High-throughput crystal-optimization strategies in the South Paris Yeast Structural Genomics Project: one size fits all?

PubMed

Leulliot, Nicolas; Trésaugues, Lionel; Bremang, Michael; Sorel, Isabelle; Ulryck, Nathalie; Graille, Marc; Aboulfath, Ilham; Poupon, Anne; Liger, Dominique; Quevillon-Cheruel, Sophie; Janin, Joël; van Tilbeurgh, Herman

2005-06-01

Crystallization has long been regarded as one of the major bottlenecks in high-throughput structural determination by X-ray crystallography. Structural genomics projects have addressed this issue by using robots to set up automated crystal screens using nanodrop technology. This has moved the bottleneck from obtaining the first crystal hit to obtaining diffraction-quality crystals, as crystal optimization is a notoriously slow process that is difficult to automatize. This article describes the high-throughput optimization strategies used in the Yeast Structural Genomics project, with selected successful examples.

Preparation of crystals for characterizing the Grb7 SH2 domain before and after complex formation with a bicyclic peptide antagonist.

PubMed

Ambaye, Nigus D; Gunzburg, Menachem J; Traore, Daouda A K; Del Borgo, Mark P; Perlmutter, Patrick; Wilce, Matthew C J; Wilce, Jacqueline A

2014-02-01

Human growth factor receptor-bound protein 7 (Grb7) is an adapter protein involved in cell growth, migration and proliferation. It is now recognized that Grb7 is an emerging therapeutic target in specific cancer subtypes. Recently, the discovery of a bicyclic peptide inhibitor that targets the Grb7 SH2 domain, named G7-B1, was reported. In an attempt to probe the foundation of its interaction with Grb7, the crystallization and preliminary data collection of both the apo and G7-B1-bound forms of the Grb7 SH2 domain are reported here. Diffraction-quality crystals were obtained using the hanging-drop vapour-diffusion method. After several rounds of microseeding, crystals of the apo Grb7 SH2 domain were obtained that diffracted to 1.8 Å resolution, while those of the G7-B1-Grb7 SH2 domain complex diffracted to 2.2 Å resolution. The apo Grb7 SH2 domain crystallized in the trigonal space group P63, whereas the G7-B1-Grb7 SH2 domain complex crystallized in the monoclinic space group P21. The experimental aspects of crystallization, crystal optimization and data collection and the preliminary data are reported.

Microseed matrix screening for optimization in protein crystallization: what have we learned?

PubMed

D'Arcy, Allan; Bergfors, Terese; Cowan-Jacob, Sandra W; Marsh, May

2014-09-01

Protein crystals obtained in initial screens typically require optimization before they are of X-ray diffraction quality. Seeding is one such optimization method. In classical seeding experiments, the seed crystals are put into new, albeit similar, conditions. The past decade has seen the emergence of an alternative seeding strategy: microseed matrix screening (MMS). In this strategy, the seed crystals are transferred into conditions unrelated to the seed source. Examples of MMS applications from in-house projects and the literature include the generation of multiple crystal forms and different space groups, better diffracting crystals and crystallization of previously uncrystallizable targets. MMS can be implemented robotically, making it a viable option for drug-discovery programs. In conclusion, MMS is a simple, time- and cost-efficient optimization method that is applicable to many recalcitrant crystallization problems.

Microseed matrix screening for optimization in protein crystallization: what have we learned?

PubMed Central

D’Arcy, Allan; Bergfors, Terese; Cowan-Jacob, Sandra W.; Marsh, May

2014-01-01

Protein crystals obtained in initial screens typically require optimization before they are of X-ray diffraction quality. Seeding is one such optimization method. In classical seeding experiments, the seed crystals are put into new, albeit similar, conditions. The past decade has seen the emergence of an alternative seeding strategy: microseed matrix screening (MMS). In this strategy, the seed crystals are transferred into conditions unrelated to the seed source. Examples of MMS applications from in-house projects and the literature include the generation of multiple crystal forms and different space groups, better diffracting crystals and crystallization of previously uncrystallizable targets. MMS can be implemented robotically, making it a viable option for drug-discovery programs. In conclusion, MMS is a simple, time- and cost-efficient optimization method that is applicable to many recalcitrant crystallization problems. PMID:25195878

The amino-terminal structure of human fragile X mental retardation protein obtained using precipitant-immobilized imprinted polymers

NASA Astrophysics Data System (ADS)

Hu, Yufeng; Chen, Zhenhang; Fu, Yanjun; He, Qingzhong; Jiang, Lun; Zheng, Jiangge; Gao, Yina; Mei, Pinchao; Chen, Zhongzhou; Ren, Xueqin

2015-03-01

Flexibility is an intrinsic property of proteins and essential for their biological functions. However, because of structural flexibility, obtaining high-quality crystals of proteins with heterogeneous conformations remain challenging. Here, we show a novel approach to immobilize traditional precipitants onto molecularly imprinted polymers (MIPs) to facilitate protein crystallization, especially for flexible proteins. By applying this method, high-quality crystals of the flexible N-terminus of human fragile X mental retardation protein are obtained, whose absence causes the most common inherited mental retardation. A novel KH domain and an intermolecular disulfide bond are discovered, and several types of dimers are found in solution, thus providing insights into the function of this protein. Furthermore, the precipitant-immobilized MIPs (piMIPs) successfully facilitate flexible protein crystal formation for five model proteins with increased diffraction resolution. This highlights the potential of piMIPs for the crystallization of flexible proteins.

Crystallographic analysis of ground and space thermostable T1 lipase crystal obtained via counter diffusion method approach.

PubMed

Mohamad Aris, Sayangku Nor Ariati; Thean Chor, Adam Leow; Mohamad Ali, Mohd Shukuri; Basri, Mahiran; Salleh, Abu Bakar; Raja Abd Rahman, Raja Noor Zaliha

2014-01-01

Three-dimensional structure of thermostable lipase is much sought after nowadays as it is important for industrial application mainly found in the food, detergent, and pharmaceutical sectors. Crystallization utilizing the counter diffusion method in space was performed with the aim to obtain high resolution diffracting crystals with better internal order to improve the accuracy of the structure. Thermostable T1 lipase enzyme has been crystallized in laboratory on earth and also under microgravity condition aboard Progress spacecraft to the ISS in collaboration with JAXA (Japanese Aerospace Exploration Agency). This study is conducted with the aims of improving crystal packing and structure resolution. The diffraction data set for ground grown crystal was collected to 1.3 Å resolution and belonged to monoclinic C2 space group with unit cell parameters a = 117.40 Å, b = 80.95 Å, and c = 99.81 Å, whereas the diffraction data set for space grown crystal was collected to 1.1 Å resolution and belonged to monoclinic C2 space group with unit cell parameters a = 117.31 Å, b = 80.85 Å, and c = 99.81 Å. The major difference between the two crystal growth systems is the lack of convection and sedimentation in microgravity environment resulted in the growth of much higher quality crystals of T1 lipase.

Study of Fluid Flow Control In Protein Crystallization Using Strong Magnetic Fields

NASA Technical Reports Server (NTRS)

Ramachandran, N.; Leslie, F.; Ciszak, E.; Curreri, Peter A. (Technical Monitor)

2002-01-01

An important component in biotechnology, particularly in the area of protein engineering and rational drug design is the knowledge of the precise three-dimensional molecular structure of proteins. The quality of structural information obtained from X-ray diffraction methods is directly dependent on the degree of perfection of the protein crystals. As a consequence, the growth of high quality macromolecular crystals for diffraction analyses has been the central focus for biochemists, biologists, and bioengineers. Macromolecular crystals are obtained from solutions that contain the crystallizing species in equilibrium with higher aggregates, ions, precipitants, other possible phases of the protein, foreign particles, the walls of the container, and a likely host of other impurities. By changing transport modes in general, i.e., reduction of convection and sedimentation, as is achieved in 'microgravity', researchers have been able to dramatically affect the movement and distribution of macromolecules in the fluid, and thus their transport, formation of crystal nuclei, and adsorption to the crystal surface. While a limited number of high quality crystals from space flights have been obtained, as the recent National Research Council (NRC) review of the NASA microgravity crystallization program pointed out, the scientific approach and research in crystallization of proteins has been mainly empirical yielding inconclusive results. We postulate that we can reduce convection in ground-based experiments and we can understand the different aspects of convection control through the use of strong magnetic fields and field gradients. Whether this limited convection in a magnetic field will provide the environment for the growth of high quality crystals is still a matter of conjecture that our research will address. The approach exploits the variation of fluid magnetic susceptibility with concentration for this purpose and the convective damping is realized by appropriately positioning the crystal growth cell so that the magnetic susceptibility force counteracts terrestrial gravity. The general objective is to test the hypothesis of convective control using a strong magnetic field and magnetic field gradient and to understand the nature of the various forces that come into play. Specifically we aim to delineate causative factors and to quantify them through experiments, analysis and numerical modeling. Once the basic understanding is obtained, the study will focus on testing the hypothesis on proteins of pyruvate dehydrogenase complex (PDC), proteins E1 and E3. Obtaining high crystal quality of these proteins is of great importance to structural biologists since their structures need to be determined.

SdsA polymorph isolation and improvement of their crystal quality using nonconventional crystallization techniques

DOE Office of Scientific and Technical Information (OSTI.GOV)

De la Mora, Eugenio; Flores-Hernández, Edith; Jakoncic, Jean

SdsA, a sodium dodecyl sulfate hydrolase, from Pseudomonas aeruginosa was crystallized in three different crystal polymorphs and their three-dimensional structure was determined. The different polymorphs present different crystal packing habits. One of the polymorphs suggests the existence of a tetramer, an oligomeric state not observed previously, while the crystal packing of the remaining two polymorphs obstructs the active site entrance but stabilizes flexible regions of the protein. Nonconventional crystallization methods that minimize convection, such as counterdiffusion in polyvinyl alcohol gel coupled with the influence of a 500 MHz (10.2 T) magnetic field, were necessary to isolate the poorest diffracting polymorphmore » and increase its internal order to determine its structure by X-ray diffraction. In conclusion, the results obtained show the effectiveness of nonconventional crystallographic methods to isolate different crystal polymorphs.« less

Accounting for partiality in serial crystallography using ray-tracing principles.

PubMed

Kroon-Batenburg, Loes M J; Schreurs, Antoine M M; Ravelli, Raimond B G; Gros, Piet

2015-09-01

Serial crystallography generates `still' diffraction data sets that are composed of single diffraction images obtained from a large number of crystals arbitrarily oriented in the X-ray beam. Estimation of the reflection partialities, which accounts for the expected observed fractions of diffraction intensities, has so far been problematic. In this paper, a method is derived for modelling the partialities by making use of the ray-tracing diffraction-integration method EVAL. The method estimates partialities based on crystal mosaicity, beam divergence, wavelength dispersion, crystal size and the interference function, accounting for crystallite size. It is shown that modelling of each reflection by a distribution of interference-function weighted rays yields a `still' Lorentz factor. Still data are compared with a conventional rotation data set collected from a single lysozyme crystal. Overall, the presented still integration method improves the data quality markedly. The R factor of the still data compared with the rotation data decreases from 26% using a Monte Carlo approach to 12% after applying the Lorentz correction, to 5.3% when estimating partialities by EVAL and finally to 4.7% after post-refinement. The merging R(int) factor of the still data improves from 105 to 56% but remains high. This suggests that the accuracy of the model parameters could be further improved. However, with a multiplicity of around 40 and an R(int) of ∼50% the merged still data approximate the quality of the rotation data. The presented integration method suitably accounts for the partiality of the observed intensities in still diffraction data, which is a critical step to improve data quality in serial crystallography.

Crystallization and preliminary X-ray analysis of a family 19 glycosyl hydrolase from Carica papaya latex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huet, Joëlle, E-mail: jhuet@ulb.ac.be; Azarkan, Mohamed; Looze, Yvan

2008-05-01

A chitinase isolated from the latex of the tropical species Carica papaya has been crystallized. The addition of N-acetyl-d-glucosamine to the crystallization solution has improved the diffraction quality resolution of the crystal to 1.8 Å resolution. A chitinase isolated from the latex of the tropical species Carica papaya has been purified to homogeneity and crystallized. This enzyme belongs to glycosyl hydrolase family 19 and exhibits exceptional resistance to proteolysis. The initially observed crystals, which diffracted to a resolution of 2.0 Å, were improved through modification of the crystallization protocol. Well ordered crystals were subsequently obtained using N-acetyl-d-glucosamine, the monomer resultingmore » from the hydrolysis of chitin, as an additive to the crystallization solution. Here, the characterization of a chitinase crystal that belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 69.08, b = 44.79, c = 76.73 Å, β = 95.33° and two molecules per asymmetric unit, is reported. Diffraction data were collected to a resolution of 1.8 Å. Structure refinement is currently in progress.« less

Cloning, purification, crystallization and preliminary X-ray crystallographic analysis of MCAT from Synechocystis sp. PCC 6803.

PubMed

Liu, Yinghui; Zhang, Yanming; Cao, Xupeng; Xue, Song

2013-11-01

Malonyl-coenzymeA:acyl-carrier protein transacylase (MCAT), which catalyzes the transfer of the malonyl group from malonyl-CoA to acyl-carrier protein (ACP), is an essential enzyme in type II fatty-acid synthesis. The enzyme MCAT from Synechocystis sp. PCC 6803 (spMCAT), the first MCAT counterpart from a cyanobacterium, was cloned, purified and crystallized in order to determine its three-dimensional crystal structure. A higher-quality crystal with better diffraction was obtained by crystallization optimization. The crystal diffracted to 1.8 Å resolution and belonged to the orthorhombic space group P2(1)2(1)2, with unit-cell parameters a = 43.22, b = 149.21, c = 40.59 Å. Matthews coefficient calculations indicated that the crystal contained one spMCAT molecule in the asymmetric unit with a Matthews coefficient of 2.18 Å(3) Da(-1) and a solvent content of 43.65%.

Using Strong Magnetic Fields to Control Solutal Convection

NASA Technical Reports Server (NTRS)

Ramachandran, N.; Leslie, F. W.

2003-01-01

An important component in biotechnology, particularly in the area of protein engineering and rational drug design is the knowledge of the precise three-dimensional molecular structure of proteins. The quality of structural information obtained from X-ray diffraction methods is directly dependent on the degree of perfection of the protein crystals. As a consequence, the growth of high quality macromolecular crystals for diffraction analyses has been the central focus for biochemists, biologists, and bioengineers. Macromolecular crystals are obtained from solutions that contain the crystallizing species in equilibrium with higher aggregates, ions, precipitants, other possible phases of the protein, foreign particles, the walls of the container, and a likely host of other impurities. By changing transport modes in general, i.e., reduction of convection and sedimentation, as is achieved in microgravity , we have been able to dramatically affect the movement and distribution of macromolecules in the fluid, and thus their transport, formation of crystal nuclei, and adsorption to the crystal surface. While a limited number of high quality crystals from space flights have been obtained, as the recent National Research Council (NRC) review of the NASA microgravity crystallization program pointed out, the scientific approach and research in crystallization of proteins has been mainly empirical yielding inconclusive results. We postulate that we can reduce convection in ground-based experiments and we can understand the different aspects of convection control through the use of strong magnetic fields and field gradients. We postulate that limited convection in a magnetic field will provide the environment for the growth of high quality crystals. The approach exploits the variation of fluid magnetic susceptibility with concentration for this purpose and the convective damping is realized by appropriately positioning the crystal growth cell so that the magnetic susceptibility force counteracts terrestrial gravity. The general objective is to test the hypothesis of convective control using a strong magnetic field and magnetic field gradient and to understand the nature of the various forces that come into play. Specifically we aim to delineate causative factors and to quantify them through experiments, analysis and numerical modeling. The paper will report on the experimental results using paramagnetic salts and solutions in magnetic fields and compare them to analytical predictions.

Countering Solutal Buoyant Convection with High Magnetic Fields

NASA Technical Reports Server (NTRS)

Ramachandran, N.; Leslie, F. W.

2002-01-01

An important component in biotechnology, particularly in the area of protein engineering and rational drug design is the knowledge of the precise three-dimensional molecular structure of proteins. The quality of structural information obtained from X-ray diffraction methods is directly dependent on the degree of perfection of the protein crystals. As a consequence, the growth of high quality macromolecular crystals for diffraction analyses has been the central focus for biochemist, biologists, and bioengineers. Macromolecular crystals are obtained from solutions that contain the crystallizing species in equilibrium with higher aggregates, ions, precipitant, other possible phases of the protein, foreign particles, the walls of the container, and a likely host of other impurities. By changing transport modes in general, i.e., reduction of convection and sedimentation, as is achieved in microgravity, we have been able to dramatically effect the movement and distribution of macromolecules in the fluid, and thus their transport, formation of crystal nuclei, and adsorption to the crystal surface. While a limited number of high quality crystals from space flights have been obtained, as the recent National Research Council (NRC) review of the NASA microgravity crystallization program pointed out, the scientific approach and research in crystallization of proteins has been mainly empirical yielding inconclusive results. We postulate that we can reduce convection in ground-based experiments and we can understand the different aspects of convection control through the use of strong magnetic fields and field gradients. We postulate that limited convection in a magnetic field will provide the environment for the growth of high quality crystals. The approach exploits the variation of fluid magnetic susceptibility with concentration for this purpose and the convective damping is realized by appropriately positioning the crystal growth cell so that the magnetic susceptibility force counteracts terrestrial gravity. The general objective is to test the hypothesis of convective control using a strong magnetic field and magnetic field gradient and to understand the nature of the various forces that come into play. Specifically we aim to delineate causative factors and to quantify them through experiments, analysis and numerical modeling. The paper will report on the current status of the investigation and discuss results from the experimental and modeling efforts.

Accounting for partiality in serial crystallography using ray-tracing principles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kroon-Batenburg, Loes M. J., E-mail: l.m.j.kroon-batenburg@uu.nl; Schreurs, Antoine M. M.; Ravelli, Raimond B. G.

Serial crystallography generates partial reflections from still diffraction images. Partialities are estimated with EVAL ray-tracing simulations, thereby improving merged reflection data to a similar quality as conventional rotation data. Serial crystallography generates ‘still’ diffraction data sets that are composed of single diffraction images obtained from a large number of crystals arbitrarily oriented in the X-ray beam. Estimation of the reflection partialities, which accounts for the expected observed fractions of diffraction intensities, has so far been problematic. In this paper, a method is derived for modelling the partialities by making use of the ray-tracing diffraction-integration method EVAL. The method estimates partialitiesmore » based on crystal mosaicity, beam divergence, wavelength dispersion, crystal size and the interference function, accounting for crystallite size. It is shown that modelling of each reflection by a distribution of interference-function weighted rays yields a ‘still’ Lorentz factor. Still data are compared with a conventional rotation data set collected from a single lysozyme crystal. Overall, the presented still integration method improves the data quality markedly. The R factor of the still data compared with the rotation data decreases from 26% using a Monte Carlo approach to 12% after applying the Lorentz correction, to 5.3% when estimating partialities by EVAL and finally to 4.7% after post-refinement. The merging R{sub int} factor of the still data improves from 105 to 56% but remains high. This suggests that the accuracy of the model parameters could be further improved. However, with a multiplicity of around 40 and an R{sub int} of ∼50% the merged still data approximate the quality of the rotation data. The presented integration method suitably accounts for the partiality of the observed intensities in still diffraction data, which is a critical step to improve data quality in serial crystallography.« less

Lab-on-a-Chip Based Protein Crystallization

NASA Technical Reports Server (NTRS)

vanderWoerd, Mark J.; Brasseur, Michael M.; Spearing, Scott F.; Whitaker, Ann F. (Technical Monitor)

2001-01-01

We are developing a novel technique with which we will grow protein crystals in very small volumes, utilizing chip-based, microfluidic ("LabChip") technology. This development, which is a collaborative effort between NASA's Marshall Space Flight Center and Caliper Technologies Corporation, promises a breakthrough in the field of protein crystal growth. Our initial results obtained from two model proteins, Lysozyme and Thaumatin, show that it is feasible to dispense and adequately mix protein and precipitant solutions on a nano-liter scale. The mixtures have shown crystal growth in volumes in the range of 10 nanoliters to 5 microliters. In addition, large diffraction quality crystals were obtained by this method. X-ray data from these crystals were shown to be of excellent quality. Our future efforts will include the further development of protein crystal growth with LabChip(trademark) technology for more complex systems. We will initially address the batch growth method, followed by the vapor diffusion method and the liquid-liquid diffusion method. The culmination of these chip developments is to lead to an on orbit protein crystallization facility on the International Space Station. Structural biologists will be invited to utilize the on orbit Iterative Biological Crystallization facility to grow high quality macromolecular crystals in microgravity.

The use of a mini-κ goniometer head in macromolecular crystallography diffraction experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brockhauser, Sandor; UJF–EMBL–CNRS UMI 3265, 6 Rue Jules Horowitz, 38043 Grenoble; Ravelli, Raimond B. G.

2013-07-01

Hardware and software solutions for MX data-collection strategies using the EMBL/ESRF miniaturized multi-axis goniometer head are presented. Most macromolecular crystallography (MX) diffraction experiments at synchrotrons use a single-axis goniometer. This markedly contrasts with small-molecule crystallography, in which the majority of the diffraction data are collected using multi-axis goniometers. A novel miniaturized κ-goniometer head, the MK3, has been developed to allow macromolecular crystals to be aligned. It is available on the majority of the structural biology beamlines at the ESRF, as well as elsewhere. In addition, the Strategy for the Alignment of Crystals (STAC) software package has been developed to facilitatemore » the use of the MK3 and other similar devices. Use of the MK3 and STAC is streamlined by their incorporation into online analysis tools such as EDNA. The current use of STAC and MK3 on the MX beamlines at the ESRF is discussed. It is shown that the alignment of macromolecular crystals can result in improved diffraction data quality compared with data obtained from randomly aligned crystals.« less

Accounting for partiality in serial crystallography using ray-tracing principles

PubMed Central

Kroon-Batenburg, Loes M. J.; Schreurs, Antoine M. M.; Ravelli, Raimond B. G.; Gros, Piet

2015-01-01

Serial crystallography generates ‘still’ diffraction data sets that are composed of single diffraction images obtained from a large number of crystals arbitrarily oriented in the X-ray beam. Estimation of the reflection partialities, which accounts for the expected observed fractions of diffraction intensities, has so far been problematic. In this paper, a method is derived for modelling the partialities by making use of the ray-tracing diffraction-integration method EVAL. The method estimates partialities based on crystal mosaicity, beam divergence, wavelength dispersion, crystal size and the interference function, accounting for crystallite size. It is shown that modelling of each reflection by a distribution of interference-function weighted rays yields a ‘still’ Lorentz factor. Still data are compared with a conventional rotation data set collected from a single lysozyme crystal. Overall, the presented still integration method improves the data quality markedly. The R factor of the still data compared with the rotation data decreases from 26% using a Monte Carlo approach to 12% after applying the Lorentz correction, to 5.3% when estimating partialities by EVAL and finally to 4.7% after post-refinement. The merging R int factor of the still data improves from 105 to 56% but remains high. This suggests that the accuracy of the model parameters could be further improved. However, with a multiplicity of around 40 and an R int of ∼50% the merged still data approximate the quality of the rotation data. The presented integration method suitably accounts for the partiality of the observed intensities in still diffraction data, which is a critical step to improve data quality in serial crystallography. PMID:26327370

Pink-beam serial crystallography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meents, A.; Wiedorn, M. O.; Srajer, V.

Serial X-ray crystallography allows macromolecular structure determination at both X-ray free electron lasers (XFELs) and, more recently, synchrotron sources. The time resolution for serial synchrotron crystallography experiments has been limited to millisecond timescales with monochromatic beams. The polychromatic, “pink”, beam provides a more than two orders of magnitude increased photon flux and hence allows accessing much shorter timescales in diffraction experiments at synchrotron sources. Here we report the structure determination of two different protein samples by merging pink-beam diffraction patterns from many crystals, each collected with a single 100 ps X-ray pulse exposure per crystal using a setup optimized formore » very low scattering background. In contrast to experiments with monochromatic radiation, data from only 50 crystals were required to obtain complete datasets. The high quality of the diffraction data highlights the potential of this method for studying irreversible reactions at sub-microsecond timescales using high-brightness X-ray facilities.« less

Pink-beam serial crystallography

DOE PAGES

Meents, A.; Wiedorn, M. O.; Srajer, V.; ...

2017-11-03

Serial X-ray crystallography allows macromolecular structure determination at both X-ray free electron lasers (XFELs) and, more recently, synchrotron sources. The time resolution for serial synchrotron crystallography experiments has been limited to millisecond timescales with monochromatic beams. The polychromatic, “pink”, beam provides a more than two orders of magnitude increased photon flux and hence allows accessing much shorter timescales in diffraction experiments at synchrotron sources. Here we report the structure determination of two different protein samples by merging pink-beam diffraction patterns from many crystals, each collected with a single 100 ps X-ray pulse exposure per crystal using a setup optimized formore » very low scattering background. In contrast to experiments with monochromatic radiation, data from only 50 crystals were required to obtain complete datasets. The high quality of the diffraction data highlights the potential of this method for studying irreversible reactions at sub-microsecond timescales using high-brightness X-ray facilities.« less

Salvage of failed protein targets by reductive alkylation.

PubMed

Tan, Kemin; Kim, Youngchang; Hatzos-Skintges, Catherine; Chang, Changsoo; Cuff, Marianne; Chhor, Gekleng; Osipiuk, Jerzy; Michalska, Karolina; Nocek, Boguslaw; An, Hao; Babnigg, Gyorgy; Bigelow, Lance; Joachimiak, Grazyna; Li, Hui; Mack, Jamey; Makowska-Grzyska, Magdalena; Maltseva, Natalia; Mulligan, Rory; Tesar, Christine; Zhou, Min; Joachimiak, Andrzej

2014-01-01

The growth of diffraction-quality single crystals is of primary importance in protein X-ray crystallography. Chemical modification of proteins can alter their surface properties and crystallization behavior. The Midwest Center for Structural Genomics (MCSG) has previously reported how reductive methylation of lysine residues in proteins can improve crystallization of unique proteins that initially failed to produce diffraction-quality crystals. Recently, this approach has been expanded to include ethylation and isopropylation in the MCSG protein crystallization pipeline. Applying standard methods, 180 unique proteins were alkylated and screened using standard crystallization procedures. Crystal structures of 12 new proteins were determined, including the first ethylated and the first isopropylated protein structures. In a few cases, the structures of native and methylated or ethylated states were obtained and the impact of reductive alkylation of lysine residues was assessed. Reductive methylation tends to be more efficient and produces the most alkylated protein structures. Structures of methylated proteins typically have higher resolution limits. A number of well-ordered alkylated lysine residues have been identified, which make both intermolecular and intramolecular contacts. The previous report is updated and complemented with the following new data; a description of a detailed alkylation protocol with results, structural features, and roles of alkylated lysine residues in protein crystals. These contribute to improved crystallization properties of some proteins.

Salvage of Failed Protein Targets by Reductive Alkylation

PubMed Central

Tan, Kemin; Kim, Youngchang; Hatzos-Skintges, Catherine; Chang, Changsoo; Cuff, Marianne; Chhor, Gekleng; Osipiuk, Jerzy; Michalska, Karolina; Nocek, Boguslaw; An, Hao; Babnigg, Gyorgy; Bigelow, Lance; Joachimiak, Grazyna; Li, Hui; Mack, Jamey; Makowska-Grzyska, Magdalena; Maltseva, Natalia; Mulligan, Rory; Tesar, Christine; Zhou, Min; Joachimiak, Andrzej

2014-01-01

The growth of diffraction-quality single crystals is of primary importance in protein X-ray crystallography. Chemical modification of proteins can alter their surface properties and crystallization behavior. The Midwest Center for Structural Genomics (MCSG) has previously reported how reductive methylation of lysine residues in proteins can improve crystallization of unique proteins that initially failed to produce diffraction-quality crystals. Recently, this approach has been expanded to include ethylation and isopropylation in the MCSG protein crystallization pipeline. Applying standard methods, 180 unique proteins were alkylated and screened using standard crystallization procedures. Crystal structures of 12 new proteins were determined, including the first ethylated and the first isopropylated protein structures. In a few cases, the structures of native and methylated or ethylated states were obtained and the impact of reductive alkylation of lysine residues was assessed. Reductive methylation tends to be more efficient and produces the most alkylated protein structures. Structures of methylated proteins typically have higher resolution limits. A number of well-ordered alkylated lysine residues have been identified, which make both intermolecular and intramolecular contacts. The previous report is updated and complemented with the following new data; a description of a detailed alkylation protocol with results, structural features, and roles of alkylated lysine residues in protein crystals. These contribute to improved crystallization properties of some proteins. PMID:24590719

Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi

Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 Mmore » sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.« less

Preparation and Analysis of RNA Crystals

NASA Technical Reports Server (NTRS)

Todd, Paul

2000-01-01

The crystallization of RiboNucleic Acids (RNA) was studied from the standpoint of mechanisms of crystal growth in three tasks: (1) preparation of high-quality crystals of oligonuclotides for X-ray diffraction, (2) finding pathways to the growth of high-quality crystals for X-ray diffraction and (3) investigation of mechanisms of action of inertial acceleration on crystal growth. In these tasks: (1) RNA crystals were prepared and studied by X-ray diffraction; (2) a pathway to high-quality crystals was discovered and characterized; a combination of kinetic and equilibrium factors could be optimized as described below; and (3) an interplay between purity and gravity was found in a combination of space and ground experiments with nucleic acids and proteins. Most significantly, the rate of concentration of precipitant and RNA can be controlled by membrane-based methods of water removal or by diffusion of multivalent cations across an interface stabilized by a membrane. Oligonucleotide solutions are electrokinetically stabilized colloids, and crystals can form by the controlled addition of multivalent cations.

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708

PubMed Central

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-01-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (V M = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit. PMID:19923737

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708.

PubMed

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-11-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 angstrom resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 angstrom. The Matthews coefficient (V(M) = 1.76 angstrom(3) Da(-1)) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit.

Magnetic Control of Convection during Protein Crystallization

NASA Technical Reports Server (NTRS)

Ramachandran, N.; Leslie, F. W.

2004-01-01

An important component in biotechnology, particularly in the area of protein engineering and rational drug design is the knowledge of the precise three-dimensional molecular structure of proteins. The quality of structural information obtained from X-ray diffraction methods is directly dependent on the degree of perfection of the protein crystals. As a consequence, the growth of high quality macromolecular Crystals for diffraction analyses has been the central focus for bio-chemists, biologists, and bioengineers. Macromolecular crystals are obtained from solutions that contain the crystallizing species in equilibrium with higher aggregates, ions, precipitants, other possible phases of the protein, foreign particles, the walls of container, and a likely host of other impurities. By changing transport modes in general, i.e., reduction of convection and Sedimentation as is achieved in "microgravity", we have been able to dramatically affect the movement and distribution of macromolecules in the fluid, and thus their transport, f o d o n of crystal nuclei, and adsorption to the crystal surface. While a limited number of high quality crystals from space flights have been obtained, as the recent National Research Council (NRC) review of the NASA microgravity crystallization program pointed out, the scientific approach and research in crystallization of proteins has been mainly empirical yielding inconclusive results. We postulate that we can reduce convection in ground-based experiments and we can understand the different aspects of convection control through the use of strong magnetic fields and field gradients. We postulate that limited convection in a magnetic field will provide the environment for the growth of high quality crystals. The approach exploits the variation of fluid magnetic susceptibility with counteracts on for this purpose and the convective damping is realized by appropriately positioning the crystal growth cell so that the magnetic susceptibility force counteract terrestrial gravity. The genera1 objective is to test the hypothesis of convective control using a strong magnetic field and magnetic field gradient and to understand the nature of the various forces that come into play. Specifically we aim to delineate causative factors and to quantify them through experiments, analysis and numerical modeling. The paper will report on the experimental results using paramagentic salts and solutions in magnetic fields and compare them to analyticalprctions.

Expression, crystallization and phasing of vacuolar H(+)-ATPase subunit C (Vma5p) of Saccharomyces cerevisiae.

PubMed

Drory, Omri; Mor, Adi; Frolow, Felix; Nelson, Nathan

2004-10-01

The expression, crystallization and phasing of subunit C (Vma5p) of the yeast (Saccharomyces cerevisiae) vacuolar proton-translocating ATPase (V-ATPase) is described. The expressed protein consists of 412 residues: 392 from the reading frame of Vma5p and 20 N-terminal residues originating from the plasmid. Diffraction-quality crystals were obtained using the hanging-drop and sitting-drop vapour-diffusion methods assisted by streak-seeding, with PEG 3350 as precipitant. The crystals formed in hanging drops diffracted to 1.80 A and belong to space group P4(3)2(1)2(1), with unit-cell parameters a = b = 62.54, c = 327.37 A, alpha = beta = gamma = 90 degrees. The structure was solved using SIRAS with a Lu(O2C2H3)2 heavy-atom derivative.

Crystallization and preliminary X-ray analysis of human MTH1 with a homogeneous N-terminus

PubMed Central

Koga, Yukari; Inazato, Miyuki; Nakamura, Teruya; Hashikawa, Chie; Chirifu, Mami; Michi, Asuka; Yamashita, Taku; Toma, Sachiko; Kuniyasu, Akihiko; Ikemizu, Shinji; Nakabeppu, Yusaku; Yamagata, Yuriko

2013-01-01

Human MTH1 (hMTH1) is an enzyme that hydrolyses several oxidized purine nucleoside triphosphates to their corresponding nucleoside monophosphates. Crystallographic studies have shown that the accurate mode of interaction between 8-oxoguanine and hMTH1 cannot be understood without determining the positions of the H atoms, as can be observed in neutron and/or ultrahigh-resolution X-ray diffraction studies. The hMTH1 protein prepared in the original expression system from Escherichia coli did not appear to be suitable for obtaining high-quality crystals because the hMTH1 protein had heterogeneous N-termini of Met1 and Gly2 that resulted from N-terminal Met excision by methionine aminopeptidase from the E. coli host. To obtain homogeneous hMTH1, the Gly at the second position was replaced by Lys. As a result, mutant hMTH1 protein [hMTH1(G2K)] with a homogeneous N-terminus could be prepared and high-quality crystals which diffracted to near 1.1 Å resolution using synchrotron radiation were produced. The new crystals belonged to space group P212121, with unit-cell parameters a = 46.36, b = 47.58, c = 123.89 Å. PMID:23295485

Crystallization and preliminary X-ray analysis of human MTH1 with a homogeneous N-terminus.

PubMed

Koga, Yukari; Inazato, Miyuki; Nakamura, Teruya; Hashikawa, Chie; Chirifu, Mami; Michi, Asuka; Yamashita, Taku; Toma, Sachiko; Kuniyasu, Akihiko; Ikemizu, Shinji; Nakabeppu, Yusaku; Yamagata, Yuriko

2013-01-01

Human MTH1 (hMTH1) is an enzyme that hydrolyses several oxidized purine nucleoside triphosphates to their corresponding nucleoside monophosphates. Crystallographic studies have shown that the accurate mode of interaction between 8-oxoguanine and hMTH1 cannot be understood without determining the positions of the H atoms, as can be observed in neutron and/or ultrahigh-resolution X-ray diffraction studies. The hMTH1 protein prepared in the original expression system from Escherichia coli did not appear to be suitable for obtaining high-quality crystals because the hMTH1 protein had heterogeneous N-termini of Met1 and Gly2 that resulted from N-terminal Met excision by methionine aminopeptidase from the E. coli host. To obtain homogeneous hMTH1, the Gly at the second position was replaced by Lys. As a result, mutant hMTH1 protein [hMTH1(G2K)] with a homogeneous N-terminus could be prepared and high-quality crystals which diffracted to near 1.1 Å resolution using synchrotron radiation were produced. The new crystals belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 46.36, b = 47.58, c = 123.89 Å.

Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

2016-11-30

A tetrahydrofolate-dependentO-demethylase, LigM, from Sphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtained P3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding using P3 121/P3 2 21 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space group P2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c = 128.1 Å. The P2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing themore » cryoconditions. Phasing using the single anomalous diffraction method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

Macromolecular diffractive imaging using imperfect crystals

PubMed Central

Ayyer, Kartik; Yefanov, Oleksandr; Oberthür, Dominik; Roy-Chowdhury, Shatabdi; Galli, Lorenzo; Mariani, Valerio; Basu, Shibom; Coe, Jesse; Conrad, Chelsie E.; Fromme, Raimund; Schaffer, Alexander; Dörner, Katerina; James, Daniel; Kupitz, Christopher; Metz, Markus; Nelson, Garrett; Lourdu Xavier, Paulraj; Beyerlein, Kenneth R.; Schmidt, Marius; Sarrou, Iosifina; Spence, John C. H.; Weierstall, Uwe; White, Thomas A.; Yang, Jay-How; Zhao, Yun; Liang, Mengning; Aquila, Andrew; Hunter, Mark S.; Robinson, Joseph S.; Koglin, Jason E.; Boutet, Sébastien; Fromme, Petra; Barty, Anton; Chapman, Henry N.

2016-01-01

The three-dimensional structures of macromolecules and their complexes are predominantly elucidated by X-ray protein crystallography. A major limitation is access to high-quality crystals, to ensure X-ray diffraction extends to sufficiently large scattering angles and hence yields sufficiently high-resolution information that the crystal structure can be solved. The observation that crystals with shrunken unit-cell volumes and tighter macromolecular packing often produce higher-resolution Bragg peaks1,2 hints that crystallographic resolution for some macromolecules may be limited not by their heterogeneity but rather by a deviation of strict positional ordering of the crystalline lattice. Such displacements of molecules from the ideal lattice give rise to a continuous diffraction pattern, equal to the incoherent sum of diffraction from rigid single molecular complexes aligned along several discrete crystallographic orientations and hence with an increased information content3. Although such continuous diffraction patterns have long been observed—and are of interest as a source of information about the dynamics of proteins4 —they have not been used for structure determination. Here we show for crystals of the integral membrane protein complex photosystem II that lattice disorder increases the information content and the resolution of the diffraction pattern well beyond the 4.5 Å limit of measurable Bragg peaks, which allows us to directly phase5 the pattern. With the molecular envelope conventionally determined at 4.5 Å as a constraint, we then obtain a static image of the photosystem II dimer at 3.5 Å resolution. This result shows that continuous diffraction can be used to overcome long-supposed resolution limits of macromolecular crystallography, with a method that puts great value in commonly encountered imperfect crystals and opens up the possibility for model-free phasing6,7. PMID:26863980

Membrane Protein Crystallization Using Laser Irradiation

NASA Astrophysics Data System (ADS)

Adachi, Hiroaki; Murakami, Satoshi; Niino, Ai; Matsumura, Hiroyoshi; Takano, Kazufumi; Inoue, Tsuyoshi; Mori, Yusuke; Yamaguchi, Akihito; Sasaki, Takatomo

2004-10-01

We demonstrate the crystallization of a membrane protein using femtosecond laser irradiation. This method, which we call the laser irradiated growth technique (LIGHT), is useful for producing AcrB crystals in a solution of low supersaturation range. LIGHT is characterized by reduced nucleation times. This feature is important for crystallizing membrane proteins because of their labile properties when solubilized as protein-detergent micelles. Using LIGHT, high-quality crystals of a membrane transporter protein, AcrB, were obtained. The resulting crystals were found to be of sufficiently high resolution for X-ray diffraction. The results reported here indicate that LIGHT is a powerful tool for membrane protein crystallization, as well as for the growth of soluble proteins.

The use of workflows in the design and implementation of complex experiments in macromolecular crystallography.

PubMed

Brockhauser, Sandor; Svensson, Olof; Bowler, Matthew W; Nanao, Max; Gordon, Elspeth; Leal, Ricardo M F; Popov, Alexander; Gerring, Matthew; McCarthy, Andrew A; Gotz, Andy

2012-08-01

The automation of beam delivery, sample handling and data analysis, together with increasing photon flux, diminishing focal spot size and the appearance of fast-readout detectors on synchrotron beamlines, have changed the way that many macromolecular crystallography experiments are planned and executed. Screening for the best diffracting crystal, or even the best diffracting part of a selected crystal, has been enabled by the development of microfocus beams, precise goniometers and fast-readout detectors that all require rapid feedback from the initial processing of images in order to be effective. All of these advances require the coupling of data feedback to the experimental control system and depend on immediate online data-analysis results during the experiment. To facilitate this, a Data Analysis WorkBench (DAWB) for the flexible creation of complex automated protocols has been developed. Here, example workflows designed and implemented using DAWB are presented for enhanced multi-step crystal characterizations, experiments involving crystal reorientation with kappa goniometers, crystal-burning experiments for empirically determining the radiation sensitivity of a crystal system and the application of mesh scans to find the best location of a crystal to obtain the highest diffraction quality. Beamline users interact with the prepared workflows through a specific brick within the beamline-control GUI MXCuBE.

Purification, crystallization and preliminary X-ray analysis of Escherichia coli UDP-N-acetylmuramoyl:L-alanine ligase (MurC).

PubMed

Deva, Taru; Pryor, KellyAnn D; Leiting, Barbara; Baker, Edward N; Smith, Clyde A

2003-08-01

UDP-N-acetylmuramoyl:L-alanine ligase (MurC) is involved in the pathway leading from UDP-N-glucosamine to the UDP-N-acetylmuramoyl:pentapeptide unit, which is the building block for the peptidoglycan layer found in all bacterial cell walls. The pathways leading to the biosynthesis of the peptidoglycan layer are important targets for the development of novel antibiotics, since animal cells do not contain these pathways. MurC is the first of four similar ATP-dependent amide-bond ligases which share primary and tertiary structural similarities. The crystal structures of three of these have been determined by X-ray crystallography, giving insights into the binding of the carbohydrate substrate and the ATP. Diffraction-quality crystals of the enzyme MurC have been obtained in both native and selenomethionine forms and X-ray diffraction data have been collected at the Se edge at a synchrotron source. The crystals are orthorhombic, with unit-cell parameters a = 73.9, b = 93.6, c = 176.8 A, and diffraction has been observed to 2.6 A resolution.

Crystallization, optimization and preliminary X-ray characterization of a metal-dependent PI-PLC from Streptomyces antibioticus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jackson, Michael R.; Selby, Thomas L.

2012-10-30

A recombinant metal-dependent phosphatidylinositol-specific phospholipase C (PI-PLC) fromStreptomyces antibioticushas been crystallized by the hanging-drop method with and without heavy metals. The native crystals belonged to the orthorhombic space groupP222, with unit-cell parametersa= 41.26,b= 51.86,c = 154.78 Å. The X-ray diffraction results showed significant differences in the crystal quality of samples soaked with heavy atoms. Additionally, drop pinning, which increases the surface area of the drops, was also used to improve crystal growth and quality. The combination of heavy-metal soaks and drop pinning was found to be critical for producing high-quality crystals that diffracted to 1.23 Å resolution.

On thermal conditions and properties of thallium bromide single crystals grown by the Electro Dynamic Gradient method

NASA Astrophysics Data System (ADS)

Zheng, Zhiping; Yu, Yongtao; Gong, Shuping; Fu, Qiuyun; Zhou, Dongxiang

2013-05-01

The Electro Dynamic Gradient (EDG) method has been proved to be a feasible way to grow TlBr crystals in our previous work. In this research, the influence of thermal conditions such as cooling rate during growth process on the crystal performance was investigated. Crystals of approximately 12 mm diameter were obtained by the EDG method at different cooling rates during the growth process, and the quality of the crystals was routinely evaluated by X-ray diffraction (XRD), infrared (IR) and ultraviolet (UV) transmission, I-V measurement and energy response spectrum. The results proved that thermal conditions during growth had a profound influence on the characteristics of the crystals.

Crystallization of human estrogenic 17β-hydroxysteroid dehydrogenase under microgravity

NASA Astrophysics Data System (ADS)

Zhu, Dao-Wei; Zhou, Ming; Mao, Ying; Labrie, Fernand; Lin, Sheng-Xiang

1995-11-01

Human 17β-hydroxysteroid dehydrogenase has been crystallized on the ground in the complex form with NADP + and a complete data set of the crystal was primarily collected at 2.9 Å [D.-W. Zhu, X. Lee, R. Breton, D. Ghosh, W. Pangborn, W.L. Duax and S.-X. Lin, J. Mol. Biol. 234 (1993) 242]. To eliminate multiseeding, formation of multicrystals and to obtain higher quality crystals, we carried out the crystallization aboard the Russian MIR space station and crystals were recovered in January, 1994. Crystals of the enzyme were formed in 9 of the total 12 sitting drops in the space mission, in the presence of NADP + or estradiol. This is a first attempt of crystallization of a membrane-associated protein under microgravity in the presence of a detergent. The space experiments showed better results in nucleation number, crystal size and morphology than the ground ones, obtaining crystals diffracting to resolutions between 2.5-2.7 Å. The too early ground mixing has limited a more important improvement of the crystallization.

High-throughput crystallization screening.

PubMed

Skarina, Tatiana; Xu, Xiaohui; Evdokimova, Elena; Savchenko, Alexei

2014-01-01

Protein structure determination by X-ray crystallography is dependent on obtaining a single protein crystal suitable for diffraction data collection. Due to this requirement, protein crystallization represents a key step in protein structure determination. The conditions for protein crystallization have to be determined empirically for each protein, making this step also a bottleneck in the structure determination process. Typical protein crystallization practice involves parallel setup and monitoring of a considerable number of individual protein crystallization experiments (also called crystallization trials). In these trials the aliquots of purified protein are mixed with a range of solutions composed of a precipitating agent, buffer, and sometimes an additive that have been previously successful in prompting protein crystallization. The individual chemical conditions in which a particular protein shows signs of crystallization are used as a starting point for further crystallization experiments. The goal is optimizing the formation of individual protein crystals of sufficient size and quality to make them suitable for diffraction data collection. Thus the composition of the primary crystallization screen is critical for successful crystallization.Systematic analysis of crystallization experiments carried out on several hundred proteins as part of large-scale structural genomics efforts allowed the optimization of the protein crystallization protocol and identification of a minimal set of 96 crystallization solutions (the "TRAP" screen) that, in our experience, led to crystallization of the maximum number of proteins.

Macromolecule Crystal Quality Improvement in Microgravity: The Role of Impurities

NASA Technical Reports Server (NTRS)

Judge, Russell A.; Snell, Edward H.; Pusey, Marc L.; Sportiello, Michael G.; Todd, Paul; Bellamy, Henry; Borgstahl, Gloria E.; Pokros, Matt; Cassanto, John M.

2000-01-01

While macromolecule impurities may affect crystal size and morphology the over-riding question is; "How do macromolecule impurities effect crystal X-ray quality and diffraction resolution?" In the case of chicken egg white lysozyme, crystals can be grown in the presence of a number of impurities without affecting diffraction resolution. One impurity however, the lysozyme dimer, does negatively impact the X-ray crystal properties. Crystal quality improvement as a result of better partitioning of this impurity during crystallization in microgravity has been reported'. In our recent experimental work dimer partitioning was found to be not significantly different between the two environments. Mosaicity analysis of pure crystals showed a reduced mosaicity and increased signal to noise for the microgravity grown crystals. Dimer incorporation however, did greatly reduce the resolution limit in both ground and microgravity grown crystals. These results indicate that impurity effects in microgravity are complex and may rely on the conditions or techniques employed.

Crystallization, dehydration and experimental phasing of WbdD, a bifunctional kinase and methyltransferase from Escherichia coli O9a

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hagelueken, Gregor; Huang, Hexian; Harlos, Karl

2012-10-01

The optimization of WbdD crystals using a novel dehydration protocol and experimental phasing at 3.5 Å resolution by cross-crystal averaging followed by molecular replacement of electron density into a non-isomorphous 3.0 Å resolution native data set are reported. WbdD is a bifunctional kinase/methyltransferase that is responsible for regulation of lipopolysaccharide O antigen polysaccharide chain length in Escherichia coli serotype O9a. Solving the crystal structure of this protein proved to be a challenge because the available crystals belonging to space group I23 only diffracted to low resolution (>95% of the crystals diffracted to resolution lower than 4 Å and most onlymore » to 8 Å) and were non-isomorphous, with changes in unit-cell dimensions of greater than 10%. Data from a serendipitously found single native crystal that diffracted to 3.0 Å resolution were non-isomorphous with a lower (3.5 Å) resolution selenomethionine data set. Here, a strategy for improving poor (3.5 Å resolution) initial phases by density modification and cross-crystal averaging with an additional 4.2 Å resolution data set to build a crude model of WbdD is desribed. Using this crude model as a mask to cut out the 3.5 Å resolution electron density yielded a successful molecular-replacement solution of the 3.0 Å resolution data set. The resulting map was used to build a complete model of WbdD. The hydration status of individual crystals appears to underpin the variable diffraction quality of WbdD crystals. After the initial structure had been solved, methods to control the hydration status of WbdD were developed and it was thus possible to routinely obtain high-resolution diffraction (to better than 2.5 Å resolution). This novel and facile crystal-dehydration protocol may be useful for similar challenging situations.« less

Purification and crystallization of dengue and West Nile virus NS2B–NS3 complexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

D’Arcy, Allan, E-mail: allan.darcy@novartis.com; Chaillet, Maxime; Schiering, Nikolaus

Crystals of dengue serotype 2 and West Nile virus NS2B–NS3 protease complexes have been obtained and the crystals of both diffract to useful resolution. Sample homogeneity was essential for obtaining X-ray-quality crystals of the dengue protease. Controlled proteolysis produced a crystallizable fragment of the apo West Nile virus NS2B–NS3 and crystals were also obtained in the presence of a peptidic inhibitor. Both dengue and West Nile virus infections are an increasing risk to humans, not only in tropical and subtropical areas, but also in North America and parts of Europe. These viral infections are generally transmitted by mosquitoes, but maymore » also be tick-borne. Infection usually results in mild flu-like symptoms, but can also cause encephalitis and fatalities. Approximately 2799 severe West Nile virus cases were reported this year in the United States, resulting in 102 fatalities. With this alarming increase in the number of West Nile virus infections in western countries and the fact that dengue virus already affects millions of people per year in tropical and subtropical climates, there is a real need for effective medicines. A possible therapeutic target to combat these viruses is the protease, which is essential for virus replication. In order to provide structural information to help to guide a lead identification and optimization program, crystallizations of the NS2B–NS3 protease complexes from both dengue and West Nile viruses have been initiated. Crystals that diffract to high resolution, suitable for three-dimensional structure determinations, have been obtained.« less

Optimization of crystallization conditions for biological macromolecules.

PubMed

McPherson, Alexander; Cudney, Bob

2014-11-01

For the successful X-ray structure determination of macromolecules, it is first necessary to identify, usually by matrix screening, conditions that yield some sort of crystals. Initial crystals are frequently microcrystals or clusters, and often have unfavorable morphologies or yield poor diffraction intensities. It is therefore generally necessary to improve upon these initial conditions in order to obtain better crystals of sufficient quality for X-ray data collection. Even when the initial samples are suitable, often marginally, refinement of conditions is recommended in order to obtain the highest quality crystals that can be grown. The quality of an X-ray structure determination is directly correlated with the size and the perfection of the crystalline samples; thus, refinement of conditions should always be a primary component of crystal growth. The improvement process is referred to as optimization, and it entails sequential, incremental changes in the chemical parameters that influence crystallization, such as pH, ionic strength and precipitant concentration, as well as physical parameters such as temperature, sample volume and overall methodology. It also includes the application of some unique procedures and approaches, and the addition of novel components such as detergents, ligands or other small molecules that may enhance nucleation or crystal development. Here, an attempt is made to provide guidance on how optimization might best be applied to crystal-growth problems, and what parameters and factors might most profitably be explored to accelerate and achieve success.

Optimization of crystallization conditions for biological macromolecules

PubMed Central

McPherson, Alexander; Cudney, Bob

2014-01-01

For the successful X-ray structure determination of macromolecules, it is first necessary to identify, usually by matrix screening, conditions that yield some sort of crystals. Initial crystals are frequently microcrystals or clusters, and often have unfavorable morphologies or yield poor diffraction intensities. It is therefore generally necessary to improve upon these initial conditions in order to obtain better crystals of sufficient quality for X-ray data collection. Even when the initial samples are suitable, often marginally, refinement of conditions is recommended in order to obtain the highest quality crystals that can be grown. The quality of an X-ray structure determination is directly correlated with the size and the perfection of the crystalline samples; thus, refinement of conditions should always be a primary component of crystal growth. The improvement process is referred to as optimization, and it entails sequential, incremental changes in the chemical parameters that influence crystallization, such as pH, ionic strength and precipitant concentration, as well as physical parameters such as temperature, sample volume and overall methodology. It also includes the application of some unique procedures and approaches, and the addition of novel components such as detergents, ligands or other small molecules that may enhance nucleation or crystal development. Here, an attempt is made to provide guidance on how optimization might best be applied to crystal-growth problems, and what parameters and factors might most profitably be explored to accelerate and achieve success. PMID:25372810

Delta L: An Apparatus for Measuring Macromolecule Crystal Growth Rates in Microgravity

NASA Technical Reports Server (NTRS)

Judge, Russell A.; Whitaker, Ann F. (Technical Monitor)

2001-01-01

Strongly diffracting high quality macromolecule crystals of suitable volume are keenly sought for X-ray diffraction analysis so that high-resolution molecular structure data can be obtained. Such data is of tremendous value to medical research, agriculture and commercial biotechnology. In previous studies by many investigators microgravity has been reported in some instances to improve biological macromolecule X-ray crystal quality while little or no improvement was observed in other cases. A better understanding of processes effecting crystal quality improvement in microgravity will therefore be of great benefit in optimizing crystallization success in microgravity. In ground based research with the protein lysozyme we have previously shown that a population of crystals grown under the same solution conditions, exhibit a variation in X-ray diffraction properties (Judge et al., 1999). We have also observed that under the same solution conditions, individual crystals will grow at slightly different growth rates. This phenomenon is called growth rate dispersion. For small molecule materials growth rate dispersion has been directly related to crystal quality (Cunningham et al., 1991; Ristic et al., 1991). We therefore postulate that microgravity may act to improve crystal quality by reducing growth rate dispersion. If this is the case then as different, Materials exhibit different degrees of growth rate dispersion on the ground then growth rate dispersion could be used to screen which materials may benefit the most from microgravity crystallization. In order to assess this theory the Delta L hardware is being developed so that macromolecule crystal growth rates can be measured in microgravity. Crystal growth rate is defined as the change or delta in crystal size (defined as a characteristic length, L) over time; hence the name of the hardware. Delta L will consist of an optics, a fluids, and a data acquisition sub-assemblies. The optics assembly will consist of a video microscope camera mounted on three axis computer controlled translation stages. The fluids assembly consists of macromolecule and precipitant reservoirs, a temperature controlled growth cell and waste container, The data acquisition is achieved by using a frame-gabber, with images being stored on a hard drive. In operation, macromolecule and precipitant solution will be injected into the temperature controlled growth cell. As macromolecule crystals grow, the video microscope camera controlled by the translation stages, will be used to locate and record images of individual crystals, returning to the same crystals at specific time intervals. The images will be stored on the hard drive and used to calculate the crystal growth rate. To prevent vibrations interfering in the crystal growth rate measurements (Snell et al., 1997) Delta L will be used in connection with the Glovebox Integrated Microgravity Isolation Technology (g-LIMIT) inside the Microgravity Science Glovebox (MSG), onboard the International Space Station (ISS).

Image processing for grazing incidence fast atom diffraction

NASA Astrophysics Data System (ADS)

Debiossac, Maxime; Roncin, Philippe

2016-09-01

Grazing incidence fast atom diffraction (GIFAD, or FAD) has developed as a surface sensitive technique. Compared with thermal energies helium diffraction (TEAS or HAS), GIFAD is less sensitive to thermal decoherence but also more demanding in terms of surface coherence, the mean distance between defects. Such high quality surfaces can be obtained from freshly cleaved crystals or in a molecular beam epitaxy (MBE) chamber where a GIFAD setup has been installed allowing in situ operation. Based on recent publications by Atkinson et al. (2014) and Debiossac et al. (2014), the paper describes in detail the basic steps needed to measure the relative intensities of the diffraction spots. Care is taken to outline the underlying physical assumptions.

Assessment of microcrystal quality by transmission electron microscopy for efficient serial femtosecond crystallography.

PubMed

Barnes, Christopher O; Kovaleva, Elena G; Fu, Xiaofeng; Stevenson, Hilary P; Brewster, Aaron S; DePonte, Daniel P; Baxter, Elizabeth L; Cohen, Aina E; Calero, Guillermo

2016-07-15

Serial femtosecond crystallography (SFX) employing high-intensity X-ray free-electron laser (XFEL) sources has enabled structural studies on microcrystalline protein samples at non-cryogenic temperatures. However, the identification and optimization of conditions that produce well diffracting microcrystals remains an experimental challenge. Here, we report parallel SFX and transmission electron microscopy (TEM) experiments using fragmented microcrystals of wild type (WT) homoprotocatechuate 2,3-dioxygenase (HPCD) and an active site variant (H200Q). Despite identical crystallization conditions and morphology, as well as similar crystal size and density, the indexing efficiency of the diffraction data collected using the H200Q variant sample was over 7-fold higher compared to the diffraction results obtained using the WT sample. TEM analysis revealed an abundance of protein aggregates, crystal conglomerates and a smaller population of highly ordered lattices in the WT sample as compared to the H200Q variant sample. While not reported herein, the 1.75 Å resolution structure of the H200Q variant was determined from ∼16 min of beam time, demonstrating the utility of TEM analysis in evaluating sample monodispersity and lattice quality, parameters critical to the efficiency of SFX experiments. Copyright © 2016 Elsevier Inc. All rights reserved.

Growth of high quality and large-sized Rb 0.3MoO 3 single crystals by molten salt electrolysis method

NASA Astrophysics Data System (ADS)

Wang, Junfeng; Xiong, Rui; Yi, Fan; Yin, Di; Ke, Manzhu; Li, Changzhen; Liu, Zhengyou; Shi, Jing

2005-05-01

High quality and large-sized Rb 0.3MoO 3 single crystals were synthesized by molten salt electrolysis method. X-ray diffraction (XRD) patterns and rocking curves, as well as the white beam Laue diffraction of X-ray images show the crystals grown by this method have high quality. The lattice constants evaluated from XRD patterns are a0=1.87 nm, b0=0.75 nm, c0=1.00 nm, β=118.83∘. The in situ selected area electron diffraction (SAED) patterns along the [101¯], [11¯1¯] and [103¯] zone axes at room temperature indicate that the Rb 0.3MoO 3 crystal possess perfect C-centered symmetry. Temperature dependence of the resistivity shows this compound undergoes a metal to semiconductor transition at 183 K.

LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kusakizako, Tsukasa; Tanaka, Yoshiki; Hipolito, Christopher J.

A V. cholerae MATE transporter was crystallized using the lipidic cubic phase (LCP) method. X-ray diffraction data sets were collected from single crystals obtained in a sandwich plate and a sitting-drop plate to resolutions of 2.5 and 2.2 Å, respectively. Multidrug and toxic compound extrusion (MATE) transporters, one of the multidrug exporter families, efflux xenobiotics towards the extracellular side of the membrane. Since MATE transporters expressed in bacterial pathogens contribute to multidrug resistance, they are important therapeutic targets. Here, a MATE-transporter homologue from Vibrio cholerae, VcmN, was overexpressed in Escherichia coli, purified and crystallized in lipidic cubic phase (LCP). X-raymore » diffraction data were collected to 2.5 Å resolution from a single crystal obtained in a sandwich plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.3, b = 93.7, c = 100.2 Å. As a result of further LCP crystallization trials, crystals of larger size were obtained using sitting-drop plates. X-ray diffraction data were collected to 2.2 Å resolution from a single crystal obtained in a sitting-drop plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.9, b = 91.8, c = 100.9 Å. The present work provides valuable insights into the atomic resolution structure determination of membrane transporters.« less

Correlation between protein sequence similarity and x-ray diffraction quality in the protein data bank.

PubMed

Lu, Hui-Meng; Yin, Da-Chuan; Ye, Ya-Jing; Luo, Hui-Min; Geng, Li-Qiang; Li, Hai-Sheng; Guo, Wei-Hong; Shang, Peng

2009-01-01

As the most widely utilized technique to determine the 3-dimensional structure of protein molecules, X-ray crystallography can provide structure of the highest resolution among the developed techniques. The resolution obtained via X-ray crystallography is known to be influenced by many factors, such as the crystal quality, diffraction techniques, and X-ray sources, etc. In this paper, the authors found that the protein sequence could also be one of the factors. We extracted information of the resolution and the sequence of proteins from the Protein Data Bank (PDB), classified the proteins into different clusters according to the sequence similarity, and statistically analyzed the relationship between the sequence similarity and the best resolution obtained. The results showed that there was a pronounced correlation between the sequence similarity and the obtained resolution. These results indicate that protein structure itself is one variable that may affect resolution when X-ray crystallography is used.

Preparation, crystallization and preliminary X-ray diffraction analysis of two intestinal fatty-acid binding proteins in the presence of 11-(dansylamino)undecanoic acid

PubMed Central

Laguerre, Aisha; Wielens, Jerome; Parker, Michael W.; Porter, Christopher J. H.; Scanlon, Martin J.

2011-01-01

Fatty-acid binding proteins (FABPs) are abundantly expressed proteins that bind a range of lipophilic molecules. They have been implicated in the import and intracellular distribution of their ligands and have been linked with metabolic and inflammatory responses in the cells in which they are expressed. Despite their high sequence identity, human intestinal FABP (hIFABP) and rat intestinal FABP (rIFABP) bind some ligands with different affinities. In order to address the structural basis of this differential binding, diffraction-quality crystals have been obtained of hIFABP and rIFABP in complex with the fluorescent fatty-acid analogue 11-(dansylamino)undecanoic acid. PMID:21301109

New methods for indexing multi-lattice diffraction data

PubMed Central

Gildea, Richard J.; Waterman, David G.; Parkhurst, James M.; Axford, Danny; Sutton, Geoff; Stuart, David I.; Sauter, Nicholas K.; Evans, Gwyndaf; Winter, Graeme

2014-01-01

A new indexing method is presented which is capable of indexing multiple crystal lattices from narrow wedges of diffraction data. The method takes advantage of a simplification of Fourier transform-based methods that is applicable when the unit-cell dimensions are known a priori. The efficacy of this method is demonstrated with both semi-synthetic multi-lattice data and real multi-lattice data recorded from crystals of ∼1 µm in size, where it is shown that up to six lattices can be successfully indexed and subsequently integrated from a 1° wedge of data. Analysis is presented which shows that improvements in data-quality indicators can be obtained through accurate identification and rejection of overlapping reflections prior to scaling. PMID:25286849

New methods for indexing multi-lattice diffraction data.

PubMed

Gildea, Richard J; Waterman, David G; Parkhurst, James M; Axford, Danny; Sutton, Geoff; Stuart, David I; Sauter, Nicholas K; Evans, Gwyndaf; Winter, Graeme

2014-10-01

A new indexing method is presented which is capable of indexing multiple crystal lattices from narrow wedges of diffraction data. The method takes advantage of a simplification of Fourier transform-based methods that is applicable when the unit-cell dimensions are known a priori. The efficacy of this method is demonstrated with both semi-synthetic multi-lattice data and real multi-lattice data recorded from crystals of ∼1 µm in size, where it is shown that up to six lattices can be successfully indexed and subsequently integrated from a 1° wedge of data. Analysis is presented which shows that improvements in data-quality indicators can be obtained through accurate identification and rejection of overlapping reflections prior to scaling.

New methods for indexing multi-lattice diffraction data

DOE PAGES

Gildea, Richard J.; Waterman, David G.; Parkhurst, James M.; ...

2014-09-27

A new indexing method is presented which is capable of indexing multiple crystal lattices from narrow wedges of diffraction data. The method takes advantage of a simplification of Fourier transform-based methods that is applicable when the unit-cell dimensions are known a priori. The efficacy of this method is demonstrated with both semi-synthetic multi-lattice data and real multi-lattice data recorded from crystals of ~1 µm in size, where it is shown that up to six lattices can be successfully indexed and subsequently integrated from a 1° wedge of data. Analysis is presented which shows that improvements in data-quality indicators can bemore » obtained through accurate identification and rejection of overlapping reflections prior to scaling.« less

Crystal growth of triphenylphosphine oxide 4-nitrophenol (TP4N) for nonlinear optical (NLO) applications

NASA Astrophysics Data System (ADS)

Pandian, Muthu Senthil; Karuppasamy, P.; Kamalesh, T.; Ramasamy, P.; Verma, Sunil

2018-04-01

The optically good quality organic single crystals of triphenylphosphine oxide 4-nitrophenol (TP4N) were successfully grown by slow evaporation solution technique (SEST) using methanol as solvent. The lattice parameters of the grown crystal were confirmed by single crystal X-ray diffraction analysis. The optical transmittance, cut-off wavelength and band gap of the TP4N crystal were obtained by UV-Vis NIR spectrum analysis. The photoluminescence studies were carried out to find out the luminesce properties of TP4N single crystal. The photoconductivity studies reveal that the TP4N crystal has negative photoconductive nature. The third order nonlinear susceptibility (χ(3)) of TP4N crystal was evaluated using the Z-scan technique at 640 nm.

Dynamic X-ray diffraction sampling for protein crystal positioning

DOE Office of Scientific and Technical Information (OSTI.GOV)

Scarborough, Nicole M.; Godaliyadda, G. M. Dilshan P.; Ye, Dong Hye

A sparse supervised learning approach for dynamic sampling (SLADS) is described for dose reduction in diffraction-based protein crystal positioning. Crystal centering is typically a prerequisite for macromolecular diffraction at synchrotron facilities, with X-ray diffraction mapping growing in popularity as a mechanism for localization. In X-ray raster scanning, diffraction is used to identify the crystal positions based on the detection of Bragg-like peaks in the scattering patterns; however, this additional X-ray exposure may result in detectable damage to the crystal prior to data collection. Dynamic sampling, in which preceding measurements inform the next most information-rich location to probe for image reconstruction,more » significantly reduced the X-ray dose experienced by protein crystals during positioning by diffraction raster scanning. The SLADS algorithm implemented herein is designed for single-pixel measurements and can select a new location to measure. In each step of SLADS, the algorithm selects the pixel, which, when measured, maximizes the expected reduction in distortion given previous measurements. Ground-truth diffraction data were obtained for a 5 µm-diameter beam and SLADS reconstructed the image sampling 31% of the total volume and only 9% of the interior of the crystal greatly reducing the X-ray dosage on the crystal. Furthermore, by usingin situtwo-photon-excited fluorescence microscopy measurements as a surrogate for diffraction imaging with a 1 µm-diameter beam, the SLADS algorithm enabled image reconstruction from a 7% sampling of the total volume and 12% sampling of the interior of the crystal. When implemented into the beamline at Argonne National Laboratory, without ground-truth images, an acceptable reconstruction was obtained with 3% of the image sampled and approximately 5% of the crystal. The incorporation of SLADS into X-ray diffraction acquisitions has the potential to significantly minimize the impact of X-ray exposure on the crystal by limiting the dose and area exposed for image reconstruction and crystal positioning using data collection hardware present in most macromolecular crystallography end-stations.« less

Dynamic X-ray diffraction sampling for protein crystal positioning

DOE PAGES

Scarborough, Nicole M.; Godaliyadda, G. M. Dilshan P.; Ye, Dong Hye; ...

2017-01-01

A sparse supervised learning approach for dynamic sampling (SLADS) is described for dose reduction in diffraction-based protein crystal positioning. Crystal centering is typically a prerequisite for macromolecular diffraction at synchrotron facilities, with X-ray diffraction mapping growing in popularity as a mechanism for localization. In X-ray raster scanning, diffraction is used to identify the crystal positions based on the detection of Bragg-like peaks in the scattering patterns; however, this additional X-ray exposure may result in detectable damage to the crystal prior to data collection. Dynamic sampling, in which preceding measurements inform the next most information-rich location to probe for image reconstruction,more » significantly reduced the X-ray dose experienced by protein crystals during positioning by diffraction raster scanning. The SLADS algorithm implemented herein is designed for single-pixel measurements and can select a new location to measure. In each step of SLADS, the algorithm selects the pixel, which, when measured, maximizes the expected reduction in distortion given previous measurements. Ground-truth diffraction data were obtained for a 5 µm-diameter beam and SLADS reconstructed the image sampling 31% of the total volume and only 9% of the interior of the crystal greatly reducing the X-ray dosage on the crystal. Furthermore, by usingin situtwo-photon-excited fluorescence microscopy measurements as a surrogate for diffraction imaging with a 1 µm-diameter beam, the SLADS algorithm enabled image reconstruction from a 7% sampling of the total volume and 12% sampling of the interior of the crystal. When implemented into the beamline at Argonne National Laboratory, without ground-truth images, an acceptable reconstruction was obtained with 3% of the image sampled and approximately 5% of the crystal. The incorporation of SLADS into X-ray diffraction acquisitions has the potential to significantly minimize the impact of X-ray exposure on the crystal by limiting the dose and area exposed for image reconstruction and crystal positioning using data collection hardware present in most macromolecular crystallography end-stations.« less

Dynamic X-ray diffraction sampling for protein crystal positioning

PubMed Central

Scarborough, Nicole M.; Godaliyadda, G. M. Dilshan P.; Ye, Dong Hye; Kissick, David J.; Zhang, Shijie; Newman, Justin A.; Sheedlo, Michael J.; Chowdhury, Azhad U.; Fischetti, Robert F.; Das, Chittaranjan; Buzzard, Gregery T.; Bouman, Charles A.; Simpson, Garth J.

2017-01-01

A sparse supervised learning approach for dynamic sampling (SLADS) is described for dose reduction in diffraction-based protein crystal positioning. Crystal centering is typically a prerequisite for macromolecular diffraction at synchrotron facilities, with X-ray diffraction mapping growing in popularity as a mechanism for localization. In X-ray raster scanning, diffraction is used to identify the crystal positions based on the detection of Bragg-like peaks in the scattering patterns; however, this additional X-ray exposure may result in detectable damage to the crystal prior to data collection. Dynamic sampling, in which preceding measurements inform the next most information-rich location to probe for image reconstruction, significantly reduced the X-ray dose experienced by protein crystals during positioning by diffraction raster scanning. The SLADS algorithm implemented herein is designed for single-pixel measurements and can select a new location to measure. In each step of SLADS, the algorithm selects the pixel, which, when measured, maximizes the expected reduction in distortion given previous measurements. Ground-truth diffraction data were obtained for a 5 µm-diameter beam and SLADS reconstructed the image sampling 31% of the total volume and only 9% of the interior of the crystal greatly reducing the X-ray dosage on the crystal. Using in situ two-photon-excited fluorescence microscopy measurements as a surrogate for diffraction imaging with a 1 µm-diameter beam, the SLADS algorithm enabled image reconstruction from a 7% sampling of the total volume and 12% sampling of the interior of the crystal. When implemented into the beamline at Argonne National Laboratory, without ground-truth images, an acceptable reconstruction was obtained with 3% of the image sampled and approximately 5% of the crystal. The incorporation of SLADS into X-ray diffraction acquisitions has the potential to significantly minimize the impact of X-ray exposure on the crystal by limiting the dose and area exposed for image reconstruction and crystal positioning using data collection hardware present in most macromolecular crystallography end-stations. PMID:28009558

Dynamic X-ray diffraction sampling for protein crystal positioning.

PubMed

Scarborough, Nicole M; Godaliyadda, G M Dilshan P; Ye, Dong Hye; Kissick, David J; Zhang, Shijie; Newman, Justin A; Sheedlo, Michael J; Chowdhury, Azhad U; Fischetti, Robert F; Das, Chittaranjan; Buzzard, Gregery T; Bouman, Charles A; Simpson, Garth J

2017-01-01

A sparse supervised learning approach for dynamic sampling (SLADS) is described for dose reduction in diffraction-based protein crystal positioning. Crystal centering is typically a prerequisite for macromolecular diffraction at synchrotron facilities, with X-ray diffraction mapping growing in popularity as a mechanism for localization. In X-ray raster scanning, diffraction is used to identify the crystal positions based on the detection of Bragg-like peaks in the scattering patterns; however, this additional X-ray exposure may result in detectable damage to the crystal prior to data collection. Dynamic sampling, in which preceding measurements inform the next most information-rich location to probe for image reconstruction, significantly reduced the X-ray dose experienced by protein crystals during positioning by diffraction raster scanning. The SLADS algorithm implemented herein is designed for single-pixel measurements and can select a new location to measure. In each step of SLADS, the algorithm selects the pixel, which, when measured, maximizes the expected reduction in distortion given previous measurements. Ground-truth diffraction data were obtained for a 5 µm-diameter beam and SLADS reconstructed the image sampling 31% of the total volume and only 9% of the interior of the crystal greatly reducing the X-ray dosage on the crystal. Using in situ two-photon-excited fluorescence microscopy measurements as a surrogate for diffraction imaging with a 1 µm-diameter beam, the SLADS algorithm enabled image reconstruction from a 7% sampling of the total volume and 12% sampling of the interior of the crystal. When implemented into the beamline at Argonne National Laboratory, without ground-truth images, an acceptable reconstruction was obtained with 3% of the image sampled and approximately 5% of the crystal. The incorporation of SLADS into X-ray diffraction acquisitions has the potential to significantly minimize the impact of X-ray exposure on the crystal by limiting the dose and area exposed for image reconstruction and crystal positioning using data collection hardware present in most macromolecular crystallography end-stations.

Controlled In Meso Phase Crystallization – A Method for the Structural Investigation of Membrane Proteins

PubMed Central

Kubicek, Jan; Schlesinger, Ramona; Baeken, Christian; Büldt, Georg; Schäfer, Frank; Labahn, Jörg

2012-01-01

We investigated in meso crystallization of membrane proteins to develop a fast screening technology which combines features of the well established classical vapor diffusion experiment with the batch meso phase crystallization, but without premixing of protein and monoolein. It inherits the advantages of both methods, namely (i) the stabilization of membrane proteins in the meso phase, (ii) the control of hydration level and additive concentration by vapor diffusion. The new technology (iii) significantly simplifies in meso crystallization experiments and allows the use of standard liquid handling robots suitable for 96 well formats. CIMP crystallization furthermore allows (iv) direct monitoring of phase transformation and crystallization events. Bacteriorhodopsin (BR) crystals of high quality and diffraction up to 1.3 Å resolution have been obtained in this approach. CIMP and the developed consumables and protocols have been successfully applied to obtain crystals of sensory rhodopsin II (SRII) from Halobacterium salinarum for the first time. PMID:22536388

Inorganic pyrophosphatase crystals from Thermococcus thioreducens for X-ray and neutron diffraction.

PubMed

Hughes, Ronny C; Coates, Leighton; Blakeley, Matthew P; Tomanicek, Steve J; Langan, Paul; Kovalevsky, Andrey Y; García-Ruiz, Juan M; Ng, Joseph D

2012-12-01

Inorganic pyrophosphatase (IPPase) from the archaeon Thermococcus thioreducens was cloned, overexpressed in Escherichia coli, purified and crystallized in restricted geometry, resulting in large crystal volumes exceeding 5 mm3. IPPase is thermally stable and is able to resist denaturation at temperatures above 348 K. Owing to the high temperature tolerance of the enzyme, the protein was amenable to room-temperature manipulation at the level of protein preparation, crystallization and X-ray and neutron diffraction analyses. A complete synchrotron X-ray diffraction data set to 1.85 Å resolution was collected at room temperature from a single crystal of IPPase (monoclinic space group C2, unit-cell parameters a=106.11, b=95.46, c=113.68 Å, α=γ=90.0, β=98.12°). As large-volume crystals of IPPase can be obtained, preliminary neutron diffraction tests were undertaken. Consequently, Laue diffraction images were obtained, with reflections observed to 2.1 Å resolution with I/σ(I) greater than 2.5. The preliminary crystallographic results reported here set in place future structure-function and mechanism studies of IPPase.

Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

2016-11-30

A tetrahydrofolate-dependentO-demethylase, LigM, fromSphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtainedP3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding usingP3 121/P3 221 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space groupP2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c= 128.1 Å. TheP2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing the cryoconditions. Phasing using the single anomalous diffractionmore » method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

Perfectly Cold Crystals: What Happens When They Are X-rayed?

NASA Technical Reports Server (NTRS)

vanderWoerd, Mark; Ferree, Darren S.; Snell, Edward H.

2003-01-01

For many macromolecular crystals the cryo-preservation of these crystals during X-ray data collection is of crucial importance, particularly at synchrotron facilities where the crystals rapidly receive a high dose of radiation. A practical variable to ensure adequate preservation is the variation of the cryo-protectant present when the crystal is preserved. Our initial approach to study X-ray diffraction data quality as a function of cryo-protectant present when preserving a xylose isomerase crystal shows that the data quality can be tremendously improved by recipe adjustment. Guided by crystal mosaicity estimates, we optimized crystal growth conditions to obtain cryo-preserved xylose isomerase crystals that withstand a very high dose of X-rays, with only the smallest amount of radiation damage at ultra-high resolution (1.2Angstroms). The rate at which damage occurs allowed us to collect a series of complete data sets, which show how the data degradation proceeds over time. We are here presenting data for the xylose isomerase crystallization recipe improvement and our interpretation of the crystal degradation process during X-ray data collection.

Fixed target matrix for femtosecond time-resolved and in situ serial micro-crystallography

PubMed Central

Mueller, C.; Marx, A.; Epp, S. W.; Zhong, Y.; Kuo, A.; Balo, A. R.; Soman, J.; Schotte, F.; Lemke, H. T.; Owen, R. L.; Pai, E. F.; Pearson, A. R.; Olson, J. S.; Anfinrud, P. A.; Ernst, O. P.; Dwayne Miller, R. J.

2015-01-01

We present a crystallography chip enabling in situ room temperature crystallography at microfocus synchrotron beamlines and X-ray free-electron laser (X-FEL) sources. Compared to other in situ approaches, we observe extremely low background and high diffraction data quality. The chip design is robust and allows fast and efficient loading of thousands of small crystals. The ability to load a large number of protein crystals, at room temperature and with high efficiency, into prescribed positions enables high throughput automated serial crystallography with microfocus synchrotron beamlines. In addition, we demonstrate the application of this chip for femtosecond time-resolved serial crystallography at the Linac Coherent Light Source (LCLS, Menlo Park, California, USA). The chip concept enables multiple images to be acquired from each crystal, allowing differential detection of changes in diffraction intensities in order to obtain high signal-to-noise and fully exploit the time resolution capabilities of XFELs. PMID:26798825

Fixed target matrix for femtosecond time-resolved and in situ serial micro-crystallography.

PubMed

Mueller, C; Marx, A; Epp, S W; Zhong, Y; Kuo, A; Balo, A R; Soman, J; Schotte, F; Lemke, H T; Owen, R L; Pai, E F; Pearson, A R; Olson, J S; Anfinrud, P A; Ernst, O P; Dwayne Miller, R J

2015-09-01

We present a crystallography chip enabling in situ room temperature crystallography at microfocus synchrotron beamlines and X-ray free-electron laser (X-FEL) sources. Compared to other in situ approaches, we observe extremely low background and high diffraction data quality. The chip design is robust and allows fast and efficient loading of thousands of small crystals. The ability to load a large number of protein crystals, at room temperature and with high efficiency, into prescribed positions enables high throughput automated serial crystallography with microfocus synchrotron beamlines. In addition, we demonstrate the application of this chip for femtosecond time-resolved serial crystallography at the Linac Coherent Light Source (LCLS, Menlo Park, California, USA). The chip concept enables multiple images to be acquired from each crystal, allowing differential detection of changes in diffraction intensities in order to obtain high signal-to-noise and fully exploit the time resolution capabilities of XFELs.

Crystallization of the photosystem II core complex and its chlorophyll binding subunit CP43 from transplastomic plants of Nicotiana tabacum.

PubMed

Piano, Dario; El Alaoui, Sabah; Korza, Henryk J; Filipek, Renata; Sabala, Izabela; Haniewicz, Patrycja; Buechel, Claudia; De Sanctis, Daniele; Bochtler, Matthias

2010-12-01

Photosystem II from transplastomic plants of Nicotiana tabacum with a hexahistidine tag at the N-terminal end of the PsbE subunit (α-chain of the cytochrome b(559)) was purified according to the protocol of Fey et al. (BBA 12:1501-1509, 2008). The protein sample was then subjected to two additional gel filtration runs in order to increase its homogeneity and to standardize the amount of detergent. Large three dimensional crystals of the core complex were obtained. Crystals of one of its chlorophyll binding subunits (CP43) in isolation grew in very similar conditions that differed only in the concentration of the detergent. Diffraction of Photosystem II and CP43 crystals at various synchrotron beamlines was limited to a resolution of 7 and 14 Å, respectively. In both cases the diffraction quality was insufficient for an unambiguous assignment of the crystallographic lattice or space group.

Growth and characterization of β-Ga2O3 crystals

NASA Astrophysics Data System (ADS)

Nikolaev, V. I.; Maslov, V.; Stepanov, S. I.; Pechnikov, A. I.; Krymov, V.; Nikitina, I. P.; Guzilova, L. I.; Bougrov, V. E.; Romanov, A. E.

2017-01-01

Here we report on the growth and characterization of β-Ga2O3 bulk crystals and polycrystalline layer on different substrates. Bulk β-Ga2O3 crystals were produced by free crystallisation of gallium oxide melt in sapphire crucible. Transparent single crystals measuring up to 8 mm across were obtained. Good structural quality was confirmed by x-ray diffraction rocking curve FWHM values of 46″. Young's modulus, shear modulus and hardness of the β-Ga2O3 crystals were measured by nanoindentation and Vickers microindentation techniques. Polycrystalline β-Ga2O3 films were deposited on silicon and sapphire substrates by sublimation method. It was found that structure and morphology of the films were greatly influenced by the material and orientation of the substrates. The best results were achieved on a-plane sapphire substrates where predominantly (111) oriented films were obtained.

Crystallization, X-ray diffraction analysis and SIRAS/molecular-replacenent phasing of three crystal forms of Anabaena sensory rhodopsin transducer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vogeley, Lutz; Luecke, Hartmut, E-mail: hudel@uci.edu

2006-04-01

Crystals of Anabaena sensory rhodopsin transducer, the transducer for the cyanobacterial photosensor Anabaena sensory rhodopsin, obtained in the space groups P4, C2 and P2{sub 1}2{sub 1}2{sub 1} diffract to 1.8, 2.1 and 2.0 Å, respectively. Phases for these crystal forms were obtained by SIRAS phasing using an iodide quick-soak derivative (P4) and molecular replacement (C2 and P2{sub 1}2{sub 1}2{sub 1}). Anabaena sensory rhodopsin transducer (ASRT) is a 14.7 kDa soluble signaling protein associated with the membrane-embedded light receptor Anabaena sensory rhodopsin (ASR) from Anabaena sp., a freshwater cyanobacterium. Crystals of ASRT were obtained in three different space groups, P4, C2more » and P2{sub 1}2{sub 1}2{sub 1}, which diffract to 1.8, 2.1 and 2.0 Å, respectively. Phases for one of these crystal forms (P4) were obtained by SIRAS phasing using an iodide quick-soak derivative and a partial model was built. Phases for the remaining crystal forms were obtained by molecular replacement using the partial model from the P4 crystal form.« less

Crystallization and preliminary crystallographic analysis of latent, active and recombinantly expressed aurone synthase, a polyphenol oxidase, from Coreopsis grandiflora

DOE Office of Scientific and Technical Information (OSTI.GOV)

Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette, E-mail: annette.rompel@univie.ac.at

2015-05-22

Latent and active aurone synthase purified from petals of C. grandiflora (cgAUS1) were crystallized. The crystal quality of recombinantly expressed latent cgAUS1 was significantly improved by co-crystallization with the polyoxotungstate Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase-separation zone. Aurone synthase (AUS), a member of a novel group of plant polyphenol oxidases (PPOs), catalyzes the oxidative conversion of chalcones to aurones. Two active cgAUS1 (41.6 kDa) forms that differed in the level of phosphorylation or sulfation as well as the latent precursor form (58.9 kDa) were purified from the petals of Coreopsis grandiflora. The differing active cgAUS1 forms and themore » latent cgAUS1 as well as recombinantly expressed latent cgAUS1 were crystallized, resulting in six different crystal forms. The active forms crystallized in space groups P2{sub 1}2{sub 1}2{sub 1} and P12{sub 1}1 and diffracted to ∼1.65 Å resolution. Co-crystallization of active cgAUS1 with 1,4-resorcinol led to crystals belonging to space group P3{sub 1}21. The crystals of latent cgAUS1 belonged to space group P12{sub 1}1 and diffracted to 2.50 Å resolution. Co-crystallization of recombinantly expressed pro-AUS with the hexatungstotellurate(VI) salt Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase separation zone significantly improved the quality of the crystals compared with crystals obtained without hexatungstotellurate(VI)« less

Novel diamond cells for neutron diffraction using multi-carat CVD anvils.

PubMed

Boehler, R; Molaison, J J; Haberl, B

2017-08-01

Traditionally, neutron diffraction at high pressure has been severely limited in pressure because low neutron flux required large sample volumes and therefore large volume presses. At the high-flux Spallation Neutron Source at the Oak Ridge National Laboratory, we have developed new, large-volume diamond anvil cells for neutron diffraction. The main features of these cells are multi-carat, single crystal chemical vapor deposition diamonds, very large diffraction apertures, and gas membranes to accommodate pressure stability, especially upon cooling. A new cell has been tested for diffraction up to 40 GPa with an unprecedented sample volume of ∼0.15 mm 3 . High quality spectra were obtained in 1 h for crystalline Ni and in ∼8 h for disordered glassy carbon. These new techniques will open the way for routine megabar neutron diffraction experiments.

Study of Fluid Flow Control in Protein Crystallization using Strong Magnetic Fields

NASA Astrophysics Data System (ADS)

Ramachandran, Narayanan; Leslie, Fred; Ciszak, Ewa

2002-11-01

An important component in biotechnology, particularly in the area of protein engineering and rational drug design is the knowledge of the precise three-dimensional molecular structure of proteins. The quality of structural information obtained from X-ray diffraction methods is directly dependent on the degree of perfection of the protein crystals. As a consequence, the growth of high quality macromolecular crystals for diffraction analyses has been the central focus for biochemists, biologists, and bioengineers. Macromolecular crystals are obtained from solutions that contain the crystallizing species in equilibrium with higher aggregates, ions, precipitants, other possible phases of the protein, foreign particles, the walls of the container, and a likely host of other impurities. By changing transport modes in general, i.e., reduction of convection and sedimentation, as is achieved in "microgravity", researchers have been able to dramatically affect the movement and distribution of macromolecules in the fluid, and thus their transport, formation of crystal nuclei, and adsorption to the crystal surface. While a limited number of high quality crystals from space flights have been obtained, as the recent National Research Council (NRC) review of the NASA microgravity crystallization program pointed out, the scientific approach and research in crystallization of proteins has been mainly empirical yielding inconclusive results. We postulate that we can reduce convection in ground-based experiments and we can understand the different aspects of convection control through the use of strong magnetic fields and field gradients. Whether this limited convection in a magnetic field will provide the environment for the growth of high quality crystals is still a matter of conjecture that our research will address. The approach exploits the variation of fluid magnetic susceptibility with concentration for this purpose and the convective damping is realized by appropriately positioning the crystal growth cell so that the magnetic susceptibility force counteracts terrestrial gravity. The general objective is to test the hypothesis of convective control using a strong magnetic field and magnetic field gradient and to understand the nature of the various forces that come into play. Specifically we aim to delineate causative factors and to quantify them through experiments, analysis and numerical modeling. Once the basic understanding is obtained, the study will focus on testing the hypothesis on proteins of pyruvate dehydrogenase complex (PDC), proteins E1 and E3. Obtaining high crystal quality of these proteins is of great importance to structural biologists since their structures need to be determined. Specific goals for the investigation are: 1. To develop an understanding of convection control in diamagnetic fluids with concentration gradients through experimentation and numerical modeling. Specifically solutal buoyancy driven convection due to crystal growth will be considered. 2. To develop predictive measures for successful crystallization in a magnetic field using analyses and numerical modeling for use in future protein crystal growth experiments. This will establish criteria that can be used to estimate the efficacy of magnetic field flow damping on crystallization of candidate proteins. 3. To demonstrate the understanding of convection damping by high magnetic fields to a class of proteins that is of interest and whose structure is as yet not determined. 4. To compare quantitatively, the quality of the grown crystals with and without a magnetic field. X-ray diffraction techniques will be used for the comparative studies. In a preliminary set of experiments, we studied crystal dissolution effects in a 5 Tesla magnet available at NASA Marshall Space Flight Center (MSFC). Using a Schlieren setup, a 1mm crystal of Alum (Aluminum-Potassium Sulfate) was introduced in a 75% saturated solution and the resulting dissolution plume was observed. The experiment was conducted both in the presence and absence of a magnetic field gradient. The magnet produces a gradient field of approx. 1 Tesla2/cm. Image analysis of the recorded images indicated an enhanced plume velocity that was of the order of the measurement limit. For this experiment, both the gradient and gravity fields are in the same direction resulting in an enhanced effective gravity that tends to accelerate the observed plume velocity. While the results are not conclusive, pending further tests, it clearly points out the inadequacy of the MSFC magnet for conducting protein crystallization experiments and the need for a stronger magnet. In spacebased experiments, however, where the gravitational effects are small, only a weak magnetic field will be required to control or mitigate the effects of convective contamination.

Study of Fluid Flow Control in Protein Crystallization using Strong Magnetic Fields

NASA Technical Reports Server (NTRS)

Ramachandran, Narayanan; Leslie, Fred; Ciszak, Ewa

2002-01-01

An important component in biotechnology, particularly in the area of protein engineering and rational drug design is the knowledge of the precise three-dimensional molecular structure of proteins. The quality of structural information obtained from X-ray diffraction methods is directly dependent on the degree of perfection of the protein crystals. As a consequence, the growth of high quality macromolecular crystals for diffraction analyses has been the central focus for biochemists, biologists, and bioengineers. Macromolecular crystals are obtained from solutions that contain the crystallizing species in equilibrium with higher aggregates, ions, precipitants, other possible phases of the protein, foreign particles, the walls of the container, and a likely host of other impurities. By changing transport modes in general, i.e., reduction of convection and sedimentation, as is achieved in "microgravity", researchers have been able to dramatically affect the movement and distribution of macromolecules in the fluid, and thus their transport, formation of crystal nuclei, and adsorption to the crystal surface. While a limited number of high quality crystals from space flights have been obtained, as the recent National Research Council (NRC) review of the NASA microgravity crystallization program pointed out, the scientific approach and research in crystallization of proteins has been mainly empirical yielding inconclusive results. We postulate that we can reduce convection in ground-based experiments and we can understand the different aspects of convection control through the use of strong magnetic fields and field gradients. Whether this limited convection in a magnetic field will provide the environment for the growth of high quality crystals is still a matter of conjecture that our research will address. The approach exploits the variation of fluid magnetic susceptibility with concentration for this purpose and the convective damping is realized by appropriately positioning the crystal growth cell so that the magnetic susceptibility force counteracts terrestrial gravity. The general objective is to test the hypothesis of convective control using a strong magnetic field and magnetic field gradient and to understand the nature of the various forces that come into play. Specifically we aim to delineate causative factors and to quantify them through experiments, analysis and numerical modeling. Once the basic understanding is obtained, the study will focus on testing the hypothesis on proteins of pyruvate dehydrogenase complex (PDC), proteins E1 and E3. Obtaining high crystal quality of these proteins is of great importance to structural biologists since their structures need to be determined. Specific goals for the investigation are: 1. To develop an understanding of convection control in diamagnetic fluids with concentration gradients through experimentation and numerical modeling. Specifically solutal buoyancy driven convection due to crystal growth will be considered. 2. To develop predictive measures for successful crystallization in a magnetic field using analyses and numerical modeling for use in future protein crystal growth experiments. This will establish criteria that can be used to estimate the efficacy of magnetic field flow damping on crystallization of candidate proteins. 3. To demonstrate the understanding of convection damping by high magnetic fields to a class of proteins that is of interest and whose structure is as yet not determined. 4. To compare quantitatively, the quality of the grown crystals with and without a magnetic field. X-ray diffraction techniques will be used for the comparative studies. In a preliminary set of experiments, we studied crystal dissolution effects in a 5 Tesla magnet available at NASA Marshall Space Flight Center (MSFC). Using a Schlieren setup, a 1mm crystal of Alum (Aluminum-Potassium Sulfate) was introduced in a 75% saturated solution and the resulting dissolution plume was observed. The experiment was conducted both in the presence and absence of a magnetic field gradient. The magnet produces a gradient field of approx. 1 Tesla2/cm. Image analysis of the recorded images indicated an enhanced plume velocity that was of the order of the measurement limit. For this experiment, both the gradient and gravity fields are in the same direction resulting in an enhanced effective gravity that tends to accelerate the observed plume velocity. While the results are not conclusive, pending further tests, it clearly points out the inadequacy of the MSFC magnet for conducting protein crystallization experiments and the need for a stronger magnet. In spacebased experiments, however, where the gravitational effects are small, only a weak magnetic field will be required to control or mitigate the effects of convective contamination.

Solvent minimization induces preferential orientation and crystal clustering in serial micro-crystallography on micro-meshes, in situ plates and on a movable crystal conveyor belt

DOE Office of Scientific and Technical Information (OSTI.GOV)

Soares, Alexei S.; Mullen, Jeffrey D.; Parekh, Ruchi M.

X-ray diffraction data were obtained at the National Synchrotron Light Source from insulin and lysozyme crystals that were densely deposited on three types of surfaces suitable for serial micro-crystallography: MiTeGen MicroMeshes™, Greiner Bio-One Ltdin situmicro-plates, and a moving kapton crystal conveyor belt that is used to deliver crystals directly into the X-ray beam. 6° wedges of data were taken from ~100 crystals mounted on each material, and these individual data sets were merged to form nine complete data sets (six from insulin crystals and three from lysozyme crystals). Insulin crystals have a parallelepiped habit with an extended flat face thatmore » preferentially aligned with the mounting surfaces, impacting the data collection strategy and the design of the serial crystallography apparatus. Lysozyme crystals had a cuboidal habit and showed no preferential orientation. Preferential orientation occluded regions of reciprocal space when the X-ray beam was incident normal to the data-collection medium surface, requiring a second pass of data collection with the apparatus inclined away from the orthogonal. In addition, crystals measuring less than 20 µm were observed to clump together into clusters of crystals. Clustering required that the X-ray beam be adjusted to match the crystal size to prevent overlapping diffraction patterns. No additional problems were encountered with the serial crystallography strategy of combining small randomly oriented wedges of data from a large number of specimens. Lastly, high-quality data able to support a realistic molecular replacement solution were readily obtained from both crystal types using all three serial crystallography strategies.« less

Solvent minimization induces preferential orientation and crystal clustering in serial micro-crystallography on micro-meshes, in situ plates and on a movable crystal conveyor belt.

PubMed

Soares, Alexei S; Mullen, Jeffrey D; Parekh, Ruchi M; McCarthy, Grace S; Roessler, Christian G; Jackimowicz, Rick; Skinner, John M; Orville, Allen M; Allaire, Marc; Sweet, Robert M

2014-11-01

X-ray diffraction data were obtained at the National Synchrotron Light Source from insulin and lysozyme crystals that were densely deposited on three types of surfaces suitable for serial micro-crystallography: MiTeGen MicroMeshes™, Greiner Bio-One Ltd in situ micro-plates, and a moving kapton crystal conveyor belt that is used to deliver crystals directly into the X-ray beam. 6° wedges of data were taken from ∼100 crystals mounted on each material, and these individual data sets were merged to form nine complete data sets (six from insulin crystals and three from lysozyme crystals). Insulin crystals have a parallelepiped habit with an extended flat face that preferentially aligned with the mounting surfaces, impacting the data collection strategy and the design of the serial crystallography apparatus. Lysozyme crystals had a cuboidal habit and showed no preferential orientation. Preferential orientation occluded regions of reciprocal space when the X-ray beam was incident normal to the data-collection medium surface, requiring a second pass of data collection with the apparatus inclined away from the orthogonal. In addition, crystals measuring less than 20 µm were observed to clump together into clusters of crystals. Clustering required that the X-ray beam be adjusted to match the crystal size to prevent overlapping diffraction patterns. No additional problems were encountered with the serial crystallography strategy of combining small randomly oriented wedges of data from a large number of specimens. High-quality data able to support a realistic molecular replacement solution were readily obtained from both crystal types using all three serial crystallography strategies.

Solvent minimization induces preferential orientation and crystal clustering in serial micro-crystallography on micro-meshes, in situ plates and on a movable crystal conveyor belt

DOE PAGES

Soares, Alexei S.; Mullen, Jeffrey D.; Parekh, Ruchi M.; ...

2014-10-09

X-ray diffraction data were obtained at the National Synchrotron Light Source from insulin and lysozyme crystals that were densely deposited on three types of surfaces suitable for serial micro-crystallography: MiTeGen MicroMeshes™, Greiner Bio-One Ltdin situmicro-plates, and a moving kapton crystal conveyor belt that is used to deliver crystals directly into the X-ray beam. 6° wedges of data were taken from ~100 crystals mounted on each material, and these individual data sets were merged to form nine complete data sets (six from insulin crystals and three from lysozyme crystals). Insulin crystals have a parallelepiped habit with an extended flat face thatmore » preferentially aligned with the mounting surfaces, impacting the data collection strategy and the design of the serial crystallography apparatus. Lysozyme crystals had a cuboidal habit and showed no preferential orientation. Preferential orientation occluded regions of reciprocal space when the X-ray beam was incident normal to the data-collection medium surface, requiring a second pass of data collection with the apparatus inclined away from the orthogonal. In addition, crystals measuring less than 20 µm were observed to clump together into clusters of crystals. Clustering required that the X-ray beam be adjusted to match the crystal size to prevent overlapping diffraction patterns. No additional problems were encountered with the serial crystallography strategy of combining small randomly oriented wedges of data from a large number of specimens. Lastly, high-quality data able to support a realistic molecular replacement solution were readily obtained from both crystal types using all three serial crystallography strategies.« less

Solvent minimization induces preferential orientation and crystal clustering in serial micro-crystallography on micro-meshes, in situ plates and on a movable crystal conveyor belt

PubMed Central

Soares, Alexei S.; Mullen, Jeffrey D.; Parekh, Ruchi M.; McCarthy, Grace S.; Roessler, Christian G.; Jackimowicz, Rick; Skinner, John M.; Orville, Allen M.; Allaire, Marc; Sweet, Robert M.

2014-01-01

X-ray diffraction data were obtained at the National Synchrotron Light Source from insulin and lysozyme crystals that were densely deposited on three types of surfaces suitable for serial micro-crystallography: MiTeGen MicroMeshes™, Greiner Bio-One Ltd in situ micro-plates, and a moving kapton crystal conveyor belt that is used to deliver crystals directly into the X-ray beam. 6° wedges of data were taken from ∼100 crystals mounted on each material, and these individual data sets were merged to form nine complete data sets (six from insulin crystals and three from lysozyme crystals). Insulin crystals have a parallelepiped habit with an extended flat face that preferentially aligned with the mounting surfaces, impacting the data collection strategy and the design of the serial crystallography apparatus. Lysozyme crystals had a cuboidal habit and showed no preferential orientation. Preferential orientation occluded regions of reciprocal space when the X-ray beam was incident normal to the data-collection medium surface, requiring a second pass of data collection with the apparatus inclined away from the orthogonal. In addition, crystals measuring less than 20 µm were observed to clump together into clusters of crystals. Clustering required that the X-ray beam be adjusted to match the crystal size to prevent overlapping diffraction patterns. No additional problems were encountered with the serial crystallography strategy of combining small randomly oriented wedges of data from a large number of specimens. High-quality data able to support a realistic molecular replacement solution were readily obtained from both crystal types using all three serial crystallography strategies. PMID:25343789

Collection of X-ray diffraction data from macromolecular crystals

PubMed Central

Dauter, Zbigniew

2017-01-01

Diffraction data acquisition is the final experimental stage of the crystal structure analysis. All subsequent steps involve mainly computer calculations. Optimally measured and accurate data make the structure solution and refinement easier and lead to more faithful interpretation of the final models. Here, the important factors in data collection from macromolecular crystals are discussed and strategies appropriate for various applications, such as molecular replacement, anomalous phasing, atomic-resolution refinement etc., are presented. Criteria useful for judging the diffraction data quality are also discussed. PMID:28573573

Phononic crystal diffraction gratings

NASA Astrophysics Data System (ADS)

Moiseyenko, Rayisa P.; Herbison, Sarah; Declercq, Nico F.; Laude, Vincent

2012-02-01

When a phononic crystal is interrogated by an external source of acoustic waves, there is necessarily a phenomenon of diffraction occurring on the external enclosing surfaces. Indeed, these external surfaces are periodic and the resulting acoustic diffraction grating has a periodicity that depends on the orientation of the phononic crystal. This work presents a combined experimental and theoretical study on the diffraction of bulk ultrasonic waves on the external surfaces of a 2D phononic crystal that consists of a triangular lattice of steel rods in a water matrix. The results of transmission experiments are compared with theoretical band structures obtained with the finite-element method. Angular spectrograms (showing frequency as a function of angle) determined from diffraction experiments are then compared with finite-element simulations of diffraction occurring on the surfaces of the crystal. The experimental results show that the diffraction that occurs on its external surfaces is highly frequency-dependent and has a definite relation with the Bloch modes of the phononic crystal. In particular, a strong influence of the presence of bandgaps and deaf bands on the diffraction efficiency is found. This observation opens perspectives for the design of efficient phononic crystal diffraction gratings.

A new method to evaluate the quality of single crystal Cu by an X-ray diffraction butterfly pattern method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu Zhenming; Guo Zhenqi; Li Jianguo

2004-12-15

A new method for the evaluation of the quality of an Ohno continuous cast (OCC) Cu single crystal by X-ray diffraction (XRD) butterfly pattern was brought forward. Experimental results show that the growth direction of single crystal Cu is inclined from both sides of the single crystal Cu rod to the axis and is axially symmetric. The degree of deviation from the [100] orientation from the crystal axis is less than 5 deg. with a casting speed 10-40 mm/min. The orientation of single crystal Cu does not have a fixed direction but is in a regular range. Moreover, the orientationmore » of stray grains in the single crystal Cu is random from continuous casting.« less

Synchrotron X-ray reciprocal-space mapping, topography and diffraction resolution studies of macromolecular crystal quality.

PubMed

Boggon, T J; Helliwell, J R; Judge, R A; Olczak, A; Siddons, D P; Snell, E H; Stojanoff, V

2000-07-01

A comprehensive study of microgravity and ground-grown chicken egg-white lysozyme crystals is presented using synchrotron X-ray reciprocal-space mapping, topography techniques and diffraction resolution. Microgravity crystals displayed reduced intrinsic mosaicities on average, but no differences in terms of strain over their ground-grown counterparts. Topographic analysis revealed that in the microgravity case the majority of the crystal was contributing to the peak of the reflection at the appropriate Bragg angle. In the ground-control case only a small volume of the crystal contributed to the intensity at the diffraction peak. The techniques prove to be highly complementary, with the reciprocal-space mapping providing a quantitative measure of the crystal mosaicity and strain (or variation in lattice spacing) and the topography providing a qualitative overall assessment of the crystal in terms of its X-ray diffraction properties. Structural data collection was also carried out at the synchrotron.

Purification, crystallization and preliminary X-ray diffraction studies of parakeet (Psittacula krameri) haemoglobin

PubMed Central

Jaimohan, S. M.; Naresh, M. D.; Arumugam, V.; Mandal, A. B.

2009-01-01

Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemo­globins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 Å resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 Å, β = 109.35°. Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit. PMID:19851014

Purification, crystallization and preliminary X-ray diffraction studies of parakeet (Psittacula krameri) haemoglobin.

PubMed

Jaimohan, S M; Naresh, M D; Arumugam, V; Mandal, A B

2009-10-01

Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemoglobins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 A resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 A, beta = 109.35 degrees . Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

Synchrotron X-Ray Reciprocal Space Mapping, Topography and Diffraction Resolution Studies of Macromolecular Crystal Quality

NASA Technical Reports Server (NTRS)

Boggon, T. J.; Helliwell, J. R.; Judge, Russell A.; Siddons, D. P.; Snell, Edward H.; Stojanoff, V.

2000-01-01

A comprehensive study of microgravity and ground grown chicken egg white lysozyme crystals is presented using synchrotron X-ray reciprocal space mapping, topography techniques and diffraction resolution. Microgravity crystals displayed, on average, reduced intrinsic mosaicities but no differences in terms of stress over their earth grown counterparts. Topographic analysis revealed that in the microgravity case the majority of the crystal was contributing to the peak of the reflection at the appropriate Bragg angle. In the earth case at the diffraction peak only a small volume of the crystal contributed to the intensity. The techniques prove to be highly complementary with the reciprocal space mapping providing a quantitative measure of the crystal mosaicity and stress (or variation in lattice spacing) and topography providing a qualitative overall assessment of the crystal in terms of its X-ray diffraction properties. Structural data collection was also carried out both at the synchrotron and in the laboratory.

X-ray characterization of curved crystals for hard x-ray astronomy

NASA Astrophysics Data System (ADS)

Buffagni, Elisa; Bonnini, Elisa; Ferrari, Claudio; Virgilli, Enrico; Frontera, Filippo

2015-05-01

Among the methods to focus photons the diffraction in crystals results as one of the most effective for high energy photons. An assembling of properly oriented crystals can form a lens able to focus x-rays at high energy via Laue diffraction in transmission geometry; this is a Laue lens. The x-ray diffraction theory provides that the maximum diffraction efficiency is achieved in ideal mosaic crystals, but real mosaic crystals show diffraction efficiencies several times lower than the ideal case due to technological problems. An alternative and convenient approach is the use of curved crystals. We have recently optimized an efficient method based on the surface damage of crystals to produce self-standing uniformly curved Si, GaAs and Ge tiles of thickness up to 2-3 mm and curvature radii R down to a few meters. We show that, for curved diffracting planes, such crystals have a diffraction efficiency nearly forty times higher than the diffraction efficiency of perfect similar flat crystals, thus very close to that of ideal mosaic crystals. Moreover, in an alternative configuration where the diffracting planes are perpendicular to the curved ones, a focusing effect occurs and will be shown. These results were obtained for several energies between 17 and 120 keV with lab sources or at high energy facilities such as LARIX at Ferrara (Italy), ESRF at Grenoble (France), and ANKA at Karlsruhe (Germany).

Polymorphism of Alprazolam (Xanax): a review of its crystalline phases and identification, crystallographic characterization, and crystal structure of a new polymorph (form III).

PubMed

de Armas, Héctor Novoa; Peeters, Oswald M; Van den Mooter, Guy; Blaton, Norbert

2007-05-01

A new polymorphic form of Alprazolam (Xanax), 8-chloro-1-methyl-6-phenyl-4H-[1,2,4]triazolo-[4,3-alpha][1,4]benzodiazepine, C(17)H(13)ClN(4), has been investigated by means of X-ray powder diffraction (XRPD), single crystal X-ray diffraction, and differential scanning calorimetry (DSC). This polymorphic form (form III) was obtained during DSC experiments after the exothermic recrystallization of the melt of form I. The crystal unit cell dimensions for form III were determined from diffractometer methods. The monoclinic unit cell found for this polymorph using XRPD after indexing the powder diffractogram was confirmed by the cell parameters obtained from single crystal X-ray diffractometry on a crystal isolated from the DSC pans. The single crystal unit cell parameters are: a = 28.929(9), b = 13.844(8), c = 7.361(3) angstroms, beta = 92.82(3) degrees , V = 2944(2) angstroms(3), Z = 8, space group P2(1) (No.4), Dx = 1.393 Mg/m(3). The structure obtained from single crystal X-ray diffraction was used as initial model for Rietveld refinement on the powder diffraction data of form III. The temperature phase transformations of alprazolam were also studied using high temperature XRPD. A review of the different phases available in the Powder Diffraction File (PDF) database for this drug is described bringing some clarification and corrections. (c) 2007 Wiley-Liss, Inc. and the American Pharmacists Association.

Investigation of Renal Stones by X-ray and Neutron Diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baeva, M.; Boianova, A.; Beskrovnyi, A. I.

2007-04-23

Renal stones were investigated by X-ray diffraction. The obtained results showed only one crystal phase in every sample. With the aim to verify eventual availability of second phase (under 3 volume %) the same renal stones were investigated by neutron diffraction. The neutron spectra proved that additional crystal phase was absent in the renal stones. The obtained results are scientific-practical, in aid of the medicine, especially in the case of renal stone disease.

High-Resolution Protein Structure Determination by Serial Femtosecond Crystallography

PubMed Central

Boutet, Sébastien; Lomb, Lukas; Williams, Garth J.; Barends, Thomas R. M.; Aquila, Andrew; Doak, R. Bruce; Weierstall, Uwe; DePonte, Daniel P.; Steinbrener, Jan; Shoeman, Robert L.; Messerschmidt, Marc; Barty, Anton; White, Thomas A.; Kassemeyer, Stephan; Kirian, Richard A.; Seibert, M. Marvin; Montanez, Paul A.; Kenney, Chris; Herbst, Ryan; Hart, Philip; Pines, Jack; Haller, Gunther; Gruner, Sol M.; Philipp, Hugh T.; Tate, Mark W.; Hromalik, Marianne; Koerner, Lucas J.; van Bakel, Niels; Morse, John; Ghonsalves, Wilfred; Arnlund, David; Bogan, Michael J.; Caleman, Carl; Fromme, Raimund; Hampton, Christina Y.; Hunter, Mark S.; Johansson, Linda C.; Katona, Gergely; Kupitz, Christopher; Liang, Mengning; Martin, Andrew V.; Nass, Karol; Redecke, Lars; Stellato, Francesco; Timneanu, Nicusor; Wang, Dingjie; Zatsepin, Nadia A.; Schafer, Donald; Defever, James; Neutze, Richard; Fromme, Petra; Spence, John C. H.; Chapman, Henry N.; Schlichting, Ilme

2013-01-01

Structure determination of proteins and other macromolecules has historically required the growth of high-quality crystals sufficiently large to diffract x-rays efficiently while withstanding radiation damage. We applied serial femtosecond crystallography (SFX) using an x-ray free-electron laser (XFEL) to obtain high-resolution structural information from microcrystals (less than 1 micrometer by 1 micrometer by 3 micrometers) of the well-characterized model protein lysozyme. The agreement with synchrotron data demonstrates the immediate relevance of SFX for analyzing the structure of the large group of difficult-to-crystallize molecules. PMID:22653729

Strategies for the crystallization of viruses: using phase diagrams and gels to produce 3D crystals of Grapevine fanleaf virus.

PubMed

Schellenberger, Pascale; Demangeat, Gérard; Lemaire, Olivier; Ritzenthaler, Christophe; Bergdoll, Marc; Oliéric, Vincent; Sauter, Claude; Lorber, Bernard

2011-05-01

The small icosahedral plant RNA nepovirus Grapevine fanleaf virus (GFLV) is specifically transmitted by a nematode and causes major damage to vineyards worldwide. To elucidate the molecular mechanisms underlying the recognition between the surface of its protein capsid and cellular components of its vector, host and viral proteins synthesized upon infection, the wild type GFLV strain F13 and a natural mutant (GFLV-TD) carrying a Gly₂₉₇Asp mutation were purified, characterized and crystallized. Subsequently, the geometry and volume of their crystals was optimized by establishing phase diagrams. GFLV-TD was twice as soluble as the parent virus in the crystallization solution and its crystals diffracted X-rays to a resolution of 2.7 Å. The diffraction limit of GFLV-F13 crystals was extended from 5.5 to 3 Å by growth in agarose gel. Preliminary crystallographic analyses indicate that both types of crystals are suitable for structure determination. Keys for the successful production of GFLV crystals include the rigorous quality control of virus preparations, crystal quality improvement using phase diagrams, and crystal lattice reinforcement by growth in agarose gel. These strategies are applicable to the production of well-diffracting crystals of other viruses and macromolecular assemblies. Copyright © 2011 Elsevier Inc. All rights reserved.

Using Two-Dimensional Colloidal Crystals to Understand Crystallography

ERIC Educational Resources Information Center

Bosse, Stephanie A.; Loening, Nikolaus M.

2008-01-01

X-ray crystallography is an essential technique for modern chemistry and biochemistry, but it is infrequently encountered by undergraduate students owing to lack of access to equipment, the time-scale for generating diffraction-quality molecular crystals, and the level of mathematics involved in analyzing the resulting diffraction patterns.…

Crystallization of Mitochondrial Respiratory Complex II from Chicken Heart: a Membrane Protein Complex Diffracting to 2.0 Å.

PubMed Central

Huang, Li-shar; Borders, Toni M.; Shen, John T.; Wang, Chung-Jen; Berry, Edward

2006-01-01

Synopsis A multi-subunit mitochondrial membrane protein complex involved in the Krebs Cycle and respiratory chain has been crystallized in a form suitable for near-atomic resolution structure determination. A procedure is presented for preparation of diffraction-quality crystals of a vertebrate mitochondrial respiratory Complex II. The crystals have the potential to diffract to at least 2.0 Å with optimization of post-crystal-growth treatment and cryoprotection. This should allow determination of the structure of this important and medically relevant membrane protein complex at near-atomic resolution and provide great detail of the mode of binding of substrates and inhibitors at the two substrate-binding sites. PMID:15805592

Novel diamond cells for neutron diffraction using multi-carat CVD anvils

DOE PAGES

Boehler, R.; Molaison, J. J.; Haberl, B.

2017-08-17

Traditionally, neutron diffraction at high pressure has been severely limited in pressure because low neutron flux required large sample volumes and therefore large volume presses. At the high-flux Spallation Neutron Source at the Oak Ridge National Laboratory, we have developed in this paper new, large-volume diamond anvil cells for neutron diffraction. The main features of these cells are multi-carat, single crystal chemical vapor deposition diamonds, very large diffraction apertures, and gas membranes to accommodate pressure stability, especially upon cooling. A new cell has been tested for diffraction up to 40 GPa with an unprecedented sample volume of ~0.15 mm 3.more » High quality spectra were obtained in 1 h for crystalline Ni and in ~8 h for disordered glassy carbon. Finally, these new techniques will open the way for routine megabar neutron diffraction experiments.« less

Diffraction and Imaging Study of Imperfections of Protein Crystals with Coherent X-rays

NASA Technical Reports Server (NTRS)

Hu, Z. W.; Thomas, B. R.; Chernov, A. A.; Chu, Y. S.; Lai, B.

2004-01-01

High angular-resolution x-ray diffraction and phase contrast x-ray imaging were combined to study defects and perfection of protein crystals. Imperfections including line defects, inclusions and other microdefects were observed in the diffraction images of a uniformly grown lysozyme crystal. The observed line defects carry distinct dislocation features running approximately along the <110> growth front and have been found to originate mostly in a central growth area and occasionally in outer growth regions. Slow dehydration led to the broadening of a fairly symmetric 4 4 0 rocking curve by a factor of approximately 2.6, which was primarily attributed to the dehydration-induced microscopic effects that are clearly shown in diffraction images. X-ray imaging and diffraction characterization of the quality of apoferritin crystals will also be discussed in the presentation.

Microgravity

NASA Image and Video Library

2000-05-01

The structure of the Satellite Tobacco Mosaic Viurus (STMV)--one of the smallest viruses known--has been successfully reduced using STMV crystals grown aboard the Space Shuttle in 1992 and 1994. The STMV crystals were up to 30 times the volume of any seen in the laboratory. At the time they gave the best resolution data ever obtained on any virus crystal. STMV is a small icosahedral plant virus, consisting of a protein shell made up of 60 identical protein subunits of molecular weight 17,500. Particularly noteworthy is the fact that, in contrast to the crystals grown on Earth, the crystals grown under microgravity conditions were visually perfect, with no striations or clumping of crystals. Furthermore, the x-ray diffraction data obtained from the space-grown crystals was of a much higher quality than the best data available at that time from ground-based crystals. This stylized ribbon model shows the protein coat in white and the nucleic acid in yellow. STMV is used because it is a simple protein to work with; studies are unrelated to tobacco. Credit: Dr. Alex McPherson, University of California at Irvin.

Microgravity

NASA Image and Video Library

2000-05-01

The structure of the Satellite Tobacco Mosaic Virus (STMV)--one of the smallest viruses known--has been successfully deduced using STMV crystals grown aboard the Space Shuttle in 1992 and 1994. The STMV crystals were up to 30 times the volume of any seen in the laboratory. At the same time they gave the best resolution data ever obtained on any virus crystal. STMV is a small icosahedral plant virus, consisting of a protein shell made up of 60 identical protein subunits of molecular weight 17,500. Particularly noteworthy is the fact that, in contrast to the crystal grown on Earth, the crystals grown under microgravity conditions were viusally perfect, with no striations or clumping of crystals. Furthermore, the X-ray diffraction data obtained from the space-grown crystals was of a much higher quality than the best data available at that time from ground-based crystals. This computer model shows the external coating or capsid. STMV is used because it is a simple protein to work with; studies are unrelated to tobacco. Credit: Dr. Alex McPherson, Univeristy of California at Irvin.

Satellite Tobacco Mosaic Virus (STMV)

NASA Technical Reports Server (NTRS)

2000-01-01

The structure of the Satellite Tobacco Mosaic Virus (STMV)--one of the smallest viruses known--has been successfully deduced using STMV crystals grown aboard the Space Shuttle in 1992 and 1994. The STMV crystals were up to 30 times the volume of any seen in the laboratory. At the same time they gave the best resolution data ever obtained on any virus crystal. STMV is a small icosahedral plant virus, consisting of a protein shell made up of 60 identical protein subunits of molecular weight 17,500. Particularly noteworthy is the fact that, in contrast to the crystal grown on Earth, the crystals grown under microgravity conditions were viusally perfect, with no striations or clumping of crystals. Furthermore, the X-ray diffraction data obtained from the space-grown crystals was of a much higher quality than the best data available at that time from ground-based crystals. This computer model shows the external coating or capsid. STMV is used because it is a simple protein to work with; studies are unrelated to tobacco. Credit: Dr. Alex McPherson, Univeristy of California at Irvin.

Satellite Tobacco Mosaic Virus Structure

NASA Technical Reports Server (NTRS)

2000-01-01

The structure of the Satellite Tobacco Mosaic Viurus (STMV)--one of the smallest viruses known--has been successfully reduced using STMV crystals grown aboard the Space Shuttle in 1992 and 1994. The STMV crystals were up to 30 times the volume of any seen in the laboratory. At the time they gave the best resolution data ever obtained on any virus crystal. STMV is a small icosahedral plant virus, consisting of a protein shell made up of 60 identical protein subunits of molecular weight 17,500. Particularly noteworthy is the fact that, in contrast to the crystals grown on Earth, the crystals grown under microgravity conditions were visually perfect, with no striations or clumping of crystals. Furthermore, the x-ray diffraction data obtained from the space-grown crystals was of a much higher quality than the best data available at that time from ground-based crystals. This stylized ribbon model shows the protein coat in white and the nucleic acid in yellow. STMV is used because it is a simple protein to work with; studies are unrelated to tobacco. Credit: Dr. Alex McPherson, University of California at Irvin.

The MORPHEUS II protein crystallization screen

PubMed Central

Gorrec, Fabrice

2015-01-01

High-quality macromolecular crystals are a prerequisite for the process of protein structure determination by X-ray diffraction. Unfortunately, the relative yield of diffraction-quality crystals from crystallization experiments is often very low. In this context, innovative crystallization screen formulations are continuously being developed. In the past, MORPHEUS, a screen in which each condition integrates a mix of additives selected from the Protein Data Bank, a cryoprotectant and a buffer system, was developed. Here, MORPHEUS II, a follow-up to the original 96-condition initial screen, is described. Reagents were selected to yield crystals when none might be observed in traditional initial screens. Besides, the screen includes heavy atoms for experimental phasing and small polyols to ensure the cryoprotection of crystals. The suitability of the resulting novel conditions is shown by the crystallization of a broad variety of protein samples and their efficiency is compared with commercially available conditions. PMID:26144227

The MORPHEUS II protein crystallization screen.

PubMed

Gorrec, Fabrice

2015-07-01

High-quality macromolecular crystals are a prerequisite for the process of protein structure determination by X-ray diffraction. Unfortunately, the relative yield of diffraction-quality crystals from crystallization experiments is often very low. In this context, innovative crystallization screen formulations are continuously being developed. In the past, MORPHEUS, a screen in which each condition integrates a mix of additives selected from the Protein Data Bank, a cryoprotectant and a buffer system, was developed. Here, MORPHEUS II, a follow-up to the original 96-condition initial screen, is described. Reagents were selected to yield crystals when none might be observed in traditional initial screens. Besides, the screen includes heavy atoms for experimental phasing and small polyols to ensure the cryoprotection of crystals. The suitability of the resulting novel conditions is shown by the crystallization of a broad variety of protein samples and their efficiency is compared with commercially available conditions.

A multi-step strategy to obtain crystals of the dengue virus RNA-dependent RNA polymerase that diffract to high resolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yap, Thai Leong; School of Biological Sciences, Nanyang Technological University, 60 Nanyang Drive, Singapore 637551; Chen, Yen Liang

Crystals of the RNA-dependent RNA polymerase catalytic domain from the dengue virus NS5 protein have been obtained using a strategy that included expression screening of naturally occurring serotype variants of the protein, the addition of divalent metal ions and crystal dehydration. These crystals diffract to 1.85 Å resolution and are thus suitable for a structure-based drug-design program. Dengue virus, a member of the Flaviviridae genus, causes dengue fever, an important emerging disease with several million infections occurring annually for which no effective therapy exists. The viral RNA-dependent RNA polymerase NS5 plays an important role in virus replication and represents anmore » interesting target for the development of specific antiviral compounds. Crystals that diffract to 1.85 Å resolution that are suitable for three-dimensional structure determination and thus for a structure-based drug-design program have been obtained using a strategy that included expression screening of naturally occurring serotype variants of the protein, the addition of divalent metal ions and crystal dehydration.« less

Supercritical carbon dioxide treatment as a method for polymorph preparation of deoxycholic acid.

PubMed

Tozuka, Yuichi; Kawada, Dai; Oguchi, Toshio; Yamamoto, Keiji

2003-09-16

A new polymorph of deoxycholic acid (DCA) was formed by using a supercritical carbon dioxide treatment. Deoxycholic acid crystals were stored in a pressure vessel purged with carbon dioxide at 12MPa, 60 degrees C for definite intervals. After storage for 1h in supercritical carbon dioxide (SC-CO2), new X-ray diffraction (XRD) peaks, not found in the bulk DCA crystal, were observed at 2theta = 7.4 degrees, 9.7 degrees and 14.0 degrees. The intensities of the new diffraction peaks increased with an increase in storage time, whereas the intensities of the diffraction peaks due to bulk DCA crystal decreased. On the DSC curves, the crystals obtained showed an exothermic peak at around 155 degrees C followed by the melting peak of bulk DCA crystal at 175 degrees C. By the temperature-controlled powder XRD measurement, the crystals obtained were found to be a metastable form of DCA. The polymorphs of DCA have not been reported; therefore, the SC-CO2 treatment would be a peculiar method to obtain a DCA polymorph.

Crystallization and preliminary X-ray diffraction studies of the ferredoxin reductase component in the Rieske nonhaem iron oxygenase system carbazole 1,9a-dioxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ashikawa, Yuji; Uchimura, Hiromasa; Fujimoto, Zui

2007-06-01

The NAD(P)H:ferredoxin oxidoreductase in carbazole 1,9a-dioxygenase from Janthinobacterium sp. J3 was crystallized and diffraction data were collected to 2.60 Å resolution. Carbazole 1,9a-dioxygenase (CARDO), which consists of an oxygenase component (CARDO-O) and the electron-transport components ferredoxin (CARDO-F) and ferredoxin reductase (CARDO-R), catalyzes dihydroxylation at the C1 and C9a positions of carbazole. CARDO-R was crystallized at 277 K using the hanging-drop vapour-diffusion method with the precipitant PEG 8000. Two crystal types (types I and II) were obtained. The type I crystal diffracted to a maximum resolution of 2.80 Å and belonged to space group P4{sub 2}2{sub 1}2, with unit-cell parameters amore » = b = 158.7, c = 81.4 Å. The type II crystal was obtained in drops from which type I crystals had been removed; it diffracted to 2.60 Å resolution and belonged to the same space group, with unit-cell parameters a = b = 161.8, c = 79.5 Å.« less

Bulk growth of <001> organic nonlinear optical (NLO) L-arginine 4-nitrophenolate 4-nitrophenol dihydrate (LAPP) single crystals by SR method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pandian, Muthu Senthil, E-mail: senthilpandianm@ssn.edu.in; Sivasubramani, V.; Ramasamy, P.

2015-06-24

A transparent uniaxial L-arginine 4-nitrophenolate 4-nitrophenol dehydrate (LAPP) single crystal having dimension of 20 mm diameter and 45 mm length was grown by Sankaranarayanan-Ramasamy (SR) method with a growth rate of 1 mm per day. Using an identical solution the conventional crystal grown to a dimension of 8×5×5 mm{sup 3} was obtained over a period of 30 days. The crystal structure has been confirmed by single crystal X-ray diffraction measurement. The crystalline perfection of LAPP crystals grown by slow evaporation solution technique (SEST) and SR method were characterized using Vickers microhardness, UV-Vis NIR, chemical etching, dark and photo current measurements. The above study indicatesmore » that the crystal quality of the Sankaranarayanan-Ramasamy (SR) method grown LAPP is good compared to the conventional method grown crystal.« less

Magnetic anisotropy and spin-flop transition of NiWO4 single crystals

NASA Astrophysics Data System (ADS)

Liu, C. B.; He, Z. Z.; Liu, Y. J.; Chen, R.; Shi, M. M.; Zhu, H. P.; Dong, C.; Wang, J. F.

2017-12-01

NiWO4 exhibits a spin chain structure built by magnetic Ni2+ ions, which may be considered as a one dimensional S = 1 system. In this work, large-sized single crystals of NiWO4 were successfully synthesized by a flux method and the crystal quality was confirmed by X-ray diffraction. Magnetic properties of obtained single crystals were studied by means of magnetic susceptibility and high field magnetization along crystallographic axes. The results demonstrate that NiWO4 is highly magnetic anisotropic and possesses a three-dimensional long range ordering below 60 K, where a spin flop transition can be observed at 17.5 T in applied magnetic fields along the magnetic easy axis (c-axis).

Method for detecting a mass density image of an object

DOEpatents

Wernick, Miles N [Chicago, IL; Yang, Yongyi [Westmont, IL

2008-12-23

A method for detecting a mass density image of an object. An x-ray beam is transmitted through the object and a transmitted beam is emitted from the object. The transmitted beam is directed at an angle of incidence upon a crystal analyzer. A diffracted beam is emitted from the crystal analyzer onto a detector and digitized. A first image of the object is detected from the diffracted beam emitted from the crystal analyzer when positioned at a first angular position. A second image of the object is detected from the diffracted beam emitted from the crystal analyzer when positioned at a second angular position. A refraction image is obtained and a regularized mathematical inversion algorithm is applied to the refraction image to obtain a mass density image.

X-ray diffraction imaging (topography) of electroopticcrystals by synchrotron radiation

NASA Technical Reports Server (NTRS)

Steiner, Bruce; Kuriyama, Masao; Dobbyn, Ronald C.; Laor, Uri

1988-01-01

Information of special interest to crystal growers and device physicists now available from monochromatic synchrotron diffraction imaging (topography) is reviewed. Illustrations are taken from a variety of electro-optic crystals. Aspects of the detailed understanding of crystal growth processes obtainable from carefully selected samples are described. Finally, new experimental opportunities now available for exploitation are indicated.

Growth and characterization of diammonium copper disulphate hexahydrate single crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Siva Sankari, R.; Perumal, Rajesh Narayana, E-mail: r.shankarisai@gmail.com

2014-03-01

Graphical abstract: Diammonium copper disulphate hexahydrate (DACS) is one of the most promising inorganic dielectric crystals with exceptional mechanical properties. Good quality crystals of DACS were grown by using solution method in a period of 30 days. The grown crystals were subjected to single crystal X-ray diffraction analysis in order to establish their crystalline nature. Thermo gravimetric, differential thermal analysis, FTIR, and UV–vis–NIR analysis were performed for the crystal. Several solid state physical parameters have been determined for the grown crystals. The dielectric constant and the dielectric loss and AC conductivity of the grown crystal were studied as a functionmore » of frequency and temperature has been calculated and plotted. - Highlights: • Diammonium copper disulphate is grown for the first time and CCDC number obtained. • Thermal analysis is done to see the stability range of the crystals. • Band gap and UV cut off wavelength of the crystal are determined to be 2.4 eV and 472.86 nm, respectively. • Dielectric constant, dielectric loss and AC conductivity are plotted as a function of applied field. - Abstract: Diammonium copper disulphate hexahydrate is one of the most promising inorganic crystals with exceptional dielectric properties. A good quality crystal was harvested in a 30-day period using solution growth method. The grown crystal was subjected to various characterization techniques like single crystal X-ray diffraction analysis, thermo gravimetric, differential thermal analysis, FTIR, and UV–vis–NIR analysis. Unit cell dimensions of the grown crystal have been identified from XRD studies. Functional groups of the title compounds have been identified from FTIR studies. Thermal stability of the samples was checked by TG/DTA studies. Band gap of the crystal was calculated. The dielectric constant and dielectric loss were studied as a function of frequency of the applied field. AC conductivity was plotted as a function of temperature.« less

Improving the diffraction of apoA-IV crystals through extreme dehydration.

PubMed

Deng, Xiaodi; Davidson, W Sean; Thompson, Thomas B

2012-01-01

Apolipoproteins are the protein component of high-density lipoproteins (HDL), which are necessary for mobilizing lipid-like molecules throughout the body. Apolipoproteins undergo self-association, especially at higher concentrations, making them difficult to crystallize. Here, the crystallization and diffraction of the core fragment of apolipoprotein A-IV (apoA-IV), consisting of residues 64-335, is presented. ApoA-IV(64-335) crystallized readily in a variety of hexagonal (P6) morphologies with similar unit-cell parameters, all containing a long axis of nearly 550 Å in length. Preliminary diffraction experiments with the different crystal morphologies all resulted in limited streaky diffraction to 3.5 Å resolution. Crystal dehydration was applied to the different morphologies with variable success and was also used as a quality indicator of crystal-growth conditions. The results show that the morphologies that withstood the most extreme dehydration conditions showed the greatest improvement in diffraction. One morphology in particular was able to withstand dehydration in 60% PEG 3350 for over 12 h, which resulted in well defined intensities to 2.7 Å resolution. These results suggest that the approach of integrating dehydration with variation in crystal-growth conditions might be a general technique to optimize diffraction. © 2012 International Union of Crystallography. All rights reserved.

Femtosecond time-resolved MeV electron diffraction

DOE PAGES

Zhu, Pengfei; Zhu, Y.; Hidaka, Y.; ...

2015-06-02

We report the experimental demonstration of femtosecond electron diffraction using high-brightness MeV electron beams. High-quality, single-shot electron diffraction patterns for both polycrystalline aluminum and single-crystal 1T-TaS 2 are obtained utilizing a 5 fC (~3 × 10 4 electrons) pulse of electrons at 2.8 MeV. The high quality of the electron diffraction patterns confirms that electron beam has a normalized emittance of ~50 nm rad. The transverse and longitudinal coherence length is ~11 and ~2.5 nm, respectively. The timing jitter between the pump laser and probe electron beam was found to be ~100 fs (rms). The temporal resolution is demonstrated bymore » observing the evolution of Bragg and superlattice peaks of 1T-TaS 2 following an 800 nm optical pump and was found to be 130 fs. Lastly, our results demonstrate the advantages of MeV electrons, including large elastic differential scattering cross-section and access to high-order reflections, and the feasibility of ultimately realizing below 10 fs time-resolved electron diffraction.« less

Order and disorder in crystals of hexameric NTPases from dsRNA bacteriophages.

PubMed

Mancini, Erika J; Grimes, Jonathan M; Malby, Robyn; Sutton, Geoffrey C; Kainov, Denis E; Juuti, Jarmo T; Makeyev, Eugene V; Tuma, Roman; Bamford, Dennis H; Stuart, David I

2003-12-01

The packaging of genomic RNA in members of the Cystoviridae is performed by P4, a hexameric protein with NTPase activity. Across family members such as Phi6, Phi8 and Phi13, the P4 proteins show low levels of sequence identity, but presumably have similar atomic structures. Initial structure-determination efforts for P4 from Phi6 and Phi8 were hampered by difficulties in obtaining crystals that gave ordered diffraction. Diffraction from crystals of full-length P4 showed a variety of disorder and anisotropy. Subsequently, crystals of Phi13 P4 were obtained which yielded well ordered diffraction to 1.7 A. Comparison of the packing arrangements of P4 hexamers in different crystal forms and analysis of the disorder provides insights into the flexibility of this family of proteins, which might be an integral part of their biological function.

New methods for indexing multi-lattice diffraction data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gildea, Richard J.; Waterman, David G.; CCP4, Research Complex at Harwell, Rutherford Appleton Laboratory, Didcot OX11 0FA

2014-10-01

A new indexing method is presented which is capable of indexing multiple crystal lattices from narrow wedges of data. The efficacy of this method is demonstrated with both semi-synthetic multi-lattice data and real multi-lattice data recorded from microcrystals of ∼1 µm in size. A new indexing method is presented which is capable of indexing multiple crystal lattices from narrow wedges of diffraction data. The method takes advantage of a simplification of Fourier transform-based methods that is applicable when the unit-cell dimensions are known a priori. The efficacy of this method is demonstrated with both semi-synthetic multi-lattice data and real multi-latticemore » data recorded from crystals of ∼1 µm in size, where it is shown that up to six lattices can be successfully indexed and subsequently integrated from a 1° wedge of data. Analysis is presented which shows that improvements in data-quality indicators can be obtained through accurate identification and rejection of overlapping reflections prior to scaling.« less

Fixed target matrix for femtosecond time-resolved and in situ serial micro-crystallography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mueller, C.; Marx, A.; Epp, S. W.

We present a crystallography chip enabling in situ room temperature crystallography at microfocus synchrotron beamlines and X-ray free-electron laser (X-FEL) sources. Compared to other in situ approaches, we observe extremely low background and high diffraction data quality. The chip design is robust and allows fast and efficient loading of thousands of small crystals. The ability to load a large number of protein crystals, at room temperature and with high efficiency, into prescribed positions enables high throughput automated serial crystallography with microfocus synchrotron beamlines. In addition, we demonstrate the application of this chip for femtosecond time-resolved serial crystallography at the Linacmore » Coherent Light Source (LCLS, Menlo Park, California, USA). As a result, the chip concept enables multiple images to be acquired from each crystal, allowing differential detection of changes in diffraction intensities in order to obtain high signal-to-noise and fully exploit the time resolution capabilities of XFELs.« less

Fixed target matrix for femtosecond time-resolved and in situ serial micro-crystallography

DOE PAGES

Mueller, C.; Marx, A.; Epp, S. W.; ...

2015-08-18

We present a crystallography chip enabling in situ room temperature crystallography at microfocus synchrotron beamlines and X-ray free-electron laser (X-FEL) sources. Compared to other in situ approaches, we observe extremely low background and high diffraction data quality. The chip design is robust and allows fast and efficient loading of thousands of small crystals. The ability to load a large number of protein crystals, at room temperature and with high efficiency, into prescribed positions enables high throughput automated serial crystallography with microfocus synchrotron beamlines. In addition, we demonstrate the application of this chip for femtosecond time-resolved serial crystallography at the Linacmore » Coherent Light Source (LCLS, Menlo Park, California, USA). As a result, the chip concept enables multiple images to be acquired from each crystal, allowing differential detection of changes in diffraction intensities in order to obtain high signal-to-noise and fully exploit the time resolution capabilities of XFELs.« less

Effect of leucine-to-methionine substitutions on the diffraction quality of histone chaperone SET/TAF-Ibeta/INHAT crystals.

PubMed

Senda, Miki; Muto, Shinsuke; Horikoshi, Masami; Senda, Toshiya

2008-10-01

One of the most frequent problems in crystallization is poor quality of the crystals. In order to overcome this obstacle several methods have been utilized, including amino-acid substitutions of the target protein. Here, an example is presented of crystal-quality improvement by leucine-to-methionine substitutions. A variant protein with three amino-acid substitutions enabled improvement of the crystal quality of the histone chaperone SET/TAF-Ibeta/INHAT when combined with optimization of the cryoconditions. This procedure improved the resolution of the SET/TAF-Ibeta/INHAT crystals from around 5.5 to 2.3 A without changing the crystallization conditions.

Simulations of X-ray diffraction of shock-compressed single-crystal tantalum with synchrotron undulator sources.

PubMed

Tang, M X; Zhang, Y Y; E, J C; Luo, S N

2018-05-01

Polychromatic synchrotron undulator X-ray sources are useful for ultrafast single-crystal diffraction under shock compression. Here, simulations of X-ray diffraction of shock-compressed single-crystal tantalum with realistic undulator sources are reported, based on large-scale molecular dynamics simulations. Purely elastic deformation, elastic-plastic two-wave structure, and severe plastic deformation under different impact velocities are explored, as well as an edge release case. Transmission-mode diffraction simulations consider crystallographic orientation, loading direction, incident beam direction, X-ray spectrum bandwidth and realistic detector size. Diffraction patterns and reciprocal space nodes are obtained from atomic configurations for different loading (elastic and plastic) and detection conditions, and interpretation of the diffraction patterns is discussed.

Simulations of X-ray diffraction of shock-compressed single-crystal tantalum with synchrotron undulator sources

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, M. X.; Zhang, Y. Y.; E, J. C.

Polychromatic synchrotron undulator X-ray sources are useful for ultrafast single-crystal diffraction under shock compression. Here, simulations of X-ray diffraction of shock-compressed single-crystal tantalum with realistic undulator sources are reported, based on large-scale molecular dynamics simulations. Purely elastic deformation, elastic–plastic two-wave structure, and severe plastic deformation under different impact velocities are explored, as well as an edge release case. Transmission-mode diffraction simulations consider crystallographic orientation, loading direction, incident beam direction, X-ray spectrum bandwidth and realistic detector size. Diffraction patterns and reciprocal space nodes are obtained from atomic configurations for different loading (elastic and plastic) and detection conditions, and interpretation of themore » diffraction patterns is discussed.« less

Towards protein-crystal centering using second-harmonic generation (SHG) microscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kissick, David J.; Dettmar, Christopher M.; Becker, Michael

2013-05-01

The potential of second-harmonic generation (SHG) microscopy for automated crystal centering to guide synchrotron X-ray diffraction of protein crystals has been explored. The potential of second-harmonic generation (SHG) microscopy for automated crystal centering to guide synchrotron X-ray diffraction of protein crystals was explored. These studies included (i) comparison of microcrystal positions in cryoloops as determined by SHG imaging and by X-ray diffraction rastering and (ii) X-ray structure determinations of selected proteins to investigate the potential for laser-induced damage from SHG imaging. In studies using β{sub 2} adrenergic receptor membrane-protein crystals prepared in lipidic mesophase, the crystal locations identified by SHGmore » images obtained in transmission mode were found to correlate well with the crystal locations identified by raster scanning using an X-ray minibeam. SHG imaging was found to provide about 2 µm spatial resolution and shorter image-acquisition times. The general insensitivity of SHG images to optical scatter enabled the reliable identification of microcrystals within opaque cryocooled lipidic mesophases that were not identified by conventional bright-field imaging. The potential impact of extended exposure of protein crystals to five times a typical imaging dose from an ultrafast laser source was also assessed. Measurements of myoglobin and thaumatin crystals resulted in no statistically significant differences between structures obtained from diffraction data acquired from exposed and unexposed regions of single crystals. Practical constraints for integrating SHG imaging into an active beamline for routine automated crystal centering are discussed.« less

Goniometer-based femtosecond crystallography with X-ray free electron lasers

DOE PAGES

Cohen, Aina E.; Soltis, S. Michael; González, Ana; ...

2014-10-31

The emerging method of femtosecond crystallography (FX) may extend the diffraction resolution accessible from small radiation-sensitive crystals and provides a means to determine catalytically accurate structures of acutely radiation-sensitive metalloenzymes. Automated goniometer-based instrumentation developed for use at the Linac Coherent Light Source enabled efficient and flexible FX experiments to be performed on a variety of sample types. In the case of rod-shaped Cpl hydrogenase crystals, only five crystals and about 30 min of beam time were used to obtain the 125 still diffraction patterns used to produce a 1.6-Å resolution electron density map. With smaller crystals, high-density grids were usedmore » to increase sample throughput; 930 myoglobin crystals mounted at random orientation inside 32 grids were exposed, demonstrating the utility of this approach. Screening results from cryocooled crystals of β 2-adrenoreceptor and an RNA polymerase II complex indicate the potential to extend the diffraction resolution obtainable from very radiation-sensitive samples beyond that possible with undulator-based synchrotron sources.« less

Goniometer-based femtosecond crystallography with X-ray free electron lasers

PubMed Central

Cohen, Aina E.; Soltis, S. Michael; González, Ana; Aguila, Laura; Alonso-Mori, Roberto; Barnes, Christopher O.; Baxter, Elizabeth L.; Brehmer, Winnie; Brewster, Aaron S.; Brunger, Axel T.; Calero, Guillermo; Chang, Joseph F.; Chollet, Matthieu; Ehrensberger, Paul; Eriksson, Thomas L.; Feng, Yiping; Hattne, Johan; Hedman, Britt; Hollenbeck, Michael; Holton, James M.; Keable, Stephen; Kobilka, Brian K.; Kovaleva, Elena G.; Kruse, Andrew C.; Lemke, Henrik T.; Lin, Guowu; Lyubimov, Artem Y.; Manglik, Aashish; Mathews, Irimpan I.; McPhillips, Scott E.; Nelson, Silke; Peters, John W.; Sauter, Nicholas K.; Smith, Clyde A.; Song, Jinhu; Stevenson, Hilary P.; Tsai, Yingssu; Uervirojnangkoorn, Monarin; Vinetsky, Vladimir; Wakatsuki, Soichi; Weis, William I.; Zadvornyy, Oleg A.; Zeldin, Oliver B.; Zhu, Diling; Hodgson, Keith O.

2014-01-01

The emerging method of femtosecond crystallography (FX) may extend the diffraction resolution accessible from small radiation-sensitive crystals and provides a means to determine catalytically accurate structures of acutely radiation-sensitive metalloenzymes. Automated goniometer-based instrumentation developed for use at the Linac Coherent Light Source enabled efficient and flexible FX experiments to be performed on a variety of sample types. In the case of rod-shaped Cpl hydrogenase crystals, only five crystals and about 30 min of beam time were used to obtain the 125 still diffraction patterns used to produce a 1.6-Å resolution electron density map. For smaller crystals, high-density grids were used to increase sample throughput; 930 myoglobin crystals mounted at random orientation inside 32 grids were exposed, demonstrating the utility of this approach. Screening results from cryocooled crystals of β2-adrenoreceptor and an RNA polymerase II complex indicate the potential to extend the diffraction resolution obtainable from very radiation-sensitive samples beyond that possible with undulator-based synchrotron sources. PMID:25362050

Protein crystal growth in microgravity: Temperature induced large scale crystallization of insulin

NASA Technical Reports Server (NTRS)

Long, Marianna M.; Delucas, Larry J.; Smith, C.; Carson, M.; Moore, K.; Harrington, Michael D.; Pillion, D. J.; Bishop, S. P.; Rosenblum, W. M.; Naumann, R. J.

1994-01-01

One of the major stumbling blocks that prevents rapid structure determination using x-ray crystallography is macro-molecular crystal growth. There are many examples where crystallization takes longer than structure determination. In some cases, it is impossible to grow useful crystals on earth. Recent experiments conducted in conjuction with NASA on various Space Shuttle missions have demonstrated that protein crystals often grow larger and display better internal molecular order than their earth-grown counterparts. This paper reports results from three Shuttle flights using the Protein Crystallization Facility (PCF). The PCF hardware produced large, high-quality insulin crystals by using a temperature change as the sole means to affect protein solubility and thus, crystallization. The facility consists of cylinders/containers with volumes of 500, 200, 100, and 50 ml. Data from the three Shuttle flights demonstrated that larger, higher resolution crystals (as evidenced by x-ray diffraction data) were obtained from the microgravity experiments when compared to earth-grown crystals.

Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals

DOE PAGES

Dao, E. Han; Sierra, Raymond G.; Laksmono, Hartawan; ...

2015-04-30

In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS) using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecondmore » X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.« less

Crystallization and evaluation of hen egg-white lysozyme crystals for protein pH titration in the crystalline state

PubMed Central

Iwai, Wakari; Yagi, Daichi; Ishikawa, Takuya; Ohnishi, Yuki; Tanaka, Ichiro; Niimura, Nobuo

2008-01-01

To observe the ionized status of the amino acid residues in proteins at different pH (protein pH titration in the crystalline state) by neutron diffraction, hen egg-white lysozyme was crystallized over a wide pH range (2.5–8.0). Crystallization phase diagrams at pH 2.5, 6.0 and 7.5 were determined. At pH < 4.5 the border between the metastable region and the nucleation region shifted to the left (lower precipitant concentration) in the phase diagram, and at pH > 4.5 the border shifted to the right (higher precipitant concentration). The qualities of these crystals were characterized using the Wilson plot method. The qualities of all crystals at different pH were more or less equivalent (B-factor values within 25–40). It is expected that neutron diffraction analysis of these crystals of different pH provides equivalent data in quality for discussions of protein pH titration in the crystalline state of hen egg-white lysozyme. PMID:18421167

Crystallization and evaluation of hen egg-white lysozyme crystals for protein pH titration in the crystalline state.

PubMed

Iwai, Wakari; Yagi, Daichi; Ishikawa, Takuya; Ohnishi, Yuki; Tanaka, Ichiro; Niimura, Nobuo

2008-05-01

To observe the ionized status of the amino acid residues in proteins at different pH (protein pH titration in the crystalline state) by neutron diffraction, hen egg-white lysozyme was crystallized over a wide pH range (2.5-8.0). Crystallization phase diagrams at pH 2.5, 6.0 and 7.5 were determined. At pH < 4.5 the border between the metastable region and the nucleation region shifted to the left (lower precipitant concentration) in the phase diagram, and at pH > 4.5 the border shifted to the right (higher precipitant concentration). The qualities of these crystals were characterized using the Wilson plot method. The qualities of all crystals at different pH were more or less equivalent (B-factor values within 25-40). It is expected that neutron diffraction analysis of these crystals of different pH provides equivalent data in quality for discussions of protein pH titration in the crystalline state of hen egg-white lysozyme.

Microfluidic sorting of protein nanocrystals by size for X-ray free-electron laser diffraction

PubMed Central

Abdallah, Bahige G.; Zatsepin, Nadia A.; Roy-Chowdhury, Shatabdi; Coe, Jesse; Conrad, Chelsie E.; Dörner, Katerina; Sierra, Raymond G.; Stevenson, Hilary P.; Camacho-Alanis, Fernanda; Grant, Thomas D.; Nelson, Garrett; James, Daniel; Calero, Guillermo; Wachter, Rebekka M.; Spence, John C. H.; Weierstall, Uwe; Fromme, Petra; Ros, Alexandra

2015-01-01

The advent and application of the X-ray free-electron laser (XFEL) has uncovered the structures of proteins that could not previously be solved using traditional crystallography. While this new technology is powerful, optimization of the process is still needed to improve data quality and analysis efficiency. One area is sample heterogeneity, where variations in crystal size (among other factors) lead to the requirement of large data sets (and thus 10–100 mg of protein) for determining accurate structure factors. To decrease sample dispersity, we developed a high-throughput microfluidic sorter operating on the principle of dielectrophoresis, whereby polydisperse particles can be transported into various fluid streams for size fractionation. Using this microsorter, we isolated several milliliters of photosystem I nanocrystal fractions ranging from 200 to 600 nm in size as characterized by dynamic light scattering, nanoparticle tracking, and electron microscopy. Sorted nanocrystals were delivered in a liquid jet via the gas dynamic virtual nozzle into the path of the XFEL at the Linac Coherent Light Source. We obtained diffraction to ∼4 Å resolution, indicating that the small crystals were not damaged by the sorting process. We also observed the shape transforms of photosystem I nanocrystals, demonstrating that our device can optimize data collection for the shape transform-based phasing method. Using simulations, we show that narrow crystal size distributions can significantly improve merged data quality in serial crystallography. From this proof-of-concept work, we expect that the automated size-sorting of protein crystals will become an important step for sample production by reducing the amount of protein needed for a high quality final structure and the development of novel phasing methods that exploit inter-Bragg reflection intensities or use variations in beam intensity for radiation damage-induced phasing. This method will also permit an analysis of the dependence of crystal quality on crystal size. PMID:26798818

Microfluidic sorting of protein nanocrystals by size for X-ray free-electron laser diffraction

DOE PAGES

Abdallah, Bahige G.; Zatsepin, Nadia A.; Roy-Chowdhury, Shatabdi; ...

2015-08-19

We report that the advent and application of the X-ray free-electron laser (XFEL) has uncovered the structures of proteins that could not previously be solved using traditional crystallography. While this new technology is powerful, optimization of the process is still needed to improve data quality and analysis efficiency. One area is sample heterogeneity, where variations in crystal size (among other factors) lead to the requirement of large data sets (and thus 10–100 mg of protein) for determining accurate structure factors. To decrease sample dispersity, we developed a high-throughput microfluidic sorter operating on the principle of dielectrophoresis, whereby polydisperse particles canmore » be transported into various fluid streams for size fractionation. Using this microsorter, we isolated several milliliters of photosystem I nanocrystal fractions ranging from 200 to 600 nm in size as characterized by dynamic light scattering, nanoparticle tracking, and electron microscopy. Sorted nanocrystals were delivered in a liquid jet via the gas dynamic virtual nozzle into the path of the XFEL at the Linac Coherent Light Source. We obtained diffraction to ~4 Å resolution, indicating that the small crystals were not damaged by the sorting process. We also observed the shape transforms of photosystem I nanocrystals, demonstrating that our device can optimize data collection for the shape transform-based phasing method. Using simulations, we show that narrow crystal size distributions can significantly improve merged data quality in serial crystallography. From this proof-of-concept work, we expect that the automated size-sorting of protein crystals will become an important step for sample production by reducing the amount of protein needed for a high quality final structure and the development of novel phasing methods that exploit inter-Bragg reflection intensities or use variations in beam intensity for radiation damage-induced phasing. Ultimately, this method will also permit an analysis of the dependence of crystal quality on crystal size.« less

Macromolecular Crystal Quality

NASA Technical Reports Server (NTRS)

Snell, Edward H.; Borgstahl, Gloria E. O.; Bellamy, Henry D.; Curreri, Peter A. (Technical Monitor)

2001-01-01

There are many ways of judging a good crystal. Which we use depends on the qualities we seek. For gemstones size, clarity and impurity levels (color) are paramount. For the semiconductor industry purity is probably the most important quality. For the structural crystallographer the primary desideratum is the somewhat more subtle concept of internal order. In this chapter we discuss the effect of internal order (or the lack of it) on the crystal's diffraction properties.

Radiation damage in a micron-sized protein crystal studied via reciprocal space mapping and Bragg coherent diffractive imaging.

PubMed

Coughlan, H D; Darmanin, C; Phillips, N W; Hofmann, F; Clark, J N; Harder, R J; Vine, D J; Abbey, B

2015-07-01

For laboratory and synchrotron based X-ray sources, radiation damage has posed a significant barrier to obtaining high-resolution structural data from biological macromolecules. The problem is particularly acute for micron-sized crystals where the weaker signal often necessitates the use of higher intensity beams to obtain the relevant data. Here, we employ a combination of techniques, including Bragg coherent diffractive imaging to characterise the radiation induced damage in a micron-sized protein crystal over time. The approach we adopt here could help screen for potential protein crystal candidates for measurement at X-ray free election laser sources.

Radiation damage in a micron-sized protein crystal studied via reciprocal space mapping and Bragg coherent diffractive imaging

PubMed Central

Coughlan, H. D.; Darmanin, C.; Phillips, N. W.; Hofmann, F.; Clark, J. N.; Harder, R. J.; Vine, D. J.; Abbey, B.

2015-01-01

For laboratory and synchrotron based X-ray sources, radiation damage has posed a significant barrier to obtaining high-resolution structural data from biological macromolecules. The problem is particularly acute for micron-sized crystals where the weaker signal often necessitates the use of higher intensity beams to obtain the relevant data. Here, we employ a combination of techniques, including Bragg coherent diffractive imaging to characterise the radiation induced damage in a micron-sized protein crystal over time. The approach we adopt here could help screen for potential protein crystal candidates for measurement at X-ray free election laser sources. PMID:26798804

Radiation damage in a micron-sized protein crystal studied via reciprocal space mapping and Bragg coherent diffractive imaging

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coughlan, H. D.; Darmanin, C.; Phillips, N. W.

For laboratory and synchrotron based X-ray sources, radiation damage has posed a significant barrier to obtaining high-resolution structural data from biological macromolecules. The problem is particularly acute for micron-sized crystals where the weaker signal often necessitates the use of higher intensity beams to obtain the relevant data. Here, we employ a combination of techniques, including Bragg coherent diffractive imaging to characterise the radiation induced damage in a micron-sized protein crystal over time. The approach we adopt here could help screen for potential protein crystal candidates for measurement at X-ray free election laser sources.

Radiation damage in a micron-sized protein crystal studied via reciprocal space mapping and Bragg coherent diffractive imaging

DOE PAGES

Coughlan, H. D.; Darmanin, C.; Phillips, N. W.; ...

2015-04-29

For laboratory and synchrotron based X-ray sources, radiation damage has posed a significant barrier to obtaining high-resolution structural data from biological macromolecules. The problem is particularly acute for micron-sized crystals where the weaker signal often necessitates the use of higher intensity beams to obtain the relevant data. Here, we employ a combination of techniques, including Bragg coherent diffractive imaging to characterise the radiation induced damage in a micron-sized protein crystal over time. The approach we adopt here could help screen for potential protein crystal candidates for measurement at X-ray free election laser sources.

Purification, crystallization and preliminary X-ray characterization of prunin-1, a major component of the almond (Prunus dulcis) allergen amandin.

PubMed

Albillos, Silvia M; Jin, Tengchuan; Howard, Andrew; Zhang, Yuzhu; Kothary, Mahendra H; Fu, Tong-Jen

2008-07-09

The 11S globulins from plant seeds account for a number of major food allergens. Because of the interest in the structural basis underlying the allergenicity of food allergens, we sought to crystallize the main 11S seed storage protein from almond ( Prunus dulcis). Prunin-1 (Pru1) was purified from defatted almond flour by water extraction, cryoprecipitation, followed by sequential anion exchange, hydrophobic interaction, and size exclusion chromatography. Single crystals of Pru1 were obtained in a screening with a crystal screen kit, using the hanging-drop vapor diffusion method. Diffraction quality crystals were grown after optimization. The Pru1 crystals diffracted to at least 3.0 A and belong to the tetragonal space group P4(1)22, with unit cell parameters of a = b = 150.912 A, c = 165.248 A. Self-rotation functions and molecular replacement calculations showed that there are three molecules in the asymmetry unit with water content of 51.41%. The three Pru1 protomers are related by a noncrystallographic 3-fold axis and they form a doughnut-shaped trimer. Two prunin trimers form a homohexamer. Elucidation of prunin structure will allow further characterization of the allergenic features of the 11S protein allergens at the molecular level.

Sequential x-ray diffraction topography at 1-BM x-ray optics testing beamline at the advanced photon source

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stoupin, Stanislav, E-mail: sstoupin@aps.anl.gov; Shvyd’ko, Yuri; Trakhtenberg, Emil

2016-07-27

We report progress on implementation and commissioning of sequential X-ray diffraction topography at 1-BM Optics Testing Beamline of the Advanced Photon Source to accommodate growing needs of strain characterization in diffractive crystal optics and other semiconductor single crystals. The setup enables evaluation of strain in single crystals in the nearly-nondispersive double-crystal geometry. Si asymmetric collimator crystals of different crystallographic orientations were designed, fabricated and characterized using in-house capabilities. Imaging the exit beam using digital area detectors permits rapid sequential acquisition of X-ray topographs at different angular positions on the rocking curve of a crystal under investigation. Results on sensitivity andmore » spatial resolution are reported based on experiments with high-quality Si and diamond crystals. The new setup complements laboratory-based X-ray topography capabilities of the Optics group at the Advanced Photon Source.« less

An Overview of Hardware for Protein Crystallization in a Magnetic Field.

PubMed

Yan, Er-Kai; Zhang, Chen-Yan; He, Jin; Yin, Da-Chuan

2016-11-16

Protein crystallization under a magnetic field is an interesting research topic because a magnetic field may provide a special environment to acquire improved quality protein crystals. Because high-quality protein crystals are very useful in high-resolution structure determination using diffraction techniques (X-ray, neutron, and electron diffraction), research using magnetic fields in protein crystallization has attracted substantial interest; some studies have been performed in the past two decades. In this research field, the hardware is especially essential for successful studies because the environment is special and the design and utilization of the research apparatus in such an environment requires special considerations related to the magnetic field. This paper reviews the hardware for protein crystallization (including the magnet systems and the apparatus designed for use in a magnetic field) and progress in this area. Future prospects in this field will also be discussed.

An Overview of Hardware for Protein Crystallization in a Magnetic Field

PubMed Central

Yan, Er-Kai; Zhang, Chen-Yan; He, Jin; Yin, Da-Chuan

2016-01-01

Protein crystallization under a magnetic field is an interesting research topic because a magnetic field may provide a special environment to acquire improved quality protein crystals. Because high-quality protein crystals are very useful in high-resolution structure determination using diffraction techniques (X-ray, neutron, and electron diffraction), research using magnetic fields in protein crystallization has attracted substantial interest; some studies have been performed in the past two decades. In this research field, the hardware is especially essential for successful studies because the environment is special and the design and utilization of the research apparatus in such an environment requires special considerations related to the magnetic field. This paper reviews the hardware for protein crystallization (including the magnet systems and the apparatus designed for use in a magnetic field) and progress in this area. Future prospects in this field will also be discussed. PMID:27854318

Synchrotron Bragg diffraction imaging characterization of synthetic diamond crystals for optical and electronic power device applications1 1

PubMed Central

Tran Thi, Thu Nhi; Morse, J.; Caliste, D.; Fernandez, B.; Eon, D.; Härtwig, J.; Mer-Calfati, C.; Tranchant, N.; Arnault, J. C.; Lafford, T. A.; Baruchel, J.

2017-01-01

Bragg diffraction imaging enables the quality of synthetic single-crystal diamond substrates and their overgrown, mostly doped, diamond layers to be characterized. This is very important for improving diamond-based devices produced for X-ray optics and power electronics applications. The usual first step for this characterization is white-beam X-ray diffraction topography, which is a simple and fast method to identify the extended defects (dislocations, growth sectors, boundaries, stacking faults, overall curvature etc.) within the crystal. This allows easy and quick comparison of the crystal quality of diamond plates available from various commercial suppliers. When needed, rocking curve imaging (RCI) is also employed, which is the quantitative counterpart of monochromatic Bragg diffraction imaging. RCI enables the local determination of both the effective misorientation, which results from lattice parameter variation and the local lattice tilt, and the local Bragg position. Maps derived from these parameters are used to measure the magnitude of the distortions associated with polishing damage and the depth of this damage within the volume of the crystal. For overgrown layers, these maps also reveal the distortion induced by the incorporation of impurities such as boron, or the lattice parameter variations associated with the presence of growth-incorporated nitrogen. These techniques are described, and their capabilities for studying the quality of diamond substrates and overgrown layers, and the surface damage caused by mechanical polishing, are illustrated by examples. PMID:28381981

Crystallization of a pentapeptide-repeat protein by reductive cyclic pentylation of free amines with glutaraldehyde

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vetting, Matthew W., E-mail: vetting@aecom.yu.edu; Hegde, Subray S.; Blanchard, John S.

2009-05-01

A method to modify proteins with glutaraldehyde under reducing conditions is presented. Treatment with glutaraldehyde and dimethylaminoborane was found to result in cyclic pentylation of free amines and facilitated the structural determination of a protein previously recalcitrant to the formation of diffraction quality crystals. The pentapeptide-repeat protein EfsQnr from Enterococcus faecalis protects DNA gyrase from inhibition by fluoroquinolones. EfsQnr was cloned and purified to homogeneity, but failed to produce diffraction-quality crystals in initial crystallization screens. Treatment of EfsQnr with glutaraldehyde and the strong reducing agent borane–dimethylamine resulted in a derivatized protein which produced crystals that diffracted to 1.6 Å resolution;more » their structure was subsequently determined by single-wavelength anomalous dispersion. Analysis of the derivatized protein using Fourier transform ion cyclotron resonance mass spectrometry indicated a mass increase of 68 Da per free amino group. Electron-density maps about a limited number of structurally ordered lysines indicated that the modification was a cyclic pentylation of free amines, producing piperidine groups.« less

On the purification and preliminary crystallographic analysis of isoquinoline 1-oxidoreductase from Brevundimonas diminuta 7

PubMed Central

Boer, D. Roeland; Müller, Axel; Fetzner, Susanne; Lowe, David J.; Romão, Maria João

2005-01-01

Isoquinoline 1-oxidoreductase (IOR) from Brevundimonas diminuta is a mononuclear molybdoenzyme of the xanthine-dehydrogenase family of proteins and catalyzes the conversion of isoquinoline to isoquinoline-1-one. Its primary sequence and behaviour, specifically in its substrate specificity and lipophilicity, differ from other members of the family. A crystal structure of the enzyme is expected to provide an explanation for these differences. This paper describes the crystallization and preliminary X-ray diffraction experiments as well as an optimized purification protocol for IOR. Crystallization of IOR was achieved using two different crystallization buffers. Streak-seeding and cross-linking were essential to obtain well diffracting crystals. Suitable cryo-conditions were found and a structure solution was obtained by molecular replacement. However, phases need to be improved in order to obtain a more interpretable electron-density map. PMID:16508115

Large Area Stress Distribution in Crystalline Materials Calculated from Lattice Deformation Identified by Electron Backscatter Diffraction

NASA Astrophysics Data System (ADS)

Shao, Yongliang; Zhang, Lei; Hao, Xiaopeng; Wu, Yongzhong; Dai, Yuanbin; Tian, Yuan; Huo, Qin

2014-08-01

We report a method to obtain the stress of crystalline materials directly from lattice deformation by Hooke's law. The lattice deformation was calculated using the crystallographic orientations obtained from electron backscatter diffraction (EBSD) technology. The stress distribution over a large area was obtained efficiently and accurately using this method. Wurtzite structure gallium nitride (GaN) crystal was used as the example of a hexagonal crystal system. With this method, the stress distribution of a GaN crystal was obtained. Raman spectroscopy was used to verify the stress distribution. The cause of the stress distribution found in the GaN crystal was discussed from theoretical analysis and EBSD data. Other properties related to lattice deformation, such as piezoelectricity, can also be analyzed by this novel approach based on EBSD data.

Large area stress distribution in crystalline materials calculated from lattice deformation identified by electron backscatter diffraction.

PubMed

Shao, Yongliang; Zhang, Lei; Hao, Xiaopeng; Wu, Yongzhong; Dai, Yuanbin; Tian, Yuan; Huo, Qin

2014-08-05

We report a method to obtain the stress of crystalline materials directly from lattice deformation by Hooke's law. The lattice deformation was calculated using the crystallographic orientations obtained from electron backscatter diffraction (EBSD) technology. The stress distribution over a large area was obtained efficiently and accurately using this method. Wurtzite structure gallium nitride (GaN) crystal was used as the example of a hexagonal crystal system. With this method, the stress distribution of a GaN crystal was obtained. Raman spectroscopy was used to verify the stress distribution. The cause of the stress distribution found in the GaN crystal was discussed from theoretical analysis and EBSD data. Other properties related to lattice deformation, such as piezoelectricity, can also be analyzed by this novel approach based on EBSD data.

Large Area Stress Distribution in Crystalline Materials Calculated from Lattice Deformation Identified by Electron Backscatter Diffraction

PubMed Central

Shao, Yongliang; Zhang, Lei; Hao, Xiaopeng; Wu, Yongzhong; Dai, Yuanbin; Tian, Yuan; Huo, Qin

2014-01-01

We report a method to obtain the stress of crystalline materials directly from lattice deformation by Hooke's law. The lattice deformation was calculated using the crystallographic orientations obtained from electron backscatter diffraction (EBSD) technology. The stress distribution over a large area was obtained efficiently and accurately using this method. Wurtzite structure gallium nitride (GaN) crystal was used as the example of a hexagonal crystal system. With this method, the stress distribution of a GaN crystal was obtained. Raman spectroscopy was used to verify the stress distribution. The cause of the stress distribution found in the GaN crystal was discussed from theoretical analysis and EBSD data. Other properties related to lattice deformation, such as piezoelectricity, can also be analyzed by this novel approach based on EBSD data. PMID:25091314

Determination of the X-ray structure of the snake venom protein omwaprin by total chemical synthesis and racemic protein crystallography.

PubMed

Banigan, James R; Mandal, Kalyaneswar; Sawaya, Michael R; Thammavongsa, Vilasak; Hendrickx, Antoni P A; Schneewind, Olaf; Yeates, Todd O; Kent, Stephen B H

2010-10-01

The 50-residue snake venom protein L-omwaprin and its enantiomer D-omwaprin were prepared by total chemical synthesis. Radial diffusion assays were performed against Bacillus megaterium and Bacillus anthracis; both L- and D-omwaprin showed antibacterial activity against B. megaterium. The native protein enantiomer, made of L-amino acids, failed to crystallize readily. However, when a racemic mixture containing equal amounts of L- and D-omwaprin was used, diffraction quality crystals were obtained. The racemic protein sample crystallized in the centrosymmetric space group P2(1)/c and its structure was determined at atomic resolution (1.33 A) by a combination of Patterson and direct methods based on the strong scattering from the sulfur atoms in the eight cysteine residues per protein. Racemic crystallography once again proved to be a valuable method for obtaining crystals of recalcitrant proteins and for determining high-resolution X-ray structures by direct methods.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gavira, José A.; Jesus, Walleska de; Camara-Artigas, Ana

The haemoglobin II from the clam L. pectinata has been crystallized using counter-diffusion in single capillary in the presence of agarose to improve crystal quality. Initial phases have been obtained by molecular replacement. Haemoglobin II is one of three haemoglobins present in the cytoplasm of the Lucina pectinata mollusc that inhabits the Caribbean coast. Using HBII purified from its natural source, crystallization screening was performed using the counter-diffusion method with capillaries of 0.2 mm inner diameter. Crystals of HbII suitable for data collection and structure determination were grown in the presence of agarose at 0.1%(w/v) in order to improve theirmore » quality. The crystals belong to the tetragonal space group P4{sub 2}2{sub 1}2, with unit-cell parameters a = b = 73.92, c = 152.35 Å, and diffracted X-rays to a resolution of better than 2.0 Å. The asymmetric unit is a homodimer with a corresponding Matthews coefficient (V{sub M}) of 3.15 Å{sup 3} Da{sup −1} and a solvent content of 61% by volume.« less

Diffraction crystal for sagittally focusing x-rays

DOEpatents

Ice, Gene E.; Sparks, Jr., Cullie J.

1984-01-01

The invention is a new type of diffraction crystal designed for sagittally focusing photons of various energies. The invention is based on the discovery that such focusing is not obtainable with conventional crystals because of distortion resulting from anticlastic curvature. The new crystal comprises a monocrystalline base having a front face contoured for sagittally focusing photons and a back face provided with rigid, upstanding, stiffening ribs restricting anticlastic curvature. When mounted in a suitable bending device, the reflecting face of the crystal can be adjusted to focus photons having any one of a range of energies.

Diffraction crystals for sagittally focusing x-rays

DOEpatents

Ice, G.E.; Sparks, C.J. Jr.

1982-06-07

The invention is a new type of diffraction crystal designed for sagittally focusing photons of various energies. The invention is based on the discovery that such focusing is not obtainable with conventional crystals because of distortion resulting from anticlastic curvature. The new crystal comprises a monocrystalline base having a front face contoured for sagittally focusing photons and a back face provided with rigid, upstanding, stiffening ribs restricting anticlastic curvature. When mounted in a suitable bending device, the reflecting face of the crystal can be adjusted to focus photons having any one of a range of energies.

Growth Temperature Dependence of Morphology of GaN Single Crystals in the Na-Li-Ca Flux Method

NASA Astrophysics Data System (ADS)

Wu, Xi; Hao, Hangfei; Li, Zhenrong; Fan, Shiji; Xu, Zhuo

2018-02-01

In this paper, the effect of growth temperature on the morphology and transparency of the GaN crystals obtained by the Li-Ca-added Na Flux method was studied. Addition of Li-Ca was attempted to control the growth habit and further improve transparency of GaN crystals. The samples with wurtzite structure of GaN were confirmed by the x-ray powder diffraction analysis. GaN single crystal with maximum size of about 6 mm was grown at 750°C. As the growth temperature was increased from 700°C to 850°C, the morphology of the crystals changed from pyramid to prism, and their surfaces became smooth. It was found that high growth temperature was beneficial to obtain a transparent crystal, but the evaporation of sodium would suppress its further growth. The E 2 (high) mode in the Raman spectra was at 568 cm-1, and the full-width at half-maximum values of this peak for the crystals obtained at 700°C, 750°C, 800°C, and 850°C were 7.5 cm-1, 10.3 cm-1, 4.4 cm-1, and 4.0 cm-1, respectively. It indicates that all the crystals are stress free and the transparent crystal grown at high temperature has high structural quality or low impurity concentrations.

Imperfection and radiation damage in protein crystals studied with coherent radiation

PubMed Central

Nave, Colin; Sutton, Geoff; Evans, Gwyndaf; Owen, Robin; Rau, Christoph; Robinson, Ian; Stuart, David Ian

2016-01-01

Fringes and speckles occur within diffraction spots when a crystal is illuminated with coherent radiation during X-ray diffraction. The additional information in these features provides insight into the imperfections in the crystal at the sub-micrometre scale. In addition, these features can provide more accurate intensity measurements (e.g. by model-based profile fitting), detwinning (by distinguishing the various components), phasing (by exploiting sampling of the molecular transform) and refinement (by distinguishing regions with different unit-cell parameters). In order to exploit these potential benefits, the features due to coherent diffraction have to be recorded and any change due to radiation damage properly modelled. Initial results from recording coherent diffraction at cryotemperatures from polyhedrin crystals of approximately 2 µm in size are described. These measurements allowed information about the type of crystal imperfections to be obtained at the sub-micrometre level, together with the changes due to radiation damage. PMID:26698068

A simple X-ray source of two orthogonal beams for small samples imaging

NASA Astrophysics Data System (ADS)

Hrdý, J.

2018-04-01

A simple method for simultaneous imaging of small samples by two orthogonal beams is proposed. The method is based on one channel-cut crystal which is oriented such that the beam is diffracted on two crystallographic planes simultaneously. These planes are symmetrically inclined to the crystal surface. The beams are three times diffracted. After the first diffraction the beam is split. After the second diffraction the split beams become parallel. Finally, after the third diffraction the beams become convergent and may be used for imaging. The corresponding angular relations to obtain orthogonal beams are derived.

Characterization of CuCl quantum dots grown in NaCl single crystals via optical measurements, X-ray diffraction, and transmission electron microscopy

NASA Astrophysics Data System (ADS)

Miyajima, Kensuke; Akatsu, Tatsuro; Itoh, Ken

2018-05-01

We evaluated the crystal size, shape, and alignment of the lattice planes of CuCl quantum dots (QDs) embedded in NaCl single crystals by optical measurements, X-ray diffraction (XRD) patterns, and transmission electron microscopy (TEM). We obtained, for the first time, an XRD pattern and TEM images for CuCl QDs in NaCl crystals. The XRD pattern showed that the lattice planes of the CuCl QDs were parallel to those of the NaCl crystals. In addition, the size of the QDs was estimated from the diffraction width. It was apparent from the TEM images that almost all CuCl QDs were polygonal, although some cubic QDs were present. The mean size and size distribution of the QDs were also obtained. The dot size obtained from optical measurements, XRD, and TEM image were almost consistent. Our new findings can help to reveal the growth mechanism of semiconductor QDs embedded in a crystallite matrix. In addition, this work will play an important role in progressing the study of optical phenomena originating from assembled semiconductor QDs.

IOTA: integration optimization, triage and analysis tool for the processing of XFEL diffraction images.

PubMed

Lyubimov, Artem Y; Uervirojnangkoorn, Monarin; Zeldin, Oliver B; Brewster, Aaron S; Murray, Thomas D; Sauter, Nicholas K; Berger, James M; Weis, William I; Brunger, Axel T

2016-06-01

Serial femtosecond crystallography (SFX) uses an X-ray free-electron laser to extract diffraction data from crystals not amenable to conventional X-ray light sources owing to their small size or radiation sensitivity. However, a limitation of SFX is the high variability of the diffraction images that are obtained. As a result, it is often difficult to determine optimal indexing and integration parameters for the individual diffraction images. Presented here is a software package, called IOTA , which uses a grid-search technique to determine optimal spot-finding parameters that can in turn affect the success of indexing and the quality of integration on an image-by-image basis. Integration results can be filtered using a priori information about the Bravais lattice and unit-cell dimensions and analyzed for unit-cell isomorphism, facilitating an improvement in subsequent data-processing steps.

Crystallization and crystal manipulation of a steric chaperone in complex with its lipase substrate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pauwels, Kris, E-mail: krpauwel@vub.ac.be; Loris, Remy; Vandenbussche, Guy

2005-08-01

Crystals of the lipase of B. glumae in complex with its specific foldase were obtained in two forms. Crystallization, crystal manipulation and preliminary X-ray diffraction analysis are described. Bacterial lipases that are secreted via the type II secretion pathway require a lipase-specific foldase in order to obtain their native and biologically active conformation in the periplasmic space. The lipase–foldase complex from Burkholderia glumae (319 and 333 residues, respectively) was crystallized in two crystal forms. One crystal form belongs to space group P3{sub 1}21 (P3{sub 2}21), with unit-cell parameters a = b = 122.3, c = 98.2 Å. A procedure ismore » presented which improved the diffraction of these crystals from ∼5 to 2.95 Å. For the second crystal form, which belonged to space group C2 with unit-cell parameters a = 183.0, b = 75.7, c = 116.6 Å, X-ray data were collected to 1.85 Å.« less

Purification, crystallization and preliminary X-ray diffraction studies of N-acetylglucosamine-phosphate mutase from Candida albicans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishitani, Yuichi; Maruyama, Daisuke; Nonaka, Tsuyoshi

2006-04-01

Preliminary X-ray diffraction studies on N-acetylglucosamine-phosphate mutase from C. albicans are reported. N-acetylglucosamine-phosphate mutase (AGM1) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine (UDP-GlcNAc) in eukaryotes and belongs to the α-d-phosphohexomutase superfamily. AGM1 from Candida albicans (CaAGM1) was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals obtained belong to the primitive monoclinic space group P2{sub 1}, with unit-cell parameters a = 60.2, b = 130.2, c = 78.0 Å, β = 106.7°. The crystals diffract X-rays to beyond 1.8 Å resolution using synchrotron radiation.

Neutron and X-ray single-crystal diffraction from protein microcrystals via magnetically oriented microcrystal arrays in gels.

PubMed

Tsukui, Shu; Kimura, Fumiko; Kusaka, Katsuhiro; Baba, Seiki; Mizuno, Nobuhiro; Kimura, Tsunehisa

2016-07-01

Protein microcrystals magnetically aligned in D2O hydrogels were subjected to neutron diffraction measurements, and reflections were observed for the first time to a resolution of 3.4 Å from lysozyme microcrystals (∼10 × 10 × 50 µm). This result demonstrated the possibility that magnetically oriented microcrystals consolidated in D2O gels may provide a promising means to obtain single-crystal neutron diffraction from proteins that do not crystallize at the sizes required for neutron diffraction structure determination. In addition, lysozyme microcrystals aligned in H2O hydrogels allowed structure determination at a resolution of 1.76 Å at room temperature by X-ray diffraction. The use of gels has advantages since the microcrystals are measured under hydrated conditions.

Crystal growth of enzymes in low gravity (L-5)

NASA Technical Reports Server (NTRS)

Morita, Yuhei

1993-01-01

Recent developments in protein engineering have expanded the possibilities of studies of enzymes and other proteins. Now such studies are not limited to the elucidation of the relationship between the structure and function of the protein. They also aim at the production of proteins with new and practical functions, based on results obtained during investigation of structure and function. For continuing research in this field, investigation of the tertiary structure of proteins is important. X-ray diffraction of single crystals of protein is usually used for this purpose. The main difficulty is the preparation of the crystals. The theme of the research is to prepare such crystals at very low gravity, with the main purpose being to obtain large single crystals of proteins suitable for x-ray diffraction studies.

A multi-dataset data-collection strategy produces better diffraction data

PubMed Central

Liu, Zhi-Jie; Chen, Lirong; Wu, Dong; Ding, Wei; Zhang, Hua; Zhou, Weihong; Fu, Zheng-Qing; Wang, Bi-Cheng

2011-01-01

A multi-dataset (MDS) data-collection strategy is proposed and analyzed for macromolecular crystal diffraction data acquisition. The theoretical analysis indicated that the MDS strategy can reduce the standard deviation (background noise) of diffraction data compared with the commonly used single-dataset strategy for a fixed X-ray dose. In order to validate the hypothesis experimentally, a data-quality evaluation process, termed a readiness test of the X-ray data-collection system, was developed. The anomalous signals of sulfur atoms in zinc-free insulin crystals were used as the probe to differentiate the quality of data collected using different data-collection strategies. The data-collection results using home-laboratory-based rotating-anode X-ray and synchrotron X-ray systems indicate that the diffraction data collected with the MDS strategy contain more accurate anomalous signals from sulfur atoms than the data collected with a regular data-collection strategy. In addition, the MDS strategy offered more advantages with respect to radiation-damage-sensitive crystals and better usage of rotating-anode as well as synchrotron X-rays. PMID:22011470

A Novel In-situ Electrochemical Cell for Neutron Diffraction Studies of Phase Transitions in Small Volume Electrodes of Li-ion Batteries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vadlamani, Bhaskar S; An, Ke; Jagannathan, M.

2014-01-01

The design and performance of a novel in-situ electrochemical cell that greatly facilitates the neutron diffraction study of complex phase transitions in small volume electrodes of Li-ion cells, is presented in this work. Diffraction patterns that are Rietveld-refinable could be obtained simultaneously for all the electrodes, which demonstrates that the cell is best suited to explore electrode phase transitions driven by the lithiation and delithiation processes. This has been facilitated by the use of single crystal (100) Si sheets as casing material and the planar cell configuration, giving improved signal-to-noise ratio relative to other casing materials. The in-situ cell hasmore » also been designed for easy assembly and to facilitate rapid experiments. The effectiveness of cell is demonstrated by tracking the neutron diffraction patterns during the charging of graphite/LiCoO2 and graphite/LiMn2O4 cells. It is shown that good quality neutron diffraction data can be obtained and that most of the finer details of the phase transitions, and the associated changes in crystallographic parameters in these electrodes, can be captured.« less

Room-temperature serial crystallography using a kinetically optimized microfluidic device for protein crystallization and on-chip X-ray diffraction

PubMed Central

Heymann, Michael; Opthalage, Achini; Wierman, Jennifer L.; Akella, Sathish; Szebenyi, Doletha M. E.; Gruner, Sol M.; Fraden, Seth

2014-01-01

An emulsion-based serial crystallographic technology has been developed, in which nanolitre-sized droplets of protein solution are encapsulated in oil and stabilized by surfactant. Once the first crystal in a drop is nucleated, the small volume generates a negative feedback mechanism that lowers the supersaturation. This mechanism is exploited to produce one crystal per drop. Diffraction data are measured, one crystal at a time, from a series of room-temperature crystals stored on an X-ray semi-transparent microfluidic chip, and a 93% complete data set is obtained by merging single diffraction frames taken from different unoriented crystals. As proof of concept, the structure of glucose isomerase was solved to 2.1 Å, demonstrating the feasibility of high-throughput serial X-ray crystallography using synchrotron radiation. PMID:25295176

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aoki, Ken-ichi; Tanaka, Nobutada, E-mail: ntanaka@pharm.showa-u.ac.jp; Ishikura, Shuhei

Pig heart carbonyl reductase has been crystallized in the presence of NADPH. Diffraction data have been collected using synchrotron radiation. Pig heart carbonyl reductase (PHCR), which belongs to the short-chain dehydrogenase/reductase (SDR) family, has been crystallized by the hanging-drop vapour-diffusion method. Two crystal forms (I and II) have been obtained in the presence of NADPH. Form I crystals belong to the tetragonal space group P4{sub 2}, with unit-cell parameters a = b = 109.61, c = 94.31 Å, and diffract to 1.5 Å resolution. Form II crystals belong to the tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters amore » = b = 120.10, c = 147.00 Å, and diffract to 2.2 Å resolution. Both crystal forms are suitable for X-ray structure analysis at high resolution.« less

Transmission electron microscopy as a tool for nanocrystal characterization pre- and post-injector

PubMed Central

Stevenson, H. P.; DePonte, D. P.; Makhov, A. M.; Conway, James F.; Zeldin, O. B.; Boutet, S.; Calero, G.; Cohen, A. E.

2014-01-01

Recent advancements at the Linac Coherent Light Source X-ray free-electron laser (XFEL) enabling successful serial femtosecond diffraction experiments using nanometre-sized crystals (NCs) have opened up the possibility of X-ray structure determination of proteins that produce only submicrometre crystals such as many membrane proteins. Careful crystal pre-characterization including compatibility testing of the sample delivery method is essential to ensure efficient use of the limited beamtime available at XFEL sources. This work demonstrates the utility of transmission electron microscopy for detecting and evaluating NCs within the carrier solutions of liquid injectors. The diffraction quality of these crystals may be assessed by examining the crystal lattice and by calculating the fast Fourier transform of the image. Injector reservoir solutions, as well as solutions collected post-injection, were evaluated for three types of protein NCs (i) the membrane protein PTHR1, (ii) the multi-protein complex Pol II-GFP and (iii) the soluble protein lysozyme. Our results indicate that the concentration and diffraction quality of NCs, particularly those with high solvent content and sensitivity to mechanical manipulation may be affected by the delivery process. PMID:24914151

The MORPHEUS II protein crystallization screen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gorrec, Fabrice, E-mail: fgorrec@mrc-lmb.cam.ac.uk

2015-06-27

MORPHEUS II is a 96-condition initial crystallization screen formulated de novo. The screen incorporates reagents selected from the Protein Data Bank to yield crystals that are not observed in traditional conditions. In addition, the formulation facilitates the optimization and cryoprotection of crystals. High-quality macromolecular crystals are a prerequisite for the process of protein structure determination by X-ray diffraction. Unfortunately, the relative yield of diffraction-quality crystals from crystallization experiments is often very low. In this context, innovative crystallization screen formulations are continuously being developed. In the past, MORPHEUS, a screen in which each condition integrates a mix of additives selected frommore » the Protein Data Bank, a cryoprotectant and a buffer system, was developed. Here, MORPHEUS II, a follow-up to the original 96-condition initial screen, is described. Reagents were selected to yield crystals when none might be observed in traditional initial screens. Besides, the screen includes heavy atoms for experimental phasing and small polyols to ensure the cryoprotection of crystals. The suitability of the resulting novel conditions is shown by the crystallization of a broad variety of protein samples and their efficiency is compared with commercially available conditions.« less

Expression, purification, crystallization and preliminary X-ray diffraction analysis of α-11 giardin from Giardia lamblia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pathuri, Puja; Nguyen, Emily Tam; Luecke, Hartmut, E-mail: hudel@uci.edu

2006-11-01

α-11 giardin from the intestinal protozoan parasite, G. lamblia has been cloned, expressed, purified and crystallized under two different conditions and in two different space groups. Crystals from the first condition diffracted to 1.1 Å and belong to a primitive orthorhombic space group and crystals obtained in the second condition diffracted to 2.93 Å and belong to a primitive monoclinic space group. α-11 Giardin, a protein from the annexin superfamily, is a 35.0 kDa protein from the intestinal protozoan parasite Giardia lamblia which triggers a form of diarrhea called giardiasis. Here, the cloning, expression, purification and the crystallization of α-11more » giardin under two different conditions and in two different space groups is reported. Crystals from the first condition diffracted to 1.1 Å and belong to a primitive orthorhombic space group, while crystals from the second condition, which included calcium in the crystallization solution, diffracted to 2.93 Å and belong to a primitive monoclinic space group. Determination of the detailed atomic structure of α-11 giardin will provide a better insight into its biological function and might establish whether this class of proteins is a potential drug target against giardiasis.« less

Purification, Crystallization and Preliminary X-ray Characterization of Prunin-1, a Major Component of the Almond (Prunus dulcis) Allergen Amandin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Albillos, Silvia M.; Jin, Tengchuan; Howard, Andrew

2008-08-04

The 11S globulins from plant seeds account for a number of major food allergens. Because of the interest in the structural basis underlying the allergenicity of food allergens, we sought to crystallize the main 11S seed storage protein from almond (Prunus dulcis). Prunin-1 (Pru1) was purified from defatted almond flour by water extraction, cryoprecipitation, followed by sequential anion exchange, hydrophobic interaction, and size exclusion chromatography. Single crystals of Pru1 were obtained in a screening with a crystal screen kit, using the hanging-drop vapor diffusion method. Diffraction quality crystals were grown after optimization. The Pru1 crystals diffracted to at least 3.0more » {angstrom} and belong to the tetragonal space group P4{sub 1}22, with unit cell parameters of a = b = 150.912 {angstrom}, c = 165.248 {angstrom}. Self-rotation functions and molecular replacement calculations showed that there are three molecules in the asymmetry unit with water content of 51.41%. The three Pru1 protomers are related by a noncrystallographic 3-fold axis and they form a doughnut-shaped trimer. Two prunin trimers form a homohexamer. Elucidation of prunin structure will allow further characterization of the allergenic features of the 11S protein allergens at the molecular level.« less

[Effects of annealing temperature on the structure and optical properties of ZnMgO films prepared by atom layer deposition].

PubMed

Sun, Dong-Xiao; Li, Jin-Hua; Fang, Xuan; Chen, Xin-Ying; Fang, Fang; Chu, Xue-Ying; Wei, Zhi-Peng; Wang, Xiao-Hua

2014-07-01

In the present paper, we report the research on the effects of annealing temperature on the crystal quality and optical properties of ZnMgO films deposited by atom layer deposition(ALD). ZnMgO films were prepared on quartz substrates by ALD and then some of the samples were treated in air ambient at different annealing temperature. The effects of annealing temperature on the crystal quality and optical properties of ZnMgO films were characterized by X-ray diffraction (XRD), photoluminescence (PL) and ultraviolet-visible (UV-Vis) absorption spectra. The XRD results showed that the crystal quality of ZnMgO films was significantly improved when the annealing temperature was 600 degrees C, meanwhile the intensity of(100) diffraction peak was the strongest. Combination of PL and UV-Vis absorption measurements showed that it can strongly promote the Mg content increasing in ZnMgO films and increase the band gap of films. So the results illustrate that suitable annealing temperature can effectively improve the crystal quality and optical properties of ZnMgO films.

Purification, crystallization and preliminary X-ray diffraction analysis of GatD, a glutamine amidotransferase-like protein from Staphylococcus aureus peptidoglycan

PubMed Central

Vieira, Diana; Figueiredo, Teresa A.; Verma, Anil; Sobral, Rita G.; Ludovice, Ana M.; de Lencastre, Hermínia; Trincao, Jose

2014-01-01

Amidation of peptidoglycan is an essential feature in Staphylococcus aureus that is necessary for resistance to β-lactams and lysozyme. GatD, a 27 kDa type I glutamine amidotransferase-like protein, together with MurT ligase, catalyses the amidation reaction of the glutamic acid residues of the peptidoglycan of S. aureus. The native and the selenomethionine-derivative proteins were crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol, sodium acetate and calcium acetate. The crystals obtained diffracted beyond 1.85 and 2.25 Å, respectively, and belonged to space group P212121. X-ray diffraction data sets were collected at Diamond Light Source (on beamlines I02 and I04) and were used to obtain initial phases. PMID:24817726

Improvements in serial femtosecond crystallography of photosystem II by optimizing crystal uniformity using microseeding procedures

DOE PAGES

Ibrahim, Mohamed; Chatterjee, Ruchira; Hellmich, Julia; ...

2015-07-01

In photosynthesis, photosystem II (PSII) is the multi-subunit membrane protein complex that catalyzes photo-oxidation of water into dioxygen through the oxygen evolving complex (OEC). To understand the water oxidation reaction, it is important to get structural information about the transient and intermediate states of the OEC in the dimeric PSII core complex (dPSIIcc). In recent times, femtosecond X-ray pulses from the free electron laser (XFEL) are being used to obtain X-ray diffraction (XRD) data of dPSIIcc microcrystals at room temperature that are free of radiation damage. In our experiments at the XFEL, we used an electrospun liquid microjet setup thatmore » requires microcrystals less than 40 μm in size. In this study, we explored various microseeding techniques to get a high yield of monodisperse uniform-sized microcrystals. Monodisperse microcrystals of dPSIIcc of uniform size were a key to improve the stability of the jet and the quality of XRD data obtained at the XFEL. This was evident by an improvement of the quality of the datasets obtained, from 6.5 Å, using crystals grown without the micro seeding approach, to 4.5 Å using crystals generated with the new method.« less

Phase modulation due to crystal diffraction by ptychographic imaging

DOE Office of Scientific and Technical Information (OSTI.GOV)

Civita, M.; Diaz, A.; Bean, R. J.

Solving the phase problem in x-ray crystallography has occupied a considerable scientific effort in the 20th century and led to great advances in structural science. Here we use x-ray ptychography to demonstrate an interference method which measures the phase of the beam transmitted through a crystal, relative to the incoming beam, when diffraction takes place. The observed phase change of the direct beam through a small gold crystal is found to agree with both a quasikinematical model and full dynamical theories of diffraction. Our discovery of a diffraction contrast mechanism will enhance the interpretation of data obtained from crystalline samplesmore » using the ptychography method, which provides some of the most accurate x-ray phase-contrast images.« less

Phase modulation due to crystal diffraction by ptychographic imaging

DOE PAGES

Civita, M.; Diaz, A.; Bean, R. J.; ...

2018-03-06

Solving the phase problem in x-ray crystallography has occupied a considerable scientific effort in the 20th century and led to great advances in structural science. Here we use x-ray ptychography to demonstrate an interference method which measures the phase of the beam transmitted through a crystal, relative to the incoming beam, when diffraction takes place. The observed phase change of the direct beam through a small gold crystal is found to agree with both a quasikinematical model and full dynamical theories of diffraction. Our discovery of a diffraction contrast mechanism will enhance the interpretation of data obtained from crystalline samplesmore » using the ptychography method, which provides some of the most accurate x-ray phase-contrast images.« less

Phase modulation due to crystal diffraction by ptychographic imaging

NASA Astrophysics Data System (ADS)

Civita, M.; Diaz, A.; Bean, R. J.; Shabalin, A. G.; Gorobtsov, O. Yu.; Vartanyants, I. A.; Robinson, I. K.

2018-03-01

Solving the phase problem in x-ray crystallography has occupied a considerable scientific effort in the 20th century and led to great advances in structural science. Here we use x-ray ptychography to demonstrate an interference method which measures the phase of the beam transmitted through a crystal, relative to the incoming beam, when diffraction takes place. The observed phase change of the direct beam through a small gold crystal is found to agree with both a quasikinematical model and full dynamical theories of diffraction. Our discovery of a diffraction contrast mechanism will enhance the interpretation of data obtained from crystalline samples using the ptychography method, which provides some of the most accurate x-ray phase-contrast images.

Crystallization and preliminary X-ray crystallographic analysis of the heterodimeric crotoxin complex and the isolated subunits crotapotin and phospholipase A{sub 2}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santos, K. F.; Murakami, M. T.; Cintra, A. C. O.

2007-04-01

Crotoxin, a potent neurotoxin from the venom of the South American rattlesnake Crotalus durissus terrificus, exists as a heterodimer formed between a phospholipase A{sub 2} and a catalytically inactive acidic phospholipase A{sub 2} analogue (crotapotin). Large single crystals of the crotoxin complex and of the isolated subunits have been obtained. Crotoxin, a potent neurotoxin from the venom of the South American rattlesnake Crotalus durissus terrificus, exists as a heterodimer formed between a phospholipase A{sub 2} and a catalytically inactive acidic phospholipase A{sub 2} analogue (crotapotin). Large single crystals of the crotoxin complex and of the isolated subunits have been obtained.more » The crotoxin complex crystal belongs to the orthorhombic space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 38.2, b = 68.7, c = 84.2 Å, and diffracted to 1.75 Å resolution. The crystal of the phospholipase A{sub 2} domain belongs to the hexagonal space group P6{sub 1}22 (or its enantiomorph P6{sub 5}22), with unit-cell parameters a = b = 38.7, c = 286.7 Å, and diffracted to 2.6 Å resolution. The crotapotin crystal diffracted to 2.3 Å resolution; however, the highly diffuse diffraction pattern did not permit unambiguous assignment of the unit-cell parameters.« less

Racemic & quasi-racemic protein crystallography enabled by chemical protein synthesis.

PubMed

Kent, Stephen Bh

2018-04-04

A racemic protein mixture can be used to form centrosymmetric crystals for structure determination by X-ray diffraction. Both the unnatural d-protein and the corresponding natural l-protein are made by total chemical synthesis based on native chemical ligation-chemoselective condensation of unprotected synthetic peptide segments. Racemic protein crystallography is important for structure determination of the many natural protein molecules that are refractory to crystallization. Racemic mixtures facilitate the crystallization of recalcitrant proteins, and give diffraction-quality crystals. Quasi-racemic crystallization, using a single d-protein molecule, can facilitate the determination of the structures of a series of l-protein analog molecules. Copyright © 2018 Elsevier Ltd. All rights reserved.

Growth and characterization of ammonium nickel-cobalt sulfate Tutton's salt for UV light applications

NASA Astrophysics Data System (ADS)

Ghosh, Santunu; Oliveira, Michelle; Pacheco, Tiago S.; Perpétuo, Genivaldo J.; Franco, Carlos J.

2018-04-01

We have obtained a set of sample crystals of the family of Tutton's salt comprise in the isomorphic series with general chemical formula (NH4)2NixCo(1-x) (SO4)2·6H2O, by employing growth from solutions by slow evaporation technique. The samples crystals were characterized by ICP-AES, X-ray powder diffraction analysis, thermogravimetric analysis, UV-Vis-NIR, Raman and FTIR spectroscopy. This type of material has been studied because of its physical and chemical properties not yet understood and they have potential technological applications. Chemical analysis of the samples by ICP-AES method allowed us to investigate the efficiency of the method of growth used. Thermogravimetric analysis provides the information about the thermal stability of the obtained crystals for high temperature applications, and powder X-ray diffraction analysis at ambient and high temperature reveals the structural quality and structural change of the samples respectively. We have used Raman spectroscopy in the range 100-4000 cm-1 and FTIR spectroscopy in the range 400-4000 cm-1 to understand the internal vibrational mode of the octahedral complexes [Ni(H2O)6]2+ and [Co(H2O)6]2+, SO42- and NH4+ tetrahedra. The transmittance of our mixed ammonium nickel cobalt sulfate hexahydrate (ACNSH) crystals is 75% in the UV region, which indicates that they are ideal to use in UV light filters and UV sensors.

Surface-treated self-standing curved crystals as high-efficiency elements for X- and γ-ray optics: theory and experiment.

PubMed

Bonnini, Elisa; Buffagni, Elisa; Zappettini, Andrea; Doyle, Stephen; Ferrari, Claudio

2015-06-01

The efficiency of a Laue lens for X- and γ-ray focusing in the energy range 60-600 keV is closely linked to the diffraction efficiency of the single crystals composing the lens. A powerful focusing system is crucial for applications like medical imaging and X-ray astronomy where wide beams must be focused. Mosaic crystals with a high density, such as Cu or Au, and bent crystals with curved diffracting planes (CDPs) are considered for the realization of a focusing system for γ-rays, owing to their high diffraction efficiency in a predetermined angular range. In this work, a comparison of the efficiency of CDP crystals and Cu and Au mosaic crystals was performed on the basis of the theory of X-ray diffraction. Si, GaAs and Ge CDP crystals with optimized thicknesses and moderate radii of curvature of several tens of metres demonstrate comparable or superior performance with respect to the higher atomic number mosaic crystals generally used. In order to increase the efficiency of the lens further, a stack of several CDP crystals is proposed as an optical element. CDP crystals were obtained by a surface-damage method, and a stack of two surface-damaged bent Si crystals was prepared and tested. Rocking curves of the stack were performed with synchrotron radiation at 19 keV to check the lattice alignment: they exhibited only one diffraction peak.

Top-seeded solution growth of SrTiO3 single crystals virtually free of mosaicity

NASA Astrophysics Data System (ADS)

Guguschev, Christo; Kok, Dirk J.; Juda, Uta; Uecker, Reinhard; Sintonen, Sakari; Galazka, Zbigniew; Bickermann, Matthias

2017-06-01

Strontium titanate (SrTiO3), a well-established traditional perovskite substrate as well as a promising substrate crystal for the epitaxy of new advanced perovskite-type thin films, suffers from the unavailability in adequate quality for the latter. To improve the situation attempts have been made to grow SrTiO3 at moderate temperatures (<1535 °C) well below the melting temperature and under low temperature gradients by the top-seeded solution growth method. Based on very special modifications of the growth conditions, virtually mosaicity-free SrTiO3 single crystals in the 1-2 cm range were obtained. High crystalline quality was verified by defect selective etching, rocking curve measurements, energy dispersive Laue mappings and by synchrotron X-Ray diffraction topography. The production of virtually subgrain- and dislocation free substrate crystals is essential to considerably improve characteristics of SrTiO3 based SQUIDs, transistors or memory devices and to allow an in-depth analysis of intrinsic and extrinsic factors influencing the properties of epitaxially grown oxide heterostructures.

Crystallization and preliminary crystallographic analysis of the Clostridium perfringens enterotoxin

PubMed Central

Briggs, David C.; Smedley, James G.; McClane, Bruce A.; Basak, Ajit K.

2010-01-01

Clostridium perfringens is a Gram-positive anaerobic species of bacterium that is notable for its ability to produce a plethora of toxins, including membrane-active toxins (α-toxins), pore-forming toxins (∊-toxins) and binary toxins (ι-toxins). Here, the crystallization of the full-length wild-type C. perfringens enterotoxin is reported, which is the causative agent of the second most prevalent food-borne illness in the United States and has been implicated in many other gastrointestinal pathologies. Several crystal forms were obtained. However, only two of these optimized crystal forms (I and II) were useable for X-ray diffraction data collection. The form I crystals diffracted to d min = 2.7 Å and belonged to space group C2, while the form II crystals diffracted to d min = 4 Å and belonged to space group P213. PMID:20606275

Crystal structure determination of new antimitotic agent bis(p-fluorobenzyl)trisulfide.

PubMed

An, Haoyun; Hu, Xiurong; Gu, Jianming; Chen, Linshen; Xu, Weiming; Mo, Xiaopeng; Xu, Wanhong; Wang, Xiaobo; Xu, Xiao

2008-01-01

The purpose of this research was to investigate the physical characteristics and crystalline structure of bis(p-fluorobenzyl)trisulfide, a new anti-tumor agent. Methods used included X-ray single crystal diffraction, X-ray powder diffraction (XRPD), Fourier-transform infrared (FT-IR) spectroscopy, differential scanning calorimetric (DSC) and thermogravimetric (TG) analyses. The findings obtained with X-ray single crystal diffraction showed that a monoclinic unit cell was a = 12.266(1) A, b = 4.7757(4) A, c = 25.510(1) A, beta = 104.25(1) degrees ; cell volume = 1,448.4(2) A(3), Z = 4, and space group C2/c. The XRPD studies of the four crystalline samples, obtained by recrystallization from four different solvents, indicated that they had the same diffraction patterns. The diffraction pattern stimulated from the crystal structure data is in excellent agreement with the experimental results. In addition, the identical FT-IR spectra of the four crystalline samples revealed absorption bands corresponding to S-S and C-S stretching as well as the characteristic aromatic substitution. Five percent weight loss at 163.3 degrees C was observed when TG was used to study the decomposition process in the temperature range of 20-200 degrees C. DSC also allowed for the determination of onset temperatures at 60.4(1)-60.7(3) degrees C and peak temperatures at 62.1(3)-62.4(3) degrees C for the four crystalline samples studied. The results verified that the single crystal structure shared the same crystal form with the four crystalline samples investigated.

Purification, crystallization and preliminary X-ray diffraction analysis of royal palm tree (Roystonea regia) peroxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, Leandra; Nascimento, Alessandro S.; Zamorano, Laura S.

2007-09-01

The purification, crystallization, X-ray diffraction data acquisition and molecular-replacement results of royal palm tree (R. regia) peroxidase are described. Royal palm tree peroxidase (RPTP), which was isolated from Roystonea regia leaves, has an unusually high stability that makes it a promising candidate for diverse applications in industry and analytical chemistry [Caramyshev et al. (2005 ▶), Biomacromolecules, 6, 1360–1366]. Here, the purification and crystallization of this plant peroxidase and its X-ray diffraction data collection are described. RPTP crystals were obtained by the hanging-drop vapour-diffusion method and diffraction data were collected to a resolution of 2.8 Å. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 116.83, c = 92.24 Å, and contain one protein molecule per asymmetric unit. The V{sub M} value and solvent content are 4.07 Å{sup 3} Da{sup −1} and 69.8%, respectively.« less

Syntheses, Characterizations, and Applications of Molecular Metal Wires

DTIC Science & Technology

2011-08-05

treated with KPF6 (500 mg, 2.7 mmol). A dark greenish-brown complex was obtained after evaporation. The single crystals suitable for X-ray diffraction...CH2Cl2. Recrystallization from a CH2Cl2 solution layered with hexane gave deep brown single crystals suitable for X-ray diffraction. Yield: 83 mg...5 Synthetic challenges Conductance of single molecules Concluding Remarks

Continuous diffraction of molecules and disordered molecular crystals

PubMed Central

Yefanov, Oleksandr M.; Ayyer, Kartik; White, Thomas A.; Barty, Anton; Morgan, Andrew; Mariani, Valerio; Oberthuer, Dominik; Pande, Kanupriya

2017-01-01

The intensities of far-field diffraction patterns of orientationally aligned molecules obey Wilson statistics, whether those molecules are in isolation (giving rise to a continuous diffraction pattern) or arranged in a crystal (giving rise to Bragg peaks). Ensembles of molecules in several orientations, but uncorrelated in position, give rise to the incoherent sum of the diffraction from those objects, modifying the statistics in a similar way as crystal twinning modifies the distribution of Bragg intensities. This situation arises in the continuous diffraction of laser-aligned molecules or translationally disordered molecular crystals. This paper develops the analysis of the intensity statistics of such continuous diffraction to obtain parameters such as scaling, beam coherence and the number of contributing independent object orientations. When measured, continuous molecular diffraction is generally weak and accompanied by a background that far exceeds the strength of the signal. Instead of just relying upon the smallest measured intensities or their mean value to guide the subtraction of the background, it is shown how all measured values can be utilized to estimate the background, noise and signal, by employing a modified ‘noisy Wilson’ distribution that explicitly includes the background. Parameters relating to the background and signal quantities can be estimated from the moments of the measured intensities. The analysis method is demonstrated on previously published continuous diffraction data measured from crystals of photosystem II [Ayyer et al. (2016 ▸), Nature, 530, 202–206]. PMID:28808434

Ultra-fast switching blue phase liquid crystals diffraction grating stabilized by chiral monomer

NASA Astrophysics Data System (ADS)

Manda, Ramesh; Pagidi, Srinivas; Sarathi Bhattacharya, Surjya; Yoo, Hyesun; T, Arun Kumar; Lim, Young Jin; Lee, Seung Hee

2018-05-01

We have demonstrated an ultra-fast switching and efficient polymer stabilized blue phase liquid crystal (PS-BPLC) diffraction grating utilizing a chiral monomer. We have obtained a 0.5 ms response time by a novel polymer stabilization method which is three times faster than conventional PS-BPLC. In addition, the diffraction efficiency was improved 2% with a much wider phase range and the driving voltage to switch the device is reduced. The polarization properties of the diffracted beam are unaffected by this novel polymer stabilization. This device can be useful for future photonic applications.

Preliminary morphological and X-ray diffraction studies of the crystals of the DNA cetyltrimethylammonium salt.

PubMed

Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y

1977-04-01

Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained.

Preliminary morphological and X-ray diffraction studies of the crystals of the DNA cetyltrimethylammonium salt.

PubMed Central

Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y

1977-01-01

Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained. Images PMID:866188

Electromigration in epitaxial Cu(001) lines

NASA Astrophysics Data System (ADS)

Ramanath, G.; Kim, H.; Goindi, H. S.; Frederick, M. J.; Shin, C.-S.; Goswami, R.; Petrov, I.; Greene, J. E.

2002-04-01

We report the electromigration (EM) response of single-domain epitaxial Cu(001) lines on layers of Ta, TaN, and TiN. Epitaxial Cu(001) lines on nitride layers exhibit nearly two orders of magnitude higher mean-time-to-failure (MTTF) values than those on Ta, indicating the strong influence of the underlayer. The activation energy of EM for Cu on the nitrides is ˜0.8-1.2 eV, and that of Cu on Ta is ˜0.2 eV, for 200-300 °C. Our results also indicate that the MTTF values correlate inversely to the crystal quality of the Cu layers measured by X-ray diffraction. The EM resistance of epitaxial Cu lines with different crystal quality on TaN were measured to separate the effects of interface chemistry and crystal quality. While higher quality epitaxial films reveal a higher EM resistance, the magnitude of the change is smaller than that obtained by changing the interface chemistry. Epitaxial lines exhibit more than 3-4 orders of magnitude higher MTTF than polycrystalline lines on the same underlayer. Based upon our results, we propose that the Cu/underlayer interface chemistry and presence of grain boundary diffusion play important roles in unpassivated Cu films.

Protein Crystal Movements and Fluid Flows During Microgravity Growth

NASA Technical Reports Server (NTRS)

Boggon, Titus J.; Chayen, Naomi E.; Snell, Edward H.; Dong, Jun; Lautenschlager, Peter; Potthast, Lothar; Siddons, D. Peter; Stojanoff, Vivian; Gordon, Elspeth; Thompson, Andrew W.;

Valence-band and core-level photoemission study of single-crystal Bi2CaSr2Cu2O8 superconductors

NASA Astrophysics Data System (ADS)

Shen, Z.-X.; Lindberg, P. A. P.; Wells, B. O.; Mitzi, D. B.; Lindau, I.; Spicer, W. E.; Kapitulnik, A.

1988-12-01

High-quality single crystals of Bi2CaSr2Cu2O8 superconductors have been prepared and cleaved in ultrahigh vacuum. Low-energy electron diffraction measurements show that the surface structure is consistent with the bulk crystal structure. Ultraviolet photoemission and x-ray photoemission experiments were performed on these well-characterized sample surfaces. The valence-band and the core-level spectra obtained from the single-crystal surfaces are in agreement with spectra recorded from polycrystalline samples, justifying earlier results from polycrystalline samples. Cu satellites are observed both in the valence band and Cu 2p core level, signaling the strong correlation among the Cu 3d electrons. The O 1s core-level data exhibit a sharp, single peak at 529-eV binding energy without any clear satellite structures.

Disparities in correlating microstructural to nanostructural preservation of dinosaur femoral bones

NASA Astrophysics Data System (ADS)

Kim, Jung-Kyun; Kwon, Yong-Eun; Lee, Sang-Gil; Lee, Ji-Hyun; Kim, Jin-Gyu; Huh, Min; Lee, Eunji; Kim, Youn-Joong

2017-03-01

Osteohistological researches on dinosaurs are well documented, but descriptions of direct correlations between the bone microstructure and corresponding nanostructure are currently lacking. By applying correlative microscopy, we aimed to verify that well-preserved osteohistological features correlate with pristine fossil bone nanostructures from the femoral bones of Koreanosaurus boseongensis. The quality of nanostructural preservation was evaluated based on the preferred orientation level of apatite crystals obtained from selected area electron diffraction (SAED) patterns and by measuring the “arcs” from the {100} and {002} diffraction rings. Unlike our expectations, our results revealed that well-preserved microstructures do not guarantee pristine nanostructures and vice versa. Structural preservation of bone from macro- to nanoscale primarily depends on original bioapatite density, and subsequent taphonomical factors such as effects from burial, pressure, influx of external elements and the rate of diagenetic alteration of apatite crystals. Our findings suggest that the efficient application of SAED analysis opens the opportunity for comprehensive nanostructural investigations of bone.

Studies on 2-amino-5-nitropyridinium nitrate (2A5NPN): A semi-organic third order nonlinear optical single crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sivasubramani, V.; Pandian, Muthu Senthil, E-mail: senthilpandianm@ssn.edu.in; Ramasamy, P.

2016-05-23

2-amino-5-nitropyridinium nitrate (2A5NPN) is a semi-organic nonlinear optical crystal and optically good quality 2A5NPN single crystals were successfully grown by slow evaporation solution growth technique (SEST) at ambient temperature. The crystallographic structure of the grown crystal was determined by single crystal X-Ray diffraction analysis and it belongs to Monoclinic crystal system with centro symmetric crystalline nature. The crystallinity of the grown crystal was confirmed by powder X-ray diffraction analysis. The other physical properties of grown crystals are also characterized using TG-DTA, UV-Visible NIR, chemical etching, photoconductivity and Z-scan measurements. The Z-scan method reveals that the 2A5NPN crystal possesses multi photonmore » absorption behaviour and the significantly higher third order susceptibility and it is a promising potential NLO material.« less

Investigations on synthesis, growth and physicochemical properties of semi-organic NLO crystal bis(thiourea) ammonium nitrate for nonlinear frequency conversion

NASA Astrophysics Data System (ADS)

Anbarasi, A.; Ravi Kumar, S. M.; Sundar, G. J. Shanmuga; Mosses, M. Allen; Raj, M. Packiya; Prabhakaran, M.; Ravisankar, R.; Gunaseelan, R.

2017-10-01

Bis(thiourea) ammonium nitrate (BTAN), a new nonlinear optical crystal was grown successfully by slow evaporation technique using water as solvent at room temperature. The grown crystals were optically good quality with dimensions upto 10 × 6 × 3 mm3. Single crystal X-Ray diffraction analysis reveals that the crystal lattice is orthorhombic. From Powder X-ray diffraction analysis the diffraction planes have been indexed. The presence of the various functional groups of BTAN was identified through FTIR spectroscopic analysis. UV cut-off wavelength was observed from optical absorbance spectrum and it was found to be 240 nm. Second harmonic efficiency was determined using Kurtz powder method in comparison with KDP to confirm the nonlinearity of the material. Thermal analysis confirmed that grown crystal is thermally stable upto 184 °C. Microhardness studies show that hardness number (Hv) increases with load. Conductivity measurements such as dielectric, ac and photoconductivity were studied. Growth mechanism and surface features of the as grown single crystal was analysed by chemical etching analysis.

Structural properties of a family of hydrogen-bonded co-crystals formed between gemfibrozil and hydroxy derivatives of t-butylamine, determined directly from powder X-ray diffraction data

NASA Astrophysics Data System (ADS)

Cheung, Eugene Y.; David, Sarah E.; Harris, Kenneth D. M.; Conway, Barbara R.; Timmins, Peter

2007-03-01

We report the formation and structural properties of co-crystals containing gemfibrozil and hydroxy derivatives of t-butylamine H 2NC(CH 3) 3-n(CH 2OH) n, with n=0, 1, 2 and 3. In each case, a 1:1 co-crystal is formed, with transfer of a proton from the carboxylic acid group of gemfibrozil to the amino group of the t-butylamine derivative. All of the co-crystal materials prepared are polycrystalline powders, and do not contain single crystals of suitable size and/or quality for single crystal X-ray diffraction studies. Structure determination of these materials has been carried out directly from powder X-ray diffraction data, using the direct-space Genetic Algorithm technique for structure solution followed by Rietveld refinement. The structural chemistry of this series of co-crystal materials reveals well-defined structural trends within the first three members of the family ( n=0, 1, 2), but significantly contrasting structural properties for the member with n=3.

Crystallization and preliminary X-ray diffraction analysis of restriction endonuclease EcoRII

NASA Technical Reports Server (NTRS)

Karpova, E. A.; Meehan, E.; Pusey, M. L.; Chen, L.

1999-01-01

Crystals of the restriction endonuclease EcoRII have been obtained by the vapor-diffusion technique in the presence of ammonium sulfate or polyethylene glycol. The best crystals were grown with ammonium sulfate as a precipitant. Crystals with dimensions of up to 0.6 x 0. 6 x 0.6 mm have been observed. The crystals diffract to about 4.0 A resolution at a cryo-temperature of 100 K using a rotating-anode X-ray source and a Rigaku R-AXIS IV imaging-plate detector. The space group has been determined to be either I23 or I2(1)3, with unit-cell parameters a = b = c = 160.3 A, alpha = beta = gamma = 90 degrees. The crystal asymmetric unit contains two protein molecules, and self-rotation function analysis shows a pseudo-twofold symmetry relating the two monomers. Attempts to improve the resolution of crystal diffraction and to search for heavy-atom derivatives are under way.

Crystallization and preliminary X-ray studies of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of Agkistrodon acutus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hou, Jing; Li, Ming; Chen, Jiashu

Crystals of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of A. acutus have been obtained and characterized by X-ray diffraction. A non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of Agkistrodon acutus has been crystallized by the hanging-drop method. The crystals belong to space group P3{sub 1}21, with unit-cell parameters a = b = 80.57, c = 66.77 Å and one molecule in the asymmetric unit. X-ray diffraction data were collected to 1.86 Å resolution.

Use of a miniature diamond-anvil cell in high-pressure single-crystal neutron Laue diffraction

PubMed Central

Binns, Jack; Kamenev, Konstantin V.; McIntyre, Garry J.; Moggach, Stephen A.; Parsons, Simon

2016-01-01

The first high-pressure neutron diffraction study in a miniature diamond-anvil cell of a single crystal of size typical for X-ray diffraction is reported. This is made possible by modern Laue diffraction using a large solid-angle image-plate detector. An unexpected finding is that even reflections whose diffracted beams pass through the cell body are reliably observed, albeit with some attenuation. The cell body does limit the range of usable incident angles, but the crystallographic completeness for a high-symmetry unit cell is only slightly less than for a data collection without the cell. Data collections for two sizes of hexamine single crystals, with and without the pressure cell, and at 300 and 150 K, show that sample size and temperature are the most important factors that influence data quality. Despite the smaller crystal size and dominant parasitic scattering from the diamond-anvil cell, the data collected allow a full anisotropic refinement of hexamine with bond lengths and angles that agree with literature data within experimental error. This technique is shown to be suitable for low-symmetry crystals, and in these cases the transmission of diffracted beams through the cell body results in much higher completeness values than are possible with X-rays. The way is now open for joint X-ray and neutron studies on the same sample under identical conditions. PMID:27158503

The Stanford Automated Mounter: Enabling High-Throughput Protein Crystal Screening at SSRL

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smith, C.A.; Cohen, A.E.

2009-05-26

The macromolecular crystallography experiment lends itself perfectly to high-throughput technologies. The initial steps including the expression, purification, and crystallization of protein crystals, along with some of the later steps involving data processing and structure determination have all been automated to the point where some of the last remaining bottlenecks in the process have been crystal mounting, crystal screening, and data collection. At the Stanford Synchrotron Radiation Laboratory, a National User Facility that provides extremely brilliant X-ray photon beams for use in materials science, environmental science, and structural biology research, the incorporation of advanced robotics has enabled crystals to be screenedmore » in a true high-throughput fashion, thus dramatically accelerating the final steps. Up to 288 frozen crystals can be mounted by the beamline robot (the Stanford Auto-Mounting System) and screened for diffraction quality in a matter of hours without intervention. The best quality crystals can then be remounted for the collection of complete X-ray diffraction data sets. Furthermore, the entire screening and data collection experiment can be controlled from the experimenter's home laboratory by means of advanced software tools that enable network-based control of the highly automated beamlines.« less

X-ray transparent microfluidic chip for mesophase-based crystallization of membrane proteins and on-chip structure determination

DOE PAGES

Khvostichenko, Daria S.; Schieferstein, Jeremy M.; Pawate, Ashtamurthy S.; ...

2014-08-21

Crystallization from lipidic mesophase matrices is a promising route to diffraction-quality crystals and structures of membrane proteins. The microfluidic approach reported here eliminates two bottlenecks of the standard mesophase-based crystallization protocols: (i) manual preparation of viscous mesophases and (ii) manual harvesting of often small and fragile protein crystals. In the approach reported here, protein-loaded mesophases are formulated in an X-ray transparent microfluidic chip using only 60 nL of the protein solution per crystallization trial. The X-ray transparency of the chip enables diffraction data collection from multiple crystals residing in microfluidic wells, eliminating the normally required manual harvesting and mounting ofmore » individual crystals. In addition, we validated our approach by on-chip crystallization of photosynthetic reaction center, a membrane protein from Rhodobacter sphaeroides, followed by solving its structure to a resolution of 2.5 Å using X-ray diffraction data collected on-chip under ambient conditions. A moderate conformational change in hydrophilic chains of the protein was observed when comparing the on-chip, room temperature structure with known structures for which data were acquired under cryogenic conditions.« less

X-ray Transparent Microfluidic Chip for Mesophase-Based Crystallization of Membrane Proteins and On-Chip Structure Determination

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khvostichenko, Daria S.; Schieferstein, Jeremy M.; Pawate, Ashtamurthy S.

2014-10-01

Crystallization from lipidic mesophase matrices is a promising route to diffraction-quality crystals and structures of membrane proteins. The microfluidic approach reported here eliminates two bottlenecks of the standard mesophase-based crystallization protocols: (i) manual preparation of viscous mesophases and (ii) manual harvesting of often small and fragile protein crystals. In the approach reported here, protein-loaded mesophases are formulated in an X-ray transparent microfluidic chip using only 60 nL of the protein solution per crystallization trial. The X-ray transparency of the chip enables diffraction data collection from multiple crystals residing in microfluidic wells, eliminating the normally required manual harvesting and mounting ofmore » individual crystals. We validated our approach by on-chip crystallization of photosynthetic reaction center, a membrane protein from Rhodobacter sphaeroides, followed by solving its structure to a resolution of 2.5 Å using X-ray diffraction data collected on-chip under ambient conditions. A moderate conformational change in hydrophilic chains of the protein was observed when comparing the on-chip, room temperature structure with known structures for which data were acquired under cryogenic conditions.« less

Controlling Vapor Pressure In Hanging-Drop Crystallization

NASA Technical Reports Server (NTRS)

Carter, Daniel C.; Smith, Robbie

1988-01-01

Rate of evaporation adjusted to produce larger crystals. Device helps to control vapor pressure of water and other solvents in vicinity of hanging drop of solution containing dissolved enzyme protein. Well of porous frit (sintered glass) holds solution in proximity to drop of solution containing protein or enzyme. Vapor from solution in frit controls evaporation of solvent from drop to control precipitation of protein or enzyme. With device, rate of nucleation limited to decrease number and increase size (and perhaps quality) of crystals - large crystals of higher quality needed for x-ray diffraction studies of macromolecules.

Flux growth of high-quality CoFe 2O 4 single crystals and their characterization

NASA Astrophysics Data System (ADS)

Wang, W. H.; Ren, X.

2006-04-01

We report the growth of high-quality CoFe 2O 4 single crystals using a borax flux method. The crystals were characterized by powder X-ray diffraction, electron probe microanalysis and Raman spectroscopy. We found the crystals are flux-free and highly homogeneous in composition. X-ray rocking curves of the CoFe 2O 4 single crystals showed a full-width at half-maximum of 0.15°. The saturation magnetization of the CoFe 2O 4 single crystals was measured to be 90 emu/g or equivalently 3.65 μ B/f.u. at 5 K.

Three-dimensional Bragg coherent diffraction imaging of an extended ZnO crystal.

PubMed

Huang, Xiaojing; Harder, Ross; Leake, Steven; Clark, Jesse; Robinson, Ian

2012-08-01

A complex three-dimensional quantitative image of an extended zinc oxide (ZnO) crystal has been obtained using Bragg coherent diffraction imaging integrated with ptychography. By scanning a 2.5 µm-long arm of a ZnO tetrapod across a 1.3 µm X-ray beam with fine step sizes while measuring a three-dimensional diffraction pattern at each scan spot, the three-dimensional electron density and projected displacement field of the entire crystal were recovered. The simultaneously reconstructed complex wavefront of the illumination combined with its coherence properties determined by a partial coherence analysis implemented in the reconstruction process provide a comprehensive characterization of the incident X-ray beam.

Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishimura, Mitsuhiro; Protein Research Group, RIKEN Yokohama Institute, RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045; Kaminishi, Tatsuya

2007-11-01

A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to spacemore » group P3{sub 1}21 or P3{sub 2}21.« less

Projection x-ray topography system at 1-BM x-ray optics test beamline at the advanced photon source

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stoupin, Stanislav, E-mail: sstoupin@aps.anl.gov; Liu, Zunping; Trakhtenberg, Emil

2016-07-27

Projection X-ray topography of single crystals is a classic technique for the evaluation of intrinsic crystal quality of large crystals. In this technique a crystal sample and an area detector (e.g., X-ray film) collecting intensity of a chosen crystallographic reflection are translated simultaneously across an X-ray beam collimated in the diffraction scattering plane (e.g., [1, 2]). A bending magnet beamline of a third-generation synchrotron source delivering x-ray beam with a large horizontal divergence, and therefore, a large horizontal beam size at a crystal sample position offers an opportunity to obtain X-ray topographs of large crystalline samples (e.g., 6-inch wafers) inmore » just a few exposures. Here we report projection X-ray topography system implemented recently at 1-BM beamline of the Advanced Photon Source. A selected X-ray topograph of a 6-inch wafer of 4H-SiC illustrates capabilities and limitations of the technique.« less

In situ neutron diffraction study of twin reorientation and pseudoplastic strain in Ni-Mn-Ga single crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stoica, Alexandru Dan

2011-01-01

Twin variant reorientation in single-crystal Ni-Mn-Ga during quasi-static mechanical compression was studied using in situ neutron diffraction. The volume fraction of reoriented twin variants for different stress amplitudes were obtained from the changes in integrated intensities of high-order neutron diffraction peaks. It is shown that, during compressive loading, {approx}85% of the twins were reoriented parallel to the loading direction resulting in a maximum pseudoplasticstrain of {approx}5.5%, which is in agreement with measured macroscopic strain.

Coherent X-ray beam metrology using 2D high-resolution Fresnel-diffraction analysis.

PubMed

Ruiz-Lopez, M; Faenov, A; Pikuz, T; Ozaki, N; Mitrofanov, A; Albertazzi, B; Hartley, N; Matsuoka, T; Ochante, Y; Tange, Y; Yabuuchi, T; Habara, T; Tanaka, K A; Inubushi, Y; Yabashi, M; Nishikino, M; Kawachi, T; Pikuz, S; Ishikawa, T; Kodama, R; Bleiner, D

2017-01-01

Direct metrology of coherent short-wavelength beamlines is important for obtaining operational beam characteristics at the experimental site. However, since beam-time limitation imposes fast metrology procedures, a multi-parametric metrology from as low as a single shot is desirable. Here a two-dimensional (2D) procedure based on high-resolution Fresnel diffraction analysis is discussed and applied, which allowed an efficient and detailed beamline characterization at the SACLA XFEL. So far, the potential of Fresnel diffraction for beamline metrology has not been fully exploited because its high-frequency fringes could be only partly resolved with ordinary pixel-limited detectors. Using the high-spatial-frequency imaging capability of an irradiated LiF crystal, 2D information of the coherence degree, beam divergence and beam quality factor M 2 were retrieved from simple diffraction patterns. The developed beam metrology was validated with a laboratory reference laser, and then successfully applied at a beamline facility, in agreement with the source specifications.

Feasibility of one-shot-per-crystal structure determination using Laue diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cornaby, Sterling; CHESS; Szebenyi, Doletha M. E.

Structure determination was successfully carried out using single Laue exposures from a group of lysozyme crystals. The Laue method may be a viable option for collection of one-shot-per-crystal data from microcrystals. Crystal size is an important factor in determining the number of diffraction patterns which may be obtained from a protein crystal before severe radiation damage sets in. As crystal dimensions decrease this number is reduced, eventually falling to one, at which point a complete data set must be assembled using data from multiple crystals. When only a single exposure is to be collected from each crystal, the polychromatic Lauemore » technique may be preferable to monochromatic methods owing to its simultaneous recording of a large number of fully recorded reflections per image. To assess the feasibility of solving structures using single Laue images from multiple crystals, data were collected using a ‘pink’ beam at the CHESS D1 station from groups of lysozyme crystals with dimensions of the order of 20–30 µm mounted on MicroMesh grids. Single-shot Laue data were used for structure determination by molecular replacement and correct solutions were obtained even when as few as five crystals were used.« less

Crystal engineering: co-crystals of cinnamic acid derivatives with a pyridyl derivative co-crystallizer.

PubMed

Lorenzo, Daniel A; Forrest, Sebastian J K; Sparkes, Hazel A

2016-02-01

A number of hydrogen-bonded co-crystals, consisting of a cinnamic acid derivative and a pyridyl co-crystallizer, have been synthesized and their properties investigated by X-ray diffraction. Samples were prepared by recrystallization or solvent drop grinding of trans-cinnamic acid (1), 4-methylcinnamic acid (2), 4-methoxy cinnamic acid (3) or 3,4-methoxy cinnamic acid (4), with 4,4-dipyridyl (A), iso-nicotinamide (B) or nicotinamide (C). The X-ray single-crystal structures of seven novel co-crystals, obtained through recrystallization, are examined and the hydrogen-bonding interactions discussed. Consistent hydrogen-bonding motifs were observed for samples prepared when using 4,4-dipyridyl (A) or iso-nicotinamide (B) as the co-crystallizing agent. Powder X-ray diffraction analysis of the samples prepared by solvent drop grinding suggests the formation of ten co-crystals.

A Test of Macromolecular Crystallization in Microgravity: Large, Well-Ordered Insulin Crystals

NASA Technical Reports Server (NTRS)

Borgstahl, Gloria E. O.; Vahedi-Faridi, Ardeschir; Lovelace, Jeff; Bellamy, Henry D.; Snell, Edward H.; Whitaker, Ann F. (Technical Monitor)

2001-01-01

Crystals of insulin grown in microgravity on space shuttle mission STS-95 were extremely well-ordered and unusually large (many > 2 mm). The physical characteristics of six microgravity and six earth-grown crystals were examined by X-ray analysis employing superfine f slicing and unfocused synchrotron radiation. This experimental setup allowed hundreds of reflections to be precisely examined for each crystal in a short period of time. The microgravity crystals were on average 34 times larger, had 7 times lower mosaicity, had 54 times higher reflection peak heights and diffracted to significantly higher resolution than their earth grown counterparts. A single mosaic domain model could account for reflections in microgravity crystals whereas reflections from earth crystals required a model with multiple mosaic domains. This statistically significant and unbiased characterization indicates that the microgravity environment was useful for the improvement of crystal growth and resultant diffraction quality in insulin crystals and may be similarly useful for macromolecular crystals in general.

A low-cost method for visible fluorescence imaging.

PubMed

Tarver, Crissy L; Pusey, Marc

2017-12-01

A wide variety of crystallization solutions are screened to establish conditions that promote the growth of a diffraction-quality crystal. Screening these conditions requires the assessment of many crystallization plates for the presence of crystals. Automated systems for screening and imaging are very expensive. A simple approach to imaging trace fluorescently labeled protein crystals in crystallization plates has been devised, and can be implemented at a cost as low as $50. The proteins β-lactoglobulin B, trypsin and purified concanavalin A (ConA) were trace fluorescently labeled using three different fluorescent probes: Cascade Yellow (CY), Carboxyrhodamine 6G (CR) and Pacific Blue (PB). A crystallization screening plate was set up using β-lactoglobulin B labeled with CR, trypsin labeled with CY, ConA labeled with each probe, and a mixture consisting of 50% PB-labeled ConA and 50% CR-labeled ConA. The wells of these plates were imaged using a commercially available macro-imaging lens attachment for smart devices that have a camera. Several types of macro lens attachments were tested with smartphones and tablets. Images with the highest quality were obtained with an iPhone 6S and an AUKEY Ora 10× macro lens. Depending upon the fluorescent probe employed and its Stokes shift, a light-emitting diode or a laser diode was used for excitation. An emission filter was used for the imaging of protein crystals labeled with CR and crystals with two-color fluorescence. This approach can also be used with microscopy systems commonly used to observe crystallization plates.

Curved crystals for high-resolution focusing of X and gamma rays through a Laue lens

NASA Astrophysics Data System (ADS)

Guidi, Vincenzo; Bellucci, Valerio; Camattari, Riccardo; Neri, Ilaria

2013-08-01

Crystals with curved diffracting planes have been investigated as high-efficiency optical components for the realization of a Laue lens for satellite-borne experiments in astrophysics. At Sensor and Semiconductor Laboratory (Ferrara, Italy) a research and development plan to implement Si and Ge curved crystals by surface grooving technique has been undertaken. The method of surface grooving allows obtaining Si and Ge curved crystals with self-standing curvature, i.e., with no need for external bending device, which is a mandatory issue in satellite-borne experiments. Si and Ge grooved crystals have been characterized by X-ray diffraction at ESRF and ILL to prove their functionality for a high-reflectivity Laue lens.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imamura, Kayo; Matsuura, Takanori; Ye, Zhengmao

Disproportionating enzyme from potato was crystallized and preliminarily analyzed using X-ray diffraction. Disproportionating enzyme (D-enzyme; EC 2.4.1.25) is a 59 kDa protein that belongs to the α-amylase family. D-enzyme catalyses intramolecular and intermolecular transglycosylation reactions of α-1,4 glucan. A crystal of the D-enzyme from potato was obtained by the hanging-drop vapour-diffusion method. Preliminary X-ray data showed that the crystal diffracts to 2.0 Å resolution and belongs to space group C222{sub 1}, with unit-cell parameters a = 69.7, b = 120.3, c = 174.2 Å.

The statistical kinematical theory of X-ray diffraction as applied to reciprocal-space mapping

PubMed

Nesterets; Punegov

2000-11-01

The statistical kinematical X-ray diffraction theory is developed to describe reciprocal-space maps (RSMs) from deformed crystals with defects of the structure. The general solutions for coherent and diffuse components of the scattered intensity in reciprocal space are derived. As an example, the explicit expressions for intensity distributions in the case of spherical defects and of a mosaic crystal were obtained. The theory takes into account the instrumental function of the triple-crystal diffractometer and can therefore be used for experimental data analysis.

Bragg coherent diffraction imaging and metrics for radiation damage in protein micro-crystallography.

PubMed

Coughlan, H D; Darmanin, C; Kirkwood, H J; Phillips, N W; Hoxley, D; Clark, J N; Vine, D J; Hofmann, F; Harder, R J; Maxey, E; Abbey, B

2017-01-01

The proliferation of extremely intense synchrotron sources has enabled ever higher-resolution structures to be obtained using data collected from smaller and often more imperfect biological crystals (Helliwell, 1984). Synchrotron beamlines now exist that are capable of measuring data from single crystals that are just a few micrometres in size. This provides renewed motivation to study and understand the radiation damage behaviour of small protein crystals. Reciprocal-space mapping and Bragg coherent diffractive imaging experiments have been performed on cryo-cooled microcrystals of hen egg-white lysozyme as they undergo radiation damage. Several well established metrics, such as intensity-loss and lattice expansion, are applied to the diffraction data and the results are compared with several new metrics that can be extracted from the coherent imaging experiments. Individually some of these metrics are inconclusive. However, combining metrics, the results suggest that radiation damage behaviour in protein micro-crystals differs from that of larger protein crystals and may allow them to continue to diffract for longer. A possible mechanism to account for these observations is proposed.

Bragg coherent diffraction imaging and metrics for radiation damage in protein micro-crystallography

DOE PAGES

Coughlan, H. D.; Darmanin, C.; Kirkwood, H. J.; ...

2017-01-01

The proliferation of extremely intense synchrotron sources has enabled ever higher-resolution structures to be obtained using data collected from smaller and often more imperfect biological crystals. Synchrotron beamlines now exist that are capable of measuring data from single crystals that are just a few micrometres in size. This provides renewed motivation to study and understand the radiation damage behaviour of small protein crystals. Reciprocal-space mapping and Bragg coherent diffractive imaging experiments have been performed on cryo-cooled microcrystals of hen egg-white lysozyme as they undergo radiation damage. Several well established metrics, such as intensity-loss and lattice expansion, are applied to themore » diffraction data and the results are compared with several new metrics that can be extracted from the coherent imaging experiments. Individually some of these metrics are inconclusive. However, combining metrics, the results suggest that radiation damage behaviour in protein micro-crystals differs from that of larger protein crystals and may allow them to continue to diffract for longer. As a result, a possible mechanism to account for these observations is proposed.« less

Bragg coherent diffraction imaging and metrics for radiation damage in protein micro-crystallography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coughlan, H. D.; Darmanin, C.; Kirkwood, H. J.

The proliferation of extremely intense synchrotron sources has enabled ever higher-resolution structures to be obtained using data collected from smaller and often more imperfect biological crystals. Synchrotron beamlines now exist that are capable of measuring data from single crystals that are just a few micrometres in size. This provides renewed motivation to study and understand the radiation damage behaviour of small protein crystals. Reciprocal-space mapping and Bragg coherent diffractive imaging experiments have been performed on cryo-cooled microcrystals of hen egg-white lysozyme as they undergo radiation damage. Several well established metrics, such as intensity-loss and lattice expansion, are applied to themore » diffraction data and the results are compared with several new metrics that can be extracted from the coherent imaging experiments. Individually some of these metrics are inconclusive. However, combining metrics, the results suggest that radiation damage behaviour in protein micro-crystals differs from that of larger protein crystals and may allow them to continue to diffract for longer. As a result, a possible mechanism to account for these observations is proposed.« less

In situ high-pressure measurement of crystal solubility by using neutron diffraction

NASA Astrophysics Data System (ADS)

Chen, Ji; Hu, Qiwei; Fang, Leiming; He, Duanwei; Chen, Xiping; Xie, Lei; Chen, Bo; Li, Xin; Ni, Xiaolin; Fan, Cong; Liang, Akun

2018-05-01

Crystal solubility is one of the most important thermo-physical properties and plays a key role in industrial applications, fundamental science, and geoscientific research. However, high-pressure in situ measurements of crystal solubility remain very challenging. Here, we present a method involving high-pressure neutron diffraction for making high-precision in situ measurements of crystal solubility as a function of pressure over a wide range of pressures. For these experiments, we designed a piston-cylinder cell with a large chamber volume for high-pressure neutron diffraction. The solution pressures are continuously monitored in situ based on the equation of state of the sample crystal. The solubility at a high pressure can be obtained by applying a Rietveld quantitative multiphase analysis. To evaluate the proposed method, we measured the high-pressure solubility of NaCl in water up to 610 MPa. At a low pressure, the results are consistent with the previous results measured ex situ. At a higher pressure, more reliable data could be provided by using an in situ high-pressure neutron diffraction method.

About Small Streams and Shiny Rocks: Macromolecular Crystal Growth in Microfluidics

NASA Technical Reports Server (NTRS)

vanderWoerd, Mark; Ferree, Darren; Spearing, Scott; Monaco, Lisa; Molho, Josh; Spaid, Michael; Brasseur, Mike; Curreri, Peter A. (Technical Monitor)

2002-01-01

We are developing a novel technique with which we have grown diffraction quality protein crystals in very small volumes, utilizing chip-based, microfluidic ("LabChip") technology. With this technology volumes smaller than achievable with any laboratory pipette can be dispensed with high accuracy. We have performed a feasibility study in which we crystallized several proteins with the aid of a LabChip device. The protein crystals are of excellent quality as shown by X-ray diffraction. The advantages of this new technology include improved accuracy of dispensing for small volumes, complete mixing of solution constituents without bubble formation, highly repeatable recipe and growth condition replication, and easy automation of the method. We have designed a first LabChip device specifically for protein crystallization in batch mode and can reliably dispense and mix from a range of solution constituents. We are currently testing this design. Upon completion additional crystallization techniques, such as vapor diffusion and liquid-liquid diffusion will be accommodated. Macromolecular crystallization using microfluidic technology is envisioned as a fully automated system, which will use the 'tele-science' concept of remote operation and will be developed into a research facility aboard the International Space Station.

Macromolecular Crystal Growth by Means of Microfluidics

NASA Technical Reports Server (NTRS)

vanderWoerd, Mark; Ferree, Darren; Spearing, Scott; Monaco, Lisa; Molho, Josh; Spaid, Michael; Brasseur, Mike; Curreri, Peter A. (Technical Monitor)

2002-01-01

We have performed a feasibility study in which we show that chip-based, microfluidic (LabChip(TM)) technology is suitable for protein crystal growth. This technology allows for accurate and reliable dispensing and mixing of very small volumes while minimizing bubble formation in the crystallization mixture. The amount of (protein) solution remaining after completion of an experiment is minimal, which makes this technique efficient and attractive for use with proteins, which are difficult or expensive to obtain. The nature of LabChip(TM) technology renders it highly amenable to automation. Protein crystals obtained in our initial feasibility studies were of excellent quality as determined by X-ray diffraction. Subsequent to the feasibility study, we designed and produced the first LabChip(TM) device specifically for protein crystallization in batch mode. It can reliably dispense and mix from a range of solution constituents into two independent growth wells. We are currently testing this design to prove its efficacy for protein crystallization optimization experiments. In the near future we will expand our design to incorporate up to 10 growth wells per LabChip(TM) device. Upon completion, additional crystallization techniques such as vapor diffusion and liquid-liquid diffusion will be accommodated. Macromolecular crystallization using microfluidic technology is envisioned as a fully automated system, which will use the 'tele-science' concept of remote operation and will be developed into a research facility for the International Space Station as well as on the ground.

Synthesis and single crystal growth of perovskite semiconductor CsPbBr3

NASA Astrophysics Data System (ADS)

Zhang, Mingzhi; Zheng, Zhiping; Fu, Qiuyun; Chen, Zheng; He, Jianle; Zhang, Sen; Chen, Cheng; Luo, Wei

2018-02-01

As a typical representative of all-inorganic lead halide perovskites, cesium lead bromine (CsPbBr3) has attracted significant attention in recent years. The direct band gap semiconductor CsPbBr3 has a wide band gap of 2.25 eV and high average atomic number (Cs: 55, Pb: 82 and Br: 35), which meet most of the requirements for detection of X- and γ-ray radiation, such as high attenuation, high resistivity, and significant photoconductivity response. However, the growth of large volume CsPbBr3 single crystals remains a challenge. In this paper, the synthesis of CsPbBr3 polycrystalline powders by a chemical co-precipitation method was investigated and the optimum synthesis conditions were obtained. A large CsPbBr3 single crystal of 8 mm diameter and 60 mm length was obtained by a creative electronic dynamic gradient (EDG) method. X-ray diffraction (XRD) patterns and X-ray rocking curve showed that the CsPbBr3 crystal preferentially oriented in the (1 1 0) direction and had a low dislocation density and small residual stress in the crystal. The IR and UV-Vis transmittance and temperature-dependent photoluminescence (PL) spectra showed the crystal had a good basic optical performance. The almost linear current-voltage (I-V) curves implied good ohmic contact between the electrodes and crystal surfaces. The resistivity of the crystal was calculated 109-1010 Ω cm. The above results showed that the quality of the obtained crystal had met the demand of optoelectronic applications.

Langmuir-Blodgett nanotemplates for protein crystallography.

PubMed

Pechkova, Eugenia; Nicolini, Claudio

2017-12-01

The new generation of synchrotrons and microfocused beamlines has enabled great progress in X-ray protein crystallography, resulting in new 3D atomic structures for proteins of high interest to the pharmaceutical industry and life sciences. It is, however, often still challenging to produce protein crystals of sufficient size and quality (order, intensity of diffraction, radiation stability). In this protocol, we provide instructions for performing the Langmuir-Blodgett (LB) nanotemplate method, a crystallization approach that can be used for any protein (including membrane proteins). We describe how to produce highly ordered 2D LB protein monolayers at the air-water interface and deposit them on glass slides. LB-film formation can be observed by surface-pressure measurements and Brewster angle microscopy (BAM), although its quality can be characterized by atomic force microscopy (AFM) and nanogravimetry. Such films are then used as a 2D template for triggering 3D protein crystal formation by hanging-drop vapor diffusion. The procedure for forming the 2D template takes a few minutes. Structural information about the protein reorganization in the LB film during the crystallization process on the nano level can be obtained using an in situ submicron GISAXS (grazing-incidence small-angle X-ray scattering) method. MicroGISAXS spectra, measured directly at the interface of the LB films and protein solution in real time, as described in this protocol, can be interpreted in terms of the buildup of layers, islands, or holes. In our experience, the obtained LB crystals take 1-10 d to prepare and they are more ordered and radiation stable as compared with those produced using other crystallization methods.

Protein crystal structure obtained at 2.9 Å resolution from injecting bacterial cells into an X-ray free-electron laser beam

PubMed Central

Sawaya, Michael R.; Cascio, Duilio; Gingery, Mari; Rodriguez, Jose; Goldschmidt, Lukasz; Colletier, Jacques-Philippe; Messerschmidt, Marc M.; Boutet, Sébastien; Koglin, Jason E.; Williams, Garth J.; Brewster, Aaron S.; Nass, Karol; Hattne, Johan; Botha, Sabine; Doak, R. Bruce; Shoeman, Robert L.; DePonte, Daniel P.; Park, Hyun-Woo; Federici, Brian A.; Sauter, Nicholas K.; Schlichting, Ilme; Eisenberg, David S.

2014-01-01

It has long been known that toxins produced by Bacillus thuringiensis (Bt) are stored in the bacterial cells in crystalline form. Here we describe the structure determination of the Cry3A toxin found naturally crystallized within Bt cells. When whole Bt cells were streamed into an X-ray free-electron laser beam we found that scattering from other cell components did not obscure diffraction from the crystals. The resolution limits of the best diffraction images collected from cells were the same as from isolated crystals. The integrity of the cells at the moment of diffraction is unclear; however, given the short time (∼5 µs) between exiting the injector to intersecting with the X-ray beam, our result is a 2.9-Å-resolution structure of a crystalline protein as it exists in a living cell. The study suggests that authentic in vivo diffraction studies can produce atomic-level structural information. PMID:25136092

Crystallization Dynamics of Organolead Halide Perovskite by Real-Time X-ray Diffraction.

PubMed

Miyadera, Tetsuhiko; Shibata, Yosei; Koganezawa, Tomoyuki; Murakami, Takurou N; Sugita, Takeshi; Tanigaki, Nobutaka; Chikamatsu, Masayuki

2015-08-12

We analyzed the crystallization process of the CH3NH3PbI3 perovskite by observing real-time X-ray diffraction immediately after combining a PbI2 thin film with a CH3NH3I solution. A detailed analysis of the transformation kinetics demonstrated the fractal diffusion of the CH3NH3I solution into the PbI2 film. Moreover, the perovskite crystal was found to be initially oriented based on the PbI2 crystal orientation but to gradually transition to a random orientation. The fluctuating characteristics of the crystallization process of perovskites, such as fractal penetration and orientational transformation, should be controlled to allow the fabrication of high-quality perovskite crystals. The characteristic reaction dynamics observed in this study should assist in establishing reproducible fabrication processes for perovskite solar cells.

Survey of predictors of propensity for protein production and crystallization with application to predict resolution of crystal structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Jianzhao; Wu, Zhonghua; Hu, Gang

Selection of proper targets for the X-ray crystallography will benefit biological research community immensely. Several computational models were proposed to predict propensity of successful protein production and diffraction quality crystallization from protein sequences. We reviewed a comprehensive collection of 22 such predictors that were developed in the last decade. We found that almost all of these models are easily accessible as webservers and/or standalone software and we demonstrated that some of them are widely used by the research community. We empirically evaluated and compared the predictive performance of seven representative methods. The analysis suggests that these methods produce quite accuratemore » propensities for the diffraction-quality crystallization. We also summarized results of the first study of the relation between these predictive propensities and the resolution of the crystallizable proteins. We found that the propensities predicted by several methods are significantly higher for proteins that have high resolution structures compared to those with the low resolution structures. Moreover, we tested a new meta-predictor, MetaXXC, which averages the propensities generated by the three most accurate predictors of the diffraction-quality crystallization. MetaXXC generates putative values of resolution that have modest levels of correlation with the experimental resolutions and it offers the lowest mean absolute error when compared to the seven considered methods. We conclude that protein sequences can be used to fairly accurately predict whether their corresponding protein structures can be solved using X-ray crystallography. Moreover, we also ascertain that sequences can be used to reasonably well predict the resolution of the resulting protein crystals.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David

The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit.

The Question of Impurities in Macromolecule Crystal Quality Improvement in Microgravity

NASA Technical Reports Server (NTRS)

Judge, Russell A.; Snell, Edward H.; Pusey, Marc L.; Sportiello, Michael G.; Todd, Paul; Bellamy, Henry; Borgstahl, Gloria E.; Pokros, Matthew; Cassanto, John M.

2000-01-01

While macromolecule impurities may affect crystal size and morphology the over-riding question is how do macromolecule impurities effect crystal X-ray quality and diffraction resolution. In the case of chicken egg white lysozyme previous researchers have reported that crystals grown in the presence of ovalbumin, ovotransferrin, and turkey egg white lysozyme show no difference in diffraction resolution compared to those grown in pure solutions. One impurity however, a naturally occurring lysozyme dimer, does negatively impact the X-ray crystal properties. For this impurity it has been reported that crystal quality improvement in microgravity may be due to improved impurity partitioning during crystallization. In this study we have examined the incorporation of the dimer into lysozyme crystals, both on the ground and in microgravity experiments, and have performed detailed X-ray analysis of the crystals using a new technique for finely probing the mosaicity of the crystal at the Stanford Synchrotron Radiation Laboratory. Dimer partitioning was not significantly different in microgravity compared to the ground based experiments, although it is significantly better than that previously reported in microgravity. Mosaicity analysis of pure crystals, 1422 indexed reflections (microgravity) and 752 indexed reflections (ground), gave average results of 0.0066 and 0.0092 degrees (FWHM) respectively. The microgravity crystals also provided an increased signal to noise. Dimer incorporation increased the average mosaicity in microgravity but not on the ground. However, dimer incorporation did greatly reduce the resolution limit in both ground and microgravity grown crystals. The data is being treated anisotropically to explore these effects. These results indicate that impurity effects in microgravity are complex and that the conditions or techniques employed may greatly affect the role of impurities.

Influence of Containment on the Growth of Silicon-Germanium (ICESAGE): A Materials Science Investigation

NASA Technical Reports Server (NTRS)

Volz, M. P.; Mazuruk, K.; Croll, A.

2014-01-01

A series of Ge Si crystal growth experiments are planned to be conducted in the Low 1-x x Gradient Furnace (LGF) onboard the International Space Station. The primary objective of the research is to determine the influence of containment on the processing-induced defects and impurity incorporation in germanium-silicon alloy crystals. A comparison will be made between crystals grown by the normal and "detached" Bridgman methods and the ground-based float zone technique. Crystals grown without being in contact with a container have superior quality to otherwise similar crystals grown in direct contact with a container, especially with respect to impurity incorporation, formation of dislocations, and residual stress in crystals. "Detached" or "dewetted" Bridgman growth is similar to regular Bridgman growth in that most of the melt is in contact with the crucible wall, but the crystal is separated from the wall by a small gap, typically of the order of 10-100 microns. Long duration reduced gravity is essential to test the proposed theory of detached growth. Detached growth requires the establishment of a meniscus between the crystal and the ampoule wall. The existence of this meniscus depends on the ratio of the strength of gravity to capillary forces. On Earth, this ratio is large and stable detached growth can only be obtained over limited conditions. Crystals grown detached on the ground exhibited superior structural quality as evidenced by measurements of etch pit density, synchrotron white beam X-ray topography and double axis X-ray diffraction.

Synthesis of single-crystal perovskite PbCrO3 through a new reaction route at high pressure

NASA Astrophysics Data System (ADS)

Han, Yunxia; Wang, Shanmin; Liu, Yinjuan; Ma, Dejiang; He, Duanwei; Zhao, Yusheng

2018-04-01

As a new member in the family of Mott system, perovskite PbCrO3 has recently been uncovered to exhibit fantastic structural transition under pressure, coupled with magnetic, electronic, and ferromagnetic transitions, which provide many opportunities for understanding of correlated system. However, it is still challenging to synthesize high-quality single-crystal PbCrO3, leading to the limited exploration of this Mott compound. In this work, we formulate a new high-pressure reaction route for preparation of high-quality PbCrO3 crystals between PbCl2 and Na2CrO4 at high pressure of 5-10 GPa and at high temperature of 750-1500°C. Because of the formation of reaction byproduct NaCl, the final product can readily be separated by washing with water. The obtained sample is in the form of single crystal with crystallite size up to 200 μm. In addition, combined with X-ray diffraction measurement, a tentative pressure-temperature synthesis diagram of PbCrO3 is mapped out from the reaction between PbCl2 and Na2CrO4 and the reaction mechanism is also explored in detail.

Crystallization and preliminary X-ray diffraction analysis of the periplasmic domain of the Escherichia coli aspartate receptor Tar and its complex with aspartate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mise, Takeshi; Matsunami, Hideyuki; Samatey, Fadel A.

The periplasmic domain of the E. coli aspartate receptor Tar was cloned, expressed, purified and crystallized with and without bound ligand. The crystals obtained diffracted to resolutions of 1.58 and 1.95 Å, respectively. The cell-surface receptor Tar mediates bacterial chemotaxis toward an attractant, aspartate (Asp), and away from a repellent, Ni{sup 2+}. To understand the molecular mechanisms underlying the induction of Tar activity by its ligands, the Escherichia coli Tar periplasmic domain with and without bound aspartate (Asp-Tar and apo-Tar, respectively) were each crystallized in two different forms. Using ammonium sulfate as a precipitant, crystals of apo-Tar1 and Asp-Tar1 weremore » grown and diffracted to resolutions of 2.10 and 2.40 Å, respectively. Alternatively, using sodium chloride as a precipitant, crystals of apo-Tar2 and Asp-Tar2 were grown and diffracted to resolutions of 1.95 and 1.58 Å, respectively. Crystals of apo-Tar1 and Asp-Tar1 adopted space group P4{sub 1}2{sub 1}2, while those of apo-Tar2 and Asp-Tar2 adopted space groups P2{sub 1}2{sub 1}2{sub 1} and C2, respectively.« less

Crystal growth and characterization of the CMR compound La 1.2(Sr,Ca) 1.8Mn 2O 7

NASA Astrophysics Data System (ADS)

Velázquez, M.; Haut, C.; Hennion, B.; Revcolevschi, A.

2000-12-01

High-quality centimeter-sized single crystals of La 1.2Sr 1.8- yCa yMn 2O 7 (0.0⩽ y⩽0.2) were successfully grown using a floating zone method associated with an image furnace. We present the growth conditions together with a characterization of the single crystals by means of optical and electron microscopy, EDX and ICP⧸AES analysis, DTA-TGA measurements and redox titration, X-ray powder diffraction, Laue X-ray back-reflection and neutron diffraction. We also stress the main aspects of the complex thermodynamical and kinetic behaviors of these compounds.

Properties of pure single crystals of actinide compounds

NASA Astrophysics Data System (ADS)

Vogt, O.

1989-07-01

Actinide research started with substances of poor quality and a multitude of "unexplainable" results mostly found on powder samples of doubtful quality exerted some pressure on the crystal growers. As an example we may mention the measurements on UP. Type I antiferromagnetism was found below 123 K by neutron diffraction experiments on powdered samples. At 23 K another transition becomes apparent in susceptibility measurements. The change of the magnetic moments associated with this transition remained unexplained. It was only after the discovery of multi k structures in other actinide compounds that the need was seen to perform even inelastic neutron diffraction experiments on single crystals so that finally the true nature of the transition in UP could be revealed. NpAs is another illustrative example for the fact that sometimes it takes decades to get a clear understanding for things even so simple as macroscopic magnetic properties. The main reason for the need of single crystals is certainly the anisotropy of the magnetic moment encountered in all actinide compounds. Self-heating effects may prevent research on big crystals or might call for isotopic purity of certain samples.

Monochromatic X-ray sources based on a mechanism of real and virtual photon diffraction in crystals

NASA Astrophysics Data System (ADS)

Wagner, A. R.; Kuznetsov, S. I.; Potylitsyn, A. P.; Razin, S. V.; Uglov, S. R.; Zabaev, V. N.

2008-09-01

A source of monochromatic X-ray radiation is wanted in industry, science, medicine and so on. Many ways of making such a source are known. The present work describes two mechanisms for the creation of a monochromatic X-ray beam, which are parametric X-ray radiation (PXR) and bremsstrahlung diffraction (DBS). Both the experiments were carried out using an electron beam at a microtron. During the first experiment, the DBS process was investigated as a scattering of the Bremsstrahlung (BS) beam on the crystallographic surfaces of tungsten and pyrolytic graphite crystals. The second experiment consisted in the registration of the PXR and DBS yield during the passage of the electrons through the same crystals as in the first experiment. The spectral and orientation radiation characteristics and simulation results obtained for the DBS and PXR processes are presented. It is shown that the usage of mosaic crystalline targets is rather useful in order to obtain a monochromatic X-ray source based on bremsstrahlung diffraction from moderately relativistic electrons.

An evaluation of adhesive sample holders for advanced crystallographic experiments

PubMed Central

Mazzorana, Marco; Sanchez-Weatherby, Juan; Sandy, James; Lobley, Carina M. C.; Sorensen, Thomas

2014-01-01

The hydration state of macromolecular crystals often affects their overall order and, ultimately, the quality of the X-ray diffraction pattern that they produce. Post-crystallization techniques that alter the solvent content of a crystal may induce rearrangement within the three-dimensional array making up the crystal, possibly resulting in more ordered packing. The hydration state of a crystal can be manipulated by exposing it to a stream of air at controlled relative humidity in which the crystal can equilibrate. This approach provides a way of exploring crystal hydration space to assess the diffraction capabilities of existing crystals. A key requirement of these experiments is to expose the crystal directly to the dehydrating environment by having the minimum amount of residual mother liquor around it. This is usually achieved by placing the crystal on a flat porous support (Kapton mesh) and removing excess liquid by wicking. Here, an alternative approach is considered whereby crystals are harvested using adhesives that capture naked crystals directly from their crystallization drop, reducing the process to a one-step procedure. The impact of using adhesives to ease the harvesting of different types of crystals is presented together with their contribution to background scattering and their usefulness in dehydration experiments. It is concluded that adhesive supports represent a valuable tool for mounting macromolecular crystals to be used in humidity-controlled experiments and to improve signal-to-noise ratios in diffraction experiments, and how they can protect crystals from modifications in the sample environment is discussed. PMID:25195752

Determination of atomic site susceptibility tensors from neutron diffraction data on polycrystalline samples.

PubMed

Gukasov, A; Brown, P J

2010-12-22

Polarized neutron diffraction can provide information about the atomic site susceptibility tensor χ(ij) characterizing the magnetic response of individual atoms to an external magnetic field (Gukasov and Brown 2002 J. Phys.: Condens. Mater. 14 8831). The six independent atomic susceptibility parameters (ASPs) can be determined from polarized neutron flipping ratio measurements on single crystals and visualized as magnetic ellipsoids which are analogous to the thermal ellipsoids obtained from atomic displacement parameters (ADPs). We demonstrate now that the information about local magnetic susceptibility at different magnetic sites in a crystal can also be obtained from polarized and unpolarized neutron diffraction measurements on magnetized powder samples. The validity of the method is illustrated by the results of such measurements on a polycrystalline sample of Tb(2)Sn(2)O(7).

Crystallization of Proteins from Crude Bovine Rod Outer Segments☆

PubMed Central

Baker, Bo Y.; Gulati, Sahil; Shi, Wuxian; Wang, Benlian; Stewart, Phoebe L.; Palczewski, Krzysztof

2015-01-01

Obtaining protein crystals suitable for X-ray diffraction studies comprises the greatest challenge in the determination of protein crystal structures, especially for membrane proteins and protein complexes. Although high purity has been broadly accepted as one of the most significant requirements for protein crystallization, a recent study of the Escherichia coli proteome showed that many proteins have an inherent propensity to crystallize and do not require a highly homogeneous sample (Totir et al., 2012). As exemplified by RPE65 (Kiser, Golczak, Lodowski, Chance, & Palczewski, 2009), there also are cases of mammalian proteins crystallized from less purified samples. To test whether this phenomenon can be applied more broadly to the study of proteins from higher organisms, we investigated the protein crystallization profile of bovine rod outer segment (ROS) crude extracts. Interestingly, multiple protein crystals readily formed from such extracts, some of them diffracting to high resolution that allowed structural determination. A total of seven proteins were crystallized, one of which was a membrane protein. Successful crystallization of proteins from heterogeneous ROS extracts demonstrates that many mammalian proteins also have an intrinsic propensity to crystallize from complex biological mixtures. By providing an alternative approach to heterologous expression to achieve crystallization, this strategy could be useful for proteins and complexes that are difficult to purify or obtain by recombinant techniques. PMID:25950977

Crystallization and preliminary crystallographic study of the yeast Malassezia sympodialis allergen Mala s 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vilhelmsson, Monica, E-mail: monica.vilhelmsson@medks.ki.se; Center for Infectious Medicine, Department of Medicine, Karolinska University Hospital, Huddinge, Stockholm; Hallberg, B. Martin

2006-02-01

Crystals of the M. sympodialis allergen Mala s 1 have been obtained using the hanging-drop vapour-diffusion method. A diffraction data set has been collected from native crystals to 1.35 Å resolution. The opportunistic yeast Malassezia sympodialis can act as an allergen and elicit specific IgE- and T-cell reactivity in patients with atopic eczema. The first identified major allergen from M. sympodialis, Mala s 1, is present on the cell surface of the yeast. Recombinant Mala s 1 was expressed in Escherichia coli, purified and refolded in a soluble form. Crystals of Mala s 1 were obtained in 25% PEG 8K,more » 0.2 M (NH{sub 4}){sub 2}SO{sub 4}. Crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 44.4, b = 163.7, c = 50.6 Å, and diffract to 1.35 Å resolution.« less

Cloning, purification, crystallization and preliminary crystallographic analysis of SecA from Enterococcus faecalis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meining, Winfried, E-mail: wim@csb.ki.se; Scheuring, Johannes; Fischer, Markus

2006-06-01

SecA ATPase from E. faecalis has been cloned, overexpressed, purified and crystallized. Crystals belong to space group C2 and diffract to 2.4 Å resolution. The gene coding for SecA from Enterococcus faecalis was cloned and overexpressed in Escherichia coli. In this protein, the lysine at position 6 was replaced by an asparagine in order to reduce sensitivity towards proteases. The modified protein was purified and crystallized. Crystals diffracting to 2.4 Å resolution were obtained using the vapour-diffusion technique. The crystals belong to the monoclinic space group C2, with unit-cell parameters a = 203.4, b = 49.8, c = 100.8 Å,more » α = γ = 90.0, β = 119.1°. A selenomethionine derivative was prepared and is currently being tested in crystallization trials.« less

Structural studies on a 2,3-diphosphoglycerate independent phosphoglycerate mutase from Bacillus stearothermophilus.

PubMed

Chander, M; Setlow, P; Lamani, E; Jedrzejas, M J

1999-06-15

Phosphoglycerate mutase (PGM), an important enzyme in the glycolytic pathway, catalyzes the transfer of a phosphate group between the 2 and the 3 positions of glyceric acid. The gene coding for the 2, 3-diphosphoglycerate independent monomeric PGM from Bacillus stearothermophilus (57 kDa), whose activity is extremely pH sensitive and has an absolute and specific requirement for Mn2+, has been cloned and the enzyme overexpressed and purified to homogeneity. Circular dichroism studies showed at most only small secondary structure changes in the enzyme upon binding to Mn2+ or its 3-phosphoglycerate substrate, but thermal unfolding analyses revealed that Mn2+ but not 3-phosphoglycerate caused a large increase in the enzyme's stability. Diffraction-quality crystals of the enzyme were obtained at neutral pH in the presence of 3-phosphoglyceric acid with ammonium sulfate as the precipitating agent; these crystals diffract X rays to beyond 2.5-A resolution and belong to the orthorhombic space group C2221 with unit cell dimensions, a = 58.42, b = 206.08, c = 124.87 A, and alpha = beta = gamma = 90.0 degrees. The selenomethionyl version of the B. stearothermophilus protein has also been overexpressed, purified, and crystallized. Employing these crystals, the determination of the three-dimensional structure of this PGM by the multiwavelength anomalous dispersion method is in progress. Copyright 1999 Academic Press.

Large-scale purification and crystallization of the endoribonuclease XendoU: troubleshooting with His-tagged proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Renzi, Fabiana; Panetta, Gianna; Vallone, Beatrice

Recombinant His-tagged XendoU, a eukaryotic endoribonuclease, appeared to aggregate in the presence of divalent cations. Monodisperse protein which yielded crystals diffracting to 2.2 Å was obtained by addition of EDTA. XendoU is the first endoribonuclease described in higher eukaryotes as being involved in the endonucleolytic processing of intron-encoded small nucleolar RNAs. It is conserved among eukaryotes and its viral homologue is essential in SARS replication and transcription. The large-scale purification and crystallization of recombinant XendoU are reported. The tendency of the recombinant enzyme to aggregate could be reversed upon the addition of chelating agents (EDTA, imidazole): aggregation is a potentialmore » drawback when purifying and crystallizing His-tagged proteins, which are widely used, especially in high-throughput structural studies. Purified monodisperse XendoU crystallized in two different space groups: trigonal P3{sub 1}21, diffracting to low resolution, and monoclinic C2, diffracting to higher resolution.« less

The crystal structure of paramagnetic copper(II) oxalate (CuC₂O₄): formation and thermal decomposition of randomly stacked anisotropic nano-sized crystallites.

PubMed

Christensen, Axel Nørlund; Lebech, Bente; Andersen, Niels Hessel; Grivel, Jean-Claude

2014-11-28

Synthetic copper(II) oxalate, CuC2O4, was obtained in a precipitation reaction between a copper(II) solution and an aqueous solution of oxalic acid. The product was identified from its conventional X-ray powder patterns which match that of the copper mineral Moolooite reported to have the composition CuC2O4·0.44H2O. Time resolved in situ investigations of the thermal decomposition of copper(II) oxalate using synchrotron X-ray powder diffraction showed that in air the compound converts to Cu2O at 215 °C and oxidizes to CuO at 345 °C. Thermo gravimetric analysis performed in an inert Ar-gas reveals that the material contains no crystal water and reduces to pure Cu at 295 °C. Magnetic susceptibility measurements in the temperature range from 2 K to 300 K show intriguing paramagnetic behaviour with no sign of magnetic order down to 2 K. A crystal structure investigation is made based on powder diffraction data using one neutron diffraction pattern obtained at 5 K (λ = 1.5949(1) Å) combined with one conventional and two synchrotron X-ray diffraction patterns obtained at ambient temperature using λ = 1.54056, 1.0981 and λ = 0.50483(1) Å, respectively. Based on the X-ray synchrotron data the resulting crystal structure is described in the monoclinic space group P2₁/c (#14) in the P12₁/n1 setting with unit cell parameters a = 5.9598(1) Å, b = 5.6089(1) Å, c = 5.1138 (1) Å, β = 115.320(1)°. The composition is CuC2O4 with atomic coordinates determined by FullProf refinement of the neutron diffraction data. The crystal structure consists of a random stacking of CuC2O4 micro-crystallites where half the Cu-atoms are placed at (2a) and the other half at (2b) positions with the corresponding oxalate molecules centred around the corresponding (2b) and (2a) site positions, respectively. The diffraction patterns obtained for both kinds of radiation show considerable broadening of several Bragg peaks caused by highly anisotropic microstructural size and strain effects. In contrast to the water reported to be present in Moolooite, neither thermogravimetric nor the in situ thermal decomposition investigations and crystal structure analysis of the neutron diffraction data revealed any trace of water. An appendix contains details about the profile parameters for the diffractometers used at the European Synchrotron Radiation Facility and the Institute Max von Laue-Paul Langevin.

Colloidal crystal growth monitored by Bragg diffraction interference fringes.

PubMed

Bohn, Justin J; Tikhonov, Alexander; Asher, Sanford A

2010-10-15

We monitored the crystal growth kinetics of crystallization of a shear melted crystalline colloidal array (CCA). The fcc CCA heterogeneously nucleates at the flow cell wall surface. We examined the evolution of the (1 1 1) Bragg diffraction peak, and, for the first time, quantitatively monitored growth by measuring the temporal evolution of the Bragg diffraction interference fringes. Modeling of the evolution of the fringe patterns exposes the time dependence of the increasing crystal thickness. The initial diffusion-driven linear growth is followed by ripening-driven growth. Between 80 and 90 microM NaCl concentrations the fcc crystals first linearly grow at rates between 1.9 and 4.2 microm/s until they contact homogeneously nucleated crystals in the bulk. At lower salt concentrations interference fringes are not visible because the strong electrostatic interactions between particles result in high activation barriers, preventing defect annealing and leading to a lower crystal quality. The fcc crystals melt to a liquid phase at >90 microM NaCl concentrations. Increasing NaCl concentrations slow the fcc CCA growth rate consistent with the expectation of the classical Wilson-Frenkel growth theory. The final thickness of wall-nucleated CCA, that is determined by the competition between growth of heterogeneously and homogenously nucleated CCA, increases with higher NaCl concentrations. Copyright 2010 Elsevier Inc. All rights reserved.

Crystallization and preliminary X-ray crystallographic analysis of YfcM: an important factor for EF-P hydroxylation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kobayashi, Kan; RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198; Suzuki, Takehiro

2014-08-27

E. coli YfcM was expressed, purified and crystallized. Crystals of YfcM were obtained by the in situ proteolysis crystallization method. Using these crystals, an X-ray diffraction data set was collected at 1.45 Å resolution. Elongation factor P (EF-P) plays an essential role in the translation of polyproline-containing proteins in bacteria. It becomes functional by the post-translational modification of its highly conserved lysine residue. It is first β-lysylated by PoxA and then hydroxylated by YfcM. In this work, the YfcM protein from Escherichia coli was overexpressed, purified and crystallized. The crystal of YfcM was obtained by the in situ proteolysis crystallizationmore » method and diffracted X-rays to 1.45 Å resolution. It belonged to space group C2, with unit-cell parameters a = 124.4, b = 37.0, c = 37.6 Å, β = 101.2°. The calculated Matthews coefficient (V{sub M}) of the crystal was 1.91 Å{sup 3} Da{sup −1}, indicating that one YfcM molecule is present in the asymmetric unit with a solvent content of 35.7%.« less

A comparison between protein crystals grown with vapor diffusion methods in microgravity and protein crystals using a gel liquid-liquid diffusion ground-based method

NASA Technical Reports Server (NTRS)

Miller, Teresa Y.; He, Xiao-Min; Carter, Daniel C.

1992-01-01

Crystals of human serum albumin have been successfully grown in a variety of gels using crystallization conditions otherwise equivalent to those utilized in the popular hanging-drop vapor-equilibrium method. Preliminary comparisons of gel grown crystals with crystals grown by the vapor diffusion method via both ground-based and microgravity methods indicate that crystals superior in size and quality may be grown by limiting solutal convection. Preliminary X-ray diffraction statistics are presented.

X-ray diffraction studies of phase transformations in heavy-metal fluoride glasses

NASA Technical Reports Server (NTRS)

Bansal, N. P.; Doremus, R. H.

1985-01-01

Powder X-ray diffraction and differential scanning calorimetry studies of the crystallization properties of five ZrF4-based glass compositions have indicated that the crystalline phase in Zr-Ba-La-Pb fluoride glass is beta-BaZrF6; no such identification of crystal phases was obtainable, however, for the other glasses. Reversible polymorphic phase transformations occur in Zr-Ba-La-Li and Zr-Ba-La-Na fluoride glasses, upon heating to higher temperatures.

Effect of low NH3 flux towards high quality semi-polar (11-22) GaN on m-plane sapphire via MOCVD

NASA Astrophysics Data System (ADS)

Omar, Al-Zuhairi; Shuhaimi Bin Abu Bakar, Ahmad; Makinudin, Abdullah Haaziq Ahmad; Khudus, Muhammad Imran Mustafa Abdul; Azman, Adreen; Kamarundzaman, Anas; Supangat, Azzuliani

2018-05-01

The effect of ammonia flux towards the quality of the semi-polar (11-22) gallium nitride thin film on m-plane (10-10) sapphire is presented. Semi-polar (11-22) gallium nitride epi-layers were obtained using a two-step growth method, consisting of high temperature aluminum nitride followed by gallium nitride via metal organic chemical vapor deposition. The surface morphology analysis via field emission scanning electron microscopy and atomic force microscopy of the semi-polar (11-22) gallium nitride has shown that low ammonia flux promotes two-dimensional growth with low surface roughness of 4.08 nm. A dominant diffraction peak of (11-22) gallium nitride was also observed via X-ray diffraction upon utilizing low ammonia flux. The on- and off-axis X-ray rocking curve measurements illustrate the enhancement of the crystal quality, which might result from the reduction of the basal stacking faults and perfect dislocation. The full width half maximum values were reduced by at least 15% for both on- and off-axis measurements.

Structural analysis of bacteriophage-encoded peptidoglycan hydrolase domain KMV36C: crystallization and preliminary X-ray diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van Hecke, Kristof, E-mail: kristof.vanhecke@chem.kuleuven.be; Briers, Yves; Derua, Rita

2008-04-01

Crystallization and X-ray data collection of the C-terminus of gp36 from bacteriophage ϕKMV (KMV36C) are reported. The C-terminus of gp36 of bacteriophage ϕKMV (KMV36C) functions as a particle-associated muramidase, presumably as part of the injection needle of the ϕKMV genome during infection. Crystals of KMV36C were obtained by hanging-drop vapour diffusion and diffracted to a resolution of 1.6 Å. The crystals belong to the cubic space group P432, with unit-cell parameters a = b = c = 102.52 Å. KMV36C shows 30% sequence identity to T4 lysozyme (PDB code)

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Automated MAD and MIR structure solution

PubMed Central

Terwilliger, Thomas C.; Berendzen, Joel

1999-01-01

Obtaining an electron-density map from X-ray diffraction data can be difficult and time-consuming even after the data have been collected, largely because MIR and MAD structure determinations currently require many subjective evaluations of the qualities of trial heavy-atom partial structures before a correct heavy-atom solution is obtained. A set of criteria for evaluating the quality of heavy-atom partial solutions in macromolecular crystallography have been developed. These have allowed the conversion of the crystal structure-solution process into an optimization problem and have allowed its automation. The SOLVE software has been used to solve MAD data sets with as many as 52 selenium sites in the asymmetric unit. The automated structure-solution process developed is a major step towards the fully automated structure-determination, model-building and refinement procedure which is needed for genomic scale structure determinations. PMID:10089316

Growth, structural, spectral, mechanical, thermal and dielectric characterization of phosphoric acid admixtured L-alanine (PLA) single crystals.

PubMed

Rose, A S J Lucia; Selvarajan, P; Perumal, S

2011-10-15

Phosphoric acid admixtured L-alanine (PLA) single crystals were grown successfully by solution method with slow evaporation technique at room temperature. Crystals of size 18 mm×12 mm×8 mm have been obtained in 28 days. The grown crystals were colorless and transparent. The solubility of the grown samples has been found out at various temperatures. The lattice parameters of the grown crystals were determined by X-ray diffraction technique. The reflection planes of the sample were confirmed by the powder X-ray diffraction study and diffraction peaks were indexed. Fourier transform infrared (FTIR) studies were used to confirm the presence of various functional groups in the crystals. UV-visible transmittance spectrum was recorded to study the optical transparency of grown crystal. The nonlinear optical (NLO) property of the grown crystal was confirmed by Kurtz-Perry powder technique and a study of its second harmonic generation efficiency in comparison with potassium dihydrogen phosphate (KDP) has been made. The mechanical strength of the crystal was estimated by Vickers hardness test. The grown crystals were subjected to thermo gravimetric and differential thermal analysis (TG/DTA). The dielectric behavior of the sample was also studied. Copyright © 2011 Elsevier B.V. All rights reserved.

X-ray shearing interferometer

DOEpatents

Koch, Jeffrey A [Livermore, CA

2003-07-08

An x-ray interferometer for analyzing high density plasmas and optically opaque materials includes a point-like x-ray source for providing a broadband x-ray source. The x-rays are directed through a target material and then are reflected by a high-quality ellipsoidally-bent imaging crystal to a diffraction grating disposed at 1.times. magnification. A spherically-bent imaging crystal is employed when the x-rays that are incident on the crystal surface are normal to that surface. The diffraction grating produces multiple beams which interfere with one another to produce an interference pattern which contains information about the target. A detector is disposed at the position of the image of the target produced by the interfering beams.

Rational protein engineering in action: The first crystal structure of a phenylalanine tRNA synthetase from Staphylococcus haemolyticus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Evdokimov, Artem G.; Mekel, Marlene; Hutchings, Kim

2008-07-08

In this article, we describe for the first time the high-resolution crystal structure of a phenylalanine tRNA synthetase from the pathogenic bacterium Staphylococcus haemolyticus. We demonstrate the subtle yet important structural differences between this enzyme and the previously described Thermus thermophilus ortholog. We also explain the structure-activity relationship of several recently reported inhibitors. The native enzyme crystals were of poor quality -- they only diffracted X-rays to 3--5 {angstrom} resolution. Therefore, we have executed a rational surface mutagenesis strategy that has yielded crystals of this 2300-amino acid multidomain protein, diffracting to 2 {angstrom} or better. This methodology is discussed andmore » contrasted with the more traditional domain truncation approach.« less

FAST TRACK COMMUNICATION Determination of atomic site susceptibility tensors from neutron diffraction data on polycrystalline samples

NASA Astrophysics Data System (ADS)

Gukasov, A.; Brown, P. J.

2010-12-01

Polarized neutron diffraction can provide information about the atomic site susceptibility tensor χij characterizing the magnetic response of individual atoms to an external magnetic field (Gukasov and Brown 2002 J. Phys.: Condens. Mater. 14 8831). The six independent atomic susceptibility parameters (ASPs) can be determined from polarized neutron flipping ratio measurements on single crystals and visualized as magnetic ellipsoids which are analogous to the thermal ellipsoids obtained from atomic displacement parameters (ADPs). We demonstrate now that the information about local magnetic susceptibility at different magnetic sites in a crystal can also be obtained from polarized and unpolarized neutron diffraction measurements on magnetized powder samples. The validity of the method is illustrated by the results of such measurements on a polycrystalline sample of Tb2Sn2O7.

Crystallization and X-ray diffraction analysis of a putative bacterial class I labdane-related diterpene synthase.

PubMed

Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia; Stojanoff, Vivian; Rodríguez-Sanoja, Romina; Rudiño-Piñera, Enrique; Sánchez, Sergio

2015-09-01

Labdane-related diterpenoids are natural products with potential pharmaceutical applications that are rarely found in bacteria. Here, a putative class I labdane-related diterpene synthase (LrdC) identified by genome mining in a streptomycete was successfully crystallized using the microbatch method. Crystals of the LrdC enzyme were obtained in a holo form with its natural cofactor Mg(2+) (LrdC-Mg(2+)) and in complex with inorganic pyrophosphate (PPi) (LrdC-Mg(2+)-PPi). Crystals of native LrdC-Mg(2+) diffracted to 2.50 Å resolution and belonged to the trigonal space group P3221, with unit-cell parameters a = b = 107.1, c = 89.2 Å. Crystals of the LrdC-Mg(2+)-PPi complex grown in the same conditions as the native enzyme with PEG 8000 diffracted to 2.36 Å resolution and also belonged to the trigonal space group P3221. Crystals of the LrdC-Mg(2+)-PPi complex grown in a second crystallization condition with PEG 3350 diffracted to 2.57 Å resolution and belonged to the monoclinic space group P21, with unit-cell parameters a = 49.9, b = 104.1, c = 66.5 Å, β = 111.4°. The structure was determined by the single-wavelength anomalous dispersion (SAD) technique using the osmium signal from a potassium hexachloroosmate (IV) derivative.

Cloning, expression, purification and preliminary crystallographic analysis of the short-chain dehydrogenase enzymes WbmF, WbmG and WbmH from Bordetella bronchiseptica

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harmer, Nicholas J., E-mail: nic@cryst.bioc.cam.ac.uk; King, Jerry D.; Department of Veterinary Medicine, Cambridge CB3 0ES

2007-08-01

The expression, purification, and crystallisation of the short-chain dehydrogenases WbmF, WbmG and WbmH from B. bronchiseptica are described. Native diffraction data to 1.5, 2.0, and 2.2 Å were obtained for the three proteins, together with complexes with nucleotides. The short-chain dehydrogenase enzymes WbmF, WbmG and WbmH from Bordetella bronchiseptica were cloned into Escherichia coli expression vectors, overexpressed and purified to homogeneity. Crystals of all three wild-type enzymes were obtained using vapour-diffusion crystallization with high-molecular-weight PEGs as a primary precipitant at alkaline pH. Some of the crystallization conditions permitted the soaking of crystals with cofactors and nucleotides or nucleotide sugars, whichmore » are possible substrate compounds, and further conditions provided co-complexes of two of the proteins with these compounds. The crystals diffracted to resolutions of between 1.50 and 2.40 Å at synchrotron X-ray sources. The synchrotron data obtained were sufficient to determine eight structures of the three enzymes in complex with a variety of cofactors and substrate molecules.« less

Solid state parameters, structure elucidation, High Resolution X-Ray Diffraction (HRXRD), phase matching, thermal and impedance analysis on L-Proline trichloroacetate (L-PTCA) NLO single crystals.

PubMed

Kalaiselvi, P; Raj, S Alfred Cecil; Jagannathan, K; Vijayan, N; Bhagavannarayana, G; Kalainathan, S

2014-11-11

Nonlinear optical single crystal of L-Proline trichloroacetate (L-PTCA) was successfully grown by Slow Evaporation Solution Technique (SEST). The grown crystals were subjected to single crystal X-ray diffraction analysis to confirm the structure. From the single crystal XRD data, solid state parameters were determined for the grown crystal. The crystalline perfection has been evaluated using high resolution X-ray diffractometer. The frequencies of various functional groups were identified from FTIR spectral analysis. The percentage of transmittance was obtained from UV Visible spectral analysis. TGA-DSC measurements indicate the thermal stability of the crystal. The dielectric constant, dielectric loss and ac conductivity were measured by the impedance analyzer. The DC conductivity was calculated by the cole-cole plot method. Copyright © 2014 Elsevier B.V. All rights reserved.

Crystal-Site-Selective Spectrum of Fe3BO6 by Synchrotron Mössbauer Diffraction with Pure Nuclear Bragg Scattering

NASA Astrophysics Data System (ADS)

Nakamura, Shin; Mitsui, Takaya; Fujiwara, Kosuke; Ikeda, Naoshi; Kurokuzu, Masayuki; Shimomura, Susumu

2017-08-01

We have succeeded in obtaining the crystal-site-selective spectra of the collinear antiferromagnet Fe3BO6 using a synchrotron Mössbauer diffractometer with pure nuclear Bragg scattering at SPring-8 BL11XU. Well-resolved 300, 500, and 700 reflection spectra, having asymmetric line shapes owing to the higher-order interference effect between the nuclear energy levels, were quantitatively analyzed using a formula based on the dynamical theory of diffraction. Reasonable hyperfine parameters were obtained. The intensity ratio of Fe1 to Fe2 subspectra is in accordance with the nuclear structure factor. However, when the spectrum is measured at the peak position of the rocking curve (very near the Bragg position), the value of the center shift deviates from its intrinsic value. This is also due to the dynamical effect of γ-ray diffraction. To avoid this problem, it is necessary to use diffraction angles near the foot of the rocking curve, approximately 0.02° apart from the peak position.

Blazed vector grating liquid crystal cells with photocrosslinkable polymeric alignment films fabricated by one-step polarizer rotation method

NASA Astrophysics Data System (ADS)

Kawai, Kotaro; Kuzuwata, Mitsuru; Sasaki, Tomoyuki; Noda, Kohei; Kawatsuki, Nobuhiro; Ono, Hiroshi

2014-12-01

Blazed vector grating liquid crystal (LC) cells, in which the directors of low-molar-mass LCs are antisymmetrically distributed, were fabricated by one-step exposure of an empty glass cell inner-coated with a photocrosslinkable polymer LC (PCLC) to UV light. By adopting a LC cell structure, twisted nematic (TN) and homogeneous (HOMO) alignments were obtained in the blazed vector grating LC cells. Moreover, the diffraction efficiency of the blazed vector grating LC cells was greatly improved by increasing the thickness of the device in comparison with that of a blazed vector grating with a thin film structure obtained in our previous study. In addition, the diffraction efficiency and polarization states of ±1st-order diffracted beams from the resultant blazed vector grating LC cells were controlled by designing a blazed pattern in the alignment films, and these diffraction properties were well explained on the basis of Jones calculus and the elastic continuum theory of nematic LCs.

Preliminary Work in Obtaining Site-Directed Mutants of Hen Egg White Lysozyme

NASA Technical Reports Server (NTRS)

Holmes, Leonard D.

1996-01-01

Protein crystal growth studies are recognized as a critical endeavor in the field of molecular biotechnology. The scientific applications of this field include the understanding of how enzymes function and the accumulation of accurate information of atomic structures, a key factor in the process of rational drug design. NASA has committed substantial investment and resources to the field of protein crystal growth and has conducted many microgravity protein crystal growth experiments aboard shuttle flights. Crystals grown in space tend to be larger, denser and have a more perfect habit and geometry. These improved properties gained in the microgravity environment of space result largely from the reduction of solutal convection, and the elimination of sedimentation at the growing crystal surface. Shuttle experiments have yielded many large, high quality crystals that are suitable for high resolution X-ray diffraction analysis. Examples of biologically important macromolecules which have been successfully crystallized during shuttle missions include: lysozyme, isocitrate lyase, gamma-interferon, insulin, human serum albumin and canavalin. Numerous other examples are also available. In addition to obtaining high quality crystals, investigators are also interested in learning the mechanisms by which the growth events take place. Crystallization experiments indicate that for the enzyme HEWL, measured growth rates do not follow mathematical models for 2D nucleation and dislocation-led growth of tetragonal protein crystals. As has been suggested by the laboratory of Marc L. Pusey, a possible explanation for the disagreement between observation and data is that HEWL tetraconal crystals form by aggregated units of lysozyme in supersaturated solutions. Surface measurement data was shown to fit very well with a model using an octamer unit cell as the growth unit. According to this model, the aggregation pathway and subsequent crystal growth is described by: monomer < ------ > dimer < ------- > tetramer < ------ > octamer < ------ > higher order. It is believed that multimer aggregation of lysozyme occurs by interaction at specific binding sites on the surface of the protein crystals. If the presence of discrete binding sites and the aggregation hypothesis is true, then it follows that the alteration of the binding site(s) should have significant effect on the measurements obtained during growth experiments. Site-directed mutagenesis allows the specific alteration of proteins by replacement, deletion or addition of specific amino acid residues. This report outlines the approach for this strategy and the progress made thus far toward that end.

Crystallization and x-ray diffraction analysis of a putative bacterial class I labdane-related diterpene synthase [Crysallization and preliminary x-ray diffraction analysis of a bacterial class I labdane-related diterpene synthase

DOE PAGES

Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia; ...

2015-08-25

Here, labdane-related diterpenoids are natural products with potential pharmaceutical applications that are rarely found in bacteria. Here, a putative class I labdane-related diterpene synthase (LrdC) identified by genome mining in a streptomycete was successfully crystallized using the microbatch method. Crystals of the LrdC enzyme were obtained in a holo form with its natural cofactor Mg 2+ (LrdC-Mg 2+) and in complex with inorganic pyrophosphate (PP i) (LrdC-Mg 2+–PP i). Crystals of native LrdC-Mg 2+ diffracted to 2.50 Å resolution and belonged to the trigonal space group P3 221, with unit-cell parameters a = b = 107.1, c = 89.2 Å.more » Crystals of the LrdC-Mg 2+–PP i complex grown in the same conditions as the native enzyme with PEG 8000 diffracted to 2.36 Å resolution and also belonged to the trigonal space group P3 221. Crystals of the LrdC-Mg 2+–PP i complex grown in a second crystallization condition with PEG 3350 diffracted to 2.57 Å resolution and belonged to the monoclinic space group P2 1, with unit-cell parameters a = 49.9, b = 104.1, c = 66.5 Å, β = 111.4°. The structure was determined by the single-wavelength anomalous dispersion (SAD) technique using the osmium signal from a potassium hexachloroosmate (IV) derivative.« less

X-Ray Crystallographic Studies on Acetylcholinesterase and on Its Interaction with Anticholinesterase Agents.

DTIC Science & Technology

1994-11-24

complexes with reversible ligands, including edrophonium, d-tubocurarine and huperzine A , diffracting to similar resolution. The X26c Laue beam line...The EMBL-DESY synchrotron facility at Hamburg was employed to collect a complete 2.3 A data set for a crystal of native Torpedo AChE, as well as for...at the NSLS synchrotron facility at Brookhaven National Laboratory (BNL) was used to obtain a Laue diffraction pattern for a crystal of native Torpedo

Interactions that know no boundaries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wall, Michael E.

Deviations from an ideal crystal lead to diffuse scattering (DS) intensity, both between and beneath the Bragg peaks in diffraction patterns (Guinier, 1963). First characterized using simple ionic crystals in early studies of X-ray diffraction (Lonsdale, 1942), DS has a rich history (Welberry & Weber, 2016) and is a well established technique in smallmolecule crystallography (Welberry, 2004). DS studies in macromolecular crystallography began more recently (Phillips et al., 1980) and now the potential for obtaining information about protein motions is fueling the growing interest in DS (Meisburger et al., 2017).

Interactions that know no boundaries

DOE PAGES

Wall, Michael E.

2018-03-01

Deviations from an ideal crystal lead to diffuse scattering (DS) intensity, both between and beneath the Bragg peaks in diffraction patterns (Guinier, 1963). First characterized using simple ionic crystals in early studies of X-ray diffraction (Lonsdale, 1942), DS has a rich history (Welberry & Weber, 2016) and is a well established technique in smallmolecule crystallography (Welberry, 2004). DS studies in macromolecular crystallography began more recently (Phillips et al., 1980) and now the potential for obtaining information about protein motions is fueling the growing interest in DS (Meisburger et al., 2017).

High-energy-resolution monochromator for nuclear resonant scattering of synchrotron radiation by Te-125 at 35.49 keV

NASA Astrophysics Data System (ADS)

Imai, Yasuhiko; Yoda, Yoshitaka; Kitao, Shinji; Masuda, Ryo; Higashitaniguchi, Satoshi; Inaba, Chika; Seto, Makoto

2007-09-01

We have developed a high-resolution monochromator (HRM) for the measurement of nuclear resonant scattering (NRS) of synchrotron radiation by Te-125 at 35.49 keV using the backscattering of sapphire (9 1 -10 68). HRMs for nuclei with excitation energies less than 30 keV have been successfully developed using high angle diffractions by silicon crystals. Nearly perfect silicon crystal, however, is not suitable for high efficient HRMs at higher energy regions because the symmetry of the crystal structure is high and the Debye-temperature is low. Therefore, we used high quality synthetic sapphire crystal, which has low symmetry of crystal structure and high Debye-temperature. The temperature of the crystal was precisely controlled around 218 K to diffract synchrotron radiation with a Bragg angle of π/2 - 0.52 mrad. Energy was tuned by changing the crystal temperature under the condition of constant diffraction angle. Energy resolution was measured by detecting nuclear forward scattering by Te-125 in enriched TeO II. The relative energy resolution of 2.1×10 -7 is achieved, that is 7.5 meV in energy bandwidth. This HRM opens studies on element-specific dynamics and electronic state of substances containing Te-125.

Growth and characterizaion of urea p-nitrophenol crystal: an organic nonlinear optical material for optoelectronic device application

NASA Astrophysics Data System (ADS)

Suresh, A.; Manikandan, N.; Jauhar, RO. MU.; Murugakoothan, P.; Vinitha, G.

2018-06-01

Urea p-nitrophenol, an organic nonlinear optical crystal was synthesized and grown adopting slow evaporation and seed rotation method. Single crystal X-ray diffraction study confirmed the formation of the desired crystal. High resolution X-ray diffraction study showed the defect nature of the crystal. The presence of functional groups in the material was confirmed by FTIR analysis. UV-Vis-NIR study indicates that the grown crystal has a wider transparency region with the lower cutoff wavelength at 423 nm. The grown crystal is thermally stable up to 120 °C as assessed by TG-DTA analysis. The optical homogeneity of the grown crystal was confirmed by birefringence study. The 1064 nm Nd-YAG laser was used to obtain laser induced surface damage threshold which was found to be 0.38, 0.25 and 0.33 GW/cm2 for (0 1 0), (1 1 - 1) and (0 1 1) planes, respectively. The dielectric study was performed to find the charge distribution inside the crystal. The hardness property of the titular material has been found using Vicker's microhardness study. The optical nonlinearity obtained from third order nonlinear optical measurements carried out using Z-scan technique showed that these samples could be exploited for optical limiting studies.

Influence of Containment on the Growth of Silicon-Germanium (ICESAGE): A Materials Science ISS Investigation

NASA Technical Reports Server (NTRS)

Volz, M. P.; Mazuruk, K.; Croll, A.

2014-01-01

A series of Ge(1-x)Si(x) crystal growth experiments are planned to be conducted in the Low Gradient Furnace (LGF) onboard the International Space Station. The primary objective of the research is to determine the influence of containment on the processinginduced defects and impurity incorporation in germanium-silicon alloy crystals. A comparison will be made between crystals grown by the normal and "detached" Bridgman methods and the ground-based float zone technique. Crystals grown without being in contact with a container have superior quality to otherwise similar crystals grown in direct contact with a container, especially with respect to impurity incorporation, formation of dislocations, and residual stress in crystals. "Detached" or "dewetted" Bridgman growth is similar to regular Bridgman growth in that most of the melt is in contact with the crucible wall, but the crystal is separated from the wall by a small gap, typically of the order of 10-100 microns. Long duration reduced gravity is essential to test the proposed theory of detached growth. Detached growth requires the establishment of a meniscus between the crystal and the ampoule wall. The existence of this meniscus depends on the ratio of the strength of gravity to capillary forces. On Earth, this ratio is large and stable detached growth can only be obtained over limited conditions. Crystals grown detached on the ground exhibited superior structural quality as evidenced by measurements of etch pit density, synchrotron white beam X-ray topography and double axis X-ray diffraction. The plans for the flight experiments will be described.

Influence of Containment on the Growth of Silicon-Germanium: A Materials Science Flight Project

NASA Technical Reports Server (NTRS)

Volz, M. P.; Mazuruk, K.; Croell, A.

2012-01-01

A series of Ge(1-x)Si(x) crystal growth experiments are planned to be conducted in the Low Gradient Furnace (LGF) onboard the International Space Station. The primary objective of the research is to determine the influence of containment on the processing-induced defects and impurity incorporation in germanium-silicon alloy crystals. A comparison will be made between crystals grown by the normal and "detached" Bridgman methods and the ground-based float zone technique. Crystals grown without being in contact with a container have superior quality to otherwise similar crystals grown in direct contact with a container, especially with respect to impurity incorporation, formation of dislocations, and residual stress in crystals. "Detached" or "dewetted" Bridgman growth is similar to regular Bridgman growth in that most of the melt is in contact with the crucible wall, but the crystal is separated from the wall by a small gap, typically of the order of 10-100 microns. Long duration reduced gravity is essential to test the proposed theory of detached growth. Detached growth requires the establishment of a meniscus between the crystal and the ampoule wall. The existence of this meniscus depends on the ratio of the strength of gravity to capillary forces. On Earth, this ratio is large and stable detached growth can only be obtained over limited conditions. Crystals grown detached on the ground exhibited superior structural quality as evidenced by measurements of etch pit density, synchrotron white beam X-ray topography and double axis X-ray diffraction. The plans for the flight experiments will be described.

Transmission-line model to design matching stage for light coupling into two-dimensional photonic crystals.

PubMed

Miri, Mehdi; Khavasi, Amin; Mehrany, Khashayar; Rashidian, Bizhan

2010-01-15

The transmission-line analogy of the planar electromagnetic reflection problem is exploited to obtain a transmission-line model that can be used to design effective, robust, and wideband interference-based matching stages. The proposed model based on a new definition for a scalar impedance is obtained by using the reflection coefficient of the zeroth-order diffracted plane wave outside the photonic crystal. It is shown to be accurate for in-band applications, where the normalized frequency is low enough to ensure that the zeroth-order diffracted plane wave is the most important factor in determining the overall reflection. The frequency limitation of employing the proposed approach is explored, highly dispersive photonic crystals are considered, and wideband matching stages based on binomial impedance transformers are designed to work at the first two photonic bands.

Crystallization of FcpA from Leptospira, a novel flagellar protein that is essential for pathogenesis.

PubMed

San Martin, Fabiana; Mechaly, Ariel E; Larrieux, Nicole; Wunder, Elsio A; Ko, Albert I; Picardeau, Mathieu; Trajtenberg, Felipe; Buschiazzo, Alejandro

2017-03-01

The protein FcpA is a unique component of the flagellar filament of spirochete bacteria belonging to the genus Leptospira. Although it plays an essential role in translational motility and pathogenicity, no structures of FcpA homologues are currently available in the PDB. Its three-dimensional structure will unveil the novel motility mechanisms that render pathogenic Leptospira particularly efficient at invading and disseminating within their hosts, causing leptospirosis in humans and animals. FcpA from L. interrogans was purified and crystallized, but despite laborious attempts no useful X ray diffraction data could be obtained. This challenge was solved by expressing a close orthologue from the related saprophytic species L. biflexa. Three different crystal forms were obtained: a primitive and a centred monoclinic form, as well as a hexagonal variant. All forms diffracted X-rays to suitable resolutions for crystallographic analyses, with the hexagonal type typically reaching the highest limits of 2.0 Å and better. A variation of the quick-soaking procedure resulted in an iodide derivative that was instrumental for single-wavelength anomalous diffraction methods.

Improving the Quality of Protein Crystals Using Stirring Crystallization

NASA Astrophysics Data System (ADS)

Adachi, Hiroaki; Matsumura, Hiroyoshi; Niino, Ai; Takano, Kazufumi; Kinoshita, Takayoshi; Warizaya, Masaichi; Inoue, Tsuyoshi; Mori, Yusuke; Sasaki, Takatomo

2004-04-01

Recent reports state that a high magnetic field improves the crystal quality of bovine adenosine deaminase (ADA) with an inhibitor [Kinoshita et al.: Acta Cryst. D59 (2003) 1333]. In this paper, we examine the effect of stirring solution on ADA crystallization using a vapor-diffusion technique with rotary and figure-eight motion shakers. The probability of obtaining high-quality crystals is increased with stirring in a figure-eight pattern. Furthermore, rotary stirring greatly increased the probability of obtaining high-quality crystals, however, nucleation time was also increased. The crystal structure with the inhibitor was determined at a high resolution using a crystal obtained from a stirred solution. These results indicate that stirring with simple equipment is as useful as the high magnetic field technique for protein crystallization.

Purification, crystallization and preliminary X-ray diffraction studies of D-tagatose 3-epimerase from Pseudomonas cichorii.

PubMed

Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro

2007-02-01

D-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of D-psicose has not been reported with epimerases other than P. cichorii D-TE and D-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 A, beta = 102.82 degrees . Diffraction data were collected to 2.5 A resolution. The asymmetric unit is expected to contain four molecules.

Preliminary neutron diffraction analysis of challenging human manganese superoxide dismutase crystals

DOE PAGES

Azadmanesh, Jahaun; Trickel, Scott R.; Weiss, Kevin L.; ...

2017-03-29

Superoxide dismutases (SODs) are enzymes that protect against oxidative stress by dismutation of superoxide into oxygen and hydrogen peroxide through cyclic reduction and oxidation of the active-site metal. The complete enzymatic mechanisms of SODs are unknown since data on the positions of hydrogen are limited. Here, we present, methods for large crystal growth and neutron data collection of human manganese SOD (MnSOD) using perdeuteration and the MaNDi beamline at Oak Ridge National Laboratory. Furthermore, The crystal from which the human MnSOD data set was obtained is the crystal with the largest unit-cell edge (240 Å) from which data have beenmore » collectedvianeutron diffraction to sufficient resolution (2.30 Å) where hydrogen positions can be observed.« less

Preliminary neutron diffraction analysis of challenging human manganese superoxide dismutase crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Azadmanesh, Jahaun; Trickel, Scott R.; Weiss, Kevin L.

Superoxide dismutases (SODs) are enzymes that protect against oxidative stress by dismutation of superoxide into oxygen and hydrogen peroxide through cyclic reduction and oxidation of the active-site metal. The complete enzymatic mechanisms of SODs are unknown since data on the positions of hydrogen are limited. Here, we present, methods for large crystal growth and neutron data collection of human manganese SOD (MnSOD) using perdeuteration and the MaNDi beamline at Oak Ridge National Laboratory. Furthermore, The crystal from which the human MnSOD data set was obtained is the crystal with the largest unit-cell edge (240 Å) from which data have beenmore » collectedvianeutron diffraction to sufficient resolution (2.30 Å) where hydrogen positions can be observed.« less

Microstructural analysis in the depth direction of a heteroepitaxial AlN thick film grown on a trench-patterned template by nanobeam X-ray diffraction

NASA Astrophysics Data System (ADS)

Shida, K.; Takeuchi, S.; Tohei, T.; Miyake, H.; Hiramatsu, K.; Sumitani, K.; Imai, Y.; Kimura, S.; Sakai, A.

2018-04-01

This work quantitatively assessed the three-dimensional distribution of crystal lattice distortions in an epitaxial AlN thick film grown on a trench-patterned template, using nanobeam X-ray diffraction. Position-dependent ω-2θ-φ mapping clearly demonstrated local tilting, spacing and twisting of lattice planes as well as fluctuations in these phenomena on a sub-micrometer scale comparable to the pitch of the trench-and-terrace patterning. Analysis of the crystal lattice distortion in the depth direction was performed using a newly developed method in which the X-ray nanobeam diffracted from the sample surface to specific depths can be selectively detected by employing a Pt wire profiler. This technique generated depth-resolved ω-2θ-φ maps confirming that fluctuations in lattice plane tilting and spacing greatly depend on the dislocation distribution and the history of the AlN epitaxial growth on the trench-patterned structure. It was also found that both fluctuations were reduced on approaching the AlN surface and, in particular, were sharply reduced at specific depths in the terrace regions. These sharp reductions are attributed to the formation of sacrificial zones with degraded crystal quality around the trenches and possibly lead to raising the crystal quality near the surface of the AlN film.

Recent results and new hardware developments for protein crystal growth in microactivity

NASA Technical Reports Server (NTRS)

Delucas, L. J.; Long, M. M.; Moore, K. M.; Smith, C.; Carson, M.; Narayana, S. V. L.; Carter, D.; Clark, A. D., Jr.; Nanni, R. G.; Ding, J.

1993-01-01

Protein crystal growth experiments have been performed on 16 space shuttle missions since April, 1985. The initial experiments utilized vapor diffusion crystallization techniques similar to those used in laboratories for earth-based experiments. More recent experiments have utilized temperature induced crystallization as an alternative method for growing high quality protein crystals in microgravity. Results from both vapor diffusion and temperature induced crystallization experiments indicate that proteins grown in microgravity may be larger, display more uniform morphologies, and yield diffraction data to significantly higher resolutions than the best crystals of these proteins grown on earth.

Microgravity protein crystallization

PubMed Central

McPherson, Alexander; DeLucas, Lawrence James

2015-01-01

Over the past 20 years a variety of technological advances in X-ray crystallography have shortened the time required to determine the structures of large macromolecules (i.e., proteins and nucleic acids) from several years to several weeks or days. However, one of the remaining challenges is the ability to produce diffraction-quality crystals suitable for a detailed structural analysis. Although the development of automated crystallization systems combined with protein engineering (site-directed mutagenesis to enhance protein solubility and crystallization) have improved crystallization success rates, there remain hundreds of proteins that either cannot be crystallized or yield crystals of insufficient quality to support X-ray structure determination. In an attempt to address this bottleneck, an international group of scientists has explored use of a microgravity environment to crystallize macromolecules. This paper summarizes the history of this international initiative along with a description of some of the flight hardware systems and crystallization results. PMID:28725714

Improved crystal orientation and physical properties from single-shot XFEL stills

DOE PAGES

Sauter, Nicholas K.; Hattne, Johan; Brewster, Aaron S.; ...

2014-11-28

X-ray diffraction patterns from still crystals are inherently difficult to process because the crystal orientation is not uniquely determined by measuring the Bragg spot positions. Only one of the three rotational degrees of freedom is directly coupled to spot positions; the other two rotations move Bragg spots in and out of the reflecting condition but do not change the direction of the diffracted rays. This hinders the ability to recover accurate structure factors from experiments that are dependent on single-shot exposures, such as femtosecond diffract-and-destroy protocols at X-ray free-electron lasers (XFELs). Here, additional methods are introduced to optimally model themore » diffraction. The best orientation is obtained by requiring, for the brightest observed spots, that each reciprocal-lattice point be placed into the exact reflecting condition implied by Bragg's law with a minimal rotation. This approach reduces the experimental uncertainties in noisy XFEL data, improving the crystallographic R factors and sharpening anomalous differences that are near the level of the noise.« less

Improved crystal orientation and physical properties from single-shot XFEL stills

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sauter, Nicholas K.; Hattne, Johan; Brewster, Aaron S.

X-ray diffraction patterns from still crystals are inherently difficult to process because the crystal orientation is not uniquely determined by measuring the Bragg spot positions. Only one of the three rotational degrees of freedom is directly coupled to spot positions; the other two rotations move Bragg spots in and out of the reflecting condition but do not change the direction of the diffracted rays. This hinders the ability to recover accurate structure factors from experiments that are dependent on single-shot exposures, such as femtosecond diffract-and-destroy protocols at X-ray free-electron lasers (XFELs). Here, additional methods are introduced to optimally model themore » diffraction. The best orientation is obtained by requiring, for the brightest observed spots, that each reciprocal-lattice point be placed into the exact reflecting condition implied by Bragg's law with a minimal rotation. This approach reduces the experimental uncertainties in noisy XFEL data, improving the crystallographic R factors and sharpening anomalous differences that are near the level of the noise.« less

Orthorhombic lysozyme crystallization at acidic pH values driven by phosphate binding.

PubMed

Plaza-Garrido, Marina; Salinas-Garcia, M Carmen; Camara-Artigas, Ana

2018-05-01

The structure of orthorhombic lysozyme has been obtained at 298 K and pH 4.5 using sodium chloride as the precipitant and in the presence of sodium phosphate at a concentration as low as 5 mM. Crystals belonging to space group P2 1 2 1 2 1 (unit-cell parameters a = 30, b = 56, c = 73 Å, α = β = γ = 90.00°) diffracted to a resolution higher than 1 Å, and the high quality of these crystals permitted the identification of a phosphate ion bound to Arg14 and His15. The binding of this ion produces long-range conformational changes affecting the loop containing Ser60-Asn74. The negatively charged phosphate ion shields the electrostatic repulsion of the positively charged arginine and histidine residues, resulting in higher stability of the phosphate-bound lysozyme. Additionally, a low-humidity orthorhombic variant was obtained at pH 4.5, and comparison with those previously obtained at pH 6.5 and 9.5 shows a 1.5 Å displacement of the fifth α-helix towards the active-site cavity, which might be relevant to protein function. Since lysozyme is broadly used as a model protein in studies related to protein crystallization and amyloid formation, these results indicate that the interaction of some anions must be considered when analysing experiments performed at acidic pH values.

An evaluation of adhesive sample holders for advanced crystallographic experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mazzorana, Marco; Sanchez-Weatherby, Juan, E-mail: juan.sanchez-weatherby@diamond.ac.uk; Sandy, James

Commercially available adhesives have been evaluated for crystal mounting when undertaking complex macromolecular crystallography experiments. Here, their use as tools for advanced sample mounting and cryoprotection is assessed and their suitability for room-temperature data-collection and humidity-controlled studies is investigated. The hydration state of macromolecular crystals often affects their overall order and, ultimately, the quality of the X-ray diffraction pattern that they produce. Post-crystallization techniques that alter the solvent content of a crystal may induce rearrangement within the three-dimensional array making up the crystal, possibly resulting in more ordered packing. The hydration state of a crystal can be manipulated by exposingmore » it to a stream of air at controlled relative humidity in which the crystal can equilibrate. This approach provides a way of exploring crystal hydration space to assess the diffraction capabilities of existing crystals. A key requirement of these experiments is to expose the crystal directly to the dehydrating environment by having the minimum amount of residual mother liquor around it. This is usually achieved by placing the crystal on a flat porous support (Kapton mesh) and removing excess liquid by wicking. Here, an alternative approach is considered whereby crystals are harvested using adhesives that capture naked crystals directly from their crystallization drop, reducing the process to a one-step procedure. The impact of using adhesives to ease the harvesting of different types of crystals is presented together with their contribution to background scattering and their usefulness in dehydration experiments. It is concluded that adhesive supports represent a valuable tool for mounting macromolecular crystals to be used in humidity-controlled experiments and to improve signal-to-noise ratios in diffraction experiments, and how they can protect crystals from modifications in the sample environment is discussed.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pang, Xiaoyun; Xu, Feng, E-mail: xuf@xtal.tsinghua.edu.cn; Bell, Stephen G.

The cytochrome P450 enzyme CYP203A1 from Rhodopseudomonas palustris binds a wide range of highly substituted aromatic compounds and may play an important role in the astonishing metabolic diversity of this organism. Crystals of CYP203A1 that diffract to 2.0 Å resolution have been obtained. Cytochrome P450 enzymes constitute a large family of haemoproteins that catalyze the monooxygenation of a great variety of endogenous and exogenous organic compounds. Cytochrome P450 203A1 (CYP203A1, RPA1009) from the metabolically versatile organism Rhodopseudomonas palustris binds a broad range of substrates, in particular substituted aromatic compounds. Crystals of CYP203A1 suitable for X-ray crystallography have been obtained andmore » diffraction data were collected in-house to 2.0 Å resolution from a single crystal. The crystals belong to space group P222, with unit-cell parameters a = 40.1, b = 95.1, c = 99.0 Å, α = β = γ = 90°. There is one protein molecule per asymmetric unit.« less

(NZ)CH...O contacts assist crystallization of a ParB-like nuclease.

PubMed

Shaw, Neil; Cheng, Chongyun; Tempel, Wolfram; Chang, Jessie; Ng, Joseph; Wang, Xin-Yu; Perrett, Sarah; Rose, John; Rao, Zihe; Wang, Bi-Cheng; Liu, Zhi-Jie

2007-07-07

The major bottleneck for determination of 3 D structures of proteins using X-rays is the production of diffraction quality crystals. Often proteins are subjected to chemical modification to improve the chances of crystallization Here, we report the successful crystallization of a nuclease employing a reductive methylation protocol. The key to crystallization was the successful introduction of 44 new cohesive (NZ) CH...O contacts (3.2-3.7 A) by the addition of 2 methyl groups to the side chain amine nitrogen (NZ) of 9 lysine residues of the nuclease. The new contacts dramatically altered the crystallization properties of the protein, resulting in crystals that diffracted to 1.2 A resolution. Analytical ultracentrifugation analysis and thermodynamics results revealed a more compact protein structure with better solvent exclusion of buried Trp residues in the folded state of the methylated protein, assisting crystallization. In this study, introduction of novel cohesive (NZ)CH...O contacts by reductive methylation resulted in the crystallization of a protein that had previously resisted crystallization in spite of extensive purification and crystallization space screening. Introduction of (NZ)CH...O contacts could provide a solution to crystallization problems for a broad range of protein targets.

Ab initio structure determination from prion nanocrystals at atomic resolution by MicroED

PubMed Central

Sawaya, Michael R.; Rodriguez, Jose; Cascio, Duilio; Collazo, Michael J.; Shi, Dan; Reyes, Francis E.; Gonen, Tamir; Eisenberg, David S.

2016-01-01

Electrons, because of their strong interaction with matter, produce high-resolution diffraction patterns from tiny 3D crystals only a few hundred nanometers thick in a frozen-hydrated state. This discovery offers the prospect of facile structure determination of complex biological macromolecules, which cannot be coaxed to form crystals large enough for conventional crystallography or cannot easily be produced in sufficient quantities. Two potential obstacles stand in the way. The first is a phenomenon known as dynamical scattering, in which multiple scattering events scramble the recorded electron diffraction intensities so that they are no longer informative of the crystallized molecule. The second obstacle is the lack of a proven means of de novo phase determination, as is required if the molecule crystallized is insufficiently similar to one that has been previously determined. We show with four structures of the amyloid core of the Sup35 prion protein that, if the diffraction resolution is high enough, sufficiently accurate phases can be obtained by direct methods with the cryo-EM method microelectron diffraction (MicroED), just as in X-ray diffraction. The success of these four experiments dispels the concern that dynamical scattering is an obstacle to ab initio phasing by MicroED and suggests that structures of novel macromolecules can also be determined by direct methods. PMID:27647903

High-energy master oscillator power amplifier with near-diffraction-limited output based on ytterbium-doped PCF fiber

NASA Astrophysics Data System (ADS)

Li, Rao; Qiao, Zhi; Wang, Xiaochao; Fan, Wei; Lin, Zunqi

2017-10-01

With the development of fiber technologies, fiber lasers are able to deliver very high power beams and high energy pulses which can be used not only in scientific researches but industrial fields (laser marking, welding,…). The key of high power fiber laser is fiber amplifier. In this paper, we present a two-level master-oscillator power amplifier system at 1053 nm based on Yb-doped photonic crystal fibers. The system is used in the front-end of high power laser facility for the amplification of nano-second pulses to meet the high-level requirements. Thanks to the high gain of the system which is over 50 dB, the pulse of more than 0.89 mJ energy with the nearly diffraction-limited beam quality has been obtained.

Synthesis, growth, structural, optical, spectral, thermal and mechanical studies of 4-methoxy 4-nitrostilbene (MONS): a new organic nonlinear optical single crystal.

PubMed

Dinakaran, Paul M; Bhagavannarayana, G; Kalainathan, S

2012-11-01

4-Methoxy 4-nitrostilbene (MONS), a new organic nonlinear optical material has been synthesized. Based on the solubility data good quality single crystal with dimensions up to 38×11×3 mm(3) has been grown by slow evaporation method using ethyl methyl ketone (MEK) as a solvent. Powder XRD confirms the crystalline property and also the diffraction planes have been indexed. The lattice parameters for the grown MONS crystals were determined by using single crystal X-ray diffraction analysis and it reveals that the crystal lattice system is triclinic. The crystalline perfection of the grown crystals has been analysed by high resolution X-ray diffraction (HRXRD) rocking curve measurements. Fourier transform infrared (FTIR) spectrum for powdered MONS sample confirms the functional groups present in the grown crystal. The UV-vis absorption spectrum has been recorded in the range of 190-1100 nm and the cut off wavelength 499 nm has been determined. The optical constants of MONS have been determined through UV-vis-NIR spectroscopy. The MONS crystals were further subjected to other characterizations. i.e., (1)H NMR, TG/DTA, photoluminescence and microhardness test. The Kurtz and Perry powder technique confirms the NLO property of the grown crystal and the SHG efficiency of MONS was found to be 1.55× greater than that of KDP crystal. Copyright © 2012 Elsevier B.V. All rights reserved.

Crystallization and preliminary X-ray crystallographic analysis of two vascular apoptosis-inducing proteins (VAPs) from Crotalus atrox venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Igarashi, Tomoko; Oishi, Yuko; Araki, Satohiko

Vascular apoptosis-inducing protein 1 (VAP1) and VAP2 from C. atrox venom were crystallized in variety of different crystal forms. Diffraction data sets were obtained to 2.5 and 2.15 Å resolution for VAP1 and VAP2, respectively. VAPs are haemorrhagic snake-venom toxins belonging to the reprolysin family of zinc metalloproteinases. In vitro, VAPs induce apoptosis specifically in cultured vascular endothelial cells. VAPs have a modular structure that bears structural homology to mammalian ADAMs (a disintegrin and metalloproteinases). VAP1 is a homodimer with a MW of 110 kDa in which the monomers are connected by a single disulfide bridge. VAP2 is homologous tomore » VAP1 and exists as a monomer with a MW of 55 kDa. In the current study, several crystal forms of VAP1 and VAP2 were obtained using the vapour-diffusion method and diffraction data sets were collected using SPring-8 beamlines. The best crystals of VAP1 and VAP2 generated data sets to 2.5 and 2.15 Å resolution, respectively.« less

Diffraction Techniques in Structural Biology

PubMed Central

Egli, Martin

2016-01-01

A detailed understanding of chemical and biological function and the mechanisms underlying the molecular activities ultimately requires atomic-resolution structural data. Diffraction-based techniques such as single-crystal X-ray crystallography, electron microscopy, and neutron diffraction are well established and they have paved the road to the stunning successes of modern-day structural biology. The major advances achieved in the last 20 years in all aspects of structural research, including sample preparation, crystallization, the construction of synchrotron and spallation sources, phasing approaches, and high-speed computing and visualization, now provide specialists and nonspecialists alike with a steady flow of molecular images of unprecedented detail. The present unit combines a general overview of diffraction methods with a detailed description of the process of a single-crystal X-ray structure determination experiment, from chemical synthesis or expression to phasing and refinement, analysis, and quality control. For novices it may serve as a stepping-stone to more in-depth treatises of the individual topics. Readers relying on structural information for interpreting functional data may find it a useful consumer guide. PMID:27248784

Multi-level diffractive optics for single laser exposure fabrication of telecom-band diamond-like 3-dimensional photonic crystals.

PubMed

Chanda, Debashis; Abolghasemi, Ladan E; Haque, Moez; Ng, Mi Li; Herman, Peter R

2008-09-29

We present a novel multi-level diffractive optical element for diffractive optic near-field lithography based fabrication of large-area diamond-like photonic crystal structure in a single laser exposure step. A multi-level single-surface phase element was laser fabricated on a thin polymer film by two-photon polymerization. A quarter-period phase shift was designed into the phase elements to generate a 3D periodic intensity distribution of double basis diamond-like structure. Finite difference time domain calculation of near-field diffraction patterns and associated isointensity surfaces are corroborated by definitive demonstration of a diamond-like woodpile structure formed inside thick photoresist. A large number of layers provided a strong stopband in the telecom band that matched predictions of numerical band calculation. SEM and spectral observations indicate good structural uniformity over large exposure area that promises 3D photonic crystal devices with high optical quality for a wide range of motif shapes and symmetries. Optical sensing is demonstrated by spectral shifts of the Gamma-Zeta stopband under liquid emersion.

Diffraction Techniques in Structural Biology

PubMed Central

Egli, Martin

2010-01-01

A detailed understanding of chemical and biological function and the mechanisms underlying the activities ultimately requires atomic-resolution structural data. Diffraction-based techniques such as single-crystal X-ray crystallography, electron microscopy and neutron diffraction are well established and have paved the road to the stunning successes of modern-day structural biology. The major advances achieved in the last 20 years in all aspects of structural research, including sample preparation, crystallization, the construction of synchrotron and spallation sources, phasing approaches and high-speed computing and visualization, now provide specialists and non-specialists alike with a steady flow of molecular images of unprecedented detail. The present chapter combines a general overview of diffraction methods with a step-by-step description of the process of a single-crystal X-ray structure determination experiment, from chemical synthesis or expression to phasing and refinement, analysis and quality control. For novices it may serve as a stepping-stone to more in-depth treatises of the individual topics. Readers relying on structural information for interpreting functional data may find it a useful consumer guide. PMID:20517991

Diffraction Techniques in Structural Biology.

PubMed

Egli, Martin

2016-06-01

A detailed understanding of chemical and biological function and the mechanisms underlying the molecular activities ultimately requires atomic-resolution structural data. Diffraction-based techniques such as single-crystal X-ray crystallography, electron microscopy, and neutron diffraction are well established and they have paved the road to the stunning successes of modern-day structural biology. The major advances achieved in the last twenty years in all aspects of structural research, including sample preparation, crystallization, the construction of synchrotron and spallation sources, phasing approaches, and high-speed computing and visualization, now provide specialists and nonspecialists alike with a steady flow of molecular images of unprecedented detail. The present unit combines a general overview of diffraction methods with a detailed description of the process of a single-crystal X-ray structure determination experiment, from chemical synthesis or expression to phasing and refinement, analysis, and quality control. For novices it may serve as a stepping-stone to more in-depth treatises of the individual topics. Readers relying on structural information for interpreting functional data may find it a useful consumer guide. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.

Trace fluorescent labeling for protein crystallization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pusey, Marc, E-mail: marc.pusey@ixpressgenes.com; Barcena, Jorge; Morris, Michelle

2015-06-27

The presence of a covalently bound fluorescent probe at a concentration of <0.5% does not affect the outcome of macromolecule crystallization screening experiments. Additionally, the fluorescence can be used to determine new, not immediately apparent, lead crystallization conditions. Fluorescence can be a powerful tool to aid in the crystallization of proteins. In the trace-labeling approach, the protein is covalently derivatized with a high-quantum-yield visible-wavelength fluorescent probe. The final probe concentration typically labels ≤0.20% of the protein molecules, which has been shown to not affect the crystal nucleation or diffraction quality. The labeled protein is then used in a plate-screening experimentmore » in the usual manner. As the most densely packed state of the protein is the crystalline form, then crystals show as the brightest objects in the well under fluorescent illumination. A study has been carried out on the effects of trace fluorescent labeling on the screening results obtained compared with nonlabeled protein, and it was found that considering the stochastic nature of the crystal nucleation process the presence of the probe did not affect the outcomes obtained. Other effects are realised when using fluorescence. Crystals are clearly seen even when buried in precipitate. This approach also finds ‘hidden’ leads, in the form of bright spots, with ∼30% of the leads found being optimized to crystals in a single-pass optimization trial. The use of visible fluorescence also enables the selection of colors that bypass interfering substances, and the screening materials do not have to be UV-transparent.« less

Crystal structure of YbCu6In6 and mixed valence behavior of Yb in YbCu(6-x)In(6+x) (x = 0, 1, and 2) solid solution.

PubMed

Subbarao, Udumula; Peter, Sebastian C

2012-06-04

High quality single crystals of YbCu(6)In(6) have been grown using the flux method and characterized by means of single crystal X-ray diffraction data. YbCu(6)In(6) crystallizes in the CeMn(4)Al(8) structure type, tetragonal space group I4/mmm, and the lattice constants are a = b = 9.2200(13) Å and c = 5.3976(11) Å. The crystal structure of YbCu(6)In(6) is composed of pseudo-Frank-Kasper cages filled with one ytterbium atom in each ring. The neighboring cages share corners along [100] and [010] to build the three-dimensional network. YbCu(6-x)In(6+x) (x = 0, 1, and 2) solid solution compounds were obtained from high frequency induction heating and characterized using powder X-ray diffraction. The magnetic susceptibilities of YbCu(6-x)In(6+x) (x = 0, 1, and 2) were investigated in the temperature range 2-300 K and showed Curie-Weiss law behavior above 50 K, and the experimentally measured magnetic moment indicates mixed valent ytterbium. A deviation in inverse susceptibility data at 200 K suggests a valence transition from Yb(2+) to Yb(3+) as the temperature decreases. An increase in doping of Cu at the Al2 position enhances the disorder in the system and enhancement in the trivalent nature of Yb. Electrical conductivity measurements show that all compounds are of a metallic nature.

Growth and characterization of Methyl 2-amino-5-bromobenzoate crystal for NLO applications

NASA Astrophysics Data System (ADS)

Parthasarathy, M.; Gopalakrishnan, R.

2012-11-01

Good quality single crystal of organic Methyl 2-amino-5-bromobenzoate (M2A5B) was grown using slow evaporation solution growth technique. The grown crystal was confirmed by single crystal X-ray diffraction. The functional groups and vibrational frequencies were identified using FT-IR and FT-Raman spectral analyses. The presence of hydrogen and carbon atoms in the grown sample was confirmed with proton and carbon NMR spectral studies. The optical energy band gap of the title compound is found to be 2.7 eV from the optical transmission spectra. The refractive indices nx, ny, and nz were found to be 1.569, 1.587 and 1.600, respectively using Brewster's angle method. The melting point of the material obtained with melting point apparatus is 74 °C. Thermal stability of the grown crystal was studied by thermogravimetric analysis (TGA) and differential thermal analysis (DTA). The mechanical behaviour of the grown crystal was analyzed with Vicker's microhardness tester. The particle size dependent second harmonic generation efficiency for M2A5B was evaluated by Kurtz-Perry powder method using Nd:YAG laser, which established the existence of phase matching.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patel, Sangeeta, E-mail: spt658@aucklanduni.ac.nz; Wei, Shanghai; Han, Jie

In this present study, hydroxyapatite which was obtained from cattle bones has been heat treated at temperature 400 °C and 600 °C. The microstructure after the treatment has been studied in detail using Transmission electron microscopy (TEM) and X-ray diffraction techniques. The TEM results indicate that natural bone consists of collagen and hydroxyapatite nano-crystals which are needle shaped. The heat treatment influences the crystallinity and growth of these hydroxyapatite nano-crystals known as ‘crystal maturation’ or ‘crystal ageing’. - Highlights: • Hydroxyapatite is obtained from cattle bones. • Material has been characterised using XRD and TEM. • Crystal growth and orientationmore » has been studied in detail.« less

Compressive auto-indexing in femtosecond nanocrystallography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maia, Filipe; Yang, Chao; Marchesini, Stefano

2010-09-20

Ultrafast nanocrystallography has the potential to revolutionize biology by enabling structural elucidation of proteins for which it is possible to grow crystals with 10 or fewer unit cells. The success of nanocrystallography depends on robust orientation-determination procedures that allow us to average diffraction data from multiple nanocrystals to produce a 3D diffraction data volume with a high signal-to-noise ratio. Such a 3D diffraction volume can then be phased using standard crystallographic techniques."Indexing" algorithms used in crystallography enable orientation determination of a diffraction data from a single crystal when a relatively large number of reflections are recorded. Here we show thatmore » it is possible to obtain the exact lattice geometry from a smaller number of measurements than standard approaches using a basis pursuit solver.« less

SINGLE CRYSTAL DIFFRACTION OF SIDERITE UP TO 54 GPA AND HIGH PRESSURE-HIGH TEMPERATURE PHASES IN THE Fe-C-O SYSTEM (Invited)

NASA Astrophysics Data System (ADS)

Lavina, B.; Dera, P. K.; Downs, R. T.

2009-12-01

Phases in the Fe-C-O system are of interest for the deep carbon cycle, they might play an important role in buffering the mantle fO2. Carbon is also common in the fluid phases that greatly influence the Earth’s processes. The study of the high pressure behavior of siderite and of the phases synthesized after laser heating offers a good opportunity to illustrate the advantages and importance of single crystal diffraction in the high pressure science. The structure of siderite, FeCO3, has been refined up to 54 GPa across the spin pairing transition. Splitting of the diffraction peaks at the transition pressure provides unequivocal evidence of the sharpness of the spin crossover and of the absence of any intermediate volume and therefore of an intermediate spin state at ambient temperature. Diffraction intensities were collected in about 30 minutes at a bending magnet station (HPCAT, APS) and in about one minute at an insertion device station (GSECARS, APS). The quality of the refinement is unvaried in the investigated range, and the results obtained from the two different radiation and detectors are consistent. The refinements provide an accurate and robust determination of the dependence of bond distances and angles with pressure. Subtle structural rearrangements associated with the collapse of the octahedral cation size will be discussed. In situ laser heating is a very powerful method to study minerals at the actual P-T of the Earth’s deep interior. Overcoming the kinetic barriers required for bond breaking and atom diffusion, high pressure-high temperature phases may be synthesized. The analysis of high-pressure phases is very challenging. Diffraction patterns are usually of moderate quality and resolution, furthermore in addition to the sample, the pattern contains the contribution of other phases such as those used to insulate the anvils, to provide a pressure medium and a pressure marker. In several cases after laser heating, we observed phase transitions and growth of large crystallites, here the contribution of different phases could be better distinguished by analyzing the 3-dimensional distribution in the reciprocal space of the diffraction peaks. Laser heating experiments in the Fe-C-O system were conducted in the pressure range 20-140 GPa. The siderite stability field seems narrower than the previous investigations suggested. At least one of the extracted single crystal phases provides evidence of oxidation-reduction reactions.

Purification, crystallization and X-ray diffraction analysis of the C-terminal protease domain of Venezuelan equine encephalitis virus nsP2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Russo, Andrew T.; Watowich, Stanley J., E-mail: watowich@xray.utmb.edu

2006-06-01

The C-terminal protease domain of Venezuelan equine encephalitis virus (VEEV) nsP2 has been overexpressed in E. coli, purified and successfully crystallized. Native crystals diffract to beyond 2.5 Å resolution and isomorphous heavy-atom derivatives suitable for phase analysis have been identified. The C-terminal region of Venezuelan equine encephalitis virus (VEEV) nsP2 is responsible for proteolytic processing of the VEEV polyprotein replication complex. This action regulates the activity of the replication complex and is essential for viral replication, thus making nsP2 a very attractive target for development of VEEV therapeutics. The 338-amino-acid C-terminal region of VEEV nsP2 has been overexpressed in Escherichiamore » coli, purified and crystallized. Crystals diffract to beyond 2.5 Å resolution and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}. Isomorphous heavy-atom derivatives suitable for phase analysis have been obtained and work on building a complete structural model is under way.« less

Resolution extension by image summing in serial femtosecond crystallography of two-dimensional membrane-protein crystals

DOE PAGES

Casadei, Cecilia M.; Tsai, Ching-Ju; Barty, Anton; ...

2018-01-01

Previous proof-of-concept measurements on single-layer two-dimensional membrane-protein crystals performed at X-ray free-electron lasers (FELs) have demonstrated that the collection of meaningful diffraction patterns, which is not possible at synchrotrons because of radiation-damage issues, is feasible. Here, the results obtained from the analysis of a thousand single-shot, room-temperature X-ray FEL diffraction images from two-dimensional crystals of a bacteriorhodopsin mutant are reported in detail. The high redundancy in the measurements boosts the intensity signal-to-noise ratio, so that the values of the diffracted intensities can be reliably determined down to the detector-edge resolution of 4 Å. The results show that two-dimensional serial crystallography atmore » X-ray FELs is a suitable method to study membrane proteins to near-atomic length scales at ambient temperature. The method presented here can be extended to pump–probe studies of optically triggered structural changes on submillisecond timescales in two-dimensional crystals, which allow functionally relevant large-scale motions that may be quenched in three-dimensional crystals.« less

Resolution extension by image summing in serial femtosecond crystallography of two-dimensional membrane-protein crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Casadei, Cecilia M.; Tsai, Ching-Ju; Barty, Anton

Previous proof-of-concept measurements on single-layer two-dimensional membrane-protein crystals performed at X-ray free-electron lasers (FELs) have demonstrated that the collection of meaningful diffraction patterns, which is not possible at synchrotrons because of radiation-damage issues, is feasible. Here, the results obtained from the analysis of a thousand single-shot, room-temperature X-ray FEL diffraction images from two-dimensional crystals of a bacteriorhodopsin mutant are reported in detail. The high redundancy in the measurements boosts the intensity signal-to-noise ratio, so that the values of the diffracted intensities can be reliably determined down to the detector-edge resolution of 4 Å. The results show that two-dimensional serial crystallography atmore » X-ray FELs is a suitable method to study membrane proteins to near-atomic length scales at ambient temperature. The method presented here can be extended to pump–probe studies of optically triggered structural changes on submillisecond timescales in two-dimensional crystals, which allow functionally relevant large-scale motions that may be quenched in three-dimensional crystals.« less

Crystallization and preliminary X-ray diffraction analyses of the redox-controlled complex of terminal oxygenase and ferredoxin components in the Rieske nonhaem iron oxygenase carbazole 1,9a-dioxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsuzawa, Jun; Aikawa, Hiroki; Umeda, Takashi

2014-09-25

A crystal was obtained of the complex between reduced terminal oxygenase and oxidized ferredoxin components of carbazole 1,9a-dioxygenase. The crystal belonged to space group P2{sub 1} and diffracted to 2.25 Å resolution. The initial reaction in bacterial carbazole degradation is catalyzed by carbazole 1,9a-dioxygenase, which consists of terminal oxygenase (Oxy), ferredoxin (Fd) and ferredoxin reductase components. The electron-transfer complex between reduced Oxy and oxidized Fd was crystallized at 293 K using the hanging-drop vapour-diffusion method with PEG 3350 as the precipitant under anaerobic conditions. The crystal diffracted to a maximum resolution of 2.25 Å and belonged to space group P2{submore » 1}, with unit-cell parameters a = 97.3, b = 81.6, c = 116.2 Å, α = γ = 90, β = 100.1°. The V{sub M} value is 2.85 Å{sup 3} Da{sup −1}, indicating a solvent content of 56.8%.« less

A preliminary neutron diffraction study of rasburicase, a recombinant urate oxidase enzyme, complexed with 8-azaxanthin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Budayova-Spano, Monika, E-mail: spano@embl-grenoble.fr; Institut Laue-Langevin, 6 Rue Jules Horowitz, BP 156, 38042 Grenoble; Bonneté, Françoise

2006-03-01

Neutron diffraction data of hydrogenated recombinant urate oxidase enzyme (Rasburicase), complexed with a purine-type inhibitor 8-azaxanthin, was collected to 2.1 Å resolution from a crystal grown in D{sub 2}O by careful control and optimization of crystallization conditions via knowledge of the phase diagram. Deuterium atoms were clearly seen in the neutron-scattering density map. Crystallization and preliminary neutron diffraction measurements of rasburicase, a recombinant urate oxidase enzyme expressed by a genetically modified Saccharomyces cerevisiae strain, complexed with a purine-type inhibitor (8-azaxanthin) are reported. Neutron Laue diffraction data were collected to 2.1 Å resolution using the LADI instrument from a crystal (grownmore » in D{sub 2}O) with volume 1.8 mm{sup 3}. The aim of this neutron diffraction study is to determine the protonation states of the inhibitor and residues within the active site. This will lead to improved comprehension of the enzymatic mechanism of this important enzyme, which is used as a protein drug to reduce toxic uric acid accumulation during chemotherapy. This paper illustrates the high quality of the neutron diffraction data collected, which are suitable for high-resolution structural analysis. In comparison with other neutron protein crystallography studies to date in which a hydrogenated protein has been used, the volume of the crystal was relatively small and yet the data still extend to high resolution. Furthermore, urate oxidase has one of the largest primitive unit-cell volumes (space group I222, unit-cell parameters a = 80, b = 96, c = 106 Å) and molecular weights (135 kDa for the homotetramer) so far successfully studied with neutrons.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Xiong-Zhuo; National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871; Li, Lan-Fen

The SMU.961 protein from S. mutans was crystallized and preliminary characterization of the crystals, which diffracted to 2.9 Å resolution, shows them to belong to space group C2. The smu.961 gene encodes a putative protein of 183 residues in Streptococcus mutans, a major pathogen in human dental caries. The gene was cloned into expression vector pET28a and expressed in a substantial quantity in Escherichia coli strain BL21 (DE3) with a His tag at its N-terminus. The recombinant protein SMU.961 was purified to homogeneity in a two-step procedure consisting of Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals suitable for X-ray diffraction weremore » obtained by the hanging-drop vapour-diffusion method and diffracted to 2.9 Å resolution at beamline I911-3, MAX-II-lab, Sweden. The crystal belonged to space group C2, with unit-cell parameters a = 98.62, b = 73.73, c = 184.73 Å, β = 98.82°.« less

Expression and crystallographic studies of the Arabidopsis thaliana GDP-D-mannose pyrophosphorylase VTC1.

PubMed

Zhao, Shun; Liu, Lin

2016-10-01

GDP-D-mannose pyrophosphorylase catalyzes the production of GDP-D-mannose, an intermediate product in the plant ascorbic acid (AsA) biosynthetic pathway. This enzyme is a key regulatory target in AsA biosynthesis and is encoded by VITAMIN C DEFECTIVE 1 (VTC1) in the Arabidopsis thaliana genome. Here, recombinant VTC1 was expressed, purified and crystallized. Diffraction data were obtained from VTC1 crystals grown in the absence and presence of substrate using X-rays. The ligand-free VTC1 crystal diffracted X-rays to 3.3 Å resolution and belonged to space group R32, with unit-cell parameters a = b = 183.6, c = 368.5 Å, α = β = 90, γ = 120°; the crystal of VTC1 in the presence of substrate diffracted X-rays to 1.75 Å resolution and belonged to space group P2 1 , with unit-cell parameters a = 70.8, b = 83.9, c = 74.5 Å, α = γ = 90.0, β = 114.9°.

Growth, structural, optical and surface analysis of piperazinium tartrate: A NLO single crystal

NASA Astrophysics Data System (ADS)

Gupta, Apurva; Raseel Rahman M., K.; Nair, Lekha

2018-05-01

Single crystal of piperazinium tartrate (PPZT) was grown by the slow evaporation solution growth technique at room temperature. Crystallinity of grown crystal was examined by powder X-ray diffraction. High transparency and wide band gap were observed in the UV-Visible spectroscopic studies. Intense and broad emissions were observed in the blue region, as that is indicated by photoluminescence spectroscopy. The quality of the grown PPZT single crystals were analyzed by the etching studies using the water as the etchant.

Preliminary crystallographic analysis of salicylate 1,2-dioxygenase from Pseudaminobacter salicylatoxidans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matera, I.; Ferraroni, M.; Bürger, S.

2006-06-01

Salicylate 1,2-dioxygenase, a new ring-fission dioxygenase from the naphthalenesulfonate-degrading strain P. salicylatoxidans, which oxidizes salicylate to 2-oxohepta-3,5-dienedioic acid by a novel ring-fission mechanism, has been crystallized. The crystals obtained give diffraction data to 2.9 Å resolution which could assist in the elucidation of the catalytic mechanism of this peculiar dioxygenase. Salicylate 1,2-dioxygenase, a new ring-fission dioxygenase from the naphthalenesulfonate-degrading strain Pseudaminobacter salicylatoxidans which oxidizes salicylate to 2-oxohepta-3,5-dienedioic acid by a novel ring-fission mechanism, has been crystallized. Diffraction-quality crystals of salicylate 1,2-dioxygenase were obtained using the sitting-drop vapour-diffusion method at 277 K from a solution containing 10%(w/v) ethanol, 6%(w/v) PEG 400,more » 0.1 M sodium acetate pH 4.6. Crystals belong to the primitive tetragonal space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2, with unit-cell parameters a = 133.3, c = 191.51 Å. A complete data set at 100 K extending to a maximum resolution of 2.9 Å was collected at a wavelength of 0.8423 Å. Molecular replacement using the coordinates of known extradiol dioxygenases structures as a model has so far failed to provide a solution for salicylate 1,2-dioxygenase. Attempts are currently being made to solve the structure of the enzyme by MAD experiments using the anomalous signal of the catalytic Fe{sup II} ions. The salicylate 1,2-dioxygenase structural model will assist in the elucidation of the catalytic mechanism of this ring-fission dioxygenase from P. salicylatoxidans, which differs markedly from the known gentisate 1,2-dioxygenases or 1-hydroxy-2-naphthoate dioxygenases because of its unique ability to oxidatively cleave salicylate, gentisate and 1-hydroxy-2-naphthoate with high catalytic efficiency.« less

Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of the VP8* carbohydrate-binding protein of the human rotavirus strain Wa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kraschnefski, Mark J.; Scott, Stacy A.; Holloway, Gavan

2005-11-01

The carbohydrate-binding component (VP8*{sub 64–223}) of the human Wa rotavirus spike protein has been overexpressed in E. coli, purified and crystallized in two different crystal forms. X-ray diffraction data have been collected that have enabled determination of the Wa VP8*{sub 64–223} structure by molecular replacement. Rotaviruses exhibit host-specificity and the first crystallographic information on a rotavirus strain that infects humans is reported here. Recognition and attachment to host cells, leading to invasion and infection, is critically linked to the function of the outer capsid spike protein of the rotavirus particle. In some strains the VP8* component of the spike proteinmore » is implicated in recognition and binding of sialic-acid-containing cell-surface carbohydrates, thereby enabling infection by the virus. The cloning, expression, purification, crystallization and initial X-ray diffraction analysis of the VP8* core from human Wa rotavirus is reported. Two crystal forms (trigonal P3{sub 2}21 and monoclinic P2{sub 1}) have been obtained and X-ray diffraction data have been collected, enabling determination of the VP8*{sub 64–223} structure by molecular replacement.« less

Femtosecond X-ray protein nanocrystallography.

PubMed

Chapman, Henry N; Fromme, Petra; Barty, Anton; White, Thomas A; Kirian, Richard A; Aquila, Andrew; Hunter, Mark S; Schulz, Joachim; DePonte, Daniel P; Weierstall, Uwe; Doak, R Bruce; Maia, Filipe R N C; Martin, Andrew V; Schlichting, Ilme; Lomb, Lukas; Coppola, Nicola; Shoeman, Robert L; Epp, Sascha W; Hartmann, Robert; Rolles, Daniel; Rudenko, Artem; Foucar, Lutz; Kimmel, Nils; Weidenspointner, Georg; Holl, Peter; Liang, Mengning; Barthelmess, Miriam; Caleman, Carl; Boutet, Sébastien; Bogan, Michael J; Krzywinski, Jacek; Bostedt, Christoph; Bajt, Saša; Gumprecht, Lars; Rudek, Benedikt; Erk, Benjamin; Schmidt, Carlo; Hömke, André; Reich, Christian; Pietschner, Daniel; Strüder, Lothar; Hauser, Günter; Gorke, Hubert; Ullrich, Joachim; Herrmann, Sven; Schaller, Gerhard; Schopper, Florian; Soltau, Heike; Kühnel, Kai-Uwe; Messerschmidt, Marc; Bozek, John D; Hau-Riege, Stefan P; Frank, Matthias; Hampton, Christina Y; Sierra, Raymond G; Starodub, Dmitri; Williams, Garth J; Hajdu, Janos; Timneanu, Nicusor; Seibert, M Marvin; Andreasson, Jakob; Rocker, Andrea; Jönsson, Olof; Svenda, Martin; Stern, Stephan; Nass, Karol; Andritschke, Robert; Schröter, Claus-Dieter; Krasniqi, Faton; Bott, Mario; Schmidt, Kevin E; Wang, Xiaoyu; Grotjohann, Ingo; Holton, James M; Barends, Thomas R M; Neutze, Richard; Marchesini, Stefano; Fromme, Raimund; Schorb, Sebastian; Rupp, Daniela; Adolph, Marcus; Gorkhover, Tais; Andersson, Inger; Hirsemann, Helmut; Potdevin, Guillaume; Graafsma, Heinz; Nilsson, Björn; Spence, John C H

2011-02-03

X-ray crystallography provides the vast majority of macromolecular structures, but the success of the method relies on growing crystals of sufficient size. In conventional measurements, the necessary increase in X-ray dose to record data from crystals that are too small leads to extensive damage before a diffraction signal can be recorded. It is particularly challenging to obtain large, well-diffracting crystals of membrane proteins, for which fewer than 300 unique structures have been determined despite their importance in all living cells. Here we present a method for structure determination where single-crystal X-ray diffraction 'snapshots' are collected from a fully hydrated stream of nanocrystals using femtosecond pulses from a hard-X-ray free-electron laser, the Linac Coherent Light Source. We prove this concept with nanocrystals of photosystem I, one of the largest membrane protein complexes. More than 3,000,000 diffraction patterns were collected in this study, and a three-dimensional data set was assembled from individual photosystem I nanocrystals (∼200 nm to 2 μm in size). We mitigate the problem of radiation damage in crystallography by using pulses briefer than the timescale of most damage processes. This offers a new approach to structure determination of macromolecules that do not yield crystals of sufficient size for studies using conventional radiation sources or are particularly sensitive to radiation damage.

Growth and characterization of barium complex of 1,3,5-triazinane-2,4,6-trione in gel: a corrosion inhibiting material

NASA Astrophysics Data System (ADS)

Divya, R.; Nair, Lekshmi P.; Bijini, B. R.; Nair, C. M. K.; Babu, K. Rajendra

2018-05-01

Good quality prismatic crystals of industrially applicable corrosion inhibiting barium complex of 1,3,5-triazinane-2,4,6-trione have been grown by conventional gel method. The crystal structure, packing, and nature of bonds are revealed in the single crystal X-ray diffraction analysis. The crystal has a three-dimensional polymeric structure having a triclinic crystal system with the space group P-1. The powder X-ray diffraction analysis confirms its crystalline nature. The functional groups present in the crystal are identified by Fourier transform infrared spectroscopy. Elemental analysis confirms the stoichiometry of the elements present in the complex. Thermogravimetric analysis and differential thermal analysis reveal its good thermal stability. The optical properties like band gap, refractive index and extinction coefficient are evaluated from the UV-visible spectral analysis. The singular property of the material, corrosion inhibition efficiency achieved by the adsorption of the sample molecules is determined by the weight loss method.

There ain't nothing like a Dame: a commentary on Lonsdale (1947) 'Divergent beam X-ray photography of crystals'.

PubMed

Glazer, A M

2015-04-13

Prof. Dame Kathleen Lonsdale was one of the two first female Fellows of the Royal Society, having originally been a student of that great British scientist and Nobel Laureate William Henry Bragg. She came to fame initially for her solution of the crystal structure of hexamethyl benzene, thus demonstrating that the benzene ring was flat, of considerable importance to organic chemistry, where it had been proposed before but without proof. This was at a time when the solution of crystal structures was in its infancy, and in its day this work was considered a triumph. As a rare example then of a female physicist, Lonsdale became interested in various aspects of the diffraction of X-rays, and in particular published an important paper on a form of diffraction in which a strongly divergent source was used rather than the usual highly collimated beam. The photographs thus obtained showed a series of arcs and circles, whose positions were so sensitive that they could be used to determine the quality of crystals such as diamond, and even to calculate their lattice dimensions, and hence carbon-carbon bond lengths, to hitherto extraordinary precision. Lonsdale also became known not just as a scientist but as a peace activist and an active member of the Society of Friends. This commentary was written to celebrate the 350th anniversary of the journal Philosophical Transactions of the Royal Society.

Macromolecular crystallization in microgravity generated by a superconducting magnet.

PubMed

Wakayama, N I; Yin, D C; Harata, K; Kiyoshi, T; Fujiwara, M; Tanimoto, Y

2006-09-01

About 30% of the protein crystals grown in space yield better X-ray diffraction data than the best crystals grown on the earth. The microgravity environments provided by the application of an upward magnetic force constitute excellent candidates for simulating the microgravity conditions in space. Here, we describe a method to control effective gravity and formation of protein crystals in various levels of effective gravity. Since 2002, the stable and long-time durable microgravity generated by a convenient type of superconducting magnet has been available for protein crystal growth. For the first time, protein crystals, orthorhombic lysozyme, were grown at microgravity on the earth, and it was proved that this microgravity improved the crystal quality effectively and reproducibly. The present method always accompanies a strong magnetic field, and the magnetic field itself seems to improve crystal quality. Microgravity is not always effective for improving crystal quality. When we applied this microgravity to the formation of cubic porcine insulin and tetragonal lysozyme crystals, we observed no dependence of effective gravity on crystal quality. Thus, this kind of test will be useful for selecting promising proteins prior to the space experiments. Finally, the microgravity generated by the magnet is compared with that in space, considering the cost, the quality of microgravity, experimental convenience, etc., and the future use of this microgravity for macromolecular crystal growth is discussed.

Crystal growth, structural, thermal and mechanical behavior of l-arginine 4-nitrophenolate 4-nitrophenol dihydrate (LAPP) single crystals.

PubMed

Mahadevan, M; Ramachandran, K; Anandan, P; Arivanandhan, M; Bhagavannarayana, G; Hayakawa, Y

2014-12-10

Single crystals of l-arginine 4-nitrophenolate 4-nitrophenol dihydrate (LAPP) have been grown successfully from the solution of l-arginine and 4-nitrophenol. Slow evaporation of solvent technique was adopted to grow the bulk single crystals. Single crystal X-ray diffraction analysis confirms the grown crystal has monoclinic crystal system with space group of P21. Powder X-ray diffraction analysis shows the good crystalline nature. The crystalline perfection of the grown single crystals was analyzed by HRXRD by employing a multicrystal X-ray diffractometer. The functional groups were identified from proton NMR spectroscopic analysis. Linear and nonlinear optical properties were determined by UV-Vis spectrophotometer and Kurtz powder technique respectively. It is found that the grown crystal has no absorption in the green wavelength region and the SHG efficiency was found to be 2.66 times that of the standard KDP. The Thermal stability of the crystal was found by obtaining TG/DTA curve. The mechanical behavior of the grown crystal has been studied by Vicker's microhardness method. Copyright © 2014 Elsevier B.V. All rights reserved.

Growth, crystalline perfection, spectral, thermal and theoretical studies on imidazolium L-tartrate crystals.

PubMed

Meena, K; Muthu, K; Meenatchi, V; Rajasekar, M; Bhagavannarayana, G; Meenakshisundaram, S P

2014-04-24

Transparent optical quality single crystals of imidazolium L-tartrate (IMLT) were grown by conventional slow evaporation solution growth technique. Crystal structure of the as-grown IMLT was determined by single crystal X-ray diffraction analysis. Thermal analysis reveals the purity of the crystal and the sample is stable up to the melting point. Good transmittance in the visible region is observed and the band gap energy is estimated using diffuse reflectance data by the application of Kubelka-Munk algorithm. The powder X-ray diffraction study reveals the crystallinity of the as-grown crystal and it is compared with that of the experimental one. An additional peak in high resolution X-ray diffraction (HRXRD) indicates the presence of an internal structural low angle boundary. Second harmonic generation (SHG) activity of IMLT is significant as estimated by Kurtz and Perry powder technique. HOMO-LUMO energies and first-order molecular hyperpolarizability of IMLT have been evaluated using density functional theory (DFT) employing B3LYP functional and 6-31G(d,p) basis set. The optimized geometry closely resembles the ORTEP. The vibrational patterns present in the molecule are confirmed by FT-IR coinciding with theoretical patterns. Copyright © 2014 Elsevier B.V. All rights reserved.

X-ray diffraction and X-ray standing-wave study of the lead stearate film structure

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blagov, A. E.; Dyakova, Yu. A.; Kovalchuk, M. V.

2016-05-15

A new approach to the study of the structural quality of crystals is proposed. It is based on the use of X-ray standing-wave method without measuring secondary processes and considers the multiwave interaction of diffraction reflections corresponding to different harmonics of the same crystallographic reflection. A theory of multiwave X-ray diffraction is developed to calculate the rocking curves in the X-ray diffraction scheme under consideration for a long-period quasi-one-dimensional crystal. This phase-sensitive method is used to study the structure of a multilayer lead stearate film on a silicon substrate. Some specific structural features are revealed for the surface layer ofmore » the thin film, which are most likely due to the tilt of the upper layer molecules with respect to the external normal to the film surface.« less

Optical properties and diffraction effects in opal photonic crystals.

PubMed

Balestreri, Alessandra; Andreani, Lucio Claudio; Agio, Mario

2006-09-01

Optical properties of fcc opals oriented along the [111] direction are calculated by means of a scattering-matrix approach based on approximating each sphere with cylindrical slices. The use of a plane-wave basis in each layer allows distinguishing zero-order reflection and transmission from higher-order (diffraction) spectra. Optical spectra at large values of the angle of incidence indicate the presence of diffraction effects and of polarization mixing along the LW orientation. Reflectance and transmittance in the high-energy region show a rich spectral dependence and compare reasonably well with recent experimental observations on polystyrene opals. Diffraction spectra as a function of the number of layers display an oscillatory behavior, pointing to the existence of a Pendellösung phenomenon, related to the exchange of energy between two propagating modes in the investigated three-dimensional photonic crystal. This phenomenon could be observed in transmittance experiments on high-quality opals with controlled thickness.

The High Resolution Powder Diffraction Beam Line at ESRF.

PubMed

Fitch, A N

2004-01-01

The optical design and performance of the high-resolution powder diffraction beam line BM16 at ESRF are discussed and illustrated. Some recent studies carried out on BM16 are described, including crystal structure solution and refinement, anomalous scattering, in situ measurements, residual strain in engineering components, investigation of microstructure, and grazing-incidence diffraction from surface layers. The beam line is built on a bending magnet, and operates in the energy range from 5 keV to 40 keV. After the move to an undulator source in 2002, it will benefit from an extented energy range up to 60 keV and increased flux and resolution. It is anticipated that enhancements to the data quality will be achieved, leading to the solution of larger crystal structures, and improvements in the accuracy of refined structures. The systematic exploitation of anisotropic thermal expansion will help reduce the effects of peak overlap in the analysis of powder diffraction data.

A new polymorph of 4'-hydroxyvalerophenone revealed by thermoanalytical and X-ray diffraction studies

NASA Astrophysics Data System (ADS)

Lopes, Cátia S. D.; Bernardes, Carlos E. S.; Piedade, M. Fátima M.; Diogo, Hermínio P.; da Piedade, Manuel E. Minas

2017-04-01

A new polymorph of 1-(4-hydroxyphenyl)pentan-1-one (4'-hydroxyvalerophenone, HVP) was identified by using differential scanning calorimetry, hot stage microscopy, and X-ray powder diffraction. This novel crystal form (form II) was obtained by crystallization from melt. It has a fusion temperature of T fus = 324.3 ± 0.2 K and an enthalpy of fusion Δfus H m o = 18.14±0.18 kJ·mol-1. These values are significantly lower than those observed for the previously known phase (form I, monoclinic, space group P21/ c, T fus = 335.6 ± 0.7 K; Δfus H m o = 26.67±0.04 kJ·mol-1), which can be prepared by crystallization from ethanol. The results here obtained, therefore, suggest that form I is thermodynamically more stable than the newly identified form II and, furthermore, that the two polymorphs are monotropically related.

Electrodeposition of CdSe on GaAs and InP substrates

NASA Astrophysics Data System (ADS)

Etcheberry, A.; Cachet, H.; Cortes, R.; Froment, M.

2001-06-01

Epitaxial CdSe layers have been electrodeposited on the (1 0 0) and ( 1¯ 1¯ 1¯) faces of GaAs and InP single crystals. Chemical composition and crystalline quality of CdSe have been studied by X-photoelectron spectroscopy, reflection high energy electron diffraction and X-ray diffraction. Influence of the substrate has been pointed out.

Crystal structure of human tooth enamel studied by neutron diffraction

NASA Astrophysics Data System (ADS)

Ouladdiaf, Bachir; Rodriguez-Carvajal, Juan; Goutaudier, Christelle; Ouladdiaf, Selma; Grosgogeat, Brigitte; Pradelle, Nelly; Colon, Pierre

2015-02-01

Crystal structure of human tooth enamel was investigated using high-resolution neutron powder diffraction. Excellent agreement between observed and refined patterns is obtained, using the hexagonal hydroxyapatite model for the tooth enamel, where a large hydroxyl deficiency ˜70% is found in the 4e site. Rietveld refinements method combined with the difference Fourier maps have revealed, however, that the hydroxyl ions are not only disordered along the c-axis but also within the basal plane. Additional H ions located at the 6h site and forming HPO42- anions were found.

Twin-variant reorientation strain in Ni-Mn-Ga single crystal during quasi-static mechanical compression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pramanick, Abhijit; An, Ke; Stoica, Alexandru Dan

2011-01-01

Twin variant reorientation in single crystal Ni-Mn-Ga during quasi-static mechanical compression was studied using in-situ neutron diffraction. The volume fraction of reoriented twin variants for different stress amplitudes were obtained from the changes in integrated intensities of high-order neutron diffraction peaks. It is shown that during compressive loading, ~85% of the twins were reoriented parallel to the loading direction resulting in a maximum macroscopic strain of ~5.5%, which is in agreement with measured macroscopic strain.

Solution to the Phase Problem Using Multibeam X-Ray Diffraction.

NASA Astrophysics Data System (ADS)

Shen, Qun

Multi-beam x-ray diffraction, especially the asymmetry effect in the virtual Bragg scattering case, has been proved to provide useful phase information on the structure factors that are involved in the scattering process. A perturbation theory has been developed to provide an analytical expression for the diffracted wave field in virtual Bragg scattering situations, which explains the physical origin of the asymmetry effect. Two experiments on the (202) reflection of benzil, using 3.5 keV x-rays, have shown that the asymmetry effect is visible in a mosaic non-centrosymmetric organic crystal. The results do not depend on the shape of the crystal, hence proving that the method is universally applicable. A practical method to obtain arbitrary values of the phase triplet, based on the perturbation theory, has been developed and shown to work in the case of non-centrosymmetric crystals like benzil.

A novel structure of gel grown strontium cyanurate crystal and its structural, optical, electrical characterization

NASA Astrophysics Data System (ADS)

Divya, R.; Nair, Lekshmi P.; Bijini, B. R.; Nair, C. M. K.; Gopakumar, N.; Babu, K. Rajendra

2017-12-01

Strontium cyanurate crystals with novel structure and unique optical property like mechanoluminescence have been grown by conventional gel method. Transparent crystals were obtained. The single crystal X-ray diffraction analysis reveals the exquisite structure of the grown crystal. The crystal is centrosymmetric and has a three dimensional polymeric structure. The powder X ray diffraction analysis confirms its crystalline nature. The functional groups present in the crystal were identified by Fourier transform infrared spectroscopy. Elemental analysis confirmed the composition of the complex. A study of thermal properties was done by thermo gravimetric analysis and differential thermal analysis. The optical properties like band gap, refractive index and extinction coefficient were evaluated from the UV visible spectral analysis. The etching study was done to reveal the dislocations in the crystal which in turn explains mechanoluminescence emission. The mechanoluminescence property exhibited by the crystal makes it suitable for stress sensing applications. Besides being a centrosymmetric crystal, it also exhibits NLO behavior. Dielectric properties were studied and theoretical calculations of Fermi energy, valence electron plasma energy, penn gap and polarisability have been done.

Purification, crystallization and preliminary X-ray diffraction studies of d-tagatose 3-epimerase from Pseudomonas cichorii

PubMed Central

Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro

2007-01-01

d-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of d-­psicose has not been reported with epimerases other than P. cichorii D-­TE and d-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P21, with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 Å, β = 102.82°. Diffraction data were collected to 2.5 Å resolution. The asymmetric unit is expected to contain four molecules. PMID:17277456

Simultaneous Synchrotron WAXD and Fast Scanning (Chip) Calorimetry: On the (Isothermal) Crystallization of HDPE and PA11 at High Supercoolings and Cooling Rates up to 200 °C s(-1).

PubMed

Baeten, Dorien; Mathot, Vincent B F; Pijpers, Thijs F J; Verkinderen, Olivier; Portale, Giuseppe; Van Puyvelde, Peter; Goderis, Bart

2015-06-01

An experimental setup, making use of a Flash DSC 1 prototype, is presented in which materials can be studied simultaneously by fast scanning calorimetry (FSC) and synchrotron wide angle X-ray diffraction (WAXD). Accumulation of multiple, identical measurements results in high quality, millisecond WAXD patterns. Patterns at every degree during the crystallization and melting of high density polyethylene at FSC typical scanning rates from 20 up to 200 °C s(-1) are discussed in terms of the temperature and scanning rate dependent material crystallinities and crystal densities. Interestingly, the combined approach reveals FSC thermal lag issues, for which can be corrected. For polyamide 11, isothermal solidification at high supercooling yields a mesomorphic phase in less than a second, whereas at very low supercooling crystals are obtained. At intermediate supercooling, mixtures of mesomorphic and crystalline material are generated at a ratio proportional to the supercooling. This ratio is constant over the isothermal solidification time. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Crystallization and preliminary X-ray crystallographic analysis of hydroquinone dioxygenase from Sphingomonas sp. TTNP3

PubMed Central

Da Vela, Stefano; Ferraroni, Marta; Kolvenbach, Boris A.; Keller, Eva; Corvini, Philippe F. X.; Scozzafava, Andrea; Briganti, Fabrizio

2012-01-01

Hydroquinone dioxygenase (HQDO), a novel FeII ring-fission dioxygenase from Sphingomonas sp. strain TTNP3 which oxidizes a wide range of hydroquinones to the corresponding 4-hydroxymuconic semialdehydes, has been crystallized. The enzyme is an α2β2 heterotetramer constituted of two subunits of 19 and 38 kDa. Diffraction-quality crystals of HQDO were obtained using the sitting-drop vapour-diffusion method at 277 K from a solution consisting of 16% PEG 4000, 0.3 M MgCl2, 0.1 M Tris pH 8.5. The crystals belonged to the monoclinic space group P21, with unit-cell parameters a = 88.4, b = 125.4, c = 90.8 Å, β = 105.3°. The asymmetric unit contained two heterotetramers, i.e. four copies of each of the two different subunits related by noncrystallographic 222 symmetry. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 0.980 Å. PMID:22691794

Negative refraction imaging of acoustic metamaterial lens in the supersonic range

DOE Office of Scientific and Technical Information (OSTI.GOV)

Han, Jianning; Wen, Tingdun; Key Laboratory of Electronic Testing Technology, North University of China, Taiyuan 030051

2014-05-15

Acoustic metamaterials with negative refraction index is the most promising method to overcome the diffraction limit of acoustic imaging to achieve ultrahigh resolution. In this paper, we use localized resonant phononic crystal as the unit cell to construct the acoustic negative refraction lens. Based on the vibration model of the phononic crystal, negative quality parameters of the lens are obtained while excited near the system resonance frequency. Simulation results show that negative refraction of the acoustic lens can be achieved when a sound wave transmiting through the phononic crystal plate. The patterns of the imaging field agree well with thatmore » of the incident wave, while the dispersion is very weak. The unit cell size in the simulation is 0.0005 m and the wavelength of the sound source is 0.02 m, from which we show that acoustic signal can be manipulated through structures with dimensions much smaller than the wavelength of incident wave.« less

X-ray diffraction, spectroscopic and mechanical studies on potential organic NLO materials of metaNitroaniline and N-3-Nitrophenyl Acetamide single crystals

NASA Astrophysics Data System (ADS)

Senthil, S.; Madhavan, J.

2015-02-01

In the present paper, attempts were made to grow good quality metaNitroaniline (mNA) and N-3-Nitrophenyl (3-NAA) single crystals. The lattice parameter values from the Powder X-ray diffraction pattern confirms that mNA belongs to orthorhombic crystal system with the unit cell parameter values of a = 6.501 Å, b = 19.330 Å and c = 5.082 Å with space group Pbc21. Similarly the powder XRD data indicates that 3-NAA crystal retained its monoclinic structure with lattice parameter values a = 9.762 Å, b =13.287 Å, c =13.226 Å, and β = 102.99°. Investigation has been carried out to assign the vibrational frequencies of the grown crystals by Fourier Transform infrared spectroscopy technique. The SHG efficiency of mNA and 3NAA was determined by Kurtz and Perry powder technique. The Optical absorption study confirms the suitability of the crystals for device applications. The mechanical properties of the grown crystals have been studied using Vickers microhardness tester.

Quantitative performance of a polarization diffraction grating polarimeter encoded onto two liquid-crystal-on-silicon displays

NASA Astrophysics Data System (ADS)

Cofré, Aarón; Vargas, Asticio; Torres-Ruiz, Fabián A.; Campos, Juan; Lizana, Angel; del Mar Sánchez-López, María; Moreno, Ignacio

2017-11-01

We present a quantitative analysis of the performance of a complete snapshot polarimeter based on a polarization diffraction grating (PDGr). The PDGr is generated in a common path polarization interferometer with a Z optical architecture that uses two liquid-crystal on silicon (LCoS) displays to imprint two different phase-only diffraction gratings onto two orthogonal linear states of polarization. As a result, we obtain a programmable PDGr capable to act as a simultaneous polarization state generator (PSG), yielding diffraction orders with different states of polarization. The same system is also shown to operate as a polarization state analyzer (PSA), therefore useful for the realization of a snapshot polarimeter. We analyze its performance using quantitative metrics such as the conditional number, and verify its reliability for the detection of states of polarization.

Improved crystal orientation and physical properties from single-shot XFEL stills

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sauter, Nicholas K., E-mail: nksauter@lbl.gov; Hattne, Johan; Brewster, Aaron S.

X-ray free-electron laser crystallography relies on the collection of still-shot diffraction patterns. New methods are developed for optimal modeling of the crystals’ orientations and mosaic block properties. X-ray diffraction patterns from still crystals are inherently difficult to process because the crystal orientation is not uniquely determined by measuring the Bragg spot positions. Only one of the three rotational degrees of freedom is directly coupled to spot positions; the other two rotations move Bragg spots in and out of the reflecting condition but do not change the direction of the diffracted rays. This hinders the ability to recover accurate structure factorsmore » from experiments that are dependent on single-shot exposures, such as femtosecond diffract-and-destroy protocols at X-ray free-electron lasers (XFELs). Here, additional methods are introduced to optimally model the diffraction. The best orientation is obtained by requiring, for the brightest observed spots, that each reciprocal-lattice point be placed into the exact reflecting condition implied by Bragg’s law with a minimal rotation. This approach reduces the experimental uncertainties in noisy XFEL data, improving the crystallographic R factors and sharpening anomalous differences that are near the level of the noise.« less

Yes, one can obtain better quality structures from routine X-ray data collection.

PubMed

Sanjuan-Szklarz, W Fabiola; Hoser, Anna A; Gutmann, Matthias; Madsen, Anders Østergaard; Woźniak, Krzysztof

2016-01-01

Single-crystal X-ray diffraction structural results for benzidine dihydrochloride, hydrated and protonated N,N,N,N-peri(dimethylamino)naphthalene chloride, triptycene, dichlorodimethyltriptycene and decamethylferrocene have been analysed. A critical discussion of the dependence of structural and thermal parameters on resolution for these compounds is presented. Results of refinements against X-ray data, cut off to different resolutions from the high-resolution data files, are compared to structural models derived from neutron diffraction experiments. The Independent Atom Model (IAM) and the Transferable Aspherical Atom Model (TAAM) are tested. The average differences between the X-ray and neutron structural parameters (with the exception of valence angles defined by H atoms) decrease with the increasing 2θmax angle. The scale of differences between X-ray and neutron geometrical parameters can be significantly reduced when data are collected to the higher, than commonly used, 2θmax diffraction angles (for Mo Kα 2θmax > 65°). The final structural and thermal parameters obtained for the studied compounds using TAAM refinement are in better agreement with the neutron values than the IAM results for all resolutions and all compounds. By using TAAM, it is still possible to obtain accurate results even from low-resolution X-ray data. This is particularly important as TAAM is easy to apply and can routinely be used to improve the quality of structural investigations [Dominiak (2015 ▸). LSDB from UBDB. University of Buffalo, USA]. We can recommend that, in order to obtain more adequate (more accurate and precise) structural and displacement parameters during the IAM model refinement, data should be collected up to the larger diffraction angles, at least, for Mo Kα radiation to 2θmax = 65° (sin θmax/λ < 0.75 Å(-1)). The TAAM approach is a very good option to obtain more adequate results even using data collected to the lower 2θmax angles. Also the results of translation-libration-screw (TLS) analysis and vibrational entropy values are more reliable for 2θmax > 65°.

Protein nanocrystallography: growth mechanism and atomic structure of crystals induced by nanotemplates.

PubMed

Pechkova, E; Vasile, F; Spera, R; Fiordoro, S; Nicolini, C

2005-11-01

Protein nanocrystallography, a new technology for crystal growth based on protein nanotemplates, has recently been shown to produce diffracting, stable and radiation-resistant lysozyme crystals. This article, by computing these lysozyme crystals' atomic structures, obtained by the diffraction patterns of microfocused synchrotron radiation, provides a possible mechanism for this increased stability, namely a significant decrease in water content accompanied by a minor but significant alpha-helix increase. These data are shown to be compatible with the circular dichroism and two-dimensional Fourier transform spectra of high-resolution H NMR of proteins dissolved from the same nanotemplate-based crystal versus those from a classical crystal. Finally, evidence for protein direct transfer from the nanotemplate to the drop and the participation of the template proteins in crystal nucleation and growth is provided by high-resolution NMR spectrometry and mass spectrometry. Furthermore, the lysozyme nanotemplate appears stable up to 523 K, as confirmed by a thermal denaturation study using spectropolarimetry. The overall data suggest that heat-proof lysozyme presence in the crystal provides a possible explanation of the crystal's resistance to synchrotron radiation.

Crystal pathologies in macromolecular crystallography.

PubMed

Dauter, Zbigniew; Jaskólski, Mariusz

Macromolecules, such as proteins or nucleic acids, form crystals with a large volume fraction of water, ~50% on average. Apart from typical physical defects and rather trivial poor quality problems, macromolecular crystals, as essentially any crystals, can also suffer from several kinds of pathologies, in which everything seems to be perfect, except that from the structural point of view the interpretation may be very difficult, sometimes even impossible. A frequent nuisance is pseudosymmetry, or non-crystallographic symmetry (NCS), which is particularly nasty when it has translational character. Lattice-translocation defects, also called order-disorder twinning (OD-twinning), occur when molecules are packed regularly in layers but the layers are stacked (without rotation) in two (or more) discrete modes, with a unique translocation vector. Crystal twinning arises when twin domains have different orientations, incompatible with the symmetry of the crystal structure. There are also crystals in which the periodic (lattice) order is broken or absent altogether. When the strict short-range translational order from one unit cell to the next is lost but the long-range order is restored by a periodic modulation, we have a modulated crystal structure. In quasicrystals (not observed for macromolecules yet), the periodic order (in 3D space) is lost completely and the diffraction pattern (which is still discrete) cannot be even indexed using three hkl indices. In addition, there are other physical defects and phenomena (such as high mosaicity, diffraction anisotropy, diffuse scattering, etc.) which make diffraction data processing and structure solution difficult or even impossible.

Growth and nonlinear optical characterization of organic single crystal films

NASA Astrophysics Data System (ADS)

Zhou, Ligui

1997-12-01

Organic single crystal films are important for various future applications in photonics and integrated optics. The conventional method for inorganic crystal growth is not suitable for organic materials, and the high temperature melting method is not good for most organic materials due to decomposition problems. We developed a new method-modified shear method-to grow large area organic single crystal thin films which have exceptional nonlinear optical properties and high quality surfaces. Several organic materials (NPP, PNP and DAST) were synthesized and purified before the thin film crystal growth. Organic single crystal thin films were grown from saturated organic solutions using modified shear method. The area of single crystal films were about 1.5 cm2 for PNP, 1 cm2 for NPP and 5 mm2 for DAST. The thickness of the thin films which could be controlled by the applied pressure ranged from 1μm to 10 μm. The single crystal thin films of organic materials were characterized by polarized microscopy, x-ray diffraction, polarized UV-Visible and polarized micro-FTIR spectroscopy. Polarized microscopy showed uniform birefringence and complete extinction with the rotation of the single crystal thin films under crossed- polarization, which indicated high quality single crystals with no scattering. The surface orientation of single crystal thin films was characterized by x-ray diffraction. The molecular orientation within the crystal was further studied by the polarized UV-Visible and Polarized micro-FTIR techniques combined with the x-ray and polarized microscopy results. A Nd:YAG laser with 35 picosecond pulses at 1064nm wavelength was employed to perform the nonlinear optical characterization of the organic single crystal thin films. Two measurement techniques were used to study the crystal films: second harmonic generation (SHG) and electro-optic (EO) effect. SHG results showed that the nonlinear optical coefficient of NPP was 18 times that of LiNbO3, a standard inorganic crystal material, and the nonlinear optical coefficient of PNP was 11 times that of LiNbO3. Electro-optic measurements showed that r11 = 65 pm/V for NPP and r12 = 350 pm/V for DAST. EO modulation effect was also observed using Fabry-Perot interferometry. Waveguide devices are very important for integrated optics. But the fabrication of waveguide devices on the organic single crystal thin films was difficult due to the solubility of the film in common organic solvents. A modified photolithographic technique was employed to make channel waveguides and poly(vinyl alcohol) (PVA) was used as a protective layer in the fabrication of the waveguides. Waveguides with dimensions about 7/mum x 1μm x 1mm were obtained.

Ab initio structure determination from prion nanocrystals at atomic resolution by MicroED

DOE PAGES

Sawaya, Michael R.; Rodriguez, Jose; Cascio, Duilio; ...

2016-09-19

Electrons, because of their strong interaction with matter, produce high-resolution diffraction patterns from tiny 3D crystals only a few hundred nanometers thick in a frozen-hydrated state. This discovery offers the prospect of facile structure determination of complex biological macromolecules, which cannot be coaxed to form crystals large enough for conventional crystallography or cannot easily be produced in sufficient quantities. Two potential obstacles stand in the way. The first is a phenomenon known as dynamical scattering, in which multiple scattering events scramble the recorded electron diffraction intensities so that they are no longer informative of the crystallized molecule. The second obstaclemore » is the lack of a proven means of de novo phase determination, as is required if the molecule crystallized is insufficiently similar to one that has been previously determined.We showwith four structures of the amyloid core of the Sup35 prion protein that, if the diffraction resolution is high enough, sufficiently accurate phases can be obtained by direct methods with the cryo-EM method microelectron diffraction (MicroED), just as in X-ray diffraction. The success of these four experiments dispels the concern that dynamical scattering is an obstacle to ab initio phasing by MicroED and suggests that structures of novel macromolecules can also be determined by direct methods.« less

Ab initio structure determination from prion nanocrystals at atomic resolution by MicroED

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sawaya, Michael R.; Rodriguez, Jose; Cascio, Duilio

Electrons, because of their strong interaction with matter, produce high-resolution diffraction patterns from tiny 3D crystals only a few hundred nanometers thick in a frozen-hydrated state. This discovery offers the prospect of facile structure determination of complex biological macromolecules, which cannot be coaxed to form crystals large enough for conventional crystallography or cannot easily be produced in sufficient quantities. Two potential obstacles stand in the way. The first is a phenomenon known as dynamical scattering, in which multiple scattering events scramble the recorded electron diffraction intensities so that they are no longer informative of the crystallized molecule. The second obstaclemore » is the lack of a proven means of de novo phase determination, as is required if the molecule crystallized is insufficiently similar to one that has been previously determined.We showwith four structures of the amyloid core of the Sup35 prion protein that, if the diffraction resolution is high enough, sufficiently accurate phases can be obtained by direct methods with the cryo-EM method microelectron diffraction (MicroED), just as in X-ray diffraction. The success of these four experiments dispels the concern that dynamical scattering is an obstacle to ab initio phasing by MicroED and suggests that structures of novel macromolecules can also be determined by direct methods.« less

Characterization of a defective PbWO4 crystal cut along the a-c crystallographic plane: structural assessment and a novel photoelastic stress analysis

NASA Astrophysics Data System (ADS)

Montalto, L.; Natali, P. P.; Daví, F.; Mengucci., P.; Paone, N.; Rinaldi, D.

2017-12-01

Among scintillators, the PWO is one of the most widely used, for instance in CMS calorimeter at CERN and PANDA project. Crystallographic structure and chemical composition as well as residual stress condition, are indicators of homogeneity and good quality of the crystal. In this paper, structural characterization of a defective PbWO4 (PWO) crystal has been performed by X-ray Diffraction (XRD), Energy Dispersive Spectroscopy (EDS) and Photoelasticity in the unusual (a, c) crystallographic plane. XRD and EDS analysis have been used to investigate crystallographic orientation and chemical composition, while stress distribution, which indicates macroscopic inhomogeneities and defects, has been obtained by photoelastic approaches, in Conoscopic and Sphenoscopic configuration. Since the sample is cut along the (a, c) crystallographic plane, a new method is proposed for the interpretation of the fringe pattern. The structural analysis has detected odds from the nominal lattice dimension, which can be attributed to the strong presence of Pb and W. A strong inhomogeneity over the crystal sample has been revealed by the photoelastic inspection. The results give reliability to the proposed procedure which is exploitable in crystals with other structures.

Peculiarities of Crystallization of the Restriction Endonuclease EcoRII

NASA Technical Reports Server (NTRS)

Karpove, Elizaveta; Pusey, M.arc L.

1998-01-01

Nucleases interfere with most standard molecular biology procedures. We have purified and crystallized the restriction endonuclease EcoRII, which belongs to the type II of restriction- modification enzyme, to study the protein crystallization process using a "non standard" macromolecule. A procedure for the purification of EcoRII was developed and 99% pure protein as determined by SDS PAGE electrophoresis obtained. Light scattering experiments were performed to assist in screening protein suitable crystallization conditions. The second virial coefficient was determined as a function of precipitating salt concentration, using sodium chloride, ammonium sulfate, and sodium sulfate. Small (maximum size approximately 0.2 mm) well shaped crystals have been obtained. Larger poorly formed crystals (ca 0.5 mm) have also been obtained, but we have been unable to mount them for diff-raction analysis due to their extreme fragility. Crystallization experiments with PEG have shown that using this precipitant, the best crystals are obtained from slightly over-saturated solutions. Use of higher precipitant concentration leads to dendritic crystal formation. EcoRII is difficult to solubilize and meticulous attention must be paid to the presence of reducing agents.

Direct growth of freestanding GaN on C-face SiC by HVPE.

PubMed

Tian, Yuan; Shao, Yongliang; Wu, Yongzhong; Hao, Xiaopeng; Zhang, Lei; Dai, Yuanbin; Huo, Qin

2015-06-02

In this work, high quality GaN crystal was successfully grown on C-face 6H-SiC by HVPE using a two steps growth process. Due to the small interaction stress between the GaN and the SiC substrate, the GaN was self-separated from the SiC substrate even with a small thickness of about 100 μm. Moreover, the SiC substrate was excellent without damage after the whole process so that it can be repeatedly used in the GaN growth. Hot phosphoric acid etching (at 240 °C for 30 min) was employed to identify the polarity of the GaN layer. According to the etching results, the obtained layer was Ga-polar GaN. High-resolution X-ray diffraction (HRXRD) and electron backscatter diffraction (EBSD) were done to characterize the quality of the freestanding GaN. The Raman measurements showed that the freestanding GaN film grown on the C-face 6H-SiC was stress-free. The optical properties of the freestanding GaN layer were determined by photoluminescence (PL) spectra.

High resolution x-ray and gamma ray imaging using diffraction lenses with mechanically bent crystals

DOEpatents

Smither, Robert K [Hinsdale, IL

2008-12-23

A method for high spatial resolution imaging of a plurality of sources of x-ray and gamma-ray radiation is provided. High quality mechanically bent diffracting crystals of 0.1 mm radial width are used for focusing the radiation and directing the radiation to an array of detectors which is used for analyzing their addition to collect data as to the location of the source of radiation. A computer is used for converting the data to an image. The invention also provides for the use of a multi-component high resolution detector array and for narrow source and detector apertures.

Synthesis and Crystal Structure Study of 2’-Se-Adenosine-Derivatized DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheng, J.; Salon, J; Gan, J

2010-01-01

The selenium derivatization of nucleic acids is a novel and promising strategy for 3D structure determination of nucleic acids. Selenium can serve as an excellent anomalous scattering center to solve the phase problem, which is one of the two major bottlenecks in macromolecule X-ray crystallography. The other major bottleneck is crystallization. It has been demonstrated that the incorporated selenium functionality at the 2'-positions of the nucleosides and nucleotides is stable and does not cause significant structure perturbation. Furthermore, it was observed that the 2'-Se-derivatization could facilitate crystallization of oligonucleotides with fast crystal growth and high diffraction quality. Herein, we describemore » a convenient synthesis of the 2'-Se-adenosine phosphoramidite, and report the first synthesis and X-ray crystal structure determination of the DNA containing the 2'-Se-A derivatization. The 3D structure of 2'-Se-A-DNA decamer [5'-GTACGCGT(2'-Se-A)C-3']{sub 2} was determined at 1.75 {angstrom} resolution, the 2'-Se-functionality points to the minor groove, and the Se-modified and native structures are virtually identical. Moreover, we have observed that the 2'-Se-A modification can greatly facilitate the crystal growth with high diffraction quality. In conjunction with the crystallization facilitation by the 2'-Se-U and 2'-Se-T, this novel observation on the 2'-Se-A functionality suggests that the 2'-Se moiety is sole responsible for the crystallization facilitation and the identity of nucleobases does not influence the crystal growth significantly.« less

Crystals of Serum Albumin for Use in Genetic Engineering and Rational Drug Design

NASA Technical Reports Server (NTRS)

Carter, Daniel C. (Inventor)

1996-01-01

Serum albumin crystal forms have been produced which exhibit superior x-ray diffraction quality. The crystals are produced from both recombinant and wild-type human serum albumin, canine, and baboon serum albumin and allow the performance of drug-binding studies as well as genetic engineering studies. The crystals are grown from solutions of polyethylene glycol or ammonium sulphate within prescribed limits during growth times from one to several weeks and include the following space groups: P2(sub 1), C2, P1.

Femtosecond X-ray protein nanocrystallography

PubMed Central

Chapman, Henry N.; Fromme, Petra; Barty, Anton; White, Thomas A.; Kirian, Richard A.; Aquila, Andrew; Hunter, Mark S.; Schulz, Joachim; DePonte, Daniel P.; Weierstall, Uwe; Doak, R. Bruce; Maia, Filipe R. N. C.; Martin, Andrew V.; Schlichting, Ilme; Lomb, Lukas; Coppola, Nicola; Shoeman, Robert L.; Epp, Sascha W.; Hartmann, Robert; Rolles, Daniel; Rudenko, Artem; Foucar, Lutz; Kimmel, Nils; Weidenspointner, Georg; Holl, Peter; Liang, Mengning; Barthelmess, Miriam; Caleman, Carl; Boutet, Sébastien; Bogan, Michael J.; Krzywinski, Jacek; Bostedt, Christoph; Bajt, Saša; Gumprecht, Lars; Rudek, Benedikt; Erk, Benjamin; Schmidt, Carlo; Hömke, André; Reich, Christian; Pietschner, Daniel; Strüder, Lothar; Hauser, Günter; Gorke, Hubert; Ullrich, Joachim; Herrmann, Sven; Schaller, Gerhard; Schopper, Florian; Soltau, Heike; Kühnel, Kai-Uwe; Messerschmidt, Marc; Bozek, John D.; Hau-Riege, Stefan P.; Frank, Matthias; Hampton, Christina Y.; Sierra, Raymond G.; Starodub, Dmitri; Williams, Garth J.; Hajdu, Janos; Timneanu, Nicusor; Seibert, M. Marvin; Andreasson, Jakob; Rocker, Andrea; Jönsson, Olof; Svenda, Martin; Stern, Stephan; Nass, Karol; Andritschke, Robert; Schröter, Claus-Dieter; Krasniqi, Faton; Bott, Mario; Schmidt, Kevin E.; Wang, Xiaoyu; Grotjohann, Ingo; Holton, James M.; Barends, Thomas R. M.; Neutze, Richard; Marchesini, Stefano; Fromme, Raimund; Schorb, Sebastian; Rupp, Daniela; Adolph, Marcus; Gorkhover, Tais; Andersson, Inger; Hirsemann, Helmut; Potdevin, Guillaume; Graafsma, Heinz; Nilsson, Björn; Spence, John C. H.

2012-01-01

X-ray crystallography provides the vast majority of macromolecular structures, but the success of the method relies on growing crystals of sufficient size. In conventional measurements, the necessary increase in X-ray dose to record data from crystals that are too small leads to extensive damage before a diffraction signal can be recorded1-3. It is particularly challenging to obtain large, well-diffracting crystals of membrane proteins, for which fewer than 300 unique structures have been determined despite their importance in all living cells. Here we present a method for structure determination where single-crystal X-ray diffraction ‘snapshots’ are collected from a fully hydrated stream of nanocrystals using femtosecond pulses from a hard-X-ray free-electron laser, the Linac Coherent Light Source4. We prove this concept with nanocrystals of photosystem I, one of the largest membrane protein complexes5. More than 3,000,000 diffraction patterns were collected in this study, and a three-dimensional data set was assembled from individual photosystem I nanocrystals (~200 nm to 2 μm in size). We mitigate the problem of radiation damage in crystallography by using pulses briefer than the timescale of most damage processes6. This offers a new approach to structure determination of macromolecules that do not yield crystals of sufficient size for studies using conventional radiation sources or are particularly sensitive to radiation damage. PMID:21293373

[Physicochemical properties of suplatast tosilate racemate and enantiomers].

PubMed

Ushio, T; Endo, K; Yamamoto, K

1996-11-01

The physicochemical properties of the enantiomer and racemates of suplatast tosilate (ST) were investigated by means of infrared spectroscopy, solid-state 13C CP/MAS NMR spectroscopy, thermal analysis, and X-ray diffraction analysis, and by measuring the solubility and hygroscopy. The infrared and NMR spectra and X-ray diffraction pattern of the enantiomer were distinctly different from those of the racemate. The melting point of the enantiomer was lower than that of the racemate by 5 degrees C, while the solubility of the enantiomer was 1.3 times higher than that of the racemate. The hygroscopic rate of the enantiomer was greater than that of the racemate. These results suggested that ST was classified into a racemic compound crystal. Furthermore, by comparing the relative peak intensity ratios on X-ray diffraction patterns of the crystals with various optical purities prepared by recrystallization, it was found that a mixture of racemic compound crystals and either of racemic mixture crystals or racemic solid solutions was obtained by recrystallization of ST in the content of 0 to 64%ee, while the recrystallization of ST in the content of more than 64%ee led to the formation of racemic mixture crystals or racemic solid solutions.

Enhancement of crystal homogeneity of protein crystals under application of an external alternating current electric field

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koizumi, H.; Uda, S.; Fujiwara, K.

X-ray diffraction rocking-curve measurements were performed on tetragonal hen egg white (HEW) lysozyme crystals grown with and without the application of an external alternating current (AC) electric field. The crystal quality was assessed by the full width at half maximum (FWHM) value for each rocking curve. For two-dimensional maps of the FWHMs measured on the 440 and the 12 12 0 reflection, the crystal homogeneity was improved under application of an external electric field at 1 MHz, compared with that without. In particular, the significant improvement of the crystal homogeneity was observed for the 12 12 0 reflection.

Center for Macromolecular Crystallography, University of Alabama in Birmingham

NASA Technical Reports Server (NTRS)

Navia, Manuel A.

1991-01-01

Porcine pancreatic elastase (PPE) crystals grown under microgravity conditions on mission STS-26 of the Space Shuttle Discovery were shown to diffract to considerably higher resolution than the best PPE crystals grown by us on the ground. We have now independently refined both the microgravity and ground-based data. Preliminary results of these refinements are summarized. These results show nearly a doubling of experimental diffraction data for this structure, exceeding 1.3 A resolution. Improved phase information derived from the refined structure of PPE based on this microgravity data has allowed us to interpret previously-uninterpretable electron density obtained from ground-based crystals of a complex of PPE with a chemically-reactive inhibitor. Intermediate stages in the enzyme-inhibitor reaction mechanism in the crystal can now be directly observed. Further refinement of PPE structures is in progress.

Diffraction of three-colour radiation on an acoustic wave

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kotov, V M

We study acousto-optic Bragg diffraction of three-colour radiation having wavelengths of 488, 514 and 633 nm on a single acoustic wave propagating in a TeO{sub 2} crystal. A technique is developed that allows one to find diffraction regimes with a proportional change in the intensity of all radiations by varying the acoustic power. According to the technique, radiation with a maximum wavelength has to be in strict Bragg synchronism with the acoustic wave, while other radiations diffract during the synchronism detuning. The results obtained using this technique are experimentally confirmed. (diffraction of light)

Biochemical, spectroscopic and X-ray structural analysis of deuterated multicopper oxidase CueO prepared from a new expression construct for neutron crystallography.

PubMed

Akter, Mahfuza; Inoue, Chika; Komori, Hirofumi; Matsuda, Nana; Sakurai, Takeshi; Kataoka, Kunishige; Higuchi, Yoshiki; Shibata, Naoki

2016-10-01

Multicopper oxidases oxidize various phenolic and nonphenolic compounds by using molecular oxygen as an electron acceptor to produce water. A multicopper oxidase protein, CueO, from Escherichia coli is involved in copper homeostasis in the bacterial cell. Although X-ray crystallographic studies have been conducted, the reduction mechanism of oxygen and the proton-transfer pathway remain unclear owing to the difficulty in identifying H atoms from X-ray diffraction data alone. To elucidate the reaction mechanism using neutron crystallography, a preparation system for obtaining large, high-quality single crystals of deuterated CueO was developed. Tiny crystals were obtained from the deuterated CueO initially prepared from the original construct. The X-ray crystal structure of the deuterated CueO showed that the protein contained an incompletely truncated signal sequence at the N-terminus, which resulted in the heterogeneity of the protein sample for crystallization. Here, a new CueO expression system that had an HRV3C cleavage site just after the signal sequence was constructed. Deuterated CueO from the new construct was expressed in cells cultured in deuterated algae-extract medium and the signal sequence was completely eliminated by HRV3C protease. The deuteration level of the purified protein was estimated by MALDI-TOF mass spectrometry to be at least 83.2% compared with nondeuterated protein. Nondeuterated CueO crystallized in space group P2 1 , with unit-cell parameters a = 49.51, b = 88.79, c = 53.95 Å, β = 94.24°, and deuterated CueO crystallized in space group P2 1 2 1 2 1 , with unit-cell parameters a = 49.91, b = 106.92, c = 262.89 Å. The crystallographic parameters for the crystals of the new construct were different from those previously reported for nondeuterated crystals. The nondeuterated and deuterated CueO from the new construct had similar UV-Vis spectra, enzymatic activities and overall structure and geometry of the ligands of the Cu atoms in the active site to those of previously reported CueO structures. These results indicate that the CueO protein prepared using the new construct is suitable for further neutron diffraction studies.

Single crystal X-ray diffraction study of the HgBa2CuO4+δ superconducting compound

NASA Astrophysics Data System (ADS)

Bordet, P.; Duc, F.; Lefloch, S.; Capponi, J. J.; Alexandre, E.; Rosa-Nunes, M.; Antipov, E. V.; Putilin, S.

1996-02-01

A high precision X-ray diffraction analysis up to sin θ/λ = 1.15 of a HgBa2CuO4+δ single crystal having a Tc of ~ 90 K is presented. The cell parameters are a = 3.8815(4), c = 9.485 (7) Å. The refinements indicate the existence of a split barium site due to the presence of excess oxygen in the mercury layer. The position of this excess oxygen might be slightly displaced from the (1/2 1/2 0) position. A 6% mercury deficiency is observed. Models, including mercury defects, substitution by copper cations, or carbonate groups, are compared. However, we obtain no definite evidence for either of the three models. A possible disorder of the Hg position, due to the formation of chemical bonds with neighbouring extra oxygen anions, could correlate to the refinements of mixed species at the Hg site. A low temperature single crystal x-ray diffraction study, and comparison of refinements for the same single crystal with different extra oxygen contents, are in progress to help clarify this problem.

Crystallization and preliminary X-ray diffraction analysis of mouse 3(17)α-hydroxysteroid dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

El-Kabbani, Ossama, E-mail: ossama.el-kabbani@vcp.monash.edu.au; Ishikura, Syuhei; Wagner, Armin

2005-07-01

Orthorhombic crystals of mouse 3(17)α-hydroxysteroid dehydrogenase were obtained from buffered polyethylene glycol solutions. The crystals diffracted to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA. The 3(17)α-hydroxysteroid dehydrogenase from mouse is involved in the metabolism of oestrogens, androgens, neurosteroids and xenobiotic compounds. The enzyme was crystallized by the hanging-drop vapour-diffusion method in space group P222{sub 1}, with unit-cell parameters a = 84.91, b = 84.90, c = 95.83 Å. The Matthews coefficient (V{sub M}) and the solvent content were 2.21 Å{sup 3} Da{sup −1} and 44.6%, respectively, assuming the presence of two molecules in the asymmetricmore » unit. Diffraction data were collected to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA using a MAR CCD area detector and gave a data set with an overall R{sub merge} of 6.8% and a completeness of 91.1%.« less

Crystallization and preliminary X-ray analysis of a low density lipoprotein from human plasma.

PubMed

Prassl, R; Chapman, J M; Nigon, F; Sara, M; Eschenburg, S; Betzel, C; Saxena, A; Laggner, P

1996-11-15

Single crystals of human plasma low density lipoprotein (LDL), the major transport vehicle for cholesterol in blood, have been produced with a view to analysis of the three-dimensional structure by x-ray crystallography. Crystals with dimensions of approximately 200 x 100 x 50 microm have been reproducibly obtained from highly homogeneous LDL particle subspecies, isolated in the density ranges d = 1.0271-1. 0297 g/ml and d = 1.0297-1.0327 g/ml. Electron microscopic imaging of ultrathin-sectioned preparations of the crystals confirmed the existence of a regular, quasihexagonal arrangement of spherical particles of approximately 18 nm in diameter, thereby resembling the dimensions characteristic of LDL after dehydration and fixation. X-ray diffraction with synchrotron radiation under cryogenic conditions revealed the presence of well resolved diffraction spots, to a resolution of about 29 A. The diffraction patterns are indexed in terms of a triclinic lattice with unit cell dimensions of a = 16. 1 nm, b = 39.0 nm, c = 43.9 nm; alpha = 96.2 degrees, beta = 92.1 degrees, gamma = 102 degrees, and with space group P1.

Crystallization and preliminary X-ray diffraction analysis of the wild-type haloalkane dehalogenase DhaA and its variant DhaA13 complexed with different ligands.

PubMed

Stsiapanava, Alena; Chaloupkova, Radka; Fortova, Andrea; Brynda, Jiri; Weiss, Manfred S; Damborsky, Jiri; Smatanova, Ivana Kuta

2011-02-01

Haloalkane dehalogenases make up an important class of hydrolytic enzymes which catalyse the cleavage of carbon-halogen bonds in halogenated aliphatic compounds. There is growing interest in these enzymes owing to their potential use in environmental and industrial applications. The haloalkane dehalogenase DhaA from Rhodococcus rhodochrous NCIMB 13064 can slowly detoxify the industrial pollutant 1,2,3-trichloropropane (TCP). Structural analysis of this enzyme complexed with target ligands was conducted in order to obtain detailed information about the structural limitations of its catalytic properties. In this study, the crystallization and preliminary X-ray analysis of complexes of wild-type DhaA with 2-propanol and with TCP and of complexes of the catalytically inactive variant DhaA13 with the dye coumarin and with TCP are described. The crystals of wild-type DhaA were plate-shaped and belonged to the triclinic space group P1, while the variant DhaA13 can form prism-shaped crystals belonging to the orthorhombic space group P2(1)2(1)2(1) as well as plate-shaped crystals belonging to the triclinic space group P1. Diffraction data for crystals of wild-type DhaA grown from crystallization solutions with different concentrations of 2-propanol were collected to 1.70 and 1.26 Å resolution, respectively. A prism-shaped crystal of DhaA13 complexed with TCP and a plate-shaped crystal of the same variant complexed with the dye coumarin diffracted X-rays to 1.60 and 1.33 Å resolution, respectively. A crystal of wild-type DhaA and a plate-shaped crystal of DhaA13, both complexed with TCP, diffracted to atomic resolutions of 1.04 and 0.97 Å, respectively.

Batch crystallization of rhodopsin for structural dynamics using an X-ray free-electron laser

DOE PAGES

Wu, Wenting; Nogly, Przemyslaw; Rheinberger, Jan; ...

2015-06-27

Rhodopsin is a membrane protein from the G protein-coupled receptor family. Together with its ligand retinal, it forms the visual pigment responsible for night vision. In order to perform ultrafast dynamics studies, a time-resolved serial femtosecond crystallography method is required owing to the nonreversible activation of rhodopsin. In such an approach, microcrystals in suspension are delivered into the X-ray pulses of an X-ray free-electron laser (XFEL) after a precise photoactivation delay. Here in this study, a millilitre batch production of high-density microcrystals was developed by four methodical conversion steps starting from known vapour-diffusion crystallization protocols: (i) screening the low-salt crystallizationmore » conditions preferred for serial crystallography by vapour diffusion, (ii) optimization of batch crystallization, (iii) testing the crystal size and quality using second-harmonic generation (SHG) imaging and X-ray powder diffraction and (iv) production of millilitres of rhodopsin crystal suspension in batches for serial crystallography tests; these crystals diffracted at an XFEL at the Linac Coherent Light Source using a liquid-jet setup.« less

Three-dimensional reconstruction for coherent diffraction patterns obtained by XFEL.

PubMed

Nakano, Miki; Miyashita, Osamu; Jonic, Slavica; Song, Changyong; Nam, Daewoong; Joti, Yasumasa; Tama, Florence

2017-07-01

The three-dimensional (3D) structural analysis of single particles using an X-ray free-electron laser (XFEL) is a new structural biology technique that enables observations of molecules that are difficult to crystallize, such as flexible biomolecular complexes and living tissue in the state close to physiological conditions. In order to restore the 3D structure from the diffraction patterns obtained by the XFEL, computational algorithms are necessary as the orientation of the incident beam with respect to the sample needs to be estimated. A program package for XFEL single-particle analysis based on the Xmipp software package, that is commonly used for image processing in 3D cryo-electron microscopy, has been developed. The reconstruction program has been tested using diffraction patterns of an aerosol nanoparticle obtained by tomographic coherent X-ray diffraction microscopy.

DOE Office of Scientific and Technical Information (OSTI.GOV)

S. K. Kushwaha; Pletikosic, I.; Liang, T.

A long-standing issue in topological insulator research has been to find a bulk single crystal material that provides a high quality platform for characterizing topological surface states without interference from bulk electronic states. This material would ideally be a bulk insulator, have a surface state Dirac point energy well isolated from the bulk valence and conduction bands, display quantum oscillations from the surface state electrons, and be growable as large, high quality bulk single crystals. Here we show that this materials obstacle is overcome by bulk crystals of lightly Sn-doped Bi 1.1Sb 0.9Te 2S grown by the Vertical Bridgeman method.more » We characterize Sn-BSTS via angle-resolved photoemission spectroscopy, scanning tunneling microscopy, transport studies, X-ray diffraction, and Raman scattering. We present this material as a high quality topological insulator that can be reliably grown as bulk single crystals and thus studied by many researchers interested in topological surface states.« less

Hydrogens detected by subatomic resolution protein crystallography in a [NiFe] hydrogenase.

PubMed

Ogata, Hideaki; Nishikawa, Koji; Lubitz, Wolfgang

2015-04-23

The enzyme hydrogenase reversibly converts dihydrogen to protons and electrons at a metal catalyst. The location of the abundant hydrogens is of key importance for understanding structure and function of the protein. However, in protein X-ray crystallography the detection of hydrogen atoms is one of the major problems, since they display only weak contributions to diffraction and the quality of the single crystals is often insufficient to obtain sub-ångström resolution. Here we report the crystal structure of a standard [NiFe] hydrogenase (∼91.3 kDa molecular mass) at 0.89 Å resolution. The strictly anoxically isolated hydrogenase has been obtained in a specific spectroscopic state, the active reduced Ni-R (subform Ni-R1) state. The high resolution, proper refinement strategy and careful modelling allow the positioning of a large part of the hydrogen atoms in the structure. This has led to the direct detection of the products of the heterolytic splitting of dihydrogen into a hydride (H(-)) bridging the Ni and Fe and a proton (H(+)) attached to the sulphur of a cysteine ligand. The Ni-H(-) and Fe-H(-) bond lengths are 1.58 Å and 1.78Å, respectively. Furthermore, we can assign the Fe-CO and Fe-CN(-) ligands at the active site, and can obtain the hydrogen-bond networks and the preferred proton transfer pathway in the hydrogenase. Our results demonstrate the precise comprehensive information available from ultra-high-resolution structures of proteins as an alternative to neutron diffraction and other methods such as NMR structural analysis.

Validation of molecular crystal structures from powder diffraction data with dispersion-corrected density functional theory (DFT-D).

PubMed

van de Streek, Jacco; Neumann, Marcus A

2014-12-01

In 2010 we energy-minimized 225 high-quality single-crystal (SX) structures with dispersion-corrected density functional theory (DFT-D) to establish a quantitative benchmark. For the current paper, 215 organic crystal structures determined from X-ray powder diffraction (XRPD) data and published in an IUCr journal were energy-minimized with DFT-D and compared to the SX benchmark. The on average slightly less accurate atomic coordinates of XRPD structures do lead to systematically higher root mean square Cartesian displacement (RMSCD) values upon energy minimization than for SX structures, but the RMSCD value is still a good indicator for the detection of structures that deserve a closer look. The upper RMSCD limit for a correct structure must be increased from 0.25 Å for SX structures to 0.35 Å for XRPD structures; the grey area must be extended from 0.30 to 0.40 Å. Based on the energy minimizations, three structures are re-refined to give more precise atomic coordinates. For six structures our calculations provide the missing positions for the H atoms, for five structures they provide corrected positions for some H atoms. Seven crystal structures showed a minor error for a non-H atom. For five structures the energy minimizations suggest a higher space-group symmetry. For the 225 SX structures, the only deviations observed upon energy minimization were three minor H-atom related issues. Preferred orientation is the most important cause of problems. A preferred-orientation correction is the only correction where the experimental data are modified to fit the model. We conclude that molecular crystal structures determined from powder diffraction data that are published in IUCr journals are of high quality, with less than 4% containing an error in a non-H atom.

Validation of molecular crystal structures from powder diffraction data with dispersion-corrected density functional theory (DFT-D)

PubMed Central

van de Streek, Jacco; Neumann, Marcus A.

2014-01-01

In 2010 we energy-minimized 225 high-quality single-crystal (SX) structures with dispersion-corrected density functional theory (DFT-D) to establish a quantitative benchmark. For the current paper, 215 organic crystal structures determined from X-ray powder diffraction (XRPD) data and published in an IUCr journal were energy-minimized with DFT-D and compared to the SX benchmark. The on average slightly less accurate atomic coordinates of XRPD structures do lead to systematically higher root mean square Cartesian displacement (RMSCD) values upon energy minimization than for SX structures, but the RMSCD value is still a good indicator for the detection of structures that deserve a closer look. The upper RMSCD limit for a correct structure must be increased from 0.25 Å for SX structures to 0.35 Å for XRPD structures; the grey area must be extended from 0.30 to 0.40 Å. Based on the energy minimizations, three structures are re-refined to give more precise atomic coordinates. For six structures our calculations provide the missing positions for the H atoms, for five structures they provide corrected positions for some H atoms. Seven crystal structures showed a minor error for a non-H atom. For five structures the energy minimizations suggest a higher space-group symmetry. For the 225 SX structures, the only deviations observed upon energy minimization were three minor H-atom related issues. Preferred orientation is the most important cause of problems. A preferred-orientation correction is the only correction where the experimental data are modified to fit the model. We conclude that molecular crystal structures determined from powder diffraction data that are published in IUCr journals are of high quality, with less than 4% containing an error in a non-H atom. PMID:25449625

History and Solution of the Phase Problem in theTheory of Structure Determination of Crystals from X-ray Diffraction Experiments

ScienceCinema

Wolf, Emil [University of Rochester, Rochester, New York, United States

2017-12-09

Since the pioneering work of Max von Laue on interference and diffraction of x-rays, carried out almost 100 years ago, numerous attempts have been made to determine structures of crystalline media from x-ray diffraction experiments. The usefulness of all of them has been limited by the inability of measuring phases of the diffracted beams. In this talk, the most important research carried out in this field will be reviewed and a recently obtained solution of the phase problem will be presented.

HPHT growth and x-ray characterization of high-quality type IIa diamond.

PubMed

Burns, R C; Chumakov, A I; Connell, S H; Dube, D; Godfried, H P; Hansen, J O; Härtwig, J; Hoszowska, J; Masiello, F; Mkhonza, L; Rebak, M; Rommevaux, A; Setshedi, R; Van Vaerenbergh, P

2009-09-09

The trend in synchrotron radiation (x-rays) is towards higher brilliance. This may lead to a very high power density, of the order of hundreds of watts per square millimetre at the x-ray optical elements. These elements are, typically, windows, polarizers, filters and monochromators. The preferred material for Bragg diffracting optical elements at present is silicon, which can be grown to a very high crystal perfection and workable size as well as rather easily processed to the required surface quality. This allows x-ray optical elements to be built with a sufficient degree of lattice perfection and crystal processing that they may preserve transversal coherence in the x-ray beam. This is important for the new techniques which include phase-sensitive imaging experiments like holo-tomography, x-ray photon correlation spectroscopy, coherent diffraction imaging and nanofocusing. Diamond has a lower absorption coefficient than silicon, a better thermal conductivity and lower thermal expansion coefficient which would make it the preferred material if the crystal perfection (bulk and surface) could be improved. Synthetic HPHT-grown (high pressure, high temperature) type Ib material can readily be produced in the necessary sizes of 4-8 mm square and with a nitrogen content of typically a few hundred parts per million. This material has applications in the less demanding roles such as phase plates: however, in a coherence-preserving beamline, where all elements must be of the same high quality, its quality is far from sufficient. Advances in HPHT synthesis methods have allowed the growth of type IIa diamond crystals of the same size as type Ib, but with substantially lower nitrogen content. Characterization of this high purity type IIa material has been carried out with the result that the crystalline (bulk) perfection of some of the HPHT-grown materials is approaching the quality required for the more demanding applications such as imaging applications and imaging applications with coherence preservation. The targets for further development of the type IIa diamond are size, crystal perfection, as measured by the techniques of white beam and monochromatic x-ray diffraction imaging (historically called x-ray topography), and also surface quality. Diamond plates extracted from the cubic growth sector furthest from the seed of the new low strain material produces no measurable broadening of the x-ray rocking curve width. One measures essentially the crystal reflectivity as defined by the intrinsic reflectivity curve (Darwin curve) width of a perfect crystal. In these cases the more sensitive technique of plane wave topography has been used to establish a local upper limit of the strain at the level of an 'effective misorientation' of 10(-7) rad.

Programmable diffractive lens for ophthalmic application

NASA Astrophysics Data System (ADS)

Millán, María S.; Pérez-Cabré, Elisabet; Romero, Lenny A.; Ramírez, Natalia

2014-06-01

Pixelated liquid crystal displays have been widely used as spatial light modulators to implement programmable diffractive optical elements, particularly diffractive lenses. Many different applications of such components have been developed in information optics and optical processors that take advantage of their properties of great flexibility, easy and fast refreshment, and multiplexing capability in comparison with equivalent conventional refractive lenses. We explore the application of programmable diffractive lenses displayed on the pixelated screen of a liquid crystal on silicon spatial light modulator to ophthalmic optics. In particular, we consider the use of programmable diffractive lenses for the visual compensation of refractive errors (myopia, hypermetropia, astigmatism) and presbyopia. The principles of compensation are described and sketched using geometrical optics and paraxial ray tracing. For the proof of concept, a series of experiments with artificial eye in optical bench are conducted. We analyze the compensation precision in terms of optical power and compare the results with those obtained by means of conventional ophthalmic lenses. Practical considerations oriented to feasible applications are provided.

Ophthalmic compensation of visual ametropia based on a programmable diffractive lens

NASA Astrophysics Data System (ADS)

Millán, Maria S.; Pérez-Cabré, Elisabet; Romero, Lenny A.; Ramírez, Natalia

2013-11-01

Pixelated liquid crystal displays have been widely used as spatial light modulators to implement programmable diffractive optical elements (DOEs), particularly diffractive lenses. Many different applications of such components have been developed in information optics and optical processors that take advantage of their properties of great flexibility, easy and fast refreshment, and multiplexing capability in comparison with equivalent conventional refractive lenses. In this paper, we explore the application of programmable diffractive lenses displayed on the pixelated screen of a liquid crystal on silicon spatial light modulator (LCoS-SLM) to ophthalmic optics. In particular, we consider the use of programmable diffractive lenses for the visual compensation of some refractive errors (myopia, hyperopia). The theoretical principles of compensation are described and sketched using geometrical optics and paraxial ray tracing. A series of experiments with artificial eye in optical bench are conducted to analyze the compensation accuracy in terms of optical power and to compare the results with those obtained by means of conventional ophthalmic lenses. Practical considerations oriented to feasible applications are provided.

Super-resolution biomolecular crystallography with low-resolution data.

PubMed

Schröder, Gunnar F; Levitt, Michael; Brunger, Axel T

2010-04-22

X-ray diffraction plays a pivotal role in the understanding of biological systems by revealing atomic structures of proteins, nucleic acids and their complexes, with much recent interest in very large assemblies like the ribosome. As crystals of such large assemblies often diffract weakly (resolution worse than 4 A), we need methods that work at such low resolution. In macromolecular assemblies, some of the components may be known at high resolution, whereas others are unknown: current refinement methods fail as they require a high-resolution starting structure for the entire complex. Determining the structure of such complexes, which are often of key biological importance, should be possible in principle as the number of independent diffraction intensities at a resolution better than 5 A generally exceeds the number of degrees of freedom. Here we introduce a method that adds specific information from known homologous structures but allows global and local deformations of these homology models. Our approach uses the observation that local protein structure tends to be conserved as sequence and function evolve. Cross-validation with R(free) (the free R-factor) determines the optimum deformation and influence of the homology model. For test cases at 3.5-5 A resolution with known structures at high resolution, our method gives significant improvements over conventional refinement in the model as monitored by coordinate accuracy, the definition of secondary structure and the quality of electron density maps. For re-refinements of a representative set of 19 low-resolution crystal structures from the Protein Data Bank, we find similar improvements. Thus, a structure derived from low-resolution diffraction data can have quality similar to a high-resolution structure. Our method is applicable to the study of weakly diffracting crystals using X-ray micro-diffraction as well as data from new X-ray light sources. Use of homology information is not restricted to X-ray crystallography and cryo-electron microscopy: as optical imaging advances to subnanometre resolution, it can use similar tools.

Recent Advances in the Understanding of the Influence of Electric and Magnetic Fields on Protein Crystal Growth

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pareja-Rivera, Carina; Cuéllar-Cruz, Mayra; Esturau-Escofet, Nuria

Here, in this contribution we use nonconventional methods that help to increase the success rate of a protein crystal growth, and consequently of structural projects using X-ray diffraction techniques. In order to achieve this purpose, this contribution presents new approaches involving more sophisticated techniques of protein crystallization, not just for growing protein crystals of different sizes by using electric fields, but also for controlling crystal size and orientation. Also, this latter was possible through the use of magnetic fields that allow to obtain protein crystals suitable for both high-resolution X-ray and neutron diffraction crystallography where big crystals are required. Thismore » contribution discusses some pros, cons and realities of the role of electromagnetic fields in protein crystallization research, and their effect on protein crystal contacts. Additionally, we discuss the importance of room and low temperatures during data collection. Finally, we also discuss the effect of applying a rather strong magnetic field of 16.5 T, for shorts and long periods of time, on protein crystal growth, and on the 3D structure of two model proteins.« less

Recent Advances in the Understanding of the Influence of Electric and Magnetic Fields on Protein Crystal Growth

DOE PAGES

Pareja-Rivera, Carina; Cuéllar-Cruz, Mayra; Esturau-Escofet, Nuria; ...

2016-12-05

Here, in this contribution we use nonconventional methods that help to increase the success rate of a protein crystal growth, and consequently of structural projects using X-ray diffraction techniques. In order to achieve this purpose, this contribution presents new approaches involving more sophisticated techniques of protein crystallization, not just for growing protein crystals of different sizes by using electric fields, but also for controlling crystal size and orientation. Also, this latter was possible through the use of magnetic fields that allow to obtain protein crystals suitable for both high-resolution X-ray and neutron diffraction crystallography where big crystals are required. Thismore » contribution discusses some pros, cons and realities of the role of electromagnetic fields in protein crystallization research, and their effect on protein crystal contacts. Additionally, we discuss the importance of room and low temperatures during data collection. Finally, we also discuss the effect of applying a rather strong magnetic field of 16.5 T, for shorts and long periods of time, on protein crystal growth, and on the 3D structure of two model proteins.« less

Rietveld analysis using powder diffraction data with anomalous scattering effect obtained by focused beam flat sample method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, Masahiko, E-mail: masahiko@spring8.or.jp; Katsuya, Yoshio, E-mail: katsuya@spring8.or.jp; Sakata, Osami, E-mail: SAKATA.Osami@nims.go.jp

2016-07-27

Focused-beam flat-sample method (FFM) is a new trial for synchrotron powder diffraction method, which is a combination of beam focusing optics, flat shape powder sample and area detectors. The method has advantages for X-ray diffraction experiments applying anomalous scattering effect (anomalous diffraction), because of 1. Absorption correction without approximation, 2. High intensity X-rays of focused incident beams and high signal noise ratio of diffracted X-rays 3. Rapid data collection with area detectors. We applied the FFM to anomalous diffraction experiments and collected synchrotron X-ray powder diffraction data of CoFe{sub 2}O{sub 4} (inverse spinel structure) using X-rays near Fe K absorptionmore » edge, which can distinguish Co and Fe by anomalous scattering effect. We conducted Rietveld analyses with the obtained powder diffraction data and successfully determined the distribution of Co and Fe ions in CoFe{sub 2}O{sub 4} crystal structure.« less

Sn-doped Bi 1.1Sb 0.9Te 2S bulk crystal topological insulator with excellent properties

DOE PAGES

S. K. Kushwaha; Pletikosic, I.; Liang, T.; ...

2016-04-27

A long-standing issue in topological insulator research has been to find a bulk single crystal material that provides a high quality platform for characterizing topological surface states without interference from bulk electronic states. This material would ideally be a bulk insulator, have a surface state Dirac point energy well isolated from the bulk valence and conduction bands, display quantum oscillations from the surface state electrons, and be growable as large, high quality bulk single crystals. Here we show that this materials obstacle is overcome by bulk crystals of lightly Sn-doped Bi 1.1Sb 0.9Te 2S grown by the Vertical Bridgeman method.more » We characterize Sn-BSTS via angle-resolved photoemission spectroscopy, scanning tunneling microscopy, transport studies, X-ray diffraction, and Raman scattering. We present this material as a high quality topological insulator that can be reliably grown as bulk single crystals and thus studied by many researchers interested in topological surface states.« less

Crystallization and preliminary X-ray diffraction analysis of central structure domains from mumps virus F protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Yueyong; Xu, Yanhui; Zhu, Jieqing

2005-09-01

Single crystals of the central structure domains from mumps virus F protein have been obtained by the hanging-drop vapour-diffusion method. A diffraction data set has been collected to 2.2 Å resolution. Fusion of members of the Paramyxoviridae family involves two glycoproteins: the attachment protein and the fusion protein. Changes in the fusion-protein conformation were caused by binding of the attachment protein to the cellular receptor. In the membrane-fusion process, two highly conserved heptad-repeat (HR) regions, HR1 and HR2, are believed to form a stable six-helix coiled-coil bundle. However, no crystal structure has yet been determined for this state in themore » mumps virus (MuV, a member of the Paramyxoviridae family). In this study, a single-chain protein consisting of two HR regions connected by a flexible amino-acid linker (named 2-Helix) was expressed, purified and crystallized by the hanging-drop vapour-diffusion method. A complete X-ray data set was obtained in-house to 2.2 Å resolution from a single crystal. The crystal belongs to space group C2, with unit-cell parameters a = 161.2, b = 60.8, c = 40.1 Å, β = 98.4°. The crystal structure will help in understanding the molecular mechanism of Paramyxoviridae family membrane fusion.« less

Synthesis, optical, experimental and theoretical investigation of third order nonlinear optical properties of 8-hydroxyquinolinium 2-carboxy-6-nitrophthalate monohydrate single crystal

NASA Astrophysics Data System (ADS)

Bharathi, M. Divya; Bhuvaneswari, R.; Srividya, J.; Vinitha, G.; Prithiviraajan, R. N.; Anbalagan, G.

2018-02-01

Single crystals of 8-hydroxyquinolinium 2-carboxy-6-nitrophthalate monohydrate (8HQNP) were obtained from slow evaporation solution growth method using methanol-water (1:1) as a solvent. Powder X-ray diffraction was utilized to compute the unit cell parameters and dislocation density of 8HQNP crystal. The crystalline perfection of the as-grown crystal was investigated by high-resolution X-ray diffraction at room temperature. The molecular structure was analyzed by identifying the functional groups from FT-IR and FT-Raman spectra. The cut-off wavelength and the corresponding optical band gap obtained from an optical spectrum were 376 nm and 3.29 eV respectively. The dispersion nature of refractive index was investigated by the single-oscillator Wemple and Di-Domenico model. Red emission was observed in the photoluminescence spectrum when excited with 376 nm. The low birefringence and high laser damage threshold (8.538 GW/cm2) values dictate the suitability of the crystal for optical devices. Z-scan studies revealed the third order nonlinear absorption coefficient (β) and refractive index (n2) of the 8HQNP crystal. The theoretical value of third order nonlinear susceptibility obtained from density function theory is good accordance with the experimental value. The frontier molecular orbital energy gap decreases with increasing external electric field in different directions which attributed to the enhancement of the second hyperpolarizability. The grown title crystal is thermally stable up to 102 °C which was identified using thermal analysis. Mechanical strength of 8HQNP was estimated by using Vicker's microhardness studies.

Increasing reconstruction quality of diffractive optical elements displayed with LC SLM

NASA Astrophysics Data System (ADS)

Cheremkhin, Pavel A.; Evtikhiev, Nikolay N.; Krasnov, Vitaly V.; Rodin, Vladislav G.; Starikov, Sergey N.

2015-03-01

Phase liquid crystal (LC) spatial light modulators (SLM) are actively used in various applications. However, majority of scientific applications require stable phase modulation which might be hard to achieve with commercially available SLM due to its consumer origin. The use of digital voltage addressing scheme leads to phase temporal fluctuations, which results in lower diffraction efficiency and reconstruction quality of displayed diffractive optical elements (DOE). Due to high periodicity of fluctuations it should be possible to use knowledge of these fluctuations during DOE synthesis to minimize negative effect. We synthesized DOE using accurately measured phase fluctuations of phase LC SLM "HoloEye PLUTO VIS" to minimize its negative impact on displayed DOE reconstruction. Synthesis was conducted with versatile direct search with random trajectory (DSRT) method in the following way. Before DOE synthesis begun, two-dimensional dependency of SLM phase shift on addressed signal level and time from frame start was obtained. Then synthesis begins. First, initial phase distribution is created. Second, random trajectory of consecutive processing of all DOE elements is generated. Then iterative process begins. Each DOE element sequentially has its value changed to one that provides better value of objective criterion, e.g. lower deviation of reconstructed image from original one. If current element value provides best objective criterion value then it left unchanged. After all elements are processed, iteration repeats until stagnation is reached. It is demonstrated that application of SLM phase fluctuations knowledge in DOE synthesis with DSRT method leads to noticeable increase of DOE reconstruction quality.

Coded diffraction system in X-ray crystallography using a boolean phase coded aperture approximation

NASA Astrophysics Data System (ADS)

Pinilla, Samuel; Poveda, Juan; Arguello, Henry

2018-03-01

Phase retrieval is a problem present in many applications such as optics, astronomical imaging, computational biology and X-ray crystallography. Recent work has shown that the phase can be better recovered when the acquisition architecture includes a coded aperture, which modulates the signal before diffraction, such that the underlying signal is recovered from coded diffraction patterns. Moreover, this type of modulation effect, before the diffraction operation, can be obtained using a phase coded aperture, just after the sample under study. However, a practical implementation of a phase coded aperture in an X-ray application is not feasible, because it is computationally modeled as a matrix with complex entries which requires changing the phase of the diffracted beams. In fact, changing the phase implies finding a material that allows to deviate the direction of an X-ray beam, which can considerably increase the implementation costs. Hence, this paper describes a low cost coded X-ray diffraction system based on block-unblock coded apertures that enables phase reconstruction. The proposed system approximates the phase coded aperture with a block-unblock coded aperture by using the detour-phase method. Moreover, the SAXS/WAXS X-ray crystallography software was used to simulate the diffraction patterns of a real crystal structure called Rhombic Dodecahedron. Additionally, several simulations were carried out to analyze the performance of block-unblock approximations in recovering the phase, using the simulated diffraction patterns. Furthermore, the quality of the reconstructions was measured in terms of the Peak Signal to Noise Ratio (PSNR). Results show that the performance of the block-unblock phase coded apertures approximation decreases at most 12.5% compared with the phase coded apertures. Moreover, the quality of the reconstructions using the boolean approximations is up to 2.5 dB of PSNR less with respect to the phase coded aperture reconstructions.

Quantitative x-ray diffraction analysis of bimodal damage distributions in Tm implanted Al0.15Ga0.85N

NASA Astrophysics Data System (ADS)

Magalhães, S.; Fialho, M.; Peres, M.; Lorenz, K.; Alves, E.

2016-04-01

In this work radial symmetric x-ray diffraction scans of Al0.15Ga0.85N thin films implanted with Tm ions were measured to determine the lattice deformation and crystal quality as functions of depth. The alloys were implanted with 300 keV Tm with 10° off-set to the sample normal to avoid channelling, with fluences varying between 1013 Tm cm-2 and 5  ×  1015 Tm cm-2. Simulations of the radial 2θ-ω scans were performed under the frame of the dynamical theory of x-ray diffraction assuming Gaussian distributions of the lattice strain induced by implantation defects. The structure factor of the individual layers is multiplied by a static Debye-Waller factor in order to take into account the effect of lattice disorder due to implantation. For higher fluences two asymmetric Gaussians are required to describe well the experimental diffractograms, although a single asymmetric Gaussian profile for the deformation is found in the sample implanted with 1013 Tm cm-2. After thermal treatment at 1200 °C, the crystal quality partially recovers as seen in a reduction of the amplitude of the deformation maximum as well as the total thickness of the deformed layer. Furthermore, no evidence of changes with respect to the virgin crystal mosaicity is found after implantation and annealing.

Calculations of single crystal elastic constants for yttria partially stabilised zirconia from powder diffraction data

NASA Astrophysics Data System (ADS)

Lunt, A. J. G.; Xie, M. Y.; Baimpas, N.; Zhang, S. Y.; Kabra, S.; Kelleher, J.; Neo, T. K.; Korsunsky, A. M.

2014-08-01

Yttria Stabilised Zirconia (YSZ) is a tough, phase-transforming ceramic that finds use in a wide range of commercial applications from dental prostheses to thermal barrier coatings. Micromechanical modelling of phase transformation can deliver reliable predictions in terms of the influence of temperature and stress. However, models must rely on the accurate knowledge of single crystal elastic stiffness constants. Some techniques for elastic stiffness determination are well-established. The most popular of these involve exploiting frequency shifts and phase velocities of acoustic waves. However, the application of these techniques to YSZ can be problematic due to the micro-twinning observed in larger crystals. Here, we propose an alternative approach based on selective elastic strain sampling (e.g., by diffraction) of grain ensembles sharing certain orientation, and the prediction of the same quantities by polycrystalline modelling, for example, the Reuss or Voigt average. The inverse problem arises consisting of adjusting the single crystal stiffness matrix to match the polycrystal predictions to observations. In the present model-matching study, we sought to determine the single crystal stiffness matrix of tetragonal YSZ using the results of time-of-flight neutron diffraction obtained from an in situ compression experiment and Finite Element modelling of the deformation of polycrystalline tetragonal YSZ. The best match between the model predictions and observations was obtained for the optimized stiffness values of C11 = 451, C33 = 302, C44 = 39, C66 = 82, C12 = 240, and C13 = 50 (units: GPa). Considering the significant amount of scatter in the published literature data, our result appears reasonably consistent.

Structure and thermal expansion of Ca9Gd(VO4)7: A combined powder-diffraction and dilatometric study of a Czochralski-grown crystal

NASA Astrophysics Data System (ADS)

Paszkowicz, Wojciech; Shekhovtsov, Alexei; Kosmyna, Miron; Loiko, Pavel; Vilejshikova, Elena; Minikayev, Roman; Romanowski, Przemysław; Wierzchowski, Wojciech; Wieteska, Krzysztof; Paulmann, Carsten; Bryleva, Ekaterina; Belikov, Konstantin; Fitch, Andrew

2017-11-01

Materials of the Ca9RE(VO4)7 (CRVO) formula (RE = rare earth) and whitlockite-related structures are considered for applications in optoelectronics, e.g., in white-light emitting diodes and lasers. In the CRVO structure, the RE atoms are known to share the site occupation with Ca atoms at two or three among four Ca sites, with partial occupancy values depending on the choice of the RE atom. In this work, the structure and quality of a Czochralski-grown crystal of this family, Ca9Gd(VO4)7 (CGVO), are studied using X-ray diffraction methods. The room-temperature structure is refined using the powder diffraction data collected at a high-resolution synchrotron beamline ID22 (ESRF, Grenoble); for comparison purposes, a laboratory diffraction pattern was collected and analyzed, as well. The site occupancies are discussed on the basis of comparison with literature data of isostructural synthetic crystals of the CRVO series. The results confirm the previously reported site-occupation scheme and indicate a tendency of the CGVO compound to adopt a Gd-deficient composition. Moreover, the thermal expansion coefficient is determined for CGVO as a function of temperature in the 302-1023 K range using laboratory diffraction data. Additionally, for CGVO and six other single crystals of the same family, thermal expansion is studied in the 298-473 K range, using the dilatometric data. The magnitude and anisotropy of thermal expansion, being of importance for laser applications, are discussed for these materials.

X-ray transparent Microfluidics for Protein Crystallization and Biomineralization

NASA Astrophysics Data System (ADS)

Opathalage, Achini

Protein crystallization demands the fundamental understanding of nucleation and applying techniques to find the optimal conditions to achieve the kinetic pathway for a large and defect free crystal. Classical nucleation theory predicts that the nucleation occurs at high supersaturation conditions. In this dissertation we sought out to develop techniques to attain optimal supersaturation profile to a large defect free crystal and subject it to in-situ X-ray diffraction using microfluidics. We have developed an emulsion-based serial crystallographic technology in nanolitre-sized droplets of protein solution encapsulated in to nucleate one crystal per drop. Diffraction data are measured, one crystal at a time, from a series of room temperature crystals stored on an X-ray semi-transparent microfluidic chip, and a 93% complete data set is obtained by merging single diffraction frames taken from different un-oriented crystals. As proof of concept, the structure of Glucose Isomerase was solved to 2.1 A. We have developed a suite of X-ray semi-transparent micrfluidic devices which enables; controlled evaporation as a method of increasing supersaturation and manipulating the phase space of proteins and small molecules. We exploited the inherently high water permeability of the thin X-ray semi-transparent devices as a mean of increasing the supersaturation by controlling the evaporation. We fabricated the X-ray semi-transparent version of the PhaseChip with a thin PDMS membrane by which the storage and the reservoir layers are separated, and studies the phase transition of amorphous CaCO3.

Effect of the purity of starting materials on the growth and properties of potassium dihydrogen phosphate single crystals – A comparative study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rajesh, P., E-mail: rajeshp@ssn.edu.in; Charoen In, Urit; Manyum, Prapun

2014-11-15

Highlights: • Bulk size KDP crystal has been grown with higher growth rate. • Systematic study on the effect of starting materials has been done. • Crystalline perfection is maintained in the entire crystal. - Abstract: A systematic study on the effect of purity of starting materials on the growth and properties of potassium dihydrogen phosphate single crystals is crucial for the future study of the material for nonlinear optical applications. Potassium dihydrogen phosphate crystals were grown using high pure (99.999%) and ordinary (99.9%) starting raw materials using slow cooling method in identical conditions. Their optical transparency and crystalline perfectionmore » are studied by UV and high resolution X-ray diffraction analyses respectively. The results are checked with the help of etching analyses. The full width at half maximum is 8″ which is close to that expected from the plane wave theory of dynamical X-ray diffraction for an ideally perfect crystal. Results of those studies are correlated with each other. The quantitative results show that the raw material plays an important role in the growth of good quality crystals.« less

High power, diffraction limited picosecond oscillator based on Nd:GdVO₄ bulk crystal with σ polarized in-band pumping.

PubMed

Lin, Hua; Guo, Jie; Gao, Peng; Yu, Hai; Liang, Xiaoyan

2016-06-27

We report on a high power passively mode-locked picosecond oscillator based on Nd:GdVO₄ crystal with σ polarized in-band pumping. Thermal gradient and thermal aberration was greatly decreased with proposed configuration. Maximum output power of 37 W at 81 MHz repetition rate with 19.3 ps pulse duration was achieved directly from Nd:GdVO₄ oscillator, corresponding to 51% optical efficiency. The oscillator maintained diffraction limited beam quality of M² < 1.05 at different output coupling with pulse duration between 11.2 ps to 19.3 ps.

Microgravity

NASA Image and Video Library

1992-06-25

Zeolites are crystalline aluminosilicates that have complex framework structures. However, there are several features of zeolite crystals that make unequivocal structure determinations difficult. The acquisition of reliable structural information on zeolites is greatly facilitated by the availability of high-quality specimens. For structure determinations by conventional diffraction techniques, large single-crystal specimens are essential. Alternatively, structural determinations by powder profile refinement methods relax the constraints on crystal size, but still require materials with a high degree of crystalline perfection. Studies conducted at CAMMP (Center for Advanced Microgravity Materials Processing) have demonstrated that microgravity processing can produce larger crystal sizes and fewer structural defects relative to terrestrial crystal growth. Principal Investigator: Dr. Albert Sacco

Zeolites

NASA Technical Reports Server (NTRS)

1992-01-01

Zeolites are crystalline aluminosilicates that have complex framework structures. However, there are several features of zeolite crystals that make unequivocal structure determinations difficult. The acquisition of reliable structural information on zeolites is greatly facilitated by the availability of high-quality specimens. For structure determinations by conventional diffraction techniques, large single-crystal specimens are essential. Alternatively, structural determinations by powder profile refinement methods relax the constraints on crystal size, but still require materials with a high degree of crystalline perfection. Studies conducted at CAMMP (Center for Advanced Microgravity Materials Processing) have demonstrated that microgravity processing can produce larger crystal sizes and fewer structural defects relative to terrestrial crystal growth. Principal Investigator: Dr. Albert Sacco

Preparation, crystallization and preliminary X-ray analysis of the methionine synthase (MetE) from Streptococcus mutans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen

2006-10-01

Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution.more » The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°.« less

Preliminary X-ray crystallographic analysis of SMU.573, a putative sugar kinase from Streptococcus mutans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Yan-Feng; Li, Lan-Fen; Yang, Cheng

2008-01-01

SMU.573 from S. mutans was expressed in E. coli and crystallized. The crystals belong to space group I4 and 2.5 Å resolution diffraction data were collected at an in-house chromium radiation source. SMU.573 from Streptococcus mutans is a structurally and functionally uncharacterized protein that was selected for structural biology studies. Native and SeMet-labelled proteins were expressed with an N-His tag in Escherichia coli BL21 (DE3) and purified by Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals of the SeMet-labelled protein were obtained by the hanging-drop vapour-diffusion method and a 2.5 Å resolution diffraction data set was collected using an in-house chromium radiationmore » source. The crystals belong to space group I4, with unit-cell parameters a = b = 96.53, c = 56.26 Å, α = β = γ = 90°.« less

Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis

PubMed Central

Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

2009-01-01

RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase σ factor SigB. In order to elucidate the structural–functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 Å resolution with an R merge of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 Å, α = 98.8, β = 90.0, γ = 108.4°. PMID:19923733

Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis.

PubMed

Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

2009-11-01

RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase sigma factor SigB. In order to elucidate the structural-functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 angstrom resolution with an R(merge) of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 angstrom , alpha = 98.8, beta = 90.0, gamma = 108.4 degrees.

Crystal structure, spectrum character and explosive property of a new cocrystal CL-20/DNT

NASA Astrophysics Data System (ADS)

Liu, Ke; Zhang, Gao; Luan, Jieyu; Chen, Zhiqun; Su, Pengfei; Shu, Yuanjie

2016-04-01

A new cocrystal explosive of 2,4,6,8,10,12-hexanitrohexaazaiso-wurtzitane(CL-20) and 2,5-dinitrotoluene(DNT) in a molar ratio of 1:2 has been prepared by slow solvent evaporation method. Crystal structure of the cocrystal characterized by single crystal X-ray diffraction (SXRD) reveals that the cocrystal is formed by intermolecular hydrogen bond interactions and belongs to the triclinic system with P-1 group. Moreover, the obivious differences of powder X-ray diffraction (PXRD) patterns, infrared spectroscopy and Raman spectroscopy confirm that the intermolecular interactions have great influence for the crystal structure and formation of cocrystal. The cocrystal exhibits a lower impact height of 44 cm, suggesting a substantial reduction of sensitivity in comparison with CL-20. And thermal test results showed cocrystal obtains a lower melting point than DNT, which means huge advantages in blasting engineering.

Isolation, crystallization in the macrogravitation field, preliminary X-ray investigation of uridine phosphorylase from Escherichia coli K-12.

PubMed

Mikhailov, A M; Smirnova, E A; Tsuprun, V L; Tagunova, I V; Vainshtein, B K; Linkova, E V; Komissarov, A A; Siprashvili, Z Z; Mironov, A S

1992-03-01

Uridine phosphorylase (UPH) from Escherichia coli K-12 has been purified to near homogeneity from a strain harbouring the udp gene, encoding UPH, on a multicopy plasmid. UPH was purified to electrophoretic homogeneity with the specific activity 230 units/mg with a recovery of 80%, yielding 120 mg of enzyme from 3g cells. Crystals of enzyme suitable for X-ray diffraction analysis were obtained in a preparative ultracentrifuge. The packing of the molecules in the crystals may be described by the space group P2(1)2(1)2(1) with the unit cell constants a = 90.4; b = 128.8; c = 136.8 A. There is one molecule per asymmetric unit, Vm = 2.4. These crystals diffract to at least 2.5-2.7 A resolution. The hexameric structure of UPH was directly demonstrated by electron microscopy study and image processing.

Crystallization and preliminary X-ray diffraction studies of the ubiquitin-like (UbL) domain of the human homologue A of Rad23 (hHR23A) protein.

PubMed

Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla

2009-09-01

Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.

High quality self-separated GaN crystal grown on a novel nanoporous template by HVPE.

PubMed

Huo, Qin; Shao, Yongliang; Wu, Yongzhong; Zhang, Baoguo; Hu, Haixiao; Hao, Xiaopeng

2018-02-16

In this study, a novel nanoporous template was obtained by a two-step etching process from MOCVD-GaN/Al 2 O 3 (MGA) with electrochemical etching sequentially followed by chemical wet etching. The twice-etched MOCVD-GaN/Al 2 O 3 (TEMGA) templates were utilized to grow GaN crystals by hydride vapor phase epitaxy (HVPE) method. The GaN crystals were separated spontaneously from the TEMGA template with the assistance of voids formed by the etched nanopores. Several techniques were utilized to characterize the quality of the free-standing GaN crystals obtained from the TEMGA template. Results showed that the quality of the as-obtained GaN crystals was improved obviously compared with those grown on the MGA. This convenient technique can be applied to grow high-quality free-standing GaN crystals.

Rastering strategy for screening and centring of microcrystal samples of human membrane proteins with a sub-10 µm size X-ray synchrotron beam

PubMed Central

Cherezov, Vadim; Hanson, Michael A.; Griffith, Mark T.; Hilgart, Mark C.; Sanishvili, Ruslan; Nagarajan, Venugopalan; Stepanov, Sergey; Fischetti, Robert F.; Kuhn, Peter; Stevens, Raymond C.

2009-01-01

Crystallization of human membrane proteins in lipidic cubic phase often results in very small but highly ordered crystals. Advent of the sub-10 µm minibeam at the APS GM/CA CAT has enabled the collection of high quality diffraction data from such microcrystals. Herein we describe the challenges and solutions related to growing, manipulating and collecting data from optically invisible microcrystals embedded in an opaque frozen in meso material. Of critical importance is the use of the intense and small synchrotron beam to raster through and locate the crystal sample in an efficient and reliable manner. The resulting diffraction patterns have a significant reduction in background, with strong intensity and improvement in diffraction resolution compared with larger beam sizes. Three high-resolution structures of human G protein-coupled receptors serve as evidence of the utility of these techniques that will likely be useful for future structural determination efforts. We anticipate that further innovations of the technologies applied to microcrystallography will enable the solving of structures of ever more challenging targets. PMID:19535414

Investigation on the growth and characterization of 4-aminobenzophenone single crystal by the vertical dynamic gradient freeze technique

NASA Astrophysics Data System (ADS)

Prabhakaran, SP.; Ramesh Babu, R.; Sukumar, M.; Bhagavannarayana, G.; Ramamurthi, K.

2014-03-01

Growth of bulk single crystal of 4-Aminobenzophenone (4-ABP) from the vertical dynamic gradient freeze (VDGF) setup designed with eight zone furnace was investigated. The experimental parameters for the growth of 4-ABP single crystal with respect to the design of VDGF setup are discussed. The eight zones were used to generate multiple temperature gradients over the furnace, and video imaging system helped to capture the real time growth and solid-liquid interface. 4-ABP single crystal with the size of 18 mm diameter and 40 mm length was grown from this investigation. Structural and optical quality of grown crystal was examined by high resolution X-ray diffraction and UV-visible spectral analysis, respectively and the blue emission was also confirmed from the photoluminescence spectrum. Microhardness number of the crystal was estimated at different loads using Vicker's microhardness tester. The size and quality of single crystal grown from the present investigation are compared with the vertical Bridgman grown 4-ABP.

Energy resolution of the CdTe-XPAD detector: calibration and potential for Laue diffraction measurements on protein crystals.

PubMed

Medjoubi, Kadda; Thompson, Andrew; Bérar, Jean-François; Clemens, Jean-Claude; Delpierre, Pierre; Da Silva, Paulo; Dinkespiler, Bernard; Fourme, Roger; Gourhant, Patrick; Guimaraes, Beatriz; Hustache, Stéphanie; Idir, Mourad; Itié, Jean-Paul; Legrand, Pierre; Menneglier, Claude; Mercere, Pascal; Picca, Frederic; Samama, Jean-Pierre

2012-05-01

The XPAD3S-CdTe, a CdTe photon-counting pixel array detector, has been used to measure the energy and the intensity of the white-beam diffraction from a lysozyme crystal. A method was developed to calibrate the detector in terms of energy, allowing incident photon energy measurement to high resolution (approximately 140 eV), opening up new possibilities in energy-resolved X-ray diffraction. In order to demonstrate this, Laue diffraction experiments were performed on the bending-magnet beamline METROLOGIE at Synchrotron SOLEIL. The X-ray energy spectra of diffracted spots were deduced from the indexed Laue patterns collected with an imaging-plate detector and then measured with both the XPAD3S-CdTe and the XPAD3S-Si, a silicon photon-counting pixel array detector. The predicted and measured energy of selected diffraction spots are in good agreement, demonstrating the reliability of the calibration method. These results open up the way to direct unit-cell parameter determination and the measurement of high-quality Laue data even at low resolution. Based on the success of these measurements, potential applications in X-ray diffraction opened up by this type of technology are discussed.

Advanced Structural Analyses by Third Generation Synchrotron Radiation Powder Diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakata, M.; Aoyagi, S.; Ogura, T.

2007-01-19

Since the advent of the 3rd generation Synchrotron Radiation (SR) sources, such as SPring-8, the capabilities of SR powder diffraction increased greatly not only in an accurate structure refinement but also ab initio structure determination. In this study, advanced structural analyses by 3rd generation SR powder diffraction based on the Large Debye-Scherrer camera installed at BL02B2, SPring-8 is described. Because of high angular resolution and high counting statistics powder data collected at BL02B2, SPring-8, ab initio structure determination can cope with a molecular crystals with 65 atoms including H atoms. For the structure refinements, it is found that a kindmore » of Maximum Entropy Method in which several atoms are omitted in phase calculation become very important to refine structural details of fairy large molecule in a crystal. It should be emphasized that until the unknown structure is refined very precisely, the obtained structure by Genetic Algorithm (GA) or some other ab initio structure determination method using real space structural knowledge, it is not possible to tell whether the structure obtained by the method is correct or not. In order to determine and/or refine crystal structure of rather complicated molecules, we cannot overemphasize the importance of the 3rd generation SR sources.« less

Structure of CPV17 polyhedrin determined by the improved analysis of serial femtosecond crystallographic data

DOE PAGES

Ginn, Helen M.; Messerschmidt, Marc; Ji, Xiaoyun; ...

2015-03-09

The X-ray free-electron laser (XFEL) allows the analysis of small weakly diffracting protein crystals, but has required very many crystals to obtain good data. Here we use an XFEL to determine the room temperature atomic structure for the smallest cytoplasmic polyhedrosis virus polyhedra yet characterized, which we failed to solve at a synchrotron. These protein microcrystals, roughly a micron across, accrue within infected cells. We use a new physical model for XFEL diffraction, which better estimates the experimental signal, delivering a high-resolution XFEL structure (1.75 Å), using fewer crystals than previously required for this resolution. The crystal lattice and proteinmore » core are conserved compared with a polyhedrin with less than 10% sequence identity. We explain how the conserved biological phenotype, the crystal lattice, is maintained in the face of extreme environmental challenge and massive evolutionary divergence. Our improved methods should open up more challenging biological samples to XFEL analysis.« less

Crystallization of Δ1-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

PubMed Central

Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi

2005-01-01

Δ1-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å3 Da−1 assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively. PMID:16511162

Acousto-optic interaction in alpha-BaB(2)O(4)and Li(2)B(4)O(7) crystals.

PubMed

Martynyuk-Lototska, Irina; Mys, Oksana; Dudok, Taras; Adamiv, Volodymyr; Smirnov, Yevgen; Vlokh, Rostyslav

2008-07-01

Experimental studies and analysis of acousto-optic diffraction in alpha-BaB(2)O(4) and Li(2)B(4)O(7) crystals are given. Ultrasonic wave velocity, elastic compliance and stiffness coefficients, and piezo-optic and photoelastic coefficients of alpha-BaB(2)O(4) and Li(2)B(4)O(7) crystals are determined. The acousto-optic figure of merit has been estimated for different possible geometries of acousto-optic interaction. It is shown that the acousto-optic figures of merit for alpha-BaB(2)O(4) crystals reach the value M(2)=(270 +/- 70) x 10(-15) s(3)/kg for the case of interaction with the slowest ultrasonic wave. The directions of propagation and polarization of those acoustic waves are obtained on the basis of construction of acoustic slowness surfaces. The acousto-optic diffraction is experimentally studied for alpha-BaB(2)O(4) and Li(2)B(4)O(7) crystals.

An internal affinity-tag for purification and crystallization of the siderophore receptor FhuA, integral outer membrane protein from Escherichia coli K-12.

PubMed

Ferguson, A D; Breed, J; Diederichs, K; Welte, W; Coulton, J W

1998-07-01

FhuA (Mr 78,992, 714 amino acids), siderophore receptor for ferrichrome-iron in the outer membrane of Escherichia coli, was affinity tagged, rapidly purified, and crystallized. To obtain FhuA in quantities sufficient for crystallization, a hexahistidine tag was genetically inserted into the fhuA gene after amino acid 405, which resides in a known surface-exposed loop. Recombinant FhuA405.H6 was overexpressed in an E. coli strain that is devoid of several major porins and using metal-chelate chromatography was purified in large amounts to homogeneity. FhuA crystals were grown using the hanging drop vapor diffusion technique and were suitable for X-ray diffraction analysis. On a rotating anode X-ray source, diffraction was observed to 3.0 A resolution. The crystals belong to space group P6(1) or P6(5) with unit cell dimensions of a=b=174 A, c=88 A (alpha=beta=90 degrees, gamma=120 degrees).

Purification, crystallization and preliminary crystallographic studies of the TLDc domain of oxidation resistance protein 2 from zebrafish

PubMed Central

Alsarraf, Husam M. A. B.; Laroche, Fabrice; Spaink, Herman; Thirup, Søren; Blaise, Mickael

2011-01-01

Cell metabolic processes are constantly producing reactive oxygen species (ROS), which have deleterious effects by triggering, for example, DNA damage. Numerous enzymes such as catalase, and small compounds such as vitamin C, provide protection against ROS. The TLDc domain of the human oxidation resistance protein has been shown to be able to protect DNA from oxidative stress; however, its mechanism of action is still not understood and no structural information is available on this domain. Structural information on the TLDc domain may therefore help in understanding exactly how it works. Here, the purification, crystallization and preliminary crystallographic studies of the TLDc domain from zebrafish are reported. Crystals belonging to the orthorhombic space group P21212 were obtained and diffracted to 0.97 Å resolution. Selenomethionine-substituted protein could also be crystallized; these crystals diffracted to 1.1 Å resolution and the structure could be solved by SAD/MAD methods. PMID:22102041

Nonlinear Optical Characterization of Membrane Protein Microcrystals and Nanocrystals.

PubMed

Newman, Justin A; Simpson, Garth J

2016-01-01

Nonlinear optical methods such as second harmonic generation (SHG) and two-photon excited UV fluorescence (TPE-UVF) imaging are promising approaches to address bottlenecks in the membrane protein structure determination pipeline. The general principles of SHG and TPE-UVF are discussed here along with instrument design considerations. Comparisons to conventional methods in high throughput crystallization condition screening and crystal quality assessment prior to X-ray diffraction are also discussed.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peng, Ying; Xu, Feng, E-mail: xuf@xtal.tsinghua.edu.cn; Bell, Stephen G.

Palustrisredoxin reductase (RPA3782, PuR), a flavin-dependent ferredoxin reductase, is an essential component of the Class I cytochrome P450 systems in Rhodopseudomonas palustris CGA009. Crystals of PuR that diffract to 2.2 Å resolution have been obtained. Palustrisredoxin reductase from Rhodopseudomonas palustris CGA009, a member of the oxygenase-coupled NADH-dependent ferredoxin reductase (ONFR) family, catalyzes electron transfer from NADH to ferredoxins. It is an essential component of the cytochrome P450 systems in R. palustris CGA009, a model organism with diverse metabolic pathways. Here, the crystallization of palustrisredoxin reductase is reported. The crystals belong to the trigonal space group P3{sub 2}21, with unit-cell parametersmore » a = 107.5, b = 107.5, c = 69.9 Å, and diffract to 2.2 Å resolution on a synchrotron source.« less

There ain't nothing like a Dame: a commentary on Lonsdale (1947) ‘Divergent beam X-ray photography of crystals’

PubMed Central

Glazer, A. M.

2015-01-01

Prof. Dame Kathleen Lonsdale was one of the two first female Fellows of the Royal Society, having originally been a student of that great British scientist and Nobel Laureate William Henry Bragg. She came to fame initially for her solution of the crystal structure of hexamethyl benzene, thus demonstrating that the benzene ring was flat, of considerable importance to organic chemistry, where it had been proposed before but without proof. This was at a time when the solution of crystal structures was in its infancy, and in its day this work was considered a triumph. As a rare example then of a female physicist, Lonsdale became interested in various aspects of the diffraction of X-rays, and in particular published an important paper on a form of diffraction in which a strongly divergent source was used rather than the usual highly collimated beam. The photographs thus obtained showed a series of arcs and circles, whose positions were so sensitive that they could be used to determine the quality of crystals such as diamond, and even to calculate their lattice dimensions, and hence carbon–carbon bond lengths, to hitherto extraordinary precision. Lonsdale also became known not just as a scientist but as a peace activist and an active member of the Society of Friends. This commentary was written to celebrate the 350th anniversary of the journal Philosophical Transactions of the Royal Society. PMID:25750139

New hardware and software platform for experiments on a HUBER-5042 X-ray diffractometer with a DISPLEX DE-202 helium cryostat in the temperature range of 20-300 K

NASA Astrophysics Data System (ADS)

Dudka, A. P.; Antipin, A. M.; Verin, I. A.

2017-09-01

Huber-5042 diffractometer with a closed-cycle Displex DE-202 helium cryostat is a unique scientific instrument for carrying out X-ray diffraction experiments when studying the single crystal structure in the temperature range of 20-300 K. To make the service life longer and develop new experimental techniques, the diffractometer control is transferred to a new hardware and software platform. To this end, a modern computer; a new detector reader unit; and new control interfaces for stepper motors, temperature controller, and cryostat vacuum pumping system are used. The system for cooling the X-ray tube, the high-voltage generator, and the helium compressor and pump for maintaining the desired vacuum in the cryostat are replaced. The system for controlling the primary beam shutter is upgraded. A biological shielding is installed. The new program tools, which use the Linux Ubuntu operating system and SPEC constructor, include a set of drivers for control units through the aforementioned interfaces. A program for searching reflections from a sample using fast continuous scanning and a priori information about crystal is written. Thus, the software package for carrying out the complete cycle of precise diffraction experiment (from determining the crystal unit cell to calculating the integral reflection intensities) is upgraded. High quality of the experimental data obtained on this equipment is confirmed in a number of studies in the temperature range from 20 to 300 K.

Effect of roll hot press temperature on crystallite size of PVDF film

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hartono, Ambran, E-mail: ambranhartono@yahoo.com; Sanjaya, Edi; Djamal, Mitra

2014-03-24

Fabrication PVDF films have been made using Hot Roll Press. Preparation of samples carried out for nine different temperatures. This condition is carried out to see the effect of Roll Hot Press temperature on the size of the crystallite of PVDF films. To obtain the diffraction pattern of sample characterization is performed using X-Ray Diffraction. Furthermore, from the diffraction pattern is obtained, the calculation to determine the crystallite size of the sample by using the Scherrer equation. From the experimental results and the calculation of crystallite sizes obtained for the samples with temperature 130 °C up to 170 °C respectivelymore » increased from 7.2 nm up to 20.54 nm. These results show that increasing temperatures will also increase the size of the crystallite of the sample. This happens because with the increasing temperature causes the higher the degree of crystallization of PVDF film sample is formed, so that the crystallite size also increases. This condition indicates that the specific volume or size of the crystals depends on the magnitude of the temperature as it has been studied by Nakagawa.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramadhar, Timothy R.; Zheng, Shao-Liang; Chen, Yu-Sheng

This report describes complete practical guidelines and insights for the crystalline sponge method, which have been derived through the first use of synchrotron radiation on these systems, and includes a procedure for faster synthesis of the sponges. These guidelines will be applicable to crystal sponge data collected at synchrotrons or in-house facilities, and will allow researchers to obtain reliable high-quality data and construct chemically and physically sensible models for guest structural determination. A detailed set of synthetic and crystallographic guidelines for the crystalline sponge method based upon the analysis of expediently synthesized crystal sponges using third-generation synchrotron radiation are reported.more » The procedure for the synthesis of the zinc-based metal–organic framework used in initial crystal sponge reports has been modified to yield competent crystals in 3 days instead of 2 weeks. These crystal sponges were tested on some small molecules, with two being unexpectedly difficult cases for analysis with in-house diffractometers in regard to data quality and proper space-group determination. These issues were easily resolved by the use of synchrotron radiation using data-collection times of less than an hour. One of these guests induced a single-crystal-to-single-crystal transformation to create a larger unit cell with over 500 non-H atoms in the asymmetric unit. This led to a non-trivial refinement scenario that afforded the best Flack x absolute stereochemical determination parameter to date for these systems. The structures did not require the use of PLATON/SQUEEZE or other solvent-masking programs, and are the highest-quality crystalline sponge systems reported to date where the results are strongly supported by the data. A set of guidelines for the entire crystallographic process were developed through these studies. In particular, the refinement guidelines include strategies to refine the host framework, locate guests and determine occupancies, discussion of the proper use of geometric and anisotropic displacement parameter restraints and constraints, and whether to perform solvent squeezing/masking. The single-crystal-to-single-crystal transformation process for the crystal sponges is also discussed. The presented general guidelines will be invaluable for researchers interested in using the crystalline sponge method at in-house diffraction or synchrotron facilities, will facilitate the collection and analysis of reliable high-quality data, and will allow construction of chemically and physically sensible models for guest structural determination.« less

Quasi-mosaicity of (311) planes in silicon and its use in a Laue lens with high-focusing power

NASA Astrophysics Data System (ADS)

Camattari, Riccardo; Paternò, Gianfranco; Bellucci, Valerio; Guidi, Vincenzo

2014-12-01

(311) curved planes can be exploited for efficiently focus hard X-rays. With this purpose, a self-standing bent crystal was manufactured at the Sensor and Semiconductor Laboratory of Ferrara (Italy). The crystal was designed as an optical component for a X-ray concentrator such as a Laue lens. The curvature of (311) planes was obtained through the quasi-mosaic effect. The diffraction efficiency of the sample was tested at the Institut Laue Langevin of Grenoble (France) by using a collimated monochromatic X-ray beam. This was the first prove of the diffraction properties of (311) quasi-mosaic planes. Diffraction efficiency resulted 35 % with a 182 keV X-ray beam, in agreement with the theoretical expectation. It corresponded to a reflectivity of 33 %. While the chosen orientation is not the most performing lying of planes, it can be used, in addition to smaller-index planes, in order to raise the total effective area of a Laue lens. To quantify it, a Laue lens based on quasi-mosaic silicon and germanium crystals, exploiting (111), (422) and (311) diffracting planes, was achieved and simulated with the LaueGen code.

Measurement of helium-like and hydrogen-like argon spectra using double-crystal X-ray spectrometers on EAST

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lyu, B., E-mail: blu@ipp.ac.cn; Hefei Science Center, Chinese Academy of Sciences, Hefei 230031; Chen, J.

2016-11-15

A two-crystal assembly was deployed on the tangential X-ray crystal spectrometer to measure both helium-like and hydrogen-like spectra on EAST. High-quality helium-like and hydrogen-like spectra were observed simultaneously for the first time on one detector for a wide range of plasma parameters. Profiles of line-integrated core ion temperatures inferred from two spectra were consistent. Since tungsten was adopted as the upper divertor material, one tungsten line (W XLIV at 4.017 Å) on the short-wavelength side of the Lyman-α line (Lα1) was identified for typical USN discharges, which was diffracted by a He-like crystal (2d = 4.913 Å). Another possible Femore » XXV line (1.85 Å) was observed to be located on the long-wavelength side of resonance line (w), which was diffracted from a H-like crystal (2d = 4.5622 Å) on the second order. Be-like argon lines were also observable that fill the detector space between the He-like and H-like spectra.« less

Measurement of helium-like and hydrogen-like argon spectra using double-crystal X-ray spectrometers on EAST.

PubMed

Lyu, B; Chen, J; Hu, R J; Wang, F D; Li, Y Y; Fu, J; Shen, Y C; Bitter, M; Hill, K W; Delgado-Aparicio, L F; Pablant, N; Lee, S G; Ye, M Y; Shi, Y J; Wan, B N

2016-11-01

A two-crystal assembly was deployed on the tangential X-ray crystal spectrometer to measure both helium-like and hydrogen-like spectra on EAST. High-quality helium-like and hydrogen-like spectra were observed simultaneously for the first time on one detector for a wide range of plasma parameters. Profiles of line-integrated core ion temperatures inferred from two spectra were consistent. Since tungsten was adopted as the upper divertor material, one tungsten line (W XLIV at 4.017 Å) on the short-wavelength side of the Lyman-α line (Lα1) was identified for typical USN discharges, which was diffracted by a He-like crystal (2d = 4.913 Å). Another possible Fe XXV line (1.85 Å) was observed to be located on the long-wavelength side of resonance line (w), which was diffracted from a H-like crystal (2d = 4.5622 Å) on the second order. Be-like argon lines were also observable that fill the detector space between the He-like and H-like spectra.

Purification, crystallization and preliminary X-ray diffraction of SecDF, a translocon-associated membrane protein, from Thermus thermophilus

PubMed Central

Tsukazaki, Tomoya; Mori, Hiroyuki; Fukai, Shuya; Numata, Tomoyuki; Perederina, Anna; Adachi, Hiroaki; Matsumura, Hiroyoshi; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Sasaki, Takatomo; Vassylyev, Dmitry G.; Nureki, Osamu; Ito, Koreaki

2006-01-01

Thermus thermophilus has a multi-path membrane protein, TSecDF, as a single-chain homologue of Escherichia coli SecD and SecF, which form a translocon-associated complex required for efficient preprotein translocation and membrane-protein integration. Here, the cloning, expression in E. coli, purification and crystallization of TSecDF are reported. Overproduced TSecDF was solubilized with dodecylmaltoside, chromatographically purified and crystallized by vapour diffusion in the presence of polyethylene glycol. The crystals yielded a maximum resolution of 4.2 Å upon X-ray irradiation, revealing that they belonged to space group P43212. Attempts were made to improve the diffraction quality of the crystals by combinations of micro-stirring, laser-light irradiation and dehydration, which led to the eventual collection of complete data sets at 3.74 Å resolution and preliminary success in the single-wavelength anomalous dispersion analysis. These results provide information that is essential for the determination of the three-dimensional structure of this important membrane component of the protein-translocation machinery. PMID:16582489

A Compact X-Ray System for Support of High Throughput Crystallography

NASA Technical Reports Server (NTRS)

Ciszak, Ewa; Gubarev, Mikhail; Gibson, Walter M.; Joy, Marshall K.; Whitaker, Ann F. (Technical Monitor)

2001-01-01

Standard x-ray systems for crystallography rely on massive generators coupled with optics that guide X-ray beams onto the crystal sample. Optics for single-crystal diffractometry include total reflection mirrors, polycapillary optics or graded multilayer monochromators. The benefit of using polycapillary optic is that it can collect x-rays over tile greatest solid angle, and thus most efficiently, utilize the greatest portion of X-rays emitted from the Source, The x-ray generator has to have a small anode spot, and thus its size and power requirements can be substantially reduced We present the design and results from the first high flux x-ray system for crystallography that combine's a microfocus X-ray generator (40microns FWHM Spot size at a power of 45 W) and a collimating, polycapillary optic. Diffraction data collected from small test crystals with cell dimensions up to 160A (lysozyme and thaumatin) are of high quality. For example, diffraction data collected from a lysozyme crystal at RT yielded R=5.0% for data extending to 1.70A. We compare these results with measurements taken from standard crystallographic systems. Our current microfocus X-ray diffraction system is attractive for supporting crystal growth research in the standard crystallography laboratory as well as in remote, automated crystal growth laboratory. Its small volume, light-weight, and low power requirements are sufficient to have it installed in unique environments, i.e.. on-board International Space Station.

An Experimental Study of Ultra-Wide-Band and Ultra-Wide-Aperture Non-Collinear Acousto-Optic Diffraction in an Optically Biaxial Potassium Arsenate Titanyl Crystal

NASA Astrophysics Data System (ADS)

Milkov, M. G.; Voloshinov, V. B.; Isaenko, L. I.; Vedenyapin, V. N.

2018-01-01

Acousto-optic interaction in an optically biaxial crystalline medium under propagation of light close to one of the optical axes of a potassium arsenate titanyl KTiOAsO4 crystal has been studied. The experimental dependences of the intensity of a diffracted optical beam on the angle of light incidence on an ultrasonic wave have been obtained. It has been shown that a flat cut of a wave-vector surface provides development of an ultra-wide-aperture and ultra-wide-band acousto-optic deflector to control radiation in the visible and infrared electromagnetic spectral ranges.

Mechanochemical synthesis and structural characterization of three novel cocrystals of dimethylglyoxime with N-heterocyclic aromatic compounds and acetamide

NASA Astrophysics Data System (ADS)

Abidi, Syed Sibte Asghar; Azim, Yasser; Gupta, Abhishek Kumar; Pradeep, Chullikkattil P.

2017-12-01

With an aim to explore the interactions of (RR'Cdbnd Nsbnd OH) oxime moiety of dimethylglyoxime (DMG) with pyridyl ring of N-heterocyclic aromatic compounds and acetamide, three novel cocrystals of dimethylglyoxime with acridine (ACR), 1,10-phenanthroline monohydrate (PT) and acetamide (ACT) are reported. These three cocrystals were obtained with a mechanochemical synthesis approach and were characterized by single crystal X-ray diffraction (SCXRD), powder X-ray diffraction (PXRD), fourier transform-infrared spectroscopy (FT-IR), differential scanning calorimetry (DSC) and thermogravimetric analysis (TGA). Additionally, Hirshfeld surface analysis is used to investigate the intermolecular interaction and the crystal packing of cocrystals.

The Crystal Structures of Potentially Tautomeric Compounds

NASA Astrophysics Data System (ADS)

Furmanova, Nina G.

1981-08-01

Data on the structures of potentially proto-, metallo-, and carbono-tropic compounds, obtained mainly by X-ray diffraction, are surveyed. The results of neutron and electron diffraction studies have also been partly used. It is shown that a characteristic feature of all the systems considered is the formation of hydrogen or secondary bonds ensuring the contribution of both possible tautomeric forms to the structure. Systematic consideration of the experimental data leads to the conclusion that there is a close relation between the crystal structure and the dynamic behaviour of the molecules in solution and that secondary and hydrogen bonds play a significant role in the tautomeric transition. The bibliography includes 152 references.

Protein crystallization: Eluding the bottleneck of X-ray crystallography

PubMed Central

Holcomb, Joshua; Spellmon, Nicholas; Zhang, Yingxue; Doughan, Maysaa; Li, Chunying; Yang, Zhe

2017-01-01

To date, X-ray crystallography remains the gold standard for the determination of macromolecular structure and protein substrate interactions. However, the unpredictability of obtaining a protein crystal remains the limiting factor and continues to be the bottleneck in determining protein structures. A vast amount of research has been conducted in order to circumvent this issue with limited success. No single method has proven to guarantee the crystallization of all proteins. However, techniques using antibody fragments, lipids, carrier proteins, and even mutagenesis of crystal contacts have been implemented to increase the odds of obtaining a crystal with adequate diffraction. In addition, we review a new technique using the scaffolding ability of PDZ domains to facilitate nucleation and crystal lattice formation. Although in its infancy, such technology may be a valuable asset and another method in the crystallography toolbox to further the chances of crystallizing problematic proteins. PMID:29051919

Angular selectivity asymmetry of holograms recorded in near infrared sensitive liquid crystal photopolymerizable materials

NASA Astrophysics Data System (ADS)

Harbour, Steven; Galstian, Tigran; Akopyan, Rafik; Galstyan, Artur

2004-08-01

We have experimentally observed and theoretically explained the angular selectivity asymmetry in polymer dispersed liquid crystal holograms. Experiments are conducted in compounds with near infrared sensitivity. The coupled-wave theory is used to describe the diffraction properties of obtained anisotropic holographic gratings. Furthermore, the comparison of theory and experiments provides information about the optical axis direction that is defined by the average molecular orientation of the liquid crystal in the polymer matrix.

Scanning tunneling microscopy and atomic force microscopy: application to biology and technology.

PubMed

Hansma, P K; Elings, V B; Marti, O; Bracker, C E

1988-10-14

The scanning tunneling microscope (STM) and the atomic force microscope (AFM) are scanning probe microscopes capable of resolving surface detail down to the atomic level. The potential of these microscopes for revealing subtle details of structure is illustrated by atomic resolution images including graphite, an organic conductor, an insulating layered compound, and individual adsorbed oxygen atoms on a semiconductor. Application of the STM for imaging biological materials directly has been hampered by the poor electron conductivity of most biological samples. The use of thin conductive metal coatings and replicas has made it possible to image some biological samples, as indicated by recently obtained images of a recA-DNA complex, a phospholipid bilayer, and an enzyme crystal. The potential of the AFM, which does not require a conductive sample, is shown with molecular resolution images of a nonconducting organic monolayer and an amino acid crystal that reveals individual methyl groups on the ends of the amino acids. Applications of these new microscopes to technology are demonstrated with images of an optical disk stamper, a diffraction grating, a thin-film magnetic recording head, and a diamond cutting tool. The STM has even been used to improve the quality of diffraction gratings and magnetic recording heads.

Crystallization of SHARPIN using an automated two-dimensional grid screen for optimization.

PubMed

Stieglitz, Benjamin; Rittinger, Katrin; Haire, Lesley F

2012-07-01

An N-terminal fragment of human SHARPIN was recombinantly expressed in Escherichia coli, purified and crystallized. Crystals suitable for X-ray diffraction were obtained by a one-step optimization of seed dilution and protein concentration using a two-dimensional grid screen. The crystals belonged to the primitive tetragonal space group P4(3)2(1)2, with unit-cell parameters a = b = 61.55, c = 222.81 Å. Complete data sets were collected from native and selenomethionine-substituted protein crystals at 100 K to 2.6 and 2.0 Å resolution, respectively.

Crystallization of a 2:2 complex of granulocyte-colony stimulating factor (GCSF) with the ligand-binding region of the GCSF receptor

PubMed Central

Honjo, Eijiro; Tamada, Taro; Maeda, Yoshitake; Koshiba, Takumi; Matsukura, Yasuko; Okamoto, Tomoyuki; Ishibashi, Matsujiro; Tokunaga, Masao; Kuroki, Ryota

2005-01-01

The granulocyte-colony stimulating factor (GCSF) receptor receives signals for regulating the maturation, proliferation and differentiation of the precursor cells of neutrophilic granulocytes. The signalling complex composed of two GCSFs (GCSF, 19 kDa) and two GCSF receptors (GCSFR, 34 kDa) consisting of an Ig-like domain and a cytokine-receptor homologous (CRH) domain was crystallized. A crystal of the complex was grown in 1.0 M sodium formate and 0.1 M sodium acetate pH 4.6 and belongs to space group P41212 (or its enantiomorph P43212), with unit-cell parameters a = b = 110.1, c = 331.8 Å. Unfortunately, this crystal form did not diffract beyond 5 Å resolution. Since the heterogeneity of GCSF receptor appeared to prevent the growth of good-quality crystals, the GCSF receptor was fractionated by anion-exchange chromatography. Crystals of the GCSF–fractionated GCSF receptor complex were grown as a new crystal form in 0.2 M ammonium phosphate. This new crystal form diffracted to beyond 3.0 Å resolution and belonged to space group P3121 (or its enantiomorph P3221), with unit-cell parameters a = b = 134.8, c = 105.7 Å. PMID:16511159

Synthesis, high-resolution NMR spectroscopic analysis, and single-crystal X-ray diffraction of isoxazoline tetracycles.

PubMed

Fascio, Mirta L; Alvarez-Larena, Angel; D'Accorso, Norma B

2002-11-29

Three isoxazoline tetracycles were obtained enantiomerically pure by intramolecular 1,3-dipolar cycloaddition. The characterization of the new compounds was performed by high-resolution 1H and 13C NMR spectroscopy. The relative configuration of the new chiral centers was determined by NOESY experiments and confirmed by single-crystal X-ray structural analysis.

Femtosecond X-ray Diffraction From Two-Dimensional Protein Crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frank, Matthias; Carlson, David B.; Hunter, Mark

2014-02-28

Here we present femtosecond x-ray diffraction patterns from two-dimensional (2-D) protein crystals using an x-ray free electron laser (XFEL). To date it has not been possible to acquire x-ray diffraction from individual 2-D protein crystals due to radiation damage. However, the intense and ultrafast pulses generated by an XFEL permits a new method of collecting diffraction data before the sample is destroyed. Utilizing a diffract-before-destroy methodology at the Linac Coherent Light Source, we observed Bragg diffraction to better than 8.5 Å resolution for two different 2-D protein crystal samples that were maintained at room temperature. These proof-of-principle results show promisemore » for structural analysis of both soluble and membrane proteins arranged as 2-D crystals without requiring cryogenic conditions or the formation of three-dimensional crystals.« less

Purification and crystallization of Kokobera virus helicase

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Colibus, Luigi; Speroni, Silvia; Coutard, Bruno

2007-03-01

Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method and exhibit a diffraction limit of 2.3 Å. Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. The flavivirus genus is characterized by a positive-sense single-stranded RNA genome. The unique open reading frame of the viral RNA is transcribed and translated as a single polyprotein which is post-translationally cleaved to yield three structural and seven nonstructural proteins, one of which ismore » the NS3 gene that encodes a C-terminal helicase domain consisting of 431 amino acids. Helicase inhibitors are potential antiviral drugs as the helicase is essential to viral replication. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P3{sub 1}21 (or P3{sub 2}21), with unit-cell parameters a = 88.6, c = 138.6 Å, and exhibit a diffraction limit of 2.3 Å.« less

Crystal Growth of the S =1/2 Antiferromagnet K2PbCu(NO2)6 Elpasolite

NASA Astrophysics Data System (ADS)

Dong, Lianyang; Besara, Tiglet; Siegrist, Theo

The elpasolite K2PbCu(NO2)6is known for its two structural transitions at 281 K and 273 K. Single crystals of K2PbCu(NO2)6 have been grown in aqueous solution, but the rapid nucleation rate and convective transport renders it difficult to obtain large high quality single crystals. We developed a gel method to grow K2PbCu(NO2)6 Elpasolite with sizes up to 5x5x5 mm3, suitable for neutron diffraction measurements. Susceptibility measurements clearly show that the Jahn-Teller distortions at 286K and 273K with associated orbital ordering produce a linear chain Heisenberg antiferromagnetic system. The intrachain interaction strength has been derived from a Bonner-Fisher analysis that yielded a value of 5.4K. This work was supported by the National Science Foundation, under award DMR-1534818. A portion of this work has been performed at the National High Magnetic Field Laboratory, which is supported by the National Science Foundation Cooperative Agreement.

Self-assembled hierarchical nanostructures for high-efficiency porous photonic crystals.

PubMed

Passoni, Luca; Criante, Luigino; Fumagalli, Francesco; Scotognella, Francesco; Lanzani, Guglielmo; Di Fonzo, Fabio

2014-12-23

The nanoscale modulation of material properties such as porosity and morphology is used in the natural world to mold the flow of light and to obtain structural colors. The ability to mimic these strategies while adding technological functionality has the potential to open up a broad array of applications. Porous photonic crystals are one such technological candidate, but have typically underachieved in terms of available materials, structural and optical quality, compatibility with different substrates (e.g., silicon, flexible organics), and scalability. We report here an alternative fabrication method based on the bottom-up self-assembly of elementary building blocks from the gas phase into high surface area photonic hierarchical nanostructures at room temperature. Periodic refractive index modulation is achieved by stacking layers with different nanoarchitectures. High-efficiency porous Bragg reflectors are successfully fabricated with sub-micrometer thick films on glass, silicon, and flexible substrates. High diffraction efficiency broadband mirrors (R≈1), opto-fluidic switches, and arrays of photonic crystal pixels with size<10 μm are demonstrated. Possible applications in filtering, sensing, electro-optical modulation, solar cells, and photocatalysis are envisioned.

Crystallization and preliminary crystallographic analysis of the catechol 2,3-dioxygenase PheB from Bacillus stearothermophilus BR219

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sugimoto, Keisuke; Matsufuzi, Kazuki; Ohnuma, Hiroaki

2006-02-01

PheB, an extradiol-cleaving catecholic dioxygenase, was crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The crystal belongs to the orthorhombic system, space group P2{sub 1}2{sub 1}2{sub 1}, and diffracts to 2.3 Å resolution. Class II extradiol-cleaving catecholic dioxygenase, a key enzyme of aromatic compound degradation in bacteria, cleaves the aromatic ring of catechol by adding two O atoms. PheB is one of the class II extradiol-cleaving catecholic dioxygenases and shows a high substrate specificity for catechol derivatives, which have one aromatic ring. In order to reveal the mechanism of the substrate specificity of PheB, PheB hasmore » been crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The space group of the obtained crystal was P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 65.5, b = 119.2, c = 158.7 Å. The crystal diffracted to 2.3 Å resolution.« less

Crystallization and preliminary X-ray analysis of pyruvate kinase from Bacillus stearothermophilus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suzuki, Kenichiro; Ito, Sohei; Shimizu-Ibuka, Akiko

2005-08-01

This report describes the crystallization and X-ray diffraction data collection of three types (wild-type, W416F/V435W and C9S/C268S) of B. stearothermophilus. Crystals of C9S/C268S belonged to space group P6{sub 2}22 and diffracted to a resolution of 2.4 Å. Pyruvate kinase (PK) from a moderate thermophile, Bacillus stearothermophilus (BstPK), is an allosteric enzyme activated by AMP and ribose 5-phosphate but not by fructose 1,6-bisphosphate (FBP). However, almost all other PKs are activated by FBP. The wild-type and W416F/V435W mutant BstPKs were crystallized by the hanging-drop vapour-diffusion method. However, they were unsuitable for structural analysis because their data sets exhibited low completeness. Amore » crystal suitable for structural analysis was obtained using C9S/C268S enzyme. The crystal belonged to space group P6{sub 2}22, with unit-cell parameters a = b = 145.97, c = 118.03 Å.« less

On beam shaping of the field radiated by a line source coupled to finite or infinite photonic crystals.

PubMed

Ceccuzzi, Silvio; Jandieri, Vakhtang; Baccarelli, Paolo; Ponti, Cristina; Schettini, Giuseppe

2016-04-01

Comparison of the beam-shaping effect of a field radiated by a line source, when an ideal infinite structure constituted by two photonic crystals and an actual finite one are considered, has been carried out by means of two different methods. The lattice sums technique combined with the generalized reflection matrix method is used to rigorously investigate the radiation from the infinite photonic crystals, whereas radiation from crystals composed of a finite number of rods along the layers is analyzed using the cylindrical-wave approach. A directive radiation is observed with the line source embedded in the structure. With an increased separation distance between the crystals, a significant edge diffraction appears that provides the main radiation mechanism in the finite layout. Suitable absorbers are implemented to reduce the above-mentioned diffraction and the reflections at the boundaries, thus obtaining good agreement between radiation patterns of a localized line source coupled to finite and infinite photonic crystals, when the number of periods of the finite structure is properly chosen.

Crystallographic Characterization of Extraterrestrial Materials by Energy-Scanning X-ray Diffraction

NASA Technical Reports Server (NTRS)

Hagiya, Kenji; Mikouchi, Takashi; Ohsumi, Kazumasa; Terada, Yasuko; Yagi, Naoto; Komatsu, Mutsumi; Yamaguchi, Shoki; Hirata, Arashi; Kurokawa, Ayaka; Zolensky, Michael E. (Principal Investigator)

2016-01-01

We have continued our long-term project using X-ray diffraction to characterize a wide range of extraterrestrial samples. The stationary sample method with polychromatic X-rays is advantageous because the irradiated area of the sample is always same and fixed, meaning that all diffraction spots occur from the same area of the sample, however, unit cell parameters cannot be directly obtained by this method though they are very important for identification of mineral and for determination of crystal structures. In order to obtain the cell parameters even in the case of the sample stationary method, we apply energy scanning of a micro-beam of monochromatic SR at SPring-8.

A combined experimental and in silico characterization to highlight additional structural features and properties of a potentially new drug

NASA Astrophysics Data System (ADS)

Bastos, Isadora T. S.; Costa, Fanny N.; Silva, Tiago F.; Barreiro, Eliezer J.; Lima, Lídia M.; Braz, Delson; Lombardo, Giuseppe M.; Punzo, Francesco; Ferreira, Fabio F.; Barroso, Regina C.

2017-10-01

LASSBio-1755 is a new cycloalkyl-N-acylhydrazone parent compound designed for the development of derivatives with antinociceptive and anti-inflammatory activities. Although single crystal X-ray diffraction has been considered as the golden standard in structure determination, we successfully used X-ray powder diffraction data in the structural determination of new synthesized compounds, in order to overcome the bottle-neck due to the difficulties experienced in harvesting good quality single crystals of the compounds. We therefore unequivocally assigned the relative configuration (E) to the imine double bond and a s-cis conformation of the amide function of the N-acylhydrazone compound. These features are confirmed by a computational analysis performed on the basis of molecular dynamics calculations, which are extended not only to the structural characteristics but also to the analysis of the anisotropic atomic displacement parameters, a further information - missed in a typical powder diffraction analysis. The so inferred data were used to perform additional cycles of refinement and eventually generate a new cif file with additional physical information. Furthermore, crystal morphology prediction was performed, which is in agreement with the experimental images acquired by scanning electron microscopy, thus providing useful information on possible alternative paths for better crystallization strategies.

Diffraction Correlation to Reconstruct Highly Strained Particles

NASA Astrophysics Data System (ADS)

Brown, Douglas; Harder, Ross; Clark, Jesse; Kim, J. W.; Kiefer, Boris; Fullerton, Eric; Shpyrko, Oleg; Fohtung, Edwin

2015-03-01

Through the use of coherent x-ray diffraction a three-dimensional diffraction pattern of a highly strained nano-crystal can be recorded in reciprocal space by a detector. Only the intensities are recorded, resulting in a loss of the complex phase. The recorded diffraction pattern therefore requires computational processing to reconstruct the density and complex distribution of the diffracted nano-crystal. For highly strained crystals, standard methods using HIO and ER algorithms are no longer sufficient to reconstruct the diffraction pattern. Our solution is to correlate the symmetry in reciprocal space to generate an a priori shape constraint to guide the computational reconstruction of the diffraction pattern. This approach has improved the ability to accurately reconstruct highly strained nano-crystals.

Growth, optical, ICP and thermal studies of nonlinear optical single crystal: Sodium acid phthalate (NaAP)

NASA Astrophysics Data System (ADS)

Mahadevan, M.; Arivanandhan, M.; Elangovan, K.; Anandan, P.; Ramachandran, K.

2017-07-01

Good quality single crystals of sodium acid phthalate (NaAP) were grown by slow evaporation technique. Single crystal X-ray diffraction study of the grown crystal reveals that the crystal belongs to orthorhombic system with space group B2ab. Fourier transform infrared spectrum confirms the presence of the functional groups of the grown material. Inductively coupled plasma emission spectroscopy analysis is used to confirm the presence of Na element in the sample. Thermal analysis of the NaAP crystal shows that the crystal is stable up to 140°C. Optical transmittance of the grown crystal was recorded in the wavelength range from 200 and 800 nm using UV-Vis-NIR spectrophotometer. The second harmonic generation of NaAP was analysed using Kurtz powder technique.

Studies on the growth aspects, structural, thermal, dielectric and third order nonlinear optical properties of solution grown 4-methylpyridinium p-nitrophenolate single crystal

NASA Astrophysics Data System (ADS)

Devi, S. Reena; Kalaiyarasi, S.; Zahid, I. MD.; Kumar, R. Mohan

2016-11-01

An ionic organic optical crystal of 4-methylpyridinium p-nitrophenolate was grown from methanol by slow evaporation method at ambient temperature. Powder and single crystal X-ray diffraction studies revealed the crystal system and its crystalline perfection. The rocking curve recorded from HRXRD study confirmed the crystal quality. FTIR spectral analysis confirmed the functional groups present in the title compound. UV-visible spectral study revealed the optical window and band gap of grown crystal. The thermal, electrical and surface laser damage threshold properties of harvested crystal were examined by using TGA/DTA, LCR/Impedance Analyzer and Nd:YAG laser system respectively. The third order nonlinear optical property of grown crystal was elucidated by Z-scan technique.

Crystallization and initial X-ray diffraction studies of scaffolding protein (gp7) of bacteriophage ϕ29

DOE Office of Scientific and Technical Information (OSTI.GOV)

Badasso, Mohammed O., E-mail: badas001@umn.edu; Anderson, Dwight L.; Department of Oral Science, University of Minnesota, Minneapolis, MN 55455

2005-04-01

ϕ29 bacteriophage scaffolding protein (gp7) has been overproduced in E. coli, purified, crystallized and characterized by X-ray diffraction. Two distinct crystal forms were obtained and a diffraction data set was collected to 1.8 Å resolution. The Bacillus subtilis bacteriophage ϕ29 scaffolding protein (gp7) has been crystallized by the hanging-drop vapour-diffusion method at 293 K. Two new distinct crystal forms that both differed from a previously crystallized and solved scaffolding protein were grown under the same conditions. Form I belongs to the primitive tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 77.13, c = 37.12 Å.more » Form II crystals exhibit an orthorhombic crystal form, with space group C222 and unit-cell parameters a = 107.50, b = 107. 80, c = 37.34 Å. Complete data sets have been collected to 1.78 and 1.80 Å for forms I and II, respectively, at 100 K using Cu Kα X-rays from a rotating-anode generator. Calculation of a V{sub M} value of 2.46 Å{sup 3} Da{sup −1} for form I suggests the presence of one molecule in the asymmetric unit, corresponding to a solvent content of 50.90%, whereas form II has a V{sub M} of 4.80 Å{sup 3} Da{sup −1} with a solvent content of 48.76% and two molecules in the asymmetric unit. The structures of both crystal forms are being determined by the molecular-replacement method using the coordinates of the published crystal structure of gp7.« less

Liquid-liquid diffusion crystallization improves the X-ray diffraction of EndoS, an endo-β-N-acetylglucosaminidase from Streptococcus pyogenes with activity on human IgG.

PubMed

Trastoy, Beatriz; Lomino, Joseph V; Wang, Lai Xi; Sundberg, Eric J

2013-12-01

Endoglycosidase S (EndoS) is an enzyme secreted by Streptococcus pyogenes that specifically hydrolyzes the β-1,4-di-N-acetylchitobiose core glycan on immunoglobulin G (IgG) antibodies. One of the most common human pathogens and the cause of group A streptococcal infections, S. pyogenes secretes EndoS in order to evade the host immune system by rendering IgG effector mechanisms dysfunctional. On account of its specificity for IgG, EndoS has also been used extensively for chemoenzymatic synthesis of homogeneous IgG glycoprotein preparations and is being developed as a novel therapeutic for a wide range of autoimmune diseases. The structural basis of its enzymatic activity and substrate specificity, however, remains unknown. Here, the purification and crystallization of EndoS are reported. Using traditional hanging-drop and sitting-drop vapor-diffusion crystallization, crystals of EndoS were grown that diffracted to a maximum of 3.5 Å resolution but suffered from severe anisotropy, the data from which could only be reasonably processed to 7.5 Å resolution. When EndoS was crystallized by liquid-liquid diffusion, it was possible to grow crystals with a different space group to those obtained by vapor diffusion. Crystals of wild-type endoglycosidase and glycosynthase constructs of EndoS grown by liquid-liquid diffusion diffracted to 2.6 and 1.9 Å resolution, respectively, with a greatly diminished anisotropy. Despite extensive efforts, the failure to reproduce these liquid-liquid diffusion-grown crystals by vapor diffusion suggests that these crystallization methods each sample a distinct crystallization space.

A strategic approach to physico-chemical analysis of bis (thiourea) lead chloride - A reliable semi-organic nonlinear optical crystal

NASA Astrophysics Data System (ADS)

Rajagopalan, N. R.; Krishnamoorthy, P.; Jayamoorthy, K.

2017-03-01

Good quality crystals of bis thiourea lead chloride (BTLC) have been grown by slow evaporation method from aqueous solution. Orthorhombic structure and Pna21 space group of the crystals have been identified by single crystal X-ray diffraction. Studies on nucleation kinetics of grown BTLC has been carried out from which meta-stable zone width, induction period, free energy change, critical radius, critical number and growth rate have been calculated. The experimental values of interfacial surface energy for the crystal growth process have been compared with theoretical models. Ultra violet transmittance studies resulted in a high transmittance and wide band gap energy suggested the required optical transparency of the crystal. The second harmonic generation (SHG) and phase matching nature of the crystal have been justified by Kurtz-Perry method. The SHG nature of the crystal has been further attested by the higher values of theoretical hyper polarizability. The dielectric nature of the crystals at different temperatures with varying frequencies has been thoroughly studied. The activation energy values of the electrical process have been calculated from ac conductivity study. Solid state parameters including valence electron plasma energy, Penn gap, Fermi energy and polarisability have been unveiled by theoretical approach and correlated with the crystal's SHG efficiency. The values of hardness number, elastic stiffness constant, Meyer's Index, minimum level of indentation load, load dependent constant, fracture toughness, brittleness index and corrected hardness obtained from Vicker's hardness test clearly showed that the BTLC crystal has good mechanical stability required for NLO device fabrication.

Macromolecular Crystallization in Microgravity

NASA Technical Reports Server (NTRS)

Snell, Edward H.; Helliwell, John R.

2004-01-01

The key concepts that attracted crystal growers, macromolecular or solid state, to microgravity research is that density difference fluid flows and sedimentation of the growing crystals are greatly reduced. Thus, defects and flaws in the crystals can be reduced, even eliminated, and crystal volume can be increased. Macromolecular crystallography differs from the field of crystalline semiconductors. For the latter, crystals are harnessed for their electrical behaviors. A crystal of a biological macromolecule is used instead for diffraction experiments (X-ray or neutron) to determine the three-dimensional structure of the macromolecule. The better the internal order of the crystal of a biological macromolecule then the more molecular structure detail that can be extracted. This structural information that enables an understanding of how the molecule functions. This knowledge is changing the biological and chemical sciences with major potential in understanding disease pathologies. Macromolecular structural crystallography in general is a remarkable field where physics, biology, chemistry, and mathematics meet to enable insight to the basic fundamentals of life. In this review, we examine the use of microgravity as an environment to grow macromolecular crystals. We describe the crystallization procedures used on the ground, how the resulting crystals are studied and the knowledge obtained from those crystals. We address the features desired in an ordered crystal and the techniques used to evaluate those features in detail. We then introduce the microgravity environment, the techniques to access that environment, and the theory and evidence behind the use of microgravity for crystallization experiments. We describe how ground-based laboratory techniques have been adapted to microgravity flights and look at some of the methods used to analyze the resulting data. Several case studies illustrate the physical crystal quality improvements and the macromolecular structural advances. Finally, limitations and alternatives to microgravity and future directions for this research are covered.

Synthesis and characterization of colloidal CdTe nanocrystals

NASA Astrophysics Data System (ADS)

Semendy, Fred; Jaganathan, Gomatam; Dhar, Nibir; Trivedi, Sudhir; Bhat, Ishwara; Chen, Yuanping

2008-08-01

We synthesized CdTe nano crystals (NCs) in uniform sizes and in good quality as characterized by photoluminescence (PL), AFM, and X-ray diffraction. In this growth procedure, CdTe nano-crystal band gap is strongly dependent on the growth time and not on the injection temperature or organic ligand concentration. This is very attractive because of nano-crystal size can be easily controlled by the growth time only and is very attractive for large scale synthesis. The color of the solution changes from greenish yellow to light orange then to deep orange and finally grayish black to black over a period of one hour. This is a clear indication of the gradual growth of different size (and different band gap) of CdTe nano-crystals as a function of the growth time. In other words, the size of the nano-crystal and its band gap can be controlled by adjusting the growth time after injection of the tellurium. The prepared CdTe NCs were characterized by absorption spectra, photoluminescence (PL), AFM and X-ray diffraction. Measured absorption maxima are at 521, 560, 600 and 603 nm corresponding to band gaps of 2.38, 2.21,2,07 and 2.04 eV respectively for growth times of 15, 30, 45 and 60 minutes. From the absorption data nano-crystal growth size saturates out after 45 minutes. AFM scanning of these materials indicate that the size of these particles is between 4 - 10 nm in diameter for growth time of 45 minutes. XD-ray diffraction indicates that these nano crystals are of cubic zinc blende phase. This paper will present growth and characterization data on CdTe nano crystals for various growth times.

High-energy high-efficiency Nd:YLF laser end-pump by 808 nm diode

NASA Astrophysics Data System (ADS)

Ma, Qinglei; Mo, Haiding; Zhao, Jay

2018-04-01

A model is developed to calculate the optimal pump position for end-pump configuration. The 808 nm wing pump is employed to spread the absorption inside the crystal. By the optimal laser cavity design, a high-energy high-efficiency Nd:YLF laser operating at 1053 nm is presented. In cw operation, a 13.6 W power is obtained with a slope efficiency of 51% with respect to 30 W incident pump power. The beam quality is near diffraction limited with M2 ∼ 1.02. In Q-switch operation, a pulse energy of 5 mJ is achieved with a peak power of 125 kW at 1 kHz repetition rate.

Raman scattering and X-ray powder diffraction studies of hydrate layered perovskites: dirubidium aquapentafluoromanganate(III) and dipotassium aquapentafluoroferrate(III)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Galicka, Karolina; Slodczyk, Aneta; Ratuszna, Alicja

2004-06-08

The structural and vibrational properties of above mentioned crystals were determined using X-ray powder diffraction and Raman scattering experiments. At room temperature hydrate layered perovskites: Rb{sub 2}MnF{sub 5}{center_dot}H{sub 2}O and K{sub 2}FeF{sub 5}{center_dot}H{sub 2}O exhibit orthorhombic--Cmcm (D{sub 2h}{sup 17}) and monoclinic--C2/c (C{sub 2h}{sup 6}) symmetry. Their structure is built up of MnF{sub 6} or FeF{sub 5}{center_dot}H{sub 2}O octahedra forming trans-linked zig-zag chains or hydrogen bonded zig-zag chains along the major crystallographic direction [0 0 1], respectively. To confirm crystal structures and to describe lattice dynamics of these compounds the vibrational normal modes (in {gamma} point of first Brillouin zone) weremore » calculated on the base of the group theory analysis and compared with the spectra obtained from Raman scattering experiments. A relatively good reliability was obtained for both X-ray powder diffraction and Raman scattering.« less

Complementary use of monochromatic and white-beam X-ray micro-diffraction for the investigation of ancient materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dejoie, Catherine; Tamura, Nobumichi; Kunz, Martin

Archaeological artefacts are often heterogeneous materials where several phases coexist in a wide grain size distribution. Most of the time, retrieving structure information at the micrometre scale is of great importance for these materials. Particularly, the organization of different phases at the micrometre scale is closely related to optical or mechanical properties, manufacturing processes, functionalities in ancient times and long-term conservation. Between classic X-ray powder diffraction with a millimetre beam and transmission electron microscopy, a gap exists and structure and phase information at the micrometre scale are missing. Using a micrometre-size synchrotron X-ray beam, a hybrid approach combining both monochromaticmore » powder micro-diffraction and Laue single-crystal micro-diffraction was deployed to obtain information from nanometre- and micrometre-size phases, respectively. Therefore providing a way to bridge the aforementioned gap, this unique methodology was applied to three different types of ancient materials that all show a strong heterogeneity. In Roman terra sigillata, the specific distribution of nanocrystalline hematite is mainly responsible for the deep-red tone of the slip, while the distribution of micrometre-size quartz in ceramic bodies reflects the change of manufacturing process between pre-sigillata and high-quality sigillata periods. In the second example, we investigated the modifications occurring in Neolithic and geological flints after a heating process. By separating the diffracted signal coming from the nano- and the micrometre scale, we observed a domain size increase for nanocrystalline quartz in geological flints and a relaxation of the residual strain in larger detritic quartz. In conclusion, through the study of a Roman iron nail, we showed that the carburation process to strengthen the steel was mainly a surface process that formed 10–20 µm size domains of single–crystal ferrite and nanocrystalline cementite.« less

Complementary use of monochromatic and white-beam X-ray micro-diffraction for the investigation of ancient materials

DOE PAGES

Dejoie, Catherine; Tamura, Nobumichi; Kunz, Martin; ...

2015-09-20

Archaeological artefacts are often heterogeneous materials where several phases coexist in a wide grain size distribution. Most of the time, retrieving structure information at the micrometre scale is of great importance for these materials. Particularly, the organization of different phases at the micrometre scale is closely related to optical or mechanical properties, manufacturing processes, functionalities in ancient times and long-term conservation. Between classic X-ray powder diffraction with a millimetre beam and transmission electron microscopy, a gap exists and structure and phase information at the micrometre scale are missing. Using a micrometre-size synchrotron X-ray beam, a hybrid approach combining both monochromaticmore » powder micro-diffraction and Laue single-crystal micro-diffraction was deployed to obtain information from nanometre- and micrometre-size phases, respectively. Therefore providing a way to bridge the aforementioned gap, this unique methodology was applied to three different types of ancient materials that all show a strong heterogeneity. In Roman terra sigillata, the specific distribution of nanocrystalline hematite is mainly responsible for the deep-red tone of the slip, while the distribution of micrometre-size quartz in ceramic bodies reflects the change of manufacturing process between pre-sigillata and high-quality sigillata periods. In the second example, we investigated the modifications occurring in Neolithic and geological flints after a heating process. By separating the diffracted signal coming from the nano- and the micrometre scale, we observed a domain size increase for nanocrystalline quartz in geological flints and a relaxation of the residual strain in larger detritic quartz. In conclusion, through the study of a Roman iron nail, we showed that the carburation process to strengthen the steel was mainly a surface process that formed 10–20 µm size domains of single–crystal ferrite and nanocrystalline cementite.« less

Calculations of single crystal elastic constants for yttria partially stabilised zirconia from powder diffraction data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lunt, A. J. G., E-mail: alexander.lunt@eng.ox.ac.uk; Xie, M. Y.; Baimpas, N.

2014-08-07

Yttria Stabilised Zirconia (YSZ) is a tough, phase-transforming ceramic that finds use in a wide range of commercial applications from dental prostheses to thermal barrier coatings. Micromechanical modelling of phase transformation can deliver reliable predictions in terms of the influence of temperature and stress. However, models must rely on the accurate knowledge of single crystal elastic stiffness constants. Some techniques for elastic stiffness determination are well-established. The most popular of these involve exploiting frequency shifts and phase velocities of acoustic waves. However, the application of these techniques to YSZ can be problematic due to the micro-twinning observed in larger crystals.more » Here, we propose an alternative approach based on selective elastic strain sampling (e.g., by diffraction) of grain ensembles sharing certain orientation, and the prediction of the same quantities by polycrystalline modelling, for example, the Reuss or Voigt average. The inverse problem arises consisting of adjusting the single crystal stiffness matrix to match the polycrystal predictions to observations. In the present model-matching study, we sought to determine the single crystal stiffness matrix of tetragonal YSZ using the results of time-of-flight neutron diffraction obtained from an in situ compression experiment and Finite Element modelling of the deformation of polycrystalline tetragonal YSZ. The best match between the model predictions and observations was obtained for the optimized stiffness values of C11 = 451, C33 = 302, C44 = 39, C66 = 82, C12 = 240, and C13 = 50 (units: GPa). Considering the significant amount of scatter in the published literature data, our result appears reasonably consistent.« less

Grazing-incidence X-ray diffraction from a crystal with subsurface defects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gaevskii, A. Yu., E-mail: transilv@mail.ru; Golentus, I. E.

2015-03-15

The diffraction of X rays incident on a crystal surface under grazing angles under conditions of total external reflection has been investigated. An approach is proposed in which exact solutions to the dynamic problem of grazing-incidence diffraction in an ideal crystal are used as initial functions to calculate the diffuse component of diffraction in a crystal with defects. The diffuse component of diffraction is calculated for a crystal with surface defects of a dilatation-center type. Exact formulas of the continuum theory which take into account the mirror-image forces are used for defect-induced atomic displacements. Scattering intensity maps near Bragg peaksmore » are constructed for different scan modes, and the conditions for detecting primarily the diffuse component are determined. The results of dynamic calculations of grazing-incidence diffraction in defect-containing crystals are compared with calculations in the kinematic approximation.« less

Maximizing Macromolecule Crystal Size for Neutron Diffraction Experiments

NASA Technical Reports Server (NTRS)

Judge, R. A.; Kephart, R.; Leardi, R.; Myles, D. A.; Snell, E. H.; vanderWoerd, M.; Curreri, Peter A. (Technical Monitor)

2002-01-01

A challenge in neutron diffraction experiments is growing large (greater than 1 cu mm) macromolecule crystals. In taking up this challenge we have used statistical experiment design techniques to quickly identify crystallization conditions under which the largest crystals grow. These techniques provide the maximum information for minimal experimental effort, allowing optimal screening of crystallization variables in a simple experimental matrix, using the minimum amount of sample. Analysis of the results quickly tells the investigator what conditions are the most important for the crystallization. These can then be used to maximize the crystallization results in terms of reducing crystal numbers and providing large crystals of suitable habit. We have used these techniques to grow large crystals of Glucose isomerase. Glucose isomerase is an industrial enzyme used extensively in the food industry for the conversion of glucose to fructose. The aim of this study is the elucidation of the enzymatic mechanism at the molecular level. The accurate determination of hydrogen positions, which is critical for this, is a requirement that neutron diffraction is uniquely suited for. Preliminary neutron diffraction experiments with these crystals conducted at the Institute Laue-Langevin (Grenoble, France) reveal diffraction to beyond 2.5 angstrom. Macromolecular crystal growth is a process involving many parameters, and statistical experimental design is naturally suited to this field. These techniques are sample independent and provide an experimental strategy to maximize crystal volume and habit for neutron diffraction studies.

Optical-diffraction method for determining crystal orientation

DOEpatents

Sopori, B.L.

1982-05-07

Disclosed is an optical diffraction technique for characterizing the three-dimensional orientation of a crystal sample. An arbitrary surface of the crystal sample is texture etched so as to generate a pseudo-periodic diffraction grating on the surface. A laser light beam is then directed onto the etched surface, and the reflected light forms a farfield diffraction pattern in reflection. Parameters of the diffraction pattern, such as the geometry and angular dispersion of the diffracted beam are then related to grating shape of the etched surface which is in turn related to crystal orientation. This technique may be used for examining polycrystalline silicon for use in solar cells.

Observation of Threading Dislocations in Ammonothermal Gallium Nitride Single Crystal Using Synchrotron X-ray Topography

NASA Astrophysics Data System (ADS)

Yao, Y.; Ishikawa, Y.; Sugawara, Y.; Takahashi, Y.; Hirano, K.

2018-04-01

Synchrotron monochromatic-beam x-ray topography observation has been performed on high-quality ammonothermal gallium nitride single crystal to evaluate threading dislocations (TD) in a nondestructive manner. Asymmetric diffractions with six equivalent g-vectors of 11-26, in addition to a symmetric diffraction with g = 0008, were applied to determine the Burgers vectors (b) of dislocations. It was found that pure edge-type TDs with \\varvec b = < {11 - 20} > /3 did not exist in the sample. A dominant proportion of TDs were of mixed type with \\varvec b = < {11 - 20} > /3 + < {0001} > , i.e., so-called c + a dislocations. Pure 1c screw dislocations with \\varvec b = < {0001} > and TDs with c-component larger than 1c were also observed.

Characterization of high energy Xe ion irradiation effects in single crystal molybdenum with depth-resolved synchrotron microbeam diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yun, Di; Miao, Yinbin; Xu, Ruqing

2016-04-01

Microbeam X-ray diffraction experiments were conducted at beam line 34-ID of the Advanced Photon Source (APS) on fission fragment energy Xe heavy ion irradiated single crystal Molybdenum (Mo). Lattice strain measurements were obtained with a depth resolution of 0.7 mu m, which is critical in resolving the peculiar heterogeneity of irradiation damage associated with heavy ion irradiation. Q-space diffraction peak shift measurements were correlated with lattice strain induced by the ion irradiations. Transmission electron microscopy (TEM) characterizations were performed on the as-irradiated materials as well. Nanometer sized Xe bubble microstructures were observed via TEM. Molecular Dynamics (MD) simulations were performedmore » to help interpret the lattice strain measurement results from the experiment. This study showed that the irradiation effects by fission fragment energy Xe ion irradiations can be collaboratively understood with the depth resolved X-ray diffraction and TEM measurements under the assistance of MD simulations. (c) 2015 Elsevier B.V. All rights reserved.« less

Flow-aligned, single-shot fiber diffraction using a femtosecond X-ray free-electron laser

DOE PAGES

Popp, David; Loh, N. Duane; Zorgati, Habiba; ...

2017-06-02

A major goal for X-ray free-electron laser (XFEL) based science is to elucidate structures of biological molecules without the need for crystals. Filament systems may provide some of the first single macromolecular structures elucidated by XFEL radiation, since they contain one-dimensional translational symmetry and thereby occupy the diffraction intensity region between the extremes of crystals and single molecules. Here, we demonstrate flow alignment of as few as 100 filaments ( Escherichia coli pili, F-actin, and amyloid fibrils), which when intersected by femtosecond X-ray pulses result in diffraction patterns similar to those obtained from classical fiber diffraction studies. We also determinemore » that F-actin can be flow-aligned to a disorientation of approximately 5 degrees. Using this XFEL-based technique, we determine that gelsolin amyloids are comprised of stacked β-strands running perpendicular to the filament axis, and that a range of order from fibrillar to crystalline is discernable for individual α-synuclein amyloids.« less

Flow-aligned, single-shot fiber diffraction using a femtosecond X-ray free-electron laser

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popp, David; Loh, N. Duane; Zorgati, Habiba

A major goal for X-ray free-electron laser (XFEL) based science is to elucidate structures of biological molecules without the need for crystals. Filament systems may provide some of the first single macromolecular structures elucidated by XFEL radiation, since they contain one-dimensional translational symmetry and thereby occupy the diffraction intensity region between the extremes of crystals and single molecules. Here, we demonstrate flow alignment of as few as 100 filaments ( Escherichia coli pili, F-actin, and amyloid fibrils), which when intersected by femtosecond X-ray pulses result in diffraction patterns similar to those obtained from classical fiber diffraction studies. We also determinemore » that F-actin can be flow-aligned to a disorientation of approximately 5 degrees. Using this XFEL-based technique, we determine that gelsolin amyloids are comprised of stacked β-strands running perpendicular to the filament axis, and that a range of order from fibrillar to crystalline is discernable for individual α-synuclein amyloids.« less

Monochromatic neutron beam production at Brazilian nuclear research reactors

NASA Astrophysics Data System (ADS)

Stasiulevicius, Roberto; Rodrigues, Claudio; Parente, Carlos B. R.; Voi, Dante L.; Rogers, John D.

2000-12-01

Monochomatic beams of neutrons are obtained form a nuclear reactor polychromatic beam by the diffraction process, suing a single crystal energy selector. In Brazil, two nuclear research reactors, the swimming pool model IEA-R1 and the Argonaut type IEN-R1 have been used to carry out measurements with this technique. Neutron spectra have been measured using crystal spectrometers installed on the main beam lines of each reactor. The performance of conventional- artificial and natural selected crystals has been verified by the multipurpose neutron diffractometers installed at IEA-R1 and simple crystal spectrometer in operator at IEN- R1. A practical figure of merit formula was introduced to evaluate the performance and relative reflectivity of the selected planes of a single crystal. The total of 16 natural crystals were selected for use in the neutron monochromator, including a total of 24 families of planes. Twelve of these natural crystal types and respective best family of planes were measured directly with the multipurpose neutron diffractometers. The neutron spectrometer installed at IEN- R1 was used to confirm test results of the better specimens. The usually conventional-artificial crystal spacing distance range is limited to 3.4 angstrom. The interplane distance range has now been increased to approximately 10 angstrom by use of naturally occurring crystals. The neutron diffraction technique with conventional and natural crystals for energy selection and filtering can be utilized to obtain monochromatic sub and thermal neutrons with energies in the range of 0.001 to 10 eV. The thermal neutron is considered a good tool or probe for general applications in various fields, such as condensed matter, chemistry, biology, industrial applications and others.

Comparative analysis of anti-polyglutamine Fab crystals grown on Earth and in microgravity.

PubMed

Owens, Gwen E; New, Danielle M; Olvera, Alejandra I; Manzella, Julia Ashlyn; Macon, Brittney L; Dunn, Joshua C; Cooper, David A; Rouleau, Robyn L; Connor, Daniel S; Bjorkman, Pamela J

2016-10-01

Huntington's disease is one of nine neurodegenerative diseases caused by a polyglutamine (polyQ)-repeat expansion. An anti-polyQ antigen-binding fragment, MW1 Fab, was crystallized both on Earth and on the International Space Station, a microgravity environment where convection is limited. Once the crystals returned to Earth, the number, size and morphology of all crystals were recorded, and X-ray data were collected from representative crystals. The results generally agreed with previous microgravity crystallization studies. On average, microgravity-grown crystals were 20% larger than control crystals grown on Earth, and microgravity-grown crystals had a slightly improved mosaicity (decreased by 0.03°) and diffraction resolution (decreased by 0.2 Å) compared with control crystals grown on Earth. However, the highest resolution and lowest mosaicity crystals were formed on Earth, and the highest-quality crystal overall was formed on Earth after return from microgravity.

Comparative analysis of anti-polyglutamine Fab crystals grown on Earth and in microgravity

PubMed Central

Owens, Gwen E.; New, Danielle M.; Olvera, Alejandra I.; Manzella, Julia Ashlyn; Macon, Brittney L.; Dunn, Joshua C.; Cooper, David A.; Rouleau, Robyn L.; Connor, Daniel S.; Bjorkman, Pamela J.

2016-01-01

Huntington’s disease is one of nine neurodegenerative diseases caused by a polyglutamine (polyQ)-repeat expansion. An anti-polyQ antigen-binding fragment, MW1 Fab, was crystallized both on Earth and on the International Space Station, a microgravity environment where convection is limited. Once the crystals returned to Earth, the number, size and morphology of all crystals were recorded, and X-ray data were collected from representative crystals. The results generally agreed with previous microgravity crystallization studies. On average, microgravity-grown crystals were 20% larger than control crystals grown on Earth, and microgravity-grown crystals had a slightly improved mosaicity (decreased by 0.03°) and diffraction resolution (decreased by 0.2 Å) compared with control crystals grown on Earth. However, the highest resolution and lowest mosaicity crystals were formed on Earth, and the highest-quality crystal overall was formed on Earth after return from microgravity. PMID:27710941

Effect of annealing temperature on the stress and structural properties of Ge core fibre

NASA Astrophysics Data System (ADS)

Zhao, Ziwen; Cheng, Xueli; Xue, Fei; He, Ting; Wang, Tingyun

2017-09-01

Effect of annealing temperature on the stress and structural properties of a Ge core fibre via the molten core drawing (MCD) method is investigated using Raman spectroscopy, Scanning electronic microscopy (SEM), and X-ray diffraction. The experimental results showed that the Raman peak position of the Ge fibre shifted from 297.6 cm-1 to 300.5 cm-1, and the FWHM value decreased from 4.53 cm-1 to 4.31 cm-1, when the annealing is carried out at 700 °C, 800 °C, and 900 °C, respectively. For the Ge core annealed at 900 °C, an apparent crystal grain can be seen in the SEM image, and the diffraction peaks of the (3 3 1) plane are generated in the X-ray diffraction spectra. These results show that optimising the annealing temperature allows the release of the residual stress in the Ge core. When the Ge core fibre is annealed at 900 °C, it exhibits the lowest residual stress and the highest crystal quality, and the quality improvement relative to that of the sample annealed at 800 °C is significant. Hence, annealing at around 900 °C can greatly improve the quality of a Ge core fibre. Further performance improvement of the Ge core fibre by annealing techniques can be anticipated.

Crystal growth and magnetic properties of equiatomic CeAl

NASA Astrophysics Data System (ADS)

Das, Pranab Kumar; Thamizhavel, A.

2015-03-01

Single crystal of CeAl has been grown by flux method using Ce-Al self-flux. Several needle like single crystals were obtained and the length of the needle corresponds to the [001] crystallographic direction. Powder x-ray diffraction revealed that CeAl crystallizes in orthorhombic CrB-type structure with space group Cmcm (no. 63). The magnetic properties have been investigated by means of magnetic susceptibility, isothermal magnetization, electrical transport, and heat capacity measurements. CeAl is found to order antiferromagnetically with a Neel temperature TN = 10 K. The magnetization data below the ordering temperature reveals two metamagentic transitions for fields less than 20 kOe. From the inverse magnetic susceptibility an effective moment of 2.66 μB/Ce has been estimated, which indicates that Ce is in its trivalent state. Electrical resistivity data clearly shows a sharp drop at 10 K due to the reduction of spin disorder scattering of conduction electrons thus confirming the magnetic ordering. The estimated residual resistivity ratio (RRR) is 33, thus indicating a good quality of the single crystal. The bulk nature of the magnetic ordering is also confirmed by heat capacity data. From the Schottky anomaly of the heat capacity we have estimated the crystal field level splitting energies of the (2J + 1) degenerate ground state as 25 K and 175 K respectively for the fist and second excited states.

New structure type in the mixed-valent compound YbCu4Ga8.

PubMed

Subbarao, Udumula; Gutmann, Matthias J; Peter, Sebastian C

2013-02-18

The new compound YbCu(4)Ga(8) was obtained as large single crystals in high yield from reactions run in liquid gallium. Preliminary investigations suggest that YbCu(4)Ga(8) crystallizes in the CeMn(4)Al(8) structure type, tetragonal space group I4/mmm, and lattice constants are a = b = 8.6529(4) Å and c = 5.3976(11) Å. However, a detailed single-crystal XRD revealed a tripling of the c axis and crystallizing in a new structure type with lattice constants of a = b = 8.6529(4) Å and c = 15.465(1) Å. The structural model was further confirmed by neutron diffraction measurements on high-quality single crystal. The crystal structure of YbCu(4)Ga(8) is composed of pseudo-Frank-Kasper cages occupying one ytterbium atom in each ring which are shared through the corner along the ab plane, resulting in a three-dimensional network. The magnetic susceptibility of YbCu(4)Ga(8) investigated in the temperature range 2-300 K showed Curie-Weiss law behavior above 100 K, and the experimentally measured magnetic moment indicates mixed-valent ytterbium. Electrical resistivity measurements show the metallic nature of the compound. At low temperatures, variation of ρ as a function of T indicates a possible Fermi-liquid state at low temperatures.

Crystal growth of carbonate apatite using a CaCO3 flux.

PubMed

Suetsugu, Y; Tanaka, J

1999-09-01

Single crystals of carbonate apatite were grown using a CaCO3 flux under an Ar gas pressure of 55 MPa. The crystals obtained were observed by scanning electron microscopy, optical microscopy and X-ray diffraction. Electron probe microanalyses and thermal analyses were performed. CO3 ions in planar triangle form replaced both OH sites and PO4 tetrahedral sites in the apatite structure: in particular, the OH sites were perfectly substituted by CO3 ions using this method.

Piezo-optic, photoelastic, and acousto-optic properties of SrB4O7 crystals.

PubMed

Mytsyk, Bohdan; Demyanyshyn, Natalia; Martynyuk-Lototska, Irina; Vlokh, Rostyslav

2011-07-20

On the basis of studies of the piezo-optic effect, it has been shown that SrB(4)O(7) crystals can be used as efficient acousto-optic materials in the vacuum ultraviolet spectral range. The full matrices of piezo-optic and photoelastic coefficients have been experimentally obtained for these crystals. The acousto-optic figure of merit and the diffraction efficiency have been estimated for both the visible and deep ultraviolet spectral ranges. © 2011 Optical Society of America

New Mechanism for Toughening Ceramic Materials

DTIC Science & Technology

1994-02-01

Ferroelastic toughening, twinning, domain switching 1 17. 340.TY Q .Al MD0 .I SOWL&Nrv CLO.ASS1RC M SIS . W CASSWCAMlS 9: j"hTAfCm Of AMTLACT OF AD...crystal (Cubefaces orthogonal to (IM()) on the basis of the pseudocubic si mmetry X-ray diffraction traces using CuKa radiation were obtained show ing...Metastable Te- observed on ground or fracture surfaces of single crystals an- tragonal Zirconia Crystals." J. MAter Si . 18. 2619-28 (1983) ’T. C. Yuan

Optical devices combining an organic semiconductor crystal with a two-dimensional inorganic diffraction grating

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kitazawa, Takenori; Yamao, Takeshi, E-mail: yamao@kit.ac.jp; Hotta, Shu

2016-02-01

We have fabricated optical devices using an organic semiconductor crystal as an emission layer in combination with a two-dimensional (2D) inorganic diffraction grating used as an optical cavity. We formed the inorganic diffraction grating by wet etching of aluminum-doped zinc oxide (AZO) under a 2D cyclic olefin copolymer (COC) diffraction grating used as a mask. The COC diffraction grating was fabricated by nanoimprint lithography. The AZO diffraction grating was composed of convex prominences arranged in a triangular lattice. The organic crystal placed on the AZO diffraction grating indicated narrowed peaks in its emission spectrum under ultraviolet light excitation. These aremore » detected parallel to the crystal plane. The peaks were shifted by rotating the optical devices around the normal to the crystal plane, which reflected the rotational symmetries of the triangular lattice through 60°.« less

[Crystal structure of SMU.2055 protein from Streptococcus mutans and its small molecule inhibitors design and selection].

PubMed

Xiaodan, Chen; Xiurong, Zhan; Xinyu, Wu; Chunyan, Zhao; Wanghong, Zhao

2015-04-01

The aim of this study is to analyze the three-dimensional crystal structure of SMU.2055 protein, a putative acetyltransferase from the major caries pathogen Streptococcus mutans (S. mutans). The design and selection of the structure-based small molecule inhibitors are also studied. The three-dimensional crystal structure of SMU.2055 protein was obtained by structural genomics research methods of gene cloning and expression, protein purification with Ni²⁺-chelating affinity chromatography, crystal screening, and X-ray diffraction data collection. An inhibitor virtual model matching with its target protein structure was set up using computer-aided drug design methods, virtual screening and fine docking, and Libdock and Autodock procedures. The crystal of SMU.2055 protein was obtained, and its three-dimensional crystal structure was analyzed. This crystal was diffracted to a resolution of 0.23 nm. It belongs to orthorhombic space group C222(1), with unit cell parameters of a = 9.20 nm, b = 9.46 nm, and c = 19.39 nm. The asymmetric unit contained four molecules, with a solvent content of 56.7%. Moreover, five small molecule compounds, whose structure matched with that of the target protein in high degree, were designed and selected. Protein crystallography research of S. mutans SMU.2055 helps to understand the structures and functions of proteins from S. mutans at the atomic level. These five compounds may be considered as effective inhibitors to SMU.2055. The virtual model of small molecule inhibitors we built will lay a foundation to the anticaries research based on the crystal structure of proteins.

Iron single crystal growth from a lithium-rich melt

NASA Astrophysics Data System (ADS)

Fix, M.; Schumann, H.; Jantz, S. G.; Breitner, F. A.; Leineweber, A.; Jesche, A.

2018-03-01

α -Fe single crystals of rhombic dodecahedral habit were grown from a Li84N12Fe∼3 melt. Crystals of several millimeter along a side form at temperatures around T ≈ 800 ° C. Upon further cooling the growth competes with the formation of Fe-doped Li3N. The b.c.c. structure and good sample quality of α -Fe single crystals were confirmed by X-ray and electron diffraction as well as magnetization measurements and chemical analysis. A nitrogen concentration of 90 ppm was detected by means of carrier gas hot extraction. Scanning electron microscopy did not reveal any sign of iron nitride precipitates.

Multi-crystal native SAD analysis at 6 keV.

PubMed

Liu, Qun; Guo, Youzhong; Chang, Yanqi; Cai, Zheng; Assur, Zahra; Mancia, Filippo; Greene, Mark I; Hendrickson, Wayne A

2014-10-01

Anomalous diffraction signals from typical native macromolecules are very weak, frustrating their use in de novo structure determination. Here, native SAD procedures are described to enhance signal to noise in anomalous diffraction by using multiple crystals in combination with synchrotron X-rays at 6 keV. Increased anomalous signals were obtained at 6 keV compared with 7 keV X-ray energy, which was used for previous native SAD analyses. A feasibility test of multi-crystal-based native SAD phasing was performed at 3.2 Å resolution for a known tyrosine protein kinase domain, and real-life applications were made to two novel membrane proteins at about 3.0 Å resolution. The three applications collectively serve to validate the robust feasibility of native SAD phasing at lower energy.

Application of X-ray topography to USSR and Russian space materials science

PubMed Central

Shul’pina, I. L.; Prokhorov, I. A.; Serebryakov, Yu. A.; Bezbakh, I. Zh.

2016-01-01

The authors’ experience of the application of X-ray diffraction imaging in carrying out space technological experiments on semiconductor crystal growth for the former USSR and for Russia is reported, from the Apollo–Soyuz programme (1975) up to the present day. X-ray topography was applied to examine defects in crystals in order to obtain information on the crystallization conditions and also on their changes under the influence of factors of orbital flight in space vehicles. The data obtained have promoted a deeper understanding of the conditions and mechanisms of crystallization under both microgravity and terrestrial conditions, and have enabled the elaboration of terrestrial methods of highly perfect crystal growth. The use of X-ray topography in space materials science has enriched its methods in the field of digital image processing of growth striations and expanded its possibilities in investigating the inhomogeneity of crystals. PMID:27158506

Application of X-ray topography to USSR and Russian space materials science.

PubMed

Shul'pina, I L; Prokhorov, I A; Serebryakov, Yu A; Bezbakh, I Zh

2016-05-01

The authors' experience of the application of X-ray diffraction imaging in carrying out space technological experiments on semiconductor crystal growth for the former USSR and for Russia is reported, from the Apollo-Soyuz programme (1975) up to the present day. X-ray topography was applied to examine defects in crystals in order to obtain information on the crystallization conditions and also on their changes under the influence of factors of orbital flight in space vehicles. The data obtained have promoted a deeper understanding of the conditions and mechanisms of crystallization under both microgravity and terrestrial conditions, and have enabled the elaboration of terrestrial methods of highly perfect crystal growth. The use of X-ray topography in space materials science has enriched its methods in the field of digital image processing of growth striations and expanded its possibilities in investigating the inhomogeneity of crystals.

Crystalline Colloidal Arrays in Polymer Matrices

NASA Technical Reports Server (NTRS)

Sunkara, Hari B.; Penn, B. G.; Frazier, D. O.; Ramachandran, N.

1997-01-01

Crystalline Colloidal Arrays (CCA, also known as colloidal crystals), composed of aqueous or nonaqueous dispersions of self-assembled nanosized polymer colloidal spheres, are emerging toward the development of advanced optical devices for technological applications. The spontaneous self assembly of polymer spheres in a dielectric medium results from the electrostatic repulsive interaction between particles of uniform size and charge distribution. In a way similar to atomic crystals that diffract X-rays, CCA dispersions in thin quartz cells selectively and efficiently Bragg diffract the incident visible light. The reason for this diffraction is because the lattice (body or face centered cubic) spacing is on the order of the wavelength of visible light. Unlike the atomic crystals that diffract a fixed wavelength, colloidal crystals in principle, depending on the particle size, particle number and charge density, can diffract W, Vis or IR light. Therefore, the CCA dispersions can be used as laser filters. Besides, the diffraction intensity depends on the refractive index mismatch between polymer spheres and dielectric medium; therefore, it is possible to modulate incident light intensities by manipulating the index of either the spheres or the medium. Our interest in CCA is in the fabrication of all-optical devices such as optical switches, limiters, and spatial light modulators for optical signal processing. The two major requirements from a materials standpoint are the incorporation of suitable nonlinear optical materials (NLO) into polymer spheres which will allow us to alter the refractive index of the spheres by intense laser radiation, and preparation of solid CCA filters which can resist laser damage. The fabrication of solid composite filters not only has the advantage that the films are easier to handle, but also the arrays in solid films are more robust than in liquid media. In this paper, we report the photopolymerization process used to trap CCA in polymer matrices, the factors which affect the optical diffraction qualities of resulting polymer films, and methods to improve the efficiencies of solid optical filters. Before this, we also present the experimental demonstration, of controlling the optical diffraction intensities from aqueous CCA dispersions by varying the temperature, which establishes the feasibility of fabricating all-optical switching devices with nonlinear periodic array structures.

Growth and physicochemical properties of organometallic (DL)-trithioureatartrato-O1,O2,O3-cadmium(II) single crystals

NASA Astrophysics Data System (ADS)

Sathyamoorthy, K.; Vinothkumar, P.; Irshad Ahamed, J.; Murali Manohar, P.; Priya, M.; Liu, Jinghe

2018-04-01

Single crystals of organometallic (DL)-trithioureatartrato-O1,O2,O3-cadmium(II) (TUDLC) have been grown from methanol solution by using the slow evaporation of solvent growth technique. The lattice structure and crystalline perfection have been determined by carrying out single crystal X-ray diffraction and high resolution X-ray diffraction measurements. The grown crystal was characterized thermally and mechanically by carrying out thermo-gravimetric and micro hardness measurements. The linear and nonlinear optical characterizations were made by carrying out optical transmittance, surface laser damage threshold, particle size-dependent second harmonic generation (SHG) efficiency and photo conductivity measurements. The grown crystal was electrically characterized by carrying out frequency-dependent dielectric measurements. Chemical etching study was also carried out and the dislocation density was estimated. Results obtained in the present study indicate that the grown TUDLC crystal is optically transparent with lower cut-off wavelength 304 nm, mechanically soft, thermally stable up to 101 °C and NLO active with SHG efficiency 2.13 (in KDP unit). The grown crystal is found to have considerably large size, good crystalline perfection, large specific heat capacity, higher surface laser damage threshold and negative photoconductivity.

Concept for power scaling second harmonic generation using a cascade of nonlinear crystals.

PubMed

Hansen, A K; Tawfieq, M; Jensen, O B; Andersen, P E; Sumpf, B; Erbert, G; Petersen, P M

2015-06-15

Within the field of high-power second harmonic generation (SHG), power scaling is often hindered by adverse crystal effects such as thermal dephasing arising from the second harmonic (SH) light, which imposes limits on the power that can be generated in many crystals. Here we demonstrate a concept for efficient power scaling of single-pass SHG beyond such limits using a cascade of nonlinear crystals, in which the first crystal is chosen for high nonlinear efficiency and the subsequent crystal(s) are chosen for power handling ability. Using this highly efficient single-pass concept, we generate 3.7 W of continuous-wave diffraction-limited (M(2)=1.25) light at 532 nm from 9.5 W of non-diffraction-limited (M(2)=7.7) light from a tapered laser diode, while avoiding significant thermal effects. Besides constituting the highest SH power yet achieved using a laser diode, this demonstrates that the concept successfully combines the high efficiency of the first stage with the good power handling properties of the subsequent stages. The concept is generally applicable and can be expanded with more stages to obtain even higher efficiency, and extends also to other combinations of nonlinear media suitable for other wavelengths.

In situ study of the growth and degradation processes in tetragonal lysozyme crystals on a silicon substrate by high-resolution X-ray diffractometry

NASA Astrophysics Data System (ADS)

Kovalchuk, M. V.; Prosekov, P. A.; Marchenkova, M. A.; Blagov, A. E.; D'yakova, Yu. A.; Tereshchenko, E. Yu.; Pisarevskii, Yu. V.; Kondratev, O. A.

2014-09-01

The results of an in situ study of the growth of tetragonal lysozyme crystals by high-resolution X-ray diffractometry are considered. The crystals are grown by the sitting-drop method on crystalline silicon substrates of different types: both on smooth substrates and substrates with artificial surface-relief structures using graphoepitaxy. The crystals are grown in a special hermetically closed crystallization cell, which enables one to obtain images with an optical microscope and perform in situ X-ray diffraction studies in the course of crystal growth. Measurements for lysozyme crystals were carried out in different stages of the crystallization process, including crystal nucleation and growth, developed crystals, the degradation of the crystal structure, and complete destruction.

Improved expression, purification and crystallization of a putative N-acetyl-γ-glutamyl-phosphate reductase from rice (Oryza sativa)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miura-Ohnuma, Jun; Nonaka, Tsuyoshi; Katoh, Shizue

2005-12-01

Crystals of OsAGPR were obtained using the sitting-drop vapour-diffusion method at 293 K and diffract X-rays to at least 1.8 Å resolution. They belong to the hexagonal space group P6{sub 1}, with unit-cell parameters a = 86.11, c = 316.3 Å. N-Acetyl-γ-glutamyl-phosphate reductase (AGPR) catalyzes the third step in an eight-step arginine-biosynthetic pathway that starts with glutamate. This enzyme converts N-acetyl-γ-glutamyl phosphate to N-acetylglutamate-γ-semialdehyde by an NADPH-dependent reductive dephosphorylation. AGPR from Oryza sativa (OsAGPR) was expressed in Escherichia coli at 291 K as a soluble fusion protein with an upstream thioredoxin-hexahistidine [Trx-(His){sub 6}] extension. OsAGPR(Ala50–Pro366) was purified and crystals weremore » obtained using the sitting-drop vapour-diffusion method at 293 K and diffract X-rays to at least 1.8 Å resolution. They belong to the hexagonal space group P6{sub 1}, with unit-cell parameters a = 86.11, c = 316.3 Å.« less

Growth and characterization of LiInSe2 single crystals

NASA Astrophysics Data System (ADS)

Ma, Tianhui; Zhu, Chongqiang; Lei, Zuotao; Yang, Chunhui; Sun, Liang; Zhang, Hongchen

2015-04-01

Large and crack-free LiInSe2 single crystals were obtained by the vertical gradient freezing method with adding a temperature oscillation technology in a two-zone furnace. X-ray diffraction data showed that the pure LiInSe2 compound was synthesized. The grown crystals had different color depending on melt composition. The atomic ratios of elements of LiInSe2 crystals were obtained by an Inductively Coupled Plasma-Atomic Emission Spectrometry (ICP-AES), and the structural formula were calculated according to the relative contents of elements. The average absorption coefficients were estimated by using average reflection indices. The absorption coefficients of the thermal annealing samples are 0.6 cm-1 at 2-3 μm. The transparent range of our LiInSe2 crystals is from 0.6 μm to 13.5 μm.

Crystallization and X-ray diffraction analysis of an l-arabinonate dehydratase from Rhizobium leguminosarum bv. trifolii and a d-xylonate dehydratase from Caulobacter crescentus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rahman, Mohammad Mubinur; Andberg, Martina; Koivula, Anu

l-Arabinonate dehydratase and d-xylonate dehydratase from the IlvD/EDD family were crystallized by the vapour-diffusion method. Diffraction data sets were collected to resolutions of 2.40 and 2.66 Å from crystals of l-arabinonate dehydratase and d-xylonate dehydratase, respectively. l-Arabinonate dehydratase (EC 4.2.1.25) and d-xylonate dehydratase (EC 4.2.1.82) are two enzymes that are involved in a nonphosphorylative oxidation pathway of pentose sugars. l-Arabinonate dehydratase converts l-arabinonate into 2-dehydro-3-deoxy-l-arabinonate, and d-xylonate dehydratase catalyzes the dehydration of d-xylonate to 2-dehydro-3-deoxy-d-xylonate. l-Arabinonate and d-xylonate dehydratases belong to the IlvD/EDD family, together with 6-phosphogluconate dehydratases and dihydroxyacid dehydratases. No crystal structure of any l-arabinonate or d-xylonate dehydratasemore » is available in the PDB. In this study, recombinant l-arabinonate dehydratase from Rhizobium leguminosarum bv. trifolii (RlArDHT) and d-xylonate dehydratase from Caulobacter crescentus (CcXyDHT) were heterologously expressed in Escherichia coli and purified by the use of affinity chromatography followed by gel-filtration chromatography. The purified proteins were crystallized using the hanging-drop vapour-diffusion method at 293 K. Crystals of RlArDHT that diffracted to 2.40 Å resolution were obtained using sodium formate as a precipitating agent. They belonged to space group P2{sub 1}, with unit-cell parameters a = 106.07, b = 208.61, c = 147.09 Å, β = 90.43°. Eight RlArDHT molecules (two tetramers) in the asymmetric unit give a V{sub M} value of 3.2 Å{sup 3} Da{sup −1} and a solvent content of 62%. Crystals of CcXyDHT that diffracted to 2.66 Å resolution were obtained using sodium formate and polyethylene glycol 3350. They belonged to space group C2, with unit-cell parameters a = 270.42, b = 236.13, c = 65.17 Å, β = 97.38°. Four CcXyDHT molecules (a tetramer) in the asymmetric unit give a V{sub M} value of 4.0 Å{sup 3} Da{sup −1} and a solvent content of 69%.« less

Improved performance of GaN based light emitting diodes with ex-situ sputtered AlN nucleation layers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Shuo-Wei; Epistar Corporation, Hsinchu 300, Taiwan; Li, Heng

The crystal quality, electrical and optical properties of GaN based light emitting diodes (LEDs) with ex-situ sputtered physical vapor deposition (PVD) aluminum nitride (AlN) nucleation layers were investigated. It was found that the crystal quality in terms of defect density and x-ray diffraction linewidth was greatly improved in comparison to LEDs with in-situ low temperature GaN nucleation layer. The light output power was 3.7% increased and the reverse bias voltage of leakage current was twice on LEDs with ex-situ PVD AlN nucleation layers. However, larger compressive strain was discovered in LEDs with ex-situ PVD AlN nucleation layers. The study showsmore » the potential and constrain in applying ex-situ PVD AlN nucleation layers to fabricate high quality GaN crystals in various optoelectronics.« less

Femtosecond mega-electron-volt electron microdiffraction

DOE PAGES

Shen, X.; Li, R. K.; Lundstrom, U.; ...

2017-09-01

To understand and control the basic functions of physical, chemical and biological processes from micron to nano-meter scale, an instrument capable of visualizing transient structural changes of inhomogeneous materials with atomic spatial and temporal resolutions, is required. One such technique is femtosecond electron microdiffraction, in which a short electron pulse with femtosecond-scale duration is focused into a micron-scale spot and used to obtain diffraction images to resolve ultrafast structural dynamics over a localized crystalline domain. In this letter, we report the experimental demonstration of time-resolved mega-electron-volt electron microdiffraction which achieves a 5 μm root-mean-square (rms) beam size on the samplemore » and a 110 fs rms temporal resolution. Using pulses of 10k electrons at 4.2 MeV energy with a normalized emittance 3 nm-rad, we obtained high quality diffraction from a single 10 μm paraffin ( C 44 H 90) crystal. The phonon softening mode in optical-pumped polycrystalline Bi was also time-resolved, demonstrating the temporal resolution limits of the instrument. In conclusion, this new characterization capability will open many research opportunities in material and biological sciences.« less

Femtosecond mega-electron-volt electron microdiffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shen, X.; Li, R. K.; Lundstrom, U.

To understand and control the basic functions of physical, chemical and biological processes from micron to nano-meter scale, an instrument capable of visualizing transient structural changes of inhomogeneous materials with atomic spatial and temporal resolutions, is required. One such technique is femtosecond electron microdiffraction, in which a short electron pulse with femtosecond-scale duration is focused into a micron-scale spot and used to obtain diffraction images to resolve ultrafast structural dynamics over a localized crystalline domain. In this letter, we report the experimental demonstration of time-resolved mega-electron-volt electron microdiffraction which achieves a 5 μm root-mean-square (rms) beam size on the samplemore » and a 110 fs rms temporal resolution. Using pulses of 10k electrons at 4.2 MeV energy with a normalized emittance 3 nm-rad, we obtained high quality diffraction from a single 10 μm paraffin ( C 44 H 90) crystal. The phonon softening mode in optical-pumped polycrystalline Bi was also time-resolved, demonstrating the temporal resolution limits of the instrument. In conclusion, this new characterization capability will open many research opportunities in material and biological sciences.« less

Three-dimensional imaging of nanoscale materials by using coherent x-rays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miao, Jianwei

X-ray crystallography is currently the primary methodology used to determine the 3D structure of materials and macromolecules. However, many nanostructures, disordered materials, biomaterials, hybrid materials and biological specimens are noncrystalline and, hence, their structures are not accessible by X-ray crystallography. Probing these structures therefore requires the employment of different approaches. A very promising technique currently under rapid development is X-ray diffraction microscopy (or lensless imaging), in which the coherent X-ray diffraction pattern of a noncrystalline specimen is measured and then directly phased to obtain a high-resolution image. Through the DOE support over the past three years, we have applied X-raymore » diffraction microscopy to quantitative imaging of GaN quantum dot particles, and revealed the internal GaN-Ga2O3 core shell structure in three dimensions. By exploiting the abrupt change in the scattering cross-section near electronic resonances, we carried out the first experimental demonstration of resonant X-ray diffraction microscopy for element specific imaging. We performed nondestructive and quantitative imaging of buried Bi structures inside a Si crystal by directly phasing coherent X-ray diffraction patterns acquired below and above the Bi M5 edge. We have also applied X-ray diffraction microscopy to nondestructive imaging of mineral crystals inside biological composite materials - intramuscular fish bone - at the nanometer scale resolution. We identified mineral crystals in collagen fibrils at different stages of mineralization and proposed a dynamic mechanism to account for the nucleation and growth of mineral crystals in the collagen matrix. In addition, we have also discovered a novel 3D imaging modality, denoted ankylography, which allows for complete 3D structure determination without the necessity of sample titling or scanning. We showed that when the diffraction pattern of a finite object is sampled at a sufficiently fine scale on the Ewald sphere, the 3D structure of the object is determined by the 2D spherical pattern. We confirmed the theoretical analysis by performing 3D numerical reconstructions of a sodium silicate glass structure at 2 A resolution from a 2D spherical diffraction pattern alone. As X-ray free electron lasers are under rapid development worldwide, ankylography may open up a new horizon to obtain the 3D structure of a non-crystalline specimen from a single pulse and allow time-resolved 3D structure determination of disordered materials.« less

Vladimir V. Lunin | NREL

Science.gov Websites

Protein crystallization X-ray diffraction data collection Protein structure determination Obtaining structures of protein-ligand complexes Site-directed mutagenesis Structure-function relationship Enzymatic CelA," Science (2013) "Sequence, Structure, and Evolution of Cellulases in Glycoside

A fast point-cloud computing method based on spatial symmetry of Fresnel field

NASA Astrophysics Data System (ADS)

Wang, Xiangxiang; Zhang, Kai; Shen, Chuan; Zhu, Wenliang; Wei, Sui

2017-10-01

Aiming at the great challenge for Computer Generated Hologram (CGH) duo to the production of high spatial-bandwidth product (SBP) is required in the real-time holographic video display systems. The paper is based on point-cloud method and it takes advantage of the propagating reversibility of Fresnel diffraction in the propagating direction and the fringe pattern of a point source, known as Gabor zone plate has spatial symmetry, so it can be used as a basis for fast calculation of diffraction field in CGH. A fast Fresnel CGH method based on the novel look-up table (N-LUT) method is proposed, the principle fringe patterns (PFPs) at the virtual plane is pre-calculated by the acceleration algorithm and be stored. Secondly, the Fresnel diffraction fringe pattern at dummy plane can be obtained. Finally, the Fresnel propagation from dummy plan to hologram plane. The simulation experiments and optical experiments based on Liquid Crystal On Silicon (LCOS) is setup to demonstrate the validity of the proposed method under the premise of ensuring the quality of 3D reconstruction the method proposed in the paper can be applied to shorten the computational time and improve computational efficiency.

Comparison of silver and molybdenum microfocus X-ray sources for single-crystal structure determination.

PubMed

Krause, Lennard; Herbst-Irmer, Regine; Sheldrick, George M; Stalke, Dietmar

2015-02-01

The quality of diffraction data obtained using silver and molybdenum microsources has been compared for six model compounds with a wide range of absorption factors. The experiments were performed on two 30 W air-cooled Incoatec IµS microfocus sources with multilayer optics mounted on a Bruker D8 goniometer with a SMART APEX II CCD detector. All data were analysed, processed and refined using standard Bruker software. The results show that Ag  K α radiation can be beneficial when heavy elements are involved. A numerical absorption correction based on the positions and indices of the crystal faces is shown to be of limited use for the highly focused microsource beams, presumably because the assumption that the crystal is completely bathed in a (top-hat profile) beam of uniform intensity is no longer valid. Fortunately the empirical corrections implemented in SADABS , although originally intended as a correction for absorption, also correct rather well for the variations in the effective volume of the crystal irradiated. In three of the cases studied (two Ag and one Mo) the final SHELXL R 1 against all data after application of empirical corrections implemented in SADABS was below 1%. Since such corrections are designed to optimize the agreement of the intensities of equivalent reflections with different paths through the crystal but the same Bragg 2θ angles, a further correction is required for the 2θ dependence of the absorption. For this, SADABS uses the transmission factor of a spherical crystal with a user-defined value of μ r (where μ is the linear absorption coefficient and r is the effective radius of the crystal); the best results are obtained when r is biased towards the smallest crystal dimension. The results presented here suggest that the IUCr publication requirement that a numerical absorption correction must be applied for strongly absorbing crystals is in need of revision.

Prediction and theoretical characterization of p-type organic semiconductor crystals for field-effect transistor applications.

PubMed

Atahan-Evrenk, Sule; Aspuru-Guzik, Alán

2014-01-01

The theoretical prediction and characterization of the solid-state structure of organic semiconductors has tremendous potential for the discovery of new high performance materials. To date, the theoretical analysis mostly relied on the availability of crystal structures obtained through X-ray diffraction. However, the theoretical prediction of the crystal structures of organic semiconductor molecules remains a challenge. This review highlights some of the recent advances in the determination of structure-property relationships of the known organic semiconductor single-crystals and summarizes a few available studies on the prediction of the crystal structures of p-type organic semiconductors for transistor applications.

Expression, crystallization and preliminary X-ray diffraction studies of recombinant Clostridium perfringens β2-toxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gurjar, Abhijit A.; Yennawar, Neela H.; Yennawar, Hemant P.

2007-06-01

The cloning, expression, purification and crystallization of recombinant Clostridium perfringens β2-toxin is described. The crystals diffracted to 2.9 Å resolution. Clostridium perfringens is a Gram-positive sporulating anaerobic bacterium that is responsible for a wide spectrum of diseases in animals, birds and humans. The virulence of C. perfringens is associated with the production of several enterotoxins and exotoxins. β2-toxin is a 28 kDa exotoxin produced by C. perfringens. It is implicated in necrotic enteritis in animals and humans, a disease characterized by a sudden acute onset with lethal hemorrhagic mucosal ulceration. The recombinant expression, purification and crystallization of β2-toxin using themore » batch-under-oil technique are reported here. Native X-ray diffraction data were obtained to 2.9 Å resolution on a synchrotron beamline at the F2 station at Cornell High Energy Synchrotron Source (CHESS) using an ADSC Quantum-210 CCD detector. The crystals belong to space group R3, with a dimer in the asymmetric unit; the unit-cell parameters are a = b = 103.71, c = 193.48 Å, α = β = 90, γ = 120° using the hexagonal axis setting. A self-rotation function shows that the two molecules are related by a noncrystallographic twofold axis with polar angles ω = 90.0, ϕ = 210.3°.« less

Crucibleless crystal growth and Radioluminescence study of calcium tungstate single crystal fiber

NASA Astrophysics Data System (ADS)

Silva, M. S.; Jesus, L. M.; Barbosa, L. B.; Ardila, D. R.; Andreeta, J. P.; Silva, R. S.

2014-11-01

In this article, single phase and high optical quality scheelite calcium tungstate single crystal fibers were grown by using the crucibleless laser heated pedestal growth technique. The as-synthesized calcium tungstate powders used for shaping seed and feed rods were investigated by X-ray diffraction technique. As-grown crystals were studied by Raman spectroscopy and Radioluminescence measurements. The results indicate that in both two cases, calcined powder and single crystal fiber, only the expected scheelite CaWO4 phase was observed. It was verified large homogeneity in the crystal composition, without the presence of secondary phases. The Radioluminescence spectra of the as-grown single crystal fibers are in agreement with that present in Literature for bulk single crystals, presented a single emission band centered at 420 nm when irradiated with β-rays.

Purification, crystallization and preliminary X-ray analysis of the glucosamine-6-phosphate N-acetyltransferase from human liver

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Juan; Zhou, Yan-Feng; Li, Lan-Fen

2006-11-01

Glucosamine-6-phosphate N-acetyltransferase from human liver was expressed, purified and crystallized. Diffraction data have been collected to 2.6 Å resolution. Glucosamine-6-phosphate N-acetyltransferase from human liver, which catalyzes the transfer of an acetyl group from acetyl coenzyme A (AcCoA) to the primary amine of d-glucosamine 6-phosphate to form N-acetyl-d-glucosamine 6-phosphate, was expressed in a soluble form from Escherichia coli strain BL21 (DE3). The protein was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.6 Å resolution. The crystals belonged to space group P4{sub 1}2{sub 1}2more » or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 50.08, c = 142.88 Å.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ricagno, Stéfano; Coutard, Bruno; Grisel, Sacha

Crystals of Nsp15 from the aetiological agent of SARS have been grown at room temperature. Crystals have cubic symmetry and diffract to a maximum resolution of 2.7 Å. The non-structural protein Nsp15 from the aetiological agent of SARS (severe acute respiratory syndrome) has recently been characterized as a uridine-specific endoribonuclease. This enzyme plays an essential role in viral replication and transcription since a mutation in the related H229E human coronavirus nsp15 gene can abolish viral RNA synthesis. SARS full-length Nsp15 (346 amino acids) has been cloned and expressed in Escherichia coli with an N-terminal hexahistidine tag and has been purifiedmore » to homogeneity. The protein was subsequently crystallized using PEG 8000 or 10 000 as precipitants. Small cubic crystals of the apoenzyme were obtained from 100 nl nanodrops. They belong to space group P4{sub 1}32 or P4{sub 3}32, with unit-cell parameters a = b = c = 166.8 Å. Diffraction data were collected to a maximum resolution of 2.7 Å.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marçal, D.; Rego, A. T.; Fogg, M. J.

1,3-Propanediol dehydrogenase from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.7 Å resolution. 1,3-Propanediol dehydrogenase (1,3-PD-DH), encoded by the dhaT gene, is a key enzyme in the dissimilation process for converting glycerol to 1,3-propanediol in the human pathogen Klebsiella pneumoniae. Single colourless crystals were obtained from a recombinant preparation of 1,3-propanediol dehydrogenase overexpressed in Escherichia coli. The crystals belong to space group P2{sub 1}, with unit-cell parameters a = 91.9, b = 226.6, c = 232.6 Å, β = 92.9°. The crystals probably contain two decamers in the asymmetric unit,more » with a V{sub M} value of 3.07 Å{sup 3} Da{sup −1} and an estimated solvent content of 59%. Diffraction data were collected to 2.7 Å resolution using synchrotron radiation at the ID14-4 beamline of the European Synchrotron Radiation Facility.« less

Structural studies of homoisoflavonoids: NMR spectroscopy, X-ray diffraction, and theoretical calculations

NASA Astrophysics Data System (ADS)

Sievänen, Elina; Toušek, Jaromír; Lunerová, Kamila; Marek, Jaromír; Jankovská, Dagmar; Dvorská, Margita; Marek, Radek

2010-08-01

In this article we present a detailed structural investigation for five homoisoflavonoids, molecules important from the pharmacological point of view. For studying the electron distribution as well as its influence on the physicochemical properties, NMR spectroscopy, X-ray diffraction, and theoretical calculations have been used. Nuclear magnetic shieldings obtained by using DFT calculations for optimized molecular geometries are correlated with the experimentally determined chemical shifts. The theoretical data are well in agreement with the experimental values. The single crystal X-ray structures of homoisoflavonoid derivatives 1, 3, and 4 have been solved. The molecular geometries and crystal packing determined by X-ray diffraction are used for characterizing the intermolecular interactions. Electron distribution is crucial for the stability of radicals and hence the antioxidant efficiency of flavonoid structures. The hydrogen bonding governs the formation of complexes of homoisoflavonoids with biological targets.

Chemical characterization of 4140 steel implanted by nitrogen ions

NASA Astrophysics Data System (ADS)

Niño, E. D. V.; Pinto, J. L.; Dugar-Zhabon, V.; Henao, J. A.

2012-06-01

AISI SAE 4140 steel samples of different surface roughness which are implanted with 20 keV and 30 keV nitrogen ions at a dose of 1017 ions/cm2 are studied. The crystal phases of nitrogen compositions of the implanted samples, obtained with help of an x-ray diffraction method, are confronted with the data reported by the International Centre for Diffraction Data (ICDD) PDF-2. The implantation treatment is realized in high-voltage pulsed discharges at low pressures. The crystal structure of the implanted solid surfaces is analyzed by the x-ray diffraction technique which permits to identify the possible newly formed compounds and to identify any change in the surface structure of the treated samples. A decrease in the intensity of the plane (110), a reduction of the cell unity in values of 2-theta and a diminishing of the crystallite dimensions in comparison with non-implanted samples are observed.

Homoepitaxial growth of β-Ga{sub 2}O{sub 3} thin films by low pressure chemical vapor deposition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rafique, Subrina; Han, Lu; Zhao, Hongping, E-mail: hongping.zhao@case.edu

2016-05-02

This paper presents the homoepitaxial growth of phase pure (010) β-Ga{sub 2}O{sub 3} thin films on (010) β-Ga{sub 2}O{sub 3} substrate by low pressure chemical vapor deposition. The effects of growth temperature on the surface morphology and crystal quality of the thin films were systematically investigated. The thin films were synthesized using high purity metallic gallium (Ga) and oxygen (O{sub 2}) as precursors for gallium and oxygen, respectively. The surface morphology and structural properties of the thin films were characterized by atomic force microscopy, X-ray diffraction, and high resolution transmission electron microscopy. Material characterization indicates the growth temperature played anmore » important role in controlling both surface morphology and crystal quality of the β-Ga{sub 2}O{sub 3} thin films. The smallest root-mean-square surface roughness of ∼7 nm was for thin films grown at a temperature of 950 °C, whereas the highest growth rate (∼1.3 μm/h) with a fixed oxygen flow rate was obtained for the epitaxial layers grown at 850 °C.« less

Epitaxial growth and characterization of CuGa2O4 films by laser molecular beam epitaxy

NASA Astrophysics Data System (ADS)

Wei, Hongling; Chen, Zhengwei; Wu, Zhenping; Cui, Wei; Huang, Yuanqi; Tang, Weihua

2017-11-01

Ga2O3 with a wide bandgap of ˜ 4.9 eV can crystalize in five crystalline phases. Among those phases, the most stable monoclinic β-Ga2O3 has been studied most, however, it is hard to find materials lattice matching with β-Ga2O3 to grown epitaxial thin films for optoelectronic applications. In this work, CuGa2O4 bulk were prepared by solid state reaction as target, and the films were deposited on sapphire substrates by laser molecular beam epitaxy (L-MBE) at different substrate temperatures. The influences of substrate temperature on structural and optical properties have been systematically investigated by means of X-ray diffraction, Transmission electron microscope and UV-vis absorption spectra. High quality cubic structure and [111] oriented CuGa2O4 film can be obtained at substrate temperature of 750 °C. It's also demonstrated that the CuGa2O4 film has a bandgap of ˜ 4.4 eV and a best crystal quality at 750 °C, suggesting that CuGa2O4 film is a promising candidate for applications in ultraviolet optoelectronic devices.

Crystallization and preliminary X-ray crystallographic analysis of strictosidine synthase from Rauvolfia: the first member of a novel enzyme family.

PubMed

Ma, Xueyan; Koepke, Juergen; Fritzsch, Günter; Diem, Ralf; Kutchan, Toni M; Michel, Hartmut; Stöckigt, Joachim

2004-10-01

Strictosidine synthase is a central enzyme involved in the biosynthesis of almost all plant monoterpenoid indole alkaloids. Strictosidine synthase from Rauvolfia serpentina was heterologously expressed in Escherichia coli. Crystals of the purified recombinant enzyme have been obtained by the hanging-drop technique at 303 K with potassium sodium tartrate tetrahydrate as precipitant. The crystals belong to the space group R3 with cell dimensions of a=b=150.3 A and c=122.4 A. Under cryoconditions (120 K), the crystals diffract to about 2.95 A.

Rhombohedral crystals of 2-dehydro-3-deoxygalactarate aldolase from Escherichia coli.

PubMed

Blackwell, N C; Cullis, P M; Cooper, R A; Izard, T

1999-07-01

2-Dehydro-3-deoxygalactarate (DDG) aldolase (E.C. 4.1.2.20) catalyzes the reversible aldol cleavage of DDG and 2-dehydro-3-deoxyglucarate to pyruvate and tartronic semialdehyde. Rhombohedral crystals of recombinant DDG aldolase from Escherichia coli K-12 were obtained. The crystals belong to space group R32 with unit-cell parameters a = 93 A, alpha = 85 degrees. The crystals diffract to beyond 1.8 A resolution on a Cu Kalpha rotating-anode generator. The asymmetric unit is likely to contain two molecules, corresponding to a packing density of 1.34 A3 Da-1.

Fast ultrasonic wavelength tuning in X-ray experiment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blagov, A. E., E-mail: blagov-ae@mail.ru; Pisarevskii, Yu. V.; Koval’chuk, M. V.

2016-03-15

A method of tuning (scanning) X-ray beam wavelength based on modulation of the lattice parameter of X-ray optical crystal by an ultrasonic standing wave excited in it has been proposed and experimentally implemented. The double-crystal antiparallel scheme of X-ray diffraction, in which an ultrasonic wave is excited in the second crystal, is used in the experiment. The profile of characteristic line k{sub α1} of an X-ray tube with a molybdenum anode is recorded using both the proposed tuning scheme and conventional mechanical rotation of crystal. The results obtained by both techniques are in good agreement.

Ultrasonic acoustic levitation for fast frame rate X-ray protein crystallography at room temperature.

PubMed

Tsujino, Soichiro; Tomizaki, Takashi

2016-05-06

Increasing the data acquisition rate of X-ray diffraction images for macromolecular crystals at room temperature at synchrotrons has the potential to significantly accelerate both structural analysis of biomolecules and structure-based drug developments. Using lysozyme model crystals, we demonstrated the rapid acquisition of X-ray diffraction datasets by combining a high frame rate pixel array detector with ultrasonic acoustic levitation of protein crystals in liquid droplets. The rapid spinning of the crystal within a levitating droplet ensured an efficient sampling of the reciprocal space. The datasets were processed with a program suite developed for serial femtosecond crystallography (SFX). The structure, which was solved by molecular replacement, was found to be identical to the structure obtained by the conventional oscillation method for up to a 1.8-Å resolution limit. In particular, the absence of protein crystal damage resulting from the acoustic levitation was carefully established. These results represent a key step towards a fully automated sample handling and measurement pipeline, which has promising prospects for a high acquisition rate and high sample efficiency for room temperature X-ray crystallography.

Ultrasonic acoustic levitation for fast frame rate X-ray protein crystallography at room temperature

NASA Astrophysics Data System (ADS)

Tsujino, Soichiro; Tomizaki, Takashi

2016-05-01

Increasing the data acquisition rate of X-ray diffraction images for macromolecular crystals at room temperature at synchrotrons has the potential to significantly accelerate both structural analysis of biomolecules and structure-based drug developments. Using lysozyme model crystals, we demonstrated the rapid acquisition of X-ray diffraction datasets by combining a high frame rate pixel array detector with ultrasonic acoustic levitation of protein crystals in liquid droplets. The rapid spinning of the crystal within a levitating droplet ensured an efficient sampling of the reciprocal space. The datasets were processed with a program suite developed for serial femtosecond crystallography (SFX). The structure, which was solved by molecular replacement, was found to be identical to the structure obtained by the conventional oscillation method for up to a 1.8-Å resolution limit. In particular, the absence of protein crystal damage resulting from the acoustic levitation was carefully established. These results represent a key step towards a fully automated sample handling and measurement pipeline, which has promising prospects for a high acquisition rate and high sample efficiency for room temperature X-ray crystallography.

Ultrasonic acoustic levitation for fast frame rate X-ray protein crystallography at room temperature

PubMed Central

Tsujino, Soichiro; Tomizaki, Takashi

2016-01-01

Increasing the data acquisition rate of X-ray diffraction images for macromolecular crystals at room temperature at synchrotrons has the potential to significantly accelerate both structural analysis of biomolecules and structure-based drug developments. Using lysozyme model crystals, we demonstrated the rapid acquisition of X-ray diffraction datasets by combining a high frame rate pixel array detector with ultrasonic acoustic levitation of protein crystals in liquid droplets. The rapid spinning of the crystal within a levitating droplet ensured an efficient sampling of the reciprocal space. The datasets were processed with a program suite developed for serial femtosecond crystallography (SFX). The structure, which was solved by molecular replacement, was found to be identical to the structure obtained by the conventional oscillation method for up to a 1.8-Å resolution limit. In particular, the absence of protein crystal damage resulting from the acoustic levitation was carefully established. These results represent a key step towards a fully automated sample handling and measurement pipeline, which has promising prospects for a high acquisition rate and high sample efficiency for room temperature X-ray crystallography. PMID:27150272