact potentially invasive sample preparation methods have for both the function and durability of the material and its devices. Coherent X-ray Diffraction Imaging (CXDI) is a recently established non-destructive technique which can probe the whole three dimensional structure of small crystalline materials and has the potential for sub angstrom strain resolution. The iterative methods employed to overcome the `phase problem' are described fully. CXDI studies of wurtzite ZnO crystals in the rod morphology with high aspect ratio are presented. ZnO rods synthesised via Chemical Vapour Transport Deposition were studied in post growth state and during in-situ modification via metal evaporation processing and annealing. Small variations in post growth state were observed, the physical origin of which remains unidentified. The doping of a ZnO crystal with Iron, Nickel and Cobalt by thermal evaporation and subsequent annealing was studied. The evolution of diffusing ions into the crystal lattice from was not observed, decomposition was found to be the dominant process. Improvements in experimental technique allowed multiple Bragg reflections from a single ZnO crystal to be measured for the first time. Large aspect ratio ZnO rods were used to probe the coherence properties of the incident beam. The longitudinal coherence function of the illuminating radiation was mapped using the visibility of the interference pattern at each bragg reflection and an accurate estimate of the longitudinal coherence length obtained, xi(L) = 0.66pm 0.02 mu m. The consequences for data analysis

The effect of laser radiation on the diffraction of X-rays in crystals

NASA Astrophysics Data System (ADS)

Trushin, V. N.; Chuprunov, E. V.; Khokhlov, A. F.

1988-10-01

The effect of laser radiation on the intensity of the X-ray diffraction peaks of KDP, ADP, and CuSO4-5H2O crystals was studied experimentally. This intensity was found to increase as a function of the laser beam power. This result suggests that it is possible to use laser beams to control X-ray intensity in the crystals considered.

Crystallization and preliminary X-ray diffraction analysis of FabG from Yersinia pestis.

PubMed

Nanson, Jeffrey David; Forwood, Jade Kenneth

2014-01-01

The type II fatty-acid biosynthesis pathway of bacteria provides enormous potential for antibacterial drug development owing to the structural differences between this and the type I fatty-acid biosynthesis system found in mammals. β-Ketoacyl-ACP reductase (FabG) is responsible for the reduction of the β-ketoacyl group linked to acyl carrier protein (ACP), and is essential for the formation of fatty acids and bacterial survival. Here, the cloning, expression, purification, crystallization and diffraction of FabG from Yersinia pestis (ypFabG), the highly virulent causative agent of plague, are reported. Recombinant FabG was expressed, purified to homogeneity and crystallized via the hanging-drop vapour-diffusion technique. Diffraction data were collected at the Australian Synchrotron to 2.30 Å resolution. The crystal displayed P2(1)2(1)2(1) symmetry, with unit-cell parameters a = 68.22, b = 98.68, c = 169.84 Å, and four ypFabG molecules in the asymmetric unit.

Evanescent Properties of Optical Diffraction from 2-Dimensional Hexagonal Photonic Crystals and Their Sensor Applications.

PubMed

Liao, Yu-Yang; Chen, Yung-Tsan; Chen, Chien-Chun; Huang, Jian-Jang

2018-04-03

The sensitivity of traditional diffraction grating sensors is limited by the spatial resolution of the measurement setup. Thus, a large space is required to improve sensor performance. Here, we demonstrate a compact hexagonal photonic crystal (PhC) optical sensor with high sensitivity. PhCs are able to diffract optical beams to various angles in azimuthal space. The critical wavelength that satisfies the phase matching or becomes evanescent was used to benchmark the refractive index of a target analyte applied on a PhC sensor. Using a glucose solution as an example, our sensor demonstrated very high sensitivity and a low limit of detection. This shows that the diffraction mechanism of hexagonal photonic crystals can be used for sensors when compact size is a concern.

Diffraction Techniques in Structural Biology

PubMed Central

Egli, Martin

2016-01-01

A detailed understanding of chemical and biological function and the mechanisms underlying the molecular activities ultimately requires atomic-resolution structural data. Diffraction-based techniques such as single-crystal X-ray crystallography, electron microscopy, and neutron diffraction are well established and they have paved the road to the stunning successes of modern-day structural biology. The major advances achieved in the last 20 years in all aspects of structural research, including sample preparation, crystallization, the construction of synchrotron and spallation sources, phasing approaches, and high-speed computing and visualization, now provide specialists and nonspecialists alike with a steady flow of molecular images of unprecedented detail. The present unit combines a general overview of diffraction methods with a detailed description of the process of a single-crystal X-ray structure determination experiment, from chemical synthesis or expression to phasing and refinement, analysis, and quality control. For novices it may serve as a stepping-stone to more in-depth treatises of the individual topics. Readers relying on structural information for interpreting functional data may find it a useful consumer guide. PMID:27248784

Diffraction Techniques in Structural Biology

PubMed Central

Egli, Martin

2010-01-01

A detailed understanding of chemical and biological function and the mechanisms underlying the activities ultimately requires atomic-resolution structural data. Diffraction-based techniques such as single-crystal X-ray crystallography, electron microscopy and neutron diffraction are well established and have paved the road to the stunning successes of modern-day structural biology. The major advances achieved in the last 20 years in all aspects of structural research, including sample preparation, crystallization, the construction of synchrotron and spallation sources, phasing approaches and high-speed computing and visualization, now provide specialists and non-specialists alike with a steady flow of molecular images of unprecedented detail. The present chapter combines a general overview of diffraction methods with a step-by-step description of the process of a single-crystal X-ray structure determination experiment, from chemical synthesis or expression to phasing and refinement, analysis and quality control. For novices it may serve as a stepping-stone to more in-depth treatises of the individual topics. Readers relying on structural information for interpreting functional data may find it a useful consumer guide. PMID:20517991

The Influence of Surface Morphology and Diffraction Resolution of Canavalin Crystals

NASA Technical Reports Server (NTRS)

Plomp, M.; Thomas, B. R.; Day, J. S.; McPherson, A.; Chernov, A. A.; Malkin, A.

2003-01-01

Canavalin crystals grown from material purified and not purified by High Performance Liquid Chromatography were studied by atomic force microscopy and x-ray diffraction. After purification, resolution was improved from 2.55Angstroms to 2.22Angstroms and jagged isotropic spiral steps transformed into regular, well polygonized steps.

Blazed vector gratings fabricated using photosensitive polymer liquid crystals and control of polarization diffraction

NASA Astrophysics Data System (ADS)

Ono, Hiroshi; Kuzuwata, Mitsuru; Sasaki, Tomoyuki; Noda, Kohei; Kawatsuki, Nobuhiro

2014-03-01

The blazed vector grating possessing antisymmetric distributions of the birefringence were fabricated by exposing the line-focused linearly polarized ultraviolet light on the photosensitive polymer liquid crystals. The polarization states of the diffraction beams can be highly and widely controlled by designing the blazed structures, and the diffraction properties were well-explained by Jones calculus.

Crystallization and preliminary X-ray diffraction analysis of a chitin-binding domain of hyperthermophilic chitinase from Pyrococcus furiosus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakamura, Tsutomu; Ishikawa, Kazuhiko; Hagihara, Yoshihisa

The expression, purification and preliminary X-ray diffraction studies of a chitin-binding domain of the chitinase from P. furiosus are reported. The crystallization and preliminary X-ray diffraction analysis of the chitin-binding domain of chitinase from a hyperthermophilic archaeon, Pyrococcus furiosus, are reported. The recombinant protein was prepared using an Escherichia coli overexpression system and was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected to 1.70 Å resolution. The crystal belonged to space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2. The unit-cell parameters were determined to be a = b = 48.8, c = 85.0 Å.

Study of Inverse Ni-based Photonic Crystal using the Microradian X-ray Diffraction

NASA Astrophysics Data System (ADS)

Vasilieva, A. V.; Grigoryeva, N. A.; Mistonov, A. A.; Sapoletova, N. A.; Napolskii, K. S.; Eliseev, A. A.; Lukashin, A. V.; Tretyakov, Yu D.; Petukhov, A. V.; Byelov, D.; Chernyshov, D.; Okorokov, A. I.; Bouwman, W. G.; Grigoriev, S. V.

2010-10-01

Inverse photonic nickel-based crystal films formed by electrocrystallization of metal inside the voids of polymer artificial opal have been studied using the microradian X-ray diffraction. Analysis of the diffraction images agrees with an face-centred cubic (FCC) structure with the lattice constant a0 = 650 ± 10 nm and indicates two types of stacking sequences coexisting in the crystal (twins of ABCABC... and ACBACB... ordering motifs), the ratio between them being 4:5 The transverse structural correlation length Ltran is 2.4 ± 0.1 μm, which corresponds to a sample thickness of 6 layers. The in-plane structural correlation length Llong is 3.4 ± 0.2 μm, and the structure mosaic is of order of 10°.

Crystallization and preliminary X-ray diffraction study of recombinant ribokinase from Thermus Species 2.9

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.

2016-11-15

Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P12{sub 1}1 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, βmore » = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.« less

SINGLE CRYSTAL DIFFRACTION OF SIDERITE UP TO 54 GPA AND HIGH PRESSURE-HIGH TEMPERATURE PHASES IN THE Fe-C-O SYSTEM (Invited)

NASA Astrophysics Data System (ADS)

Lavina, B.; Dera, P. K.; Downs, R. T.

2009-12-01

Phases in the Fe-C-O system are of interest for the deep carbon cycle, they might play an important role in buffering the mantle fO2. Carbon is also common in the fluid phases that greatly influence the Earth’s processes. The study of the high pressure behavior of siderite and of the phases synthesized after laser heating offers a good opportunity to illustrate the advantages and importance of single crystal diffraction in the high pressure science. The structure of siderite, FeCO3, has been refined up to 54 GPa across the spin pairing transition. Splitting of the diffraction peaks at the transition pressure provides unequivocal evidence of the sharpness of the spin crossover and of the absence of any intermediate volume and therefore of an intermediate spin state at ambient temperature. Diffraction intensities were collected in about 30 minutes at a bending magnet station (HPCAT, APS) and in about one minute at an insertion device station (GSECARS, APS). The quality of the refinement is unvaried in the investigated range, and the results obtained from the two different radiation and detectors are consistent. The refinements provide an accurate and robust determination of the dependence of bond distances and angles with pressure. Subtle structural rearrangements associated with the collapse of the octahedral cation size will be discussed. In situ laser heating is a very powerful method to study minerals at the actual P-T of the Earth’s deep interior. Overcoming the kinetic barriers required for bond breaking and atom diffusion, high pressure-high temperature phases may be synthesized. The analysis of high-pressure phases is very challenging. Diffraction patterns are usually of moderate quality and resolution, furthermore in addition to the sample, the pattern contains the contribution of other phases such as those used to insulate the anvils, to provide a pressure medium and a pressure marker. In several cases after laser heating, we observed phase transitions

Crystallization and preliminary X-ray diffraction analysis of the arginine repressor of the hyperthermophile Thermotoga neapolitana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Massant, Jan, E-mail: jan.massant@vub.ac.be; Peeters, Eveline; Charlier, Daniel

2006-01-01

The arginine repressor of the hyperthermophile T. neapolitana was crystallized with and without its corepressor arginine. Both crystals diffracted to high resolution and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with similar unit-cell parameters. The arginine repressor of Thermotoga neapolitana (ArgRTnp) is a member of the family of multifunctional bacterial arginine repressors involved in the regulation of arginine metabolism. This hyperthermophilic repressor shows unique DNA-binding features that distinguish it from its homologues. ArgRTnp exists as a homotrimeric protein that assembles into hexamers at higher protein concentrations and/or in the presence of arginine. ArgRTnp was crystallized with andmore » without its corepressor arginine using the hanging-drop vapour-diffusion method. Crystals of the aporepressor diffracted to a resolution of 2.1 Å and belong to the orthorhombic P2{sub 1}2{sub 1}2{sub 1} space group, with unit-cell parameters a = 117.73, b = 134.15, c = 139.31 Å. Crystals of the repressor in the presence of its corepressor arginine diffracted to a resolution of 2.4 Å and belong to the same space group, with similar unit-cell parameters.« less

Crystal engineering: co-crystals of cinnamic acid derivatives with a pyridyl derivative co-crystallizer.

PubMed

Lorenzo, Daniel A; Forrest, Sebastian J K; Sparkes, Hazel A

2016-02-01

A number of hydrogen-bonded co-crystals, consisting of a cinnamic acid derivative and a pyridyl co-crystallizer, have been synthesized and their properties investigated by X-ray diffraction. Samples were prepared by recrystallization or solvent drop grinding of trans-cinnamic acid (1), 4-methylcinnamic acid (2), 4-methoxy cinnamic acid (3) or 3,4-methoxy cinnamic acid (4), with 4,4-dipyridyl (A), iso-nicotinamide (B) or nicotinamide (C). The X-ray single-crystal structures of seven novel co-crystals, obtained through recrystallization, are examined and the hydrogen-bonding interactions discussed. Consistent hydrogen-bonding motifs were observed for samples prepared when using 4,4-dipyridyl (A) or iso-nicotinamide (B) as the co-crystallizing agent. Powder X-ray diffraction analysis of the samples prepared by solvent drop grinding suggests the formation of ten co-crystals.

40-Tesla pulsed-field cryomagnet for single crystal neutron diffraction

NASA Astrophysics Data System (ADS)

Duc, F.; Tonon, X.; Billette, J.; Rollet, B.; Knafo, W.; Bourdarot, F.; Béard, J.; Mantegazza, F.; Longuet, B.; Lorenzo, J. E.; Lelièvre-Berna, E.; Frings, P.; Regnault, L.-P.

2018-05-01

We present the first long-duration and high duty cycle 40-T pulsed-field cryomagnet addressed to single crystal neutron diffraction experiments at temperatures down to 2 K. The magnet produces a horizontal field in a bi-conical geometry, ±15° and ±30° upstream and downstream of the sample, respectively. Using a 1.15 MJ mobile generator, magnetic field pulses of 100 ms length are generated in the magnet, with a rise time of 23 ms and a repetition rate of 6-7 pulses per hour at 40 T. The setup was validated for neutron diffraction on the CEA-CRG three-axis spectrometer IN22 at the Institut Laue Langevin.

Purification, crystallization and preliminary X-ray diffraction of human S100A15

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boeshans, Karen M.; Wolf, Ronald; Voscopoulos, Christopher

2006-05-01

S100 proteins are differentially expressed during epithelial cell maturation, tumorigenesis and inflammation. The novel human S100A15 protein has been cloned, expressed, purified and crystallized in two crystal forms, a triclinic and a monoclinic form, which diffract to 1.7 and 2.0 Å, respectively. Human S100A15 is a novel member of the S100 family of EF-hand calcium-binding proteins and was recently identified in psoriasis, where it is significantly upregulated in lesional skin. The protein is implicated as an effector in calcium-mediated signal transduction pathways. Although its biological function is unclear, the association of the 11.2 kDa S100A15 with psoriasis suggests that itmore » contributes to the pathogenesis of the disease and could provide a molecular target for therapy. To provide insight into the function of S100A15, the protein was crystallized to visualize its structure and to further the understanding of how the many similar calcium-binding mediator proteins in the cell distinguish their cognate target molecules. The S100A15 protein has been cloned, expressed and purified to homogeneity and produced two crystal forms. Crystals of form I are triclinic, with unit-cell parameters a = 33.5, b = 44.3, c = 44.8 Å, α = 71.2, β = 68.1, γ = 67.8° and an estimated two molecules in the asymmetric unit, and diffract to 1.7 Å resolution. Crystals of form II are monoclinic, with unit-cell parameters a = 82.1, b = 33.6, c = 52.2 Å, β = 128.2° and an estimated one molecule in the asymmetric unit, and diffract to 2.0 Å resolution. This structural analysis of the human S100A15 will further aid in the phylogenic comparison between the other members of the S100 protein family, especially the highly homologous paralog S100A7.« less

High quality self-separated GaN crystal grown on a novel nanoporous template by HVPE.

PubMed

Huo, Qin; Shao, Yongliang; Wu, Yongzhong; Zhang, Baoguo; Hu, Haixiao; Hao, Xiaopeng

2018-02-16

In this study, a novel nanoporous template was obtained by a two-step etching process from MOCVD-GaN/Al 2 O 3 (MGA) with electrochemical etching sequentially followed by chemical wet etching. The twice-etched MOCVD-GaN/Al 2 O 3 (TEMGA) templates were utilized to grow GaN crystals by hydride vapor phase epitaxy (HVPE) method. The GaN crystals were separated spontaneously from the TEMGA template with the assistance of voids formed by the etched nanopores. Several techniques were utilized to characterize the quality of the free-standing GaN crystals obtained from the TEMGA template. Results showed that the quality of the as-obtained GaN crystals was improved obviously compared with those grown on the MGA. This convenient technique can be applied to grow high-quality free-standing GaN crystals.

Optimization of crystallization conditions for biological macromolecules.

PubMed

McPherson, Alexander; Cudney, Bob

2014-11-01

For the successful X-ray structure determination of macromolecules, it is first necessary to identify, usually by matrix screening, conditions that yield some sort of crystals. Initial crystals are frequently microcrystals or clusters, and often have unfavorable morphologies or yield poor diffraction intensities. It is therefore generally necessary to improve upon these initial conditions in order to obtain better crystals of sufficient quality for X-ray data collection. Even when the initial samples are suitable, often marginally, refinement of conditions is recommended in order to obtain the highest quality crystals that can be grown. The quality of an X-ray structure determination is directly correlated with the size and the perfection of the crystalline samples; thus, refinement of conditions should always be a primary component of crystal growth. The improvement process is referred to as optimization, and it entails sequential, incremental changes in the chemical parameters that influence crystallization, such as pH, ionic strength and precipitant concentration, as well as physical parameters such as temperature, sample volume and overall methodology. It also includes the application of some unique procedures and approaches, and the addition of novel components such as detergents, ligands or other small molecules that may enhance nucleation or crystal development. Here, an attempt is made to provide guidance on how optimization might best be applied to crystal-growth problems, and what parameters and factors might most profitably be explored to accelerate and achieve success.

Optimization of crystallization conditions for biological macromolecules

PubMed Central

McPherson, Alexander; Cudney, Bob

2014-01-01

For the successful X-ray structure determination of macromolecules, it is first necessary to identify, usually by matrix screening, conditions that yield some sort of crystals. Initial crystals are frequently microcrystals or clusters, and often have unfavorable morphologies or yield poor diffraction intensities. It is therefore generally necessary to improve upon these initial conditions in order to obtain better crystals of sufficient quality for X-ray data collection. Even when the initial samples are suitable, often marginally, refinement of conditions is recommended in order to obtain the highest quality crystals that can be grown. The quality of an X-ray structure determination is directly correlated with the size and the perfection of the crystalline samples; thus, refinement of conditions should always be a primary component of crystal growth. The improvement process is referred to as optimization, and it entails sequential, incremental changes in the chemical parameters that influence crystallization, such as pH, ionic strength and precipitant concentration, as well as physical parameters such as temperature, sample volume and overall methodology. It also includes the application of some unique procedures and approaches, and the addition of novel components such as detergents, ligands or other small molecules that may enhance nucleation or crystal development. Here, an attempt is made to provide guidance on how optimization might best be applied to crystal-growth problems, and what parameters and factors might most profitably be explored to accelerate and achieve success. PMID:25372810

New methods for indexing multi-lattice diffraction data

PubMed Central

Gildea, Richard J.; Waterman, David G.; Parkhurst, James M.; Axford, Danny; Sutton, Geoff; Stuart, David I.; Sauter, Nicholas K.; Evans, Gwyndaf; Winter, Graeme

2014-01-01

A new indexing method is presented which is capable of indexing multiple crystal lattices from narrow wedges of diffraction data. The method takes advantage of a simplification of Fourier transform-based methods that is applicable when the unit-cell dimensions are known a priori. The efficacy of this method is demonstrated with both semi-synthetic multi-lattice data and real multi-lattice data recorded from crystals of ∼1 µm in size, where it is shown that up to six lattices can be successfully indexed and subsequently integrated from a 1° wedge of data. Analysis is presented which shows that improvements in data-quality indicators can be obtained through accurate identification and rejection of overlapping reflections prior to scaling. PMID:25286849

New methods for indexing multi-lattice diffraction data.

PubMed

Gildea, Richard J; Waterman, David G; Parkhurst, James M; Axford, Danny; Sutton, Geoff; Stuart, David I; Sauter, Nicholas K; Evans, Gwyndaf; Winter, Graeme

2014-10-01

A new indexing method is presented which is capable of indexing multiple crystal lattices from narrow wedges of diffraction data. The method takes advantage of a simplification of Fourier transform-based methods that is applicable when the unit-cell dimensions are known a priori. The efficacy of this method is demonstrated with both semi-synthetic multi-lattice data and real multi-lattice data recorded from crystals of ∼1 µm in size, where it is shown that up to six lattices can be successfully indexed and subsequently integrated from a 1° wedge of data. Analysis is presented which shows that improvements in data-quality indicators can be obtained through accurate identification and rejection of overlapping reflections prior to scaling.

New methods for indexing multi-lattice diffraction data

DOE PAGES

Gildea, Richard J.; Waterman, David G.; Parkhurst, James M.; ...

2014-09-27

A new indexing method is presented which is capable of indexing multiple crystal lattices from narrow wedges of diffraction data. The method takes advantage of a simplification of Fourier transform-based methods that is applicable when the unit-cell dimensions are known a priori. The efficacy of this method is demonstrated with both semi-synthetic multi-lattice data and real multi-lattice data recorded from crystals of ~1 µm in size, where it is shown that up to six lattices can be successfully indexed and subsequently integrated from a 1° wedge of data. Analysis is presented which shows that improvements in data-quality indicators can bemore » obtained through accurate identification and rejection of overlapping reflections prior to scaling.« less

Crystallization and preliminary X-ray diffraction studies of delta-toxin from Clostridium perfringens.

PubMed

Huyet, Jessica; Gilbert, Maryse; Popoff, Michel R; Basak, Ajit

2011-03-01

Clostridium perfringens is a Gram-positive anaerobic bacterium that is responsible for a wide range of diseases in humans and both wild and domesticated animals, including birds. C. perfringens is notable for its ability to produce a plethora of toxins, e.g. phospholipases C (alpha-toxin), pore-forming toxins (epsilon-toxin, beta-toxin and enterotoxin) and binary toxins (iota-toxin). Based on alpha-, beta-, epsilon- and iota-toxin production, the bacterium is classified into five different toxinotypes (A-E). Delta-toxin, which is a 32.6 kDa protein with 290 amino acids, is one of three haemolysins released by type C and possibly by type B strains of C. perfringens. This toxin is immunogenic and lytic to erythrocytes from the even-toed ungulates sheep, goats and pigs, and is cytotoxic to other cell types such as rabbit macrophages, human monocytes and blood platelets from goats, rabbits, guinea pigs and humans. The recombinant delta-toxin has been cloned, expressed, purified and crystallized in two different crystal forms by the hanging-drop vapour-diffusion method. Of these two different crystal forms, only the form II crystal diffracted to atomic resolution (dmin=2.4 Å), while the form I crystal diffracted to only 15 Å resolution. The form II crystals belonged to space group P2(1)2(1)2, with one molecule in the crystallographic asymmetric unit and unit-cell parameters a=49.66, b=58.48, c=112.93 Å.

Isolation, purification, crystallization, and preliminary X-ray diffraction study of the crystals of HU protein from M. gallisepticum

NASA Astrophysics Data System (ADS)

Nikolaeva, A. Yu.; Timofeev, V. I.; Boiko, K. M.; Korzhenevskii, D. A.; Rakitina, T. V.; Dorovatovskii, P. V.; Lipkin, A. V.

2015-11-01

HU proteins are involved in bacterial DNA and RNA repair. Since these proteins are absent in cells of higher organisms, inhibitors of HU proteins can be used as effective and safe antibiotics. The crystallization conditions for the M. gallisepticum HU protein were found and optimized by the vapor-diffusion method. The X-ray diffraction data set was collected to 2.91 Å resolution from the crystals grown by the vapor-diffusion method on a synchrotron source. The crystals of the HU protein belong to sp. gr. P41212 and have the following unit-cell parameters: a = b = 97.94 Å, c = 77.92 Å, α = β = γ = 90°.

The MORPHEUS II protein crystallization screen.

PubMed

Gorrec, Fabrice

2015-07-01

High-quality macromolecular crystals are a prerequisite for the process of protein structure determination by X-ray diffraction. Unfortunately, the relative yield of diffraction-quality crystals from crystallization experiments is often very low. In this context, innovative crystallization screen formulations are continuously being developed. In the past, MORPHEUS, a screen in which each condition integrates a mix of additives selected from the Protein Data Bank, a cryoprotectant and a buffer system, was developed. Here, MORPHEUS II, a follow-up to the original 96-condition initial screen, is described. Reagents were selected to yield crystals when none might be observed in traditional initial screens. Besides, the screen includes heavy atoms for experimental phasing and small polyols to ensure the cryoprotection of crystals. The suitability of the resulting novel conditions is shown by the crystallization of a broad variety of protein samples and their efficiency is compared with commercially available conditions.

The MORPHEUS II protein crystallization screen

PubMed Central

Gorrec, Fabrice

2015-01-01

High-quality macromolecular crystals are a prerequisite for the process of protein structure determination by X-ray diffraction. Unfortunately, the relative yield of diffraction-quality crystals from crystallization experiments is often very low. In this context, innovative crystallization screen formulations are continuously being developed. In the past, MORPHEUS, a screen in which each condition integrates a mix of additives selected from the Protein Data Bank, a cryoprotectant and a buffer system, was developed. Here, MORPHEUS II, a follow-up to the original 96-condition initial screen, is described. Reagents were selected to yield crystals when none might be observed in traditional initial screens. Besides, the screen includes heavy atoms for experimental phasing and small polyols to ensure the cryoprotection of crystals. The suitability of the resulting novel conditions is shown by the crystallization of a broad variety of protein samples and their efficiency is compared with commercially available conditions. PMID:26144227

7 Å Resolution in Protein 2-Dimentional-Crystal X-Ray Diffraction at Linac Coherent Light Source

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pedrini, Bill; Tsai, Ching-Ju; Capitani, Guido

2014-06-09

Membrane proteins arranged as two-dimensional (2D) crystals in the lipid en- vironment provide close-to-physiological structural information, which is essential for understanding the molecular mechanisms of protein function. X-ray diffraction from individual 2D crystals did not represent a suitable investigation tool because of radiation damage. The recent availability of ultrashort pulses from X-ray Free Electron Lasers (X-FELs) has now provided a mean to outrun the damage. Here we report on measurements performed at the LCLS X-FEL on bacteriorhodopsin 2D crystals mounted on a solid support and kept at room temperature. By merg- ing data from about a dozen of single crystalmore » diffraction images, we unambiguously identified the diffraction peaks to a resolution of 7 °A, thus improving the observable resolution with respect to that achievable from a single pattern alone. This indicates that a larger dataset will allow for reliable quantification of peak intensities, and in turn a corresponding increase of resolution. The presented results pave the way to further X-FEL studies on 2D crystals, which may include pump-probe experiments at subpicosecond time resolution.« less

Coherent diffraction imaging of nanoscale strain evolution in a single crystal under high pressure

PubMed Central

Yang, Wenge; Huang, Xiaojing; Harder, Ross; Clark, Jesse N.; Robinson, Ian K.; Mao, Ho-kwang

2013-01-01

The evolution of morphology and internal strain under high pressure fundamentally alters the physical property, structural stability, phase transition and deformation mechanism of materials. Until now, only averaged strain distributions have been studied. Bragg coherent X-ray diffraction imaging is highly sensitive to the internal strain distribution of individual crystals but requires coherent illumination, which can be compromised by the complex high-pressure sample environment. Here we report the successful de-convolution of these effects with the recently developed mutual coherent function method to reveal the three-dimensional strain distribution inside a 400 nm gold single crystal during compression within a diamond-anvil cell. The three-dimensional morphology and evolution of the strain under pressures up to 6.4 GPa were obtained with better than 30 nm spatial resolution. In addition to providing a new approach for high-pressure nanotechnology and rheology studies, we draw fundamental conclusions about the origin of the anomalous compressibility of nanocrystals. PMID:23575684

Coherent diffraction imaging of nanoscale strain evolution in a single crystal under high pressure.

PubMed

Yang, Wenge; Huang, Xiaojing; Harder, Ross; Clark, Jesse N; Robinson, Ian K; Mao, Ho-kwang

2013-01-01

The evolution of morphology and internal strain under high pressure fundamentally alters the physical property, structural stability, phase transition and deformation mechanism of materials. Until now, only averaged strain distributions have been studied. Bragg coherent X-ray diffraction imaging is highly sensitive to the internal strain distribution of individual crystals but requires coherent illumination, which can be compromised by the complex high-pressure sample environment. Here we report the successful de-convolution of these effects with the recently developed mutual coherent function method to reveal the three-dimensional strain distribution inside a 400 nm gold single crystal during compression within a diamond-anvil cell. The three-dimensional morphology and evolution of the strain under pressures up to 6.4 GPa were obtained with better than 30 nm spatial resolution. In addition to providing a new approach for high-pressure nanotechnology and rheology studies, we draw fundamental conclusions about the origin of the anomalous compressibility of nanocrystals.

X-ray Diffraction Crystal Calibration and Characterization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Michael J. Haugh; Richard Stewart; Nathan Kugland

2009-06-05

National Security Technologies’ X-ray Laboratory is comprised of a multi-anode Manson type source and a Henke type source that incorporates a dual goniometer and XYZ translation stage. The first goniometer is used to isolate a particular spectral band. The Manson operates up to 10 kV and the Henke up to 20 kV. The Henke rotation stages and translation stages are automated. Procedures have been developed to characterize and calibrate various NIF diagnostics and their components. The diagnostics include X-ray cameras, gated imagers, streak cameras, and other X-ray imaging systems. Components that have been analyzed include filters, filter arrays, grazing incidencemore » mirrors, and various crystals, both flat and curved. Recent efforts on the Henke system are aimed at characterizing and calibrating imaging crystals and curved crystals used as the major component of an X-ray spectrometer. The presentation will concentrate on these results. The work has been done at energies ranging from 3 keV to 16 keV. The major goal was to evaluate the performance quality of the crystal for its intended application. For the imaging crystals we measured the laser beam reflection offset from the X-ray beam and the reflectivity curves. For the curved spectrometer crystal, which was a natural crystal, resolving power was critical. It was first necessary to find sources of crystals that had sufficiently narrow reflectivity curves. It was then necessary to determine which crystals retained their resolving power after being thinned and glued to a curved substrate.« less

Structure and thermal expansion of Ca9Gd(VO4)7: A combined powder-diffraction and dilatometric study of a Czochralski-grown crystal

NASA Astrophysics Data System (ADS)

Paszkowicz, Wojciech; Shekhovtsov, Alexei; Kosmyna, Miron; Loiko, Pavel; Vilejshikova, Elena; Minikayev, Roman; Romanowski, Przemysław; Wierzchowski, Wojciech; Wieteska, Krzysztof; Paulmann, Carsten; Bryleva, Ekaterina; Belikov, Konstantin; Fitch, Andrew

2017-11-01

Materials of the Ca9RE(VO4)7 (CRVO) formula (RE = rare earth) and whitlockite-related structures are considered for applications in optoelectronics, e.g., in white-light emitting diodes and lasers. In the CRVO structure, the RE atoms are known to share the site occupation with Ca atoms at two or three among four Ca sites, with partial occupancy values depending on the choice of the RE atom. In this work, the structure and quality of a Czochralski-grown crystal of this family, Ca9Gd(VO4)7 (CGVO), are studied using X-ray diffraction methods. The room-temperature structure is refined using the powder diffraction data collected at a high-resolution synchrotron beamline ID22 (ESRF, Grenoble); for comparison purposes, a laboratory diffraction pattern was collected and analyzed, as well. The site occupancies are discussed on the basis of comparison with literature data of isostructural synthetic crystals of the CRVO series. The results confirm the previously reported site-occupation scheme and indicate a tendency of the CGVO compound to adopt a Gd-deficient composition. Moreover, the thermal expansion coefficient is determined for CGVO as a function of temperature in the 302-1023 K range using laboratory diffraction data. Additionally, for CGVO and six other single crystals of the same family, thermal expansion is studied in the 298-473 K range, using the dilatometric data. The magnitude and anisotropy of thermal expansion, being of importance for laser applications, are discussed for these materials.

Microfocus diffraction from different regions of a protein crystal: structural variations and unit-cell polymorphism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thompson, Michael C.; Cascio, Duilio; Yeates, Todd O.

Real macromolecular crystals can be non-ideal in a myriad of ways. This often creates challenges for structure determination, while also offering opportunities for greater insight into the crystalline state and the dynamic behavior of macromolecules. To evaluate whether different parts of a single crystal of a dynamic protein, EutL, might be informative about crystal and protein polymorphism, a microfocus X-ray synchrotron beam was used to collect a series of 18 separate data sets from non-overlapping regions of the same crystal specimen. A principal component analysis (PCA) approach was employed to compare the structure factors and unit cells across the datamore » sets, and it was found that the 18 data sets separated into two distinct groups, with largeRvalues (in the 40% range) and significant unit-cell variations between the members of the two groups. This categorization mapped the different data-set types to distinct regions of the crystal specimen. Atomic models of EutL were then refined against two different data sets obtained by separately merging data from the two distinct groups. A comparison of the two resulting models revealed minor but discernable differences in certain segments of the protein structure, and regions of higher deviation were found to correlate with regions where larger dynamic motions were predicted to occur by normal-mode molecular-dynamics simulations. The findings emphasize that large spatially dependent variations may be present across individual macromolecular crystals. This information can be uncovered by simultaneous analysis of multiple partial data sets and can be exploited to reveal new insights about protein dynamics, while also improving the accuracy of the structure-factor data ultimately obtained in X-ray diffraction experiments.« less

Purification, crystallization and preliminary X-ray diffraction of SecDF, a translocon-associated membrane protein, from Thermus thermophilus

PubMed Central

Tsukazaki, Tomoya; Mori, Hiroyuki; Fukai, Shuya; Numata, Tomoyuki; Perederina, Anna; Adachi, Hiroaki; Matsumura, Hiroyoshi; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Sasaki, Takatomo; Vassylyev, Dmitry G.; Nureki, Osamu; Ito, Koreaki

2006-01-01

Thermus thermophilus has a multi-path membrane protein, TSecDF, as a single-chain homologue of Escherichia coli SecD and SecF, which form a translocon-associated complex required for efficient preprotein translocation and membrane-protein integration. Here, the cloning, expression in E. coli, purification and crystallization of TSecDF are reported. Overproduced TSecDF was solubilized with dodecylmaltoside, chromatographically purified and crystallized by vapour diffusion in the presence of polyethylene glycol. The crystals yielded a maximum resolution of 4.2 Å upon X-ray irradiation, revealing that they belonged to space group P43212. Attempts were made to improve the diffraction quality of the crystals by combinations of micro-stirring, laser-light irradiation and dehydration, which led to the eventual collection of complete data sets at 3.74 Å resolution and preliminary success in the single-wavelength anomalous dispersion analysis. These results provide information that is essential for the determination of the three-dimensional structure of this important membrane component of the protein-translocation machinery. PMID:16582489

Liquid crystal point diffraction interferometer. Ph.D. Thesis - Arizona Univ., 1995

NASA Technical Reports Server (NTRS)

Mercer, Carolyn R.

1995-01-01

A new instrument, the liquid crystal point diffraction-interferometer (LCPDI), has been developed for the measurement of phase objects. This instrument maintains the compact, robust design of Linnik's point diffraction interferometer (PDI) and adds to it phase stepping capability for quantitative interferogram analysis. The result is a compact, simple to align, environmentally insensitive interferometer capable of accurately measuring optical wavefronts with very high data density and with automated data reduction. This dissertation describes the theory of both the PDI and liquid crystal phase control. The design considerations for the LCPDI are presented, including manufacturing considerations. The operation and performance of the LCPDI are discussed, including sections regarding alignment, calibration, and amplitude modulation effects. The LCPDI is then demonstrated using two phase objects: defocus difference wavefront, and a temperature distribution across a heated chamber filled with silicone oil. The measured results are compared to theoretical or independently measured results and show excellent agreement. A computer simulation of the LCPDI was performed to verify the source of observed periodic phase measurement error. The error stems from intensity variations caused by dye molecules rotating within the liquid crystal layer. Methods are discussed for reducing this error. Algorithms are presented which reduce this error; they are also useful for any phase-stepping interferometer that has unwanted intensity fluctuations, such as those caused by unregulated lasers.

Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi

Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 Mmore » sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.« less

Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum.

PubMed

Cranston, Laura J; Roszak, Aleksander W; Cogdell, Richard J

2014-06-01

LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment-protein complex that is involved in harvesting light energy and transferring it to the LH1-RC `core' complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a=b=109.36, c=80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer.

Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum

PubMed Central

Cranston, Laura J.; Roszak, Aleksander W.; Cogdell, Richard J.

2014-01-01

LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment–protein complex that is involved in harvesting light energy and transferring it to the LH1–RC ‘core’ complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a = b = 109.36, c = 80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer. PMID:24915099

Crystallization and crystal manipulation of a steric chaperone in complex with its lipase substrate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pauwels, Kris, E-mail: krpauwel@vub.ac.be; Loris, Remy; Vandenbussche, Guy

2005-08-01

Crystals of the lipase of B. glumae in complex with its specific foldase were obtained in two forms. Crystallization, crystal manipulation and preliminary X-ray diffraction analysis are described. Bacterial lipases that are secreted via the type II secretion pathway require a lipase-specific foldase in order to obtain their native and biologically active conformation in the periplasmic space. The lipase–foldase complex from Burkholderia glumae (319 and 333 residues, respectively) was crystallized in two crystal forms. One crystal form belongs to space group P3{sub 1}21 (P3{sub 2}21), with unit-cell parameters a = b = 122.3, c = 98.2 Å. A procedure ismore » presented which improved the diffraction of these crystals from ∼5 to 2.95 Å. For the second crystal form, which belonged to space group C2 with unit-cell parameters a = 183.0, b = 75.7, c = 116.6 Å, X-ray data were collected to 1.85 Å.« less

X-ray diffraction, spectroscopic and mechanical studies on potential organic NLO materials of metaNitroaniline and N-3-Nitrophenyl Acetamide single crystals

NASA Astrophysics Data System (ADS)

Senthil, S.; Madhavan, J.

2015-02-01

In the present paper, attempts were made to grow good quality metaNitroaniline (mNA) and N-3-Nitrophenyl (3-NAA) single crystals. The lattice parameter values from the Powder X-ray diffraction pattern confirms that mNA belongs to orthorhombic crystal system with the unit cell parameter values of a = 6.501 Å, b = 19.330 Å and c = 5.082 Å with space group Pbc21. Similarly the powder XRD data indicates that 3-NAA crystal retained its monoclinic structure with lattice parameter values a = 9.762 Å, b =13.287 Å, c =13.226 Å, and β = 102.99°. Investigation has been carried out to assign the vibrational frequencies of the grown crystals by Fourier Transform infrared spectroscopy technique. The SHG efficiency of mNA and 3NAA was determined by Kurtz and Perry powder technique. The Optical absorption study confirms the suitability of the crystals for device applications. The mechanical properties of the grown crystals have been studied using Vickers microhardness tester.

Diffraction Techniques in Structural Biology.

PubMed

Egli, Martin

2016-06-01

A detailed understanding of chemical and biological function and the mechanisms underlying the molecular activities ultimately requires atomic-resolution structural data. Diffraction-based techniques such as single-crystal X-ray crystallography, electron microscopy, and neutron diffraction are well established and they have paved the road to the stunning successes of modern-day structural biology. The major advances achieved in the last twenty years in all aspects of structural research, including sample preparation, crystallization, the construction of synchrotron and spallation sources, phasing approaches, and high-speed computing and visualization, now provide specialists and nonspecialists alike with a steady flow of molecular images of unprecedented detail. The present unit combines a general overview of diffraction methods with a detailed description of the process of a single-crystal X-ray structure determination experiment, from chemical synthesis or expression to phasing and refinement, analysis, and quality control. For novices it may serve as a stepping-stone to more in-depth treatises of the individual topics. Readers relying on structural information for interpreting functional data may find it a useful consumer guide. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.

Purification, crystallization and preliminary X-ray diffraction studies of UDP-N-acetylglucosamine pyrophosphorylase from Candida albicans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maruyama, Daisuke; Nishitani, Yuichi; Nonaka, Tsuyoshi

2006-12-01

UDP-N-acetylglucosamine pyrophosphorylase was purified and crystallized and X-ray diffraction data were collected to 2.3 Å resolution. UDP-N-acetylglucosamine pyrophosphorylase (UAP) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine. UAP from Candida albicans was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals of the substrate and product complexes both diffract X-rays to beyond 2.3 Å resolution using synchrotron radiation. The crystals of the substrate complex belong to the triclinic space group P1, with unit-cell parameters a = 47.77, b = 62.89, c = 90.60 Å, α = 90.01, β = 97.72, γ = 92.88°, whereas those of the productmore » complex belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.95, b = 90.87, c = 94.88 Å.« less

Angle-resolved reflection spectroscopy of high-quality PMMA opal crystal

NASA Astrophysics Data System (ADS)

Nemtsev, Ivan V.; Tambasov, Igor A.; Ivanenko, Alexander A.; Zyryanov, Victor Ya.

2018-02-01

PMMA opal crystal was prepared by a simple hybrid method, which includes sedimentation, meniscus formation and evaporation. We investigated three surfaces of this crystal by angle-resolved reflective light spectroscopy and SEM study. The angle-resolved reflective measurements were carried out in the 400-1100 nm range. We have determined the high-quality ordered surface of the crystal region. Narrow particle size distribution of the surface has been revealed. The average particle diameter obtained with SEM was nearly 361 nm. The most interesting result was that reflectivity of the surface turned out up to 98% at normal light incidence. Using a fit of dependences of the maximum reflectivity wavelength from an angle based on the Bragg-Snell law, the wavelength of maximum 0° reflectivity, the particle diameter and the fill factor have been determined. For the best surface maximum reflectivity wavelength of a 0° angle was estimated to be 869 nm. The particle diameter and fill factor were calculated as 372 nm and 0.8715, respectively. The diameter obtained by fitting is in excellent agreement with the particle diameter obtained with SEM. The reflectivity maximum is assumed to increase significantly when increasing the fill factor. We believe that using our simple approach to manufacture PMMA opal crystals will significantly increase the fabrication of high-quality photonic crystal templates and thin films.

Crystallization and evaluation of hen egg-white lysozyme crystals for protein pH titration in the crystalline state.

PubMed

Iwai, Wakari; Yagi, Daichi; Ishikawa, Takuya; Ohnishi, Yuki; Tanaka, Ichiro; Niimura, Nobuo

2008-05-01

To observe the ionized status of the amino acid residues in proteins at different pH (protein pH titration in the crystalline state) by neutron diffraction, hen egg-white lysozyme was crystallized over a wide pH range (2.5-8.0). Crystallization phase diagrams at pH 2.5, 6.0 and 7.5 were determined. At pH < 4.5 the border between the metastable region and the nucleation region shifted to the left (lower precipitant concentration) in the phase diagram, and at pH > 4.5 the border shifted to the right (higher precipitant concentration). The qualities of these crystals were characterized using the Wilson plot method. The qualities of all crystals at different pH were more or less equivalent (B-factor values within 25-40). It is expected that neutron diffraction analysis of these crystals of different pH provides equivalent data in quality for discussions of protein pH titration in the crystalline state of hen egg-white lysozyme.

A Test of Macromolecular Crystallization in Microgravity: Large, Well-Ordered Insulin Crystals

NASA Technical Reports Server (NTRS)

Borgstahl, Gloria E. O.; Vahedi-Faridi, Ardeschir; Lovelace, Jeff; Bellamy, Henry D.; Snell, Edward H.; Whitaker, Ann F. (Technical Monitor)

2001-01-01

Crystals of insulin grown in microgravity on space shuttle mission STS-95 were extremely well-ordered and unusually large (many > 2 mm). The physical characteristics of six microgravity and six earth-grown crystals were examined by X-ray analysis employing superfine f slicing and unfocused synchrotron radiation. This experimental setup allowed hundreds of reflections to be precisely examined for each crystal in a short period of time. The microgravity crystals were on average 34 times larger, had 7 times lower mosaicity, had 54 times higher reflection peak heights and diffracted to significantly higher resolution than their earth grown counterparts. A single mosaic domain model could account for reflections in microgravity crystals whereas reflections from earth crystals required a model with multiple mosaic domains. This statistically significant and unbiased characterization indicates that the microgravity environment was useful for the improvement of crystal growth and resultant diffraction quality in insulin crystals and may be similarly useful for macromolecular crystals in general.

Crystallization and preliminary X-ray diffraction analysis of mouse galectin-4 N-terminal carbohydrate recognition domain in complex with lactose

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krejčiříková, Veronika; Fábry, Milan; Marková, Vladimíra

2008-07-01

Mouse galectin-4 carbohydrate binding domain was overexpressed in E. coli and crystallized in the presence of lactose. The crystals belong to tetragonal space group P42{sub 1}2 and diffraction data were collected to 2.1 Å resolution. Galectin-4 is thought to play a role in the process of tumour conversion of cells of the alimentary tract and the breast tissue; however, its exact function remains unknown. With the aim of elucidating the structural basis of mouse galectin-4 (mGal-4) binding specificity, we have undertaken X-ray analysis of the N-terminal domain, CRD1, of mGal-4 in complex with lactose (the basic building block of knownmore » galectin-4 carbohydrate ligands). Crystals of CRD1 in complex with lactose were obtained using vapour-diffusion techniques. The crystals belong to tetragonal space group P42{sub 1}2 with unit-cell parameters a = 91.1, b = 91.16, c = 57.10 Å and preliminary X-ray diffraction data were collected to 3.2 Å resolution. An optimized crystallization procedure and cryocooling protocol allowed us to extend resolution to 2.1 Å. Structure refinement is currently under way; the initial electron-density maps clearly show non-protein electron density in the vicinity of the carbohydrate binding site, indicating the presence of one lactose molecule. The structure will help to improve understanding of the binding specificity and function of the potential colon cancer marker galectin-4.« less

Crystallization and preliminary X-ray diffraction analysis of the wild-type haloalkane dehalogenase DhaA and its variant DhaA13 complexed with different ligands.

PubMed

Stsiapanava, Alena; Chaloupkova, Radka; Fortova, Andrea; Brynda, Jiri; Weiss, Manfred S; Damborsky, Jiri; Smatanova, Ivana Kuta

2011-02-01

Haloalkane dehalogenases make up an important class of hydrolytic enzymes which catalyse the cleavage of carbon-halogen bonds in halogenated aliphatic compounds. There is growing interest in these enzymes owing to their potential use in environmental and industrial applications. The haloalkane dehalogenase DhaA from Rhodococcus rhodochrous NCIMB 13064 can slowly detoxify the industrial pollutant 1,2,3-trichloropropane (TCP). Structural analysis of this enzyme complexed with target ligands was conducted in order to obtain detailed information about the structural limitations of its catalytic properties. In this study, the crystallization and preliminary X-ray analysis of complexes of wild-type DhaA with 2-propanol and with TCP and of complexes of the catalytically inactive variant DhaA13 with the dye coumarin and with TCP are described. The crystals of wild-type DhaA were plate-shaped and belonged to the triclinic space group P1, while the variant DhaA13 can form prism-shaped crystals belonging to the orthorhombic space group P2(1)2(1)2(1) as well as plate-shaped crystals belonging to the triclinic space group P1. Diffraction data for crystals of wild-type DhaA grown from crystallization solutions with different concentrations of 2-propanol were collected to 1.70 and 1.26 Å resolution, respectively. A prism-shaped crystal of DhaA13 complexed with TCP and a plate-shaped crystal of the same variant complexed with the dye coumarin diffracted X-rays to 1.60 and 1.33 Å resolution, respectively. A crystal of wild-type DhaA and a plate-shaped crystal of DhaA13, both complexed with TCP, diffracted to atomic resolutions of 1.04 and 0.97 Å, respectively.

A second-generation liquid crystal phase-shifting point-diffraction interferometer employing structured substrates

NASA Astrophysics Data System (ADS)

Marshall, Kenneth L.; Adlesberger, Kathleen; Kolodzie, Benjamin; Myhre, Graham; Griffin, DeVon W.

2005-08-01

By design, point-diffraction interferometers are much less sensitive to environmental disturbances than dual-path interferometers, but, until very recently, have not been capable of phase shifting. The liquid crystal point-diffraction interferometer (LCPDI) utilizes a dye-doped, liquid crystal (LC) electro-optical device that functions as both the point-diffraction source and the phase-shifting element, yielding a phase-shifting diagnostic device that is significantly more compact and robust while using fewer optical elements than conventional dual-path interferometers. These attributes make the LCPDI of special interest for diagnostic applications in the scientific, commercial, military, and industrial sectors, where vibration insensitivity, power requirements, size, weight, and cost are critical issues. Until very recently, LCPDI devices have used a plastic microsphere embedded in the LC fluid layer as the point-diffraction source. The process for fabricating microsphere-based LCPDI devices is low-yield, labor-intensive, and very "hands-on" great care and skill are required to produce devices with adequate interference fringe contrast for diagnostic measurements. With the goal of evolving the LCPDI beyond the level of a laboratory prototype in mind, we have developed "second-generation" LCPDI devices in which the reference-diffracting elements are an integral part of the substrates by depositing a suitable optical material (vapor-deposited thin films or photoresist) directly onto the substrate surface. These "structured" substrates eliminate many of the assembly difficulties and performance limitations of current LCPDI devices as well as open the possibility of mass-producing LCPDI devices at low cost by the same processes used to manufacture commercial LC displays.

Anisotropic Light Diffraction by Ultrasound in Crystals with Strong Acoustic Anisotropy

NASA Astrophysics Data System (ADS)

Voloshin, Andrey S.; Balakshy, Vladimir I.

In modern acousto-optics, crystalline materials are used predominantly for manufacturing acousto-optic instruments. Among these materials, such crystals as paratellurite, tellurium, calomel, TAS and some others occupy a prominent place, which are distinguished by exceptionally large anisotropy of acoustic properties. In this work, the influence of acoustic beam energy walk-off on characteristics of Bragg diffraction of light is studied by the example of tellurium crystal. It is shown that the walk-off can substantially change angular and frequency ranges, resulting in their narrowing or broadening subject to position of the operating point in the Bragg angle frequency characteristic. Coefficients of broadening are introduced for characterization of this effect.

Strategies for the crystallization of viruses: using phase diagrams and gels to produce 3D crystals of Grapevine fanleaf virus.

PubMed

Schellenberger, Pascale; Demangeat, Gérard; Lemaire, Olivier; Ritzenthaler, Christophe; Bergdoll, Marc; Oliéric, Vincent; Sauter, Claude; Lorber, Bernard

2011-05-01

The small icosahedral plant RNA nepovirus Grapevine fanleaf virus (GFLV) is specifically transmitted by a nematode and causes major damage to vineyards worldwide. To elucidate the molecular mechanisms underlying the recognition between the surface of its protein capsid and cellular components of its vector, host and viral proteins synthesized upon infection, the wild type GFLV strain F13 and a natural mutant (GFLV-TD) carrying a Gly₂₉₇Asp mutation were purified, characterized and crystallized. Subsequently, the geometry and volume of their crystals was optimized by establishing phase diagrams. GFLV-TD was twice as soluble as the parent virus in the crystallization solution and its crystals diffracted X-rays to a resolution of 2.7 Å. The diffraction limit of GFLV-F13 crystals was extended from 5.5 to 3 Å by growth in agarose gel. Preliminary crystallographic analyses indicate that both types of crystals are suitable for structure determination. Keys for the successful production of GFLV crystals include the rigorous quality control of virus preparations, crystal quality improvement using phase diagrams, and crystal lattice reinforcement by growth in agarose gel. These strategies are applicable to the production of well-diffracting crystals of other viruses and macromolecular assemblies. Copyright © 2011 Elsevier Inc. All rights reserved.

Crystallization of a fungal lytic polysaccharide monooxygenase expressed from glycoengineered Pichia pastoris for X-ray and neutron diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

O'Dell, William B.; Swartz, Paul D.; Weiss, Kevin L.

Lytic polysaccharide monooxygenases (LPMOs) are carbohydrate-disrupting enzymes secreted by bacteria and fungi that break glycosidic bondsviaan oxidative mechanism. Fungal LPMOs typically act on cellulose and can enhance the efficiency of cellulose-hydrolyzing enzymes that release soluble sugars for bioethanol production or other industrial uses. The enzyme PMO-2 fromNeurospora crassa(NcPMO-2) was heterologously expressed inPichia pastoristo facilitate crystallographic studies of the fungal LPMO mechanism. Diffraction resolution and crystal morphology were improved by expressingNcPMO-2 from a glycoengineered strain ofP. pastorisand by the use of crystal seeding methods, respectively. These improvements resulted in high-resolution (1.20 Å) X-ray diffraction data collection at 100 K and themore » production of a largeNcPMO-2 crystal suitable for room-temperature neutron diffraction data collection to 2.12 Å resolution.« less

A multi-dataset data-collection strategy produces better diffraction data

PubMed Central

Liu, Zhi-Jie; Chen, Lirong; Wu, Dong; Ding, Wei; Zhang, Hua; Zhou, Weihong; Fu, Zheng-Qing; Wang, Bi-Cheng

2011-01-01

A multi-dataset (MDS) data-collection strategy is proposed and analyzed for macromolecular crystal diffraction data acquisition. The theoretical analysis indicated that the MDS strategy can reduce the standard deviation (background noise) of diffraction data compared with the commonly used single-dataset strategy for a fixed X-ray dose. In order to validate the hypothesis experimentally, a data-quality evaluation process, termed a readiness test of the X-ray data-collection system, was developed. The anomalous signals of sulfur atoms in zinc-free insulin crystals were used as the probe to differentiate the quality of data collected using different data-collection strategies. The data-collection results using home-laboratory-based rotating-anode X-ray and synchrotron X-ray systems indicate that the diffraction data collected with the MDS strategy contain more accurate anomalous signals from sulfur atoms than the data collected with a regular data-collection strategy. In addition, the MDS strategy offered more advantages with respect to radiation-damage-sensitive crystals and better usage of rotating-anode as well as synchrotron X-rays. PMID:22011470

Crystallization and preliminary X-ray analysis of a family 19 glycosyl hydrolase from Carica papaya latex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huet, Joëlle, E-mail: jhuet@ulb.ac.be; Azarkan, Mohamed; Looze, Yvan

2008-05-01

A chitinase isolated from the latex of the tropical species Carica papaya has been crystallized. The addition of N-acetyl-d-glucosamine to the crystallization solution has improved the diffraction quality resolution of the crystal to 1.8 Å resolution. A chitinase isolated from the latex of the tropical species Carica papaya has been purified to homogeneity and crystallized. This enzyme belongs to glycosyl hydrolase family 19 and exhibits exceptional resistance to proteolysis. The initially observed crystals, which diffracted to a resolution of 2.0 Å, were improved through modification of the crystallization protocol. Well ordered crystals were subsequently obtained using N-acetyl-d-glucosamine, the monomer resultingmore » from the hydrolysis of chitin, as an additive to the crystallization solution. Here, the characterization of a chitinase crystal that belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 69.08, b = 44.79, c = 76.73 Å, β = 95.33° and two molecules per asymmetric unit, is reported. Diffraction data were collected to a resolution of 1.8 Å. Structure refinement is currently in progress.« less

Streaking images that appear only in the plane of diffraction in undoped GaAs single crystals: Diffraction imaging (topography) by monochromatic synchrotron radiation

NASA Technical Reports Server (NTRS)

Kuriyama, Masao; Steiner, Bruce; Dobbyn, Ronald C.; Laor, Uri; Larson, David; Brown, Margaret

1988-01-01

Streaking images restricted to the direction of the diffraction (scattering) vector have been observed on transmission through undoped GaAs. These disruption images (caused by the reduction of diffraction in the direction of observation) appear both in the forward and in Bragg diffracted directions in monochromatic synchrontron radiation diffraction imaging. This previously unobserved phenomenon can be explained in terms of planar defects (interfaces) or platelets which affects the absorption coefficient in anomalous transmission. Such regions of the crystal look perfect despite the presence of imperfections when the scattering vector is not perpendicular to the normal of the platelets. The observed crystallographic orientation of these interfaces strongly indicates that they are antiphase boundaries.

Perfectly Cold Crystals: What Happens When They Are X-rayed?

NASA Technical Reports Server (NTRS)

vanderWoerd, Mark; Ferree, Darren S.; Snell, Edward H.

2003-01-01

For many macromolecular crystals the cryo-preservation of these crystals during X-ray data collection is of crucial importance, particularly at synchrotron facilities where the crystals rapidly receive a high dose of radiation. A practical variable to ensure adequate preservation is the variation of the cryo-protectant present when the crystal is preserved. Our initial approach to study X-ray diffraction data quality as a function of cryo-protectant present when preserving a xylose isomerase crystal shows that the data quality can be tremendously improved by recipe adjustment. Guided by crystal mosaicity estimates, we optimized crystal growth conditions to obtain cryo-preserved xylose isomerase crystals that withstand a very high dose of X-rays, with only the smallest amount of radiation damage at ultra-high resolution (1.2Angstroms). The rate at which damage occurs allowed us to collect a series of complete data sets, which show how the data degradation proceeds over time. We are here presenting data for the xylose isomerase crystallization recipe improvement and our interpretation of the crystal degradation process during X-ray data collection.

Characterization of high energy Xe ion irradiation effects in single crystal molybdenum with depth-resolved synchrotron microbeam diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yun, Di; Miao, Yinbin; Xu, Ruqing

2016-04-01

Microbeam X-ray diffraction experiments were conducted at beam line 34-ID of the Advanced Photon Source (APS) on fission fragment energy Xe heavy ion irradiated single crystal Molybdenum (Mo). Lattice strain measurements were obtained with a depth resolution of 0.7 mu m, which is critical in resolving the peculiar heterogeneity of irradiation damage associated with heavy ion irradiation. Q-space diffraction peak shift measurements were correlated with lattice strain induced by the ion irradiations. Transmission electron microscopy (TEM) characterizations were performed on the as-irradiated materials as well. Nanometer sized Xe bubble microstructures were observed via TEM. Molecular Dynamics (MD) simulations were performedmore » to help interpret the lattice strain measurement results from the experiment. This study showed that the irradiation effects by fission fragment energy Xe ion irradiations can be collaboratively understood with the depth resolved X-ray diffraction and TEM measurements under the assistance of MD simulations. (c) 2015 Elsevier B.V. All rights reserved.« less

Can Solution Supersaturation Affect Protein Crystal Quality?

NASA Technical Reports Server (NTRS)

Gorti, Sridhar

2013-01-01

The formation of large protein crystals of "high quality" is considered a characteristic manifestation of microgravity. The physical processes that predict the formation of large, high quality protein crystals in the microgravity environment of space are considered rooted in the existence of a "depletion zone" in the vicinity of crystal. Namely, it is considered reasonable that crystal quality suffers in earth-grown crystals as a result of the incorporation of large aggregates, micro-crystals and/or large molecular weight "impurities", processes which are aided by density driven convective flow or mixing at the crystal-liquid interface. Sedimentation and density driven convection produce unfavorable solution conditions in the vicinity of the crystal surface, which promotes rapid crystal growth to the detriment of crystal size and quality. In this effort, we shall further present the hypothesis that the solution supersaturatoin at the crystal surface determines the growth mechanism, or mode, by which protein crystals grow. It is further hypothesized that protein crystal quality is affected by the mechanism or mode of crystal growth. Hence the formation of a depletion zone in microgravity environment is beneficial due to inhibition of impurity incorporatoin as well as preventing a kinetic roughening transition. It should be noted that for many proteins the magnitude of neither protein crystal growth rates nor solution supersaturation are predictors of a kinetic roughening transition. That is, the kinetic roughening transition supersaturation must be dtermined for each individual protein.

Crystallization and preliminary X-ray diffraction analysis of the amidase domain of allophanate hydrolase from Pseudomonas sp. strain ADP

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balotra, Sahil; Newman, Janet; French, Nigel G.

2014-02-19

The amidase domain of the allophanate hydrolase AtzF from Pseudomonas sp. strain ADP has been crystallized and preliminary X-ray diffraction data have been collected. The allophanate hydrolase from Pseudomonas sp. strain ADP was expressed and purified, and a tryptic digest fragment was subsequently identified, expressed and purified. This 50 kDa construct retained amidase activity and was crystallized. The crystals diffracted to 2.5 Å resolution and adopted space group P2{sub 1}, with unit-cell parameters a = 82.4, b = 179.2, c = 112.6 Å, β = 106.6°.

Flat liquid crystal diffractive lenses with variable focus and magnification

NASA Astrophysics Data System (ADS)

Valley, Pouria

Non-mechanical variable lenses are important for creating compact imaging devices. Various methods employing dielectrically actuated lenses, membrane lenses, and liquid crystal lenses were previously proposed [1-4]. In This dissertation the design, fabrication, and characterization of innovative flat tunable-focus liquid crystal diffractive lenses (LCDL) are presented. LCDL employ binary Fresnel zone electrodes fabricated on Indium-Tin-Oxide using conventional micro-photolithography. The light phase can be adjusted by varying the effective refractive index of a nematic liquid crystal sandwiched between the electrodes and a reference substrate. Using a proper voltage distribution across various electrodes the focal length can be changed between several discrete values. Electrodes are shunted such that the correct phase retardation step sequence is achieved. If the number of 2pi zone boundaries is increased by a factor of m the focal length is changed from f to f/m based on the digitized Fresnel zone equation: f = rm2/2mlambda, where r m is mth zone radius, and lambda is the wavelength. The chromatic aberration of the diffractive lens is addressed and corrected by adding a variable fluidic lens. These LCDL operate at very low voltage levels (+/-2.5V ac input), exhibit fast switching times (20-150 ms), can have large apertures (>10 mm), and small form factor, and are robust and insensitive to vibrations, gravity, and capillary effects that limit membrane and dielectrically actuated lenses. Several tests were performed on the LCDL including diffraction efficiency measurement, switching dynamics, and hybrid imaging with a refractive lens. Negative focal lengths are achieved by adjusting the voltages across electrodes. Using these lenses in combination, magnification can be changed and zoom lenses can be formed. These characteristics make LCDL a good candidate for a variety of applications including auto-focus and zoom lenses in compact imaging devices such as camera

Crystallization and preliminary X-ray diffraction study of phosphoribosyl pyrophosphate synthetase from E. Coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Timofeev, V. I., E-mail: inna@ns.crys.ras.ru; Abramchik, Yu. A., E-mail: tostars@mail.ru; Zhukhlistova, N. E., E-mail: ugama@yandex.ru

2015-09-15

Enzymes of the phosphoribosyl pyrophosphate synthetase family (PRPPS, EC 2.7.6.1) catalyze the formation of 5-phosphoribosyl pyrophosphate (5-PRPP) from adenosine triphosphate and ribose 5-phosphate. 5-Phosphoribosyl pyrophosphate is an important intermediate in the synthesis of purine, pyrimidine, and pyridine nucleotides, as well as of the amino acids histidine and tryptophan. The crystallization conditions for E. coli PRPPS were found by the vapor-diffusion technique and were optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals grown by the counter-diffusion technique using a synchrotron radiation source to 3.1-Å resolution. The crystals of PRPPS belong to sp.more » gr. P6{sub 3}22 and have the following unit-cell parameters: a = b = 104.44 Å, c = 124.98 Å, α = β = 90°, γ = 120°. The collected X-ray diffraction data set is suitable for the solution of the three-dimensional structure of PRPPS at 3.1-Å resolution.« less

Solvent minimization induces preferential orientation and crystal clustering in serial micro-crystallography on micro-meshes, in situ plates and on a movable crystal conveyor belt.

PubMed

Soares, Alexei S; Mullen, Jeffrey D; Parekh, Ruchi M; McCarthy, Grace S; Roessler, Christian G; Jackimowicz, Rick; Skinner, John M; Orville, Allen M; Allaire, Marc; Sweet, Robert M

2014-11-01

X-ray diffraction data were obtained at the National Synchrotron Light Source from insulin and lysozyme crystals that were densely deposited on three types of surfaces suitable for serial micro-crystallography: MiTeGen MicroMeshes™, Greiner Bio-One Ltd in situ micro-plates, and a moving kapton crystal conveyor belt that is used to deliver crystals directly into the X-ray beam. 6° wedges of data were taken from ∼100 crystals mounted on each material, and these individual data sets were merged to form nine complete data sets (six from insulin crystals and three from lysozyme crystals). Insulin crystals have a parallelepiped habit with an extended flat face that preferentially aligned with the mounting surfaces, impacting the data collection strategy and the design of the serial crystallography apparatus. Lysozyme crystals had a cuboidal habit and showed no preferential orientation. Preferential orientation occluded regions of reciprocal space when the X-ray beam was incident normal to the data-collection medium surface, requiring a second pass of data collection with the apparatus inclined away from the orthogonal. In addition, crystals measuring less than 20 µm were observed to clump together into clusters of crystals. Clustering required that the X-ray beam be adjusted to match the crystal size to prevent overlapping diffraction patterns. No additional problems were encountered with the serial crystallography strategy of combining small randomly oriented wedges of data from a large number of specimens. High-quality data able to support a realistic molecular replacement solution were readily obtained from both crystal types using all three serial crystallography strategies.

Crystallization of human estrogenic 17β-hydroxysteroid dehydrogenase under microgravity

NASA Astrophysics Data System (ADS)

Zhu, Dao-Wei; Zhou, Ming; Mao, Ying; Labrie, Fernand; Lin, Sheng-Xiang

1995-11-01

Human 17β-hydroxysteroid dehydrogenase has been crystallized on the ground in the complex form with NADP + and a complete data set of the crystal was primarily collected at 2.9 Å [D.-W. Zhu, X. Lee, R. Breton, D. Ghosh, W. Pangborn, W.L. Duax and S.-X. Lin, J. Mol. Biol. 234 (1993) 242]. To eliminate multiseeding, formation of multicrystals and to obtain higher quality crystals, we carried out the crystallization aboard the Russian MIR space station and crystals were recovered in January, 1994. Crystals of the enzyme were formed in 9 of the total 12 sitting drops in the space mission, in the presence of NADP + or estradiol. This is a first attempt of crystallization of a membrane-associated protein under microgravity in the presence of a detergent. The space experiments showed better results in nucleation number, crystal size and morphology than the ground ones, obtaining crystals diffracting to resolutions between 2.5-2.7 Å. The too early ground mixing has limited a more important improvement of the crystallization.

Characterization of calcium crystals in Abelia using x-ray diffraction and electron microscopes

USDA-ARS?s Scientific Manuscript database

Localization, chemical composition, and morphology of calcium crystals in leaves and stems of Abelia mosanensis and A. ×grandiflora were analyzed with a variable pressure scanning electron microscope (VP-SEM) equipped with an X-ray diffraction system, low temperature SEM (LT-SEM) and a transmission ...

Purification, crystallization and preliminary X-ray diffraction studies on goat (Capra hircus) hemoglobin - a low oxygen affinity species.

PubMed

Moorthy, Ponnuraj Sathya; Neelagandan, Kamariah; Balasubramanian, Moovarkumudalvan; Ponnuswamy, Mondikalipudur Nanjappa Gounder

2009-01-01

Hemoglobin is a vital protein present in almost all higher species. It is a transport protein involved in carrying oxygen from lungs to tissues and carbon dioxide back to lungs by an intrinsically coordinated manner. Even though a good amount of work has been carried out in this direction there exists scarcity of structural insight on low oxygen affinity species. Attempts are being made to unravel the structural insight of this low oxygen affinity species. Goat blood plasma was collected, treated with EDTA to avoid blood clotting and purification was accomplished using DEAE-anion chromatographic column. The goat hemoglobin was crystallized using 50mM of phosphate buffer at pH 6.7 with 1M NaCl and PEG 3350 as precipitant by hanging drop vapor diffusion method. Crystals obtained are screened and suitable crystals are taken for data collection using mar345dtb as image plate detector system. Goat hemoglobin crystal diffracted up to 2.61 A resolution. Goat hemoglobin crystallizes in orthorhombic space group P212(1)2(1) as a whole biological molecule in the asymmetric unit with cell dimensions a=53.568A, b=67.365A, c=154.183A.

The MORPHEUS II protein crystallization screen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gorrec, Fabrice, E-mail: fgorrec@mrc-lmb.cam.ac.uk

2015-06-27

MORPHEUS II is a 96-condition initial crystallization screen formulated de novo. The screen incorporates reagents selected from the Protein Data Bank to yield crystals that are not observed in traditional conditions. In addition, the formulation facilitates the optimization and cryoprotection of crystals. High-quality macromolecular crystals are a prerequisite for the process of protein structure determination by X-ray diffraction. Unfortunately, the relative yield of diffraction-quality crystals from crystallization experiments is often very low. In this context, innovative crystallization screen formulations are continuously being developed. In the past, MORPHEUS, a screen in which each condition integrates a mix of additives selected frommore » the Protein Data Bank, a cryoprotectant and a buffer system, was developed. Here, MORPHEUS II, a follow-up to the original 96-condition initial screen, is described. Reagents were selected to yield crystals when none might be observed in traditional initial screens. Besides, the screen includes heavy atoms for experimental phasing and small polyols to ensure the cryoprotection of crystals. The suitability of the resulting novel conditions is shown by the crystallization of a broad variety of protein samples and their efficiency is compared with commercially available conditions.« less

Cloning, purification, crystallization and preliminary X-ray crystallographic analysis of MCAT from Synechocystis sp. PCC 6803.

PubMed

Liu, Yinghui; Zhang, Yanming; Cao, Xupeng; Xue, Song

2013-11-01

Malonyl-coenzymeA:acyl-carrier protein transacylase (MCAT), which catalyzes the transfer of the malonyl group from malonyl-CoA to acyl-carrier protein (ACP), is an essential enzyme in type II fatty-acid synthesis. The enzyme MCAT from Synechocystis sp. PCC 6803 (spMCAT), the first MCAT counterpart from a cyanobacterium, was cloned, purified and crystallized in order to determine its three-dimensional crystal structure. A higher-quality crystal with better diffraction was obtained by crystallization optimization. The crystal diffracted to 1.8 Å resolution and belonged to the orthorhombic space group P2(1)2(1)2, with unit-cell parameters a = 43.22, b = 149.21, c = 40.59 Å. Matthews coefficient calculations indicated that the crystal contained one spMCAT molecule in the asymmetric unit with a Matthews coefficient of 2.18 Å(3) Da(-1) and a solvent content of 43.65%.

Crystallization and preliminary X-ray diffraction analysis of a novel sphingomyelinase D from Loxosceles gaucho venom.

PubMed

Ullah, Anwar; Magalhães, Geraldo Santana; Masood, Rehana; Mariutti, Ricardo Barros; Coronado, Monika Aparecida; Murakami, Mário Tyago; Barbaro, Katia Cristina; Arni, Raghuvir Krishnaswamy

2014-10-01

Brown spider envenomation results in dermonecrosis, intravascular coagulation, haemolysis and renal failure, mainly owing to the action of sphingomyelinases D (SMases D), which catalyze the hydrolysis of sphingomyelin to produce ceramide 1-phosphate and choline or the hydrolysis of lysophosphatidylcholine to produce lysophosphatidic acid. Here, the heterologous expression, purification, crystallization and preliminary X-ray diffraction analysis of LgRec1, a novel SMase D from Loxosceles gaucho venom, are reported. The crystals belonged to space group P21212, with unit-cell parameters a = 52.98, b = 62.27, c = 84.84 Å and diffracted to a maximum resolution of 2.6 Å.

Crystallization and preliminary X-ray diffraction analysis of a novel sphingomyelinase D from Loxosceles gaucho venom

PubMed Central

Ullah, Anwar; Magalhães, Geraldo Santana; Masood, Rehana; Mariutti, Ricardo Barros; Coronado, Monika Aparecida; Murakami, Mário Tyago; Barbaro, Katia Cristina; Arni, Raghuvir Krishnaswamy

2014-01-01

Brown spider envenomation results in dermonecrosis, intravascular coagulation, haemolysis and renal failure, mainly owing to the action of sphingomyelinases D (SMases D), which catalyze the hydrolysis of sphingomyelin to produce ceramide 1-phosphate and choline or the hydrolysis of lysophosphatidylcholine to produce lysophosphatidic acid. Here, the heterologous expression, purification, crystallization and preliminary X-ray diffraction analysis of LgRec1, a novel SMase D from Loxosceles gaucho venom, are reported. The crystals belonged to space group P21212, with unit-cell parameters a = 52.98, b = 62.27, c = 84.84 Å and diffracted to a maximum resolution of 2.6 Å. PMID:25286953

3-dimensional imaging system using crystal diffraction lenses

DOEpatents

Smither, R.K.

1999-02-09

A device for imaging a plurality of sources of x-ray and gamma-ray radiation is provided. Diffracting crystals are used for focusing the radiation and directing the radiation to a detector which is used for analyzing their addition to collect data as to the location of the source of radiation. A computer is used for converting the data to an image. The invention also provides for a method for imaging x-ray and gamma radiation by supplying a plurality of sources of radiation; focusing the radiation onto a detector; analyzing the focused radiation to collect data as to the type and location of the radiation; and producing an image using the data. 18 figs.

Crystallization and evaluation of hen egg-white lysozyme crystals for protein pH titration in the crystalline state

PubMed Central

Iwai, Wakari; Yagi, Daichi; Ishikawa, Takuya; Ohnishi, Yuki; Tanaka, Ichiro; Niimura, Nobuo

2008-01-01

To observe the ionized status of the amino acid residues in proteins at different pH (protein pH titration in the crystalline state) by neutron diffraction, hen egg-white lysozyme was crystallized over a wide pH range (2.5–8.0). Crystallization phase diagrams at pH 2.5, 6.0 and 7.5 were determined. At pH < 4.5 the border between the metastable region and the nucleation region shifted to the left (lower precipitant concentration) in the phase diagram, and at pH > 4.5 the border shifted to the right (higher precipitant concentration). The qualities of these crystals were characterized using the Wilson plot method. The qualities of all crystals at different pH were more or less equivalent (B-factor values within 25–40). It is expected that neutron diffraction analysis of these crystals of different pH provides equivalent data in quality for discussions of protein pH titration in the crystalline state of hen egg-white lysozyme. PMID:18421167

Crystallization and preliminary X-ray diffraction analysis of Leishmania major dihydroorotate dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cordeiro, Artur T.; Feliciano, Patricia R.; Nonato, M. Cristina, E-mail: cristy@fcfrp.usp.br

2006-10-01

Dihydroorotate dehydrogenase from L. major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitant agent. A complete data set from a native crystal has been collected to 2.0 Å resolution using an in-house rotating-anode generator. Dihydroorotate dehydrogenases (DHODHs) are flavin-containing enzymes that catalyze the oxidation of l-dihydroorotate to orotate, the fourth step in the de novo pyrimidine nucleotide synthesis pathway. In this study, DHODH from Leishmania major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitating agent. The crystals belong to space group P6{sub 1}, with unit-cell parameters a = 143.7, cmore » = 69.8 Å. X-ray diffraction data were collected to 2.0 Å resolution using an in-house rotating-anode generator. Analysis of the solvent content and the self-rotation function indicate the presence of two molecules in the asymmetric unit. The structure has been solved by the molecular-replacement technique.« less

Crystallization and preliminary X-ray diffraction studies of Seneca Valley Virus-001, a new member of the Picornaviridae family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Venkataraman, Sangita; Reddy, Seshidhar P.; Loo, Jackie

2008-04-01

Seneca Valley Virus-001 of the Picornavirdae family was crystallized in the space group R3 and X-ray diffraction data was collected to a resolution of 2.3 Å. Rotation-function studies suggested the presence of two distict sets of 20 protomers that belong to two different virus particles in the crystallographic asymmetric unit. Seneca Valley Virus-001 (SVV-001) is a newly found species in the Picornaviridae family. SVV-001 is the first naturally occurring nonpathogenic picorna@@virus observed to mediate selective cytotoxicity towards tumor cells with neuroendocrine cancer features. The nonsegmented (+)ssRNA genome of SVV-001 shares closest sequence similarity to the genomes of the members ofmore » the Cardiovirus genus. However, based on the distinct characteristics of the genome organization and other biochemical properties, it has been suggested that SVV-001 represents a new genus, namely ‘Senecavirus’, in the Picornaviridae family. In order to understand the oncolytic properties of SVV-001, the native virus was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group R3, with unit-cell parameters (in the hexagonal setting) a = b = 311.5, c = 1526.4 Å. Although the SVV crystals diffracted to better than 2.3 Å resolution, the data quality is acceptable [I/σ(I) > 2.0] to 2.6 Å resolution. The unit-cell volume and the locked rotation-function analysis suggest that six particles could be accommodated in the unit cell, with two distinct sets of one third of a particle, each containing 20 protomers, occupying the crystallographic asymmetric unit.« less

X-ray diffraction imaging (topography) of electroopticcrystals by synchrotron radiation

NASA Technical Reports Server (NTRS)

Steiner, Bruce; Kuriyama, Masao; Dobbyn, Ronald C.; Laor, Uri

1988-01-01

Information of special interest to crystal growers and device physicists now available from monochromatic synchrotron diffraction imaging (topography) is reviewed. Illustrations are taken from a variety of electro-optic crystals. Aspects of the detailed understanding of crystal growth processes obtainable from carefully selected samples are described. Finally, new experimental opportunities now available for exploitation are indicated.

Preparation of crystals for characterizing the Grb7 SH2 domain before and after complex formation with a bicyclic peptide antagonist.

PubMed

Ambaye, Nigus D; Gunzburg, Menachem J; Traore, Daouda A K; Del Borgo, Mark P; Perlmutter, Patrick; Wilce, Matthew C J; Wilce, Jacqueline A

2014-02-01

Human growth factor receptor-bound protein 7 (Grb7) is an adapter protein involved in cell growth, migration and proliferation. It is now recognized that Grb7 is an emerging therapeutic target in specific cancer subtypes. Recently, the discovery of a bicyclic peptide inhibitor that targets the Grb7 SH2 domain, named G7-B1, was reported. In an attempt to probe the foundation of its interaction with Grb7, the crystallization and preliminary data collection of both the apo and G7-B1-bound forms of the Grb7 SH2 domain are reported here. Diffraction-quality crystals were obtained using the hanging-drop vapour-diffusion method. After several rounds of microseeding, crystals of the apo Grb7 SH2 domain were obtained that diffracted to 1.8 Å resolution, while those of the G7-B1-Grb7 SH2 domain complex diffracted to 2.2 Å resolution. The apo Grb7 SH2 domain crystallized in the trigonal space group P63, whereas the G7-B1-Grb7 SH2 domain complex crystallized in the monoclinic space group P21. The experimental aspects of crystallization, crystal optimization and data collection and the preliminary data are reported.

JAXA protein crystallization in space: ongoing improvements for growing high-quality crystals

PubMed Central

Takahashi, Sachiko; Ohta, Kazunori; Furubayashi, Naoki; Yan, Bin; Koga, Misako; Wada, Yoshio; Yamada, Mitsugu; Inaka, Koji; Tanaka, Hiroaki; Miyoshi, Hiroshi; Kobayashi, Tomoyuki; Kamigaichi, Shigeki

2013-01-01

The Japan Aerospace Exploration Agency (JAXA) started a high-quality protein crystal growth project, now called JAXA PCG, on the International Space Station (ISS) in 2002. Using the counter-diffusion technique, 14 sessions of experiments have been performed as of 2012 with 580 proteins crystallized in total. Over the course of these experiments, a user-friendly interface framework for high accessibility has been constructed and crystallization techniques improved; devices to maximize the use of the microgravity environment have been designed, resulting in some high-resolution crystal growth. If crystallization conditions were carefully fixed in ground-based experiments, high-quality protein crystals grew in microgravity in many experiments on the ISS, especially when a highly homogeneous protein sample and a viscous crystallization solution were employed. In this article, the current status of JAXA PCG is discussed, and a rational approach to high-quality protein crystal growth in microgravity based on numerical analyses is explained. PMID:24121350

Humidity control and hydrophilic glue coating applied to mounted protein crystals improves X-ray diffraction experiments

PubMed Central

Baba, Seiki; Hoshino, Takeshi; Ito, Len; Kumasaka, Takashi

2013-01-01

Protein crystals are fragile, and it is sometimes difficult to find conditions suitable for handling and cryocooling the crystals before conducting X-ray diffraction experiments. To overcome this issue, a protein crystal-mounting method has been developed that involves a water-soluble polymer and controlled humid air that can adjust the moisture content of a mounted crystal. By coating crystals with polymer glue and exposing them to controlled humid air, the crystals were stable at room temperature and were cryocooled under optimized humidity. Moreover, the glue-coated crystals reproducibly showed gradual transformations of their lattice constants in response to a change in humidity; thus, using this method, a series of isomorphous crystals can be prepared. This technique is valuable when working on fragile protein crystals, including membrane proteins, and will also be useful for multi-crystal data collection. PMID:23999307

Thermal Optimization of Growth and Quality in Protein Crystals

NASA Technical Reports Server (NTRS)

Wiencek, John M.

1996-01-01

Experimental evidence suggests that larger and higher quality crystals can be attained in the microgravity of space; however, the effect of growth rate on protein crystal quality is not well documented. This research is the first step towards providing strategies to grow crystals under constant rates of growth. Controlling growth rates at a constant value allows for direct one-to-one comparison of results obtained in microgravity and on earth. The overall goal of the project was to control supersaturation at a constant value during protein crystal growth by varying temperature in a predetermined manner. Applying appropriate theory requires knowledge of specific physicochemical properties of the protein solution including the effect of supersaturation on growth rates and the effect of temperature on protein solubility. Such measurements typically require gram quantities of protein and many months of data acquisition. A second goal of the project applied microcalorimetry for the rapid determination of these physicochemical properties using a minimum amount of protein. These two goals were successfully implemented on hen egg-white lysozyme. Results of these studies are described in the attached reprints.

Solvent minimization induces preferential orientation and crystal clustering in serial micro-crystallography on micro-meshes, in situ plates and on a movable crystal conveyor belt

PubMed Central

Soares, Alexei S.; Mullen, Jeffrey D.; Parekh, Ruchi M.; McCarthy, Grace S.; Roessler, Christian G.; Jackimowicz, Rick; Skinner, John M.; Orville, Allen M.; Allaire, Marc; Sweet, Robert M.

2014-01-01

X-ray diffraction data were obtained at the National Synchrotron Light Source from insulin and lysozyme crystals that were densely deposited on three types of surfaces suitable for serial micro-crystallography: MiTeGen MicroMeshes™, Greiner Bio-One Ltd in situ micro-plates, and a moving kapton crystal conveyor belt that is used to deliver crystals directly into the X-ray beam. 6° wedges of data were taken from ∼100 crystals mounted on each material, and these individual data sets were merged to form nine complete data sets (six from insulin crystals and three from lysozyme crystals). Insulin crystals have a parallelepiped habit with an extended flat face that preferentially aligned with the mounting surfaces, impacting the data collection strategy and the design of the serial crystallography apparatus. Lysozyme crystals had a cuboidal habit and showed no preferential orientation. Preferential orientation occluded regions of reciprocal space when the X-ray beam was incident normal to the data-collection medium surface, requiring a second pass of data collection with the apparatus inclined away from the orthogonal. In addition, crystals measuring less than 20 µm were observed to clump together into clusters of crystals. Clustering required that the X-ray beam be adjusted to match the crystal size to prevent overlapping diffraction patterns. No additional problems were encountered with the serial crystallography strategy of combining small randomly oriented wedges of data from a large number of specimens. High-quality data able to support a realistic molecular replacement solution were readily obtained from both crystal types using all three serial crystallography strategies. PMID:25343789

Solvent minimization induces preferential orientation and crystal clustering in serial micro-crystallography on micro-meshes, in situ plates and on a movable crystal conveyor belt

DOE Office of Scientific and Technical Information (OSTI.GOV)

Soares, Alexei S.; Mullen, Jeffrey D.; Parekh, Ruchi M.

X-ray diffraction data were obtained at the National Synchrotron Light Source from insulin and lysozyme crystals that were densely deposited on three types of surfaces suitable for serial micro-crystallography: MiTeGen MicroMeshes™, Greiner Bio-One Ltdin situmicro-plates, and a moving kapton crystal conveyor belt that is used to deliver crystals directly into the X-ray beam. 6° wedges of data were taken from ~100 crystals mounted on each material, and these individual data sets were merged to form nine complete data sets (six from insulin crystals and three from lysozyme crystals). Insulin crystals have a parallelepiped habit with an extended flat face thatmore » preferentially aligned with the mounting surfaces, impacting the data collection strategy and the design of the serial crystallography apparatus. Lysozyme crystals had a cuboidal habit and showed no preferential orientation. Preferential orientation occluded regions of reciprocal space when the X-ray beam was incident normal to the data-collection medium surface, requiring a second pass of data collection with the apparatus inclined away from the orthogonal. In addition, crystals measuring less than 20 µm were observed to clump together into clusters of crystals. Clustering required that the X-ray beam be adjusted to match the crystal size to prevent overlapping diffraction patterns. No additional problems were encountered with the serial crystallography strategy of combining small randomly oriented wedges of data from a large number of specimens. Lastly, high-quality data able to support a realistic molecular replacement solution were readily obtained from both crystal types using all three serial crystallography strategies.« less

Solvent minimization induces preferential orientation and crystal clustering in serial micro-crystallography on micro-meshes, in situ plates and on a movable crystal conveyor belt

DOE PAGES

Soares, Alexei S.; Mullen, Jeffrey D.; Parekh, Ruchi M.; ...

2014-10-09

X-ray diffraction data were obtained at the National Synchrotron Light Source from insulin and lysozyme crystals that were densely deposited on three types of surfaces suitable for serial micro-crystallography: MiTeGen MicroMeshes™, Greiner Bio-One Ltdin situmicro-plates, and a moving kapton crystal conveyor belt that is used to deliver crystals directly into the X-ray beam. 6° wedges of data were taken from ~100 crystals mounted on each material, and these individual data sets were merged to form nine complete data sets (six from insulin crystals and three from lysozyme crystals). Insulin crystals have a parallelepiped habit with an extended flat face thatmore » preferentially aligned with the mounting surfaces, impacting the data collection strategy and the design of the serial crystallography apparatus. Lysozyme crystals had a cuboidal habit and showed no preferential orientation. Preferential orientation occluded regions of reciprocal space when the X-ray beam was incident normal to the data-collection medium surface, requiring a second pass of data collection with the apparatus inclined away from the orthogonal. In addition, crystals measuring less than 20 µm were observed to clump together into clusters of crystals. Clustering required that the X-ray beam be adjusted to match the crystal size to prevent overlapping diffraction patterns. No additional problems were encountered with the serial crystallography strategy of combining small randomly oriented wedges of data from a large number of specimens. Lastly, high-quality data able to support a realistic molecular replacement solution were readily obtained from both crystal types using all three serial crystallography strategies.« less

Crystallization and X-ray diffraction analysis of an l-arabinonate dehydratase from Rhizobium leguminosarum bv. trifolii and a d-xylonate dehydratase from Caulobacter crescentus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rahman, Mohammad Mubinur; Andberg, Martina; Koivula, Anu

l-Arabinonate dehydratase and d-xylonate dehydratase from the IlvD/EDD family were crystallized by the vapour-diffusion method. Diffraction data sets were collected to resolutions of 2.40 and 2.66 Å from crystals of l-arabinonate dehydratase and d-xylonate dehydratase, respectively. l-Arabinonate dehydratase (EC 4.2.1.25) and d-xylonate dehydratase (EC 4.2.1.82) are two enzymes that are involved in a nonphosphorylative oxidation pathway of pentose sugars. l-Arabinonate dehydratase converts l-arabinonate into 2-dehydro-3-deoxy-l-arabinonate, and d-xylonate dehydratase catalyzes the dehydration of d-xylonate to 2-dehydro-3-deoxy-d-xylonate. l-Arabinonate and d-xylonate dehydratases belong to the IlvD/EDD family, together with 6-phosphogluconate dehydratases and dihydroxyacid dehydratases. No crystal structure of any l-arabinonate or d-xylonate dehydratasemore » is available in the PDB. In this study, recombinant l-arabinonate dehydratase from Rhizobium leguminosarum bv. trifolii (RlArDHT) and d-xylonate dehydratase from Caulobacter crescentus (CcXyDHT) were heterologously expressed in Escherichia coli and purified by the use of affinity chromatography followed by gel-filtration chromatography. The purified proteins were crystallized using the hanging-drop vapour-diffusion method at 293 K. Crystals of RlArDHT that diffracted to 2.40 Å resolution were obtained using sodium formate as a precipitating agent. They belonged to space group P2{sub 1}, with unit-cell parameters a = 106.07, b = 208.61, c = 147.09 Å, β = 90.43°. Eight RlArDHT molecules (two tetramers) in the asymmetric unit give a V{sub M} value of 3.2 Å{sup 3} Da{sup −1} and a solvent content of 62%. Crystals of CcXyDHT that diffracted to 2.66 Å resolution were obtained using sodium formate and polyethylene glycol 3350. They belonged to space group C2, with unit-cell parameters a = 270.42, b = 236.13, c = 65.17 Å, β = 97.38°. Four CcXyDHT molecules (a tetramer) in the asymmetric unit give a V

Purification, crystallization and preliminary X-ray diffraction analysis of saxthrombin, a thrombin-like enzyme from Gloydius saxatilis venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wei, Wenqing; Zhao, Wei; Key Laboratory of Structural Biology, Chinese Academy of Sciences, 96 Jinzhai Road, Hefei, Anhui 230027

2007-08-01

The thrombin-like enzyme saxthrombin has been purified from G. saxatilis snake venom. Crystallization conditions were found and a data set was obtained to 1.43 Å. The snake-venom thrombin-like enzymes (SVTLEs) are a class of serine proteinases that show fibrinogen-clotting and esterolytic activities. Most TLEs convert fibrinogen to fibrin by releasing either fibrinopeptide A or fibrinopeptide B and cannot activate factor XIII. The enzymes hydrolyze fibrinogen to produce non-cross-linked fibrins, which are susceptible to the lytic action of plasmin. Because of these physiological properties, TLEs have important medical applications in myocardial infarction, ischaemic stroke and thrombotic diseases. Here, a three-step chromatographymore » procedure was used to purify saxthrombin (AAP20638) from Gloydius saxatilis venom to homogeneity. Its molecular weight is about 30 kDa as estimated by SDS–PAGE. A saxthrombin crystal was obtained using the hanging-drop vapour-diffusion method and diffracted to a resolution limit of 1.43 Å. The crystal belongs to space group C2, with unit-cell parameters a = 97.23, b = 52.21, c = 50.10 Å, β = 96.72°, and the Matthews coefficient (V{sub M}) was calculated to be 2.13 Å{sup 3} Da{sup −1} with one molecule in the asymmetric unit.« less

Crystallization and preliminary X-ray diffraction studies of θ-toxin (perfringolysin O), a pore-forming cytolysin of Clostridium perfringens

NASA Astrophysics Data System (ADS)

Sugahara, Mitsuaki; Sekino-Suzuki, Naoko; Ohno-Iwashita, Yoshiko; Miki, Kunio

1996-10-01

θ-Toxin (perfringolysin O), a cholesterol-binding, pore-forming cytolysin of Clostridium perfringens type A was crystallized by the vapor diffusion procedure using polyethyleneglycol 4000 and sodium chloride as precipitants in 2-(cyclohexylamino)ethanesulfonic acid (CHES) buffer at pH 9.5. The diffraction patterns of precession photographs indicated that the crystals belong to the orthorhombic system and the space group C222 1 with unit-cell dimensions of a = 47.7 Å, b = 182.0 Å and c = 175.8 Å. Assuming that the asymmetric unit contains one or two molecules (Mw 52 700), the Vm value is calculated as 3.6 or 1.8 Å 3/dalton, respectively. The crystals diffract X-rays to at least 3 Å resolution and are suitable for high resolution X-ray crystal structure determination.

Seeding for sirtuins: microseed matrix seeding to obtain crystals of human Sirt3 and Sirt2 suitable for soaking

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rumpf, Tobias; Gerhardt, Stefan; Einsle, Oliver, E-mail: einsle@biochemie.uni-freiburg.de

2015-11-18

In the present study, microseed matrix seeding was successfully applied to obtain a large number of crystals of the human sirtuin isotypes Sirt2 and Sirt3. These crystals appeared predictably in diverse crystallization conditions, diffracted to a higher resolution than reported in the literature and were subsequently used to study the protein–ligand interactions of two indole inhibitors. Sirtuins constitute a family of NAD{sup +}-dependent enzymes that catalyse the cleavage of various acyl groups from the ∊-amino group of lysines. They regulate a series of cellular processes and their misregulation has been implicated in various diseases, making sirtuins attractive drug targets. Tomore » date, only a few sirtuin modulators have been reported that are suitable for cellular research and their development has been hampered by a lack of structural information. In this work, microseed matrix seeding (MMS) was used to obtain crystals of human Sirt3 in its apo form and of human Sirt2 in complex with ADP ribose (ADPR). Crystal formation using MMS was predictable, less error-prone and yielded a higher number of crystals per drop than using conventional crystallization screening methods. The crystals were used to solve the crystal structures of apo Sirt3 and of Sirt2 in complex with ADPR at an improved resolution, as well as the crystal structures of Sirt2 in complex with ADPR and the indoles EX527 and CHIC35. These Sirt2–ADPR–indole complexes unexpectedly contain two indole molecules and provide novel insights into selective Sirt2 inhibition. The MMS approach for Sirt2 and Sirt3 may be used as the basis for structure-based optimization of Sirt2/3 inhibitors in the future.« less

High spatial resolution X-ray and gamma ray imaging system using diffraction crystals

DOEpatents

Smither, Robert K [Hinsdale, IL

2011-05-17

A method and a device for high spatial resolution imaging of a plurality of sources of x-ray and gamma-ray radiation are provided. The device comprises a plurality of arrays, with each array comprising a plurality of elements comprising a first collimator, a diffracting crystal, a second collimator, and a detector.

Microgravity protein crystallization

PubMed Central

McPherson, Alexander; DeLucas, Lawrence James

2015-01-01

Over the past 20 years a variety of technological advances in X-ray crystallography have shortened the time required to determine the structures of large macromolecules (i.e., proteins and nucleic acids) from several years to several weeks or days. However, one of the remaining challenges is the ability to produce diffraction-quality crystals suitable for a detailed structural analysis. Although the development of automated crystallization systems combined with protein engineering (site-directed mutagenesis to enhance protein solubility and crystallization) have improved crystallization success rates, there remain hundreds of proteins that either cannot be crystallized or yield crystals of insufficient quality to support X-ray structure determination. In an attempt to address this bottleneck, an international group of scientists has explored use of a microgravity environment to crystallize macromolecules. This paper summarizes the history of this international initiative along with a description of some of the flight hardware systems and crystallization results. PMID:28725714

Programmable diffractive lens for ophthalmic application

NASA Astrophysics Data System (ADS)

Millán, María S.; Pérez-Cabré, Elisabet; Romero, Lenny A.; Ramírez, Natalia

2014-06-01

Pixelated liquid crystal displays have been widely used as spatial light modulators to implement programmable diffractive optical elements, particularly diffractive lenses. Many different applications of such components have been developed in information optics and optical processors that take advantage of their properties of great flexibility, easy and fast refreshment, and multiplexing capability in comparison with equivalent conventional refractive lenses. We explore the application of programmable diffractive lenses displayed on the pixelated screen of a liquid crystal on silicon spatial light modulator to ophthalmic optics. In particular, we consider the use of programmable diffractive lenses for the visual compensation of refractive errors (myopia, hypermetropia, astigmatism) and presbyopia. The principles of compensation are described and sketched using geometrical optics and paraxial ray tracing. For the proof of concept, a series of experiments with artificial eye in optical bench are conducted. We analyze the compensation precision in terms of optical power and compare the results with those obtained by means of conventional ophthalmic lenses. Practical considerations oriented to feasible applications are provided.

Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

2016-11-30

A tetrahydrofolate-dependentO-demethylase, LigM, from Sphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtained P3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding using P3 121/P3 2 21 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space group P2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c = 128.1 Å. The P2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing themore » cryoconditions. Phasing using the single anomalous diffraction method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

Growth and characterization of β-Ga2O3 crystals

NASA Astrophysics Data System (ADS)

Nikolaev, V. I.; Maslov, V.; Stepanov, S. I.; Pechnikov, A. I.; Krymov, V.; Nikitina, I. P.; Guzilova, L. I.; Bougrov, V. E.; Romanov, A. E.

2017-01-01

Here we report on the growth and characterization of β-Ga2O3 bulk crystals and polycrystalline layer on different substrates. Bulk β-Ga2O3 crystals were produced by free crystallisation of gallium oxide melt in sapphire crucible. Transparent single crystals measuring up to 8 mm across were obtained. Good structural quality was confirmed by x-ray diffraction rocking curve FWHM values of 46″. Young's modulus, shear modulus and hardness of the β-Ga2O3 crystals were measured by nanoindentation and Vickers microindentation techniques. Polycrystalline β-Ga2O3 films were deposited on silicon and sapphire substrates by sublimation method. It was found that structure and morphology of the films were greatly influenced by the material and orientation of the substrates. The best results were achieved on a-plane sapphire substrates where predominantly (111) oriented films were obtained.

Study of Fluid Flow Control in Protein Crystallization using Strong Magnetic Fields

NASA Astrophysics Data System (ADS)

Ramachandran, Narayanan; Leslie, Fred; Ciszak, Ewa

2002-11-01

An important component in biotechnology, particularly in the area of protein engineering and rational drug design is the knowledge of the precise three-dimensional molecular structure of proteins. The quality of structural information obtained from X-ray diffraction methods is directly dependent on the degree of perfection of the protein crystals. As a consequence, the growth of high quality macromolecular crystals for diffraction analyses has been the central focus for biochemists, biologists, and bioengineers. Macromolecular crystals are obtained from solutions that contain the crystallizing species in equilibrium with higher aggregates, ions, precipitants, other possible phases of the protein, foreign particles, the walls of the container, and a likely host of other impurities. By changing transport modes in general, i.e., reduction of convection and sedimentation, as is achieved in "microgravity", researchers have been able to dramatically affect the movement and distribution of macromolecules in the fluid, and thus their transport, formation of crystal nuclei, and adsorption to the crystal surface. While a limited number of high quality crystals from space flights have been obtained, as the recent National Research Council (NRC) review of the NASA microgravity crystallization program pointed out, the scientific approach and research in crystallization of proteins has been mainly empirical yielding inconclusive results. We postulate that we can reduce convection in ground-based experiments and we can understand the different aspects of convection control through the use of strong magnetic fields and field gradients. Whether this limited convection in a magnetic field will provide the environment for the growth of high quality crystals is still a matter of conjecture that our research will address. The approach exploits the variation of fluid magnetic susceptibility with concentration for this purpose and the convective damping is realized by appropriately

Study of Fluid Flow Control in Protein Crystallization using Strong Magnetic Fields

NASA Technical Reports Server (NTRS)

Ramachandran, Narayanan; Leslie, Fred; Ciszak, Ewa

2002-01-01

An important component in biotechnology, particularly in the area of protein engineering and rational drug design is the knowledge of the precise three-dimensional molecular structure of proteins. The quality of structural information obtained from X-ray diffraction methods is directly dependent on the degree of perfection of the protein crystals. As a consequence, the growth of high quality macromolecular crystals for diffraction analyses has been the central focus for biochemists, biologists, and bioengineers. Macromolecular crystals are obtained from solutions that contain the crystallizing species in equilibrium with higher aggregates, ions, precipitants, other possible phases of the protein, foreign particles, the walls of the container, and a likely host of other impurities. By changing transport modes in general, i.e., reduction of convection and sedimentation, as is achieved in "microgravity", researchers have been able to dramatically affect the movement and distribution of macromolecules in the fluid, and thus their transport, formation of crystal nuclei, and adsorption to the crystal surface. While a limited number of high quality crystals from space flights have been obtained, as the recent National Research Council (NRC) review of the NASA microgravity crystallization program pointed out, the scientific approach and research in crystallization of proteins has been mainly empirical yielding inconclusive results. We postulate that we can reduce convection in ground-based experiments and we can understand the different aspects of convection control through the use of strong magnetic fields and field gradients. Whether this limited convection in a magnetic field will provide the environment for the growth of high quality crystals is still a matter of conjecture that our research will address. The approach exploits the variation of fluid magnetic susceptibility with concentration for this purpose and the convective damping is realized by appropriately

Solid state parameters, structure elucidation, High Resolution X-Ray Diffraction (HRXRD), phase matching, thermal and impedance analysis on L-Proline trichloroacetate (L-PTCA) NLO single crystals.

PubMed

Kalaiselvi, P; Raj, S Alfred Cecil; Jagannathan, K; Vijayan, N; Bhagavannarayana, G; Kalainathan, S

2014-11-11

Nonlinear optical single crystal of L-Proline trichloroacetate (L-PTCA) was successfully grown by Slow Evaporation Solution Technique (SEST). The grown crystals were subjected to single crystal X-ray diffraction analysis to confirm the structure. From the single crystal XRD data, solid state parameters were determined for the grown crystal. The crystalline perfection has been evaluated using high resolution X-ray diffractometer. The frequencies of various functional groups were identified from FTIR spectral analysis. The percentage of transmittance was obtained from UV Visible spectral analysis. TGA-DSC measurements indicate the thermal stability of the crystal. The dielectric constant, dielectric loss and ac conductivity were measured by the impedance analyzer. The DC conductivity was calculated by the cole-cole plot method. Copyright © 2014 Elsevier B.V. All rights reserved.

Numerical investigation of diffraction of acoustic waves by phononic crystals

NASA Astrophysics Data System (ADS)

Moiseyenko, Rayisa P.; Declercq, Nico F.; Laude, Vincent

2012-05-01

Diffraction as well as transmission of acoustic waves by two-dimensional phononic crystals (PCs) composed of steel rods in water are investigated in this paper. The finite element simulations were performed in order to compute pressure fields generated by a line source that are incident on a finite size PC. Such field maps are analyzed based on the complex band structure for the infinite periodic PC. Finite size computations indicate that the exponential decrease of the transmission at deaf frequencies is much stronger than that in Bragg band gaps.

Achromatic diffractive lens written onto a liquid crystal display.

PubMed

Márquez, A; Iemmi, C; Campos, J; Yzuel, M J

2006-02-01

We propose a programmable diffractive lens written onto a liquid crystal display (LCD) that is able to provide equal focal lengths for several wavelengths simultaneously. To achieve this goal it is necessary that the LCD operate in the phase-only regime simultaneously for the different wavelengths. We design the appropriate lens for each wavelength, and then the lenses are spatially multiplexed onto the LCD. Various multiplexing schemes have been analyzed, and the random scheme shows the best performance. We further show the possibility of finely tuning the chromaticity of the focal spot by changing the relative weights of the multiplexing among the various wavelengths.

Crystallization and preliminary X-ray diffraction analyses of the redox-controlled complex of terminal oxygenase and ferredoxin components in the Rieske nonhaem iron oxygenase carbazole 1,9a-dioxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsuzawa, Jun; Aikawa, Hiroki; Umeda, Takashi

2014-09-25

A crystal was obtained of the complex between reduced terminal oxygenase and oxidized ferredoxin components of carbazole 1,9a-dioxygenase. The crystal belonged to space group P2{sub 1} and diffracted to 2.25 Å resolution. The initial reaction in bacterial carbazole degradation is catalyzed by carbazole 1,9a-dioxygenase, which consists of terminal oxygenase (Oxy), ferredoxin (Fd) and ferredoxin reductase components. The electron-transfer complex between reduced Oxy and oxidized Fd was crystallized at 293 K using the hanging-drop vapour-diffusion method with PEG 3350 as the precipitant under anaerobic conditions. The crystal diffracted to a maximum resolution of 2.25 Å and belonged to space group P2{submore » 1}, with unit-cell parameters a = 97.3, b = 81.6, c = 116.2 Å, α = γ = 90, β = 100.1°. The V{sub M} value is 2.85 Å{sup 3} Da{sup −1}, indicating a solvent content of 56.8%.« less

Crystallization and preliminary X-ray diffraction analysis of red clover necrotic mosaic virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, Stanton L.; Guenther, Richard H.; Sit, Tim L.

2010-11-12

Red clover necrotic mosaic virus (RCNMV) is a species that belongs to the Tombusviridae family of plant viruses with a T = 3 icosahedral capsid. RCNMV virions were purified and were crystallized for X-ray analysis using the hanging-drop vapor-diffusion method. Self-rotation functions and systematic absences identified the space group as I23, with two virions in the unit cell. The crystals diffracted to better than 4 {angstrom} resolution but were very radiation-sensitive, causing rapid decay of the high-resolution reflections. The data were processed to 6 {angstrom} in the analysis presented here.

Crystallization and preliminary X-ray diffraction data of β-galactosidase from Aspergillus niger.

PubMed

Rico-Díaz, Agustín; Vizoso Vázquez, Ángel; Cerdán, M Esperanza; Becerra, Manuel; Sanz-Aparicio, Julia

2014-11-01

β-Galactosidase from Aspergillus niger (An-β-Gal), belonging to the family 35 glycoside hydrolases, hydrolyzes the β-galactosidase linkages in lactose and other galactosides. It is extensively used in industry owing to its high hydrolytic activity and safety. The enzyme has been expressed in yeasts and purified by immobilized metal-ion affinity chromatography for crystallization experiments. The recombinant An-β-Gal, deglycosylated to avoid heterogeneity of the sample, has a molecular mass of 109 kDa. Rod-shaped crystals grew using PEG 3350 as the main precipitant agent. A diffraction data set was collected to 1.8 Å resolution.

Single-crystal diffraction at megabar conditions by synchrotron radiation

NASA Astrophysics Data System (ADS)

Merlini, Marco; Hanfland, Michael

2013-08-01

Crystal structure determination at extreme pressures is currently possible at synchrotron beamlines optimized for such a purpose. We report the description of the experimental setup available at European Synchrotron Radiation Facility ID09 beamline (Grenoble, France) and, with two examples, we illustrate the state-of-the-art experiments currently performed at third-generation synchrotrons. The first example concerns the determination of the equation of state and the structural behavior of low-spin Fe-bearing siderite in the megabar pressure range. Siderite, in fact, undergoes a first-order isosymmetric transition at 45 GPa, and, above this pressure, it features Fe2+ in electronic low-spin configuration. The local configuration of Fe coordination polyhedra, determined by structural refinements, significantly deviates from a regular octahedron. Nevertheless, no further structural transition is detected up to the maximum pressure reached in our experiments, 135 GPa. The analysis of the Fe-O bond length extrapolated to ambient pressure, which indicates that the difference in ionic radii between the high- and the low-spin state of Fe2+ is 0.172 Å, in excellent agreement with the tabulated data by Shannon and Prewitt [Effective ionic radii in oxides and fluorides. Acta Crystallogr. 1969;B25:925-946]. The second example concerns the determination and refinement of the oP8 structure adopted by sodium in the pressure interval 118-125 GPa, using an experimental dataset collected at 118 GPa. The orthorhombic [a=4.7687(15) Å, b=3.0150(6) Å, c=5.2423(7) Å, V=75.4(3) Å3] oP8 structure is topologically related to the MnP structure, with two non-equivalent atoms in the unit cell. Despite the weak scattering factor of Na atoms, the quality of the data also allows meaningful displacement parameters refinements (R1=4.6%, 14 parameters, 190 diffractions, and 105 unique) demonstrating that the current accuracy of diffraction data at extreme pressures can be comparable with ambient

Crystallization and preliminary X-ray diffraction analysis of the small laccase from Streptomyces coelicolor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Skálová, Tereza, E-mail: skalova@imc.cas.cz; Dohnálek, Jan; Institute of Physics, Academy of Sciences of the Czech Republic, Cukrovarnicka 10, 162 53 Praha 6

2007-12-01

The expression, purification and crystallization of the small laccase from S. coelicolor are reported. Diffraction data were collected to 3 Å resolution. The small bacterial laccase from the actinobacterium Streptomyces coelicolor which lacks the second of the three domains of the laccases structurally characterized to date was crystallized. This multi-copper phenol oxidase crystallizes in a primitive tetragonal lattice, with unit-cell parameters a = b = 179.8, c = 175.3 Å. The crystals belong to either space group P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2. The self-rotation function shows the presence of a noncrystallographic threefold axis in the structure. Phases willmore » be determined from the anomalous signal of the natively present copper ions.« less

New methods for indexing multi-lattice diffraction data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gildea, Richard J.; Waterman, David G.; CCP4, Research Complex at Harwell, Rutherford Appleton Laboratory, Didcot OX11 0FA

2014-10-01

A new indexing method is presented which is capable of indexing multiple crystal lattices from narrow wedges of data. The efficacy of this method is demonstrated with both semi-synthetic multi-lattice data and real multi-lattice data recorded from microcrystals of ∼1 µm in size. A new indexing method is presented which is capable of indexing multiple crystal lattices from narrow wedges of diffraction data. The method takes advantage of a simplification of Fourier transform-based methods that is applicable when the unit-cell dimensions are known a priori. The efficacy of this method is demonstrated with both semi-synthetic multi-lattice data and real multi-latticemore » data recorded from crystals of ∼1 µm in size, where it is shown that up to six lattices can be successfully indexed and subsequently integrated from a 1° wedge of data. Analysis is presented which shows that improvements in data-quality indicators can be obtained through accurate identification and rejection of overlapping reflections prior to scaling.« less

Correct interpretation of diffraction properties of quartz crystals for X-ray optics applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Xian-Rong; Gog, Thomas; Kim, Jungho

Quartz has hundreds of strong Bragg reflections that may offer a great number of choices for making fixed-angle X-ray analyzers and polarizers at virtually any hard X-ray energies with selectable resolution. However, quartz crystals, unlike silicon and germanium, are chiral and may thus appear in two different forms of handedness that are mirror images. Furthermore, because of the threefold rotational symmetry along thecaxis, the {h 1h 2h 3L} and {h 2h 1h 3L} Bragg reflections may have quite different Darwin bandwidth, reflectivity and angular acceptance, although they have the same Bragg angle. The design of X-ray optics from quartz crystalsmore » therefore requires unambiguous determination of the orientation, handedness and polarity of the crystals. The Laue method and single-axis diffraction technique can provide such information, but the variety of conventions used in the literature to describe quartz structures has caused widespread confusion. The current studies give detailed guidelines for design and fabrication of quartz X-ray optics, with special emphasis on the correct interpretation of Laue patterns in terms of the crystallography and diffraction properties of quartz. Meanwhile, the quartz crystals examined were confirmed by X-ray topography to have acceptably low densities of dislocations and other defects, which is the foundation for developing high-resolution quartz-based X-ray optics.« less

Energy-dispersive neutron imaging and diffraction of magnetically driven twins in a Ni2MnGa single crystal magnetic shape memory alloy

NASA Astrophysics Data System (ADS)

Kabra, Saurabh; Kelleher, Joe; Kockelmann, Winfried; Gutmann, Matthias; Tremsin, Anton

2016-09-01

Single crystals of a partially twinned magnetic shape memory alloy, Ni2MnGa, were imaged using neutron diffraction and energy-resolved imaging techniques at the ISIS spallation neutron source. Single crystal neutron diffraction showed that the crystal produces two twin variants with a specific crystallographic relationship. Transmission images were captured using a time of flight MCP/Timepix neutron counting detector. The twinned and untwinned regions were clearly distinguishable in images corresponding to narrow-energy transmission images. Further, the spatially-resolved transmission spectra were used to elucidate the orientations of the crystallites in the different volumes of the crystal.

Purification, crystallization and preliminary X-ray diffraction analysis of the kinase domain of human tousled-like kinase 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garrote, Ana M.; Redondo, Pilar; Montoya, Guillermo, E-mail: gmontoya@cnio.es

2014-02-19

The C-terminal kinase domain of TLK2 (a human tousled-like kinase) has been cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. Tousled-like kinases (TLKs) are an evolutionarily conserved family of serine/threonine protein kinases involved in chromatin dynamics, including DNA replication and repair, transcription and chromosome segregation. The two members of the family reported in humans, namely TLK1 and TLK2, localize to the cell nucleus and are capable of forming homo- ormore » hetero-oligomers by themselves. To characterize the role of TLK2, its C-terminal kinase domain was cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. The latter produced the best diffracting crystal (3.4 Å resolution using synchrotron radiation), with unit-cell parameters a = b = c = 126.05 Å, α = β = γ = 90°. The asymmetric unit contained one protein molecule, with a Matthews coefficient of 4.59 Å{sup 3} Da{sup −1} and a solvent content of 73.23%.« less

Expression, crystallization and phasing of vacuolar H(+)-ATPase subunit C (Vma5p) of Saccharomyces cerevisiae.

PubMed

Drory, Omri; Mor, Adi; Frolow, Felix; Nelson, Nathan

2004-10-01

The expression, crystallization and phasing of subunit C (Vma5p) of the yeast (Saccharomyces cerevisiae) vacuolar proton-translocating ATPase (V-ATPase) is described. The expressed protein consists of 412 residues: 392 from the reading frame of Vma5p and 20 N-terminal residues originating from the plasmid. Diffraction-quality crystals were obtained using the hanging-drop and sitting-drop vapour-diffusion methods assisted by streak-seeding, with PEG 3350 as precipitant. The crystals formed in hanging drops diffracted to 1.80 A and belong to space group P4(3)2(1)2(1), with unit-cell parameters a = b = 62.54, c = 327.37 A, alpha = beta = gamma = 90 degrees. The structure was solved using SIRAS with a Lu(O2C2H3)2 heavy-atom derivative.

Delta L: An Apparatus for Measuring Macromolecule Crystal Growth Rates in Microgravity

NASA Technical Reports Server (NTRS)

Judge, Russell A.; Whitaker, Ann F. (Technical Monitor)

2001-01-01

Strongly diffracting high quality macromolecule crystals of suitable volume are keenly sought for X-ray diffraction analysis so that high-resolution molecular structure data can be obtained. Such data is of tremendous value to medical research, agriculture and commercial biotechnology. In previous studies by many investigators microgravity has been reported in some instances to improve biological macromolecule X-ray crystal quality while little or no improvement was observed in other cases. A better understanding of processes effecting crystal quality improvement in microgravity will therefore be of great benefit in optimizing crystallization success in microgravity. In ground based research with the protein lysozyme we have previously shown that a population of crystals grown under the same solution conditions, exhibit a variation in X-ray diffraction properties (Judge et al., 1999). We have also observed that under the same solution conditions, individual crystals will grow at slightly different growth rates. This phenomenon is called growth rate dispersion. For small molecule materials growth rate dispersion has been directly related to crystal quality (Cunningham et al., 1991; Ristic et al., 1991). We therefore postulate that microgravity may act to improve crystal quality by reducing growth rate dispersion. If this is the case then as different, Materials exhibit different degrees of growth rate dispersion on the ground then growth rate dispersion could be used to screen which materials may benefit the most from microgravity crystallization. In order to assess this theory the Delta L hardware is being developed so that macromolecule crystal growth rates can be measured in microgravity. Crystal growth rate is defined as the change or delta in crystal size (defined as a characteristic length, L) over time; hence the name of the hardware. Delta L will consist of an optics, a fluids, and a data acquisition sub-assemblies. The optics assembly will consist of a

Crystal Structure of 17α-Dihydroequilin, C18H22O2, from Synchrotron Powder Diffraction Data and Density Functional Theory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaduk, James; Gindhart, Amy; Blanton, Thomas

The crystal structure of 17α-dihydroequilin has been solved and refined using synchrotron X-ray powder diffraction data, and optimized using density functional techniques. 17α-dihydroequilin crystallizes in space group P212121 (#19) with a = 6.76849(1) Å, b = 8.96849(1) Å, c = 23.39031(5) Å, V = 1419.915(3) Å3, and Z = 4. Both hydroxyl groups form hydrogen bonds to each other, resulting in zig-zag chains along the b-axis. The powder diffraction pattern has been submitted to ICDD for inclusion in the Powder Diffraction File™ as the entry 00-066-1608.

Validation of a Crystal Plasticity Model Using High Energy Diffraction Microscopy

NASA Technical Reports Server (NTRS)

Beaudoin, A. J.; Obstalecki, M.; Storer, R.; Tayon, W.; Mach, J.; Kenesei, P.; Lienert, U.

2012-01-01

High energy diffraction microscopy is used to measure the crystallographic orientation and evolution of lattice strain in an Al Li alloy. The relative spatial arrangement of the several pancake-shaped grains in a tensile sample is determined through in situ and ex situ techniques. A model for crystal plasticity with continuity of lattice spin is posed, where grains are represented by layers in a finite element mesh following the arrangement indicated by experiment. Comparison is drawn between experiment and simulation.

Diffraction Correlation to Reconstruct Highly Strained Particles

NASA Astrophysics Data System (ADS)

Brown, Douglas; Harder, Ross; Clark, Jesse; Kim, J. W.; Kiefer, Boris; Fullerton, Eric; Shpyrko, Oleg; Fohtung, Edwin

2015-03-01

Through the use of coherent x-ray diffraction a three-dimensional diffraction pattern of a highly strained nano-crystal can be recorded in reciprocal space by a detector. Only the intensities are recorded, resulting in a loss of the complex phase. The recorded diffraction pattern therefore requires computational processing to reconstruct the density and complex distribution of the diffracted nano-crystal. For highly strained crystals, standard methods using HIO and ER algorithms are no longer sufficient to reconstruct the diffraction pattern. Our solution is to correlate the symmetry in reciprocal space to generate an a priori shape constraint to guide the computational reconstruction of the diffraction pattern. This approach has improved the ability to accurately reconstruct highly strained nano-crystals.

Expression, purification, crystallization and preliminary X-ray diffraction analysis of the DDX3 RNA helicase domain

PubMed Central

Rodamilans, Bernardo; Montoya, Guillermo

2007-01-01

DDX3 is a human RNA helicase that is involved in RNA processing and important human diseases. This enzyme belongs to the DEAD-box protein family, the members of which are characterized by the presence of nine conserved motifs including the Asp-Glu-Ala-Asp motif that defines the family. DDX3 has two distinct domains: an ATP-binding domain in the central region of the protein and a helicase domain in the carboxy-terminal region. The helicase domain of DDX3 was cloned and overexpressed in Escherichia coli. Crystallization experiments yielded crystals that were suitable for X-ray diffraction analysis. The final crystallization conditions were a reservoir solution consisting of 2 M ammonium sulfate, 0.1 M imidazole pH 6.4 plus 5 mM spermine tetrahydrochloride and a protein solution containing 10 mM HEPES, 500 mM ammonium sulfate pH 8.0. The crystals of the helicase domain belong to the monoclinic space group P21, with unit-cell parameters a = 43.85, b = 60.72, c = 88.39 Å, α = γ = 90, β = 101.02°, and contained three molecules per asymmetric unit. These crystals diffracted to a resolution limit of 2.2 Å using synchrotron radiation at the European Synchrotron Radiation Facility (ESRF) and the Swiss Light Source (SLS). PMID:17401195

Expression, purification, crystallization and preliminary X-ray diffraction analysis of the DDX3 RNA helicase domain.

PubMed

Rodamilans, Bernardo; Montoya, Guillermo

2007-04-01

DDX3 is a human RNA helicase that is involved in RNA processing and important human diseases. This enzyme belongs to the DEAD-box protein family, the members of which are characterized by the presence of nine conserved motifs including the Asp-Glu-Ala-Asp motif that defines the family. DDX3 has two distinct domains: an ATP-binding domain in the central region of the protein and a helicase domain in the carboxy-terminal region. The helicase domain of DDX3 was cloned and overexpressed in Escherichia coli. Crystallization experiments yielded crystals that were suitable for X-ray diffraction analysis. The final crystallization conditions were a reservoir solution consisting of 2 M ammonium sulfate, 0.1 M imidazole pH 6.4 plus 5 mM spermine tetrahydrochloride and a protein solution containing 10 mM HEPES, 500 mM ammonium sulfate pH 8.0. The crystals of the helicase domain belong to the monoclinic space group P2(1), with unit-cell parameters a = 43.85, b = 60.72, c = 88.39 A, alpha = gamma = 90, beta = 101.02 degrees , and contained three molecules per asymmetric unit. These crystals diffracted to a resolution limit of 2.2 A using synchrotron radiation at the European Synchrotron Radiation Facility (ESRF) and the Swiss Light Source (SLS).

Protein crystal structure obtained at 2.9 Å resolution from injecting bacterial cells into an X-ray free-electron laser beam

PubMed Central

Sawaya, Michael R.; Cascio, Duilio; Gingery, Mari; Rodriguez, Jose; Goldschmidt, Lukasz; Colletier, Jacques-Philippe; Messerschmidt, Marc M.; Boutet, Sébastien; Koglin, Jason E.; Williams, Garth J.; Brewster, Aaron S.; Nass, Karol; Hattne, Johan; Botha, Sabine; Doak, R. Bruce; Shoeman, Robert L.; DePonte, Daniel P.; Park, Hyun-Woo; Federici, Brian A.; Sauter, Nicholas K.; Schlichting, Ilme; Eisenberg, David S.

2014-01-01

It has long been known that toxins produced by Bacillus thuringiensis (Bt) are stored in the bacterial cells in crystalline form. Here we describe the structure determination of the Cry3A toxin found naturally crystallized within Bt cells. When whole Bt cells were streamed into an X-ray free-electron laser beam we found that scattering from other cell components did not obscure diffraction from the crystals. The resolution limits of the best diffraction images collected from cells were the same as from isolated crystals. The integrity of the cells at the moment of diffraction is unclear; however, given the short time (∼5 µs) between exiting the injector to intersecting with the X-ray beam, our result is a 2.9-Å-resolution structure of a crystalline protein as it exists in a living cell. The study suggests that authentic in vivo diffraction studies can produce atomic-level structural information. PMID:25136092

Purification, crystallization and preliminary X-ray diffraction analysis of aspartate semialdehyde dehydrogenase (Rv3708c) from Mycobacterium tuberculosis

PubMed Central

Vyas, Rajan; Kumar, Vijay; Panjikar, Santosh; Karthikeyan, Subramanian; Kishan, K. V. Radha; Tewari, Rupinder; Weiss, Manfred S.

2008-01-01

Aspartate semialdehyde dehydrogenase from Mycobacterium tuberculosis (Asd, ASADH, Rv3708c), which is the second enzyme in the lysine/homoserine-biosynthetic pathways, has been expressed heterologously in Escherichia coli. The enzyme was purified using affinity and gel-filtration chromatographic techniques and crystallized in two different crystal forms. Preliminary diffraction data analysis suggested the presence of up to four monomers in the asymmetric unit of the orthorhombic crystal form A and of one or two monomers in the cubic crystal form B. PMID:18323599

IOTA: integration optimization, triage and analysis tool for the processing of XFEL diffraction images.

PubMed

Lyubimov, Artem Y; Uervirojnangkoorn, Monarin; Zeldin, Oliver B; Brewster, Aaron S; Murray, Thomas D; Sauter, Nicholas K; Berger, James M; Weis, William I; Brunger, Axel T

2016-06-01

Serial femtosecond crystallography (SFX) uses an X-ray free-electron laser to extract diffraction data from crystals not amenable to conventional X-ray light sources owing to their small size or radiation sensitivity. However, a limitation of SFX is the high variability of the diffraction images that are obtained. As a result, it is often difficult to determine optimal indexing and integration parameters for the individual diffraction images. Presented here is a software package, called IOTA , which uses a grid-search technique to determine optimal spot-finding parameters that can in turn affect the success of indexing and the quality of integration on an image-by-image basis. Integration results can be filtered using a priori information about the Bravais lattice and unit-cell dimensions and analyzed for unit-cell isomorphism, facilitating an improvement in subsequent data-processing steps.

Crystallization, optimization and preliminary X-ray characterization of a metal-dependent PI-PLC from Streptomyces antibioticus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jackson, Michael R.; Selby, Thomas L.

2012-10-30

A recombinant metal-dependent phosphatidylinositol-specific phospholipase C (PI-PLC) fromStreptomyces antibioticushas been crystallized by the hanging-drop method with and without heavy metals. The native crystals belonged to the orthorhombic space groupP222, with unit-cell parametersa= 41.26,b= 51.86,c = 154.78 Å. The X-ray diffraction results showed significant differences in the crystal quality of samples soaked with heavy atoms. Additionally, drop pinning, which increases the surface area of the drops, was also used to improve crystal growth and quality. The combination of heavy-metal soaks and drop pinning was found to be critical for producing high-quality crystals that diffracted to 1.23 Å resolution.

Purification, crystallization, and preliminary X-ray diffraction study of purine nucleoside phosphorylase from E. coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abramchik, Yu. A., E-mail: inna@ns.crys.ras.ru; Timofeev, V. I., E-mail: espiov@ibch.ru; Zhukhlistova, N. E., E-mail: tostars@mail.ru

2015-07-15

Crystals of E. coli purine nucleoside phosphorylase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 0.99 Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unit-cell parameters: a = 74.1 Å, b = 110.2 Å, c = 88.2 Å, α = γ = 90°, β = 111.08°. The crystal contains six subunits of the enzyme comprising a hexamer per asymmetric unit. The hexamermore » is the biological active form of E. coli. purine nucleoside phosphorylase.« less

Purification, isolation, crystallization, and preliminary X-ray diffraction study of the BTB domain of the centrosomal protein 190 from Drosophila melanogaster

NASA Astrophysics Data System (ADS)

Boyko, K. M.; Nikolaeva, A. Yu.; Kachalova, G. S.; Bonchuk, A. N.; Popov, V. O.

2017-11-01

The spatial organization of the genome is controlled by a special class of architectural proteins, including proteins containing BTB domains that are able to dimerize or multimerize. The centrosomal protein 190 is one of such architectural proteins. The purification, crystallization, and preliminary X-ray diffraction study of the BTB domain of the centrosomal protein 190 are reported. The crystallization conditions were found by the vapor-diffusion technique. The crystals diffracted to 1.5 Å resolution and belonged to sp. gr. P3221. The structure was solved by the molecular replacement method. The structure refinement is currently underway.

Diffractive-refractive optics: X-ray splitter.

PubMed

Hrdý, Jaromír

2010-01-01

The possibility of splitting a thin (e.g. undulator) X-ray beam based on diffraction-refraction effects is discussed. The beam is diffracted from a crystal whose diffracting surface has the shape of a roof with the ridge lying in the plane of diffraction. The crystal is cut asymmetrically. One half of the beam impinges on the left-hand part of the roof and the other half impinges on the right-hand side of the roof. Owing to refraction the left part of the beam is deviated to the left whereas the right part is deviated to the right. The device proposed consists of two channel-cut crystals with roof-like diffraction surfaces; the crystals are set in a dispersive position. The separation of the beams after splitting is calculated at a distance of 10 m from the crystals for various asymmetry and inclination angles. It is shown that such a splitting may be utilized for long beamlines. Advantages and disadvantages of this method are discussed.

Crystal growth of triphenylphosphine oxide 4-nitrophenol (TP4N) for nonlinear optical (NLO) applications

NASA Astrophysics Data System (ADS)

Pandian, Muthu Senthil; Karuppasamy, P.; Kamalesh, T.; Ramasamy, P.; Verma, Sunil

2018-04-01

The optically good quality organic single crystals of triphenylphosphine oxide 4-nitrophenol (TP4N) were successfully grown by slow evaporation solution technique (SEST) using methanol as solvent. The lattice parameters of the grown crystal were confirmed by single crystal X-ray diffraction analysis. The optical transmittance, cut-off wavelength and band gap of the TP4N crystal were obtained by UV-Vis NIR spectrum analysis. The photoluminescence studies were carried out to find out the luminesce properties of TP4N single crystal. The photoconductivity studies reveal that the TP4N crystal has negative photoconductive nature. The third order nonlinear susceptibility (χ(3)) of TP4N crystal was evaluated using the Z-scan technique at 640 nm.

Liquid-liquid diffusion crystallization improves the X-ray diffraction of EndoS, an endo-β-N-acetylglucosaminidase from Streptococcus pyogenes with activity on human IgG.

PubMed

Trastoy, Beatriz; Lomino, Joseph V; Wang, Lai Xi; Sundberg, Eric J

2013-12-01

Endoglycosidase S (EndoS) is an enzyme secreted by Streptococcus pyogenes that specifically hydrolyzes the β-1,4-di-N-acetylchitobiose core glycan on immunoglobulin G (IgG) antibodies. One of the most common human pathogens and the cause of group A streptococcal infections, S. pyogenes secretes EndoS in order to evade the host immune system by rendering IgG effector mechanisms dysfunctional. On account of its specificity for IgG, EndoS has also been used extensively for chemoenzymatic synthesis of homogeneous IgG glycoprotein preparations and is being developed as a novel therapeutic for a wide range of autoimmune diseases. The structural basis of its enzymatic activity and substrate specificity, however, remains unknown. Here, the purification and crystallization of EndoS are reported. Using traditional hanging-drop and sitting-drop vapor-diffusion crystallization, crystals of EndoS were grown that diffracted to a maximum of 3.5 Å resolution but suffered from severe anisotropy, the data from which could only be reasonably processed to 7.5 Å resolution. When EndoS was crystallized by liquid-liquid diffusion, it was possible to grow crystals with a different space group to those obtained by vapor diffusion. Crystals of wild-type endoglycosidase and glycosynthase constructs of EndoS grown by liquid-liquid diffusion diffracted to 2.6 and 1.9 Å resolution, respectively, with a greatly diminished anisotropy. Despite extensive efforts, the failure to reproduce these liquid-liquid diffusion-grown crystals by vapor diffusion suggests that these crystallization methods each sample a distinct crystallization space.

Crystallization and preliminary X-ray diffraction analysis of an endo-1,4-β-D-glucanase from Aspergillus aculeatus F-50.

PubMed

Chen, Yun; Huang, Jian Wen; Chen, Chun Chi; Lai, Hui Lin; Jin, Jian; Guo, Rey Ting

2015-04-01

Cellulose is the most abundant renewable biomass on earth, and its decomposition has proven to be very useful in a wide variety of industries. Endo-1,4-β-D-glucanase (EC 3.2.1.4; endoglucanase), which can catalyze the random hydrolysis of β-1,4-glycosidic bonds to cleave cellulose into smaller fragments, is a key cellulolytic enzyme. An endoglucanase isolated from Aspergillus aculeatus F-50 (FI-CMCase) that was classified into glycoside hydrolase family 12 has been found to be effectively expressed in the industrial strain Pichia pastoris. Here, recombinant FI-CMCase was crystallized. Crystals belonging to the orthorhombic space group C222₁, with unit-cell parameters a = 74.2, b = 75.1, c = 188.4 Å, were obtained by the sitting-drop vapour-diffusion method and diffracted to 1.6 Å resolution. Initial phase determination by molecular replacement clearly shows that the crystal contains two protein molecules in the asymmetric unit. Further model building and structure refinement are in progress.

Error analysis of the crystal orientations obtained by the dictionary approach to EBSD indexing.

PubMed

Ram, Farangis; Wright, Stuart; Singh, Saransh; De Graef, Marc

2017-10-01

The efficacy of the dictionary approach to Electron Back-Scatter Diffraction (EBSD) indexing was evaluated through the analysis of the error in the retrieved crystal orientations. EBSPs simulated by the Callahan-De Graef forward model were used for this purpose. Patterns were noised, distorted, and binned prior to dictionary indexing. Patterns with a high level of noise, with optical distortions, and with a 25 × 25 pixel size, when the error in projection center was 0.7% of the pattern width and the error in specimen tilt was 0.8°, were indexed with a 0.8° mean error in orientation. The same patterns, but 60 × 60 pixel in size, were indexed by the standard 2D Hough transform based approach with almost the same orientation accuracy. Optimal detection parameters in the Hough space were obtained by minimizing the orientation error. It was shown that if the error in detector geometry can be reduced to 0.1% in projection center and 0.1° in specimen tilt, the dictionary approach can retrieve a crystal orientation with a 0.2° accuracy. Copyright © 2017 Elsevier B.V. All rights reserved.

A Newly Designed Microspectrofluorometer for Kinetic Studies on Protein Crystals in Combination with X-Ray Diffraction

PubMed Central

Klink, Björn U.; Goody, Roger S.; Scheidig, Axel J.

2006-01-01

We present a new design for a fluorescence microspectrophotometer for use in kinetic crystallography in combination with x-ray diffraction experiments. The FLUMIX device (Fluorescence spectroscopy to monitor intermediates in x-ray crystallography) is built for 0° fluorescence detection, which has several advantages in comparison to a conventional fluorometer with 90° design. Due to the reduced spatial requirements and the need for only one objective, the system is highly versatile, easy to handle, and can be used for many different applications. In combination with a conventional stereomicroscope, fluorescence measurements or reaction initiation can be performed directly in a hanging drop crystallization setup. The FLUMIX device can be combined with most x-ray sources, normally without the need of a specialized mechanical support. As a biological model system, we have used H-Ras p21 with an artificially introduced photo-labile GTP precursor (caged GTP) and a covalently attached fluorophore (IANBD amide). Using the FLUMIX system, detailed information about the state of photolyzed crystals of the modified H-Ras p21 (p21(mod)) could be obtained. Measurements in combination with a synchrotron beamline showed significant fluorescence changes in p21(mod) crystals even within a few seconds of x-ray exposure at 100 K. PMID:16698776

Production, crystallization and preliminary X-ray diffraction of the Gαs α-helical domain in complex with a nanobody.

PubMed

Triest, Sarah; Wohlkönig, Alexandre; Pardon, Els; Steyaert, Jan

2014-11-01

GPCR-G-protein complexes are one of the most important components of cell-signalling cascades. Extracellular signals are sensed by membrane-associated G-protein-coupled receptors (GPCRs) and transduced via G proteins towards intracellular effector molecules. Structural studies of these transient complexes are crucial to understand the molecular details of these interactions. Although a nucleotide-free GPCR-G-protein complex is stable, it is not an ideal sample for crystallization owing to the intrinsic mobility of the Gαs α-helical domain (AHD). To stabilize GPCR-G-protein complexes in a nucleotide-free form, nanobodies were selected that target the flexible GαsAHD. One of these nanobodies, CA9177, was co-crystallized with the GαsAHD. Initial crystals were obtained using the sitting-drop method in a sparse-matrix screen and further optimized. The crystals diffracted to 1.59 Å resolution and belonged to the monoclinic space group P2₁, with unit-cell parameters a=44.07, b=52.55, c=52.66 Å, α=90.00, β=107.89, γ=90.00°. The structure of this specific nanobody reveals its binding epitope on GαsAHD and will help to determine whether this nanobody could be used as crystallization chaperone for GPCR-G-protein complexes.

Purification, crystallization and preliminary X-ray diffraction analysis of the Escherichia coli common pilus chaperone EcpB

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garnett, James A.; Diallo, Mamou; Matthews, Steve J., E-mail: s.j.matthews@imperial.ac.uk

In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher pathway that plays a major role in both early biofilm formation and host-cell adhesion. Initial attempts at crystallizing the chaperone EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. This is the first time that this refolding strategy has been used to purify CU chaperones. Pili are key cell-surface components that allow the attachment of bacteria to both biological andmore » abiotic solid surfaces, whilst also mediating interactions between themselves. In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher (CU) pathway that plays a major role in both early biofilm formation and host-cell adhesion. The chaperone EcpB is involved in the biogenesis of the filament, which is composed of EcpA and EcpD. Initial attempts at crystallizing EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. Diffraction data have been processed to 2.4 Å resolution. These crystals belonged to the trigonal space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 62.65, c = 121.14 Å and one monomer in the asymmetric unit. Molecular replacement was unsuccessful, but selenomethionine-substituted protein and heavy-atom derivatives are being prepared for phasing. The three-dimensional structure of EcpB will provide invaluable information on the subtle mechanistic differences in biogenesis between the alternative and classical CU pathways. Furthermore, this is the first time that this refolding strategy has been used to purify CU chaperones

On thermal conditions and properties of thallium bromide single crystals grown by the Electro Dynamic Gradient method

NASA Astrophysics Data System (ADS)

Zheng, Zhiping; Yu, Yongtao; Gong, Shuping; Fu, Qiuyun; Zhou, Dongxiang

2013-05-01

The Electro Dynamic Gradient (EDG) method has been proved to be a feasible way to grow TlBr crystals in our previous work. In this research, the influence of thermal conditions such as cooling rate during growth process on the crystal performance was investigated. Crystals of approximately 12 mm diameter were obtained by the EDG method at different cooling rates during the growth process, and the quality of the crystals was routinely evaluated by X-ray diffraction (XRD), infrared (IR) and ultraviolet (UV) transmission, I-V measurement and energy response spectrum. The results proved that thermal conditions during growth had a profound influence on the characteristics of the crystals.

Crystallization and preliminary X-ray analysis of human MTH1 with a homogeneous N-terminus

PubMed Central

Koga, Yukari; Inazato, Miyuki; Nakamura, Teruya; Hashikawa, Chie; Chirifu, Mami; Michi, Asuka; Yamashita, Taku; Toma, Sachiko; Kuniyasu, Akihiko; Ikemizu, Shinji; Nakabeppu, Yusaku; Yamagata, Yuriko

2013-01-01

Human MTH1 (hMTH1) is an enzyme that hydrolyses several oxidized purine nucleoside triphosphates to their corresponding nucleoside monophosphates. Crystallographic studies have shown that the accurate mode of interaction between 8-oxoguanine and hMTH1 cannot be understood without determining the positions of the H atoms, as can be observed in neutron and/or ultrahigh-resolution X-ray diffraction studies. The hMTH1 protein prepared in the original expression system from Escherichia coli did not appear to be suitable for obtaining high-quality crystals because the hMTH1 protein had heterogeneous N-termini of Met1 and Gly2 that resulted from N-terminal Met excision by methionine aminopeptidase from the E. coli host. To obtain homogeneous hMTH1, the Gly at the second position was replaced by Lys. As a result, mutant hMTH1 protein [hMTH1(G2K)] with a homogeneous N-terminus could be prepared and high-quality crystals which diffracted to near 1.1 Å resolution using synchrotron radiation were produced. The new crystals belonged to space group P212121, with unit-cell parameters a = 46.36, b = 47.58, c = 123.89 Å. PMID:23295485

Crystallization and preliminary X-ray analysis of human MTH1 with a homogeneous N-terminus.

PubMed

Koga, Yukari; Inazato, Miyuki; Nakamura, Teruya; Hashikawa, Chie; Chirifu, Mami; Michi, Asuka; Yamashita, Taku; Toma, Sachiko; Kuniyasu, Akihiko; Ikemizu, Shinji; Nakabeppu, Yusaku; Yamagata, Yuriko

2013-01-01

Human MTH1 (hMTH1) is an enzyme that hydrolyses several oxidized purine nucleoside triphosphates to their corresponding nucleoside monophosphates. Crystallographic studies have shown that the accurate mode of interaction between 8-oxoguanine and hMTH1 cannot be understood without determining the positions of the H atoms, as can be observed in neutron and/or ultrahigh-resolution X-ray diffraction studies. The hMTH1 protein prepared in the original expression system from Escherichia coli did not appear to be suitable for obtaining high-quality crystals because the hMTH1 protein had heterogeneous N-termini of Met1 and Gly2 that resulted from N-terminal Met excision by methionine aminopeptidase from the E. coli host. To obtain homogeneous hMTH1, the Gly at the second position was replaced by Lys. As a result, mutant hMTH1 protein [hMTH1(G2K)] with a homogeneous N-terminus could be prepared and high-quality crystals which diffracted to near 1.1 Å resolution using synchrotron radiation were produced. The new crystals belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 46.36, b = 47.58, c = 123.89 Å.

Additional evidence from x-ray powder diffraction patterns that icosahedral quasi-crystals of intermetallic compounds are twinned cubic crystals

PubMed Central

Pauling, Linus

1988-01-01

Analysis of the measured values of Q for the weak peaks (small maxima, usually considered to be background fluctuations, “noise”) on the x-ray powder diffraction curves for 17 rapidly quenched alloys leads directly to the conclusion that they are formed by an 820-atom or 1012-atom primitive cubic structure that by icosahedral twinning produces the so-called icosahedral quasi-crystals. PMID:16593948

In-situ neutron diffraction and crystal plasticity finite element modeling to study the kinematic stability of retained austenite in bearing steels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Voothaluru, Rohit; Bedekar, Vikram; Xie, Qingge

This work integrates in-situ neutron diffraction and crystal plasticity finite element modeling to study the kinematic stability of retained austenite in high carbon bearing steels. The presence of a kinematically metastable retained austenite in bearing steels can significantly affect the macro-mechanical and micro-mechanical material response. Mechanical characterization of metastable austenite is a critical component in accurately capturing the micro-mechanical behavior under typical application loads. Traditional mechanical characterization techniques are unable to discretely quantify the micro-mechanical response of the austenite, and as a result, the computational predictions rely heavily on trial and error or qualitative descriptions of the austenite phase. Inmore » order to overcome this, in the present work, we use in-situ neutron diffraction of a uniaxial tension test of an A485 Grade 1 bearing steel specimen. The mechanical response determined from the neutron diffraction analysis was incorporated into a hybrid crystal plasticity finite element model that accounts for the martensite's crystal plasticity and the stress-assisted transformation from austenite to martensite in bearing steels. Here, the modeling response was used to estimate the single crystal elastic constants of the austenite and martensite phases. Finally, the results show that using in-situ neutron diffraction, coupled with a crystal plasticity model, can successfully predict both the micro-mechanical and macro-mechanical responses of bearing steels while accounting for the martensitic transformation of the retained austenite.« less

In-situ neutron diffraction and crystal plasticity finite element modeling to study the kinematic stability of retained austenite in bearing steels

DOE PAGES

Voothaluru, Rohit; Bedekar, Vikram; Xie, Qingge; ...

2018-11-21

This work integrates in-situ neutron diffraction and crystal plasticity finite element modeling to study the kinematic stability of retained austenite in high carbon bearing steels. The presence of a kinematically metastable retained austenite in bearing steels can significantly affect the macro-mechanical and micro-mechanical material response. Mechanical characterization of metastable austenite is a critical component in accurately capturing the micro-mechanical behavior under typical application loads. Traditional mechanical characterization techniques are unable to discretely quantify the micro-mechanical response of the austenite, and as a result, the computational predictions rely heavily on trial and error or qualitative descriptions of the austenite phase. Inmore » order to overcome this, in the present work, we use in-situ neutron diffraction of a uniaxial tension test of an A485 Grade 1 bearing steel specimen. The mechanical response determined from the neutron diffraction analysis was incorporated into a hybrid crystal plasticity finite element model that accounts for the martensite's crystal plasticity and the stress-assisted transformation from austenite to martensite in bearing steels. Here, the modeling response was used to estimate the single crystal elastic constants of the austenite and martensite phases. Finally, the results show that using in-situ neutron diffraction, coupled with a crystal plasticity model, can successfully predict both the micro-mechanical and macro-mechanical responses of bearing steels while accounting for the martensitic transformation of the retained austenite.« less

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

X-ray characterization of curved crystals for hard x-ray astronomy

NASA Astrophysics Data System (ADS)

Buffagni, Elisa; Bonnini, Elisa; Ferrari, Claudio; Virgilli, Enrico; Frontera, Filippo

2015-05-01

Among the methods to focus photons the diffraction in crystals results as one of the most effective for high energy photons. An assembling of properly oriented crystals can form a lens able to focus x-rays at high energy via Laue diffraction in transmission geometry; this is a Laue lens. The x-ray diffraction theory provides that the maximum diffraction efficiency is achieved in ideal mosaic crystals, but real mosaic crystals show diffraction efficiencies several times lower than the ideal case due to technological problems. An alternative and convenient approach is the use of curved crystals. We have recently optimized an efficient method based on the surface damage of crystals to produce self-standing uniformly curved Si, GaAs and Ge tiles of thickness up to 2-3 mm and curvature radii R down to a few meters. We show that, for curved diffracting planes, such crystals have a diffraction efficiency nearly forty times higher than the diffraction efficiency of perfect similar flat crystals, thus very close to that of ideal mosaic crystals. Moreover, in an alternative configuration where the diffracting planes are perpendicular to the curved ones, a focusing effect occurs and will be shown. These results were obtained for several energies between 17 and 120 keV with lab sources or at high energy facilities such as LARIX at Ferrara (Italy), ESRF at Grenoble (France), and ANKA at Karlsruhe (Germany).

Crystallization and preliminary X-ray diffraction study of phosphopantetheine adenylyltransferase from M. tuberculosis crystallizing in space group P3{sub 2}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Timofeev, V. I., E-mail: tostars@mail.ru; Chupova, L. A.; Esipov, R. S.

Crystals of M. tuberculosis phosphopantetheine adenylyltransferase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 2.00-Å resolution. The crystals belong to sp. gr. P3{sub 2} and have the following unit-cell parameters: a = b = 106.47 Å, c = 71.32 Å, α = γ = 90°, β = 120°. The structure was solved by the molecular-replacement method. There are six subunits of the enzyme comprising a hexamer per asymmetricmore » unit. The hexamer is a biologically active form of phosphopantetheine adenylyltransferase from M. tuberculosis.« less

The purification, crystallization and preliminary diffraction of a glycerophosphodiesterase from Enterobacter aerogenes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jackson, Colin J.; Carr, Paul D.; Kim, Hye-Kyung

2006-07-01

The metallo-glycerophosphodiesterase from E. aerogenes (GpdQ) has been cloned, expressed in E. coli and purified. Initial screening of crystallization conditions for this enzyme resulted in the identification of needles from one condition in a sodium malonate grid screen. Removal of the metals from the enzyme and subsequent optimization of these conditions led to crystals. The metallo-glycerophosphodiesterase from Enterobacter aerogenes (GpdQ) has been cloned, expressed in Escherichia coli and purified. Initial screening of crystallization conditions for this enzyme resulted in the identification of needles from one condition in a sodium malonate grid screen. Removal of the metals from the enzyme andmore » subsequent optimization of these conditions led to crystals that diffracted to 2.9 Å and belonged to space group P2{sub 1}3, with unit-cell parameter a = 164.1 Å. Self-rotation function analysis and V{sub M} calculations indicated that the asymmetric unit contains two copies of the monomeric enzyme, corresponding to a solvent content of 79%. It is intended to determine the structure of this protein utilizing SAD phasing from transition metals or molecular replacement.« less

Crystallization and preliminary X-ray diffraction analysis of recombinant phosphoribosylpyrophosphate synthetase from the Thermophilic thermus thermophilus strain HB27

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.

2017-01-15

Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus (T. th HB27) has high thermal stability and shows maximum activity at 75°Ð¡, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample,more » which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.« less

Crystallization and preliminary X-ray diffraction analysis of recombinant phosphoribosylpyrophosphate synthetase from the Thermophilic thermus thermophilus strain HB27

NASA Astrophysics Data System (ADS)

Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Sinitsyna, E. V.; Esipov, R. S.; Kuranova, I. P.

2017-01-01

Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus ( T. th HB27) has high thermal stability and shows maximum activity at 75°C, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample, which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P21 and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.

Strain distribution in an Si single crystal measured by interference fringes of X-ray mirage diffraction

PubMed Central

Jongsukswat, Sukswat; Fukamachi, Tomoe; Ju, Dongying; Negishi, Riichirou; Hirano, Keiichi; Kawamura, Takaaki

2013-01-01

In X-ray interference fringes accompanied by mirage diffraction, variations have been observed in the spacing and position of the fringes from a plane-parallel Si single crystal fixed at one end as a function of distance from the incident plane of the X-rays to the free crystal end. The variations can be explained by distortion of the sample crystal due to gravity. From the variations and positions of the fringes, the strain gradient of the crystal has been determined. The distribution of the observed strain agrees with that expected from rod theory except for residual strain. When the distortion is large, the observed strain distribution does not agree with that expected from rod theory. PMID:24068841

Crystallization and X-ray diffraction analysis of salicylate synthase, a chorismate-utilizing enyme involved in siderophore biosynthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parsons, James F., E-mail: parsonsj@umbi.umd.edu; Shi, Katherine; Calabrese, Kelly

2006-03-01

Salicylate synthase, which catalyzes the first step in the synthesis of the siderophore yersiniabactin, has been crystallized. Diffraction data have been collected to 2.5 Å. Bacteria have evolved elaborate schemes that help them thrive in environments where free iron is severely limited. Siderophores such as yersiniabactin are small iron-scavenging molecules that are deployed by bacteria during iron starvation. Several studies have linked siderophore production and virulence. Yersiniabactin, produced by several Enterobacteriaceae, is derived from the key metabolic intermediate chorismic acid via its conversion to salicylate by salicylate synthase. Crystals of salicylate synthase from the uropathogen Escherichia coli CFT073 have beenmore » grown by vapour diffusion using polyethylene glycol as the precipitant. The monoclinic (P2{sub 1}) crystals diffract to 2.5 Å. The unit-cell parameters are a = 57.27, b = 164.07, c = 59.04 Å, β = 108.8°. The solvent content of the crystals is 54% and there are two molecules of the 434-amino-acid protein in the asymmetric unit. It is anticipated that the structure will reveal key details about the reaction mechanism and the evolution of salicylate synthase.« less

Controlled In Meso Phase Crystallization – A Method for the Structural Investigation of Membrane Proteins

PubMed Central

Kubicek, Jan; Schlesinger, Ramona; Baeken, Christian; Büldt, Georg; Schäfer, Frank; Labahn, Jörg

2012-01-01

We investigated in meso crystallization of membrane proteins to develop a fast screening technology which combines features of the well established classical vapor diffusion experiment with the batch meso phase crystallization, but without premixing of protein and monoolein. It inherits the advantages of both methods, namely (i) the stabilization of membrane proteins in the meso phase, (ii) the control of hydration level and additive concentration by vapor diffusion. The new technology (iii) significantly simplifies in meso crystallization experiments and allows the use of standard liquid handling robots suitable for 96 well formats. CIMP crystallization furthermore allows (iv) direct monitoring of phase transformation and crystallization events. Bacteriorhodopsin (BR) crystals of high quality and diffraction up to 1.3 Å resolution have been obtained in this approach. CIMP and the developed consumables and protocols have been successfully applied to obtain crystals of sensory rhodopsin II (SRII) from Halobacterium salinarum for the first time. PMID:22536388

Crystallization and preliminary X-ray diffraction analysis of the lectin from Dioclea rostrata Benth seeds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delatorre, Plínio; Departamento de Ciências Biológicas, Universidade Regional do Cariri, Crato, CE 63195-000; Nascimento, Kyria Santiago

2006-02-01

D. rostrata lectin was crystallized by hanging-drop vapor diffusion. The crystal belongs to the orthorhombic space group I222 and diffracted to 1.87 Å resolution. Lectins from the Diocleinae subtribe (Leguminosae) are highly similar proteins that promote various biological activities with distinctly differing potencies. The structural basis for this experimental data is not yet fully understood. Dioclea rostrata lectin was purified and crystallized by hanging-drop vapour diffusion at 293 K. The crystal belongs to the orthorhombic space group I222, with unit-cell parameters a = 61.51, b = 88.22, c = 87.76 Å. Assuming the presence of one monomer per asymmetric unit,more » the solvent content was estimated to be about 47.9%. A complete data set was collected at 1.87 Å resolution.« less

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708.

PubMed

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-11-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 angstrom resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 angstrom. The Matthews coefficient (V(M) = 1.76 angstrom(3) Da(-1)) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit.

Growth and characterization of diammonium copper disulphate hexahydrate single crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Siva Sankari, R.; Perumal, Rajesh Narayana, E-mail: r.shankarisai@gmail.com

2014-03-01

Graphical abstract: Diammonium copper disulphate hexahydrate (DACS) is one of the most promising inorganic dielectric crystals with exceptional mechanical properties. Good quality crystals of DACS were grown by using solution method in a period of 30 days. The grown crystals were subjected to single crystal X-ray diffraction analysis in order to establish their crystalline nature. Thermo gravimetric, differential thermal analysis, FTIR, and UV–vis–NIR analysis were performed for the crystal. Several solid state physical parameters have been determined for the grown crystals. The dielectric constant and the dielectric loss and AC conductivity of the grown crystal were studied as a functionmore » of frequency and temperature has been calculated and plotted. - Highlights: • Diammonium copper disulphate is grown for the first time and CCDC number obtained. • Thermal analysis is done to see the stability range of the crystals. • Band gap and UV cut off wavelength of the crystal are determined to be 2.4 eV and 472.86 nm, respectively. • Dielectric constant, dielectric loss and AC conductivity are plotted as a function of applied field. - Abstract: Diammonium copper disulphate hexahydrate is one of the most promising inorganic crystals with exceptional dielectric properties. A good quality crystal was harvested in a 30-day period using solution growth method. The grown crystal was subjected to various characterization techniques like single crystal X-ray diffraction analysis, thermo gravimetric, differential thermal analysis, FTIR, and UV–vis–NIR analysis. Unit cell dimensions of the grown crystal have been identified from XRD studies. Functional groups of the title compounds have been identified from FTIR studies. Thermal stability of the samples was checked by TG/DTA studies. Band gap of the crystal was calculated. The dielectric constant and dielectric loss were studied as a function of frequency of the applied field. AC conductivity was plotted as a

Purification and crystallization of dengue and West Nile virus NS2B–NS3 complexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

D’Arcy, Allan, E-mail: allan.darcy@novartis.com; Chaillet, Maxime; Schiering, Nikolaus

Crystals of dengue serotype 2 and West Nile virus NS2B–NS3 protease complexes have been obtained and the crystals of both diffract to useful resolution. Sample homogeneity was essential for obtaining X-ray-quality crystals of the dengue protease. Controlled proteolysis produced a crystallizable fragment of the apo West Nile virus NS2B–NS3 and crystals were also obtained in the presence of a peptidic inhibitor. Both dengue and West Nile virus infections are an increasing risk to humans, not only in tropical and subtropical areas, but also in North America and parts of Europe. These viral infections are generally transmitted by mosquitoes, but maymore » also be tick-borne. Infection usually results in mild flu-like symptoms, but can also cause encephalitis and fatalities. Approximately 2799 severe West Nile virus cases were reported this year in the United States, resulting in 102 fatalities. With this alarming increase in the number of West Nile virus infections in western countries and the fact that dengue virus already affects millions of people per year in tropical and subtropical climates, there is a real need for effective medicines. A possible therapeutic target to combat these viruses is the protease, which is essential for virus replication. In order to provide structural information to help to guide a lead identification and optimization program, crystallizations of the NS2B–NS3 protease complexes from both dengue and West Nile viruses have been initiated. Crystals that diffract to high resolution, suitable for three-dimensional structure determinations, have been obtained.« less

Diffraction of three-colour radiation on an acoustic wave

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kotov, V M

We study acousto-optic Bragg diffraction of three-colour radiation having wavelengths of 488, 514 and 633 nm on a single acoustic wave propagating in a TeO{sub 2} crystal. A technique is developed that allows one to find diffraction regimes with a proportional change in the intensity of all radiations by varying the acoustic power. According to the technique, radiation with a maximum wavelength has to be in strict Bragg synchronism with the acoustic wave, while other radiations diffract during the synchronism detuning. The results obtained using this technique are experimentally confirmed. (diffraction of light)

Thin film solar cell design based on photonic crystal and diffractive grating structures.

PubMed

Mutitu, James G; Shi, Shouyuan; Chen, Caihua; Creazzo, Timothy; Barnett, Allen; Honsberg, Christiana; Prather, Dennis W

2008-09-15

In this paper we present novel light trapping designs applied to multiple junction thin film solar cells. The new designs incorporate one dimensional photonic crystals as band pass filters that reflect short light wavelengths (400 - 867 nm) and transmit longer wavelengths(867 -1800 nm) at the interface between two adjacent cells. In addition, nano structured diffractive gratings that cut into the photonic crystal layers are incorporated to redirect incoming waves and hence increase the optical path length of light within the solar cells. Two designs based on the nano structured gratings that have been realized using the scattering matrix and particle swarm optimization methods are presented. We also show preliminary fabrication results of the proposed devices.

High-quality single-crystal thulium iron garnet films with perpendicular magnetic anisotropy by off-axis sputtering

NASA Astrophysics Data System (ADS)

Wu, C. N.; Tseng, C. C.; Lin, K. Y.; Cheng, C. K.; Yeh, S. L.; Fanchiang, Y. T.; Hong, M.; Kwo, J.

2018-05-01

High-quality single-crystal thulium iron garnet (TmIG) films of 10-30 nm thick were grown by off-axis sputtering at room temperature (RT) followed by post-annealing. X-ray photoelectron spectroscopy (XPS) was employed to determine the TmIG film composition to optimize the growth conditions, along with the aid of x-ray diffraction (XRD) structural analysis and atomic force microscope (AFM) for surface morphology. The optimized films exhibited perpendicular magnetic anisotropy (PMA) and the saturation magnetization at RT was ˜99 emu/cm3, close to the RT bulk value ˜110 emu/cm3 with a very low coercive field of ˜2.4 Oe. We extracted the H⊥ of 1734 Oe and the peak-to-peak linewidth ΔH of ferromagnetic resonance are only about 99 Oe, significantly lower than that of PLD grown TmIG film and bulk single crystals. The high-quality sputtered single-crystal TmIG films show great potential to be integrated with topological insulators or heavy metals with strong spin-orbit coupling for spintronic applications.

An Overview of Hardware for Protein Crystallization in a Magnetic Field.

PubMed

Yan, Er-Kai; Zhang, Chen-Yan; He, Jin; Yin, Da-Chuan

2016-11-16

Protein crystallization under a magnetic field is an interesting research topic because a magnetic field may provide a special environment to acquire improved quality protein crystals. Because high-quality protein crystals are very useful in high-resolution structure determination using diffraction techniques (X-ray, neutron, and electron diffraction), research using magnetic fields in protein crystallization has attracted substantial interest; some studies have been performed in the past two decades. In this research field, the hardware is especially essential for successful studies because the environment is special and the design and utilization of the research apparatus in such an environment requires special considerations related to the magnetic field. This paper reviews the hardware for protein crystallization (including the magnet systems and the apparatus designed for use in a magnetic field) and progress in this area. Future prospects in this field will also be discussed.

Towards protein-crystal centering using second-harmonic generation (SHG) microscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kissick, David J.; Dettmar, Christopher M.; Becker, Michael

2013-05-01

The potential of second-harmonic generation (SHG) microscopy for automated crystal centering to guide synchrotron X-ray diffraction of protein crystals has been explored. The potential of second-harmonic generation (SHG) microscopy for automated crystal centering to guide synchrotron X-ray diffraction of protein crystals was explored. These studies included (i) comparison of microcrystal positions in cryoloops as determined by SHG imaging and by X-ray diffraction rastering and (ii) X-ray structure determinations of selected proteins to investigate the potential for laser-induced damage from SHG imaging. In studies using β{sub 2} adrenergic receptor membrane-protein crystals prepared in lipidic mesophase, the crystal locations identified by SHGmore » images obtained in transmission mode were found to correlate well with the crystal locations identified by raster scanning using an X-ray minibeam. SHG imaging was found to provide about 2 µm spatial resolution and shorter image-acquisition times. The general insensitivity of SHG images to optical scatter enabled the reliable identification of microcrystals within opaque cryocooled lipidic mesophases that were not identified by conventional bright-field imaging. The potential impact of extended exposure of protein crystals to five times a typical imaging dose from an ultrafast laser source was also assessed. Measurements of myoglobin and thaumatin crystals resulted in no statistically significant differences between structures obtained from diffraction data acquired from exposed and unexposed regions of single crystals. Practical constraints for integrating SHG imaging into an active beamline for routine automated crystal centering are discussed.« less

Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

2016-11-30

A tetrahydrofolate-dependentO-demethylase, LigM, fromSphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtainedP3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding usingP3 121/P3 221 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space groupP2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c= 128.1 Å. TheP2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing the cryoconditions. Phasing using the single anomalous diffractionmore » method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

Magnetic anisotropy and spin-flop transition of NiWO4 single crystals

NASA Astrophysics Data System (ADS)

Liu, C. B.; He, Z. Z.; Liu, Y. J.; Chen, R.; Shi, M. M.; Zhu, H. P.; Dong, C.; Wang, J. F.

2017-12-01

NiWO4 exhibits a spin chain structure built by magnetic Ni2+ ions, which may be considered as a one dimensional S = 1 system. In this work, large-sized single crystals of NiWO4 were successfully synthesized by a flux method and the crystal quality was confirmed by X-ray diffraction. Magnetic properties of obtained single crystals were studied by means of magnetic susceptibility and high field magnetization along crystallographic axes. The results demonstrate that NiWO4 is highly magnetic anisotropic and possesses a three-dimensional long range ordering below 60 K, where a spin flop transition can be observed at 17.5 T in applied magnetic fields along the magnetic easy axis (c-axis).

Protein Crystal Quality Studies

NASA Technical Reports Server (NTRS)

1998-01-01

Eddie Snell, Post-Doctoral Fellow the National Research Council (NRC) uses a reciprocal space mapping diffractometer for macromolecular crystal quality studies. The diffractometer is used in mapping the structure of macromolecules such as proteins to determine their structure and thus understand how they function with other proteins in the body. This is one of several analytical tools used on proteins crystallized on Earth and in space experiments. Photo credit: NASA/Marshall Space Flight Center (MSFC)

Crystallization and preliminary X-ray diffraction studies of the glutaminyl cyclase from Carica papaya latex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Azarkan, Mohamed; Clantin, Bernard; Bompard, Coralie

2005-01-01

The glutaminyl cyclase isolated from C. papaya latex has been crystallized using the hanging-drop method. Diffraction data have been collected at ESRF beamline BM14 and processed to 1.7 Å resolution. In living systems, the intramolecular cyclization of N-terminal glutamine residues is accomplished by glutaminyl cyclase enzymes (EC 2.3.2.5). While in mammals these enzymes are involved in the synthesis of hormonal and neurotransmitter peptides, the physiological role played by the corresponding plant enzymes still remains to be unravelled. Papaya glutaminyl cyclase (PQC), a 33 kDa enzyme found in the latex of the tropical tree Carica papaya, displays an exceptional resistance tomore » chemical and thermal denaturation as well as to proteolysis. In order to elucidate its enzymatic mechanism and to gain insights into the structural determinants underlying its remarkable stability, PQC was isolated from papaya latex, purified and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 62.82, b = 81.23, c = 108.17 Å and two molecules per asymmetric unit. Diffraction data have been collected at ESRF beamline BM14 and processed to a resolution of 1.7 Å.« less

Using Two-Dimensional Colloidal Crystals to Understand Crystallography

ERIC Educational Resources Information Center

Bosse, Stephanie A.; Loening, Nikolaus M.

2008-01-01

X-ray crystallography is an essential technique for modern chemistry and biochemistry, but it is infrequently encountered by undergraduate students owing to lack of access to equipment, the time-scale for generating diffraction-quality molecular crystals, and the level of mathematics involved in analyzing the resulting diffraction patterns.…

Expression, purification, crystallization and preliminary X-ray diffraction analysis of an essential lipoprotein implicated in cell-wall biosynthesis in Mycobacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marland, Zara; Beddoe, Travis; Zaker-Tabrizi, Leyla

2005-12-01

A lipoprotein implicated in mycobacterial cell-wall biosynthesis, LpqW, was expressed in E. coli. Crystals were obtained that diffracted to 2.4 Å resolution. Mycobacterium tuberculosis is a renewed cause of devastation in the developing world. Critical to the success of this re-emerging pathogen is its unusual waxy cell wall, which is rich in rare components including lipoarabinomannan (LAM) and its precursors, the phosphatidylinositol mannosides (PIMs). Balanced synthesis of these related glycolipids is intrinsic to both cell-wall integrity and virulence in M. tuberculosis and presents a promising, albeit poorly defined, therapeutic target. Here, the expression, purification and crystallization of an essential 600-amino-acidmore » lipoprotein, LpqW, implicated in this process are reported. Crystals of LpqW were grown using 20–24%(w/v) PEG 4000, 8–16%(v/v) 2-propanol, 100 mM sodium citrate pH 5.5 and 10 mM DTT. A complete data set was collected at 2.4 Å using synchrotron radiation on a crystal belonging to space group C222, with unit-cell parameters a = 188.57, b = 312.04, c = 104.15 Å. Structure determination is under way.« less

Organic holographic polymer dispersed liquid crystal distributed feedback laser from different diffraction orders

NASA Astrophysics Data System (ADS)

Liu, Minghuan; Liu, Yonggang; Zhang, Guiyang; Peng, Zenghui; Li, Dayu; Ma, Ji; Xuan, Li

2016-11-01

Holographic polymer dispersed liquid crystal (HPDLC) based distributed feedback (DFB) lasers were prepared with poly (-methoxy-5-(2‧-ethyl-hexyloxy)-1,4-phenylene-vinylene) (MEH-PPV) film as the active medium layer. The HPDLC grating film was fabricated via holographic induced photopolymerization. The pure film spectra of MEH-PPV and the amplified spontaneous emission (ASE) spectrum were investigated. The laser device was single-longitudinal mode operation. The tunability of the HPDLC DFB laser was achieved by selecting different grating periods. The lasing performances were also characterized and compared from different diffraction orders. The lasing threshold increased with the diffraction order and the third order laser possessed the largest conversion efficiency in this device. The experimental results were in good agreement with the theoretical calculations.

High quality single shot diffraction patterns using ultrashort megaelectron volt electron beams from a radio frequency photoinjector.

PubMed

Musumeci, P; Moody, J T; Scoby, C M; Gutierrez, M S; Bender, H A; Wilcox, N S

2010-01-01

Single shot diffraction patterns using a 250-fs-long electron beam have been obtained at the UCLA Pegasus laboratory. High quality images with spatial resolution sufficient to distinguish closely spaced peaks in the Debye-Scherrer ring pattern have been recorded by scattering the 1.6 pC 3.5 MeV electron beam generated in the rf photoinjector off a 100-nm-thick Au foil. Dark current and high emittance particles are removed from the beam before sending it onto the diffraction target using a 1 mm diameter collimating hole. These results open the door to the study of irreversible phase transformations by single shot MeV electron diffraction.

Coherent X-ray beam metrology using 2D high-resolution Fresnel-diffraction analysis.

PubMed

Ruiz-Lopez, M; Faenov, A; Pikuz, T; Ozaki, N; Mitrofanov, A; Albertazzi, B; Hartley, N; Matsuoka, T; Ochante, Y; Tange, Y; Yabuuchi, T; Habara, T; Tanaka, K A; Inubushi, Y; Yabashi, M; Nishikino, M; Kawachi, T; Pikuz, S; Ishikawa, T; Kodama, R; Bleiner, D

2017-01-01

Direct metrology of coherent short-wavelength beamlines is important for obtaining operational beam characteristics at the experimental site. However, since beam-time limitation imposes fast metrology procedures, a multi-parametric metrology from as low as a single shot is desirable. Here a two-dimensional (2D) procedure based on high-resolution Fresnel diffraction analysis is discussed and applied, which allowed an efficient and detailed beamline characterization at the SACLA XFEL. So far, the potential of Fresnel diffraction for beamline metrology has not been fully exploited because its high-frequency fringes could be only partly resolved with ordinary pixel-limited detectors. Using the high-spatial-frequency imaging capability of an irradiated LiF crystal, 2D information of the coherence degree, beam divergence and beam quality factor M 2 were retrieved from simple diffraction patterns. The developed beam metrology was validated with a laboratory reference laser, and then successfully applied at a beamline facility, in agreement with the source specifications.

Crystallization and preliminary X-ray diffraction studies of the cysteine protease ervatamin A from Ervatamia coronaria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakraborty, Sibani; Biswas, Sampa; Chakrabarti, Chandana

2005-06-01

Ervatamin A is a papain-family cysteine protease with high activity and stability. It has been isolated and purified from the latex of the medicinal flowering plant E. coronaria and crystallized by the vapour-diffusion technique. Crystals diffracted to 2.1 Å and the structure was solved by molecular replacement. The ervatamins are highly stable cysteine proteases that are present in the latex of the medicinal plant Ervatamia coronaria and belong to the papain family, members of which share similar amino-acid sequences and also a similar fold comprising two domains. Ervatamin A from this family, a highly active protease compared with others frommore » the same source, has been purified to homogeneity by ion-exchange chromatography and crystallized by the vapour-diffusion method. Needle-shaped crystals of ervatamin A diffract to 2.1 Å resolution and belong to space group C222{sub 1}, with unit-cell parameters a = 31.10, b = 144.17, c = 108.61 Å. The solvent content using an ervatamin A molecular weight of 27.6 kDa is 43.9%, with a V{sub M} value of 2.19 Å{sup 3} Da{sup −1} assuming one protein molecule in the asymmetric unit. A molecular-replacement solution has been found using the structure of ervatamin C as a search model.« less

Monolayer-crystal streptavidin support films provide an internal standard of cryo-EM image quality

DOE Office of Scientific and Technical Information (OSTI.GOV)

Han, Bong-Gyoon; Watson, Zoe; Cate, Jamie H. D.

Analysis of images of biotinylated Escherichia coli 70S ribosome particles, bound to streptavidin affinity grids, demonstrates that the image-quality of particles can be predicted by the image-quality of the monolayer crystalline support film. Also, the quality of the Thon rings is a good predictor of the image-quality of particles, but only when images of the streptavidin crystals extend to relatively high resolution. When the estimated resolution of streptavidin was 5 Å or worse, for example, the ribosomal density map obtained from 22,697 particles went to only 9.5 Å, while the resolution of the map reached 4.0 Å for the samemore » number of particles, when the estimated resolution of streptavidin crystal was 4 Å or better. It thus is easy to tell which images in a data set ought to be retained for further work, based on the highest resolution seen for Bragg peaks in the computed Fourier transforms of the streptavidin component. The refined density map obtained from 57,826 particles obtained in this way extended to 3.6 Å, a marked improvement over the value of 3.9 Å obtained previously from a subset of 52,433 particles obtained from the same initial data set of 101,213 particles after 3-D classification. These results are consistent with the hypothesis that interaction with the air-water interface can damage particles when the sample becomes too thin. Finally, streptavidin monolayer crystals appear to provide a good indication of when that is the case.« less

Protein Crystal Movements and Fluid Flows During Microgravity Growth

NASA Technical Reports Server (NTRS)

Boggon, Titus J.; Chayen, Naomi E.; Snell, Edward H.; Dong, Jun; Lautenschlager, Peter; Potthast, Lothar; Siddons, D. Peter; Stojanoff, Vivian; Gordon, Elspeth; Thompson, Andrew W.;

Expression, purification, crystallization and X-ray diffraction studies of the molecular chaperone prefoldin from Homo sapiens.

PubMed

Aikawa, Yoshiki; Kida, Hiroshi; Nishitani, Yuichi; Miki, Kunio

2015-09-01

Proper protein folding is an essential process for all organisms. Prefoldin (PFD) is a molecular chaperone that assists protein folding by delivering non-native proteins to group II chaperonin. A heterohexamer of eukaryotic PFD has been shown to specifically recognize and deliver non-native actin and tubulin to chaperonin-containing TCP-1 (CCT), but the mechanism of specific recognition is still unclear. To determine its crystal structure, recombinant human PFD was reconstituted, purified and crystallized. X-ray diffraction data were collected to 4.7 Å resolution. The crystals belonged to space group P21212, with unit-cell parameters a = 123.2, b = 152.4, c = 105.9 Å.

Coherent diffractive imaging of solid state reactions in zinc oxide crystals

NASA Astrophysics Data System (ADS)

Leake, Steven J.; Harder, Ross; Robinson, Ian K.

2011-11-01

We investigated the doping of zinc oxide (ZnO) microcrystals with iron and nickel via in situ coherent x-ray diffractive imaging (CXDI) in vacuum. Evaporated thin metal films were deposited onto the ZnO microcrystals. A single crystal was selected and tracked through annealing cycles. A solid state reaction was observed in both iron and nickel experiments using CXDI. A combination of the shrink wrap and guided hybrid-input-output phasing methods were applied to retrieve the electron density. The resolution was 33 nm (half order) determined via the phase retrieval transfer function. The resulting images are nevertheless sensitive to sub-angstrom displacements. The exterior of the microcrystal was found to degrade dramatically. The annealing of ZnO microcrystals coated with metal thin films proved an unsuitable doping method. In addition the observed defect structure of one crystal was attributed to the presence of an array of defects and was found to change upon annealing.

The High Resolution Powder Diffraction Beam Line at ESRF.

PubMed

Fitch, A N

2004-01-01

The optical design and performance of the high-resolution powder diffraction beam line BM16 at ESRF are discussed and illustrated. Some recent studies carried out on BM16 are described, including crystal structure solution and refinement, anomalous scattering, in situ measurements, residual strain in engineering components, investigation of microstructure, and grazing-incidence diffraction from surface layers. The beam line is built on a bending magnet, and operates in the energy range from 5 keV to 40 keV. After the move to an undulator source in 2002, it will benefit from an extented energy range up to 60 keV and increased flux and resolution. It is anticipated that enhancements to the data quality will be achieved, leading to the solution of larger crystal structures, and improvements in the accuracy of refined structures. The systematic exploitation of anisotropic thermal expansion will help reduce the effects of peak overlap in the analysis of powder diffraction data.

Single crystal neutron diffraction of hydrous wadsleyite and the reason of sensitivity difference for hydration between upper and lower mantle transition zones

NASA Astrophysics Data System (ADS)

Purevjav, N.; Okuchi, T.; Tomioka, N.; Wang, X.; Hoffmann, C.

2016-12-01

Evidences from seismological and mineralogical studies increasingly indicates that water has been transported from the oceans into the Earth's deep mantle, where the mantle transition zone is believed to be the largest reservoir of this transported water. Wadsleyite and ringwoodite are the major constituents and the most important host minerals absorbing this type of water in the transition zone. These minerals are capable of storing the entire mass of the oceans as a hidden reservoirs. In order to understand the effects of such water on the physical properties and chemical evolution of the Earth's interior, it is essential to determine where in the crystal structure the hydration occurs, and which chemical bonds are altered and weakened after hydration. Here we show the result of a neutron single-crystal Laue diffraction study of hydrous wadsleyite. A crystal of homogenously-hydrated wadsleyite involving 1.4 wt. % of H2O was synthesized by our recently-established slow cooling method, which was an effective way to grow high quality large single crystals [1]. By analyzing this crystal using pulsed neutron beam, we demonstrated that the hydrogen atoms exchange only with Mg2+ at the one of the specific octahedron sites (M3) in wadsleyite. We also determined hydrogen's bonding distances and bonding angle. The results unambiguously demonstrated the unique mechanism of hydrogen incorporation into the wadsleyite crystal structure. We previously found that the hydrogen atoms exchanged with both Mg2+ and Si4+ sites simultaneously in the crystal structure of hydrous ringwoodite [2]. Therefore, the current results show that hydration mechanisms are qualitatively different between the upper and the lower transition zones in the wet mantle. The difference is a vital clue towards understanding why these mantle transition zone minerals show different sensitivity for water in their softening behaviors. In addition, we demonstrated that maximum water concentration in wadsleyite is

Crystallization, dehydration and experimental phasing of WbdD, a bifunctional kinase and methyltransferase from Escherichia coli O9a

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hagelueken, Gregor; Huang, Hexian; Harlos, Karl

2012-10-01

The optimization of WbdD crystals using a novel dehydration protocol and experimental phasing at 3.5 Å resolution by cross-crystal averaging followed by molecular replacement of electron density into a non-isomorphous 3.0 Å resolution native data set are reported. WbdD is a bifunctional kinase/methyltransferase that is responsible for regulation of lipopolysaccharide O antigen polysaccharide chain length in Escherichia coli serotype O9a. Solving the crystal structure of this protein proved to be a challenge because the available crystals belonging to space group I23 only diffracted to low resolution (>95% of the crystals diffracted to resolution lower than 4 Å and most onlymore » to 8 Å) and were non-isomorphous, with changes in unit-cell dimensions of greater than 10%. Data from a serendipitously found single native crystal that diffracted to 3.0 Å resolution were non-isomorphous with a lower (3.5 Å) resolution selenomethionine data set. Here, a strategy for improving poor (3.5 Å resolution) initial phases by density modification and cross-crystal averaging with an additional 4.2 Å resolution data set to build a crude model of WbdD is desribed. Using this crude model as a mask to cut out the 3.5 Å resolution electron density yielded a successful molecular-replacement solution of the 3.0 Å resolution data set. The resulting map was used to build a complete model of WbdD. The hydration status of individual crystals appears to underpin the variable diffraction quality of WbdD crystals. After the initial structure had been solved, methods to control the hydration status of WbdD were developed and it was thus possible to routinely obtain high-resolution diffraction (to better than 2.5 Å resolution). This novel and facile crystal-dehydration protocol may be useful for similar challenging situations.« less

An Overview of Hardware for Protein Crystallization in a Magnetic Field

PubMed Central

Yan, Er-Kai; Zhang, Chen-Yan; He, Jin; Yin, Da-Chuan

2016-01-01

Protein crystallization under a magnetic field is an interesting research topic because a magnetic field may provide a special environment to acquire improved quality protein crystals. Because high-quality protein crystals are very useful in high-resolution structure determination using diffraction techniques (X-ray, neutron, and electron diffraction), research using magnetic fields in protein crystallization has attracted substantial interest; some studies have been performed in the past two decades. In this research field, the hardware is especially essential for successful studies because the environment is special and the design and utilization of the research apparatus in such an environment requires special considerations related to the magnetic field. This paper reviews the hardware for protein crystallization (including the magnet systems and the apparatus designed for use in a magnetic field) and progress in this area. Future prospects in this field will also be discussed. PMID:27854318

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708

PubMed Central

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-01-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (V M = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit. PMID:19923737

In-situ and real-time growth observation of high-quality protein crystals under quasi-microgravity on earth.

PubMed

Nakamura, Akira; Ohtsuka, Jun; Kashiwagi, Tatsuki; Numoto, Nobutaka; Hirota, Noriyuki; Ode, Takahiro; Okada, Hidehiko; Nagata, Koji; Kiyohara, Motosuke; Suzuki, Ei-Ichiro; Kita, Akiko; Wada, Hitoshi; Tanokura, Masaru

2016-02-26

Precise protein structure determination provides significant information on life science research, although high-quality crystals are not easily obtained. We developed a system for producing high-quality protein crystals with high throughput. Using this system, gravity-controlled crystallization are made possible by a magnetic microgravity environment. In addition, in-situ and real-time observation and time-lapse imaging of crystal growth are feasible for over 200 solution samples independently. In this paper, we also report results of crystallization experiments for two protein samples. Crystals grown in the system exhibited magnetic orientation and showed higher and more homogeneous quality compared with the control crystals. The structural analysis reveals that making use of the magnetic microgravity during the crystallization process helps us to build a well-refined protein structure model, which has no significant structural differences with a control structure. Therefore, the system contributes to improvement in efficiency of structural analysis for "difficult" proteins, such as membrane proteins and supermolecular complexes.

Crystal growth of enzymes in low gravity (L-5)

NASA Technical Reports Server (NTRS)

Morita, Yuhei

1993-01-01

Recent developments in protein engineering have expanded the possibilities of studies of enzymes and other proteins. Now such studies are not limited to the elucidation of the relationship between the structure and function of the protein. They also aim at the production of proteins with new and practical functions, based on results obtained during investigation of structure and function. For continuing research in this field, investigation of the tertiary structure of proteins is important. X-ray diffraction of single crystals of protein is usually used for this purpose. The main difficulty is the preparation of the crystals. The theme of the research is to prepare such crystals at very low gravity, with the main purpose being to obtain large single crystals of proteins suitable for x-ray diffraction studies.

Bragg coherent diffraction imaging and metrics for radiation damage in protein micro-crystallography.

PubMed

Coughlan, H D; Darmanin, C; Kirkwood, H J; Phillips, N W; Hoxley, D; Clark, J N; Vine, D J; Hofmann, F; Harder, R J; Maxey, E; Abbey, B

2017-01-01

The proliferation of extremely intense synchrotron sources has enabled ever higher-resolution structures to be obtained using data collected from smaller and often more imperfect biological crystals (Helliwell, 1984). Synchrotron beamlines now exist that are capable of measuring data from single crystals that are just a few micrometres in size. This provides renewed motivation to study and understand the radiation damage behaviour of small protein crystals. Reciprocal-space mapping and Bragg coherent diffractive imaging experiments have been performed on cryo-cooled microcrystals of hen egg-white lysozyme as they undergo radiation damage. Several well established metrics, such as intensity-loss and lattice expansion, are applied to the diffraction data and the results are compared with several new metrics that can be extracted from the coherent imaging experiments. Individually some of these metrics are inconclusive. However, combining metrics, the results suggest that radiation damage behaviour in protein micro-crystals differs from that of larger protein crystals and may allow them to continue to diffract for longer. A possible mechanism to account for these observations is proposed.

Bragg coherent diffraction imaging and metrics for radiation damage in protein micro-crystallography

DOE PAGES

Coughlan, H. D.; Darmanin, C.; Kirkwood, H. J.; ...

2017-01-01

The proliferation of extremely intense synchrotron sources has enabled ever higher-resolution structures to be obtained using data collected from smaller and often more imperfect biological crystals. Synchrotron beamlines now exist that are capable of measuring data from single crystals that are just a few micrometres in size. This provides renewed motivation to study and understand the radiation damage behaviour of small protein crystals. Reciprocal-space mapping and Bragg coherent diffractive imaging experiments have been performed on cryo-cooled microcrystals of hen egg-white lysozyme as they undergo radiation damage. Several well established metrics, such as intensity-loss and lattice expansion, are applied to themore » diffraction data and the results are compared with several new metrics that can be extracted from the coherent imaging experiments. Individually some of these metrics are inconclusive. However, combining metrics, the results suggest that radiation damage behaviour in protein micro-crystals differs from that of larger protein crystals and may allow them to continue to diffract for longer. As a result, a possible mechanism to account for these observations is proposed.« less

Bragg coherent diffraction imaging and metrics for radiation damage in protein micro-crystallography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coughlan, H. D.; Darmanin, C.; Kirkwood, H. J.

The proliferation of extremely intense synchrotron sources has enabled ever higher-resolution structures to be obtained using data collected from smaller and often more imperfect biological crystals. Synchrotron beamlines now exist that are capable of measuring data from single crystals that are just a few micrometres in size. This provides renewed motivation to study and understand the radiation damage behaviour of small protein crystals. Reciprocal-space mapping and Bragg coherent diffractive imaging experiments have been performed on cryo-cooled microcrystals of hen egg-white lysozyme as they undergo radiation damage. Several well established metrics, such as intensity-loss and lattice expansion, are applied to themore » diffraction data and the results are compared with several new metrics that can be extracted from the coherent imaging experiments. Individually some of these metrics are inconclusive. However, combining metrics, the results suggest that radiation damage behaviour in protein micro-crystals differs from that of larger protein crystals and may allow them to continue to diffract for longer. As a result, a possible mechanism to account for these observations is proposed.« less

Purification, crystallization and preliminary X-ray diffraction analysis of water-soluble chlorophyll-binding protein from Chenopodium album

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohtsuki, Takayuki; Ohshima, Shigeru; Uchida, Akira, E-mail: auchida@biomol.sci.toho-u.ac.jp

2007-09-01

A water-soluble chlorophyll-binding protein with photoconvertibility from C. album was extracted, purified and crystallized in a darkroom. The crystal diffracted to around 2.0 Å resolution. A water-soluble chlorophyll-binding protein (WSCP) with photoconvertibility from Chenopodium album was extracted, purified and crystallized in a darkroom. Green crystals suitable for data collection appeared in about 10 d. A native data set was collected to 2.0 Å resolution at 100 K. The space group of the crystal was determined to be orthorhombic I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 48.13, b = 60.59, c = 107.21 Å. Preliminary analysis ofmore » the X-ray data indicated that there is one molecule per asymmetric unit.« less

Diffracted diffraction radiation and its application to beam diagnostics

NASA Astrophysics Data System (ADS)

Goponov, Yu. A.; Shatokhin, R. A.; Sumitani, K.; Syshchenko, V. V.; Takabayashi, Y.; Vnukov, I. E.

2018-03-01

We present theoretical considerations for diffracted diffraction radiation and also propose an application of this process to diagnosing ultra-relativistic electron (positron) beams for the first time. Diffraction radiation is produced when relativistic particles move near a target. If the target is a crystal or X-ray mirror, diffraction radiation in the X-ray region is expected to be diffracted at the Bragg angle and therefore be detectable. We present a scheme for applying this process to measurements of the beam angular spread, and consider how to conduct a proof-of-principle experiment for the proposed method.

Survey of predictors of propensity for protein production and crystallization with application to predict resolution of crystal structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Jianzhao; Wu, Zhonghua; Hu, Gang

Selection of proper targets for the X-ray crystallography will benefit biological research community immensely. Several computational models were proposed to predict propensity of successful protein production and diffraction quality crystallization from protein sequences. We reviewed a comprehensive collection of 22 such predictors that were developed in the last decade. We found that almost all of these models are easily accessible as webservers and/or standalone software and we demonstrated that some of them are widely used by the research community. We empirically evaluated and compared the predictive performance of seven representative methods. The analysis suggests that these methods produce quite accuratemore » propensities for the diffraction-quality crystallization. We also summarized results of the first study of the relation between these predictive propensities and the resolution of the crystallizable proteins. We found that the propensities predicted by several methods are significantly higher for proteins that have high resolution structures compared to those with the low resolution structures. Moreover, we tested a new meta-predictor, MetaXXC, which averages the propensities generated by the three most accurate predictors of the diffraction-quality crystallization. MetaXXC generates putative values of resolution that have modest levels of correlation with the experimental resolutions and it offers the lowest mean absolute error when compared to the seven considered methods. We conclude that protein sequences can be used to fairly accurately predict whether their corresponding protein structures can be solved using X-ray crystallography. Moreover, we also ascertain that sequences can be used to reasonably well predict the resolution of the resulting protein crystals.« less

High power, diffraction limited picosecond oscillator based on Nd:GdVO₄ bulk crystal with σ polarized in-band pumping.

PubMed

Lin, Hua; Guo, Jie; Gao, Peng; Yu, Hai; Liang, Xiaoyan

2016-06-27

We report on a high power passively mode-locked picosecond oscillator based on Nd:GdVO₄ crystal with σ polarized in-band pumping. Thermal gradient and thermal aberration was greatly decreased with proposed configuration. Maximum output power of 37 W at 81 MHz repetition rate with 19.3 ps pulse duration was achieved directly from Nd:GdVO₄ oscillator, corresponding to 51% optical efficiency. The oscillator maintained diffraction limited beam quality of M² < 1.05 at different output coupling with pulse duration between 11.2 ps to 19.3 ps.

Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I

DOE Office of Scientific and Technical Information (OSTI.GOV)

Enderle, Mathias; Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried; McCarthy, Andrew

Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungalmore » FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.« less

Protein Crystal Quality Studies

NASA Technical Reports Server (NTRS)

1998-01-01

Eddie Snell (standing), Post-Doctoral Fellow the National Research Council (NRC),and Marc Pusey of Marshall Space Flight Center (MSFC) use a reciprocal space mapping diffractometer for marcromolecular crystal quality studies. The diffractometer is used in mapping the structure of marcromolecules such as proteins to determine their structure and thus understand how they function with other proteins in the body. This is one of several analytical tools used on proteins crystalized on Earth and in space experiments. Photo credit: NASA/Marshall Space Flight Center (MSFC)

Controlling Vapor Pressure In Hanging-Drop Crystallization

NASA Technical Reports Server (NTRS)

Carter, Daniel C.; Smith, Robbie

1988-01-01

Rate of evaporation adjusted to produce larger crystals. Device helps to control vapor pressure of water and other solvents in vicinity of hanging drop of solution containing dissolved enzyme protein. Well of porous frit (sintered glass) holds solution in proximity to drop of solution containing protein or enzyme. Vapor from solution in frit controls evaporation of solvent from drop to control precipitation of protein or enzyme. With device, rate of nucleation limited to decrease number and increase size (and perhaps quality) of crystals - large crystals of higher quality needed for x-ray diffraction studies of macromolecules.

Expression, purification, crystallization and X-ray diffraction studies of the molecular chaperone prefoldin from Homo sapiens

PubMed Central

Aikawa, Yoshiki; Kida, Hiroshi; Nishitani, Yuichi; Miki, Kunio

2015-01-01

Proper protein folding is an essential process for all organisms. Prefoldin (PFD) is a molecular chaperone that assists protein folding by delivering non-native proteins to group II chaperonin. A heterohexamer of eukaryotic PFD has been shown to specifically recognize and deliver non-native actin and tubulin to chaperonin-containing TCP-1 (CCT), but the mechanism of specific recognition is still unclear. To determine its crystal structure, recombinant human PFD was reconstituted, purified and crystallized. X-ray diffraction data were collected to 4.7 Å resolution. The crystals belonged to space group P21212, with unit-cell parameters a = 123.2, b = 152.4, c = 105.9 Å. PMID:26323306

Trace fluorescent labeling for protein crystallization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pusey, Marc, E-mail: marc.pusey@ixpressgenes.com; Barcena, Jorge; Morris, Michelle

2015-06-27

The presence of a covalently bound fluorescent probe at a concentration of <0.5% does not affect the outcome of macromolecule crystallization screening experiments. Additionally, the fluorescence can be used to determine new, not immediately apparent, lead crystallization conditions. Fluorescence can be a powerful tool to aid in the crystallization of proteins. In the trace-labeling approach, the protein is covalently derivatized with a high-quantum-yield visible-wavelength fluorescent probe. The final probe concentration typically labels ≤0.20% of the protein molecules, which has been shown to not affect the crystal nucleation or diffraction quality. The labeled protein is then used in a plate-screening experimentmore » in the usual manner. As the most densely packed state of the protein is the crystalline form, then crystals show as the brightest objects in the well under fluorescent illumination. A study has been carried out on the effects of trace fluorescent labeling on the screening results obtained compared with nonlabeled protein, and it was found that considering the stochastic nature of the crystal nucleation process the presence of the probe did not affect the outcomes obtained. Other effects are realised when using fluorescence. Crystals are clearly seen even when buried in precipitate. This approach also finds ‘hidden’ leads, in the form of bright spots, with ∼30% of the leads found being optimized to crystals in a single-pass optimization trial. The use of visible fluorescence also enables the selection of colors that bypass interfering substances, and the screening materials do not have to be UV-transparent.« less

Guiding synchrotron X-ray diffraction by multimodal video-rate protein crystal imaging

DOE PAGES

Newman, Justin A.; Zhang, Shijie; Sullivan, Shane Z.; ...

2016-05-16

Synchronous digitization, in which an optical sensor is probed synchronously with the firing of an ultrafast laser, was integrated into an optical imaging station for macromolecular crystal positioning prior to synchrotron X-ray diffraction. Using the synchronous digitization instrument, second-harmonic generation, two-photon-excited fluorescence and bright field by laser transmittance were all acquired simultaneously with perfect image registry at up to video-rate (15 frames s –1). A simple change in the incident wavelength enabled simultaneous imaging by two-photon-excited ultraviolet fluorescence, one-photon-excited visible fluorescence and laser transmittance. Development of an analytical model for the signal-to-noise enhancement afforded by synchronous digitization suggests a 15.6-foldmore » improvement over previous photon-counting techniques. This improvement in turn allowed acquisition on nearly an order of magnitude more pixels than the preceding generation of instrumentation and reductions of well over an order of magnitude in image acquisition times. These improvements have allowed detection of protein crystals on the order of 1 µm in thickness under cryogenic conditions in the beamline. Lastly, these capabilities are well suited to support serial crystallography of crystals approaching 1 µm or less in dimension.« less

Guiding synchrotron X-ray diffraction by multimodal video-rate protein crystal imaging

DOE Office of Scientific and Technical Information (OSTI.GOV)

Newman, Justin A.; Zhang, Shijie; Sullivan, Shane Z.

Synchronous digitization, in which an optical sensor is probed synchronously with the firing of an ultrafast laser, was integrated into an optical imaging station for macromolecular crystal positioning prior to synchrotron X-ray diffraction. Using the synchronous digitization instrument, second-harmonic generation, two-photon-excited fluorescence and bright field by laser transmittance were all acquired simultaneously with perfect image registry at up to video-rate (15 frames s –1). A simple change in the incident wavelength enabled simultaneous imaging by two-photon-excited ultraviolet fluorescence, one-photon-excited visible fluorescence and laser transmittance. Development of an analytical model for the signal-to-noise enhancement afforded by synchronous digitization suggests a 15.6-foldmore » improvement over previous photon-counting techniques. This improvement in turn allowed acquisition on nearly an order of magnitude more pixels than the preceding generation of instrumentation and reductions of well over an order of magnitude in image acquisition times. These improvements have allowed detection of protein crystals on the order of 1 µm in thickness under cryogenic conditions in the beamline. Lastly, these capabilities are well suited to support serial crystallography of crystals approaching 1 µm or less in dimension.« less

Guiding synchrotron X-ray diffraction by multimodal video-rate protein crystal imaging

PubMed Central

Newman, Justin A.; Zhang, Shijie; Sullivan, Shane Z.; Dow, Ximeng Y.; Becker, Michael; Sheedlo, Michael J.; Stepanov, Sergey; Carlsen, Mark S.; Everly, R. Michael; Das, Chittaranjan; Fischetti, Robert F.; Simpson, Garth J.

2016-01-01

Synchronous digitization, in which an optical sensor is probed synchronously with the firing of an ultrafast laser, was integrated into an optical imaging station for macromolecular crystal positioning prior to synchrotron X-ray diffraction. Using the synchronous digitization instrument, second-harmonic generation, two-photon-excited fluorescence and bright field by laser transmittance were all acquired simultaneously with perfect image registry at up to video-rate (15 frames s−1). A simple change in the incident wavelength enabled simultaneous imaging by two-photon-excited ultraviolet fluorescence, one-photon-excited visible fluorescence and laser transmittance. Development of an analytical model for the signal-to-noise enhancement afforded by synchronous digitization suggests a 15.6-fold improvement over previous photon-counting techniques. This improvement in turn allowed acquisition on nearly an order of magnitude more pixels than the preceding generation of instrumentation and reductions of well over an order of magnitude in image acquisition times. These improvements have allowed detection of protein crystals on the order of 1 µm in thickness under cryogenic conditions in the beamline. These capabilities are well suited to support serial crystallography of crystals approaching 1 µm or less in dimension. PMID:27359145

Purification, crystallization and preliminary X-ray analysis of Escherichia coli UDP-N-acetylmuramoyl:L-alanine ligase (MurC).

PubMed

Deva, Taru; Pryor, KellyAnn D; Leiting, Barbara; Baker, Edward N; Smith, Clyde A

2003-08-01

UDP-N-acetylmuramoyl:L-alanine ligase (MurC) is involved in the pathway leading from UDP-N-glucosamine to the UDP-N-acetylmuramoyl:pentapeptide unit, which is the building block for the peptidoglycan layer found in all bacterial cell walls. The pathways leading to the biosynthesis of the peptidoglycan layer are important targets for the development of novel antibiotics, since animal cells do not contain these pathways. MurC is the first of four similar ATP-dependent amide-bond ligases which share primary and tertiary structural similarities. The crystal structures of three of these have been determined by X-ray crystallography, giving insights into the binding of the carbohydrate substrate and the ATP. Diffraction-quality crystals of the enzyme MurC have been obtained in both native and selenomethionine forms and X-ray diffraction data have been collected at the Se edge at a synchrotron source. The crystals are orthorhombic, with unit-cell parameters a = 73.9, b = 93.6, c = 176.8 A, and diffraction has been observed to 2.6 A resolution.

Order and disorder in crystals of hexameric NTPases from dsRNA bacteriophages.

PubMed

Mancini, Erika J; Grimes, Jonathan M; Malby, Robyn; Sutton, Geoffrey C; Kainov, Denis E; Juuti, Jarmo T; Makeyev, Eugene V; Tuma, Roman; Bamford, Dennis H; Stuart, David I

2003-12-01

The packaging of genomic RNA in members of the Cystoviridae is performed by P4, a hexameric protein with NTPase activity. Across family members such as Phi6, Phi8 and Phi13, the P4 proteins show low levels of sequence identity, but presumably have similar atomic structures. Initial structure-determination efforts for P4 from Phi6 and Phi8 were hampered by difficulties in obtaining crystals that gave ordered diffraction. Diffraction from crystals of full-length P4 showed a variety of disorder and anisotropy. Subsequently, crystals of Phi13 P4 were obtained which yielded well ordered diffraction to 1.7 A. Comparison of the packing arrangements of P4 hexamers in different crystal forms and analysis of the disorder provides insights into the flexibility of this family of proteins, which might be an integral part of their biological function.

The molecular and crystal structure of dextrans: a combined electron and X-ray diffraction study. II. A low temperature, hydrated polymorph.

PubMed

Guizard, C; Chanzy, H; Sarko, A

1985-06-05

The crystal and molecular structure of a dextran hydrate has been determined through combined electron and X-ray diffraction analysis, aided by stereochemical model refinement. A total of 65 hk0 electron diffraction intensities were measured on frozen single crystals held at the temperature of liquid nitrogen, to a resolution limit of 1.6 A. The X-ray intensities were measured from powder patterns recorded from collections of the single crystals. The structure crystallizes in a monoclinic unit cell with parameters a = 25.71 A, b = 10.21 A, c (chain axis) = 7.76 A and beta = 91.3 degrees. The space group is P2(1) with b axis unique. The unit cell contains six chains and eight water molecules, with three chains of the same polarity and four water molecules constituting the asymmetric unit. Along the chain direction the asymmetric unit is a dimer residue; however, the individual glucopyranose residues are very nearly related by a molecular 2-fold screw axis. The conformation of the chain is very similar to that in the anhydrous structure, but the chain packing differs in the two structures in that the rotational positions of the chains about the helix axes (the chain setting angles) are considerably different. The chains still pack in the form of sheets that are separated by water molecules. The difference in the chain setting angles between the anhydrous and hydrate structures corresponds to the angle between like unit cell axes observed in the diffraction diagrams recorded from hybrid crystals containing both polymorphs. Despite some beam damage effects, the structure was determined to a satisfactory degree of agreement, with the residuals R''(electron diffraction) = 0.258 and R(X-ray) = 0.127.

Dynamic Diffraction Studies on the Crystallization, Phase Transformation, and Activation Energies in Anodized Titania Nanotubes.

PubMed

Albetran, Hani; Vega, Victor; Prida, Victor M; Low, It-Meng

2018-02-23

The influence of calcination time on the phase transformation and crystallization kinetics of anodized titania nanotube arrays was studied using in-situ isothermal and non-isothermal synchrotron radiation diffraction from room temperature to 900 °C. Anatase first crystallized at 400 °C, while rutile crystallized at 550 °C. Isothermal heating of the anodized titania nanotubes by an increase in the calcination time at 400, 450, 500, 550, 600, and 650 °C resulted in a slight reduction in anatase abundance, but an increase in the abundance of rutile because of an anatase-to-rutile transformation. The Avrami equation was used to model the titania crystallization mechanism and the Arrhenius equation was used to estimate the activation energies of the titania phase transformation. Activation energies of 22 (10) kJ/mol for the titanium-to-anatase transformation, and 207 (17) kJ/mol for the anatase-to-rutile transformation were estimated.

Dynamic Diffraction Studies on the Crystallization, Phase Transformation, and Activation Energies in Anodized Titania Nanotubes

PubMed Central

Albetran, Hani; Vega, Victor

2018-01-01

The influence of calcination time on the phase transformation and crystallization kinetics of anodized titania nanotube arrays was studied using in-situ isothermal and non-isothermal synchrotron radiation diffraction from room temperature to 900 °C. Anatase first crystallized at 400 °C, while rutile crystallized at 550 °C. Isothermal heating of the anodized titania nanotubes by an increase in the calcination time at 400, 450, 500, 550, 600, and 650 °C resulted in a slight reduction in anatase abundance, but an increase in the abundance of rutile because of an anatase-to-rutile transformation. The Avrami equation was used to model the titania crystallization mechanism and the Arrhenius equation was used to estimate the activation energies of the titania phase transformation. Activation energies of 22 (10) kJ/mol for the titanium-to-anatase transformation, and 207 (17) kJ/mol for the anatase-to-rutile transformation were estimated. PMID:29473854

5-Arylidene derivatives of Meldrum's acid: Synthesis, structural characterization using single crystal and powder crystal X-ray diffraction, and electronic properties

NASA Astrophysics Data System (ADS)

Dey, Tanusri; Ghosh, Soumen; Ghosh, Somnath; Mukherjee, Alok Kumar

2015-07-01

Four 5-arylidene derivatives of Meldrum's acid, 5-(4-chlorobenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione (2), 5-(3-hydroxybenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione (3), 5-(3,4-dimethoxybenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione (4) and 5-(2,4-dimethoxy benzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione (5) have been synthesized and their crystal structures have been determined using single crystal X-ray diffractometry for 2, 4 and 5 and X-ray powder diffraction for 3. The nature of intermolecular interactions in 2-5 has been analyzed through Hirshfeld surfaces and 2D fingerprint plots. The DFT optimized molecular geometries in 2-5 agree closely with those obtained from the crystallographic studies. The crystal packing in 2-5 exhibits an interplay of Osbnd H⋯O, Csbnd H⋯O, Csbnd H⋯Cl and Csbnd H⋯π (arene) hydrogen bonds and π⋯π interactions, which assemble molecules into three-dimensional architecture in 2, 3 and 5 and two-dimensional framework in 4. The Hirshfeld surface analyses of 2-5, Meldrum's acid (1) and a few related 5-arylidene derivatives of Meldrum's acid retrieved from the Cambridge Structural Database (CSD) indicate that about 85% of the Hirshfeld surface area (72% in 2 where H⋯Cl contribution is about 13%) in this class of compounds are due to H⋯H, O⋯H and C⋯H contacts. The HOMO-LUMO energy gap (>2.2 eV) in 2-5 indicates a significant degree of internal charge transfer within the molecule.

Crystallization and preliminary crystallographic analysis of the Clostridium perfringens enterotoxin

PubMed Central

Briggs, David C.; Smedley, James G.; McClane, Bruce A.; Basak, Ajit K.

2010-01-01

Clostridium perfringens is a Gram-positive anaerobic species of bacterium that is notable for its ability to produce a plethora of toxins, including membrane-active toxins (α-toxins), pore-forming toxins (∊-toxins) and binary toxins (ι-toxins). Here, the crystallization of the full-length wild-type C. perfringens enterotoxin is reported, which is the causative agent of the second most prevalent food-borne illness in the United States and has been implicated in many other gastrointestinal pathologies. Several crystal forms were obtained. However, only two of these optimized crystal forms (I and II) were useable for X-ray diffraction data collection. The form I crystals diffracted to d min = 2.7 Å and belonged to space group C2, while the form II crystals diffracted to d min = 4 Å and belonged to space group P213. PMID:20606275

A comparison between protein crystals grown with vapor diffusion methods in microgravity and protein crystals using a gel liquid-liquid diffusion ground-based method

NASA Technical Reports Server (NTRS)

Miller, Teresa Y.; He, Xiao-Min; Carter, Daniel C.

1992-01-01

Crystals of human serum albumin have been successfully grown in a variety of gels using crystallization conditions otherwise equivalent to those utilized in the popular hanging-drop vapor-equilibrium method. Preliminary comparisons of gel grown crystals with crystals grown by the vapor diffusion method via both ground-based and microgravity methods indicate that crystals superior in size and quality may be grown by limiting solutal convection. Preliminary X-ray diffraction statistics are presented.

Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jagadeesan, G.; Malathy, P.; Gunasekaran, K.

2014-10-25

The great cormorant hemoglobin has been isolated, purified and crystallized and the three dimensional structure is solved using molecular replacement technique. Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to themore » trigonal system P3{sub 1}21, with unit-cell parameters a = b = 55.64, c = 153.38 Å, β = 120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.« less

Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin.

PubMed

Jagadeesan, G; Malathy, P; Gunasekaran, K; Harikrishna Etti, S; Aravindhan, S

2014-11-01

Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to the trigonal system P3₁21, with unit-cell parameters a=b=55.64, c=153.38 Å, β=120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.