Sample records for oligonucleotide array analysis

  1. Oligonucleotide arrays vs. metaphase-comparative genomic hybridisation and BAC arrays for single-cell analysis: first applications to preimplantation genetic diagnosis for Robertsonian translocation carriers.

    PubMed

    Ramos, Laia; del Rey, Javier; Daina, Gemma; García-Aragonés, Manel; Armengol, Lluís; Fernandez-Encinas, Alba; Parriego, Mònica; Boada, Montserrat; Martinez-Passarell, Olga; Martorell, Maria Rosa; Casagran, Oriol; Benet, Jordi; Navarro, Joaquima

    2014-01-01

    Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH) and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈ 20 kb). Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14)(q10;q10). Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers.

  2. Oligonucleotide Arrays vs. Metaphase-Comparative Genomic Hybridisation and BAC Arrays for Single-Cell Analysis: First Applications to Preimplantation Genetic Diagnosis for Robertsonian Translocation Carriers

    PubMed Central

    Ramos, Laia; del Rey, Javier; Daina, Gemma; García-Aragonés, Manel; Armengol, Lluís; Fernandez-Encinas, Alba; Parriego, Mònica; Boada, Montserrat; Martinez-Passarell, Olga; Martorell, Maria Rosa; Casagran, Oriol; Benet, Jordi; Navarro, Joaquima

    2014-01-01

    Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH) and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈20 kb). Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14)(q10;q10). Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers. PMID:25415307

  3. Genome-wide comparison of paired fresh frozen and formalin-fixed paraffin-embedded gliomas by custom BAC and oligonucleotide array comparative genomic hybridization: facilitating analysis of archival gliomas.

    PubMed

    Mohapatra, Gayatry; Engler, David A; Starbuck, Kristen D; Kim, James C; Bernay, Derek C; Scangas, George A; Rousseau, Audrey; Batchelor, Tracy T; Betensky, Rebecca A; Louis, David N

    2011-04-01

    Array comparative genomic hybridization (aCGH) is a powerful tool for detecting DNA copy number alterations (CNA). Because diffuse malignant gliomas are often sampled by small biopsies, formalin-fixed paraffin-embedded (FFPE) blocks are often the only tissue available for genetic analysis; FFPE tissues are also needed to study the intratumoral heterogeneity that characterizes these neoplasms. In this paper, we present a combination of evaluations and technical advances that provide strong support for the ready use of oligonucleotide aCGH on FFPE diffuse gliomas. We first compared aCGH using bacterial artificial chromosome (BAC) arrays in 45 paired frozen and FFPE gliomas, and demonstrate a high concordance rate between FFPE and frozen DNA in an individual clone-level analysis of sensitivity and specificity, assuring that under certain array conditions, frozen and FFPE DNA can perform nearly identically. However, because oligonucleotide arrays offer advantages to BAC arrays in genomic coverage and practical availability, we next developed a method of labeling DNA from FFPE tissue that allows efficient hybridization to oligonucleotide arrays. To demonstrate utility in FFPE tissues, we applied this approach to biphasic anaplastic oligoastrocytomas and demonstrate CNA differences between DNA obtained from the two components. Therefore, BAC and oligonucleotide aCGH can be sensitive and specific tools for detecting CNAs in FFPE DNA, and novel labeling techniques enable the routine use of oligonucleotide arrays for FFPE DNA. In combination, these advances should facilitate genome-wide analysis of rare, small and/or histologically heterogeneous gliomas from FFPE tissues.

  4. Systematic validation and atomic force microscopy of non-covalent short oligonucleotide barcode microarrays.

    PubMed

    Cook, Michael A; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

    2008-02-06

    Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20-60 base) unique sequence tags, or "barcodes", associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5'-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis.

  5. Systematic Validation and Atomic Force Microscopy of Non-Covalent Short Oligonucleotide Barcode Microarrays

    PubMed Central

    Cook, Michael A.; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

    2008-01-01

    Background Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20–60 base) unique sequence tags, or “barcodes”, associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Methodology/Principal Findings Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5′-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. Conclusions/Significance These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis. PMID:18253494

  6. Particle-Based Microarrays of Oligonucleotides and Oligopeptides.

    PubMed

    Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F Ralf; Breitling, Frank; Loeffler, Felix F

    2014-10-28

    In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches.

  7. Particle-Based Microarrays of Oligonucleotides and Oligopeptides

    PubMed Central

    Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K.; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F. Ralf; Breitling, Frank; Loeffler, Felix F.

    2014-01-01

    In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches. PMID:27600347

  8. Methods of DNA sequencing by hybridization based on optimizing concentration of matrix-bound oligonucleotide and device for carrying out same

    DOEpatents

    Khrapko, Konstantin R [Moscow, RU; Khorlin, Alexandr A [Moscow, RU; Ivanov, Igor B [Moskovskaya, RU; Ershov, Gennady M [Moscow, RU; Lysov, Jury P [Moscow, RU; Florentiev, Vladimir L [Moscow, RU; Mirzabekov, Andrei D [Moscow, RU

    1996-09-03

    A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.

  9. Analytical Devices Based on Direct Synthesis of DNA on Paper.

    PubMed

    Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

    2016-01-05

    This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

  10. Oligonucleotide-arrayed TFT photosensor applicable for DNA chip technology.

    PubMed

    Tanaka, Tsuyoshi; Hatakeyama, Keiichi; Sawaguchi, Masahiro; Iwadate, Akihito; Mizutani, Yasushi; Sasaki, Kazuhiro; Tateishi, Naofumi; Takeyama, Haruko; Matsunaga, Tadashi

    2006-09-05

    A thin film transistor (TFT) photosensor fabricated by semiconductor integrated circuit (IC) technology was applied to DNA chip technology. The surface of the TFT photosensor was coated with TiO2 using a vapor deposition technique for the fabrication of optical filters. The immobilization of thiolated oligonucleotide probes onto a TiO2-coated TFT photosensor using gamma-aminopropyltriethoxysilane (APTES) and N-(gamma-maleimidobutyloxy) sulfosuccinimide ester (GMBS) was optimized. The coverage value of immobilized oligonucleotides reached a plateau at 33.7 pmol/cm2, which was similar to a previous analysis using radioisotope-labeled oligonucleotides. The lowest detection limits were 0.05 pmol/cm2 for quantum dot and 2.1 pmol/cm2 for Alexa Fluor 350. Furthermore, single nucleotide polymorphism (SNP) detection was examined using the oligonucleotide-arrayed TFT photosensor. A SNP present in the aldehyde dehydrogenase 2 (ALDH2) gene was used as a target. The SNPs in ALDH2*1 and ALDH2*2 target DNA were detected successfully using the TFT photosensor. DNA hybridization in the presence of both ALDH2*1 and ALDH2*2 target DNA was observed using both ALDH2*1 and ALDH2*2 detection oligonucleotides-arrayed TFT photosensor. Use of the TFT photosensor will allow the development of a disposable photodetecting device for DNA chip systems. (c) 2006 Wiley Periodicals, Inc.

  11. High-density fiber optic biosensor arrays

    NASA Astrophysics Data System (ADS)

    Epstein, Jason R.; Walt, David R.

    2002-02-01

    Novel approaches are required to coordinate the immense amounts of information derived from diverse genomes. This concept has influenced the expanded role of high-throughput DNA detection and analysis in the biological sciences. A high-density fiber optic DNA biosensor was developed consisting of oligonucleotide-functionalized, 3.1 mm diameter microspheres deposited into the etched wells on the distal face of a 500 micrometers imaging fiber bundle. Imaging fiber bundles containing thousands of optical fibers, each associated with a unique oligonucleotide probe sequence, were the foundation for an optically connected, individually addressable DNA detection platform. Different oligonucleotide-functionalized microspheres were combined in a stock solution, and randomly dispersed into the etched wells. Microsphere positions were registered from optical dyes incorporated onto the microspheres. The distribution process provided an inherent redundancy that increases the signal-to-noise ratio as the square root of the number of sensors examined. The representative amount of each probe-type in the array was dependent on their initial stock solution concentration, and as other sequences of interest arise, new microsphere elements can be added to arrays without altering the existing detection capabilities. The oligonucleotide probe sequences hybridize to fluorescently-labeled, complementary DNA target solutions. Fiber optic DNA microarray research has included DNA-protein interaction profiles, microbial strain differentiation, non-labeled target interrogation with molecular beacons, and single cell-based assays. This biosensor array is proficient in DNA detection linked to specific disease states, single nucleotide polymorphism (SNP's) discrimination, and gene expression analysis. This array platform permits multiple detection formats, provides smaller feature sizes, and enables sensor design flexibility. High-density fiber optic microarray biosensors provide a fast, reversible format with the detection limit of a few hundred molecules.

  12. GeneChip{sup {trademark}} screening assay for cystic fibrosis mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cronn, M.T.; Miyada, C.G.; Fucini, R.V.

    1994-09-01

    GeneChip{sup {trademark}} assays are based on high density, carefully designed arrays of short oligonucleotide probes (13-16 bases) built directly on derivatized silica substrates. DNA target sequence analysis is achieved by hybridizing fluorescently labeled amplification products to these arrays. Fluorescent hybridization signals located within the probe array are translated into target sequence information using the known probe sequence at each array feature. The mutation screening assay for cystic fibrosis includes sets of oligonucleotide probes designed to detect numerous different mutations that have been described in 14 exons and one intron of the CFTR gene. Each mutation site is addressed by amore » sub-array of at least 40 probe sequences, half designed to detect the wild type gene sequence and half designed to detect the reported mutant sequence. Hybridization with homozygous mutant, homozygous wild type or heterozygous targets results in distinctive hybridization patterns within a sub-array, permitting specific discrimination of each mutation. The GeneChip probe arrays are very small (approximately 1 cm{sup 2}). There miniature size coupled with their high information content make GeneChip probe arrays a useful and practical means for providing CF mutation analysis in a clinical setting.« less

  13. Cross reactive arrays of three-way junction sensors for steroid determination

    NASA Technical Reports Server (NTRS)

    Stojanovic, Milan N. (Inventor); Nikic, Dragan B. (Inventor); Landry, Donald (Inventor)

    2008-01-01

    This invention provides analyte sensitive oligonucleotide compositions for detecting and analyzing analytes in solution, including complex solutions using cross reactive arrays of analyte sensitive oligonucleotide compositions.

  14. Oligonucleotide Array for Identification and Detection of Pythium Species†

    PubMed Central

    Tambong, J. T.; de Cock, A. W. A. M.; Tinker, N. A.; Lévesque, C. A.

    2006-01-01

    A DNA array containing 172 oligonucleotides complementary to specific diagnostic regions of internal transcribed spacers (ITS) of more than 100 species was developed for identification and detection of Pythium species. All of the species studied, with the exception of Pythium ostracodes, exhibited a positive hybridization reaction with at least one corresponding species-specific oligonucleotide. Hybridization patterns were distinct for each species. The array hybridization patterns included cluster-specific oligonucleotides that facilitated the recognition of species, including new ones, belonging to groups such as those producing filamentous or globose sporangia. BLAST analyses against 500 publicly available Pythium sequences in GenBank confirmed that species-specific oligonucleotides were unique to all of the available strains of each species, of which there were numerous economically important ones. GenBank entries of newly described species that are not putative synonyms showed no homology to sequences of the spotted species-specific oligonucleotides, but most new species did match some of the cluster-specific oligonucleotides. Further verification of the specificity of the DNA array was done with 50 additional Pythium isolates obtained by soil dilution plating. The hybridization patterns obtained were consistent with the identification of these isolates based on morphology and ITS sequence analyses. In another blind test, total DNA of the same soil samples was amplified and hybridized on the array, and the results were compared to those of 130 Pythium isolates obtained by soil dilution plating and root baiting. The 13 species detected by the DNA array corresponded to the isolates obtained by a combination of soil dilution plating and baiting, except for one new species that was not represented on the array. We conclude that the reported DNA array is a reliable tool for identification and detection of the majority of Pythium species in environmental samples. Simultaneous detection and identification of multiple species of soilborne pathogens such as Pythium species could be a major step forward for epidemiological and ecological studies. PMID:16597974

  15. Design of oligonucleotides for microarrays and perspectives for design of multi-transcriptome arrays.

    PubMed

    Nielsen, Henrik Bjørn; Wernersson, Rasmus; Knudsen, Steen

    2003-07-01

    Optimal design of oligonucleotides for microarrays involves tedious and laborious work evaluating potential oligonucleotides relative to a series of parameters. The currently available tools for this purpose are limited in their flexibility and do not present the oligonucleotide designer with an overview of these parameters. We present here a flexible tool named OligoWiz for designing oligonucleotides for multiple purposes. OligoWiz presents a set of parameter scores in a graphical interface to facilitate an overview for the user. Additional custom parameter scores can easily be added to the program to extend the default parameters: homology, DeltaTm, low-complexity, position and GATC-only. Furthermore we present an analysis of the limitations in designing oligonucleotide sets that can detect transcripts from multiple organisms. OligoWiz is available at www.cbs.dtu.dk/services/OligoWiz/.

  16. Method for performing site-specific affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

    1999-01-01

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

  17. Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

    2000-01-01

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

  18. Method for performing site-specific affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

    1999-05-18

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

  19. An oligonucleotide array for the identification and differentiation of bacteria pathogenic on potato.

    PubMed

    Fessehaie, Anania; De Boer, Solke H; Lévesque, C André

    2003-03-01

    ABSTRACT Oligonucleotides, 16 to 24 bases long, were selected from the 3' end of the 16S gene and the 16S-23S intergenic spacer regions of bacteria pathogenic on potato, including Clavibacter michiganensis subsp. sepedonicus, Ralstonia solanacearum, and the pectolytic erwinias, including Erwinia carotovora subsp. atroseptica and carotovora and E. chrysanthemi. Oligonucleotides were designed and formatted into an array by pin spotting on nylon membranes. Genomic DNA from bacterial cultures was amplified by polymerase chain reaction using conserved ribosomal primers and labeled simultaneously with digoxigenin-dUTP. Hybridization of amplicons to the array and subsequent serological detection of digoxigenin label revealed different hybridization patterns that were distinct for each species and subspecies tested. Hybridization of amplicons generally was restricted to appropriate homologous oligonucleotides and cross-hybridization with heterologous oligonucleotides was rare. Hybridization patterns were recorded as separate gray values for each hybridized spot and revealed a consistent pattern for multiple strains of each species or subspecies isolated from diverse geographical regions. In preliminary tests, bacteria could be correctly identified and detected by hybridizing to the array amplicons from mixed cultures and inoculated potato tissue.

  20. Custom oligonucleotide array-based CGH: a reliable diagnostic tool for detection of exonic copy-number changes in multiple targeted genes

    PubMed Central

    Vasson, Aurélie; Leroux, Céline; Orhant, Lucie; Boimard, Mathieu; Toussaint, Aurélie; Leroy, Chrystel; Commere, Virginie; Ghiotti, Tiffany; Deburgrave, Nathalie; Saillour, Yoann; Atlan, Isabelle; Fouveaut, Corinne; Beldjord, Cherif; Valleix, Sophie; Leturcq, France; Dodé, Catherine; Bienvenu, Thierry; Chelly, Jamel; Cossée, Mireille

    2013-01-01

    The frequency of disease-related large rearrangements (referred to as copy-number mutations, CNMs) varies among genes, and search for these mutations has an important place in diagnostic strategies. In recent years, CGH method using custom-designed high-density oligonucleotide-based arrays allowed the development of a powerful tool for detection of alterations at the level of exons and made it possible to provide flexibility through the possibility of modeling chips. The aim of our study was to test custom-designed oligonucleotide CGH array in a diagnostic laboratory setting that analyses several genes involved in various genetic diseases, and to compare it with conventional strategies. To this end, we designed a 12-plex CGH array (135k; 135 000 probes/subarray) (Roche Nimblegen) with exonic and intronic oligonucleotide probes covering 26 genes routinely analyzed in the laboratory. We tested control samples with known CNMs and patients for whom genetic causes underlying their disorders were unknown. The contribution of this technique is undeniable. Indeed, it appeared reproducible, reliable and sensitive enough to detect heterozygous single-exon deletions or duplications, complex rearrangements and somatic mosaicism. In addition, it improves reliability of CNM detection and allows determination of boundaries precisely enough to direct targeted sequencing of breakpoints. All of these points, associated with the possibility of a simultaneous analysis of several genes and scalability ‘homemade' make it a valuable tool as a new diagnostic approach of CNMs. PMID:23340513

  1. Enzymatic production of single-molecule FISH and RNA capture probes.

    PubMed

    Gaspar, Imre; Wippich, Frank; Ephrussi, Anne

    2017-10-01

    Arrays of singly labeled short oligonucleotides that hybridize to a specific target revolutionized RNA biology, enabling quantitative, single-molecule microscopy analysis and high-efficiency RNA/RNP capture. Here, we describe a simple and efficient method that allows flexible functionalization of inexpensive DNA oligonucleotides by different fluorescent dyes or biotin using terminal deoxynucleotidyl transferase and custom-made functional group conjugated dideoxy-UTP. We show that (i) all steps of the oligonucleotide labeling-including conjugation, enzymatic synthesis, and product purification-can be performed in a standard biology laboratory, (ii) the process yields >90%, often >95% labeled product with minimal carryover of impurities, and (iii) the oligonucleotides can be labeled with different dyes or biotin, allowing single-molecule FISH, RNA affinity purification, and Northern blot analysis to be performed. © 2017 Gaspar et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  2. Genome-wide comparison of paired fresh frozen and formalin-fixed paraffin-embedded gliomas by custom BAC and oligonucleotide array comparative genomic hybridization: facilitating analysis of archival gliomas

    PubMed Central

    Mohapatra, Gayatry; Engler, David A.; Starbuck, Kristen D.; Kim, James C.; Bernay, Derek C.; Scangas, George A.; Rousseau, Audrey; Batchelor, Tracy T.; Betensky, Rebecca A.; Louis, David N.

    2010-01-01

    Molecular genetic analysis of cancer is rapidly evolving as a result of improvement in genomic technologies and the growing applicability of such analyses to clinical oncology. Array based comparative genomic hybridization (aCGH) is a powerful tool for detecting DNA copy number alterations (CNA), particularly in solid tumors, and has been applied to the study of malignant gliomas. In the clinical setting, however, gliomas are often sampled by small biopsies and thus formalin-fixed paraffin-embedded (FFPE) blocks are often the only tissue available for genetic analysis, especially for rare types of gliomas. Moreover, the biological basis for the marked intratumoral heterogeneity in gliomas is most readily addressed in FFPE material. Therefore, for gliomas, the ability to use DNA from FFPE tissue is essential for both clinical and research applications. In this study, we have constructed a custom bacterial artificial chromosome (BAC) array and show excellent sensitivity and specificity for detecting CNAs in a panel of paired frozen and FFPE glioma samples. Our study demonstrates a high concordance rate between CNAs detected in FFPE compared to frozen DNA. We have also developed a method of labeling DNA from FFPE tissue that allows efficient hybridization to oligonucleotide arrays. This labeling technique was applied to a panel of biphasic anaplastic oligoastrocytomas (AOA) to identify genetic changes unique to each component. Together, results from these studies suggest that BAC and oligonucleotide aCGH are sensitive tools for detecting CNAs in FFPE DNA, and can enable genome-wide analysis of rare, small and/or histologically heterogeneous gliomas. PMID:21080181

  3. Genetics Home Reference: mycosis fungoides

    MedlinePlus

    ... Cigudosa JC, Barranco C, Serrano S, Dummer R, Tensen CP, Solé F, Pujol RM, Espinet B. Oligonucleotide array- ... K, Knijnenburg J, Boer JM, Willemze R, Tensen CP. Oncogenomic analysis of mycosis fungoides reveals major differences ...

  4. Soft Lithography for Oligonucleotide Arrays Fabrication

    DTIC Science & Technology

    2001-10-25

    adenosine; Abbreviated T, C, G, A respectively), the other synthesis reagents and solvents except oxidation agent (seen in Table 1) were purchased...dried by cold blowing before hybridization. Oligonucleotide arrays were hybridized in 200 nM 3’-TCC TCC GAT TCA GAG AGT CC- HEX (PE Biosystems... citrate buffer), 0.1% SDS in 0.1xSSC respectively. The probe array was scanned on the Scanarray Microarray Systems (Packard Biochip Technologies, USA

  5. Analysis of mutations in oral poliovirus vaccine by hybridization with generic oligonucleotide microchips.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Proudnikov, D.; Kirillov, E.; Chumakov, K.

    2000-01-01

    This paper describes use of a new technology of hybridization with a micro-array of immobilized oligonucleotides for detection and quantification of neurovirulent mutants in Oral Poliovirus Vaccine (OPV). We used a micro-array consisting of three-dimensional gel-elements containing all possible hexamers (total of 4096 probes). Hybridization of fluorescently labelled viral cDNA samples with such microchips resulted in a pattern of spots that was registered and quantified by a computer-linked CCD camera, so that the sequence of the original cDNA could be deduced. The method could reliably identify single point mutations, since each of them affected fluorescence intensity of 12 micro-array elements.more » Micro-array hybridization of DNA mixtures with varying contents of point mutants demonstrated that the method can detect as little as 10% of revertants in a population of vaccine virus. This new technology should be useful for quality control of live viral vaccines, as well as for other applications requiring identification and quantification of point mutations.« less

  6. Identification of clinically relevant viridans streptococci by an oligonucleotide array.

    PubMed

    Chen, Chao Chien; Teng, Lee Jene; Kaiung, Seng; Chang, Tsung Chain

    2005-04-01

    Viridans streptococci (VS) are common etiologic agents of subacute infective endocarditis and are capable of causing a variety of pyogenic infections. Many species of VS are difficult to differentiate by phenotypic traits. An oligonucleotide array based on 16S-23S rRNA gene intergenic spacer (ITS) sequences was developed to identify 11 clinically relevant VS. These 11 species were Streptococcus anginosus, S. constellatus, S. gordonii, S. intermedius, S. mitis, S. mutans, S. oralis, S. parasanguinis, S. salivarius, S. sanguinis, and S. uberis. The method consisted of PCR amplification of the ITS regions by using a pair of universal primers, followed by hybridization of the digoxigenin-labeled PCR products to a panel of species-specific oligonucleotides immobilized on a nylon membrane. After 120 strains of the 11 species of VG and 91 strains of other bacteria were tested, the sensitivity and specificity of the oligonucleotide array were found to be 100% (120 of 120 strains) and 95.6% (87 of 91 strains), respectively. S. pneumoniae cross-hybridized to the probes used for the identification of S. mitis, and simple biochemical tests such as optochin susceptibility or bile solubility should be used to differentiate S. pneumoniae from S. mitis. In conclusion, identification of species of VS by use of the present oligonucleotide array is accurate and could be used as an alternative reliable method for species identification of strains of VS.

  7. Partition resampling and extrapolation averaging: approximation methods for quantifying gene expression in large numbers of short oligonucleotide arrays.

    PubMed

    Goldstein, Darlene R

    2006-10-01

    Studies of gene expression using high-density short oligonucleotide arrays have become a standard in a variety of biological contexts. Of the expression measures that have been proposed to quantify expression in these arrays, multi-chip-based measures have been shown to perform well. As gene expression studies increase in size, however, utilizing multi-chip expression measures is more challenging in terms of computing memory requirements and time. A strategic alternative to exact multi-chip quantification on a full large chip set is to approximate expression values based on subsets of chips. This paper introduces an extrapolation method, Extrapolation Averaging (EA), and a resampling method, Partition Resampling (PR), to approximate expression in large studies. An examination of properties indicates that subset-based methods can perform well compared with exact expression quantification. The focus is on short oligonucleotide chips, but the same ideas apply equally well to any array type for which expression is quantified using an entire set of arrays, rather than for only a single array at a time. Software implementing Partition Resampling and Extrapolation Averaging is under development as an R package for the BioConductor project.

  8. Mapping of transcription factor binding regions in mammalian cells by ChIP: Comparison of array- and sequencing-based technologies

    PubMed Central

    Euskirchen, Ghia M.; Rozowsky, Joel S.; Wei, Chia-Lin; Lee, Wah Heng; Zhang, Zhengdong D.; Hartman, Stephen; Emanuelsson, Olof; Stolc, Viktor; Weissman, Sherman; Gerstein, Mark B.; Ruan, Yijun; Snyder, Michael

    2007-01-01

    Recent progress in mapping transcription factor (TF) binding regions can largely be credited to chromatin immunoprecipitation (ChIP) technologies. We compared strategies for mapping TF binding regions in mammalian cells using two different ChIP schemes: ChIP with DNA microarray analysis (ChIP-chip) and ChIP with DNA sequencing (ChIP-PET). We first investigated parameters central to obtaining robust ChIP-chip data sets by analyzing STAT1 targets in the ENCODE regions of the human genome, and then compared ChIP-chip to ChIP-PET. We devised methods for scoring and comparing results among various tiling arrays and examined parameters such as DNA microarray format, oligonucleotide length, hybridization conditions, and the use of competitor Cot-1 DNA. The best performance was achieved with high-density oligonucleotide arrays, oligonucleotides ≥50 bases (b), the presence of competitor Cot-1 DNA and hybridizations conducted in microfluidics stations. When target identification was evaluated as a function of array number, 80%–86% of targets were identified with three or more arrays. Comparison of ChIP-chip with ChIP-PET revealed strong agreement for the highest ranked targets with less overlap for the low ranked targets. With advantages and disadvantages unique to each approach, we found that ChIP-chip and ChIP-PET are frequently complementary in their relative abilities to detect STAT1 targets for the lower ranked targets; each method detected validated targets that were missed by the other method. The most comprehensive list of STAT1 binding regions is obtained by merging results from ChIP-chip and ChIP-sequencing. Overall, this study provides information for robust identification, scoring, and validation of TF targets using ChIP-based technologies. PMID:17568005

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Farahani, Poupak; Chiu, Sally; Bowlus, Christopher L.

    Obesity is a complex disease. To date, over 100 chromosomal loci for body weight, body fat, regional white adipose tissue weight, and other obesity-related traits have been identified in humans and in animal models. For most loci, the underlying genes are not yet identified; some of these chromosomal loci will be alleles of known obesity genes, whereas many will represent alleles of unknown genes. Microarray analysis allows simultaneous multiple gene and pathway discovery. cDNA and oligonucleotide arrays are commonly used to identify differentially expressed genes by surveys of large numbers of known and unnamed genes. Two papers previously identified genesmore » differentially expressed in adipose tissue of mouse models of obesity and diabetes by analysis of hybridization to Affymetrix oligonucleotide chips.« less

  10. Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays

    PubMed Central

    2011-01-01

    Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062

  11. Real-Time Continuous Identification of Greenhouse Plant Pathogens Based on Recyclable Microfluidic Bioassay System.

    PubMed

    Qu, Xiangmeng; Li, Min; Zhang, Hongbo; Lin, Chenglie; Wang, Fei; Xiao, Mingshu; Zhou, Yi; Shi, Jiye; Aldalbahi, Ali; Pei, Hao; Chen, Hong; Li, Li

    2017-09-20

    The development of a real-time continuous analytical platform for the pathogen detection is of great scientific importance for achieving better disease control and prevention. In this work, we report a rapid and recyclable microfluidic bioassay system constructed from oligonucleotide arrays for selective and sensitive continuous identification of DNA targets of fungal pathogens. We employ the thermal denaturation method to effectively regenerate the oligonucleotide arrays for multiple sample detection, which could considerably reduce the screening effort and costs. The combination of thermal denaturation and laser-induced fluorescence detection technique enables real-time continuous identification of multiple samples (<10 min per sample). As a proof of concept, we have demonstrated that two DNA targets of fungal pathogens (Botrytis cinerea and Didymella bryoniae) can be sequentially analyzed using our rapid microfluidic bioassay system, which provides a new paradigm in the design of microfluidic bioassay system and will be valuable for chemical and biomedical analysis.

  12. arrayCGHbase: an analysis platform for comparative genomic hybridization microarrays

    PubMed Central

    Menten, Björn; Pattyn, Filip; De Preter, Katleen; Robbrecht, Piet; Michels, Evi; Buysse, Karen; Mortier, Geert; De Paepe, Anne; van Vooren, Steven; Vermeesch, Joris; Moreau, Yves; De Moor, Bart; Vermeulen, Stefan; Speleman, Frank; Vandesompele, Jo

    2005-01-01

    Background The availability of the human genome sequence as well as the large number of physically accessible oligonucleotides, cDNA, and BAC clones across the entire genome has triggered and accelerated the use of several platforms for analysis of DNA copy number changes, amongst others microarray comparative genomic hybridization (arrayCGH). One of the challenges inherent to this new technology is the management and analysis of large numbers of data points generated in each individual experiment. Results We have developed arrayCGHbase, a comprehensive analysis platform for arrayCGH experiments consisting of a MIAME (Minimal Information About a Microarray Experiment) supportive database using MySQL underlying a data mining web tool, to store, analyze, interpret, compare, and visualize arrayCGH results in a uniform and user-friendly format. Following its flexible design, arrayCGHbase is compatible with all existing and forthcoming arrayCGH platforms. Data can be exported in a multitude of formats, including BED files to map copy number information on the genome using the Ensembl or UCSC genome browser. Conclusion ArrayCGHbase is a web based and platform independent arrayCGH data analysis tool, that allows users to access the analysis suite through the internet or a local intranet after installation on a private server. ArrayCGHbase is available at . PMID:15910681

  13. Template-Directed Ligation of Peptides to Oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bruick, Richard K.; Dawson, Philip E.; Kent, Stephen BH; Usman, Nassim; Joyce, Gerald F.

    1996-01-01

    Synthetic oligonucleotides and peptides have enjoyed a wide range of applications in both biology and chemistry. As a consequence, oligonucleotide-peptide conjugates have received considerable attention, most notably in the development of antisense constructs with improved pharmacological properties. In addition, oligonucleotide-peptide conjugates have been used as molecular tags, in the assembly of supramolecular arrays and in the construction of encoded combinatorial libraries. To make these chimeric molecules more accessible for a broad range of investigations, we sought to develop a facile method for joining fully deprotected oligonucleotides and peptides through a stable amide bond linkage. Furthermore, we wished to make this ligation reaction addressable, enabling one to direct the ligation of specific oligonucleotide and peptide components.To confer specificity and accelerate the rate of the reaction, the ligation process was designed to be dependent on the presence of a complementary oligonucleotide template.

  14. Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

    PubMed

    Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

    2002-12-01

    Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

  15. Hetero-oligonucleotide Nanoscale Tiles Capable of Two-Dimensional Lattice Formation as Testbeds for a Rapid, Affordable Purification Methodology

    DTIC Science & Technology

    2013-01-01

    SUBJECT TERMS DNA nanotechnology, purification, origami , 2d arrays Philip S. Lukeman St. John’s University, New York 8000 Utopia Parkway Queens, NY... origami ; DNA double-crossover (“DX”) tile based arrays5 have been constructed using PNA6 and LNA7 oligonucleotides. RNA/ DNA duplexes have been used8 for...the assembly of multiply armed tiles9 and as a template10 to fold DNA origami ;11 all-RNA systems known as ‘tecto-RNA’ have been used to generate a wide

  16. Development and characterization of a microheater array device for real-time DNA mutation detection

    NASA Astrophysics Data System (ADS)

    Williams, Layne; Okandan, Murat; Chagovetz, Alex; Blair, Steve

    2008-04-01

    DNA analysis, specifically single nucleotide polymorphism (SNP) detection, is becoming increasingly important in rapid diagnostics and disease detection. Temperature is often controlled to help speed reaction rates and perform melting of hybridized oligonucleotides. The difference in melting temperatures, Tm, between wild-type and SNP sequences, respectively, to a given probe oligonucleotide, is indicative of the specificity of the reaction. We have characterized Tm's in solution and on a solid substrate of three sequences from known mutations associated with Cystic Fibrosis. Taking advantage of Tm differences, a microheater array device was designed to enable individual temperature control of up to 18 specific hybridization events. The device was fabricated at Sandia National Laboratories using surface micromachining techniques. The microheaters have been characterized using an IR camera at Sandia and show individual temperature control with minimal thermal cross talk. Development of the device as a real-time DNA detection platform, including surface chemistry and associated microfluidics, is described.

  17. Development and characterization of a microheater array device for real-time DNA mutation detection

    NASA Astrophysics Data System (ADS)

    Williams, Layne; Okandan, Murat; Chagovetz, Alex; Blair, Steve

    2008-02-01

    DNA analysis, specifically single nucleotide polymorphism (SNP) detection, is becoming increasingly important in rapid diagnostics and disease detection. Temperature is often controlled to help speed reaction rates and perform melting of hybridized oligonucleotides. The difference in melting temperatures, Tm, between wild-type and SNP sequences, respectively, to a given probe oligonucleotide, is indicative of the specificity of the reaction. We have characterized Tm's in solution and on a solid substrate of three sequences from known mutations associated with Cystic Fibrosis. Taking advantage of Tm differences, a microheater array device was designed to enable individual temperature control of up to 18 specific hybridization events. The device was fabricated at Sandia National Laboratories using surface micromachining techniques. The microheaters have been characterized using an IR camera at Sandia and show individual temperature control with minimal thermal cross talk. Development of the device as a real-time DNA detection platform, including surface chemistry and associated microfluidics, is described.

  18. Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

    DOEpatents

    Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

    1999-01-19

    The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

  19. Cambridge Healthtech Institute's Third Annual Conference on Lab-on-a-Chip and Microarrays. 22-24 January 2001, Zurich, Switzerland.

    PubMed

    Jain, K K

    2001-02-01

    Cambridge Healthtech Institute's Third Annual Conference on Lab-on-a-Chip and Microarray technology covered the latest advances in this technology and applications in life sciences. Highlights of the meetings are reported briefly with emphasis on applications in genomics, drug discovery and molecular diagnostics. There was an emphasis on microfluidics because of the wide applications in laboratory and drug discovery. The lab-on-a-chip provides the facilities of a complete laboratory in a hand-held miniature device. Several microarray systems have been used for hybridisation and detection techniques. Oligonucleotide scanning arrays provide a versatile tool for the analysis of nucleic acid interactions and provide a platform for improving the array-based methods for investigation of antisense therapeutics. A method for analysing combinatorial DNA arrays using oligonucleotide-modified gold nanoparticle probes and a conventional scanner has considerable potential in molecular diagnostics. Various applications of microarray technology for high-throughput screening in drug discovery and single nucleotide polymorphisms (SNP) analysis were discussed. Protein chips have important applications in proteomics. With the considerable amount of data generated by the different technologies using microarrays, it is obvious that the reading of the information and its interpretation and management through the use of bioinformatics is essential. Various techniques for data analysis were presented. Biochip and microarray technology has an essential role to play in the evolving trends in healthcare, which integrate diagnosis with prevention/treatment and emphasise personalised medicines.

  20. ASSESSMENT OF THE SWINE PROTEIN-ANNOTATED OLIGONUCLEOTIDE MICROARRAY AND UTILITY OF THE ARRAYS FOR EQTL AND TRANSCRIPTIONAL PROFILING STUDIES

    USDA-ARS?s Scientific Manuscript database

    We have evaluated the new Swine Protein-Annotated Oligonucleotide Microarray (http://www.pigoligoarray.org) by analyzing transcriptional profiles for longissimus dorsi muscle (LD), Bronchial lymph node (BLN) and Lung. Four LD samples were used to assess the stringency of hybridization conditions com...

  1. Ultrasensitive Label-free Electronic Chip for DNA Analysis Using Carbon Nanotube Nanoelectrode Arrays

    NASA Technical Reports Server (NTRS)

    Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Ye, Qi; Han, Jie; Meyyappan, M.

    2004-01-01

    There is a strong need for faster, cheaper, and simpler methods for nucleic acid analysis in today s clinical tests. Nanotechnologies can potentially provide solutions to these requirements by integrating nanomaterials with biofunctionalities. Dramatic improvement in the sensitivity and multiplexing can be achieved through the high-degree miniaturization. Here, we present our study in the development of an ultrasensitive label-free electronic chip for DNA/RNA analysis based on carbon nanotube nanoelectrode arrays. A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in a SiO2 matrix is fabricated using a bottom-up approach. Characteristic nanoelectrode behavior is observed with a low-density MWNT nanoelectrode array in measuring both the bulk and surface immobilized redox species. The open-end of MWNTs are found to present similar properties as graphite edge-plane electrodes, with a wide potential window, flexible chemical functionalities, and good biocompatibility. A BRCA1 related oligonucleotide probe with 18 bases is covalently functionalized at the open ends of the MWNTs and specifically hybridized with an oligonucleotide target as well as a PCR amplicon. The guanine bases in the target molecules are employed as the signal moieties for the electrochemical measurements. Ru(bpy)3(2+) mediator is used to further amplify the guanine oxidation signal. This technique has been employed for direct electrochemical detection of label-free PCR amplicon through specific hybridization with the BRCAl probe. The detection limit is estimated to be less than approximately 1000 DNA molecules, approaching the limit of the sensitivity by laser-based fluorescence techniques in DNA microarray. This system provides a general electronic platform for rapid molecular diagnostics in applications requiring ultrahigh sensitivity, high-degree of miniaturization, simple sample preparation, and low- cost operation.

  2. A novel computational method to simulate non-enzymatic self-replication. [Abstract only

    NASA Technical Reports Server (NTRS)

    Navarro-Gonzalez, Rafael; Reggia, James A.; Wu, Jayoung; Chou, Hui-Hsien

    1994-01-01

    Non-enzymatic, template-directed synthesis of oligonucleotides has been extensively studied in the laboratory as a model to understand the kind of chemical processes that might have contributed to the origin of life on Earth. Several oligonucleotides have been shown to catalyze the synthesis of their complements from activated mononucleotides; however, a restricted number of them have been found to self-replicate. Recently we developed an efficient modified cellular automata method that supports the study of self-replicating oligonucleotides. With this method the oligonucleotide molecules are represented as active cells imbedded in a two-dimensional array of inactive cells symbolizing the environment. Random movements and probability-governed chemical reactions occurring in a cellular space can effectively simulate the experimental behavior observed in self-directed replication of oligonucleotides.

  3. Carbon Nanotube Nanoelectrode Array for Ultrasensitive DNA Detection

    NASA Technical Reports Server (NTRS)

    Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Fan, Wendy; Ye, Qi; Han, Jie; Meyyappan, M.

    2003-01-01

    A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in SiO2 is used for ultrasensitive DNA detection. Characteristic nanoelectrode behavior is observed using low-density MWNT arrays for measuring both bulk and surface immobilized redox species such as K4Fe(CN)6. The open-end of MWNTs present similar properties as graphite edge-plane electrodes with wide potential window, flexible chemical functionalities, and good biocompatibility. Oligonucleotide probes are selectively functionalized at the open ends cf the nanotube array and specifically hybridized with oligonucleotide targets. The guanine groups are employed as the signal moieties in the electrochemical measurements. Ru(bpy)3(2+) mediator is used to further amplify the guanine oxidation signal. The hybridization of subattomoles of PCR amplified DNA targets is detected electrochemically by combining the MWNT nanoelectrode array with the Ru(bpy)32' amplification mechanism. This system provides a general platform of molecular diagnostics for applications requiring ultrahigh sensitivity, high-degree of miniaturization, and simple sample preparations.

  4. DNA detection on ultrahigh-density optical fiber-based nanoarrays.

    PubMed

    Tam, Jenny M; Song, Linan; Walt, David R

    2009-04-15

    Nanoarrays for DNA detection were fabricated on etched nanofiber bundles based on recently developed techniques for microscale arrays. Two different-sized nanoarrays were created: one with 700 nm feature sizes and a 1 microm center-to-center pitch (approximately 1x10(6) array elements/mm(2)) and one with 300 nm feature sizes and a 500 nm center-to-center pitch (4.6x10(6) array elements/mm(2)). A random, multiplexed array composed of oligonucleotide-functionalized nanospheres was constructed and used for parallel detection and analysis of fluorescently labeled DNA targets. We have used these arrays to detect a variety of target sequences including Bacillus thuringiensis kurstaki and vaccina virus sequences, two potential biowarfare agents, as well as interleukin-2 sequences, an immune system modulator that has been used for the diagnosis of HIV.

  5. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, T.

    1998-09-29

    The subject invention disclosed herein is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

  6. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, Tuan

    1998-01-01

    The subject invention disclosed herein is a new gene probe biosensor and methods thereof based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays.

  7. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, T.

    1998-02-24

    The subject invention disclosed is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

  8. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, T.

    1998-07-21

    The subject invention disclosed is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

  9. Correction of Spatial Bias in Oligonucleotide Array Data

    PubMed Central

    Lemieux, Sébastien

    2013-01-01

    Background. Oligonucleotide microarrays allow for high-throughput gene expression profiling assays. The technology relies on the fundamental assumption that observed hybridization signal intensities (HSIs) for each intended target, on average, correlate with their target's true concentration in the sample. However, systematic, nonbiological variation from several sources undermines this hypothesis. Background hybridization signal has been previously identified as one such important source, one manifestation of which appears in the form of spatial autocorrelation. Results. We propose an algorithm, pyn, for the elimination of spatial autocorrelation in HSIs, exploiting the duality of desirable mutual information shared by probes in a common probe set and undesirable mutual information shared by spatially proximate probes. We show that this correction procedure reduces spatial autocorrelation in HSIs; increases HSI reproducibility across replicate arrays; increases differentially expressed gene detection power; and performs better than previously published methods. Conclusions. The proposed algorithm increases both precision and accuracy, while requiring virtually no changes to users' current analysis pipelines: the correction consists merely of a transformation of raw HSIs (e.g., CEL files for Affymetrix arrays). A free, open-source implementation is provided as an R package, compatible with standard Bioconductor tools. The approach may also be tailored to other platform types and other sources of bias. PMID:23573083

  10. Photolithographic Synthesis of High-Density DNA and RNA Arrays on Flexible, Transparent, and Easily Subdivided Plastic Substrates.

    PubMed

    Holden, Matthew T; Carter, Matthew C D; Wu, Cheng-Hsien; Wolfer, Jamison; Codner, Eric; Sussman, Michael R; Lynn, David M; Smith, Lloyd M

    2015-11-17

    The photolithographic fabrication of high-density DNA and RNA arrays on flexible and transparent plastic substrates is reported. The substrates are thin sheets of poly(ethylene terephthalate) (PET) coated with cross-linked polymer multilayers that present hydroxyl groups suitable for conventional phosphoramidite-based nucleic acid synthesis. We demonstrate that by modifying array synthesis procedures to accommodate the physical and chemical properties of these materials, it is possible to synthesize plastic-backed oligonucleotide arrays with feature sizes as small as 14 μm × 14 μm and feature densities in excess of 125 000/cm(2), similar to specifications attainable using rigid substrates such as glass or glassy carbon. These plastic-backed arrays are tolerant to a wide range of hybridization temperatures, and improved synthetic procedures are described that enable the fabrication of arrays with sequences up to 50 nucleotides in length. These arrays hybridize with S/N ratios comparable to those fabricated on otherwise identical arrays prepared on glass or glassy carbon. This platform supports the enzymatic synthesis of RNA arrays and proof-of-concept experiments are presented showing that the arrays can be readily subdivided into smaller arrays (or "millichips") using common laboratory-scale laser cutting tools. These results expand the utility of oligonucleotide arrays fabricated on plastic substrates and open the door to new applications for these important bioanalytical tools.

  11. Gene expression profiling of single cells on large-scale oligonucleotide arrays

    PubMed Central

    Hartmann, Claudia H.; Klein, Christoph A.

    2006-01-01

    Over the last decade, important insights into the regulation of cellular responses to various stimuli were gained by global gene expression analyses of cell populations. More recently, specific cell functions and underlying regulatory networks of rare cells isolated from their natural environment moved to the center of attention. However, low cell numbers still hinder gene expression profiling of rare ex vivo material in biomedical research. Therefore, we developed a robust method for gene expression profiling of single cells on high-density oligonucleotide arrays with excellent coverage of low abundance transcripts. The protocol was extensively tested with freshly isolated single cells of very low mRNA content including single epithelial, mature and immature dendritic cells and hematopoietic stem cells. Quantitative PCR confirmed that the PCR-based global amplification method did not change the relative ratios of transcript abundance and unsupervised hierarchical cluster analysis revealed that the histogenetic origin of an individual cell is correctly reflected by the gene expression profile. Moreover, the gene expression data from dendritic cells demonstrate that cellular differentiation and pathway activation can be monitored in individual cells. PMID:17071717

  12. Arrays of nucleic acid probes on biological chips

    DOEpatents

    Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.

    1998-11-17

    DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.

  13. Application of HLA-DRB1 genotyping by oligonucleotide micro-array technology in forensic medicine.

    PubMed

    Jiang, Bin; Li, Yao; Wu, Hai; He, Xianmin; Li, Chengtao; Li, Li; Tang, Rong; Xie, Yi; Mao, Yumin

    2006-10-16

    The human leukocyte antigen (HLA) system is known to be the most complex polymorphic system in the human genome. Among all of the HLA loci, HLA-DRB1 has the second largest number of alleles. The purpose of this study is to develop an oligonucleotide micro-array based HLA-DRB1 typing system for use in forensic identification, anthropology, tissue transplantation, and other genetic research fields. The system was developed by analyzing the HLA-DRB1 (DRB1) genotypes in 1198 unrelated healthy Chinese Han individuals originating from various parts of China and residing in Shanghai, China. Polymerase chain reaction (PCR) coupled with the oligonucleotide micro-array technology was used to detect and type HLA-DRB1 alleles of the sample individuals. The reliability, sensitivity, consistency and specificity were evaluated for use in forensic identification. Furthermore, a meta-analysis was carried out by comparing the allele frequencies of the HLA-DRB1 locus with those of other Chinese Han groups, Chinese minorities and other ethnic populations. All the DNA samples yielded a 273 bp amplification product, with no other amplification products in this length range. The minimum quantity of DNA detected by this method is 15 ng in a PCR reaction system of 25 microl. The population studied appeared to be not in Hardy-Weinberg equilibrium. Observed heterozygosity (Ho), expected heterozygosity (He), expected probability of exclusion (PE), polymorphic information content (PIC), and discrimination power (DP) of the HLA-DRB1 locus from the Shanghai Han ethnic group were evaluated to be 0.8022, 0.8870, 0.7741, 0.8771, 0.9750, respectively. A total of 25 HLA-DRB1 alleles were identified. HLA-DRB1*09XX, *04XX, *12XX and *15XX were the most frequent DRB1 alleles, which were observed in 58.76% of the sample. One hundred and sixteen genotypes were found. The five most frequent genotypes were: *04XX/*04XX (0.0626), *09XX/*09XX (0.0593), *04XX/*09XX (0.0551), *09XX/*15XX (0.0384) and *08XX/*12XX (0.0351). The meta-analysis showed that there were uniquely distributed features of DRB1 alleles among various ethnic populations and among the studied population groups from various regions with the same ethnic origin. An HLA-DRB1 genotyping system has been developed and established based on the oligonucleotide micro-array technology. The HLA-DRB1 typing of the Han population in Shanghai has revealed a relatively high heterogeneity. Information obtained in this study will be useful for medical and forensic applications as well as in anthropology research. Large-scale micro-array detection is highly accurate and reliable for DNA-based HLA-DRB1 genotyping. These results suggest that HLA-DRB1 DNA polymorphisms and the database of the Shanghai Han group have useful applications in processing forensic casework (as personal identification, paternity test), tracing population migration and genetic diagnosis.

  14. A functional genomics tool for the Pacific bluefin tuna: Development of a 44K oligonucleotide microarray from whole-genome sequencing data for global transcriptome analysis.

    PubMed

    Yasuike, Motoshige; Fujiwara, Atushi; Nakamura, Yoji; Iwasaki, Yuki; Nishiki, Issei; Sugaya, Takuma; Shimizu, Akio; Sano, Motohiko; Kobayashi, Takanori; Ototake, Mitsuru

    2016-02-01

    Bluefin tunas are one of the most important fishery resources worldwide. Because of high market values, bluefin tuna farming has been rapidly growing during recent years. At present, the most common form of the tuna farming is based on the stocking of wild-caught fish. Therefore, concerns have been raised about the negative impact of the tuna farming on wild stocks. Recently, the Pacific bluefin tuna (PBT), Thunnus orientalis, has succeeded in completing the reproduction cycle under aquaculture conditions, but production bottlenecks remain to be solved because of very little biological information on bluefin tunas. Functional genomics approaches promise to rapidly increase our knowledge on biological processes in the bluefin tuna. Here, we describe the development of the first 44K PBT oligonucleotide microarray (oligo-array), based on whole-genome shotgun (WGS) sequencing and large-scale expressed sequence tags (ESTs) data. In addition, we also introduce an initial 44K PBT oligo-array experiment using in vitro grown peripheral blood leukocytes (PBLs) stimulated with immunostimulants such as lipopolysaccharide (LPS: a cell wall component of Gram-negative bacteria) or polyinosinic:polycytidylic acid (poly I:C: a synthetic mimic of viral infection). This pilot 44K PBT oligo-array analysis successfully addressed distinct immune processes between LPS- and poly I:C- stimulated PBLs. Thus, we expect that this oligo-array will provide an excellent opportunity to analyze global gene expression profiles for a better understanding of diseases and stress, as well as for reproduction, development and influence of nutrition on tuna aquaculture production. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  15. A Complex 6p25 Rearrangement in a Child With Multiple Epiphyseal Dysplasia

    PubMed Central

    Bedoyan, Jirair K.; Lesperance, Marci M.; Ackley, Todd; Iyer, Ramaswamy K.; Innis, Jeffrey W.; Misra, Vinod K.

    2015-01-01

    Genomic rearrangements are increasingly recognized as important contributors to human disease. Here we report on an 11½-year-old child with myopia, Duane retraction syndrome, bilateral mixed hearing loss, skeletal anomalies including multiple epiphyseal dysplasia, and global developmental delay, and a complex 6p25 genomic rearrangement. We have employed oligonucleotide-based comparative genomic hybridization arrays (aCGH) of different resolutions (44 and 244K) as well as a 1 M single nucleotide polymorphism (SNP) array to analyze this complex rearrangement. Our analyses reveal a complex rearrangement involving a ~2.21 Mb interstitial deletion, a ~240 kb terminal deletion, and a 70–80 kb region in between these two deletions that shows maintenance of genomic copy number. The interstitial deletion contains eight known genes, including three Forkhead box containing (FOX) transcription factors (FOXQ1, FOXF2, and FOXC1). The region maintaining genomic copy number partly overlaps the dual specificity protein phosphatase 22 (DUSP22) gene. Array analyses suggest a homozygous loss of genomic material at the 5′ end of DUSP22, which was corroborated using TaqMan® copy number analysis. It is possible that this homozygous genomic loss may render both copies of DUSP22 or its products non-functional. Our analysis suggests a rearrangement mechanism distinct from a previously reported replication-based error-prone mechanism without template switching for a specific 6p25 rearrangement with a 1.22 Mb interstitial deletion. Our study demonstrates the utility and limitations of using oligonucleotide-based aCGH and SNP array technologies of increasing resolutions in order to identify complex DNA rearrangements and gene disruptions. PMID:21204225

  16. Automated detection and quantitation of bacterial RNA by using electrical microarrays.

    PubMed

    Elsholz, B; Wörl, R; Blohm, L; Albers, J; Feucht, H; Grunwald, T; Jürgen, B; Schweder, T; Hintsche, Rainer

    2006-07-15

    Low-density electrical 16S rRNA specific oligonucleotide microarrays and an automated analysis system have been developed for the identification and quantitation of pathogens. The pathogens are Escherichia coli, Pseudomonas aeruginosa, Enterococcus faecalis, Staphylococcus aureus, and Staphylococcus epidermidis, which are typically involved in urinary tract infections. Interdigitated gold array electrodes (IDA-electrodes), which have structures in the nanometer range, have been used for very sensitive analysis. Thiol-modified oligonucleotides are immobilized on the gold IDA as capture probes. They mediate the specific recognition of the target 16S rRNA by hybridization. Additionally three unlabeled oligonucleotides are hybridized in close proximity to the capturing site. They are supporting molecules, because they improve the RNA hybridization at the capturing site. A biotin labeled detector oligonucleotide is also allowed to hybridize to the captured RNA sequence. The biotin labels enable the binding of avidin alkaline phophatase conjugates. The phosphatase liberates the electrochemical mediator p-aminophenol from its electrically inactive phosphate derivative. The electrical signals were generated by amperometric redox cycling and detected by a unique multipotentiostat. The read out signals of the microarray are position specific current and change over time in proportion to the analyte concentration. If two additional biotins are introduced into the affinity binding complex via the supporting oligonucleotides, the sensitivity of the assays increase more than 60%. The limit of detection of Escherichia coli total RNA has been determined to be 0.5 ng/microL. The control of fluidics for variable assay formats as well as the multichannel electrical read out and data handling have all been fully automated. The fast and easy procedure does not require any amplification of the targeted nucleic acids by PCR.

  17. Rapid and accurate synthesis of TALE genes from synthetic oligonucleotides.

    PubMed

    Wang, Fenghua; Zhang, Hefei; Gao, Jingxia; Chen, Fengjiao; Chen, Sijie; Zhang, Cuizhen; Peng, Gang

    2016-01-01

    Custom synthesis of transcription activator-like effector (TALE) genes has relied upon plasmid libraries of pre-fabricated TALE-repeat monomers or oligomers. Here we describe a novel synthesis method that directly incorporates annealed synthetic oligonucleotides into the TALE-repeat units. Our approach utilizes iterative sets of oligonucleotides and a translational frame check strategy to ensure the high efficiency and accuracy of TALE-gene synthesis. TALE arrays of more than 20 repeats can be constructed, and the majority of the synthesized constructs have perfect sequences. In addition, this novel oligonucleotide-based method can readily accommodate design changes to the TALE repeats. We demonstrated an increased gene targeting efficiency against a genomic site containing a potentially methylated cytosine by incorporating non-conventional repeat variable di-residue (RVD) sequences.

  18. Microwell Array Method for Rapid Generation of Uniform Agarose Droplets and Beads for Single Molecule Analysis.

    PubMed

    Li, Xingrui; Zhang, Dongfeng; Zhang, Huimin; Guan, Zhichao; Song, Yanling; Liu, Ruochen; Zhu, Zhi; Yang, Chaoyong

    2018-02-20

    Compartmentalization of aqueous samples in uniform emulsion droplets has proven to be a useful tool for many chemical, biological, and biomedical applications. Herein, we introduce an array-based emulsification method for rapid and easy generation of monodisperse agarose-in-oil droplets in a PDMS microwell array. The microwells are filled with agarose solution, and subsequent addition of hot oil results in immediate formation of agarose droplets due to the surface-tension of the liquid solution. Because droplet size is determined solely by the array unit dimensions, uniform droplets with preselectable diameters ranging from 20 to 100 μm can be produced with relative standard deviations less than 3.5%. The array-based droplet generation method was used to perform digital PCR for absolute DNA quantitation. The array-based droplet isolation and sol-gel switching property of agarose enable formation of stable beads by chilling the droplet array at -20 °C, thus, maintaining the monoclonality of each droplet and facilitating the selective retrieval of desired droplets. The monoclonality of droplets was demonstrated by DNA sequencing and FACS analysis, suggesting the robustness and flexibility of the approach for single molecule amplification and analysis. We believe our approach will lead to new possibilities for a great variety of applications, such as single-cell gene expression studies, aptamer selection, and oligonucleotide analysis.

  19. Assessing differential gene expression with small sample sizes in oligonucleotide arrays using a mean-variance model.

    PubMed

    Hu, Jianhua; Wright, Fred A

    2007-03-01

    The identification of the genes that are differentially expressed in two-sample microarray experiments remains a difficult problem when the number of arrays is very small. We discuss the implications of using ordinary t-statistics and examine other commonly used variants. For oligonucleotide arrays with multiple probes per gene, we introduce a simple model relating the mean and variance of expression, possibly with gene-specific random effects. Parameter estimates from the model have natural shrinkage properties that guard against inappropriately small variance estimates, and the model is used to obtain a differential expression statistic. A limiting value to the positive false discovery rate (pFDR) for ordinary t-tests provides motivation for our use of the data structure to improve variance estimates. Our approach performs well compared to other proposed approaches in terms of the false discovery rate.

  20. Current progress on aptamer-targeted oligonucleotide therapeutics

    PubMed Central

    Dassie, Justin P; Giangrande, Paloma H

    2014-01-01

    Exploiting the power of the RNAi pathway through the use of therapeutic siRNA drugs has remarkable potential for treating a vast array of human disease conditions. However, difficulties in delivery of these and similar nucleic acid-based pharmacological agents to appropriate organs or tissues, remains a major impediment to their broad clinical application. Synthetic nucleic acid ligands (aptamers) have emerged as effective delivery vehicles for therapeutic oligonucleotides, including siRNAs. In this review, we summarize recent attractive developments in creatively employing cell-internalizing aptamers to deliver therapeutic oligonucleotides (e.g., siRNAs, miRNAs, anti-miRs and antisense oligos) to target cells. We also discuss advancements in aptamer-siRNA chimera technology, as well as, aptamer-functionalized nanoparticles for siRNA delivery. In addition, the challenges and future prospects of aptamer-targeted oligonucleotide drugs for clinical translation are further highlighted. PMID:24304250

  1. Optimization of oligonucleotide arrays and RNA amplification protocols for analysis of transcript structure and alternative splicing.

    PubMed

    Castle, John; Garrett-Engele, Phil; Armour, Christopher D; Duenwald, Sven J; Loerch, Patrick M; Meyer, Michael R; Schadt, Eric E; Stoughton, Roland; Parrish, Mark L; Shoemaker, Daniel D; Johnson, Jason M

    2003-01-01

    Microarrays offer a high-resolution means for monitoring pre-mRNA splicing on a genomic scale. We have developed a novel, unbiased amplification protocol that permits labeling of entire transcripts. Also, hybridization conditions, probe characteristics, and analysis algorithms were optimized for detection of exons, exon-intron edges, and exon junctions. These optimized protocols can be used to detect small variations and isoform mixtures, map the tissue specificity of known human alternative isoforms, and provide a robust, scalable platform for high-throughput discovery of alternative splicing.

  2. Optimization of oligonucleotide arrays and RNA amplification protocols for analysis of transcript structure and alternative splicing

    PubMed Central

    Castle, John; Garrett-Engele, Phil; Armour, Christopher D; Duenwald, Sven J; Loerch, Patrick M; Meyer, Michael R; Schadt, Eric E; Stoughton, Roland; Parrish, Mark L; Shoemaker, Daniel D; Johnson, Jason M

    2003-01-01

    Microarrays offer a high-resolution means for monitoring pre-mRNA splicing on a genomic scale. We have developed a novel, unbiased amplification protocol that permits labeling of entire transcripts. Also, hybridization conditions, probe characteristics, and analysis algorithms were optimized for detection of exons, exon-intron edges, and exon junctions. These optimized protocols can be used to detect small variations and isoform mixtures, map the tissue specificity of known human alternative isoforms, and provide a robust, scalable platform for high-throughput discovery of alternative splicing. PMID:14519201

  3. Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array

    USDA-ARS?s Scientific Manuscript database

    A large number of genetic variations have been identified in rice. Such variations must in many cases control phenotypic differences in abiotic stress tolerance and other traits. A single feature polymorphism (SFP) is an oligonucleotide array-based polymorphism which can be used for identification o...

  4. Linear model for fast background subtraction in oligonucleotide microarrays.

    PubMed

    Kroll, K Myriam; Barkema, Gerard T; Carlon, Enrico

    2009-11-16

    One important preprocessing step in the analysis of microarray data is background subtraction. In high-density oligonucleotide arrays this is recognized as a crucial step for the global performance of the data analysis from raw intensities to expression values. We propose here an algorithm for background estimation based on a model in which the cost function is quadratic in a set of fitting parameters such that minimization can be performed through linear algebra. The model incorporates two effects: 1) Correlated intensities between neighboring features in the chip and 2) sequence-dependent affinities for non-specific hybridization fitted by an extended nearest-neighbor model. The algorithm has been tested on 360 GeneChips from publicly available data of recent expression experiments. The algorithm is fast and accurate. Strong correlations between the fitted values for different experiments as well as between the free-energy parameters and their counterparts in aqueous solution indicate that the model captures a significant part of the underlying physical chemistry.

  5. Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process

    PubMed Central

    LeProust, Emily M.; Peck, Bill J.; Spirin, Konstantin; McCuen, Heather Brummel; Moore, Bridget; Namsaraev, Eugeni; Caruthers, Marvin H.

    2010-01-01

    We have achieved the ability to synthesize thousands of unique, long oligonucleotides (150mers) in fmol amounts using parallel synthesis of DNA on microarrays. The sequence accuracy of the oligonucleotides in such large-scale syntheses has been limited by the yields and side reactions of the DNA synthesis process used. While there has been significant demand for libraries of long oligos (150mer and more), the yields in conventional DNA synthesis and the associated side reactions have previously limited the availability of oligonucleotide pools to lengths <100 nt. Using novel array based depurination assays, we show that the depurination side reaction is the limiting factor for the synthesis of libraries of long oligonucleotides on Agilent Technologies’ SurePrint® DNA microarray platform. We also demonstrate how depurination can be controlled and reduced by a novel detritylation process to enable the synthesis of high quality, long (150mer) oligonucleotide libraries and we report the characterization of synthesis efficiency for such libraries. Oligonucleotide libraries prepared with this method have changed the economics and availability of several existing applications (e.g. targeted resequencing, preparation of shRNA libraries, site-directed mutagenesis), and have the potential to enable even more novel applications (e.g. high-complexity synthetic biology). PMID:20308161

  6. Precise and selective sensing of DNA-DNA hybridization by graphene/Si-nanowires diode-type biosensors.

    PubMed

    Kim, Jungkil; Park, Shin-Young; Kim, Sung; Lee, Dae Hun; Kim, Ju Hwan; Kim, Jong Min; Kang, Hee; Han, Joong-Soo; Park, Jun Woo; Lee, Hosun; Choi, Suk-Ho

    2016-08-18

    Single-Si-nanowire (NW)-based DNA sensors have been recently developed, but their sensitivity is very limited because of high noise signals, originating from small source-drain current of the single Si NW. Here, we demonstrate that chemical-vapor-deposition-grown large-scale graphene/surface-modified vertical-Si-NW-arrays junctions can be utilized as diode-type biosensors for highly-sensitive and -selective detection of specific oligonucleotides. For this, a twenty-seven-base-long synthetic oligonucleotide, which is a fragment of human DENND2D promoter sequence, is first decorated as a probe on the surface of vertical Si-NW arrays, and then the complementary oligonucleotide is hybridized to the probe. This hybridization gives rise to a doping effect on the surface of Si NWs, resulting in the increase of the current in the biosensor. The current of the biosensor increases from 19 to 120% as the concentration of the target DNA varies from 0.1 to 500 nM. In contrast, such biosensing does not come into play by the use of the oligonucleotide with incompatible or mismatched sequences. Similar results are observed from photoluminescence microscopic images and spectra. The biosensors show very-uniform current changes with standard deviations ranging ~1 to ~10% by ten-times endurance tests. These results are very promising for their applications in accurate, selective, and stable biosensing.

  7. Large-Scale Interaction Profiling of Protein Domains Through Proteomic Peptide-Phage Display Using Custom Peptidomes.

    PubMed

    Seo, Moon-Hyeong; Nim, Satra; Jeon, Jouhyun; Kim, Philip M

    2017-01-01

    Protein-protein interactions are essential to cellular functions and signaling pathways. We recently combined bioinformatics and custom oligonucleotide arrays to construct custom-made peptide-phage libraries for screening peptide-protein interactions, an approach we call proteomic peptide-phage display (ProP-PD). In this chapter, we describe protocols for phage display for the identification of natural peptide binders for a given protein. We finally describe deep sequencing for the analysis of the proteomic peptide-phage display.

  8. Towards MRI microarrays.

    PubMed

    Hall, Andrew; Mundell, Victoria J; Blanco-Andujar, Cristina; Bencsik, Martin; McHale, Glen; Newton, Michael I; Cave, Gareth W V

    2010-04-14

    Superparamagnetic iron oxide nanometre scale particles have been utilised as contrast agents to image staked target binding oligonucleotide arrays using MRI to correlate the signal intensity and T(2)* relaxation times in different NMR fluids.

  9. Arrays of carbon nanofibers as a platform for biosensing at the molecular level and for tissue engineering and implantation.

    PubMed

    Koehne, Jessica E; Chen, Hua; Cassell, Alan; Liu, Gang-yu; Li, Jun; Meyyappan, M

    2009-01-01

    Arrays of Carbon nanofibers (CNFs) harness the advantages of individual CNF as well the collective property of assemblies, which made them promising materials in biosensing and tissue engineering or implantation. Here, we report two studies to explore the applications of vertically aligned CNFs. First, a nanoelectrode array (NEA) based on vertically aligned CNFs embedded in SiO(2) is used for ultrasensitive DNA detection. Oligonucleotide probes are selectively functionalized at the open ends of the CNFs and specifically hybridized with oligonucleotide targets. The guanine groups are employed as the signal moieties in the electrochemical measurements. Ru(bpy)(3)(2+) mediator is used to further amplify the guanine oxidation signal. The hybridization of less than approximately 1000 molecules of PCR amplified DNA targets are detected electrochemically by combining the CNF nanoelectrode array with the Ru(bpy)(3)(2+) amplification mechanism. Second, the SiO(2) matrix was etched back to produce needle-like protruding nanoelectrode arrays to be used as cell interfacing fibers for investigating gene transfection, electrical stimulation and detection of cellular processes. Our goal is to take advantage of the nanostructure of CNFs for unconventional biomolecular studies requiring ultrahigh sensitivity, high-degree of miniaturization and selective biofunctionalization.

  10. Multiplexed screening assay for mRNA combining nuclease protection with luminescent array detection.

    PubMed

    Martel, Ralph R; Botros, Ihab W; Rounseville, Matthew P; Hinton, James P; Staples, Robin R; Morales, David A; Farmer, John B; Seligmann, Bruce E

    2002-11-01

    The principles and performance are described for the ArrayPlate mRNA assay, a multiplexed mRNA assay for high-throughput and high-content screening and drug development. THP-1 monocytes grown and subjected to compound treatments in 96-well plates were subjected to a multiplexed nuclease protection assay in situ. The nuclease protection assay destroyed all cell-derived mRNA, but left intact stoichiometric amounts of 16 target-specific oligonucleotide probes. Upon transfer of processed cell lysates to a microplate that contained a 16-element oligonucleotide array at the bottom of each well, the various probe species were separated by immobilization at predefined elements of the array. Quantitative detection of array-bound probes was by enzyme-mediated chemiluminescence. A high-resolution charge-coupled device imager was used for the simultaneous readout of all 1536 array elements in a 96-well plate. For the measurement of 16 genes in samples of 25000 cells, the average standard deviation from well to well within a plate was 8.6% of signal intensity and was 10.8% from plate to plate. Assay response was linear and reproducibility was constant for all detected genes in samples ranging from 1000 to 50000 cells. When THP-1 monocytes were differentiated with phorbol ester and subsequently activated with bacterial lipopolysaccharide that contained different concentrations of dexamethasone, dose-dependent effects of dexamethasone on the mRNA levels of several genes were observed.

  11. High-density, microsphere-based fiber optic DNA microarrays.

    PubMed

    Epstein, Jason R; Leung, Amy P K; Lee, Kyong Hoon; Walt, David R

    2003-05-01

    A high-density fiber optic DNA microarray has been developed consisting of oligonucleotide-functionalized, 3.1-microm-diameter microspheres randomly distributed on the etched face of an imaging fiber bundle. The fiber bundles are comprised of 6000-50000 fused optical fibers and each fiber terminates with an etched well. The microwell array is capable of housing complementary-sized microspheres, each containing thousands of copies of a unique oligonucleotide probe sequence. The array fabrication process results in random microsphere placement. Determining the position of microspheres in the random array requires an optical encoding scheme. This array platform provides many advantages over other array formats. The microsphere-stock suspension concentration added to the etched fiber can be controlled to provide inherent sensor redundancy. Examining identical microspheres has a beneficial effect on the signal-to-noise ratio. As other sequences of interest are discovered, new microsphere sensing elements can be added to existing microsphere pools and new arrays can be fabricated incorporating the new sequences without altering the existing detection capabilities. These microarrays contain the smallest feature sizes (3 microm) of any DNA array, allowing interrogation of extremely small sample volumes. Reducing the feature size results in higher local target molecule concentrations, creating rapid and highly sensitive assays. The microsphere array platform is also flexible in its applications; research has included DNA-protein interaction profiles, microbial strain differentiation, and non-labeled target interrogation with molecular beacons. Fiber optic microsphere-based DNA microarrays have a simple fabrication protocol enabling their expansion into other applications, such as single cell-based assays.

  12. Novel Multiplex Oligonucleotide-Conjugated Bead Suspension Array for Rapid Identification of Enterovirus 71 Subgenogroups▿ §

    PubMed Central

    Wu, Y.; Tan, E. L.; Yeo, A.; Chan, K. P.; Nishimura, H.; Cardosa, M. J.; Poh, C. L.; Quak, S. H.; Chow, Vincent T.

    2011-01-01

    A high-throughput multiplex bead suspension array was developed for the rapid subgenogrouping of EV71 strains, based on single nucleotide polymorphisms observed within the VP1 region with a high sensitivity as low as 1 PFU. Of 33 viral isolates and 55 clinical samples, all EV71 strains were successfully detected and correctly subgenogrouped. PMID:21084510

  13. A new normalizing algorithm for BAC CGH arrays with quality control metrics.

    PubMed

    Miecznikowski, Jeffrey C; Gaile, Daniel P; Liu, Song; Shepherd, Lori; Nowak, Norma

    2011-01-01

    The main focus in pin-tip (or print-tip) microarray analysis is determining which probes, genes, or oligonucleotides are differentially expressed. Specifically in array comparative genomic hybridization (aCGH) experiments, researchers search for chromosomal imbalances in the genome. To model this data, scientists apply statistical methods to the structure of the experiment and assume that the data consist of the signal plus random noise. In this paper we propose "SmoothArray", a new method to preprocess comparative genomic hybridization (CGH) bacterial artificial chromosome (BAC) arrays and we show the effects on a cancer dataset. As part of our R software package "aCGHplus," this freely available algorithm removes the variation due to the intensity effects, pin/print-tip, the spatial location on the microarray chip, and the relative location from the well plate. removal of this variation improves the downstream analysis and subsequent inferences made on the data. Further, we present measures to evaluate the quality of the dataset according to the arrayer pins, 384-well plates, plate rows, and plate columns. We compare our method against competing methods using several metrics to measure the biological signal. With this novel normalization algorithm and quality control measures, the user can improve their inferences on datasets and pinpoint problems that may arise in their BAC aCGH technology.

  14. Parallel gene analysis with allele-specific padlock probes and tag microarrays

    PubMed Central

    Banér, Johan; Isaksson, Anders; Waldenström, Erik; Jarvius, Jonas; Landegren, Ulf; Nilsson, Mats

    2003-01-01

    Parallel, highly specific analysis methods are required to take advantage of the extensive information about DNA sequence variation and of expressed sequences. We present a scalable laboratory technique suitable to analyze numerous target sequences in multiplexed assays. Sets of padlock probes were applied to analyze single nucleotide variation directly in total genomic DNA or cDNA for parallel genotyping or gene expression analysis. All reacted probes were then co-amplified and identified by hybridization to a standard tag oligonucleotide array. The technique was illustrated by analyzing normal and pathogenic variation within the Wilson disease-related ATP7B gene, both at the level of DNA and RNA, using allele-specific padlock probes. PMID:12930977

  15. Combinatorial algorithms for design of DNA arrays.

    PubMed

    Hannenhalli, Sridhar; Hubell, Earl; Lipshutz, Robert; Pevzner, Pavel A

    2002-01-01

    Optimal design of DNA arrays requires the development of algorithms with two-fold goals: reducing the effects caused by unintended illumination (border length minimization problem) and reducing the complexity of masks (mask decomposition problem). We describe algorithms that reduce the number of rectangles in mask decomposition by 20-30% as compared to a standard array design under the assumption that the arrangement of oligonucleotides on the array is fixed. This algorithm produces provably optimal solution for all studied real instances of array design. We also address the difficult problem of finding an arrangement which minimizes the border length and come up with a new idea of threading that significantly reduces the border length as compared to standard designs.

  16. MALDI MS analysis of oligonucleotides: desalting by functional magnetite beads using microwave-assisted extraction.

    PubMed

    Chen, Wei-Yu; Chen, Yu-Chie

    2007-11-01

    The presence of alkali cation adductions of oligonucleotides commonly deteriorates matrix-assisted laser desorption/ionization (MALDI) mass spectra. Thus, desalting is required for oligonucleotide samples prior to MALDI MS analysis in order to prevent the mass spectra from developing poor quality. In this paper, we demonstrate a new approach to extract traces of oligonucleotides from aqueous solutions containing high concentrations of salts using microwave-assisted extraction. The C18-presenting magnetite beads, capable of absorbing microwave irradiation, are used as affinity probes for oligonucleotides with the addition of triethylammonium acetate as the counterions. This new microwave-assisted extraction approach using magnetite beads as the trapping agents and as microwave-absorbers has been demonstrated to be very effective in the selective binding of oligonucleotides from aqueous solutions. The extraction of oligonucleotides from solutions onto the C18-presenting magnetite beads takes only 30 s to enrich oligonucleotides in sufficient quantities for MALDI MS analysis. After using this desalting approach, alkali cation adductions of oligonucleotides are dramatically reduced in the MALDI mass spectra. The presence of saturated NaCl (approximately 6 M) in the oligonucleotide sample is tolerated without degrading the mass spectra. The detection limit for d(A)6 is approximately 2.8 fmol.

  17. Identification of transcribed sequences in Arabidopsis thaliana by using high-resolution genome tiling arrays

    PubMed Central

    Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Sethi, Himanshu; Liang, Shoudan; Nelson, David C.; Hegeman, Adrian; Nelson, Clark; Rancour, David; Bednarek, Sebastian; Ulrich, Eldon L.; Zhao, Qin; Wrobel, Russell L.; Newman, Craig S.; Fox, Brian G.; Phillips, George N.; Markley, John L.; Sussman, Michael R.

    2005-01-01

    Using a maskless photolithography method, we produced DNA oligonucleotide microarrays with probe sequences tiled throughout the genome of the plant Arabidopsis thaliana. RNA expression was determined for the complete nuclear, mitochondrial, and chloroplast genomes by tiling 5 million 36-mer probes. These probes were hybridized to labeled mRNA isolated from liquid grown T87 cells, an undifferentiated Arabidopsis cell culture line. Transcripts were detected from at least 60% of the nearly 26,330 annotated genes, which included 151 predicted genes that were not identified previously by a similar genome-wide hybridization study on four different cell lines. In comparison with previously published results with 25-mer tiling arrays produced by chromium masking-based photolithography technique, 36-mer oligonucleotide probes were found to be more useful in identifying intron–exon boundaries. Using two-dimensional HPLC tandem mass spectrometry, a small-scale proteomic analysis was performed with the same cells. A large amount of strongly hybridizing RNA was found in regions “antisense” to known genes. Similarity of antisense activities between the 25-mer and 36-mer data sets suggests that it is a reproducible and inherent property of the experiments. Transcription activities were also detected for many of the intergenic regions and the small RNAs, including tRNA, small nuclear RNA, small nucleolar RNA, and microRNA. Expression of tRNAs correlates with genome-wide amino acid usage. PMID:15755812

  18. Identification of transcribed sequences in Arabidopsis thaliana by using high-resolution genome tiling arrays

    NASA Technical Reports Server (NTRS)

    Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Sethi, Himanshu; Liang, Shoudan; Nelson, David C.; Hegeman, Adrian; Nelson, Clark; Rancour, David; Bednarek, Sebastian; hide

    2005-01-01

    Using a maskless photolithography method, we produced DNA oligonucleotide microarrays with probe sequences tiled throughout the genome of the plant Arabidopsis thaliana. RNA expression was determined for the complete nuclear, mitochondrial, and chloroplast genomes by tiling 5 million 36-mer probes. These probes were hybridized to labeled mRNA isolated from liquid grown T87 cells, an undifferentiated Arabidopsis cell culture line. Transcripts were detected from at least 60% of the nearly 26,330 annotated genes, which included 151 predicted genes that were not identified previously by a similar genome-wide hybridization study on four different cell lines. In comparison with previously published results with 25-mer tiling arrays produced by chromium masking-based photolithography technique, 36-mer oligonucleotide probes were found to be more useful in identifying intron-exon boundaries. Using two-dimensional HPLC tandem mass spectrometry, a small-scale proteomic analysis was performed with the same cells. A large amount of strongly hybridizing RNA was found in regions "antisense" to known genes. Similarity of antisense activities between the 25-mer and 36-mer data sets suggests that it is a reproducible and inherent property of the experiments. Transcription activities were also detected for many of the intergenic regions and the small RNAs, including tRNA, small nuclear RNA, small nucleolar RNA, and microRNA. Expression of tRNAs correlates with genome-wide amino acid usage.

  19. Mapping of RNA accessible sites by extension of random oligonucleotide libraries with reverse transcriptase.

    PubMed Central

    Allawi, H T; Dong, F; Ip, H S; Neri, B P; Lyamichev, V I

    2001-01-01

    A rapid and simple method for determining accessible sites in RNA that is independent of the length of target RNA and does not require RNA labeling is described. In this method, target RNA is allowed to hybridize with sequence-randomized libraries of DNA oligonucleotides linked to a common tag sequence at their 5'-end. Annealed oligonucleotides are extended with reverse transcriptase and the extended products are then amplified by using PCR with a primer corresponding to the tag sequence and a second primer specific to the target RNA sequence. We used the combination of both the lengths of the RT-PCR products and the location of the binding site of the RNA-specific primer to determine which regions of the RNA molecules were RNA extendible sites, that is, sites available for oligonucleotide binding and extension. We then employed this reverse transcription with the random oligonucleotide libraries (RT-ROL) method to determine the accessible sites on four mRNA targets, human activated ras (ha-ras), human intercellular adhesion molecule-1 (ICAM-1), rabbit beta-globin, and human interferon-gamma (IFN-gamma). Our results were concordant with those of other researchers who had used RNase H cleavage or hybridization with arrays of oligonucleotides to identify accessible sites on some of these targets. Further, we found good correlation between sites when we compared the location of extendible sites identified by RT-ROL with hybridization sites of effective antisense oligonucleotides on ICAM-1 mRNA in antisense inhibition studies. Finally, we discuss the relationship between RNA extendible sites and RNA accessibility. PMID:11233988

  20. Gene chips and arrays revealed: a primer on their power and their uses.

    PubMed

    Watson, S J; Akil, H

    1999-03-01

    This article provides an overview and general explanation of the rapidly developing area of gene chips and expression array technology. These are methods targeted at allowing the simultaneous study of thousands of genes or messenger RNAs under various physiological and pathological states. Their technical basis grows from the Human Genome Project. Both methods place DNA strands on glass computer chips (or microscope slides). Expression arrays start with complementary DNA (cDNA) clones derived from the EST data base, whereas Gene Chips synthesize oligonucleotides directly on the chip itself. Both are analyzed using image analysis systems, are capable of reading values from two different individuals at any one site, and can yield quantitative data for thousands of genes or mRNAs per slide. These methods promise to revolutionize molecular biology, cell biology, neuroscience and psychiatry. It is likely that this technology will radically open up our ability to study the actions and structure of the multiple genes involved in the complex genetics of brain disorders.

  1. Refinement of light-responsive transcript lists using rice oligonucleotide arrays: evaluation of gene-redundancy.

    PubMed

    Jung, Ki-Hong; Dardick, Christopher; Bartley, Laura E; Cao, Peijian; Phetsom, Jirapa; Canlas, Patrick; Seo, Young-Su; Shultz, Michael; Ouyang, Shu; Yuan, Qiaoping; Frank, Bryan C; Ly, Eugene; Zheng, Li; Jia, Yi; Hsia, An-Ping; An, Kyungsook; Chou, Hui-Hsien; Rocke, David; Lee, Geun Cheol; Schnable, Patrick S; An, Gynheung; Buell, C Robin; Ronald, Pamela C

    2008-10-06

    Studies of gene function are often hampered by gene-redundancy, especially in organisms with large genomes such as rice (Oryza sativa). We present an approach for using transcriptomics data to focus functional studies and address redundancy. To this end, we have constructed and validated an inexpensive and publicly available rice oligonucleotide near-whole genome array, called the rice NSF45K array. We generated expression profiles for light- vs. dark-grown rice leaf tissue and validated the biological significance of the data by analyzing sources of variation and confirming expression trends with reverse transcription polymerase chain reaction. We examined trends in the data by evaluating enrichment of gene ontology terms at multiple false discovery rate thresholds. To compare data generated with the NSF45K array with published results, we developed publicly available, web-based tools (www.ricearray.org). The Oligo and EST Anatomy Viewer enables visualization of EST-based expression profiling data for all genes on the array. The Rice Multi-platform Microarray Search Tool facilitates comparison of gene expression profiles across multiple rice microarray platforms. Finally, we incorporated gene expression and biochemical pathway data to reduce the number of candidate gene products putatively participating in the eight steps of the photorespiration pathway from 52 to 10, based on expression levels of putatively functionally redundant genes. We confirmed the efficacy of this method to cope with redundancy by correctly predicting participation in photorespiration of a gene with five paralogs. Applying these methods will accelerate rice functional genomics.

  2. Carbon Nanotube Nanoelectrode Array as an Electronic Chip for Ultrasensitive Label-free DNA Detection

    NASA Technical Reports Server (NTRS)

    Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Fan, Wendy; Ye, Qi; Han, Jie; Meyyappan, M.

    2003-01-01

    A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in SiO2 is used for ultrasensitive DNA detection. Characteristic nanoelectrode behavior is observed using low-density MWNT arrays for measuring both bulk and surface immobilized redox species such as K4Fe(CN)6 and ferrocene derivatives. The open-end of MWNTs are found to present similar properties as graphite edge-plane electrodes with wide potential window, flexible chemical functionalities, and good biocompatibility. BRCA1 related oligonucleotide probes with 18 bp are selectively functionalized at the open ends of the nanotube array and specifically hybridized with oligonucleotide targets incorporated with a polyG tag. The guanine groups are employed as the signal moieties in the electrochemical measurements. R(bpy)(sup 2+, sub 3) mediator is used to further amplify the guanine oxidation signal. The hybridization of sub-attomoles of DNA targets is detected electrochemically by combining the MWNT nanoelectrode array with the R(bpy)(sup 2+, sub 3) amplification mechanism. This technique was employed for direct electrochemical detection of label-free PCR amplicon from a healthy donor through specific hybridization with the BRCA1 probe. The detection limit is estimated to be less than 1000 DNA molecules since abundant guanine bases in the PCR amplicon provides a large signal. This system provides a general platform for rapid molecular diagnostics in applications requiring ultrahigh sensitivity, high-degree of miniaturization, and simple sample preparation, and low-cost operation.

  3. Paper-based solid-phase multiplexed nucleic acid hybridization assay with tunable dynamic range using immobilized quantum dots as donors in fluorescence resonance energy transfer.

    PubMed

    Noor, M Omair; Krull, Ulrich J

    2013-08-06

    A multiplexed solid-phase nucleic acid hybridization assay on a paper-based platform is presented using multicolor immobilized quantum dots (QDs) as donors in fluorescence resonance energy transfer (FRET). The surface of paper was modified with imidazole groups to immobilize two types of QD-probe oligonucleotide conjugates that were assembled in solution. Green-emitting QDs (gQDs) and red-emitting QDs (rQDs) served as donors with Cy3 and Alexa Fluor 647 (A647) acceptors. The gQD/Cy3 FRET pair served as an internal standard, while the rQD/A647 FRET pair served as a detection channel, combining the control and analytical test zones in one physical location. Hybridization of dye-labeled oligonucleotide targets provided the proximity for FRET sensitized emission from the acceptor dyes, which served as an analytical signal. Hybridization assays in the multicolor format provided a limit of detection of 90 fmol and an upper limit of dynamic range of 3.5 pmol. The use of an array of detection zones was designed to provide improved analytical figures of merit compared to that which could be achieved on one type of array design in terms of relative concentration of multicolor QDs. The hybridization assays showed excellent resistance to nonspecific adsorption of oligonucleotides. Selectivity of the two-plex hybridization assay was demonstrated by single nucleotide polymorphism (SNP) detection at a contrast ratio of 50:1. Additionally, it is shown that the use of preformed QD-probe oligonucleotide conjugates and consideration of the relative number density of the two types of QD-probe conjugates in the two-color assay format is advantageous to maximize assay sensitivity and the upper limit of dynamic range.

  4. Modulation of Stat3 Alternative Splicing in Breast Cancer

    DTIC Science & Technology

    2010-09-01

    using morpholino oligonucleotides covalently linked to an octaguanidine dendrimer (vivo- morpholinos) [54]. Since delivery of vivo-morpholino oligos...Li, and S. Jiang, Vivo-Morpholinos: a non-peptide transporter delivers Morpholinos into a wide array of mouse tissues. Biotechniques, 2008. 45(6

  5. Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays

    PubMed Central

    Jin, Lian-Qun; Li, Jun-Wen; Wang, Sheng-Qi; Chao, Fu-Huan; Wang, Xin-Wei; Yuan, Zheng-Quan

    2005-01-01

    AIM: To detect the common intestinal pathogenic bacteria quickly and accurately. METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays. RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified. CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, Proteus sp., Bacillus cereus, Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range, and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost. PMID:16437687

  6. Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

    NASA Astrophysics Data System (ADS)

    Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran

    2016-03-01

    Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.

  7. ASSESSING THE USE OF OLIGONUCLEOTIDE MICROARRAYS FOR FATHEAD MINNOW (PIMEPHALES PROMELAS) TO EXAMINE EXPOSURE VARIABLES

    EPA Science Inventory

    Microarray technology has proven to be a useful tool for analyzing the transcriptome of various organisms representing conditions such as disease states, developmental stages, and responses to chemical exposure. Although most commercially available arrays are limited to organism...

  8. Optimised laser microdissection of the human ocular surface epithelial regions for microarray studies

    PubMed Central

    2013-01-01

    Background The most important challenge of performing insitu transcriptional profiling of the human ocular surface epithelial regions is obtaining samples in sufficient amounts, without contamination from adjacent tissue, as the region of interest is microscopic and closely apposed to other tissues regions. We have effectively collected ocular surface (OS) epithelial tissue samples from the Limbal Epithelial Crypt (LEC), limbus, cornea and conjunctiva of post-mortem cadaver eyes with laser microdissection (LMD) technique for gene expression studies with spotted oligonucleotide microarrays and Gene 1.0 ST arrays. Methods Human donor eyes (4 pairs for spotted oligonucleotide microarrays, 3 pairs for Gene 1.0 ST arrays) consented for research were included in this study with due ethical approval of the Nottingham Research Ethics Committee. Eye retrieval was performed within 36 hours of post-mortem period. The dissected corneoscleral buttons were immersed in OCT media and frozen in liquid nitrogen and stored at −80°C till further use. Microscopic tissue sections of interest were taken on PALM slides and stained with Toluidine Blue for laser microdissection with PALM microbeam systems. Optimisation of the laser microdissection technique was crucial for efficient and cost effective sample collection. Results The starting concentration of RNA as stipulated by the protocol of microarray platforms was taken as the cut-off concentration of RNA samples in our studies. The area of LMD tissue processed for spotted oligonucleotide microarray study ranged from 86,253 μm2 in LEC to 392,887 μm2 in LEC stroma. The RNA concentration of the LMD samples ranged from 22 to 92 pg/μl. The recommended starting concentration of the RNA samples used for Gene 1.0 ST arrays was 6 ng/5 μl. To achieve the desired RNA concentration the area of ocular surface epithelial tissue sample processed for the Gene 1.0 ST array experiments was approximately 100,0000 μm2 to 130,0000 μm2. RNA concentration of these samples ranged from 10.88 ng/12 μl to 25.8 ng/12 μl, with the RNA integrity numbers (RIN) for these samples from 3.3 to 7.9. RNA samples with RIN values below 2, that had failed to amplify satisfactorily were discarded. Conclusions The optimised protocol for sample collection and laser microdissection improved the RNA yield of the insitu ocular surface epithelial regions for effective microarray studies on spotted oligonucleotide and affymetrix platforms. PMID:24160452

  9. Combined array CGH plus SNP genome analyses in a single assay for optimized clinical testing

    PubMed Central

    Wiszniewska, Joanna; Bi, Weimin; Shaw, Chad; Stankiewicz, Pawel; Kang, Sung-Hae L; Pursley, Amber N; Lalani, Seema; Hixson, Patricia; Gambin, Tomasz; Tsai, Chun-hui; Bock, Hans-Georg; Descartes, Maria; Probst, Frank J; Scaglia, Fernando; Beaudet, Arthur L; Lupski, James R; Eng, Christine; Wai Cheung, Sau; Bacino, Carlos; Patel, Ankita

    2014-01-01

    In clinical diagnostics, both array comparative genomic hybridization (array CGH) and single nucleotide polymorphism (SNP) genotyping have proven to be powerful genomic technologies utilized for the evaluation of developmental delay, multiple congenital anomalies, and neuropsychiatric disorders. Differences in the ability to resolve genomic changes between these arrays may constitute an implementation challenge for clinicians: which platform (SNP vs array CGH) might best detect the underlying genetic cause for the disease in the patient? While only SNP arrays enable the detection of copy number neutral regions of absence of heterozygosity (AOH), they have limited ability to detect single-exon copy number variants (CNVs) due to the distribution of SNPs across the genome. To provide comprehensive clinical testing for both CNVs and copy-neutral AOH, we enhanced our custom-designed high-resolution oligonucleotide array that has exon-targeted coverage of 1860 genes with 60 000 SNP probes, referred to as Chromosomal Microarray Analysis – Comprehensive (CMA-COMP). Of the 3240 cases evaluated by this array, clinically significant CNVs were detected in 445 cases including 21 cases with exonic events. In addition, 162 cases (5.0%) showed at least one AOH region >10 Mb. We demonstrate that even though this array has a lower density of SNP probes than other commercially available SNP arrays, it reliably detected AOH events >10 Mb as well as exonic CNVs beyond the detection limitations of SNP genotyping. Thus, combining SNP probes and exon-targeted array CGH into one platform provides clinically useful genetic screening in an efficient manner. PMID:23695279

  10. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    PubMed

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  11. Genomic analysis using high density SNP based oligonucleotide arrays and MLPA provides a comprehensive analysis of INI1/SMARCB1 in malignant rhabdoid tumors

    PubMed Central

    Jackson, Eric M.; Sievert, Angela J.; Gai, Xiaowu; Hakonarson, Hakon; Judkins, Alexander R; Tooke, Laura; Perin, Juan Carlos; Xie, Hongbo; Shaikh, Tamim H.; Biegel, Jaclyn A.

    2009-01-01

    Translational Relevance Previous reports suggested that abnormalities of INI1 could be detected in 70–75% of malignant rhabdoid tumors. The mechanism of inactivation in the other 25% remained unclear. The goal of this study was to perform a high-resolution genomic analysis of a large series of rhabdoid tumors with the expectation of identifying additional loci related to the initiation or progression of these malignancies. We also developed a comprehensive set of assays, including a new MLPA assay, to interrogate the INI1 locus in 22q11.2. Intragenic deletions could be detected using the Illumina 550K Beadchip, whereas single exon deletions could be detected using MLPA. The current study demonstrates that with a multi-platform approach, alterations at the INI1 locus can be detected in almost all cases. Thus, appropriate molecular genetic testing can be used as an aid in the diagnosis and for treatment planning for most patients. Purpose A high-resolution genomic profiling and comprehensive targeted analysis of INI1/SMARCB1 of a large series of pediatric rhabdoid tumors was performed. The aim was to identify regions of copy number change and loss of heterozygosity that might pinpoint additional loci involved in the development or progression of rhabdoid tumors, and define the spectrum of genomic alterations of INI1 in this malignancy. Experimental Design A multi-platform approach, utilizing Illumina single nucleotide polymorphism (SNP) based oligonucleotide arrays, multiplex ligation dependent probe amplification (MLPA), fluorescence in situ hybridization (FISH), and coding sequence analysis was used to characterize genome wide copy number changes, loss of heterozygosity, and genomic alterations of INI1/SMARCB1 in a series of pediatric rhabdoid tumors. Results The bi-allelic alterations of INI1 that led to inactivation were elucidated in 50 of 51 tumors. INI1 inactivation was demonstrated by a variety of mechanisms, including deletions, mutations, and loss of heterozygosity. The results from the array studies highlighted the complexity of rearrangements of chromosome 22, compared to the low frequency of alterations involving the other chromosomes. Conclusions The results from the genome wide SNP-array analysis suggest that INI1 is the primary tumor suppressor gene involved in the development of rhabdoid tumors with no second locus identified. In addition, we did not identify hot spots for the breakpoints in sporadic tumors with deletions of chromosome 22q11.2. By employing a multimodality approach, the wide spectrum of alterations of INI1 can be identified in the majority of patients, which increases the clinical utility of molecular diagnostic testing. PMID:19276269

  12. Molecular testing for familial hypercholesterolaemia-associated mutations in a UK-based cohort: development of an NGS-based method and comparison with multiplex polymerase chain reaction and oligonucleotide arrays.

    PubMed

    Reiman, Anne; Pandey, Sarojini; Lloyd, Kate L; Dyer, Nigel; Khan, Mike; Crockard, Martin; Latten, Mark J; Watson, Tracey L; Cree, Ian A; Grammatopoulos, Dimitris K

    2016-11-01

    Background Detection of disease-associated mutations in patients with familial hypercholesterolaemia is crucial for early interventions to reduce risk of cardiovascular disease. Screening for these mutations represents a methodological challenge since more than 1200 different causal mutations in the low-density lipoprotein receptor has been identified. A number of methodological approaches have been developed for screening by clinical diagnostic laboratories. Methods Using primers targeting, the low-density lipoprotein receptor, apolipoprotein B, and proprotein convertase subtilisin/kexin type 9, we developed a novel Ion Torrent-based targeted re-sequencing method. We validated this in a West Midlands-UK small cohort of 58 patients screened in parallel with other mutation-targeting methods, such as multiplex polymerase chain reaction (Elucigene FH20), oligonucleotide arrays (Randox familial hypercholesterolaemia array) or the Illumina next-generation sequencing platform. Results In this small cohort, the next-generation sequencing method achieved excellent analytical performance characteristics and showed 100% and 89% concordance with the Randox array and the Elucigene FH20 assay. Investigation of the discrepant results identified two cases of mutation misclassification of the Elucigene FH20 multiplex polymerase chain reaction assay. A number of novel mutations not previously reported were also identified by the next-generation sequencing method. Conclusions Ion Torrent-based next-generation sequencing can deliver a suitable alternative for the molecular investigation of familial hypercholesterolaemia patients, especially when comprehensive mutation screening for rare or unknown mutations is required.

  13. Array painting reveals a high frequency of balanced translocations in breast cancer cell lines that break in cancer-relevant genes

    PubMed Central

    Howarth, KD; Blood, KA; Ng, BL; Beavis, JC; Chua, Y; Cooke, SL; Raby, S; Ichimura, K; Collins, VP; Carter, NP; Edwards, PAW

    2008-01-01

    Chromosome translocations in the common epithelial cancers are abundant, yet little is known about them. They have been thought to be almost all unbalanced and therefore dismissed as mostly mediating tumour suppressor loss. We present a comprehensive analysis by array painting of the chromosome translocations of breast cancer cell lines HCC1806, HCC1187 and ZR-75-30. In array painting, chromosomes are isolated by flow cytometry, amplified and hybridized to DNA microarrays. A total of 200 breakpoints were identified and all were mapped to 1Mb resolution on BAC arrays, then 40 selected breakpoints, including all balanced breakpoints, were further mapped on tiling-path BAC arrays or to around 2kb resolution using oligonucleotide arrays. Many more of the translocations were balanced at 1Mb resolution than expected, either reciprocal (eight in total) or balanced for at least one participating chromosome (19 paired breakpoints). Secondly, many of the breakpoints were at genes that are plausible targets of oncogenic translocation, including balanced breaks at CTCF, EP300/p300, and FOXP4. Two gene fusions were demonstrated, TAX1BP1-AHCY and RIF1-PKD1L1. Our results support the idea that chromosome rearrangements may play an important role in common epithelial cancers such as breast cancer. PMID:18084325

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Andersen, G.L.; He, Z.; DeSantis, T.Z.

    Microarrays have proven to be a useful and high-throughput method to provide targeted DNA sequence information for up to many thousands of specific genetic regions in a single test. A microarray consists of multiple DNA oligonucleotide probes that, under high stringency conditions, hybridize only to specific complementary nucleic acid sequences (targets). A fluorescent signal indicates the presence and, in many cases, the abundance of genetic regions of interest. In this chapter we will look at how microarrays are used in microbial ecology, especially with the recent increase in microbial community DNA sequence data. Of particular interest to microbial ecologists, phylogeneticmore » microarrays are used for the analysis of phylotypes in a community and functional gene arrays are used for the analysis of functional genes, and, by inference, phylotypes in environmental samples. A phylogenetic microarray that has been developed by the Andersen laboratory, the PhyloChip, will be discussed as an example of a microarray that targets the known diversity within the 16S rRNA gene to determine microbial community composition. Using multiple, confirmatory probes to increase the confidence of detection and a mismatch probe for every perfect match probe to minimize the effect of cross-hybridization by non-target regions, the PhyloChip is able to simultaneously identify any of thousands of taxa present in an environmental sample. The PhyloChip is shown to reveal greater diversity within a community than rRNA gene sequencing due to the placement of the entire gene product on the microarray compared with the analysis of up to thousands of individual molecules by traditional sequencing methods. A functional gene array that has been developed by the Zhou laboratory, the GeoChip, will be discussed as an example of a microarray that dynamically identifies functional activities of multiple members within a community. The recent version of GeoChip contains more than 24,000 50mer oligonucleotide probes and covers more than 10,000 gene sequences in 150 gene categories involved in carbon, nitrogen, sulfur, and phosphorus cycling, metal resistance and reduction, and organic contaminant degradation. GeoChip can be used as a generic tool for microbial community analysis, and also link microbial community structure to ecosystem functioning. Examples of the application of both arrays in different environmental samples will be described in the two subsequent sections.« less

  15. sigReannot: an oligo-set re-annotation pipeline based on similarities with the Ensembl transcripts and Unigene clusters.

    PubMed

    Casel, Pierrot; Moreews, François; Lagarrigue, Sandrine; Klopp, Christophe

    2009-07-16

    Microarray is a powerful technology enabling to monitor tens of thousands of genes in a single experiment. Most microarrays are now using oligo-sets. The design of the oligo-nucleotides is time consuming and error prone. Genome wide microarray oligo-sets are designed using as large a set of transcripts as possible in order to monitor as many genes as possible. Depending on the genome sequencing state and on the assembly state the knowledge of the existing transcripts can be very different. This knowledge evolves with the different genome builds and gene builds. Once the design is done the microarrays are often used for several years. The biologists working in EADGENE expressed the need of up-to-dated annotation files for the oligo-sets they share including information about the orthologous genes of model species, the Gene Ontology, the corresponding pathways and the chromosomal location. The results of SigReannot on a chicken micro-array used in the EADGENE project compared to the initial annotations show that 23% of the oligo-nucleotide gene annotations were not confirmed, 2% were modified and 1% were added. The interest of this up-to-date annotation procedure is demonstrated through the analysis of real data previously published. SigReannot uses the oligo-nucleotide design procedure criteria to validate the probe-gene link and the Ensembl transcripts as reference for annotation. It therefore produces a high quality annotation based on reference gene sets.

  16. A high-resolution, nucleosome position map of C. elegans reveals a lack of universal sequence-dictated positioning

    PubMed Central

    Valouev, Anton; Ichikawa, Jeffrey; Tonthat, Thaisan; Stuart, Jeremy; Ranade, Swati; Peckham, Heather; Zeng, Kathy; Malek, Joel A.; Costa, Gina; McKernan, Kevin; Sidow, Arend; Fire, Andrew; Johnson, Steven M.

    2008-01-01

    Using the massively parallel technique of sequencing by oligonucleotide ligation and detection (SOLiD; Applied Biosystems), we have assessed the in vivo positions of more than 44 million putative nucleosome cores in the multicellular genetic model organism Caenorhabditis elegans. These analyses provide a global view of the chromatin architecture of a multicellular animal at extremely high density and resolution. While we observe some degree of reproducible positioning throughout the genome in our mixed stage population of animals, we note that the major chromatin feature in the worm is a diversity of allowed nucleosome positions at the vast majority of individual loci. While absolute positioning of nucleosomes can vary substantially, relative positioning of nucleosomes (in a repeated array structure likely to be maintained at least in part by steric constraints) appears to be a significant property of chromatin structure. The high density of nucleosomal reads enabled a substantial extension of previous analysis describing the usage of individual oligonucleotide sequences along the span of the nucleosome core and linker. We release this data set, via the UCSC Genome Browser, as a resource for the high-resolution analysis of chromatin conformation and DNA accessibility at individual loci within the C. elegans genome. PMID:18477713

  17. Identification of characteristic oligonucleotides in the bacterial 16S ribosomal RNA sequence dataset

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; Willson, Richard C.; Fox, George E.

    2002-01-01

    MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.

  18. Microarray Technology for the Diagnosis of Fetal Chromosomal Aberrations: Which Platform Should We Use?

    PubMed Central

    Karampetsou, Evangelia; Morrogh, Deborah; Chitty, Lyn

    2014-01-01

    The advantage of microarray (array) over conventional karyotype for the diagnosis of fetal pathogenic chromosomal anomalies has prompted the use of microarrays in prenatal diagnostics. In this review we compare the performance of different array platforms (BAC, oligonucleotide CGH, SNP) and designs (targeted, whole genome, whole genome, and targeted, custom) and discuss their advantages and disadvantages in relation to prenatal testing. We also discuss the factors to consider when implementing a microarray testing service for the diagnosis of fetal chromosomal aberrations. PMID:26237396

  19. Discovery of novel variants in genotyping arrays improves genotype retention and reduces ascertainment bias

    PubMed Central

    2012-01-01

    Background High-density genotyping arrays that measure hybridization of genomic DNA fragments to allele-specific oligonucleotide probes are widely used to genotype single nucleotide polymorphisms (SNPs) in genetic studies, including human genome-wide association studies. Hybridization intensities are converted to genotype calls by clustering algorithms that assign each sample to a genotype class at each SNP. Data for SNP probes that do not conform to the expected pattern of clustering are often discarded, contributing to ascertainment bias and resulting in lost information - as much as 50% in a recent genome-wide association study in dogs. Results We identified atypical patterns of hybridization intensities that were highly reproducible and demonstrated that these patterns represent genetic variants that were not accounted for in the design of the array platform. We characterized variable intensity oligonucleotide (VINO) probes that display such patterns and are found in all hybridization-based genotyping platforms, including those developed for human, dog, cattle, and mouse. When recognized and properly interpreted, VINOs recovered a substantial fraction of discarded probes and counteracted SNP ascertainment bias. We developed software (MouseDivGeno) that identifies VINOs and improves the accuracy of genotype calling. MouseDivGeno produced highly concordant genotype calls when compared with other methods but it uniquely identified more than 786000 VINOs in 351 mouse samples. We used whole-genome sequence from 14 mouse strains to confirm the presence of novel variants explaining 28000 VINOs in those strains. We also identified VINOs in human HapMap 3 samples, many of which were specific to an African population. Incorporating VINOs in phylogenetic analyses substantially improved the accuracy of a Mus species tree and local haplotype assignment in laboratory mouse strains. Conclusion The problems of ascertainment bias and missing information due to genotyping errors are widely recognized as limiting factors in genetic studies. We have conducted the first formal analysis of the effect of novel variants on genotyping arrays, and we have shown that these variants account for a large portion of miscalled and uncalled genotypes. Genetic studies will benefit from substantial improvements in the accuracy of their results by incorporating VINOs in their analyses. PMID:22260749

  20. Method of identifying hairpin DNA probes by partial fold analysis

    DOEpatents

    Miller, Benjamin L [Penfield, NY; Strohsahl, Christopher M [Saugerties, NY

    2009-10-06

    Method of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

  1. Method of identifying hairpin DNA probes by partial fold analysis

    DOEpatents

    Miller, Benjamin L.; Strohsahl, Christopher M.

    2008-10-28

    Methods of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

  2. Homogeneous versus heterogeneous probes for microbial ecological microarrays.

    PubMed

    Bae, Jin-Woo; Park, Yong-Ha

    2006-07-01

    Microbial ecological microarrays have been developed for investigating the composition and functions of microorganism communities in environmental niches. These arrays include microbial identification microarrays, which use oligonucleotides, gene fragments or microbial genomes as probes. In this article, the advantages and disadvantages of each type of probe are reviewed. Oligonucleotide probes are currently useful for probing uncultivated bacteria that are not amenable to gene fragment probing, whereas the functional gene fragments amplified randomly from microbial genomes require phylogenetic and hierarchical categorization before use as microbial identification probes, despite their high resolution for both specificity and sensitivity. Until more bacteria are sequenced and gene fragment probes are thoroughly validated, heterogeneous bacterial genome probes will provide a simple, sensitive and quantitative tool for exploring the ecosystem structure.

  3. eSensor®: A Microarray Technology Based on Electrochemical Detection of Nucleic Acids and Its Application to Cystic Fibrosis Carrier Screening

    NASA Astrophysics Data System (ADS)

    Reed, Michael R.; Coty, William A.

    We have developed a test for identification of carriers for cystic fibrosis using the eSensor® DNA detection technology. Oligonucleotide probes are deposited within self-assembled monolayers on gold electrodes arrayed upon printed circuit boards. These probes allow sequence-specific capture of amplicons containing a panel of mutation sites associated with cystic fibrosis. DNA targets are detected and mutations genotyped using a “sandwich” assay methodology employing electrochemical detection of ferrocene-labeled oligonucleotides for discrimination of carrier and non-carrier alleles. Performance of the cystic fibrosis application demonstrates sufficient accuracy and reliability for clinical diagnostic use, and the procedure can be performed by trained medical technologists available in the hospital laboratory.

  4. Flexible CRISPR library construction using parallel oligonucleotide retrieval

    PubMed Central

    Read, Abigail; Gao, Shaojian; Batchelor, Eric

    2017-01-01

    Abstract CRISPR/Cas9-based gene knockout libraries have emerged as a powerful tool for functional screens. We present here a set of pre-designed human and mouse sgRNA sequences that are optimized for both high on-target potency and low off-target effect. To maximize the chance of target gene inactivation, sgRNAs were curated to target both 5΄ constitutive exons and exons that encode conserved protein domains. We describe here a robust and cost-effective method to construct multiple small sized CRISPR library from a single oligo pool generated by array synthesis using parallel oligonucleotide retrieval. Together, these resources provide a convenient means for individual labs to generate customized CRISPR libraries of variable size and coverage depth for functional genomics application. PMID:28334828

  5. Identification of a deep intronic mutation in the COL6A2 gene by a novel custom oligonucleotide CGH array designed to explore allelic and genetic heterogeneity in collagen VI-related myopathies

    PubMed Central

    2010-01-01

    Background Molecular characterization of collagen-VI related myopathies currently relies on standard sequencing, which yields a detection rate approximating 75-79% in Ullrich congenital muscular dystrophy (UCMD) and 60-65% in Bethlem myopathy (BM) patients as PCR-based techniques tend to miss gross genomic rearrangements as well as copy number variations (CNVs) in both the coding sequence and intronic regions. Methods We have designed a custom oligonucleotide CGH array in order to investigate the presence of CNVs in the coding and non-coding regions of COL6A1, A2, A3, A5 and A6 genes and a group of genes functionally related to collagen VI. A cohort of 12 patients with UCMD/BM negative at sequencing analysis and 2 subjects carrying a single COL6 mutation whose clinical phenotype was not explicable by inheritance were selected and the occurrence of allelic and genetic heterogeneity explored. Results A deletion within intron 1A of the COL6A2 gene, occurring in compound heterozygosity with a small deletion in exon 28, previously detected by routine sequencing, was identified in a BM patient. RNA studies showed monoallelic transcription of the COL6A2 gene, thus elucidating the functional effect of the intronic deletion. No pathogenic mutations were identified in the remaining analyzed patients, either within COL6A genes, or in genes functionally related to collagen VI. Conclusions Our custom CGH array may represent a useful complementary diagnostic tool, especially in recessive forms of the disease, when only one mutant allele is detected by standard sequencing. The intronic deletion we identified represents the first example of a pure intronic mutation in COL6A genes. PMID:20302629

  6. Detecting novel genes with sparse arrays

    PubMed Central

    Haiminen, Niina; Smit, Bart; Rautio, Jari; Vitikainen, Marika; Wiebe, Marilyn; Martinez, Diego; Chee, Christine; Kunkel, Joe; Sanchez, Charles; Nelson, Mary Anne; Pakula, Tiina; Saloheimo, Markku; Penttilä, Merja; Kivioja, Teemu

    2014-01-01

    Species-specific genes play an important role in defining the phenotype of an organism. However, current gene prediction methods can only efficiently find genes that share features such as sequence similarity or general sequence characteristics with previously known genes. Novel sequencing methods and tiling arrays can be used to find genes without prior information and they have demonstrated that novel genes can still be found from extensively studied model organisms. Unfortunately, these methods are expensive and thus are not easily applicable, e.g., to finding genes that are expressed only in very specific conditions. We demonstrate a method for finding novel genes with sparse arrays, applying it on the 33.9 Mb genome of the filamentous fungus Trichoderma reesei. Our computational method does not require normalisations between arrays and it takes into account the multiple-testing problem typical for analysis of microarray data. In contrast to tiling arrays, that use overlapping probes, only one 25mer microarray oligonucleotide probe was used for every 100 b. Thus, only relatively little space on a microarray slide was required to cover the intergenic regions of a genome. The analysis was done as a by-product of a conventional microarray experiment with no additional costs. We found at least 23 good candidates for novel transcripts that could code for proteins and all of which were expressed at high levels. Candidate genes were found to neighbour ire1 and cre1 and many other regulatory genes. Our simple, low-cost method can easily be applied to finding novel species-specific genes without prior knowledge of their sequence properties. PMID:20691772

  7. Copy number analysis of NIPBL in a cohort of 510 patients reveals rare copy number variants and a mosaic deletion.

    PubMed

    Cheng, Yu-Wei; Tan, Christopher A; Minor, Agata; Arndt, Kelly; Wysinger, Latrice; Grange, Dorothy K; Kozel, Beth A; Robin, Nathaniel H; Waggoner, Darrel; Fitzpatrick, Carrie; Das, Soma; Del Gaudio, Daniela

    2014-03-01

    Cornelia de Lange syndrome (CdLS) is a genetically heterogeneous disorder characterized by growth retardation, intellectual disability, upper limb abnormalities, hirsutism, and characteristic facial features. In this study we explored the occurrence of intragenic NIPBL copy number variations (CNVs) in a cohort of 510 NIPBL sequence-negative patients with suspected CdLS. Copy number analysis was performed by custom exon-targeted oligonucleotide array-comparative genomic hybridization and/or MLPA. Whole-genome SNP array was used to further characterize rearrangements extending beyond the NIPBL gene. We identified NIPBL CNVs in 13 patients (2.5%) including one intragenic duplication and a deletion in mosaic state. Breakpoint sequences in two patients provided further evidence of a microhomology-mediated replicative mechanism as a potential predominant contributor to CNVs in NIPBL. Patients for whom clinical information was available share classical CdLS features including craniofacial and limb defects. Our experience in studying the frequency of NIBPL CNVs in the largest series of patients to date widens the mutational spectrum of NIPBL and emphasizes the clinical utility of performing NIPBL deletion/duplication analysis in patients with CdLS.

  8. Integrated analysis of copy number alteration and RNA expression profiles of cancer using a high-resolution whole-genome oligonucleotide array.

    PubMed

    Jung, Seung-Hyun; Shin, Seung-Hun; Yim, Seon-Hee; Choi, Hye-Sun; Lee, Sug-Hyung; Chung, Yeun-Jun

    2009-07-31

    Recently, microarray-based comparative genomic hybridization (array-CGH) has emerged as a very efficient technology with higher resolution for the genome-wide identification of copy number alterations (CNA). Although CNAs are thought to affect gene expression, there is no platform currently available for the integrated CNA-expression analysis. To achieve high-resolution copy number analysis integrated with expression profiles, we established human 30k oligoarray-based genome-wide copy number analysis system and explored the applicability of this system for integrated genome and transcriptome analysis using MDA-MB-231 cell line. We compared the CNAs detected by the oligoarray with those detected by the 3k BAC array for validation. The oligoarray identified the single copy difference more accurately and sensitively than the BAC array. Seventeen CNAs detected by both platforms in MDA-MB-231 such as gains of 5p15.33-13.1, 8q11.22-8q21.13, 17p11.2, and losses of 1p32.3, 8p23.3-8p11.21, and 9p21 were consistently identified in previous studies on breast cancer. There were 122 other small CNAs (mean size 1.79 mb) that were detected by oligoarray only, not by BAC-array. We performed genomic qPCR targeting 7 CNA regions, detected by oligoarray only, and one non-CNA region to validate the oligoarray CNA detection. All qPCR results were consistent with the oligoarray-CGH results. When we explored the possibility of combined interpretation of both DNA copy number and RNA expression profiles, mean DNA copy number and RNA expression levels showed a significant correlation. In conclusion, this 30k oligoarray-CGH system can be a reasonable choice for analyzing whole genome CNAs and RNA expression profiles at a lower cost.

  9. EvOligo: A Novel Software to Design and Group Libraries of Oligonucleotides Applicable for Nucleic Acid-Based Experiments.

    PubMed

    Milewski, Marek C; Kamel, Karol; Kurzynska-Kokorniak, Anna; Chmielewski, Marcin K; Figlerowicz, Marek

    2017-10-01

    Experimental methods based on DNA and RNA hybridization, such as multiplex polymerase chain reaction, multiplex ligation-dependent probe amplification, or microarray analysis, require the use of mixtures of multiple oligonucleotides (primers or probes) in a single test tube. To provide an optimal reaction environment, minimal self- and cross-hybridization must be achieved among these oligonucleotides. To address this problem, we developed EvOligo, which is a software package that provides the means to design and group DNA and RNA molecules with defined lengths. EvOligo combines two modules. The first module performs oligonucleotide design, and the second module performs oligonucleotide grouping. The software applies a nearest-neighbor model of nucleic acid interactions coupled with a parallel evolutionary algorithm to construct individual oligonucleotides, and to group the molecules that are characterized by the weakest possible cross-interactions. To provide optimal solutions, the evolutionary algorithm sorts oligonucleotides into sets, preserves preselected parts of the oligonucleotides, and shapes their remaining parts. In addition, the oligonucleotide sets can be designed and grouped based on their melting temperatures. For the user's convenience, EvOligo is provided with a user-friendly graphical interface. EvOligo was used to design individual oligonucleotides, oligonucleotide pairs, and groups of oligonucleotide pairs that are characterized by the following parameters: (1) weaker cross-interactions between the non-complementary oligonucleotides and (2) more uniform ranges of the oligonucleotide pair melting temperatures than other available software products. In addition, in contrast to other grouping algorithms, EvOligo offers time-efficient sorting of paired and unpaired oligonucleotides based on various parameters defined by the user.

  10. A method for high-throughput production of sequence-verified DNA libraries and strain collections.

    PubMed

    Smith, Justin D; Schlecht, Ulrich; Xu, Weihong; Suresh, Sundari; Horecka, Joe; Proctor, Michael J; Aiyar, Raeka S; Bennett, Richard A O; Chu, Angela; Li, Yong Fuga; Roy, Kevin; Davis, Ronald W; Steinmetz, Lars M; Hyman, Richard W; Levy, Sasha F; St Onge, Robert P

    2017-02-13

    The low costs of array-synthesized oligonucleotide libraries are empowering rapid advances in quantitative and synthetic biology. However, high synthesis error rates, uneven representation, and lack of access to individual oligonucleotides limit the true potential of these libraries. We have developed a cost-effective method called Recombinase Directed Indexing (REDI), which involves integration of a complex library into yeast, site-specific recombination to index library DNA, and next-generation sequencing to identify desired clones. We used REDI to generate a library of ~3,300 DNA probes that exhibited > 96% purity and remarkable uniformity (> 95% of probes within twofold of the median abundance). Additionally, we created a collection of ~9,000 individually accessible CRISPR interference yeast strains for > 99% of genes required for either fermentative or respiratory growth, demonstrating the utility of REDI for rapid and cost-effective creation of strain collections from oligonucleotide pools. Our approach is adaptable to any complex DNA library, and fundamentally changes how these libraries can be parsed, maintained, propagated, and characterized. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  11. Multichannel microchip electrophoresis device fabricated in polycarbonate with an integrated contact conductivity sensor array.

    PubMed

    Shadpour, Hamed; Hupert, Mateusz L; Patterson, Donald; Liu, Changgeng; Galloway, Michelle; Stryjewski, Wieslaw; Goettert, Jost; Soper, Steven A

    2007-02-01

    A 16-channel microfluidic chip with an integrated contact conductivity sensor array is presented. The microfluidic network consisted of 16 separation channels that were hot-embossed into polycarbonate (PC) using a high-precision micromilled metal master. All channels were 40 microm deep and 60 microm wide with an effective separation length of 40 mm. A gold (Au) sensor array was lithographically patterned onto a PC cover plate and assembled to the fluidic chip via thermal bonding in such a way that a pair of Au microelectrodes (60 microm wide with a 5 microm spacing) was incorporated into each of the 16 channels and served as independent contact conductivity detectors. The spacing between the corresponding fluidic reservoirs for each separation channel was set to 9 mm, which allowed for loading samples and buffers to all 40 reservoirs situated on the microchip in only five pipetting steps using an 8-channel pipettor. A printed circuit board (PCB) with platinum (Pt) wires was used to distribute the electrophoresis high-voltage to all reservoirs situated on the fluidic chip. Another PCB was used for collecting the conductivity signals from the patterned Au microelectrodes. The device performance was evaluated using microchip capillary zone electrophoresis (mu-CZE) of amino acid, peptide, and protein mixtures as well as oligonucleotides that were separated via microchip capillary electrochromatography (mu-CEC). The separations were performed with an electric field (E) of 90 V/cm and were completed in less than 4 min in all cases. The conductivity detection was carried out using a bipolar pulse voltage waveform with a pulse amplitude of +/-0.6 V and a frequency of 6.0 kHz. The conductivity sensor array concentration limit of detection (SNR = 3) was determined to be 7.1 microM for alanine. The separation efficiency was found to be 6.4 x 10(4), 2.0 x 10(3), 4.8 x 10(3), and 3.4 x 10(2) plates for the mu-CEC of the oligonucleotides and mu-CZE of the amino acids, peptides, and proteins, respectively, with an average channel-to-channel migration time reproducibility of 2.8%. The average resolution obtained for mu-CEC of the oligonucleotides and mu-CZE of the amino acids, peptides, and proteins was 4.6, 1.0, 0.9, and 1.0, respectively. To the best of our knowledge, this report is the first to describe a multichannel microchip electrophoresis device with integrated contact conductivity sensor array.

  12. Data-adaptive test statistics for microarray data.

    PubMed

    Mukherjee, Sach; Roberts, Stephen J; van der Laan, Mark J

    2005-09-01

    An important task in microarray data analysis is the selection of genes that are differentially expressed between different tissue samples, such as healthy and diseased. However, microarray data contain an enormous number of dimensions (genes) and very few samples (arrays), a mismatch which poses fundamental statistical problems for the selection process that have defied easy resolution. In this paper, we present a novel approach to the selection of differentially expressed genes in which test statistics are learned from data using a simple notion of reproducibility in selection results as the learning criterion. Reproducibility, as we define it, can be computed without any knowledge of the 'ground-truth', but takes advantage of certain properties of microarray data to provide an asymptotically valid guide to expected loss under the true data-generating distribution. We are therefore able to indirectly minimize expected loss, and obtain results substantially more robust than conventional methods. We apply our method to simulated and oligonucleotide array data. By request to the corresponding author.

  13. Application of oligonucleotide array CGH to the simultaneous detection of a deletion in the nuclear TK2 gene and mtDNA depletion.

    PubMed

    Zhang, Shulin; Li, Fang-Yuan; Bass, Harold N; Pursley, Amber; Schmitt, Eric S; Brown, Blaire L; Brundage, Ellen K; Mardach, Rebecca; Wong, Lee-Jun

    2010-01-01

    Thymidine kinase 2 (TK2), encoded by the TK2 gene on chromosome 16q22, is one of the deoxyribonucleoside kinases responsible for the maintenance of mitochondrial deoxyribonucleotide pools. Defects in TK2 mainly cause a myopathic form of the mitochondrial DNA depletion syndrome (MDDS). Currently, only point mutations and small insertions and deletions have been reported in TK2 gene; gross rearrangements of TK2 gene and possible hepatic involvement in patients with TK2 mutations have not been described. We report a non-consanguineous Jordanian family with three deceased siblings due to mtDNA depletion. Sequence analysis of the father detected a heterozygous c.761T>A (p.I254N) mutation in his TK2 gene; however, point mutations in the mother were not detected. Subsequent gene dosage analysis using oligonucleotide array CGH identified an intragenic approximately 5.8-kb deletion encompassing the 5'UTR to intron 2 of her TK2 gene. Sequence analysis confirmed that the deletion spans c.1-495 to c.283-2899 of the TK2 gene (nucleotide 65,136,256-65,142,086 of chromosome 16). Analysis of liver and muscle specimens from one of the deceased infants in this family revealed compound heterozygosity for the paternal point mutation and maternal intragenic deletion. In addition, a significant reduction of the mtDNA content in liver and muscle was detected (10% and 20% of age- and tissue-matched controls, respectively). Prenatal diagnosis was performed in the third pregnancy. The fetus was found to carry both the point mutation and the deletion. This child died 6months after birth due to myopathy. A serum specimen demonstrated elevated liver transaminases in two of the infants from whom results were available. This report expands the mutation spectrum associated with TK2 deficiency. While the myopathic form of MDDS appears to be the main phenotype of TK2 mutations, liver dysfunction may also be a part of the mitochondrial depletion syndrome caused by TK2 gene defects.

  14. Identification of sequence motifs in oligonucleotides whose presence is correlated with antisense activity

    PubMed Central

    Matveeva, O. V.; Tsodikov, A. D.; Giddings, M.; Freier, S. M.; Wyatt, J. R.; Spiridonov, A. N.; Shabalina, S. A.; Gesteland, R. F.; Atkins, J. F.

    2000-01-01

    Design of antisense oligonucleotides targeting any mRNA can be much more efficient when several activity-enhancing motifs are included and activity-decreasing motifs are avoided. This conclusion was made after statistical analysis of data collected from >1000 experiments with phosphorothioate-modified oligonucleotides. Highly significant positive correlation between the presence of motifs CCAC, TCCC, ACTC, GCCA and CTCT in the oligonucleotide and its antisense efficiency was demonstrated. In addition, negative correlation was revealed for the motifs GGGG, ACTG, AAA and TAA. It was found that the likelihood of activity of an oligonucleotide against a desired mRNA target is sequence motif content dependent. PMID:10908347

  15. An Undergraduate Laboratory Exercise to Study the Effect of Darkness on Plant Gene Expression Using DNA Microarray

    ERIC Educational Resources Information Center

    Chang, Ming-Mei; Briggs, George M.

    2007-01-01

    DNA microarrays are microscopic arrays on a solid surface, typically a glass slide, on which DNA oligonucleotides are deposited or synthesized in a high-density matrix with a predetermined spatial order. Several types of DNA microarrays have been developed and used for various biological studies. Here, we developed an undergraduate laboratory…

  16. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    DOEpatents

    Bavykin, Sergei G.; Mirzabekov, Andrei D.

    2007-10-30

    The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  17. Customized Oligonucleotide Array-Based Comparative Genomic Hybridization as a Clinical Assay for Genomic Profiling of Chronic Lymphocytic Leukemia

    PubMed Central

    Sargent, Rachel; Jones, Dan; Abruzzo, Lynne V.; Yao, Hui; Bonderover, Jaime; Cisneros, Marissa; Wierda, William G.; Keating, Michael J.; Luthra, Rajyalakshmi

    2009-01-01

    Chromosome gains and losses used for risk stratification in chronic lymphocytic leukemia (CLL) are commonly assessed by multiprobe fluorescence in situ hybridization (FISH) studies. We designed and validated a customized array-comparative genomic hybridization (aCGH) platform as a clinical assay for CLL genomic profiling. A 60-mer, 44,000-probe oligonucleotide array with a 50-kb average spatial resolution was augmented with high-density probe tiling at loci that are frequently aberrant in CLL. Aberrations identified by aCGH were compared with those identified by a FISH panel, including locus-specific probes to ATM (11q22.3), the centromeric region of chromosome 12 (12p11.1–q11), D13S319 (13q14.3), LAMP1 (13q34), and TP53 (17p13.1). In 100 CLL samples, aCGH/FISH concordance was seen for 89% of FISH-called aberrations at the ATM (n = 18), D13S319 (n = 42), LAMP (n = 12), and TP53 (n = 22) loci and for chromosome 12 (n = 14). Eighty-four percentage of FISH/aCGH discordant calls were in samples either at or below the limit of aCGH sensitivity (10% to 25% FISH aberration-containing cells). Therefore, aCGH profiling is a feasible routine clinical test with comparable results to multiprobe FISH studies; however, it may be less sensitive than FISH in cases with low-level aberrations. Further, a customized array design can provide comprehensive genomic profiling with additional accuracy in both identifying and defining the extent of small aberrations at target loci. PMID:19074592

  18. Manipulation of oligonucleotides immobilized on solid supports - DNA computations on surfaces

    NASA Astrophysics Data System (ADS)

    Liu, Qinghua

    The manipulation of DNA oligonucleotides immobilized on various solid supports has been studied intensively, especially in the area of surface hybridization. Recently, surface-based biotechnology has been applied to the area of molecular computing. These surface-based methods have advantages with regard to ease of handling, facile purification, and less interference when compared to solution methodologies. This dissertation describes the investigation of molecular approaches to DNA computing. The feasibility of encoding a bit (0 or 1) of information for DNA-based computations at the single nucleotide level was studied, particularly with regard to the efficiency and specificity of hybridization discrimination. Both gold and glass surfaces, with addressed arrays of 32 oligonucleotides, were employed with similar hybridization results. Although single-base discrimination may be achieved in the system, it is at the cost of a severe decrease in the efficiency of hybridization to perfectly matched sequences. This compromises the utility of single nucleotide encoding for DNA computing applications in the absence of some additional mechanism for increasing specificity. Several methods are suggested including a multiple-base encoding strategy. The multiple-base encoding strategy was employed to develop a prototype DNA computer. The approach was demonstrated by solving a small example of the Satisfiability (SAT) problem, an NP-complete problem in Boolean logic. 16 distinct DNA oligonucleotides, encoding all candidate solutions to the 4-variable-4-clause-3-SAT problem, were immobilized on a gold surface in the non-addressed format. Four cycles of MARK (hybridization), DESTROY (enzymatic destruction) and UNMARK (denaturation) were performed, which identified and eliminated members of the set which were not solutions to the problem. Determination of the answer was accomplished in the READOUT (sequence identification) operation by PCR amplification of the remaining molecules and hybridization to an addressed array. Four answers were determined and the S/N ratio between correct and incorrect solutions ranged from 10 to 777, making discrimination between correct and incorrect solutions to the problem straightforward. Additionally, studies of enzymatic manipulations of DNA molecules on surfaces suggested the use of E. coli Exonuclease I (Exo I) and perhaps EarI in the DESTROY operation.

  19. Targeted delivery of an antisense oligonucleotide in the retina: uptake, distribution, stability, and effect.

    PubMed

    Rakoczy, P E; Lai, M C; Watson, M; Seydel, U; Constable, I

    1996-01-01

    In this article, we describe the preliminary results of the development of an animal model that will enable us to study the effect of photoreceptor-derived debris accumulation on the normal function of the retina in vivo. An antisense oligonucleotide (Cat 5), saline, and two control oligonucleotides were injected into the vitreous of 7-week-old RCS-rdy+ rats. The uptake, distribution, and persistence of the antisense oligonucleotide in the retina was demonstrated by fluorescent confocal microscopy, and the stability of the oligonucleotide was shown by GeneScan analysis using a fluorescein-labeled derivative of Cat 5 (Cat 5F). The accumulation of photoreceptor-derived debris was monitored by the number of undigested phagosomes in the RPE layer by light microscopy. Following intravitreal injection of Cat 5F, penetration of the oligonucleotide was observed in the ganglion cell layer in 2 hours and in the photoreceptor and pigment epithelial layers 3 days later. However, at 7, 28, and 56 days postinjection, only the RPE layer had significant amounts of Cat 5F present. Using GeneScan analysis, it was demonstrated that the fluorescein-labeled oligonucleotide present in the RPE layer was not degraded and it retained its original 19-mer length. There was no statistically significant difference in the number of phagosomes found in the RPE layer of control uninjected, saline-injected, and two sense and two antisense oligonucleotides-injected animals at 7 and 28 days postinjection. In contrast, the number of phagosomes was significantly higher (p < 0.001) in the RPE layer of Cat 5 antisense oligonucleotide-injected animals at 7 and 28 days postinjection. This difference, however, disappeared by 56 days postinjection. The inner nuclear layers of the retina of control and experimental animals were not affected by the injections.

  20. Time-series oligonucleotide count to assign antiviral siRNAs with long utility fit in the big data era.

    PubMed

    Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T

    2017-10-01

    Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the 'awaiting-type oligonucleotide'; the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility.

  1. Global gene expression profiles of Phytophthora ramorum strain pr102 in response to plant host and tissue differentiation

    Treesearch

    Caroline M. Press; Niklaus J. Grunwald

    2008-01-01

    The release of the draft genome sequence of P. ramorum strain Pr102, enabled the construction of an oligonucleotide microarray of the entire genome of Pr102. The array contains 344,680 features (oligos) that represent the transcriptome of Pr102. P. ramorum RNA was extracted from mycelium and sporangia and used to compare gene...

  2. Plasmodium Genus Assay Transition to the Joint Biological Agent Identification and Diagnostic System (JBAIDS)

    DTIC Science & Technology

    2012-07-12

    readily transferable to diverse real-time PCR instrumentation. These assays are used regularly for vector surveillance and are the primary...instrumentation ( FilmArray ) is under assessment. Assay oligonucleotide sequences and formulations are available for use in future joint projects...Plasmodium real-time PCR detection capability has been challenging. During 2006, the Division of Entomology, WRAIR designed and developed a

  3. Accurate and rapid modeling of iron-bleomycin-induced DNA damage using tethered duplex oligonucleotides and electrospray ionization ion trap mass spectrometric analysis.

    PubMed

    Harsch, A; Marzilli, L A; Bunt, R C; Stubbe, J; Vouros, P

    2000-05-01

    Bleomycin B(2)(BLM) in the presence of iron [Fe(II)] and O(2)catalyzes single-stranded (ss) and double-stranded (ds) cleavage of DNA. Electrospray ionization ion trap mass spectrometry was used to monitor these cleavage processes. Two duplex oligonucleotides containing an ethylene oxide tether between both strands were used in this investigation, allowing facile monitoring of all ss and ds cleavage events. A sequence for site-specific binding and cleavage by Fe-BLM was incorporated into each analyte. One of these core sequences, GTAC, is a known hot-spot for ds cleavage, while the other sequence, GGCC, is a hot-spot for ss cleavage. Incubation of each oligo-nucleotide under anaerobic conditions with Fe(II)-BLM allowed detection of the non-covalent ternary Fe-BLM/oligonucleotide complex in the gas phase. Cleavage studies were then performed utilizing O(2)-activated Fe(II)-BLM. No work-up or separation steps were required and direct MS and MS/MS analyses of the crude reaction mixtures confirmed sequence-specific Fe-BLM-induced cleavage. Comparison of the cleavage patterns for both oligonucleotides revealed sequence-dependent preferences for ss and ds cleavages in accordance with previously established gel electrophoresis analysis of hairpin oligonucleotides. This novel methodology allowed direct, rapid and accurate determination of cleavage profiles of model duplex oligonucleotides after exposure to activated Fe-BLM.

  4. Single-Cell in Situ RNA Analysis With Switchable Fluorescent Oligonucleotides.

    PubMed

    Xiao, Lu; Guo, Jia

    2018-01-01

    Comprehensive RNA analyses in individual cells in their native spatial contexts promise to transform our understanding of normal physiology and disease pathogenesis. Here we report a single-cell in situ RNA analysis approach using switchable fluorescent oligonucleotides (SFO). In this method, transcripts are first hybridized by pre-decoding oligonucleotides. These oligonucleotides subsequently recruit SFO to stain their corresponding RNA targets. After fluorescence imaging, all the SFO in the whole specimen are simultaneously removed by DNA strand displacement reactions. Through continuous cycles of target staining, fluorescence imaging, and SFO removal, a large number of different transcripts can be identified by unique fluorophore sequences and visualized at the optical resolution. To demonstrate the feasibility of this approach, we show that the hybridized SFO can be efficiently stripped by strand displacement reactions within 30 min. We also demonstrate that this SFO removal process maintains the integrity of the RNA targets and the pre-decoding oligonucleotides, and keeps them hybridized. Applying this approach, we show that transcripts can be restained in at least eight hybridization cycles with high analysis accuracy, which theoretically would enable the whole transcriptome to be quantified at the single molecule sensitivity in individual cells. This in situ RNA analysis technology will have wide applications in systems biology, molecular diagnosis, and targeted therapies.

  5. Method and apparatus for combinatorial chemistry

    DOEpatents

    Foote, Robert S.

    2007-02-20

    A method and apparatus are provided for performing light-directed reactions in spatially addressable channels within a plurality of channels. One aspect of the invention employs photoactivatable reagents in solutions disposed into spatially addressable flow streams to control the parallel synthesis of molecules immobilized within the channels. The reagents may be photoactivated within a subset of channels at the site of immobilized substrate molecules or at a light-addressable site upstream from the substrate molecules. The method and apparatus of the invention find particularly utility in the synthesis of biopolymer arrays, e.g., oligonucleotides, peptides and carbohydrates, and in the combinatorial synthesis of small molecule arrays for drug discovery.

  6. Method and apparatus for combinatorial chemistry

    DOEpatents

    Foote, Robert S [Oak Ridge, TN

    2012-06-05

    A method and apparatus are provided for performing light-directed reactions in spatially addressable channels within a plurality of channels. One aspect of the invention employs photoactivatable reagents in solutions disposed into spatially addressable flow streams to control the parallel synthesis of molecules immobilized within the channels. The reagents may be photoactivated within a subset of channels at the site of immobilized substrate molecules or at a light-addressable site upstream from the substrate molecules. The method and apparatus of the invention find particularly utility in the synthesis of biopolymer arrays, e.g., oligonucleotides, peptides and carbohydrates, and in the combinatorial synthesis of small molecule arrays for drug discovery.

  7. A dynamic bead-based microarray for parallel DNA detection

    NASA Astrophysics Data System (ADS)

    Sochol, R. D.; Casavant, B. P.; Dueck, M. E.; Lee, L. P.; Lin, L.

    2011-05-01

    A microfluidic system has been designed and constructed by means of micromachining processes to integrate both microfluidic mixing of mobile microbeads and hydrodynamic microbead arraying capabilities on a single chip to simultaneously detect multiple bio-molecules. The prototype system has four parallel reaction chambers, which include microchannels of 18 × 50 µm2 cross-sectional area and a microfluidic mixing section of 22 cm length. Parallel detection of multiple DNA oligonucleotide sequences was achieved via molecular beacon probes immobilized on polystyrene microbeads of 16 µm diameter. Experimental results show quantitative detection of three distinct DNA oligonucleotide sequences from the Hepatitis C viral (HCV) genome with single base-pair mismatch specificity. Our dynamic bead-based microarray offers an effective microfluidic platform to increase parallelization of reactions and improve microbead handling for various biological applications, including bio-molecule detection, medical diagnostics and drug screening.

  8. Identification of FVIII gene mutations in patients with hemophilia A using new combinatorial sequencing by hybridization

    PubMed Central

    Chetta, M.; Drmanac, A.; Santacroce, R.; Grandone, E.; Surrey, S.; Fortina, P.; Margaglione, M.

    2008-01-01

    BACKGROUND: Standard methods of mutation detection are time consuming in Hemophilia A (HA) rendering their application unavailable in some analysis such as prenatal diagnosis. OBJECTIVES: To evaluate the feasibility of combinatorial sequencing-by-hybridization (cSBH) as an alternative and reliable tool for mutation detection in FVIII gene. PATIENTS/METHODS: We have applied a new method of cSBH that uses two different colors for detection of multiple point mutations in the FVIII gene. The 26 exons encompassing the HA gene were analyzed in 7 newly diagnosed Italian patients and in 19 previously characterized individuals with FVIII deficiency. RESULTS: Data show that, when solution-phase TAMRA and QUASAR labeled 5-mer oligonucleotide sets mixed with unlabeled target PCR templates are co-hybridized in the presence of DNA ligase to universal 6-mer oligonucleotide probe-based arrays, a number of mutations can be successfully detected. The technique was reliable also in identifying a mutant FVIII allele in an obligate heterozygote. A novel missense mutation (Leu1843Thr) in exon 16 and three novel neutral polymorphisms are presented with an updated protocol for 2-color cSBH. CONCLUSIONS: cSBH is a reliable tool for mutation detection in FVIII gene and may represent a complementary method for the genetic screening of HA patients. PMID:20300295

  9. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    DOEpatents

    Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.

    2007-12-04

    The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  10. Review on investigations of antisense oligonucleotides with the use of mass spectrometry.

    PubMed

    Studzińska, Sylwia

    2018-01-01

    Antisense oligonucleotides have been investigated as potential drugs for years. They inhibit target gene or protein expression. The present review summarizes their modifications, modes of action, and applications of liquid chromatography coupled with mass spectrometry for qualitative and quantitative analysis of these compounds. The most recent reports on a given topic were given prominence, while some early studies were reviewed in order to provide a theoretical background. The present review covers the issues of using ion-exchange chromatography, ion-pair reversed-phase high performance liquid chromatography and hydrophilic interaction chromatography for the separation of antisense oligonucleotides. The application of mass spectrometry was described with regard to the ionization type used for the determination of these potential therapeutics. Moreover, the current approaches and applications of mass spectrometry for quantitative analysis of antisense oligonucleotides and their metabolites as well as their impurities during in vitro and in vivo studies were discussed. Finally, certain conclusions and perspectives on the determination of therapeutic oligonucleotides in various samples were briefly described. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Tissue Gene Expression Analysis Using Arrayed Normalized cDNA Libraries

    PubMed Central

    Eickhoff, Holger; Schuchhardt, Johannes; Ivanov, Igor; Meier-Ewert, Sebastian; O'Brien, John; Malik, Arif; Tandon, Neeraj; Wolski, Eryk-Witold; Rohlfs, Elke; Nyarsik, Lajos; Reinhardt, Richard; Nietfeld, Wilfried; Lehrach, Hans

    2000-01-01

    We have used oligonucleotide-fingerprinting data on 60,000 cDNA clones from two different mouse embryonic stages to establish a normalized cDNA clone set. The normalized set of 5,376 clones represents different clusters and therefore, in almost all cases, different genes. The inserts of the cDNA clones were amplified by PCR and spotted on glass slides. The resulting arrays were hybridized with mRNA probes prepared from six different adult mouse tissues. Expression profiles were analyzed by hierarchical clustering techniques. We have chosen radioactive detection because it combines robustness with sensitivity and allows the comparison of multiple normalized experiments. Sensitive detection combined with highly effective clustering algorithms allowed the identification of tissue-specific expression profiles and the detection of genes specifically expressed in the tissues investigated. The obtained results are publicly available (http://www.rzpd.de) and can be used by other researchers as a digital expression reference. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. AL360374–AL36537.] PMID:10958641

  12. Experimental analysis of oligonucleotide microarray design criteria to detect deletions by comparative genomic hybridization.

    PubMed

    Flibotte, Stephane; Moerman, Donald G

    2008-10-21

    Microarray comparative genomic hybridization (CGH) is currently one of the most powerful techniques to measure DNA copy number in large genomes. In humans, microarray CGH is widely used to assess copy number variants in healthy individuals and copy number aberrations associated with various diseases, syndromes and disease susceptibility. In model organisms such as Caenorhabditis elegans (C. elegans) the technique has been applied to detect mutations, primarily deletions, in strains of interest. Although various constraints on oligonucleotide properties have been suggested to minimize non-specific hybridization and improve the data quality, there have been few experimental validations for CGH experiments. For genomic regions where strict design filters would limit the coverage it would also be useful to quantify the expected loss in data quality associated with relaxed design criteria. We have quantified the effects of filtering various oligonucleotide properties by measuring the resolving power for detecting deletions in the human and C. elegans genomes using NimbleGen microarrays. Approximately twice as many oligonucleotides are typically required to be affected by a deletion in human DNA samples in order to achieve the same statistical confidence as one would observe for a deletion in C. elegans. Surprisingly, the ability to detect deletions strongly depends on the oligonucleotide 15-mer count, which is defined as the sum of the genomic frequency of all the constituent 15-mers within the oligonucleotide. A similarity level above 80% to non-target sequences over the length of the probe produces significant cross-hybridization. We recommend the use of a fairly large melting temperature window of up to 10 degrees C, the elimination of repeat sequences, the elimination of homopolymers longer than 5 nucleotides, and a threshold of -1 kcal/mol on the oligonucleotide self-folding energy. We observed very little difference in data quality when varying the oligonucleotide length between 50 and 70, and even when using an isothermal design strategy. We have determined experimentally the effects of varying several key oligonucleotide microarray design criteria for detection of deletions in C. elegans and humans with NimbleGen's CGH technology. Our oligonucleotide design recommendations should be applicable for CGH analysis in most species.

  13. 2'-O-[2-[2-(N,N-Dimethylamino)ethoxy]ethyl] Modified Antisense Oligonucleotides: Symbiosis of Charge Interaction Factors and Stereoelectronic Effects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prhavc, M.; Prakash, T.P.; Minasov, G.

    Oligonucleotides with a novel, 2'-O-[2-[2-(N,N-dimethylamino)ethoxy]ethyl] (2'-O-DMAEOE) modification have been synthesized. This modification, a cationic analogue of the 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, exhibits high binding affinity to target RNA (but not to DNA) and exceptional resistance to nuclease degradation. Analysis of the crystal structure of a self-complementary oligonucleotide containing a single 2'-O-DMAEOE modification explains the importance of charge factors and gauche effects on the observed antisense properties. 2'-O-DMAEOE modified oligonucleotides are ideal candidates for antisense drugs.

  14. Time-series oligonucleotide count to assign antiviral siRNAs with long utility fit in the big data era

    PubMed Central

    Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T

    2017-01-01

    Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the ‘awaiting-type oligonucleotide’ the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility. PMID:28905886

  15. Preparation and Analysis of Oligonucleotides Containing the C4′-Oxidized Abasic Site and Related Mechanistic Probes

    PubMed Central

    Kim, Jaeseung; Kreller, Cortney R.; Greenberg, Marc M.

    2005-01-01

    The C4′-oxidized abasic site (C4-AP) is produced by a variety of DNA damaging agents. This alkali labile lesion can exist in up to four diastereomeric cyclic forms, in addition to the acyclic keto-aldehyde. Synthetic oligonucleotides containing the lesion were prepared from a stable photochemical precursor. Chemical integrity of the lesion containing oligonucleotides was probed using phosphodiesterase lability. Analysis of the 3′,5′-phosphate diester of the monomeric lesion released from single diastereomers of photolabile precursors by 1H NMR indicates that isomerization of the hemiacetal and/or hemiketal is rapid. The syntheses and characterization of oligonucleotides containing configurationally stable analogues of C4-AP, which serve as mechanistic probes for deciphering the structural basis of the biochemical and biological effects of the C4′-oxidized abasic lesion, are also described. PMID:16277338

  16. Gene ARMADA: an integrated multi-analysis platform for microarray data implemented in MATLAB.

    PubMed

    Chatziioannou, Aristotelis; Moulos, Panagiotis; Kolisis, Fragiskos N

    2009-10-27

    The microarray data analysis realm is ever growing through the development of various tools, open source and commercial. However there is absence of predefined rational algorithmic analysis workflows or batch standardized processing to incorporate all steps, from raw data import up to the derivation of significantly differentially expressed gene lists. This absence obfuscates the analytical procedure and obstructs the massive comparative processing of genomic microarray datasets. Moreover, the solutions provided, heavily depend on the programming skills of the user, whereas in the case of GUI embedded solutions, they do not provide direct support of various raw image analysis formats or a versatile and simultaneously flexible combination of signal processing methods. We describe here Gene ARMADA (Automated Robust MicroArray Data Analysis), a MATLAB implemented platform with a Graphical User Interface. This suite integrates all steps of microarray data analysis including automated data import, noise correction and filtering, normalization, statistical selection of differentially expressed genes, clustering, classification and annotation. In its current version, Gene ARMADA fully supports 2 coloured cDNA and Affymetrix oligonucleotide arrays, plus custom arrays for which experimental details are given in tabular form (Excel spreadsheet, comma separated values, tab-delimited text formats). It also supports the analysis of already processed results through its versatile import editor. Besides being fully automated, Gene ARMADA incorporates numerous functionalities of the Statistics and Bioinformatics Toolboxes of MATLAB. In addition, it provides numerous visualization and exploration tools plus customizable export data formats for seamless integration by other analysis tools or MATLAB, for further processing. Gene ARMADA requires MATLAB 7.4 (R2007a) or higher and is also distributed as a stand-alone application with MATLAB Component Runtime. Gene ARMADA provides a highly adaptable, integrative, yet flexible tool which can be used for automated quality control, analysis, annotation and visualization of microarray data, constituting a starting point for further data interpretation and integration with numerous other tools.

  17. Identifying allelic loss and homozygous deletions in pancreatic cancer without matched normals using high-density single-nucleotide polymorphism arrays.

    PubMed

    Calhoun, Eric S; Hucl, Tomas; Gallmeier, Eike; West, Kristen M; Arking, Dan E; Maitra, Anirban; Iacobuzio-Donahue, Christine A; Chakravarti, Aravinda; Hruban, Ralph H; Kern, Scott E

    2006-08-15

    Recent advances in oligonucleotide arrays and whole-genome complexity reduction data analysis now permit the evaluation of tens of thousands of single-nucleotide polymorphisms simultaneously for a genome-wide analysis of allelic status. Using these arrays, we created high-resolution allelotype maps of 26 pancreatic cancer cell lines. The areas of heterozygosity implicitly served to reveal regions of allelic loss. The array-derived maps were verified by a panel of 317 microsatellite markers used in a subset of seven samples, showing a 97.1% concordance between heterozygous calls. Three matched tumor/normal pairs were used to estimate the false-negative and potential false-positive rates for identifying loss of heterozygosity: 3.6 regions (average minimal region of loss, 720,228 bp) and 2.3 regions (average heterozygous gap distance, 4,434,994 bp) per genome, respectively. Genomic fractional allelic loss calculations showed that cumulative levels of allelic loss ranged widely from 17.1% to 79.9% of the haploid genome length. Regional increases in "NoCall" frequencies combined with copy number loss estimates were used to identify 41 homozygous deletions (19 first reports), implicating an additional 13 regions disrupted in pancreatic cancer. Unexpectedly, 23 of these occurred in just two lines (BxPc3 and MiaPaCa2), suggesting the existence of at least two subclasses of chromosomal instability (CIN) patterns, distinguished here by allelic loss and copy number changes (original CIN) and those also highly enriched in the genomic "holes" of homozygous deletions (holey CIN). This study provides previously unavailable high-resolution allelotype and deletion breakpoint maps in widely shared pancreatic cancer cell lines and effectively eliminates the need for matched normal tissue to define informative loci.

  18. PRACTICAL STRATEGIES FOR PROCESSING AND ANALYZING SPOTTED OLIGONUCLEOTIDE MICROARRAY DATA

    EPA Science Inventory

    Thoughtful data analysis is as important as experimental design, biological sample quality, and appropriate experimental procedures for making microarrays a useful supplement to traditional toxicology. In the present study, spotted oligonucleotide microarrays were used to profile...

  19. Global analysis of gene expression in pulmonary fibrosis reveals distinct programs regulating lung inflammation and fibrosis

    NASA Astrophysics Data System (ADS)

    Kaminski, Naftali; Allard, John D.; Pittet, Jean F.; Zuo, Fengrong; Griffiths, Mark J. D.; Morris, David; Huang, Xiaozhu; Sheppard, Dean; Heller, Renu A.

    2000-02-01

    The molecular mechanisms of pulmonary fibrosis are poorly understood. We have used oligonucleotide arrays to analyze the gene expression programs that underlie pulmonary fibrosis in response to bleomycin, a drug that causes lung inflammation and fibrosis, in two strains of susceptible mice (129 and C57BL/6). We then compared the gene expression patterns in these mice with 129 mice carrying a null mutation in the epithelial-restricted integrin 6 subunit (6/-), which develop inflammation but are protected from pulmonary fibrosis. Cluster analysis identified two distinct groups of genes involved in the inflammatory and fibrotic responses. Analysis of gene expression at multiple time points after bleomycin administration revealed sequential induction of subsets of genes that characterize each response. The availability of this comprehensive data set should accelerate the development of more effective strategies for intervention at the various stages in the development of fibrotic diseases of the lungs and other organs.

  20. Practical guidelines for interpreting copy number gains detected by high-resolution array in routine diagnostics

    PubMed Central

    Hanemaaijer, Nicolien M; Sikkema-Raddatz, Birgit; van der Vries, Gerben; Dijkhuizen, Trijnie; Hordijk, Roel; van Essen, Anthonie J; Veenstra-Knol, Hermine E; Kerstjens-Frederikse, Wilhelmina S; Herkert, Johanna C; Gerkes, Erica H; Leegte, Lamberta K; Kok, Klaas; Sinke, Richard J; van Ravenswaaij-Arts, Conny M A

    2012-01-01

    The correct interpretation of copy number gains in patients with developmental delay and multiple congenital anomalies is hampered by the large number of copy number variations (CNVs) encountered in healthy individuals. The variable phenotype associated with copy number gains makes interpretation even more difficult. Literature shows that inheritence, size and presence in healthy individuals are commonly used to decide whether a certain copy number gain is pathogenic, but no general consensus has been established. We aimed to develop guidelines for interpreting gains detected by array analysis using array CGH data of 300 patients analysed with the 105K Agilent oligo array in a diagnostic setting. We evaluated the guidelines in a second, independent, cohort of 300 patients. In the first 300 patients 797 gains of four or more adjacent oligonucleotides were observed. Of these, 45.4% were de novo and 54.6% were familial. In total, 94.8% of all de novo gains and 87.1% of all familial gains were concluded to be benign CNVs. Clinically relevant gains ranged from 288 to 7912 kb in size, and were significantly larger than benign gains and gains of unknown clinical relevance (P<0.001). Our study showed that a threshold of 200 kb is acceptable in a clinical setting, whereas heritability does not exclude a pathogenic nature of a gain. Evaluation of the guidelines in the second cohort of 300 patients revealed that the interpretation guidelines were clear, easy to follow and efficient. PMID:21934709

  1. Multienzyme-nanoparticles amplification for sensitive virus genotyping in microfluidic microbeads array using Au nanoparticle probes and quantum dots as labels.

    PubMed

    Zhang, He; Liu, Lian; Li, Cheuk-Wing; Fu, Huayang; Chen, Yao; Yang, Mengsu

    2011-11-15

    A novel microfluidic device with microbeads array was developed and sensitive genotyping of human papillomavirus was demonstrated using a multiple-enzyme labeled oligonucleotide-Au nanoparticle bioconjugate as the detection tool. This method utilizes microbeads as sensing platform that was functionalized with the capture probes and modified electron rich proteins, and uses the horseradish peroxidase (HRP)-functionalized gold nanoparticles as label with a secondary DNA probe. The functionalized microbeads were independently introduced into the arrayed chambers using the loading chip slab. A single channel was used to generate weir structures to confine the microbeads and make the beads array accessible by microfluidics. Through "sandwich" hybridization, the enzyme-functionalized Au nanoparticles labels were brought close to the surface of microbeads. The oxidation of biotin-tyramine by hydrogen peroxide resulted in the deposition of multiple biotin moieties onto the surface of beads. This deposition is markedly increased in the presence of immobilized electron rich proteins. Streptavidin-labeled quantum dots were then allowed to bind to the deposited biotin moieties and displayed the signal. Enhanced detection sensitivity was achieved where the large surface area of Au nanoparticle carriers increased the amount HRP bound per sandwiched hybridization. The on-chip genotyping method could discriminate as low as 1fmol/L (10zmol/chip, SNR>3) synthesized HPV oligonucleotides DNA. The chip-based signal enhancement of the amplified assay resulted in 1000 times higher sensitivity than that of off-chip test. In addition, this on-chip format could discriminate and genotype 10copies/μL HPV genomic DNA using the PCR products. These results demonstrated that this on-chip approach can achieve highly sensitive detection and genotyping of target DNA and can be further developed for detection of disease-related biomolecules at the lowest level at their earliest incidence. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Microfabricated Fountain Pens for High-Density DNA Arrays

    PubMed Central

    Reese, Matthew O.; van Dam, R. Michae; Scherer, Axel; Quake, Stephen R.

    2003-01-01

    We used photolithographic microfabrication techniques to create very small stainless steel fountain pens that were installed in place of conventional pens on a microarray spotter. Because of the small feature size produced by the microfabricated pens, we were able to print arrays with up to 25,000 spots/cm2, significantly higher than can be achieved by other deposition methods. This feature density is sufficiently large that a standard microscope slide can contain multiple replicates of every gene in a complex organism such as a mouse or human. We tested carryover during array printing with dye solution, labeled DNA, and hybridized DNA, and we found it to be indistinguishable from background. Hybridization also showed good sequence specificity to printed oligonucleotides. In addition to improved slide capacity, the microfabrication process offers the possibility of low-cost mass-produced pens and the flexibility to include novel pen features that cannot be machined with conventional techniques. PMID:12975313

  3. Genome-wide profiling of gene expression in the epididymis of alpha-chlorohydrin-induced infertile rats using an oligonucleotide microarray

    PubMed Central

    2010-01-01

    Background As one of the chlorinated antifertility compounds, alpha-chlorohydrin (ACH) can inhibit glyceraldehyde-3-phosphate dehydrogenase (G3PDH) activity in epididymal sperm and affect sperm energy metabolism, maturation and fertilization, eventually leading to male infertility. Further studies demonstrated that the inhibitory effect of ACH on G3PDH is not only confined to epididymal sperm but also to the epididymis. Moreover, little investigation on gene expression changes in the epididymis after ACH treatment has been conducted. Therefore, gene expression studies may indicate new epididymal targets related to sperm maturation and fertility through the analysis of ACH-treated infertile animals. Methods Rats were treated with ACH for ten consecutive days, and then each male rat copulated with two female rats in proestrus. Then sperm maturation and other fertility parameters were analyzed. Furthermore, we identified epididymal-specific genes that are associated with fertility between control and ACH groups using an Affymetrix Rat 230 2.0 oligo-microarray. Finally, we performed RT-PCR analysis for several differentially expressed genes to validate the alteration in gene expression observed by oligonucleotide microarray. Results Among all the differentially expressed genes, we analyzed and screened the down-regulated genes associated with metabolism processes, which are considered the major targets of ACH action. Simultaneously, the genes that were up-regulated by chlorohydrin were detected. The genes that negatively regulate sperm maturation and fertility include apoptosis and immune-related genes and have not been reported previously. The overall results of PCR analysis for selected genes were consistent with the array data. Conclusions In this study, we have described the genome-wide profiles of gene expression in the epididymides of infertile rats induced by ACH, which could become potential epididymal specific targets for male contraception and infertility treatment. PMID:20409345

  4. Genome-wide profiling of gene expression in the epididymis of alpha-chlorohydrin-induced infertile rats using an oligonucleotide microarray.

    PubMed

    Xie, Shuwu; Zhu, Yan; Ma, Li; Lu, Yingying; Zhou, Jieyun; Gui, Youlun; Cao, Lin

    2010-04-22

    As one of the chlorinated antifertility compounds, alpha-chlorohydrin (ACH) can inhibit glyceraldehyde-3-phosphate dehydrogenase (G3PDH) activity in epididymal sperm and affect sperm energy metabolism, maturation and fertilization, eventually leading to male infertility. Further studies demonstrated that the inhibitory effect of ACH on G3PDH is not only confined to epididymal sperm but also to the epididymis. Moreover, little investigation on gene expression changes in the epididymis after ACH treatment has been conducted. Therefore, gene expression studies may indicate new epididymal targets related to sperm maturation and fertility through the analysis of ACH-treated infertile animals. Rats were treated with ACH for ten consecutive days, and then each male rat copulated with two female rats in proestrus. Then sperm maturation and other fertility parameters were analyzed. Furthermore, we identified epididymal-specific genes that are associated with fertility between control and ACH groups using an Affymetrix Rat 230 2.0 oligo-microarray. Finally, we performed RT-PCR analysis for several differentially expressed genes to validate the alteration in gene expression observed by oligonucleotide microarray. Among all the differentially expressed genes, we analyzed and screened the down-regulated genes associated with metabolism processes, which are considered the major targets of ACH action. Simultaneously, the genes that were up-regulated by chlorohydrin were detected. The genes that negatively regulate sperm maturation and fertility include apoptosis and immune-related genes and have not been reported previously. The overall results of PCR analysis for selected genes were consistent with the array data. In this study, we have described the genome-wide profiles of gene expression in the epididymides of infertile rats induced by ACH, which could become potential epididymal specific targets for male contraception and infertility treatment.

  5. Salivary gland carcinosarcoma: oligonucleotide array CGH reveals similar genomic profiles in epithelial and mesenchymal components.

    PubMed

    Vékony, Hedy; Leemans, C René; Ylstra, Bauke; Meijer, Gerrit A; van der Waal, Isaäc; Bloemena, Elisabeth

    2009-03-01

    In this study, we present a case of parotid gland de novo carcinosarcoma. Salivary gland carcinosarcoma (or true malignant mixed tumor) is a rare biphasic neoplasm, composed of both malignant epithelial and malignant mesenchymal components. It is yet unclear whether these two phenotypes occur by collision of two independent tumors or if they are of clonal origin. To analyze the clonality of the different morphologic tumor components, oligonucleotide microarray-based comparative genomic hybridization (oaCGH) was performed on the carcinoma and the sarcoma entity separately. This technique enables a high-resolution, genome-wide overview of the chromosomal alterations in the distinct tumor elements. Analysis of both fractions showed a high number of DNA copy number changes. Losses were more prevalent than gains (82 and 49, respectively). The carcinomatous element displayed more chromosomal aberrations than the sarcomatous component. Specific amplifications of MUC20 (in mesenchymal element) and BMI-1 (in both elements) loci were observed. Overall homology between the two genomic profiles was 75%. DNA copy number profiles of the epithelial and mesenchymal components in this salivary gland carcinosarcoma displayed extensive overlap, indicating a monoclonal origin. Since losses are shared to a larger extent than gains, they seem to be more essential for initial oncogenic events. Furthermore, specific amplifications of a mucin and a Polycomb group gene imply these proteins in the tumorigenesis of carcinosarcomas.

  6. Multiplex Detection of Bacteria Associated with Normal Microbiota and with Bacterial Vaginosis in Vaginal Swabs by Use of Oligonucleotide-Coupled Fluorescent Microspheres▿ †

    PubMed Central

    Dumonceaux, Tim J.; Schellenberg, John; Goleski, Vanessa; Hill, Janet E.; Jaoko, Walter; Kimani, Joshua; Money, Deborah; Ball, T. Blake; Plummer, Francis A.; Severini, Alberto

    2009-01-01

    Bacterial vaginosis (BV) is a recurrent condition that is associated with a range of negative outcomes, including the acquisition of human immunodeficiency virus and other sexually transmitted diseases, preterm births, and pelvic inflammatory disease. In contrast to the Lactobacillus-dominated normal vaginal microbiota, BV is characterized by a lack of lactobacilli and an abundance of anaerobic and gram-negative organisms, including Gardnerella vaginalis and Atopobium vaginae. To date, the laboratory diagnosis of BV has relied upon the fulfillment of criteria determined by microscopic observation of Gram-stained vaginal swabs. We describe a molecular-based method for the easy determination of the species profile within the vaginal microbiota based on the amplification of the chaperonin-60 genes of all bacteria present in the swab and hybridization of the amplicon to species-specific oligonucleotide-coupled fluorescent beads that are identified by flow cytometry with a Luminex instrument. We designed a nineplex Luminex array for characterization of the vaginal microbiota and applied it to the analysis of vaginal swabs from individuals from Africa and North America. Using the presence of A. vaginae or G. vaginalis, or both, as the defining criterion for BV, we found that the method was highly specific and sensitive for the diagnosis of BV using microscopy as a gold standard. PMID:19794034

  7. Engineering Improvements in a Bacterial Therapeutic Delivery System for Breast Cancer

    DTIC Science & Technology

    2009-09-01

    curve is observed on the other platform (Supplementary Figure 2H). Although it is not the object of this article to explore a physical explanation for...light-directed oligonucleotide microarrays using a digital micromirror array.. Nat Biotechnol, 17(10), 974–978. [12] Matveeva, O. V., Shabalina, S. A...Rouillard, J. M., Whittam, T. S., Gulari, E., Tiedje, J. M., and Hashsham, S. A. (2006) On- chip non-equilibrium dissociation curves and dissociation

  8. As Technologies for Nucleotide Therapeutics Mature, Products Emerge.

    PubMed

    Beierlein, Jennifer M; McNamee, Laura M; Ledley, Fred D

    2017-12-15

    The long path from initial research on oligonucleotide therapies to approval of antisense products is not unfamiliar. This lag resembles those encountered with monoclonal antibodies, gene therapies, and many biological targets and is consistent with studies of innovation showing that technology maturation is a critical determinant of product success. We previously described an analytical model for the maturation of biomedical research, demonstrating that the efficiency of targeted and biological development is connected to metrics of technology growth. The present work applies this model to characterize the advance of oligonucleotide therapeutics. We show that recent oligonucleotide product approvals incorporate technologies and targets that are past the established point of technology growth, as do most of the oligonucleotide products currently in phase 3. Less mature oligonucleotide technologies, such as miRNAs and some novel gene targets, have not passed the established point and have not yielded products. This analysis shows that oligonucleotide product development has followed largely predictable patterns of innovation. While technology maturation alone does not ensure success, these data show that many oligonucleotide technologies are sufficiently mature to be considered part of the arsenal for therapeutic development. These results demonstrate the importance of technology assessment in strategic management of biomedical technologies. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  9. [Oligonucleotide derivatives in the nucleic acid hybridization analysis. III. Synthesis and investigation of properties of oligonucleotides, bearing bifunctional non-nucleotide insert].

    PubMed

    Kupriushkin, M S; Pyshnyĭ, D V

    2012-01-01

    Non-nucleotide phosporamidites were synthetized, having branched backbone with different position of functional groups. Obtained phosphoramidite monomers contain intercalator moiety--6-chloro-2-methoxyacridine, and additional hydroxyl residue protected with dimethoxytrityl group or with tert-butyldimethylsilyl group for post-synthetic modification. Synthesized oligothymidilates contain one or more modified units in different positions of sequence. Melting temperature and thermodynamic parameters of formation of complementary duplexes formed by modified oligonucleotides was defined (change in enthalpy and entropy). The introduction of intercalating residue causes a significant stabilization of DNA duplexes. It is shown that the efficiency of the fluorescence of acridine residue in the oligonucleotide conjugate significantly changes upon hybridization with DNA.

  10. Analysis of new charge-neutral DNA/RNA analogues phosphoryl guanidine oligonucleotides (PGO) by gel electrophoresis.

    PubMed

    Fokina, Alesya; Wang, Meiling; Ilyina, Anna; Klabenkova, Kristina; Burakova, Ekaterina; Chelobanov, Boris; Stetsenko, Dmitry

    2018-06-02

    Analysis and isolation of new charge-neutral phosphoryl guanidine oligonucleotides (PGO) by vertical slab electrophoresis were tested at different pH values (3-11) or in the presence of SDS as a micelle-forming agent. The most convenient way to analyze and purify phosphoryl guanidine oligonucleotides was by denaturing PAGE (8 M urea) at pH 3. The mobility of PGO is dependent on their A + C content. To analyze PGO containing only G, T or U, denaturing PAGE at pH 11 can be used, although the conditions need to be optimized. Bands were visualized by UV shadowing or Coomassie Brilliant Blue staining. Copyright © 2018. Published by Elsevier Inc.

  11. Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

    PubMed

    Kalendar, Ruslan; Lee, David; Schulman, Alan H

    2011-08-01

    The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. Oligo Design: a computer program for development of probes for oligonucleotide microarrays.

    PubMed

    Herold, Keith E; Rasooly, Avraham

    2003-12-01

    Oligonucleotide microarrays have demonstrated potential for the analysis of gene expression, genotyping, and mutational analysis. Our work focuses primarily on the detection and identification of bacteria based on known short sequences of DNA. Oligo Design, the software described here, automates several design aspects that enable the improved selection of oligonucleotides for use with microarrays for these applications. Two major features of the program are: (i) a tiling algorithm for the design of short overlapping temperature-matched oligonucleotides of variable length, which are useful for the analysis of single nucleotide polymorphisms and (ii) a set of tools for the analysis of multiple alignments of gene families and related short DNA sequences, which allow for the identification of conserved DNA sequences for PCR primer selection and variable DNA sequences for the selection of unique probes for identification. Note that the program does not address the full genome perspective but, instead, is focused on the genetic analysis of short segments of DNA. The program is Internet-enabled and includes a built-in browser and the automated ability to download sequences from GenBank by specifying the GI number. The program also includes several utilities, including audio recital of a DNA sequence (useful for verifying sequences against a written document), a random sequence generator that provides insight into the relationship between melting temperature and GC content, and a PCR calculator.

  13. WebaCGH: an interactive online tool for the analysis and display of array comparative genomic hybridisation data.

    PubMed

    Frankenberger, Casey; Wu, Xiaolin; Harmon, Jerry; Church, Deanna; Gangi, Lisa M; Munroe, David J; Urzúa, Ulises

    2006-01-01

    Gene copy number variations occur both in normal cells and in numerous pathologies including cancer and developmental diseases. Array comparative genomic hybridisation (aCGH) is an emerging technology that allows detection of chromosomal gains and losses in a high-resolution format. When aCGH is performed on cDNA and oligonucleotide microarrays, the impact of DNA copy number on gene transcription profiles may be directly compared. We have created an online software tool, WebaCGH, that functions to (i) upload aCGH and gene transcription results from multiple experiments; (ii) identify significant aberrant regions using a local Z-score threshold in user-selected chromosomal segments subjected to smoothing with moving averages; and (iii) display results in a graphical format with full genome and individual chromosome views. In the individual chromosome display, data can be zoomed in/out in both dimensions (i.e. ratio and physical location) and plotted features can have 'mouse over' linking to outside databases to identify loci of interest. Uploaded data can be stored indefinitely for subsequent retrieval and analysis. WebaCGH was created as a Java-based web application using the open-source database MySQL. WebaCGH is freely accessible at http://129.43.22.27/WebaCGH/welcome.htm Xiaolin Wu (forestwu@mail.nih.gov) or Ulises Urzúa (uurzua@med.uchile.cl).

  14. MicroRNA profiling of the murine hematopoietic system

    PubMed Central

    Monticelli, Silvia; Ansel, K Mark; Xiao, Changchun; Socci, Nicholas D; Krichevsky, Anna M; Thai, To-Ha; Rajewsky, Nikolaus; Marks, Debora S; Sander, Chris; Rajewsky, Klaus; Rao, Anjana; Kosik, Kenneth S

    2005-01-01

    Background MicroRNAs (miRNAs) are a class of recently discovered noncoding RNA genes that post-transcriptionally regulate gene expression. It is becoming clear that miRNAs play an important role in the regulation of gene expression during development. However, in mammals, expression data are principally based on whole tissue analysis and are still very incomplete. Results We used oligonucleotide arrays to analyze miRNA expression in the murine hematopoietic system. Complementary oligonucleotides capable of hybridizing to 181 miRNAs were immobilized on a membrane and probed with radiolabeled RNA derived from low molecular weight fractions of total RNA from several different hematopoietic and neuronal cells. This method allowed us to analyze cell type-specific patterns of miRNA expression and to identify miRNAs that might be important for cell lineage specification and/or cell effector functions. Conclusion This is the first report of systematic miRNA gene profiling in cells of the hematopoietic system. As expected, miRNA expression patterns were very different between hematopoietic and non-hematopoietic cells, with further subtle differences observed within the hematopoietic group. Interestingly, the most pronounced similarities were observed among fully differentiated effector cells (Th1 and Th2 lymphocytes and mast cells) and precursors at comparable stages of differentiation (double negative thymocytes and pro-B cells), suggesting that in addition to regulating the process of commitment to particular cellular lineages, miRNAs might have an important general role in the mechanism of cell differentiation and maintenance of cell identity. PMID:16086853

  15. Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

    PubMed

    Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

    2007-04-10

    For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

  16. Evolution of thermophilic DNA polymerases for the recognition and amplification of C2ʹ-modified DNA

    NASA Astrophysics Data System (ADS)

    Chen, Tingjian; Hongdilokkul, Narupat; Liu, Zhixia; Adhikary, Ramkrishna; Tsuen, Shujian S.; Romesberg, Floyd E.

    2016-06-01

    The PCR amplification of oligonucleotides enables the evolution of sequences called aptamers that bind specific targets with antibody-like affinity. However, in many applications the use of these aptamers is limited by nuclease-mediated degradation. In contrast, oligonucleotides that are modified at their sugar C2ʹ positions with methoxy or fluorine substituents are stable to nucleases, but they cannot be synthesized by natural polymerases. Here we report the development of a polymerase-evolution system and its use to evolve thermostable polymerases that efficiently interconvert C2ʹ-OMe-modified oligonucleotides and their DNA counterparts via ‘transcription’ and ‘reverse transcription’ or, more importantly, that PCR-amplify partially C2ʹ-OMe- or C2ʹ-F-modified oligonucleotides. A mechanistic analysis demonstrates that the ability to amplify the modified oligonucleotides evolved by optimizing interdomain interactions that stabilize the catalytically competent closed conformation of the polymerase. The evolved polymerases should find practical applications and the developed evolution system should be a powerful tool for tailoring polymerases to have other types of novel function.

  17. [Evaluation of transfection effectiveness using fluorescein-labelled oligonucleotides and entraster-R siRNA transfection into Plasmodium falciparum].

    PubMed

    Zhou, Hong-Chang; Gao, Yu-Hui; Shao, Sheng-Wen; Zhang, Hui; Zhang, Ting

    2013-12-01

    The cultured Plasmodium falciparum parasites were synchronized twice by 5% sorbitol treatment twice (8-hour window), and then incubated at 37 degrees C for 16 h. Parasites were transfected with fluorescein-labelled oligonucleotides (group A) or fluorescein-labelled oligonucleotides+Entranster-R siRNA transfection reagent (group B). After 5 h a part of parasites was evaluated by fluorescence microscopy and flow cytometry. The rest of parasites were washed with RPMI 1640 medium, and then incubated with 500 microl new medium containing 2% fresh erythrocytes for another 12 h, and detected by flow cytometry. The fluorescein-labelled oligonucleotides were localized in erythrocytes in group B, but nearly no fluorescence was observed for group A. Flow cytometry analysis indicated that the transfection efficiency of group B [(47.40 +/- 3.39)%] was higher than that of group A [(0.60 +/- 0.27)%]. In the second cell cycle, the transfection efficiency in group B was (26.85 +/- 2.90)%, while that of group A was nearly zero. The results indicated that Entranster-R siRNA transfection reagent may increase the oligonucleotides transfection efficiency.

  18. Emerging Use of Gene Expression Microarrays in Plant Physiology

    DOE PAGES

    Wullschleger, Stan D.; Difazio, Stephen P.

    2003-01-01

    Microarrays have become an important technology for the global analysis of gene expression in humans, animals, plants, and microbes. Implemented in the context of a well-designed experiment, cDNA and oligonucleotide arrays can provide highthroughput, simultaneous analysis of transcript abundance for hundreds, if not thousands, of genes. However, despite widespread acceptance, the use of microarrays as a tool to better understand processes of interest to the plant physiologist is still being explored. To help illustrate current uses of microarrays in the plant sciences, several case studies that we believe demonstrate the emerging application of gene expression arrays in plant physiology weremore » selected from among the many posters and presentations at the 2003 Plant and Animal Genome XI Conference. Based on this survey, microarrays are being used to assess gene expression in plants exposed to the experimental manipulation of air temperature, soil water content and aluminium concentration in the root zone. Analysis often includes characterizing transcript profiles for multiple post-treatment sampling periods and categorizing genes with common patterns of response using hierarchical clustering techniques. In addition, microarrays are also providing insights into developmental changes in gene expression associated with fibre and root elongation in cotton and maize, respectively. Technical and analytical limitations of microarrays are discussed and projects attempting to advance areas of microarray design and data analysis are highlighted. Finally, although much work remains, we conclude that microarrays are a valuable tool for the plant physiologist interested in the characterization and identification of individual genes and gene families with potential application in the fields of agriculture, horticulture and forestry.« less

  19. Sieve-based device for MALDI sample preparation. I. Influence of sample deposition conditions in oligonucleotide analysis to achieve significant increases in both sensitivity and resolution.

    PubMed

    Molin, Laura; Cristoni, Simone; Crotti, Sara; Bernardi, Luigi Rossi; Seraglia, Roberta; Traldi, Pietro

    2008-11-01

    Spraying of oligonucleotide-matrix solutions through a stainless steel (ss) sieve (38 microm, 450 mesh) leads to the formation, on the matrix-assisted laser desorption/ionization (MALDI) sample holder, of uniformly distributed microcrystals, well separated from each other. When the resulting sample holder surface is irradiated by laser, abundant molecular species form, with a clear increase in both intensity and resolution with respect to values obtained by 'Dried Droplet', 'Double Layer', and 'Sandwich' deposition methods. In addition, unlike the usual situation, the sample is perfectly homogeneous, and identical spectra are obtained by irradiating different areas. On one hand, the data indicate that this method is highly effective for oligonucleotide MALDI analysis, and on the other, that it can be validly employed for fully automated MALDI procedures.

  20. Persistence and breakdown of strand symmetry in the human genome.

    PubMed

    Zhang, Shang-Hong

    2015-04-07

    Afreixo, V., Bastos, C.A.C., Garcia, S.P., Rodrigues, J.M.O.S., Pinho, A.J., Ferreira, P.J.S.G., 2013. The breakdown of the word symmetry in the human genome. J. Theor. Biol. 335, 153-159 analyzed the word symmetry (strand symmetry or the second parity rule) in the human genome. They concluded that strand symmetry holds for oligonucleotides up to 6 nt and is no longer statistically significant for oligonucleotides of higher orders. However, although they provided some new results for the issue, their interpretation would not be fully justified. Also, their conclusion needs to be further evaluated. Further analysis of their results, especially those of equivalence tests and word symmetry distance, shows that strand symmetry would persist for higher-order oligonucleotides up to 9 nt in the human genome, at least for its overall frequency framework (oligonucleotide frequency pattern). Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. 3D DNA Crystals and Nanotechnology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paukstelis, Paul; Seeman, Nadrian

    DNA's molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.

  2. Blocks of limited haplotype diversity revealed by high-resolution scanning of human chromosome 21.

    PubMed

    Patil, N; Berno, A J; Hinds, D A; Barrett, W A; Doshi, J M; Hacker, C R; Kautzer, C R; Lee, D H; Marjoribanks, C; McDonough, D P; Nguyen, B T; Norris, M C; Sheehan, J B; Shen, N; Stern, D; Stokowski, R P; Thomas, D J; Trulson, M O; Vyas, K R; Frazer, K A; Fodor, S P; Cox, D R

    2001-11-23

    Global patterns of human DNA sequence variation (haplotypes) defined by common single nucleotide polymorphisms (SNPs) have important implications for identifying disease associations and human traits. We have used high-density oligonucleotide arrays, in combination with somatic cell genetics, to identify a large fraction of all common human chromosome 21 SNPs and to directly observe the haplotype structure defined by these SNPs. This structure reveals blocks of limited haplotype diversity in which more than 80% of a global human sample can typically be characterized by only three common haplotypes.

  3. 3D DNA Crystals and Nanotechnology

    DOE PAGES

    Paukstelis, Paul; Seeman, Nadrian

    2016-08-18

    DNA's molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.

  4. Introduction on Using the FastPCR Software and the Related Java Web Tools for PCR and Oligonucleotide Assembly and Analysis.

    PubMed

    Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M

    2017-01-01

    This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .

  5. A High-throughput Assay for mRNA Silencing in Primary Cortical Neurons in vitro with Oligonucleotide Therapeutics.

    PubMed

    Alterman, Julia F; Coles, Andrew H; Hall, Lauren M; Aronin, Neil; Khvorova, Anastasia; Didiot, Marie-Cécile

    2017-08-20

    Primary neurons represent an ideal cellular system for the identification of therapeutic oligonucleotides for the treatment of neurodegenerative diseases. However, due to the sensitive nature of primary cells, the transfection of small interfering RNAs (siRNA) using classical methods is laborious and often shows low efficiency. Recent progress in oligonucleotide chemistry has enabled the development of stabilized and hydrophobically modified small interfering RNAs (hsiRNAs). This new class of oligonucleotide therapeutics shows extremely efficient self-delivery properties and supports potent and durable effects in vitro and in vivo . We have developed a high-throughput in vitro assay to identify and test hsiRNAs in primary neuronal cultures. To simply, rapidly, and accurately quantify the mRNA silencing of hundreds of hsiRNAs, we use the QuantiGene 2.0 quantitative gene expression assay. This high-throughput, 96-well plate-based assay can quantify mRNA levels directly from sample lysate. Here, we describe a method to prepare short-term cultures of mouse primary cortical neurons in a 96-well plate format for high-throughput testing of oligonucleotide therapeutics. This method supports the testing of hsiRNA libraries and the identification of potential therapeutics within just two weeks. We detail methodologies of our high throughput assay workflow from primary neuron preparation to data analysis. This method can help identify oligonucleotide therapeutics for treatment of various neurological diseases.

  6. ChIP-chip.

    PubMed

    Kim, Tae Hoon; Dekker, Job

    2018-05-01

    ChIP-chip can be used to analyze protein-DNA interactions in a region-wide and genome-wide manner. DNA microarrays contain PCR products or oligonucleotide probes that are designed to represent genomic sequences. Identification of genomic sites that interact with a specific protein is based on competitive hybridization of the ChIP-enriched DNA and the input DNA to DNA microarrays. The ChIP-chip protocol can be divided into two main sections: Amplification of ChIP DNA and hybridization of ChIP DNA to arrays. A large amount of DNA is required to hybridize to DNA arrays, and hybridization to a set of multiple commercial arrays that represent the entire human genome requires two rounds of PCR amplifications. The relative hybridization intensity of ChIP DNA and that of the input DNA is used to determine whether the probe sequence is a potential site of protein-DNA interaction. Resolution of actual genomic sites bound by the protein is dependent on the size of the chromatin and on the genomic distance between the probes on the array. As with expression profiling using gene chips, ChIP-chip experiments require multiple replicates for reliable statistical measure of protein-DNA interactions. © 2018 Cold Spring Harbor Laboratory Press.

  7. Integrated high-resolution array CGH and SKY analysis of homozygous deletions and other genomic alterations present in malignant mesothelioma cell lines.

    PubMed

    Klorin, Geula; Rozenblum, Ester; Glebov, Oleg; Walker, Robert L; Park, Yoonsoo; Meltzer, Paul S; Kirsch, Ilan R; Kaye, Frederic J; Roschke, Anna V

    2013-05-01

    High-resolution oligonucleotide array comparative genomic hybridization (aCGH) and spectral karyotyping (SKY) were applied to a panel of malignant mesothelioma (MMt) cell lines. SKY has not been applied to MMt before, and complete karyotypes are reported based on the integration of SKY and aCGH results. A whole genome search for homozygous deletions (HDs) produced the largest set of recurrent and non-recurrent HDs for MMt (52 recurrent HDs in 10 genomic regions; 36 non-recurrent HDs). For the first time, LINGO2, RBFOX1/A2BP1, RPL29, DUSP7, and CCSER1/FAM190A were found to be homozygously deleted in MMt, and some of these genes could be new tumor suppressor genes for MMt. Integration of SKY and aCGH data allowed reconstruction of chromosomal rearrangements that led to the formation of HDs. Our data imply that only with acquisition of structural and/or numerical karyotypic instability can MMt cells attain a complete loss of tumor suppressor genes located in 9p21.3, which is the most frequently homozygously deleted region. Tetraploidization is a late event in the karyotypic progression of MMt cells, after HDs in the 9p21.3 region have already been acquired. Published by Elsevier Inc.

  8. DNA Microarray Profiling Highlights Nrf2-Mediated Chemoprevention Targeted by Wasabi-Derived Isothiocyanates in HepG2 Cells.

    PubMed

    Trio, Phoebe Zapanta; Kawahara, Atsuyoshi; Tanigawa, Shunsuke; Sakao, Kozue; Hou, De-Xing

    2017-01-01

    6-MSITC and 6-MTITC are sulforaphane (SFN) analogs found in Japanese Wasabi. As we reported previously, Wasabi isothiocyanates (ITCs) are activators of Nrf2-antioxidant response element pathway, and also inhibitors of pro-inflammatory cyclooxygenase-2. This study is the first to assess the global changes in transcript levels by Wasabi ITCs, comparing with SFN, in HepG2 cells. We performed comparative gene expression profiling by treating HepG2 cells with ITCs, followed by DNA microarray analyses using HG-U133 plus 2.0 oligonucleotide array. Partial array data on selected gene products were confirmed by RT-PCR and Western blotting. Ingenuity Pathway Analysis (IPA) was used to identify functional subsets of genes and biologically significant network pathways. 6-MTITC showed the highest number of differentially altered (≥2 folds) gene expression, of which 114 genes were upregulated and 75 were downregulated. IPA revealed that Nrf2-mediated pathway, together with glutamate metabolism, is the common significantly modulated pathway across treatments. Interestingly, 6-MSITC exhibited the most potent effect toward Nrf2-mediated pathway. Our data suggest that 6-MSITC could exert chemopreventive role against cancer through its underlying antioxidant activity via the activation of Nrf2-mediated subsequent induction of cytoprotective genes.

  9. Analysis of LDLR mutations in familial hypercholesterolemia patients in Greece by use of the NanoChip microelectronic array technology.

    PubMed

    Laios, Eleftheria; Drogari, Euridiki

    2006-12-01

    Three mutations in the low density lipoprotein receptor (LDLR) gene account for 49% of familial hypercholesterolemia (FH) cases in Greece. We used the microelectronic array technology of the NanoChip Molecular Biology Workstation to develop a multiplex method to analyze these single-nucleotide polymorphisms (SNPs). Primer pairs amplified the region encompassing each SNP. The biotinylated PCR amplicon was electronically addressed to streptavidin-coated microarray sites. Allele-specific fluorescently labeled oligonucleotide reporters were designed and used for detection of wild-type and SNP sequences. Genotypes were compared to PCR-restriction fragment length polymorphism (PCR-RFLP). We developed three monoplex assays (1 SNP/site) and an optimized multiplex assay (3SNPs/site). We performed 92 Greece II, 100 Genoa, and 98 Afrikaner-2 NanoChip monoplex assays (addressed to duplicate sites and analyzed separately). Of the 580 monoplex genotypings (290 samples), 579 agreed with RFLP. Duplicate sites of one sample were not in agreement with each other. Of the 580 multiplex genotypings, 576 agreed with the monoplex results. Duplicate sites of three samples were not in agreement with each other, indicating requirement for repetition upon which discrepancies were resolved. The multiplex assay detects common LDLR mutations in Greek FH patients and can be extended to accommodate additional mutations.

  10. Stable Gene Targeting in Human Cells Using Single-Strand Oligonucleotides with Modified Bases

    PubMed Central

    Rios, Xavier; Briggs, Adrian W.; Christodoulou, Danos; Gorham, Josh M.; Seidman, Jonathan G.; Church, George M.

    2012-01-01

    Recent advances allow multiplexed genome engineering in E. coli, employing easily designed oligonucleotides to edit multiple loci simultaneously. A similar technology in human cells would greatly expedite functional genomics, both by enhancing our ability to test how individual variants such as single nucleotide polymorphisms (SNPs) are related to specific phenotypes, and potentially allowing simultaneous mutation of multiple loci. However, oligo-mediated targeting of human cells is currently limited by low targeting efficiencies and low survival of modified cells. Using a HeLa-based EGFP-rescue reporter system we show that use of modified base analogs can increase targeting efficiency, in part by avoiding the mismatch repair machinery. We investigate the effects of oligonucleotide toxicity and find a strong correlation between the number of phosphorothioate bonds and toxicity. Stably EGFP-corrected cells were generated at a frequency of ~0.05% with an optimized oligonucleotide design combining modified bases and reduced number of phosphorothioate bonds. We provide evidence from comparative RNA-seq analysis suggesting cellular immunity induced by the oligonucleotides might contribute to the low viability of oligo-corrected cells. Further optimization of this method should allow rapid and scalable genome engineering in human cells. PMID:22615794

  11. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  12. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

    PubMed

    Yeo, Hyun Koo; Lee, Jae Young

    2010-05-01

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

  13. Tuning the Cavity Size and Chirality of Self-Assembling 3D DNA Crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Simmons, Chad R.; Zhang, Fei; MacCulloch, Tara

    The foundational goal of structural DNA nanotechnology—the field that uses oligonucleotides as a molecular building block for the programmable self-assembly of nanostructured systems—was to use DNA to construct three-dimensional (3D) lattices for solving macromolecular structures. The programmable nature of DNA makes it an ideal system for rationally constructing self-assembled crystals and immobilizing guest molecules in a repeating 3D array through their specific stereospatial interactions with the scaffold. In this work, we have extended a previously described motif (4 × 5) by expanding the structure to a system that links four double-helical layers; we use a central weaving oligonucleotide containing amore » sequence of four six-base repeats (4 × 6), forming a matrix of layers that are organized and dictated by a series of Holliday junctions. In addition, we have assembled mirror image crystals (l-DNA) with the identical sequence that are completely resistant to nucleases. Bromine and selenium derivatives were obtained for the l- and d-DNA forms, respectively, allowing phase determination for both forms and solution of the resulting structures to 3.0 and 3.05 Å resolution. Both right- and left-handed forms crystallized in the trigonal space groups with mirror image 3-fold helical screw axes P32 and P31 for each motif, respectively. The structures reveal a highly organized array of discrete and well-defined cavities that are suitable for hosting guest molecules and allow us to dictate a priori the assembly of guest–DNA conjugates with a specified crystalline hand.« less

  14. Miniaturized multiplex label-free electronic chip for rapid nucleic acid analysis based on carbon nanotube nanoelectrode arrays

    NASA Technical Reports Server (NTRS)

    Koehne, Jessica E.; Chen, Hua; Cassell, Alan M.; Ye, Qi; Han, Jie; Meyyappan, Meyya; Li, Jun

    2004-01-01

    BACKGROUND: Reducing cost and time is the major concern in clinical diagnostics, particularly in molecular diagnostics. Miniaturization technologies have been recognized as promising solutions to provide low-cost microchips for diagnostics. With the recent advancement in nanotechnologies, it is possible to further improve detection sensitivity and simplify sample preparation by incorporating nanoscale elements in diagnostics devices. A fusion of micro- and nanotechnologies with biology has great potential for the development of low-cost disposable chips for rapid molecular analysis that can be carried out with simple handheld devices. APPROACH: Vertically aligned multiwalled carbon nanotubes (MWNTs) are fabricated on predeposited microelectrode pads and encapsulated in SiO2 dielectrics with only the very end exposed at the surface to form an inlaid nanoelectrode array (NEA). The NEA is used to collect the electrochemical signal associated with the target molecules binding to the probe molecules, which are covalently attached to the end of the MWNTs. CONTENT: A 3 x 3 microelectrode array is presented to demonstrate the miniaturization and multiplexing capability. A randomly distributed MWNT NEA is fabricated on each microelectrode pad. Selective functionalization of the MWNT end with a specific oligonucleotide probe and passivation of the SiO2 surface with ethylene glycol moieties are discussed. Ru(bpy)2+ -mediator-amplified guanine oxidation is used to directly measure the electrochemical signal associated with target molecules. SUMMARY: The discussed MWNT NEAs have ultrahigh sensitivity in direct electrochemical detection of guanine bases in the nucleic acid target. Fewer than approximately 1000 target nucleic acid molecules can be measured with a single microelectrode pad of approximately 20 x 20 microm2, which approaches the detection limit of laser scanners in fluorescence-based DNA microarray techniques. MWNT NEAs can be easily integrated with microelectronic circuitry and microfluidics for development of a fully automated system for rapid molecular analysis with minimum cost.

  15. DETECTING LOW-LEVEL SYNTHESIS IMPURITIES IN MODIFIED PHOSPHOROTHIOATE OLIGONUCLEOTIDES USING LIQUID CHROMATOGRAPHY – HIGH RESOLUTION MASS SPECTROMETRY

    PubMed Central

    Nikcevic, Irena; Wyrzykiewicz, Tadeusz K.; Limbach, Patrick A.

    2010-01-01

    Summary An LC-MS method based on the use of high resolution Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS) for profiling oligonucleotides synthesis impurities is described. Oligonucleotide phosphorothioatediesters (phosphorothioate oligonucleotides), in which one of the non-bridging oxygen atoms at each phosphorus center is replaced by a sulfur atom, are now one of the most popular oligonucleotide modifications due to their ease of chemical synthesis and advantageous pharmacokinetic properties. Despite significant progress in the solid-phase oligomerization chemistry used in the manufacturing of these oligonucleotides, multiple classes of low-level impurities always accompany synthetic oligonucleotides. Liquid chromatography-mass spectrometry has emerged as a powerful technique for the identification of these synthesis impurities. However, impurity profiling, where the entire complement of low-level synthetic impurities is identified in a single analysis, is more challenging. Here we present an LC-MS method based the use of high resolution-mass spectrometry, specifically Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS or FTMS). The optimal LC-FTMS conditions, including the stationary phase and mobile phases for the separation and identification of phosphorothioate oligonucleotides, were found. The characteristics of FTMS enable charge state determination from single m/z values of low-level impurities. Charge state information then enables more accurate modeling of the detected isotopic distribution for identification of the chemical composition of the detected impurity. Using this approach, a number of phosphorothioate impurities can be detected by LC-FTMS including failure sequences carrying 3′-terminal phosphate monoester and 3′-terminal phosphorothioate monoester, incomplete backbone sulfurization and desulfurization products, high molecular weight impurities, and chloral, isobutyryl, and N3 (2-cyanoethyl) adducts of the full length product. When compared with low resolution LC-MS, ~60% more impurities can be identified when charge state and isotopic distribution information is available and used for impurity profiling. PMID:21811394

  16. A regenerated electrochemical biosensor for label-free detection of glucose and urea based on conformational switch of i-motif oligonucleotide probe.

    PubMed

    Gao, Zhong Feng; Chen, Dong Mei; Lei, Jing Lei; Luo, Hong Qun; Li, Nian Bing

    2015-10-15

    Improving the reproducibility of electrochemical signal remains a great challenge over the past decades. In this work, i-motif oligonucleotide probe-based electrochemical DNA (E-DNA) sensor is introduced for the first time as a regenerated sensing platform, which enhances the reproducibility of electrochemical signal, for label-free detection of glucose and urea. The addition of glucose or urea is able to activate glucose oxidase-catalyzed or urease-catalyzed reaction, inducing or destroying the formation of i-motif oligonucleotide probe. The conformational switch of oligonucleotide probe can be recorded by electrochemical impedance spectroscopy. Thus, the difference of electron transfer resistance is utilized for the quantitative determination of glucose and urea. We further demonstrate that the E-DNA sensor exhibits high selectivity, excellent stability, and remarkable regenerated ability. The human serum analysis indicates that this simple and regenerated strategy holds promising potential in future biosensing applications. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Effect of Molecular Crowding and Ionic Strength on the Isothermal Hybridization of Oligonucleotides

    PubMed Central

    Markarian, Marie Z.; Schlenoff, Joseph B.

    2010-01-01

    The isothermal hybridization of complimentary oligonucleotides, 15-mer, 25-mer, 35-mer, and a molecular beacon, was investigated under varying conditions of molecular crowding and ionic strength, using hypochromicity to follow strand pairing and polyethylene glycol as a crowding agent. Thermodynamic analysis of the results revealed the addition of counterions to the oligonucleotide backbones, Δψ, to be dependent on the strand G-C content and the molecular crowding. A decrease in Δψ was observed with both increasing GC% and solution PEG content. In contrast, the number of bound water molecules depended on the activity of Na+, where two regimes were observed. At aNa+⟨0.05 and increasing molecular crowding, water molecules were released into the DNA solutions and oligonucleotide pairing was favored with both increasing hydrophobic forces, while at aNa+≥0.05, water molecules were bound to the strands and the extent of double strand formation decreased with increasing PEG wt%. PMID:20701389

  18. Impact of point-mutations on the hybridization affinity of surface-bound DNA/DNA and RNA/DNA oligonucleotide-duplexes: Comparison of single base mismatches and base bulges

    PubMed Central

    Naiser, Thomas; Ehler, Oliver; Kayser, Jona; Mai, Timo; Michel, Wolfgang; Ott, Albrecht

    2008-01-01

    Background The high binding specificity of short 10 to 30 mer oligonucleotide probes enables single base mismatch (MM) discrimination and thus provides the basis for genotyping and resequencing microarray applications. Recent experiments indicate that the underlying principles governing DNA microarray hybridization – and in particular MM discrimination – are not completely understood. Microarrays usually address complex mixtures of DNA targets. In order to reduce the level of complexity and to study the problem of surface-based hybridization with point defects in more detail, we performed array based hybridization experiments in well controlled and simple situations. Results We performed microarray hybridization experiments with short 16 to 40 mer target and probe lengths (in situations without competitive hybridization) in order to systematically investigate the impact of point-mutations – varying defect type and position – on the oligonucleotide duplex binding affinity. The influence of single base bulges and single base MMs depends predominantly on position – it is largest in the middle of the strand. The position-dependent influence of base bulges is very similar to that of single base MMs, however certain bulges give rise to an unexpectedly high binding affinity. Besides the defect (MM or bulge) type, which is the second contribution in importance to hybridization affinity, there is also a sequence dependence, which extends beyond the defect next-neighbor and which is difficult to quantify. Direct comparison between binding affinities of DNA/DNA and RNA/DNA duplexes shows, that RNA/DNA purine-purine MMs are more discriminating than corresponding DNA/DNA MMs. In DNA/DNA MM discrimination the affected base pair (C·G vs. A·T) is the pertinent parameter. We attribute these differences to the different structures of the duplexes (A vs. B form). Conclusion We have shown that DNA microarrays can resolve even subtle changes in hybridization affinity for simple target mixtures. We have further shown that the impact of point defects on oligonucleotide stability can be broken down to a hierarchy of effects. In order to explain our observations we propose DNA molecular dynamics – in form of zipping of the oligonucleotide duplex – to play an important role. PMID:18477387

  19. Global gene expression analysis of apple fruit development from the floral bud to ripe fruit

    PubMed Central

    Janssen, Bart J; Thodey, Kate; Schaffer, Robert J; Alba, Rob; Balakrishnan, Lena; Bishop, Rebecca; Bowen, Judith H; Crowhurst, Ross N; Gleave, Andrew P; Ledger, Susan; McArtney, Steve; Pichler, Franz B; Snowden, Kimberley C; Ward, Shayna

    2008-01-01

    Background Apple fruit develop over a period of 150 days from anthesis to fully ripe. An array representing approximately 13000 genes (15726 oligonucleotides of 45–55 bases) designed from apple ESTs has been used to study gene expression over eight time points during fruit development. This analysis of gene expression lays the groundwork for a molecular understanding of fruit growth and development in apple. Results Using ANOVA analysis of the microarray data, 1955 genes showed significant changes in expression over this time course. Expression of genes is coordinated with four major patterns of expression observed: high in floral buds; high during cell division; high when starch levels and cell expansion rates peak; and high during ripening. Functional analysis associated cell cycle genes with early fruit development and three core cell cycle genes are significantly up-regulated in the early stages of fruit development. Starch metabolic genes were associated with changes in starch levels during fruit development. Comparison with microarrays of ethylene-treated apple fruit identified a group of ethylene induced genes also induced in normal fruit ripening. Comparison with fruit development microarrays in tomato has been used to identify 16 genes for which expression patterns are similar in apple and tomato and these genes may play fundamental roles in fruit development. The early phase of cell division and tissue specification that occurs in the first 35 days after pollination has been associated with up-regulation of a cluster of genes that includes core cell cycle genes. Conclusion Gene expression in apple fruit is coordinated with specific developmental stages. The array results are reproducible and comparisons with experiments in other species has been used to identify genes that may play a fundamental role in fruit development. PMID:18279528

  20. Global gene expression analysis of apple fruit development from the floral bud to ripe fruit.

    PubMed

    Janssen, Bart J; Thodey, Kate; Schaffer, Robert J; Alba, Rob; Balakrishnan, Lena; Bishop, Rebecca; Bowen, Judith H; Crowhurst, Ross N; Gleave, Andrew P; Ledger, Susan; McArtney, Steve; Pichler, Franz B; Snowden, Kimberley C; Ward, Shayna

    2008-02-17

    Apple fruit develop over a period of 150 days from anthesis to fully ripe. An array representing approximately 13000 genes (15726 oligonucleotides of 45-55 bases) designed from apple ESTs has been used to study gene expression over eight time points during fruit development. This analysis of gene expression lays the groundwork for a molecular understanding of fruit growth and development in apple. Using ANOVA analysis of the microarray data, 1955 genes showed significant changes in expression over this time course. Expression of genes is coordinated with four major patterns of expression observed: high in floral buds; high during cell division; high when starch levels and cell expansion rates peak; and high during ripening. Functional analysis associated cell cycle genes with early fruit development and three core cell cycle genes are significantly up-regulated in the early stages of fruit development. Starch metabolic genes were associated with changes in starch levels during fruit development. Comparison with microarrays of ethylene-treated apple fruit identified a group of ethylene induced genes also induced in normal fruit ripening. Comparison with fruit development microarrays in tomato has been used to identify 16 genes for which expression patterns are similar in apple and tomato and these genes may play fundamental roles in fruit development. The early phase of cell division and tissue specification that occurs in the first 35 days after pollination has been associated with up-regulation of a cluster of genes that includes core cell cycle genes. Gene expression in apple fruit is coordinated with specific developmental stages. The array results are reproducible and comparisons with experiments in other species has been used to identify genes that may play a fundamental role in fruit development.

  1. Integrated Safety Assessment of 2′-O-Methoxyethyl Chimeric Antisense Oligonucleotides in NonHuman Primates and Healthy Human Volunteers

    PubMed Central

    Crooke, Stanley T; Baker, Brenda F; Kwoh, T Jesse; Cheng, Wei; Schulz, Dan J; Xia, Shuting; Salgado, Nelson; Bui, Huynh-Hoa; Hart, Christopher E; Burel, Sebastien A; Younis, Husam S; Geary, Richard S; Henry, Scott P; Bhanot, Sanjay

    2016-01-01

    The common chemical and biological properties of antisense oligonucleotides provide the opportunity to identify and characterize chemical class effects across species. The chemical class that has proven to be the most versatile and best characterized is the 2′-O-methoxyethyl chimeric antisense oligonucleotides. In this report we present an integrated safety assessment of data obtained from controlled dose-ranging studies in nonhuman primates (macaques) and healthy human volunteers for 12 unique 2′-O-methoxyethyl chimeric antisense oligonucleotides. Safety was assessed by the incidence of safety signals in standardized laboratory tests for kidney and liver function, hematology, and complement activation; as well as by the mean test results as a function of dose level over time. At high doses a number of toxicities were observed in nonhuman primates. However, no class safety effects were identified in healthy human volunteers from this integrated data analysis. Effects on complement in nonhuman primates were not observed in humans. Nonhuman primates predicted safe doses in humans, but over predicted risk of complement activation and effects on platelets. Although limited to a single chemical class, comparisons from this analysis are considered valid and accurate based on the carefully controlled setting for the specified study populations and within the total exposures studied. PMID:27357629

  2. Resolving prokaryotic taxonomy without rRNA: longer oligonucleotide word lengths improve genome and metagenome taxonomic classification.

    PubMed

    Alsop, Eric B; Raymond, Jason

    2013-01-01

    Oligonucleotide signatures, especially tetranucleotide signatures, have been used as method for homology binning by exploiting an organism's inherent biases towards the use of specific oligonucleotide words. Tetranucleotide signatures have been especially useful in environmental metagenomics samples as many of these samples contain organisms from poorly classified phyla which cannot be easily identified using traditional homology methods, including NCBI BLAST. This study examines oligonucleotide signatures across 1,424 completed genomes from across the tree of life, substantially expanding upon previous work. A comprehensive analysis of mononucleotide through nonanucleotide word lengths suggests that longer word lengths substantially improve the classification of DNA fragments across a range of sizes of relevance to high throughput sequencing. We find that, at present, heptanucleotide signatures represent an optimal balance between prediction accuracy and computational time for resolving taxonomy using both genomic and metagenomic fragments. We directly compare the ability of tetranucleotide and heptanucleotide world lengths (tetranucleotide signatures are the current standard for oligonucleotide word usage analyses) for taxonomic binning of metagenome reads. We present evidence that heptanucleotide word lengths consistently provide more taxonomic resolving power, particularly in distinguishing between closely related organisms that are often present in metagenomic samples. This implies that longer oligonucleotide word lengths should replace tetranucleotide signatures for most analyses. Finally, we show that the application of longer word lengths to metagenomic datasets leads to more accurate taxonomic binning of DNA scaffolds and have the potential to substantially improve taxonomic assignment and assembly of metagenomic data.

  3. Recommendations of the Oligonucleotide Safety Working Group's Formulated Oligonucleotide Subcommittee for the Safety Assessment of Formulated Oligonucleotide-Based Therapeutics.

    PubMed

    Marlowe, Jennifer L; Akopian, Violetta; Karmali, Priya; Kornbrust, Douglas; Lockridge, Jennifer; Semple, Sean

    2017-08-01

    The use of lipid formulations has greatly improved the ability to effectively deliver oligonucleotides and has been instrumental in the rapid expansion of therapeutic development programs using oligonucleotide drugs. However, the development of such complex multicomponent therapeutics requires the implementation of unique, scientifically sound approaches to the nonclinical development of these drugs, based upon a hybrid of knowledge and experiences drawn from small molecule, protein, and oligonucleotide therapeutic drug development. The relative paucity of directly applicable regulatory guidance documents for oligonucleotide therapeutics in general has resulted in the generation of multiple white papers from oligonucleotide drug development experts and members of the Oligonucleotide Safety Working Group (OSWG). The members of the Formulated Oligonucleotide Subcommittee of the OSWG have utilized their collective experience working with a variety of formulations and their associated oligonucleotide payloads, as well as their insights into regulatory considerations and expectations, to generate a series of consensus recommendations for the pharmacokinetic characterization and nonclinical safety assessment of this unique class of therapeutics. It should be noted that the focus of Subcommittee discussions was on lipid nanoparticle and other types of particulate formulations of therapeutic oligonucleotides and not on conjugates or other types of modifications of oligonucleotide structure intended to facilitate delivery.

  4. Rapid, sensitive and label-free detection of Shiga-toxin producing Escherichia coli O157 using carbon nanotube biosensors.

    PubMed

    Subramanian, Sowmya; Aschenbach, Konrad H; Evangelista, Jennifer P; Najjar, Mohamed Badaoui; Song, Wenxia; Gomez, Romel D

    2012-02-15

    An electronic platform to detect very small amounts of genomic DNA from bacteria without the need for PCR amplification and molecular labeling is described. The system uses carbon nanotube field-effect transistor (FET) arrays whose electrical properties are affected by minute electrical charges localized on their active regions. Two pathogenic strains of E. coli are used to evaluate the detection properties of the transistor arrays. Described herein are the results for detection of synthetic oligomers, unpurified and highly purified genomic DNA at various concentrations and their comparison against non-specific binding. In particular, the capture of genomic DNA of E. coli O157:H7 by a specific oligonucleotide probe coated onto the transistor array results in a significant shift in the threshold (gate-source) voltage (V(th)). By contrast the signal under the same procedure using a different strain, E. coli O45 that is non-complementary to the probe remained nearly constant. This work highlights the detection sensitivity and efficacy of this biosensor without stringent requirement for DNA sample preparation. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Analysis of oligonucleotide photoproducts produced by UV-A light and a riboflavin photosensitizer

    NASA Astrophysics Data System (ADS)

    Gelhaus, Stacy L.; LaCourse, William R.

    2004-12-01

    DNA damage is caused by a variety of foreign and endogenous compounds. There are endogenous photosensitizers in cells, such as porphyrins and flavins, which may create damage in the presence of UV-A light. Typically, samples are analyzed by 32P-postlabelling and electrophoretic separation or by LC-MS separation and detection. Separation by HPLC is common; however, in all instances, the DNA sample is hydrolyzed down to nucleosides prior to analysis. It will be shown here that ion-pairing reversed phase high performance liquid chromatography (IP-RPLC) has the ability to provide biophysical information concerning the sites of UV-A induced photosensitizer damage on an intact oligonucleotide concurrent with the separation. IP-RPLC is less labor intensive and faster than electrophoretic methods and it is less costly than LC-MS. IP-RPLC can also be used to purify modified oligonucleotides for further use and analysis. This technique is sensitive to the charge, conformation, and sequence characteristics of the nucleic acid sample and may be used to determine the damage or modifications made to DNA by a variety of compounds.

  6. Coordinated transcriptional regulation patterns associated with infertility phenotypes in men

    PubMed Central

    Ellis, Peter J I; Furlong, Robert A; Conner, Sarah J; Kirkman‐Brown, Jackson; Afnan, Masoud; Barratt, Christopher; Griffin, Darren K; Affara, Nabeel A

    2007-01-01

    Introduction Microarray gene‐expression profiling is a powerful tool for global analysis of the transcriptional consequences of disease phenotypes. Understanding the genetic correlates of particular pathological states is important for more accurate diagnosis and screening of patients, and thus for suggesting appropriate avenues of treatment. As yet, there has been little research describing gene‐expression profiling of infertile and subfertile men, and thus the underlying transcriptional events involved in loss of spermatogenesis remain unclear. Here we present the results of an initial screen of 33 patients with differing spermatogenic phenotypes. Methods Oligonucleotide array expression profiling was performed on testis biopsies for 33 patients presenting for testicular sperm extraction. Significantly regulated genes were selected using a mixed model analysis of variance. Principle components analysis and hierarchical clustering were used to interpret the resulting dataset with reference to the patient history, clinical findings and histological composition of the biopsies. Results Striking patterns of coordinated gene expression were found. The most significant contains multiple germ cell‐specific genes and corresponds to the degree of successful spermatogenesis in each patient, whereas a second pattern corresponds to inflammatory activity within the testis. Smaller‐scale patterns were also observed, relating to unique features of the individual biopsies. PMID:17496197

  7. Inhibition of B cell proliferation by antisense DNA to both alpha and beta forms of Fc epsilon R II.

    PubMed

    Bhatti, L; Behle, K; Stevens, R H

    1992-10-01

    Epstein-Barr Virus (EBV) infection activates B lymphocyte proliferation through partially understood mechanisms, resulting in phenotypic changes, including the appearance of new antigens. One such antigen is Fc epsilon R II/CD-23 which may be relevant for B cell proliferation. We have used anti-sense oligonucleotides to study the importance of the two forms of this molecule for proliferation in the EBV-transformed, Fc epsilon R II +ve lymphoblastoid B cell line, RPMI 8866. Anti-sense oligodeoxynucleotides were generated to the two forms of Fc epsilon R II; Fc epsilon R IIa (alpha) and IIb (beta) which differ only in their intracytoplasmic domains. Addition of increasing concentrations of anti-sense oligonucleotides, ranging from 1 to 30 microM, significantly decreased cellular proliferation as measured by the incorporation of [3H]thymidine (inhibition range 8-88%). Optimum inhibition of cellular proliferation was apparent at 15 microM concentration of both anti-sense Fc epsilon R IIa and IIb (Fc epsilon R IIa, mean +/- SE = 75 +/- 7% inhibition, p less than 0.001; Fc epsilon R IIb, mean +/- SE = 71 +/- 7% inhibition, p less than 0.001). Anti-sense oligonucleotides complementary to the common part of Fc epsilon R II resulted in a similar inhibition of proliferation. Sense oligonucleotides did not induce significant inhibition. Preincubation of sense and anti-sense oligonucleotides resulted in an abrogation of proliferation inhibition. Moreover, none of these oligonucleotides had any effect on a Fc epsilon R II -ve cell line. Incubation with both anti-sense IIa and IIb resulted in additive, but not synergistic inhibition of proliferation. Addition of soluble Fc epsilon R II did not reverse inhibition of proliferation, suggesting that membrane-bound or intracellular rather than soluble Fc epsilon R II was important for the induced proliferation. Analysis of cell surface expression for Fc epsilon II indicated that while there was a pronounced effect on cell number following incubation with anti-sense oligonucleotides, surface expression of Fc epsilon R II was consistent as measured over different time points. PCR analysis revealed that while most cells expressed either the alpha or the beta form of Fc epsilon R II, EBV-transformed cell lines, particularly RPMI 8866, were found to express both alpha and beta forms simultaneously. This may constitute a mechanism whereby EBV infection confers an immortal state to the cell, resulting in its uncontrolled proliferation. Cell lines expressing only one receptor form, either alpha or beta, were unaffected after incubation with anti-sense oligonucleotides.(ABSTRACT TRUNCATED AT 400 WORDS)

  8. The delivery of therapeutic oligonucleotides

    PubMed Central

    Juliano, Rudolph L.

    2016-01-01

    The oligonucleotide therapeutics field has seen remarkable progress over the last few years with the approval of the first antisense drug and with promising developments in late stage clinical trials using siRNA or splice switching oligonucleotides. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major issue. This review will describe the biological basis of oligonucleotide delivery including the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. It will then examine a variety of current approaches for enhancing the delivery of oligonucleotides. This includes molecular scale targeted ligand-oligonucleotide conjugates, lipid- and polymer-based nanoparticles, antibody conjugates and small molecules that improve oligonucleotide delivery. The merits and liabilities of these approaches will be discussed in the context of the underlying basic biology. PMID:27084936

  9. Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

    PubMed Central

    Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.

    2013-01-01

    Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

  10. Advanced surface-enhanced Raman gene probe systems and methods thereof

    DOEpatents

    Vo-Dinh, Tuan

    2001-01-01

    The subject invention is a series of methods and systems for using the Surface-Enhanced Raman (SER)-labeled Gene Probe for hybridization, detection and identification of SER-labeled hybridized target oligonucleotide material comprising the steps of immobilizing SER-labeled hybridized target oligonucleotide material on a support means, wherein the SER-labeled hybridized target oligonucleotide material comprise a SER label attached either to a target oligonucleotide of unknown sequence or to a gene probe of known sequence complementary to the target oligonucleotide sequence, the SER label is unique for the target oligonucleotide strands of a particular sequence wherein the SER-labeled oligonucleotide is hybridized to its complementary oligonucleotide strand, then the support means having the SER-labeled hybridized target oligonucleotide material adsorbed thereon is SERS activated with a SERS activating means, then the support means is analyzed.

  11. Comprehensive hydrophilic interaction and ion-pair reversed-phase liquid chromatography for analysis of di- to deca-oligonucleotides.

    PubMed

    Li, Qin; Lynen, Frédéric; Wang, Jian; Li, Hanlin; Xu, Guowang; Sandra, Pat

    2012-09-14

    A comprehensive two-dimensional HPLC approach with a high degree of orthogonality was developed for analysis of di- to deca-oligonucleotides (ONs). Hydrophilic interaction liquid chromatography (HILIC) was used in the first dimension, and ion-pair reversed-phase liquid chromatography (IP-RPLC) was employed in the second dimension. The two dimensions were connected via a ten-port valve interface equipped with octadecyl silica (ODS) traps to immobilize and focus the ONs eluting from the first dimension prior to IP-RPLC separation. An aqueous make-up flow was used for effective trapping. The comprehensive two-dimensional HPLC system was optimized with a mixture consisting of 27 oligonucleotide standards. An overall chromatographic peak capacity of 500 was obtained. The use of the volatile buffer triethylamine acetate in the second dimension allowed straightforward coupling to electrospray ionization mass spectrometry (ESI-MS) and detection of each ON in the negative ionization mode. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Mass spectrometric detection of siRNA in plasma samples for doping control purposes.

    PubMed

    Kohler, Maxie; Thomas, Andreas; Walpurgis, Katja; Schänzer, Wilhelm; Thevis, Mario

    2010-10-01

    Small interfering ribonucleic acid (siRNA) molecules can effect the expression of any gene by inducing the degradation of mRNA. Therefore, these molecules can be of interest for illicit performance enhancement in sports by affecting different metabolic pathways. An example of an efficient performance-enhancing gene knockdown is the myostatin gene that regulates muscle growth. This study was carried out to provide a tool for the mass spectrometric detection of modified and unmodified siRNA from plasma samples. The oligonucleotides are purified by centrifugal filtration and the use of an miRNA purification kit, followed by flow-injection analysis using an Exactive mass spectrometer to yield the accurate masses of the sense and antisense strands. Although chromatography and sensitive mass spectrometric analysis of oligonucleotides are still challenging, a method was developed and validated that has adequate sensitivity (limit of detection 0.25-1 nmol mL(-1)) and performance (precision 11-21%, recovery 23-67%) for typical antisense oligonucleotides currently used in clinical studies.

  13. Human Leukocyte Antigen Typing Using a Knowledge Base Coupled with a High-Throughput Oligonucleotide Probe Array Analysis

    PubMed Central

    Zhang, Guang Lan; Keskin, Derin B.; Lin, Hsin-Nan; Lin, Hong Huang; DeLuca, David S.; Leppanen, Scott; Milford, Edgar L.; Reinherz, Ellis L.; Brusic, Vladimir

    2014-01-01

    Human leukocyte antigens (HLA) are important biomarkers because multiple diseases, drug toxicity, and vaccine responses reveal strong HLA associations. Current clinical HLA typing is an elimination process requiring serial testing. We present an alternative in situ synthesized DNA-based microarray method that contains hundreds of thousands of probes representing a complete overlapping set covering 1,610 clinically relevant HLA class I alleles accompanied by computational tools for assigning HLA type to 4-digit resolution. Our proof-of-concept experiment included 21 blood samples, 18 cell lines, and multiple controls. The method is accurate, robust, and amenable to automation. Typing errors were restricted to homozygous samples or those with very closely related alleles from the same locus, but readily resolved by targeted DNA sequencing validation of flagged samples. High-throughput HLA typing technologies that are effective, yet inexpensive, can be used to analyze the world’s populations, benefiting both global public health and personalized health care. PMID:25505899

  14. DNA recognition by peptide nucleic acid-modified PCFs: from models to real samples

    NASA Astrophysics Data System (ADS)

    Selleri, S.; Coscelli, E.; Poli, F.; Passaro, D.; Cucinotta, A.; Lantano, C.; Corradini, R.; Marchelli, R.

    2010-04-01

    The increased concern, emerged in the last few years, on food products safety has stimulated the research on new techniques for traceability of raw food materials. DNA analysis is one of the most powerful tools for the certification of food quality, and it is presently performed through the polymerase chain reaction technique. Photonic crystal fibers, due to the presence of an array of air holes running along their length, can be exploited for performing DNA recognition by derivatizing hole surfaces and checking hybridization of complementary nucledotide chains in the sample. In this paper the application of a suspended core photonic crystal fiber in the recognition of DNA sequences is discussed. The fiber is characterized in terms of electromagnetic properties by means of a full-vector modal solver based on the finite element method. Then, the performances of the fiber in the recognition of mall synthetic oligonucleotides are discussed, together with a test of the possibility to extend this recognition to samples of DNA of applicative interest, such as olive leaves.

  15. DNA microarray-based detection and identification of Burkholderia mallei, Burkholderia pseudomallei and Burkholderia spp.

    PubMed

    Schmoock, Gernot; Ehricht, Ralf; Melzer, Falk; Rassbach, Astrid; Scholz, Holger C; Neubauer, Heinrich; Sachse, Konrad; Mota, Rinaldo Aparecido; Saqib, Muhammad; Elschner, Mandy

    2009-01-01

    We developed a rapid oligonucleotide microarray assay based on genetic markers for the accurate identification and differentiation of Burkholderia (B.) mallei and Burkholderia pseudomallei, the agents of glanders and melioidosis, respectively. These two agents were clearly identified using at least 4 independent genetic markers including 16S rRNA gene, fliC, motB and also by novel species-specific target genes, identified by in silico sequence analysis. Specific hybridization signal profiles allowed the detection and differentiation of up to 10 further Burkholderia spp., including the closely related species Burkholderia thailandensis and Burkholderia-like agents, such as Burkholderia cepacia, Burkholderia cenocepacia, Burkholderia vietnamiensis, Burkholderia ambifaria, and Burkholderia gladioli, which are often associated with cystic fibrosis (CF) lung disease. The assay was developed using the easy-to-handle and economical ArrayTube (AT) platform. A representative strain panel comprising 44 B. mallei, 32 B. pseudomallei isolates, and various Burkholderia type strains were examined to validate the test. Assay specificity was determined by examination of 40 non-Burkholderia strains.

  16. [Study toward practical use of oligonucleotide therapeutics].

    PubMed

    Inoue, Takao; Yoshida, Tokuyuki

    2014-01-01

    Over the past decade, oligonucleotide-based therapeutics such as antisense oligonucleotides and small interfering RNAs (siRNAs) have been developed extensively. For example, mipomersen (Kynamro; ISIS Pharmaceuticals), which is a second-generation antisense oligonucleotide administered by subcutaneous injection, has recently been approved by the FDA for the treatment of homozygous familial hypercholesterolemia. On the other hands, methods for the evaluation of quality, efficacy and safety of oligonucleotide therapeutics have not been fully discussed. Furthermore, the regulatory guidance specific for oligonucleotide therapeutics has not been established yet. Under these circumstances, we started to collaborate with Osaka University and PMDA to discuss regulatory science focused on oligonucleotide therapeutics. Through the collaboration, we would like to propose the possible design of quality evaluation and preclinical safety-evaluation of oligonucleotide therapeutics.

  17. Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides.

    PubMed

    Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M; Högberg, Björn

    2013-07-01

    Single-stranded oligonucleotides are important as research tools, as diagnostic probes, in gene therapy and in DNA nanotechnology. Oligonucleotides are typically produced via solid-phase synthesis, using polymer chemistries that are limited relative to what biological systems produce. The number of errors in synthetic DNA increases with oligonucleotide length, and the resulting diversity of sequences can be a problem. Here we present the 'monoclonal stoichiometric' (MOSIC) method for enzyme-mediated production of DNA oligonucleotides. We amplified oligonucleotides from clonal templates derived from single bacterial colonies and then digested cutter hairpins in the products, which released pools of oligonucleotides with precisely controlled relative stoichiometric ratios. We prepared 14-378-nucleotide MOSIC oligonucleotides either by in vitro rolling-circle amplification or by amplification of phagemid DNA in Escherichia coli. Analyses of the formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides.

  18. Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides

    PubMed Central

    Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M.; Högberg, Björn

    2013-01-01

    Single-stranded oligonucleotides are important as research tools as probes for diagnostics and gene therapy. Today, production of oligonucleotides is done via solid-phase synthesis. However, the capabilities of current polymer chemistry are limited in comparison to what can be produced in biological systems. The errors in synthetic DNA increases with oligonucleotide length, and sequence diversity can often be a problem. Here, we present the Monoclonal Stoichiometric (MOSIC) method for enzymatic DNA oligonucleotide production. Using this method, we amplify oligonucleotides from clonal templates followed by digestion of a cutter-hairpin, resulting in pools of monoclonal oligonucleotides with precisely controlled relative stoichiometric ratios. We present data where MOSIC oligonucleotides, 14–378 nt long, were prepared either by in vitro rolling-circle amplification, or by amplification in Escherichia coli in the form of phagemid DNA. The formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides. PMID:23727986

  19. Syntheses of prodrug-type phosphotriester oligonucleotides responsive to intracellular reducing environment for improvement of cell membrane permeability and nuclease resistance.

    PubMed

    Hayashi, Junsuke; Samezawa, Yusuke; Ochi, Yosuke; Wada, Shun-Ichi; Urata, Hidehito

    2017-07-15

    We synthesized prodrug-type phosphotriester (PTE) oligonucleotides containing the six-membered cyclic disulfide moiety by using phosphoramidite chemistry. Prodrug-type oligonucleotides named "Reducing-Environment-Dependent Uncatalyzed Chemical Transforming (REDUCT) PTE oligonucleotides" were converted into natural oligonucleotides under cytosol-mimetic reductive condition. Furthermore, the REDUCT PTE oligonucleotides were robust to nuclease digestion and exhibited good cell membrane permeability. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Ultrasensitive sliver nanorods array SERS sensor for mercury ions.

    PubMed

    Song, Chunyuan; Yang, Boyue; Zhu, Yu; Yang, Yanjun; Wang, Lianhui

    2017-01-15

    With years of outrageous mercury emissions, there is an urgent need to develop convenient and sensitive methods for detecting mercury ions in response to increasingly serious mercury pollution in water. In the present work, a portable, ultrasensitive SERS sensor is proposed and utilized for detecting trace mercury ions in water. The SERS sensor is prepared on an excellent sliver nanorods array SERS substrate by immobilizing T-component oligonucleotide probes labeled with dye on the 3'-end and -SH on the 5'-end. The SERS sensor responses to the specific chemical bonding between thymine and mercury ions, which causes the previous flexible single strand of oligonucleotide probe changing into rigid and upright double chain structure. Such change in the structure drives the dyes far away from the excellent SERS substrate and results in a SERS signal attenuation of the dye. Therefore, by monitoring the decay of SERS signal of the dye, mercury ions in water can be detected qualitatively and quantitatively. The experimental results indicate that the proposed optimal SERS sensor owns a linear response with wide detecting range from 1pM to 1μM, and a detection limit of 0.16pM is obtained. In addition, the SERS sensor demonstrates good specificity for Hg 2+ , which can accurately identify trace mercury ions from a mixture of ten kinds of other ions. The SERS sensor has been further executed to analyze the trace mercury ions in tap water and lake water respectively, and good recovery rates are obtained for sensing both kinds of water. With its high selectivity and good portability, the ultrasensitive SERS sensor is expected to be a promising candidate for discriminating mercury ions in the fields of environmental monitoring and food safety. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Molecular Diagnostic Tools for Detection and Differentiation of Phytoplasmas Based on Chaperonin-60 Reveal Differences in Host Plant Infection Patterns

    PubMed Central

    Dumonceaux, Tim J.; Green, Margaret; Hammond, Christine; Perez, Edel; Olivier, Chrystel

    2014-01-01

    Phytoplasmas (‘Candidatus Phytoplasma’ spp.) are insect-vectored bacteria that infect a wide variety of plants, including many agriculturally important species. The infections can cause devastating yield losses by inducing morphological changes that dramatically alter inflorescence development. Detection of phytoplasma infection typically utilizes sequences located within the 16S–23S rRNA-encoding locus, and these sequences are necessary for strain identification by currently accepted standards for phytoplasma classification. However, these methods can generate PCR products >1400 bp that are less divergent in sequence than protein-encoding genes, limiting strain resolution in certain cases. We describe a method for accessing the chaperonin-60 (cpn60) gene sequence from a diverse array of ‘Ca.Phytoplasma’ spp. Two degenerate primer sets were designed based on the known sequence diversity of cpn60 from ‘Ca.Phytoplasma’ spp. and used to amplify cpn60 gene fragments from various reference samples and infected plant tissues. Forty three cpn60 sequences were thereby determined. The cpn60 PCR-gel electrophoresis method was highly sensitive compared to 16S-23S-targeted PCR-gel electrophoresis. The topology of a phylogenetic tree generated using cpn60 sequences was congruent with that reported for 16S rRNA-encoding genes. The cpn60 sequences were used to design a hybridization array using oligonucleotide-coupled fluorescent microspheres, providing rapid diagnosis and typing of phytoplasma infections. The oligonucleotide-coupled fluorescent microsphere assay revealed samples that were infected simultaneously with two subtypes of phytoplasma. These tools were applied to show that two host plants, Brassica napus and Camelina sativa, displayed different phytoplasma infection patterns. PMID:25551224

  2. Junctions between i-motif tetramers in supramolecular structures

    PubMed Central

    Guittet, Eric; Renciuk, Daniel; Leroy, Jean-Louis

    2012-01-01

    The symmetry of i-motif tetramers gives to cytidine-rich oligonucleotides the capacity to associate into supramolecular structures (sms). In order to determine how the tetramers are linked together in such structures, we have measured by gel filtration chromatography and NMR the formation and dissociation kinetics of sms built by oligonucleotides containing two short C stretches separated by a non-cytidine-base. We show that a stretch of only two cytidines either at the 3′- or 5′-end is long enough to link the tetramers into sms. The analysis of the properties of sms formed by oligonucleotides differing by the length of the oligo-C stretches, the sequence orientation and the nature of the non-C base provides a model of the junction connecting the tetramers in sms. PMID:22362739

  3. Application of a cholesterol stationary phase in the analysis of phosphorothioate oligonucleotides by means of ion pair chromatography coupled with tandem mass spectrometry.

    PubMed

    Studzińska, Sylwia; Krzemińska, Katarzyna; Szumski, Michał; Buszewski, Bogusław

    2016-07-01

    The main aim of this study was the investigation of the influence of several ion pair reagents towards both the retention and the mass spectrometry sensitivity of phosphorothioate oligonucleotides. A cholesterol stationary phase was applied for the first time in the analysis of this group of compounds. The mobile phase composition was modified by changing the concentration and the type of amines and acetates or 1,1,1,3,3,3-hexafluoroisopropanol. It has been shown that the increase of amines concentration results in the retention factor increase for each oligonucleotide, on each adsorbent. The only exception was the mobile phase composed of triethylamine and 1,1,1,3,3,3-hexafluoroisopropanol. This is a consequence of interactions taking place between a cholesterol molecule and an alcohol. This effect was convenient when the mass spectrometry detection was applied, since it allowed an increase in the sensitivity. Moreover, optimization of the mobile phase composition and its impact on the efficiency of ionization process and on the sensitivity in mass spectrometry were also presented. The optimization of this new method, based on cholesterol stationary phase coupled with mass spectrometry detection, was finally applied for the determination of phosphorothioate oligonucleotides impurity in a real sample. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Receptor-Mediated Uptake of Phosphorothioate Antisense Oligonucleotides in Different Cell Types of the Liver.

    PubMed

    Miller, Colton M; Tanowitz, Michael; Donner, Aaron J; Prakash, Thazha P; Swayze, Eric E; Harris, Edward N; Seth, Punit P

    2018-06-01

    Oligonucleotide therapeutics have emerged as a third distinct platform for drug discovery within the pharmaceutical industry. Five oligonucleotide-based drugs have been approved by the US FDA and over 100 oligonucleotides drugs are currently at different stages of human trials. Several of these oligonucleotide drugs are modified using the phosphorothioate (PS) backbone modification where one of the nonbridging oxygen atoms of the phosphodiester linkage is replaced with sulfur. In this review, we summarize our knowledge on receptor-mediated uptake of PS antisense oligonucleotides (ASOs) within different cell types of the liver-a privileged organ for the discovery of oligonucleotide-based therapeutics.

  5. Discrimination of heterogenous mRNAs encoding strychnine-sensitive glycine receptors in Xenopus oocytes by antisense oligonucleotides.

    PubMed Central

    Akagi, H; Patton, D E; Miledi, R

    1989-01-01

    Three synthetic oligodeoxynucleotides complementary to different parts of an RNA encoding a glycine receptor subunit were used to discriminate heterogenous mRNAs coding for glycine receptors in adult and neonatal rat spinal cord. Injection of the three antisense oligonucleotides into Xenopus oocytes specifically inhibited the expression of glycine receptors by adult spinal cord mRNA. In contrast, the antisense oligonucleotides were much less potent in inhibiting the expression of glycine receptors encoded by neonatal spinal cord mRNA. Northern blot analysis revealed that the oligonucleotides hybridized mostly to an adult cord transcript of approximately 10 kilobases in size. This band was also present in neonatal spinal cord mRNA but its density was about one-fourth of the adult cord message. There was no intense band in the low molecular weight position (approximately 2 kilobases), the existence of which was expected from electrophysiological studies with size-fractionated mRNA of neonatal spinal cord. Our results suggest that in the rat spinal cord there are at least three different types of mRNAs encoding functional strychnine-sensitive glycine receptors. Images PMID:2479016

  6. Regulation of the activity of the promoter of RNA-induced silencing, C3PO.

    PubMed

    Sahu, Shriya; Williams, Leo; Perez, Alberto; Philip, Finly; Caso, Giuseppe; Zurawsky, Walter; Scarlata, Suzanne

    2017-09-01

    RNA-induced silencing is a process which allows cells to regulate the synthesis of specific proteins. RNA silencing is promoted by the protein C3PO (component 3 of RISC). We have previously found that phospholipase Cβ, which increases intracellular calcium levels in response to specific G protein signals, inhibits C3PO activity towards certain genes. Understanding the parameters that control C3PO activity and which genes are impacted by G protein activation would help predict which genes are more vulnerable to downregulation. Here, using a library of 10 18 oligonucleotides, we show that C3PO binds oligonucleotides with structural specificity but little sequence specificity. Alternately, C3PO hydrolyzes oligonucleotides with a rate that is sensitive to substrate stability. Importantly, we find that oligonucleotides with higher Tm values are inhibited by bound PLCβ. This finding is supported by microarray analysis in cells over-expressing PLCβ1. Taken together, this study allows predictions of the genes whose post-transcriptional regulation is responsive to the G protein/phospholipase Cβ/calcium signaling pathway. © 2017 The Protein Society.

  7. What controls the hybridization thermodynamics of spherical nucleic acids?

    PubMed

    Randeria, Pratik S; Jones, Matthew R; Kohlstedt, Kevin L; Banga, Resham J; Olvera de la Cruz, Monica; Schatz, George C; Mirkin, Chad A

    2015-03-18

    The hybridization of free oligonucleotides to densely packed, oriented arrays of DNA modifying the surfaces of spherical nucleic acid (SNA)-gold nanoparticle conjugates occurs with negative cooperativity; i.e., each binding event destabilizes subsequent binding events. DNA hybridization is thus an ever-changing function of the number of strands already hybridized to the particle. Thermodynamic quantification of this behavior reveals a 3 orders of magnitude decrease in the binding constant for the capture of a free oligonucleotide by an SNA conjugate as the fraction of pre-hybridized strands increases from 0 to ∼30%. Increasing the number of pre-hybridized strands imparts an increasing enthalpic penalty to hybridization that makes binding more difficult, while simultaneously decreasing the entropic penalty to hybridization, which makes binding more favorable. Hybridization of free DNA to an SNA is thus governed by both an electrostatic barrier as the SNA accumulates charge with additional binding events and an effect consistent with allostery, where hybridization at certain sites on an SNA modify the binding affinity at a distal site through conformational changes to the remaining single strands. Leveraging these insights allows for the design of conjugates that hybridize free strands with significantly higher efficiencies, some of which approach 100%.

  8. A novel 4p16.3 microduplication distal to WHSC1 and WHSC2 characterized by oligonucleotide array with new phenotypic features.

    PubMed

    Cyr, Andrew B; Nimmakayalu, Manjunath; Longmuir, Susannah Q; Patil, Shivanand R; Keppler-Noreuil, Kim M; Shchelochkov, Oleg A

    2011-09-01

    Larger imbalances on chromosome 4p in the form of deletions associated with Wolf-Hirschhorn syndrome (WHS) and duplications of chromosome 4p have a defined clinical phenotype. The critical region for both these clinical disorders has been narrowed based on the genotype-phenotype correlations. However, cryptic rearrangements in this region have been reported infrequently. We report on a male patient with a microduplication of chromosome 4p, who presents with findings of macrocephaly, irregular iris pigmentation-heterochromia, and preserved linear growth in addition to overlapping features of trisomy 4p such as seizures, delayed psychomotor development, and dysmorphic features including prominent glabella, low-set ears, and short neck. Using a high-density oligonucleotide microarray, we have identified a novel submicroscopic duplication involving dosage sensitive genes TACC3, FGFR3, and LETM1. The microduplication did not involve WHSC1 and WHSC2 which are considered in the critical region for WHS and trisomy 4p. This patient's presentation and genomic findings help further delineate clinical significance of re-arrangements in the 4p16 region without the involvement of WHS critical region. Copyright © 2011 Wiley-Liss, Inc.

  9. Identification of differentially regulated transcripts in mouse striatum following methamphetamine treatment--an oligonucleotide microarray approach.

    PubMed

    Thomas, David M; Francescutti-Verbeem, Dina M; Liu, Xiuli; Kuhn, Donald M

    2004-01-01

    Methamphetamine is an addictive drug of abuse that can produce neurotoxic effects in dopamine nerve endings of the striatum. The purpose of this study was to identify new genes that may play a role in the highly complex cascade of events associated with methamphetamine intoxication. Using Affymetrix oligonucleotide arrays, 12 488 genes were simultaneously interrogated and there were 152 whose expression levels were changed following methamphetamine treatment. The genes are grouped into broad functional categories with inflammatory/immune response elements, receptor/signal transduction components and ion channel/transport proteins among the most populated. Many genes within these categories can be linked to ion regulation and apoptosis, both of which have been implicated in methamphetamine toxicity, and numerous factors associated with microglial activation emerged with significant changes in expression. For example, brain-derived neurotrophic factor (BDNF), chemokine (C-C) receptor 6 (CCr6) and numerous chemokine transcripts were increased or decreased in expression more than 2.8-fold. These results point to activated microglia as a potential source of the reactive oxygen/nitrogen species and cytokines that have been previously associated with methamphetamine toxicity and other neurotoxic conditions.

  10. Simplified Paper Format for Detecting HIV Drug Resistance in Clinical Specimens by Oligonucleotide Ligation

    PubMed Central

    Panpradist, Nuttada; Beck, Ingrid A.; Chung, Michael H.; Kiarie, James N.; Frenkel, Lisa M.; Lutz, Barry R.

    2016-01-01

    Human immunodeficiency virus (HIV) is a chronic infection that can be managed by antiretroviral treatment (ART). However, periods of suboptimal viral suppression during lifelong ART can select for HIV drug resistant (DR) variants. Transmission of drug resistant virus can lessen or abrogate ART efficacy. Therefore, testing of individuals for drug resistance prior to initiation of treatment is recommended to ensure effective ART. Sensitive and inexpensive HIV genotyping methods are needed in low-resource settings where most HIV infections occur. The oligonucleotide ligation assay (OLA) is a sensitive point mutation assay for detection of drug resistance mutations in HIV pol. The current OLA involves four main steps from sample to analysis: (1) lysis and/or nucleic acid extraction, (2) amplification of HIV RNA or DNA, (3) ligation of oligonucleotide probes designed to detect single nucleotide mutations that confer HIV drug resistance, and (4) analysis via oligonucleotide surface capture, denaturation, and detection (CDD). The relative complexity of these steps has limited its adoption in resource-limited laboratories. Here we describe a simplification of the 2.5-hour plate-format CDD to a 45-minute paper-format CDD that eliminates the need for a plate reader. Analysis of mutations at four HIV-1 DR codons (K103N, Y181C, M184V, and G190A) in 26 blood specimens showed a strong correlation of the ratios of mutant signal to total signal between the paper CDD and the plate CDD. The assay described makes the OLA easier to perform in low resource laboratories. PMID:26751207

  11. A limited innate immune response is induced by a replication-defective herpes simplex virus vector following delivery to the murine central nervous system

    PubMed Central

    Zeier, Zane; Aguilar, J Santiago; Lopez, Cecilia M; Devi-Rao, G B; Watson, Zachary L; Baker, Henry V; Wagner, Edward K; Bloom, David C

    2010-01-01

    Herpes simplex virus type 1 (HSV-1)–based vectors readily transduce neurons and have a large payload capacity, making them particularly amenable to gene therapy applications within the central nervous system (CNS). Because aspects of the host responses to HSV-1 vectors in the CNS are largely unknown, we compared the host response of a nonreplicating HSV-1 vector to that of a replication-competent HSV-1 virus using microarray analysis. In parallel, HSV-1 gene expression was tracked using HSV-specific oligonucleotide-based arrays in order to correlate viral gene expression with observed changes in host response. Microarray analysis was performed following stereotactic injection into the right hippocampal formation of mice with either a replication-competent HSV-1 or a nonreplicating recombinant of HSV-1, lacking the ICP4 gene (ICP4−). Genes that demonstrated a significant change (P < .001) in expression in response to the replicating HSV-1 outnumbered those that changed in response to mock or nonreplicating vector by approximately 3-fold. Pathway analysis revealed that both the replicating and nonreplicating vectors induced robust antigen presentation but only mild interferon, chemokine, and cytokine signaling responses. The ICP4− vector was restricted in several of the Toll-like receptor-signaling pathways, indicating reduced stimulation of the innate immune response. These array analyses suggest that although the nonreplicating vector induces detectable activation of immune response pathways, the number and magnitude of the induced response is dramatically restricted compared to the replicating vector, and with the exception of antigen presentation, host gene expression induced by the non-replicating vector largely resembles mock infection. PMID:20095947

  12. Design and evaluation of Actichip, a thematic microarray for the study of the actin cytoskeleton

    PubMed Central

    Muller, Jean; Mehlen, André; Vetter, Guillaume; Yatskou, Mikalai; Muller, Arnaud; Chalmel, Frédéric; Poch, Olivier; Friederich, Evelyne; Vallar, Laurent

    2007-01-01

    Background The actin cytoskeleton plays a crucial role in supporting and regulating numerous cellular processes. Mutations or alterations in the expression levels affecting the actin cytoskeleton system or related regulatory mechanisms are often associated with complex diseases such as cancer. Understanding how qualitative or quantitative changes in expression of the set of actin cytoskeleton genes are integrated to control actin dynamics and organisation is currently a challenge and should provide insights in identifying potential targets for drug discovery. Here we report the development of a dedicated microarray, the Actichip, containing 60-mer oligonucleotide probes for 327 genes selected for transcriptome analysis of the human actin cytoskeleton. Results Genomic data and sequence analysis features were retrieved from GenBank and stored in an integrative database called Actinome. From these data, probes were designed using a home-made program (CADO4MI) allowing sequence refinement and improved probe specificity by combining the complementary information recovered from the UniGene and RefSeq databases. Actichip performance was analysed by hybridisation with RNAs extracted from epithelial MCF-7 cells and human skeletal muscle. Using thoroughly standardised procedures, we obtained microarray images with excellent quality resulting in high data reproducibility. Actichip displayed a large dynamic range extending over three logs with a limit of sensitivity between one and ten copies of transcript per cell. The array allowed accurate detection of small changes in gene expression and reliable classification of samples based on the expression profiles of tissue-specific genes. When compared to two other oligonucleotide microarray platforms, Actichip showed similar sensitivity and concordant expression ratios. Moreover, Actichip was able to discriminate the highly similar actin isoforms whereas the two other platforms did not. Conclusion Our data demonstrate that Actichip is a powerful alternative to commercial high density microarrays for cytoskeleton gene profiling in normal or pathological samples. Actichip is available upon request. PMID:17727702

  13. A robust method to analyze copy number alterations of less than 100 kb in single cells using oligonucleotide array CGH.

    PubMed

    Möhlendick, Birte; Bartenhagen, Christoph; Behrens, Bianca; Honisch, Ellen; Raba, Katharina; Knoefel, Wolfram T; Stoecklein, Nikolas H

    2013-01-01

    Comprehensive genome wide analyses of single cells became increasingly important in cancer research, but remain to be a technically challenging task. Here, we provide a protocol for array comparative genomic hybridization (aCGH) of single cells. The protocol is based on an established adapter-linker PCR (WGAM) and allowed us to detect copy number alterations as small as 56 kb in single cells. In addition we report on factors influencing the success of single cell aCGH downstream of the amplification method, including the characteristics of the reference DNA, the labeling technique, the amount of input DNA, reamplification, the aCGH resolution, and data analysis. In comparison with two other commercially available non-linear single cell amplification methods, WGAM showed a very good performance in aCGH experiments. Finally, we demonstrate that cancer cells that were processed and identified by the CellSearch® System and that were subsequently isolated from the CellSearch® cartridge as single cells by fluorescence activated cell sorting (FACS) could be successfully analyzed using our WGAM-aCGH protocol. We believe that even in the era of next-generation sequencing, our single cell aCGH protocol will be a useful and (cost-) effective approach to study copy number alterations in single cells at resolution comparable to those reported currently for single cell digital karyotyping based on next generation sequencing data.

  14. Random oligonucleotide mutagenesis: application to a large protein coding sequence of a major histocompatibility complex class I gene, H-2DP.

    PubMed Central

    Murray, R; Pederson, K; Prosser, H; Muller, D; Hutchison, C A; Frelinger, J A

    1988-01-01

    We have used random oligonucleotide mutagenesis (or saturation mutagenesis) to create a library of point mutations in the alpha 1 protein domain of a Major Histocompatibility Complex (MHC) molecule. This protein domain is critical for T cell and B cell recognition. We altered the MHC class I H-2DP gene sequence such that synthetic mutant alpha 1 exons (270 bp of coding sequence), which contain mutations identified by sequence analysis, can replace the wild type alpha 1 exon. The synthetic exons were constructed from twelve overlapping oligonucleotides which contained an average of 1.3 random point mutations per intact exon. DNA sequence analysis of mutant alpha 1 exons has shown a point mutant distribution that fits a Poisson distribution, and thus emphasizes the utility of this mutagenesis technique to "scan" a large protein sequence for important mutations. We report our use of saturation mutagenesis to scan an entire exon of the H-2DP gene, a cassette strategy to replace the wild type alpha 1 exon with individual mutant alpha 1 exons, and analysis of mutant molecules expressed on the surface of transfected mouse L cells. Images PMID:2903482

  15. Pyrophosphorolytic dismutation of oligodeoxy-nucleotides by terminal deoxynucleotidyltransferase.

    PubMed Central

    Anderson, R S; Bollum, F J; Beattie, K L

    1999-01-01

    Terminal transferase (TdT), when incubated with a purified(32)P-5"-end-labeled oligonucleotide of defined length in the presence of Co(2+), Mn(2+)or Mg(2+)and 2-mercaptoethanol in cacodylate or HEPES buffer, pH 7.2, exhibits the ability to remove a 3"-nucleotide from one oligonucleotide and add it to the 3"-end of another. When analyzed by urea-PAGE, this activity is observed as a disproportionation of the starting oligonucleotide into a ladder of shorter and longer oligonucleotides distributed around the starting material. Optimal metal ion concentration is 1-2 mM. All three metal ions support this activity with Co(2+)> Mn(2+) congruent with Mg(2+). Oligonucleotides p(dT) and p(dA) are more efficient substrates than p(dG) and p(dC) because the latter may form secondary structures. The dismutase activity is significant even in the presence of dNTP concentrations comparable to those that exist in the nucleus during the G(1)phase of the cell cycle. Using BetaScope image analysis the rate of pyrophosphorolytic dismutase activity was found to be only moderately slower than the poly-merization activity. These results may help explain the GC-richness of immunoglobulin gene segment joins (N regions) and the loss of bases that occur during gene rearrangements in pre-B and pre-T cells. PMID:10454617

  16. Direct profiling of environmental microbial populations by thermal dissociation analysis of native rRNAs hybridized to oligonucleotide microarrays

    NASA Technical Reports Server (NTRS)

    El Fantroussi, Said; Urakawa, Hidetoshi; Bernhard, Anne E.; Kelly, John J.; Noble, Peter A.; Smidt, H.; Yershov, G. M.; Stahl, David A.

    2003-01-01

    Oligonucleotide microarrays were used to profile directly extracted rRNA from environmental microbial populations without PCR amplification. In our initial inspection of two distinct estuarine study sites, the hybridization patterns were reproducible and varied between estuarine sediments of differing salinities. The determination of a thermal dissociation curve (i.e., melting profile) for each probe-target duplex provided information on hybridization specificity, which is essential for confirming adequate discrimination between target and nontarget sequences.

  17. Pentopyranosyl Oligonucleotide Systems. Part 11: Systems with Shortened Backbones: D)-beta-Ribopyranosyl-(4 yields 3 )- and (L)-alpha - Lyxopyranosyl-(4 yields 3 )-oligonucleotides

    NASA Technical Reports Server (NTRS)

    Wippo, Harald; Reck, Folkert; Kudick, Rene; Ramaseshan, Mahesh; Ceulemans, Griet; Bolli, Martin; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2001-01-01

    The (L)-a-lyxopyranosyl-(4'yields 3')-oligonucleotide system-a member of a pentopyranosyl oligonucleotide family containing a shortened backbone-is capable of cooperative base-pairing and of cross-pairing with DNA and RNA. In contrast, corresponding (D)-beta-ribopyransoyl-(4' yields 3')-oligonucleotides do not show base-pairing under similar conditions. We conclude that oligonucleotide systems can violate the six-bonds-per-backbone-unit rule by having five bonds instead, if their vicinally bound phosphodiester bridges can assume an antiperiplanar conformation. An additional structural feature that seems relevant to the cross-pairing capability of the (L)-a-lyxopyranosyl-(4' yields 3')-oligonucleotide system is its (small) backbone/basepair axes inclination. An inclination which is similar to that in B-DNA seems to be a prerequisite for an oligonucleotide system s capability to cross-pair with DNA.

  18. A New Oligonucleotide Microarray for Detection of Pathogenic and Non-Pathogenic Legionella spp.

    PubMed Central

    Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

    2014-01-01

    Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp. PMID:25469776

  19. A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.

    PubMed

    Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

    2014-01-01

    Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.

  20. Current Status and Future Prospects for Aptamer-Based Mycotoxin Detection.

    PubMed

    Ruscito, Annamaria; Smith, McKenzie; Goudreau, Daniel N; DeRosa, Maria C

    2016-07-01

    Aptamers are single-stranded oligonucleotides with the ability to bind tightly and selectively to a target analyte. High-affinity and specific aptamers for a variety of mycotoxins have been reported over the past decade. Increasingly, these molecular recognition elements are finding applications in biosensors and assays for the detection of mycotoxins in a variety of complex matrixes. This review article highlights the mycotoxin aptamers that are available for mycotoxin detection and the array of biosensing platforms into which they have been incorporated. Key advantages that aptamers have over analogous technology, and areas in which these advantages may be applied for the benefit of practical mycotoxin detection, are also discussed.

  1. Degenerative encephalopathy in a coastal mountain kingsnake (Lampropeltis zonata multifasciata) due to adenoviral-like infection.

    PubMed

    Raymond, James T; Lamm, Marnie; Nordhausen, Robert; Latimer, Ken; Garner, Michael M

    2003-04-01

    In March 2000, an approximately 30-yr-old, male coastal mountain kingsnake (Lampropeltis zonata multifasciata) presented with disequilibrium and unresponsiveness to stimuli that ultimately lead to euthanasia. Histologically, there were foci of gliosis primarily within the caudal cerebrum, brainstem, and cervical spinal cord. Several glial cells and endothelial cells contained magenta, intranuclear inclusion bodies. Electron microscopy of the inclusions revealed paracrystalline arrays of 79-82 nm, viral-like particles. DNA in situ hybridization of sections of formalin-fixed brain using a mixture of two digoxigenin-end-labeled, adenovirus specific, oligonucleotide probes at low and high stringency was positive for adenovirus.

  2. Multiplex Identification of Microbes ▿ †

    PubMed Central

    Hyman, Richard W.; St.Onge, Robert P.; Allen, Edward A.; Miranda, Molly; Aparicio, Ana Maria; Fukushima, Marilyn; Davis, Ronald W.

    2010-01-01

    We have adapted molecular inversion probe technology to identify microbes in a highly multiplexed procedure. This procedure does not require growth of the microbes. Rather, the technology employs DNA homology twice: once for the molecular probe to hybridize to its homologous DNA and again for the 20-mer oligonucleotide barcode on the molecular probe to hybridize to a commercially available molecular barcode array. As proof of concept, we have designed, tested, and employed 192 molecular probes for 40 microbes. While these particular molecular probes are aimed at our interest in the microbes in the human vagina, this molecular probe method could be employed to identify the microbes in any ecological niche. PMID:20418427

  3. Molecular identification of common Salmonella serovars using multiplex DNA sensor-based suspension array.

    PubMed

    Aydin, Muhsin; Carter-Conger, Jacqueline; Gao, Ning; Gilmore, David F; Ricke, Steven C; Ahn, Soohyoun

    2018-04-01

    Salmonella is one of major foodborne pathogens and the leading cause of foodborne illness-related hospitalizations and deaths. It is critical to develop a sensitive and rapid detection assay that can identify Salmonella to ensure food safety. In this study, a DNA sensor-based suspension array system of high multiplexing ability was developed to identify eight Salmonella serovars commonly associated with foodborne outbreaks to the serotype level. Each DNA sensor was prepared by activating pre-encoded microspheres with oligonucleotide probes that are targeting virulence genes and serovar-specific regions. The mixture of 12 different types of DNA sensors were loaded into a 96-well microplate and used as a 12-plex DNA sensor array platform. DNA isolated from Salmonella was amplified by multiplex polymerase chain reaction (mPCR), and the presence of Salmonella was determined by reading fluorescent signals from hybridization between probes on DNA sensors and fluorescently labeled target DNA using the Bio-Plex® system. The developed multiplex array was able to detect synthetic DNA at the concentration as low as 100 fM and various Salmonella serovars as low as 100 CFU/mL within 1 h post-PCR. Sensitivity of this assay was further improved to 1 CFU/mL with 6-h enrichment. The array system also correctly and specifically identified serotype of tested Salmonella strains without any cross-reactivity with other common foodborne pathogens. Our results indicate the developed DNA sensor suspension array can be a rapid and reliable high-throughput method for simultaneous detection and molecular identification of common Salmonella serotypes.

  4. Microarray-Based Comparative Genomic Hybridization Using Sex-Matched Reference DNA Provides Greater Sensitivity for Detection of Sex Chromosome Imbalances than Array-Comparative Genomic Hybridization with Sex-Mismatched Reference DNA

    PubMed Central

    Yatsenko, Svetlana A.; Shaw, Chad A.; Ou, Zhishuo; Pursley, Amber N.; Patel, Ankita; Bi, Weimin; Cheung, Sau Wai; Lupski, James R.; Chinault, A. Craig; Beaudet, Arthur L.

    2009-01-01

    In array-comparative genomic hybridization (array-CGH) experiments, the measurement of DNA copy number of sex chromosomal regions depends on the sex of the patient and the reference DNAs used. We evaluated the ability of bacterial artificial chromosomes/P1-derived artificial and oligonucleotide array-CGH analyses to detect constitutional sex chromosome imbalances using sex-mismatched reference DNAs. Twenty-two samples with imbalances involving either the X or Y chromosome, including deletions, duplications, triplications, derivative or isodicentric chromosomes, and aneuploidy, were analyzed. Although concordant results were obtained for approximately one-half of the samples when using sex-mismatched and sex-matched reference DNAs, array-CGH analyses with sex-mismatched reference DNAs did not detect genomic imbalances that were detected using sex-matched reference DNAs in 6 of 22 patients. Small duplications and deletions of the X chromosome were most difficult to detect in female and male patients, respectively, when sex-mismatched reference DNAs were used. Sex-matched reference DNAs in array-CGH analyses provides optimal sensitivity and enables an automated statistical evaluation for the detection of sex chromosome imbalances when compared with an experimental design using sex-mismatched reference DNAs. Using sex-mismatched reference DNAs in array-CGH analyses may generate false-negative, false-positive, and ambiguous results for sex chromosome-specific probes, thus masking potential pathogenic genomic imbalances. Therefore, to optimize both detection of clinically relevant sex chromosome imbalances and ensure proper experimental performance, we suggest that alternative internal controls be developed and used instead of using sex-mismatched reference DNAs. PMID:19324990

  5. Fabrication of 3D Reconstituted Organoid Arrays by DNA-programmed Assembly of Cells (DPAC)

    PubMed Central

    Todhunter, Michael E; Weber, Robert J; Farlow, Justin; Jee, Noel Y; Cerchiari, Alec E; Gartner, Zev J

    2016-01-01

    Tissues are the organizational units of function in metazoan organisms. Tissues comprise an assortment of cellular building blocks, soluble factors, and extracellular matrix (ECM) that are composed into specific three dimensional (3D) structures. The capacity to reconstitute tissues in vitro with the structural complexity observed in vivo is key to understanding processes such as morphogenesis, homeostasis, and disease. In this unit, we describe DNA-programmed Assembly of Cells (DPAC), a method to fabricate viable, functional arrays of organoid-like tissues within 3D ECM gels. In DPAC, dissociated cells are chemically functionalized with degradable oligonucleotide “velcro,” allowing rapid, specific, and reversible cell adhesion to a two-dimensional (2D) template patterned with complementary DNA. An iterative assembly process builds up organoids, layer-by-layer, from this initial 2D template and into the third dimension. Cleavage of the DNA releases the completed array of tissues that are captured and fully embedded in ECM gels for culture and observation. DPAC controls the size, shape, composition, and spatial heterogeneity of organoids, and permits positioning constituent cells with single-cell resolution even within cultures several centimeters long. PMID:27622567

  6. In situ identification of nocardioform actinomycetes in activated sludge using fluorescent rRNA-targeted oligonucleotide probes.

    PubMed

    Schuppler, M; Wagner, M; Schön, G; Göbel, U B

    1998-01-01

    Hitherto, few environmental samples have been investigated by a 'full cycle rRNA analysis'. Here the results of in situ hybridization experiments with specific rRNA-targeted oligonucleotide probes developed on the basis of new sequences derived from a previously described comparative 16S rRNA analysis of nocardioform actinomycetes in activated sludge are reported. Application of the specific probes enabled identification and discrimination of the distinct populations of nocardioform actinomycetes in activated sludge. One of the specific probes (DLP) detected rod-shaped bacteria which were found in 13 of the 16 investigated sludge samples from various wastewater treatment plants, suggesting their importance in the wastewater treatment process. Another probe (GLP2) hybridized with typically branched filaments of nocardioforms mainly found in samples from enhanced biological phosphorus removal plants, suggesting that these bacteria are involved in sludge foaming. The combination of in situ hybridization with fluorescently labelled rRNA-targeted oligonucleotide probes and confocal laser scanning microscopy improved the detection of nocardioform actinomycetes, which often showed only weak signals inside the activated-sludge flocs.

  7. [Impact of Delivery Method on Antiviral Activity of Phosphodiester, Phosphorothioate, and Phosphoryl Guanidine Oligonucleotides in MDCK Cells Infected with H5N1 Bird Flu Virus].

    PubMed

    Levina, A S; Repkova, M N; Chelobanov, B P; Bessudnova, E V; Mazurkova, N A; Stetsenko, D A; Zarytova, V F

    2017-01-01

    We have previously described nanocomposites containing conjugates or complexes of native oligodeoxyribonucleotides with poly-L-lysine and TiO2 nanoparticles. We have shown that these nanocomposites efficiently suppressed influenza A virus reproduction in MDCK cells. Here, we have synthesized previously undescribed nanocomposites that consist of TiO2 nanoparticles and polylysine conjugates with oligonucleotides that contain phosphoryl guanidine or phosphorothioate internucleotide groups. These nanocomposites have been shown to exhibit antiviral activity in MDCK cells infected with H5N1 influenza A virus. The nanocomposites containing phosphorothioate oligonucleotides inhibited virus replication ~130-fold. More potent inhibition, i.e., ~5000-fold or ~4600-fold, has been demonstrated by nanocomposites that contain phosphoryl guanidine or phosphodiester oligonucleotides, respectively. Free oligonucleotides have been nearly inactive. The antiviral activity of oligonucleotides of all three types, when delivered by Lipofectamine, has been significantly lower compared to the oligonucleotides delivered in the nanocomposites. In the former case, the phosphoryl guanidine oligonucleotide has appeared to be the most efficient; it has inhibited the virus replication by a factor of 400. The results make it possible to consider phosphoryl guanidine oligonucleotides, along with other oligonucleotide derivatives, as potential antiviral agents against H5N1 avian flu virus.

  8. High-resolution array comparative genomic hybridization analysis of human bronchial and salivary adenoid cystic carcinoma.

    PubMed

    Bernheim, Alain; Toujani, Saloua; Saulnier, Patrick; Robert, Thomas; Casiraghi, Odile; Validire, Pierre; Temam, Stéphane; Menard, Philippe; Dessen, Philippe; Fouret, Pierre

    2008-05-01

    Adenoid cystic carcinoma (ACC) is a rare but distinctive tumor. Oligonucleotide array comparative genomic hybridization has been applied for cataloging genomic copy number alterations (CNAs) in 17 frozen salivary or bronchial tumors. Only four whole chromosome CNAs were found, and most cases had 2-4 segmental CNAs. No high level amplification was observed. There were recurrent gains at 7p15.2, 17q21-25, and 22q11-13, and recurrent losses at 1p35, 6q22-25, 8q12-13, 9p21, 12q12-13, and 17p11-13. The minimal region of gain at 7p15.2 contained the HOXA cluster. The minimal common regions of deletions contained the CDKN2A/CDKN2B, TP53, and LIMA1 tumor suppressor genes. The recurrent deletion at 8q12.3-13.1 contained no straightforward tumor suppressor gene, but the MIRN124A2 microRNA gene, whose product regulates MMP2 and CDK6. Among unique CNAs, gains harbored CCND1, KIT/PDGFRA/KDR, MDM2, and JAK2. The CNAs involving CCND1, MDM2, KIT, CDKN2A/2B, and TP53 were validated by FISH and/or multiplex ligation-dependent probe amplification. Although most tumors overexpressed cyclin D1 compared with surrounding glands, the only case to overexpress MDM2 had the corresponding CNA. In conclusion, our report suggests that ACC is characterized by a relatively low level of structural complexity. Array CGH and immunohistochemical data implicate MDM2 as the oncogene targeted at 12q15. The gain at 4q12 warrants further exploration as it contains a cluster of receptor kinase genes (KIT/PDGFRA/KDR), whose products can be responsive to specific therapies.

  9. Correlating cellular and molecular signatures of mucosal immunity that distinguish HIV controllers from noncontrollers.

    PubMed

    Loke, P'ng; Favre, David; Hunt, Peter W; Leung, Jacqueline M; Kanwar, Bittoo; Martin, Jeffrey N; Deeks, Steven G; McCune, Joseph M

    2010-04-15

    HIV "controllers" are persons infected with human immunodeficiency virus, type I (HIV) who maintain long-term control of viremia without antiviral therapy and who usually do not develop the acquired immune deficiency syndrome (AIDS). In this study, we have correlated results from polychromatic flow cytometry and oligonucleotide expression arrays to characterize the mucosal immune responses of these subjects in relation to untreated HIV(+) persons with high viral loads and progressive disease ("noncontrollers"). Paired peripheral blood and rectosigmoid biopsies were analyzed from 9 controllers and 11 noncontrollers. Several cellular immune parameters were found to be concordant between the 2 compartments. Compared with noncontrollers, the mucosal tissues of controllers had similar levels of effector T cells and fewer regulatory T cells (Tregs). Using principal component analysis to correlate immunologic parameters with gene expression profiles, transcripts were identified that accurately distinguished between controllers and noncontrollers. Direct 2-way comparison also revealed genes that are significantly different in their expression between controllers and noncontrollers, all of which had reduced expression in controllers. In addition to providing an approach that integrates flow cytometry datasets with transcriptional profiling analysis, these results underscore the importance of the sustained inflammatory response that attends progressive HIV disease.

  10. Modification of the 5' terminus of oligodeoxyribonucleotides for conjugation with ligands.

    PubMed

    Asseline, U; Thuong, N T

    2001-08-01

    Ligands can be introduced at the 5' terminus of an oligonucleotide by adding a linker to the ligand and modifying the 5' terminus of the oligonucleotide. These are then reacted to give the ligand-oligonucleotide conjugate. This unit describes the addition of carboxylated and aminoalkylated linkers, and phosphorothioate, phosphate, and masked thiol groups to the 5' terminus of an oligonucleotide. The addition of linkers to ligands and the final reaction that produces the ligand-conjugated oligonucleotide are described elsewhere in the series. This approach is particularly useful when there is a limited amount of ligand available, when the ligand is sensitive to chemical conditions required for oligonucleotide deprotection, or when the ligand is weakly soluble in solvents required for phosphoramidite- or H-phosphonate-mediated oligonucleotide synthesis.

  11. New approach to the determination phosphorothioate oligonucleotides by ultra high performance liquid chromatography coupled with inductively coupled plasma mass spectrometry.

    PubMed

    Studzińska, Sylwia; Mounicou, Sandra; Szpunar, Joanna; Łobiński, Ryszard; Buszewski, Bogusław

    2015-01-15

    This text presents a novel method for the separation and detection of phosphorothioate oligonucleotides with the use of ion pair ultra high performance liquid chromatography coupled with inductively coupled plasma mass spectrometry The research showed that hexafluoroisopropanol/triethylamine based mobile phases may be successfully used when liquid chromatography is coupled with such elemental detection. However, the concentration of both HFIP and TEA influences the final result. The lower concentration of HFIP, the lower the background in ICP-MS and the greater the sensitivity. The method applied for the analysis of serum samples was based on high resolution inductively coupled plasma mass spectrometry. Utilization of this method allows determination of fifty times lower quantity of phosphorothioate oligonucleotides than in the case of quadrupole mass analyzer. Monitoring of (31)P may be used to quantify these compounds at the level of 80 μg L(-1), while simultaneous determination of sulfur is very useful for qualitative analysis. Moreover, the results presented in this paper demonstrate the practical applicability of coupling LC with ICP-MS in determining phosphorothioate oligonucleotides and their metabolites in serum within 7 min with a very good sensitivity. The method was linear in the concentration range between 0.2 and 3 mg L(-1). The limit of detection was in the range of 0.07 and 0.13 mg L(-1). Accuracy varied with concentration, but was in the range of 3%. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Nucleic acid sequence detection using multiplexed oligonucleotide PCR

    DOEpatents

    Nolan, John P [Santa Fe, NM; White, P Scott [Los Alamos, NM

    2006-12-26

    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  13. Genome-Wide Requirements for Resistance to Functionally Distinct DNA-Damaging Agents

    PubMed Central

    Proctor, Michael; Flaherty, Patrick; Jordan, Michael I; Arkin, Adam P; Davis, Ronald W; Nislow, Corey; Giaever, Guri

    2005-01-01

    The mechanistic and therapeutic differences in the cellular response to DNA-damaging compounds are not completely understood, despite intense study. To expand our knowledge of DNA damage, we assayed the effects of 12 closely related DNA-damaging agents on the complete pool of ~4,700 barcoded homozygous deletion strains of Saccharomyces cerevisiae. In our protocol, deletion strains are pooled together and grown competitively in the presence of compound. Relative strain sensitivity is determined by hybridization of PCR-amplified barcodes to an oligonucleotide array carrying the barcode complements. These screens identified genes in well-characterized DNA-damage-response pathways as well as genes whose role in the DNA-damage response had not been previously established. High-throughput individual growth analysis was used to independently confirm microarray results. Each compound produced a unique genome-wide profile. Analysis of these data allowed us to determine the relative importance of DNA-repair modules for resistance to each of the 12 profiled compounds. Clustering the data for 12 distinct compounds uncovered both known and novel functional interactions that comprise the DNA-damage response and allowed us to define the genetic determinants required for repair of interstrand cross-links. Further genetic analysis allowed determination of epistasis for one of these functional groups. PMID:16121259

  14. Fabrication of Micropatterned Dipeptide Hydrogels by Acoustic Trapping of Stimulus-Responsive Coacervate Droplets.

    PubMed

    Nichols, Madeleine K; Kumar, Ravinash Krishna; Bassindale, Philip G; Tian, Liangfei; Barnes, Adrian C; Drinkwater, Bruce W; Patil, Avinash J; Mann, Stephen

    2018-06-01

    Acoustic standing waves offer an excellent opportunity to trap and spatially manipulate colloidal objects. This noncontact technique is used for the in situ formation and patterning in aqueous solution of 1D or 2D arrays of pH-responsive coacervate microdroplets comprising poly(diallyldimethylammonium) chloride and the dipeptide N-fluorenyl-9-methoxy-carbonyl-D-alanine-D-alanine. Decreasing the pH of the preformed droplet arrays results in dipeptide nanofilament self-assembly and subsequent formation of a micropatterned supramolecular hydrogel that can be removed as a self-supporting monolith. Guest molecules such as molecular dyes, proteins, and oligonucleotides are sequestered specifically within the coacervate droplets during acoustic processing to produce micropatterned hydrogels containing spatially organized functional components. Using this strategy, the site-specific isolation of multiple enzymes to drive a catalytic cascade within the micropatterned hydrogel films is exploited. © 2018 The Authors. Published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Early-onset seizures due to mosaic exonic deletions of CDKL5 in a male and two females.

    PubMed

    Bartnik, Magdalena; Derwińska, Katarzyna; Gos, Monika; Obersztyn, Ewa; Kołodziejska, Katarzyna E; Erez, Ayelet; Szpecht-Potocka, Agnieszka; Fang, Ping; Terczyńska, Iwona; Mierzewska, Hanna; Lohr, Naomi J; Bellus, Gary A; Reimschisel, Tyler; Bocian, Ewa; Mazurczak, Tadeusz; Cheung, Sau Wai; Stankiewicz, Paweł

    2011-05-01

    Mutations in the CDKL5 gene have been associated with an X-linked dominant early infantile epileptic encephalopathy-2. The clinical presentation is usually of severe encephalopathy with refractory seizures and Rett syndrome (RTT)-like phenotype. We attempted to assess the role of mosaic intragenic copy number variation in CDKL5. We have used comparative genomic hybridization with a custom-designed clinical oligonucleotide array targeting exons of selected disease and candidate genes, including CDKL5. We have identified mosaic exonic deletions of CDKL5 in one male and two females with developmental delay and medically intractable seizures. These three mosaic changes represent 60% of all deletions detected in 12,000 patients analyzed by array comparative genomic hybridization and involving the exonic portion of CDKL5. We report the first case of an exonic deletion of CDKL5 in a male and emphasize the importance of underappreciated mosaic exonic copy number variation in patients with early-onset seizures and RTT-like features of both genders.

  16. Direct detection of a BRAF mutation in total RNA from melanoma cells using cantilever arrays

    NASA Astrophysics Data System (ADS)

    Huber, F.; Lang, H. P.; Backmann, N.; Rimoldi, D.; Gerber, Ch.

    2013-02-01

    Malignant melanoma, the deadliest form of skin cancer, is characterized by a predominant mutation in the BRAF gene. Drugs that target tumours carrying this mutation have recently entered the clinic. Accordingly, patients are routinely screened for mutations in this gene to determine whether they can benefit from this type of treatment. The current gold standard for mutation screening uses real-time polymerase chain reaction and sequencing methods. Here we show that an assay based on microcantilever arrays can detect the mutation nanomechanically without amplification in total RNA samples isolated from melanoma cells. The assay is based on a BRAF-specific oligonucleotide probe. We detected mutant BRAF at a concentration of 500 pM in a 50-fold excess of the wild-type sequence. The method was able to distinguish melanoma cells carrying the mutation from wild-type cells using as little as 20 ng µl-1 of RNA material, without prior PCR amplification and use of labels.

  17. MEF2C haploinsufficiency caused by either microdeletion of the 5q14.3 region or mutation is responsible for severe mental retardation with stereotypic movements, epilepsy and/or cerebral malformations

    PubMed Central

    Le Meur, Nathalie; Holder-Espinasse, Muriel; Jaillard, Sylvie; Goldenberg, Alice; Joriot, Sylvie; Amati-Bonneau, Patrizia; Guichet, Agnès; Barth, Magalie; Charollais, Aude; Journel, Hubert; Auvin, Stéphane; Boucher, Cécile; Kerckaert, Jean-Pierre; David, Véronique; Manouvrier-Hanu, Sylvie; Saugier-Veber, Pascale; Frébourg, Thierry; Dubourg, Christèle; Andrieux, Joris; Bonneau, Dominique

    2010-01-01

    Over the last few years, array-CGH has remarkably improved the ability to detect cryptic unbalanced rearrangements in patients presenting with syndromic mental retardation. Using whole genome oligonucleotide array-CGH, we detected 5q14.3 microdeletions ranging from 216 kb to 8.8 Mb in 5 unrelated patients showing phenotypic similarities, namely severe mental retardation with absent speech, hypotonia and stereotypic movements. Most of the patients presented also with facial dysmorphic features, epilepsy and/or cerebral malformations. The minimal common deleted region of these 5q14 microdeletions encompassed only MEF2C, known to act in brain as a neurogenesis effector which regulates excitatory synapse number. In a patient presenting a similar phenotype, we subsequently identified a MEF2C nonsense mutation. Taken together, these results strongly suggest that haploinsufficiency of MEF2C is responsible for severe mental retardation with stereotypic movements, seizures and/or cerebral malformations. PMID:19592390

  18. Colloidal silica films for high-capacity DNA arrays

    NASA Astrophysics Data System (ADS)

    Glazer, Marc Irving

    The human genome project has greatly expanded the amount of genetic information available to researchers, but before this vast new source of data can be fully utilized, techniques for rapid, large-scale analysis of DNA and RNA must continue to develop. DNA arrays have emerged as a powerful new technology for analyzing genomic samples in a highly parallel format. The detection sensitivity of these arrays is dependent on the quantity and density of immobilized probe molecules. We have investigated substrates with a porous, "three-dimensional" surface layer as a means of increasing the surface area available for the synthesis of oligonucleotide probes, thereby increasing the number of available probes and the amount of detectable bound target. Porous colloidal silica films were created by two techniques. In the first approach, films were deposited by spin-coating silica colloid suspensions onto flat glass substrates, with the pores being formed by the natural voids between the solid particles (typically 23nm pores, 35% porosity). In the second approach, latex particles were co-deposited with the silica and then pyrolyzed, creating films with larger pores (36 nm), higher porosity (65%), and higher surface area. For 0.3 mum films, enhancements of eight to ten-fold and 12- to 14-fold were achieved with the pure silica films and the films "templated" with polymer latex, respectively. In gene expression assays for up to 7,000 genes using complex biological samples, the high-capacity films provided enhanced signals and performed equivalently or better than planar glass on all other functional measures, confirming that colloidal silica films are a promising platform for high-capacity DNA arrays. We have also investigated the kinetics of hybridization on planar glass and high-capacity substrates. Adsorption on planar arrays is similar to ideal Langmuir-type adsorption, although with an "overshoot" at high solution concentration. Hybridization on high-capacity films is controlled by traditional adsorption (ka) and desorption (kd) coefficients, as well as morphology factors and transient binding interactions between the target and probes. The strength of the transient probe/target binding interactions are on the order of 5--7 DNA base pairs, which suggests the formation of nucleation or other metastable complexes, rather than fully-zippered duplexes.

  19. The pitfalls of platform comparison: DNA copy number array technologies assessed

    PubMed Central

    2009-01-01

    Background The accurate and high resolution mapping of DNA copy number aberrations has become an important tool by which to gain insight into the mechanisms of tumourigenesis. There are various commercially available platforms for such studies, but there remains no general consensus as to the optimal platform. There have been several previous platform comparison studies, but they have either described older technologies, used less-complex samples, or have not addressed the issue of the inherent biases in such comparisons. Here we describe a systematic comparison of data from four leading microarray technologies (the Affymetrix Genome-wide SNP 5.0 array, Agilent High-Density CGH Human 244A array, Illumina HumanCNV370-Duo DNA Analysis BeadChip, and the Nimblegen 385 K oligonucleotide array). We compare samples derived from primary breast tumours and their corresponding matched normals, well-established cancer cell lines, and HapMap individuals. By careful consideration and avoidance of potential sources of bias, we aim to provide a fair assessment of platform performance. Results By performing a theoretical assessment of the reproducibility, noise, and sensitivity of each platform, notable differences were revealed. Nimblegen exhibited between-replicate array variances an order of magnitude greater than the other three platforms, with Agilent slightly outperforming the others, and a comparison of self-self hybridizations revealed similar patterns. An assessment of the single probe power revealed that Agilent exhibits the highest sensitivity. Additionally, we performed an in-depth visual assessment of the ability of each platform to detect aberrations of varying sizes. As expected, all platforms were able to identify large aberrations in a robust manner. However, some focal amplifications and deletions were only detected in a subset of the platforms. Conclusion Although there are substantial differences in the design, density, and number of replicate probes, the comparison indicates a generally high level of concordance between platforms, despite differences in the reproducibility, noise, and sensitivity. In general, Agilent tended to be the best aCGH platform and Affymetrix, the superior SNP-CGH platform, but for specific decisions the results described herein provide a guide for platform selection and study design, and the dataset a resource for more tailored comparisons. PMID:19995423

  20. Antisense Oligonucleotides Modulating Activation of a Nonsense-Mediated RNA Decay Switch Exon in the ATM Gene.

    PubMed

    Kralovicova, Jana; Moreno, Pedro M D; Cross, Nicholas C P; Pêgo, Ana Paula; Vorechovsky, Igor

    2016-12-01

    ATM (ataxia-telangiectasia, mutated) is an important cancer susceptibility gene that encodes a key apical kinase in the DNA damage response pathway. ATM mutations in the germ line result in ataxia-telangiectasia (A-T), a rare genetic syndrome associated with hypersensitivity to double-strand DNA breaks and predisposition to lymphoid malignancies. ATM expression is limited by a tightly regulated nonsense-mediated RNA decay (NMD) switch exon (termed NSE) located in intron 28. In this study, we identify antisense oligonucleotides that modulate NSE inclusion in mature transcripts by systematically targeting the entire 3.1-kb-long intron. Their identification was assisted by a segmental deletion analysis of transposed elements, revealing NSE repression upon removal of a distant antisense Alu and NSE activation upon elimination of a long terminal repeat transposon MER51A. Efficient NSE repression was achieved by delivering optimized splice-switching oligonucleotides to embryonic and lymphoblastoid cells using chitosan-based nanoparticles. Together, these results provide a basis for possible sequence-specific radiosensitization of cancer cells, highlight the power of intronic antisense oligonucleotides to modify gene expression, and demonstrate transposon-mediated regulation of NSEs.

  1. probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016

    PubMed Central

    Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas

    2016-01-01

    probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809

  2. High-Throughput Identification of Combinatorial Ligands for DNA Delivery in Cell Culture

    NASA Astrophysics Data System (ADS)

    Svahn, Mathias G.; Rabe, Kersten S.; Barger, Geoffrey; EL-Andaloussi, Samir; Simonson, Oscar E.; Didier, Boturyn; Olivier, Renaudet; Dumy, Pascal; Brandén, Lars J.; Niemeyer, Christof M.; Smith, C. I. Edvard

    2008-10-01

    Finding the optimal combinations of ligands for tissue-specific delivery is tedious even if only a few well-established compounds are tested. The cargo affects the receptor-ligand interaction, especially when it is charged like DNA. The ligand should therefore be evaluated together with its cargo. Several viruses have been shown to interact with more than one receptor, for efficient internalization. We here present a DNA oligonucleotide-based method for inexpensive and rapid screening of biotin labeled ligands for combinatorial effects on cellular binding and uptake. The oligonucleotide complex was designed as a 44 bp double-stranded DNA oligonucleotide with one central streptavidin molecule and a second streptavidin at the terminus. The use of a highly advanced robotic platform ensured stringent processing and execution of the experiments. The oligonucleotides were fluorescently labeled and used for detection and analysis of cell-bound, internalized and intra-cellular compartmentalized constructs by an automated line-scanning confocal microscope, IN Cell Analyzer 3000. All possible combinations of 22 ligands were explored in sets of 2 and tested on 6 different human cell lines in triplicates. In total, 10 000 transfections were performed on the automation platform. Cell-specific combinations of ligands were identified and their relative position on the scaffold oligonucleotide was found to be of importance. The ligands were found to be cargo dependent, carbohydrates were more potent for DNA delivery whereas cell penetrating peptides were more potent for delivery of less charged particles.

  3. Predicting oligonucleotide affinity to nucleic acid targets.

    PubMed Central

    Mathews, D H; Burkard, M E; Freier, S M; Wyatt, J R; Turner, D H

    1999-01-01

    A computer program, OligoWalk, is reported that predicts the equilibrium affinity of complementary DNA or RNA oligonucleotides to an RNA target. This program considers the predicted stability of the oligonucleotide-target helix and the competition with predicted secondary structure of both the target and the oligonucleotide. Both unimolecular and bimolecular oligonucleotide self structure are considered with a user-defined concentration. The application of OligoWalk is illustrated with three comparisons to experimental results drawn from the literature. PMID:10580474

  4. Detecting and Genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Call, Douglas R.; Brockman, Fred J.; Chandler, Darrell P.

    2000-12-01

    Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification.more » The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFU ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.« less

  5. Detecting and genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Call, Douglas R.; Brockman, Fred J.; Chandler, Darrell P.

    2001-07-05

    Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification.more » The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFUs ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.« less

  6. Aptamer-Mediated Codelivery of Doxorubicin and NF-κB Decoy Enhances Chemosensitivity of Pancreatic Tumor Cells

    PubMed Central

    Porciani, David; Tedeschi, Lorena; Marchetti, Laura; Citti, Lorenzo; Piazza, Vincenzo; Beltram, Fabio; Signore, Giovanni

    2015-01-01

    Aptamers able to bind efficiently cell-surface receptors differentially expressed in tumor and in healthy cells are emerging as powerful tools to perform targeted anticancer therapy. Here, we present a novel oligonucleotide chimera, composed by an RNA aptamer and a DNA decoy. Our assembly is able to (i) target tumor cells via an antitransferrin receptor RNA aptamer and (ii) perform selective codelivery of a chemotherapeutic drug (Doxorubicin) and of an inhibitor of a cell-survival factor, the nuclear factor κB decoy oligonucleotide. Both payloads are released under conditions found in endolysosomal compartments (low pH and reductive environment). Targeting and cytotoxicity of the oligonucleotidic chimera were assessed by confocal microscopy, cell viability, and Western blot analysis. These data indicated that the nuclear factor κB decoy does inhibit nuclear factor κB activity and ultimately leads to an increased therapeutic efficacy of Doxorubicin selectively in tumor cells. PMID:25919089

  7. Clustered regularly interspaced short palindromic repeats (CRISPRs) analysis of members of the Mycobacterium tuberculosis complex.

    PubMed

    Botelho, Ana; Canto, Ana; Leão, Célia; Cunha, Mónica V

    2015-01-01

    Typical CRISPR (clustered, regularly interspaced, short palindromic repeat) regions are constituted by short direct repeats (DRs), interspersed with similarly sized non-repetitive spacers, derived from transmissible genetic elements, acquired when the cell is challenged with foreign DNA. The analysis of the structure, in number and nature, of CRISPR spacers is a valuable tool for molecular typing since these loci are polymorphic among strains, originating characteristic signatures. The existence of CRISPR structures in the genome of the members of Mycobacterium tuberculosis complex (MTBC) enabled the development of a genotyping method, based on the analysis of the presence or absence of 43 oligonucleotide spacers separated by conserved DRs. This method, called spoligotyping, consists on PCR amplification of the DR chromosomal region and recognition after hybridization of the spacers that are present. The workflow beneath this methodology implies that the PCR products are brought onto a membrane containing synthetic oligonucleotides that have complementary sequences to the spacer sequences. Lack of hybridization of the PCR products to a specific oligonucleotide sequence indicates absence of the correspondent spacer sequence in the examined strain. Spoligotyping gained great notoriety as a robust identification and typing tool for members of MTBC, enabling multiple epidemiological studies on human and animal tuberculosis.

  8. Methods and kits for nucleic acid analysis using fluorescence resonance energy transfer

    DOEpatents

    Kwok, Pui-Yan; Chen, Xiangning

    1999-01-01

    A method for detecting the presence of a target nucleotide or sequence of nucleotides in a nucleic acid is disclosed. The method is comprised of forming an oligonucleotide labeled with two fluorophores on the nucleic acid target site. The doubly labeled oligonucleotide is formed by addition of a singly labeled dideoxynucleoside triphosphate to a singly labeled polynucleotide or by ligation of two singly labeled polynucleotides. Detection of fluorescence resonance energy transfer upon denaturation indicates the presence of the target. Kits are also provided. The method is particularly applicable to genotyping.

  9. PCR amplification on microarrays of gel immobilized oligonucleotides

    DOEpatents

    Strizhkov, Boris; Tillib, Sergei; Mikhailovich, Vladimir; Mirzabekov, Andrei

    2003-11-04

    The invention relates two general methods for performing PCR amplification, combined with the detection and analysis of the PCR products on a microchip. In the first method, the amplification occurs both outside and within a plurality of gel pads on a microchip, with at least one oligonucleotide primer immobilized in a gel pad. In the second method, PCR amplification also takes place within gel pads on a microchip, but the pads are surrounded by a hydrophobic liquid such as that which separates the individual gel pads into environments which resemble micro-miniaturized test tubes.

  10. Kinetic and mechanistic analysis of dinucleotide and oligonucleotide formation from the 5'-phosphorimidazolide of adenosine on Na(+)-montmorillonite

    NASA Technical Reports Server (NTRS)

    Kawamura, K.; Ferris, J. P.

    1994-01-01

    The rate constants for the condensation reaction of the 5'-phosphorimidazolide of adenosine (ImpA) to form dinucleotides and oligonucleotides have been measured in the presence of Na(+)-volclay (a Na(+)-montmorillonite) in pH 8 aqueous solution at 25 degrees C. The rates of the reaction of ImpA with an excess of adenosine 5'-monophosphoramidate (NH2pA), P1,P2-diadenosine 5',5'-pyrophosphate (A5'ppA), or adenosine 5'-monophosphate (5'-AMP or pA) in the presence of the montmorillonite to form NH2pA3'pA, A5'ppA3'pA, and pA3'pA, respectively, were measured. Only 3',5'-linked products were observed. The magnitude of the rate constants decrease in the order NH2pA3'pA > A5'-ppA3'pA > pA3'pA. The binding of ImpA to montmorillonite was measured, and the adsorption isotherm was determined. The binding of ImpA to montmorillonite and the formation of higher oligonucleotides is not observed in the absence of salts. Mg2+ enhances binding and oligonucleotide formation more than Ca2+ and Na+. The rate constants for the oligonucleotide formation were determined from the reaction products formed from 10 to 40 mM ImpA in the presence of Na(+)-montmorillonite using the computer program SIMFIT. The magnitudes of the rate constants for the formation of oligonucleotides increased in the order 2-mer < 3-mer < 4-mer ... 7-mer. The rate constants for dinucleotide and trinucleotide formation are more than 1000 times larger than those measured in the absence of montmorillonite. The rate constants for the formation of dinucleotide, trinucleotide, and tetranucleotide are 41,2.6, and 3.7 times larger than those for the formation of oligo(G)s with a poly(C) template. The hydrolysis of ImpA was accelerated 35 times in the presence of the montmorillonite. The catalytic ability of montmorillonite to form dinucleotides and oligonucleotides is quantitatively evaluated and possible pathways for oligo(A) formation are proposed.

  11. Versatile Method for the Site-Specific Modification of DNA with Boron Clusters: Anti-Epidermal Growth Factor Receptor (EGFR) Antisense Oligonucleotide Case.

    PubMed

    Ebenryter-Olbińska, Katarzyna; Kaniowski, Damian; Sobczak, Milena; Wojtczak, Błażej A; Janczak, Sławomir; Wielgus, Ewelina; Nawrot, Barbara; Leśnikowski, Zbigniew J

    2017-11-21

    A general and convenient approach for the incorporation of different types of boron clusters into specific locations of the DNA-oligonucleotide chain based on the automated phosphoramidite method of oligonucleotide synthesis and post-synthetic "click chemistry" modification has been developed. Pronounced effects of boron-cluster modification on the physico- and biochemical properties of the antisense oligonucleotides were observed. The silencing activity of antisense oligonucleotides bearing a single boron cluster modification in the middle of the oligonucleotide chain was substantially higher than that of unmodified oligonucleotides. This finding may be of importance for the design of therapeutic nucleic acids with improved properties. The proposed synthetic methodology broadens the availability of nucleic acid-boron cluster conjugates and opens up new avenues for their potential practical use. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

    PubMed Central

    Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.

    2015-01-01

    Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534

  13. Simple and rapid enzymatic method for the synthesis of single-strand oligonucleotides containing trifluorothymidine.

    PubMed

    Suzuki, Norihiko; Fukushima, Masakazu

    2010-11-01

    To investigate the mechanism of trifluorothymidine (TFT)-induced DNA damage, we developed an enzymatic method for the synthesis of single-strand oligonucleotides containing TFT-monophosphate residues. Sixteen-mer oligonucleotides and 14-mer 5'-phosphorylated oligonucleotides were annealed to the template of 25-mer, so as to empty one nucleotide site. TFT-triphosphate was incorporated into the site by DNA polymerase and then ligated to 5'-phosphorylated oligonucleotides by DNA ligase. The synthesized 31-mer oligonucleotides containing TFT residues were isolated from the 25-mer complementary template by denaturing polyacrylamide electrophoresis. Using these single-strand oligonucleotides containing TFT residues, the cleavage of TFT residues from DNA, using mismatch uracil-DNA glycosylase (MUG) of E.coli origin, was compared with that of 5-fluorouracil (5FU) and 5-bromodeoxyuridine (BrdU). The TFT/A pair was not cleaved by MUG, while the other pairs, namely, 5FU/A, 5FU/G, BrdU/A, BrdU/G, and TFT/G, were easily cleaved from each synthesized DNA. Thus, this method is useful for obtaining some site-specifically modified oligonucleotides.

  14. Intravenous administration of stabilized antisense lipid particles (SALP) leads to activation and expansion of liver natural killer cells.

    PubMed

    Bramson, J L; Bodner, C A; Johnson, J; Semple, S; Hope, M J

    2000-06-01

    Stabilized antisense lipid particles (SALP) have been developed for the systemic delivery of oligonucleotides. The impact of intravenous SALP administration was measured with respect to activation of natural killer (NK) and NK1.1+ T (NKT) cells in the livers of immunocompetent mice. Treatment with a SALP containing a highly mitogenic oligonucleotide (INX-6295) generated an increase in NK cytolytic activity and cell number within the liver but did not appear to affect the number of hepatic NKT cells or their cytolytic activity. The same results were observed after intravenous administration of the mitogenic oligonucleotide alone. Interestingly, treatment with a SALP containing a weakly mitogenic oligonucleotide (INX-6300) also activated the liver NK cells, whereas the oligonucleotide alone was unable to elicit these effects. The NK stimulatory activity of a SALP containing INX-6300 required both lipid and oligonucleotide components. These results demonstrate that in addition to modifying the pharmacokinetics and biodistribution of intravenously administered oligonucleotides, SALP possess immunostimulatory activity independent of oligonucleotide mitogenicity, which can serve as an adjuvant to antisense therapies for cancer.

  15. The chemical evolution of oligonucleotide therapies of clinical utility

    PubMed Central

    Khvorova, Anastasia; Watts, Jonathan K.

    2017-01-01

    After nearly 40 years of development, oligonucleotide therapeutics are nearing meaningful clinical productivity. One of the key advantages of oligonucleotide drugs is that their delivery and potency properties are derived primarily from the chemical structure of the oligonucleotide, while their target is defined by the base sequence. Thus, as oligonucleotides with a particular chemical design demonstrate appropriate distribution and safety profiles for clinical gene silencing in a particular tissue, this will open the door to the rapid development of additional drugs targeting other disease-associated genes in the same tissue. To achieve clinical productivity, the chemical architecture of the oligonucleotide needs to be optimized as a whole, using a combination of sugar, backbone, nucleobase and 3′/5′-terminal modifications. A portfolio of chemistries can be used to confer drug like properties onto the oligonucleotide as a whole, with minor chemical changes often translating into major improvements in clinical efficacy. Outstanding challenges in oligonucleotide chemical development include optimization of chemical architectures to ensure long-term safety and to enable robust clinical activity beyond the liver. PMID:28244990

  16. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

  17. Giant magnetoresistive biosensors for molecular diagnosis: surface chemistry and assay development

    NASA Astrophysics Data System (ADS)

    Yu, Heng; Osterfeld, Sebastian J.; Xu, Liang; White, Robert L.; Pourmand, Nader; Wang, Shan X.

    2008-08-01

    Giant magnetoresistive (GMR) biochips using magnetic nanoparticle as labels were developed for molecular diagnosis. The sensor arrays consist of GMR sensing strips of 1.5 μm or 0.75 μm in width. GMR sensors are exquisitely sensitive yet very delicate, requiring ultrathin corrosion-resistive passivation and efficient surface chemistry for oligonucleotide probe immobilization. A mild and stable surface chemistry was first developed that is especially suitable for modifying delicate electronic device surfaces, and a practical application of our GMR biosensors was then demonstrated for detecting four most common human papillomavirus (HPV) subtypes in plasmids. We also showed that the DNA hybridization time could potentially be reduced from overnight to about ten minutes using microfluidics.

  18. Photo-Induced Click Chemistry for DNA Surface Structuring by Direct Laser Writing.

    PubMed

    Kerbs, Antonina; Mueller, Patrick; Kaupp, Michael; Ahmed, Ishtiaq; Quick, Alexander S; Abt, Doris; Wegener, Martin; Niemeyer, Christof M; Barner-Kowollik, Christopher; Fruk, Ljiljana

    2017-04-11

    Oligonucleotides containing photo-caged dienes were prepared and shown to react quantitatively in a light-induced Diels-Alder cycloaddition with functional maleimides in aqueous solution within minutes. Due to its high yield and fast rate, the reaction was exploited for DNA surface patterning with sub-micrometer resolution employing direct laser writing (DLW). Functional DNA arrays were written by direct laser writing (DLW) in variable patterns, which were further encoded with fluorophores and proteins through DNA directed immobilization. This mild and efficient light-driven platform technology holds promise for the fabrication of complex bioarrays with sub-micron resolution. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Insertional translocation leading to a 4q13 duplication including the EPHA5 gene in two siblings with attention-deficit hyperactivity disorder.

    PubMed

    Matoso, Eunice; Melo, Joana B; Ferreira, Susana I; Jardim, Ana; Castelo, Teresa M; Weise, Anja; Carreira, Isabel M

    2013-08-01

    An insertional translocation (IT) can result in pure segmental aneusomy for the inserted genomic segment allowing to define a more accurate clinical phenotype. Here, we report on two siblings sharing an unbalanced IT inherited from the mother with a history of learning difficulty. An 8-year-old girl with developmental delay, speech disability, and attention-deficit hyperactivity disorder (ADHD), showed by GTG banding analysis a subtle interstitial alteration in 21q21. Oligonucleotide array comparative genomic hybridization (array-CGH) analysis showed a 4q13.1-q13.3 duplication spanning 8.6 Mb. Fluorescence in situ hybridization (FISH) with bacterial artificial chromosome (BAC) clones confirmed the rearrangement, a der(21)ins(21;4)(q21;q13.1q13.3). The duplication described involves 50 RefSeq genes including the EPHA5 gene that encodes for the EphA5 receptor involved in embryonic development of the brain and also in synaptic remodeling and plasticity thought to underlie learning and memory. The same rearrangement was observed in a younger brother with behavioral problems and also exhibiting ADHD. ADHD is among the most heritable of neuropsychiatric disorders. There are few reports of patients with duplications involving the proximal region of 4q and a mild phenotype. To the best of our knowledge this is the first report of a duplication restricted to band 4q13. This abnormality could be easily missed in children who have nonspecific cognitive impairment. The presence of this behavioral disorder in the two siblings reinforces the hypothesis that the region involved could include genes involved in ADHD. Copyright © 2013 Wiley Periodicals, Inc.

  20. Proof of concept: preimplantation genetic screening without embryo biopsy through analysis of cell-free DNA in spent embryo culture media.

    PubMed

    Shamonki, Mousa I; Jin, Helen; Haimowitz, Zachary; Liu, Lian

    2016-11-01

    To assess whether preimplantation genetic screening (PGS) is possible by testing for free embryonic DNA in spent IVF media from embryos undergoing trophectoderm biopsy. Prospective cohort analysis. Academic fertility center. Seven patients undergoing IVF and 57 embryos undergoing trophectoderm biopsy for PGS. On day 3 of development, each embryo was placed in a separate media droplet. All biopsied embryos received a PGS result by array comparative genomic hybridization. Preimplantation genetic screening was performed on amplified DNA extracted from media and results were compared with PGS results for the corresponding biopsy. [1] Presence of DNA in spent IVF culture media. [2] Correlation between genetic screening result from spent media and corresponding biopsy. Fifty-five samples had detectable DNA ranging from 2-642 ng/μL after a 2-hour amplification. Six samples with the highest DNA levels underwent PGS, rendering one result with a derivative log ratio SD (DLRSD) of <0.85 (a quality control metric of oligonucleotide array comparative genomic hybridization). The fluid sample and trophectoderm results were identical demonstrating (45XY, -13). Three samples were reamplified 1 hour later and tested showing improving DLRSD. One of the three samples with a DLRSD of 0.85 demonstrated (46XY), consistent with the biopsy. Overnight DNA amplification showed DNA in all samples. We demonstrate two novel findings: the presence of free embryonic DNA in spent media and a result that is consistent with trophectoderm biopsy. Improvements in DNA collection, amplification, and testing may allow for PGS without biopsy in the future. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  1. Genotyping microarray (gene chip) for the ABCR (ABCA4) gene.

    PubMed

    Jaakson, K; Zernant, J; Külm, M; Hutchinson, A; Tonisson, N; Glavac, D; Ravnik-Glavac, M; Hawlina, M; Meltzer, M R; Caruso, R C; Testa, F; Maugeri, A; Hoyng, C B; Gouras, P; Simonelli, F; Lewis, R A; Lupski, J R; Cremers, F P M; Allikmets, R

    2003-11-01

    Genetic variation in the ABCR (ABCA4) gene has been associated with five distinct retinal phenotypes, including Stargardt disease/fundus flavimaculatus (STGD/FFM), cone-rod dystrophy (CRD), and age-related macular degeneration (AMD). Comparative genetic analyses of ABCR variation and diagnostics have been complicated by substantial allelic heterogeneity and by differences in screening methods. To overcome these limitations, we designed a genotyping microarray (gene chip) for ABCR that includes all approximately 400 disease-associated and other variants currently described, enabling simultaneous detection of all known ABCR variants. The ABCR genotyping microarray (the ABCR400 chip) was constructed by the arrayed primer extension (APEX) technology. Each sequence change in ABCR was included on the chip by synthesis and application of sequence-specific oligonucleotides. We validated the chip by screening 136 confirmed STGD patients and 96 healthy controls, each of whom we had analyzed previously by single strand conformation polymorphism (SSCP) technology and/or heteroduplex analysis. The microarray was >98% effective in determining the existing genetic variation and was comparable to direct sequencing in that it yielded many sequence changes undetected by SSCP. In STGD patient cohorts, the efficiency of the array to detect disease-associated alleles was between 54% and 78%, depending on the ethnic composition and degree of clinical and molecular characterization of a cohort. In addition, chip analysis suggested a high carrier frequency (up to 1:10) of ABCR variants in the general population. The ABCR genotyping microarray is a robust, cost-effective, and comprehensive screening tool for variation in one gene in which mutations are responsible for a substantial fraction of retinal disease. The ABCR chip is a prototype for the next generation of screening and diagnostic tools in ophthalmic genetics, bridging clinical and scientific research. Copyright 2003 Wiley-Liss, Inc.

  2. Nutrition metabolism plays an important role in the alternate bearing of the olive tree (Olea europaea L.).

    PubMed

    Turktas, Mine; Inal, Behcet; Okay, Sezer; Erkilic, Emine Gulden; Dundar, Ekrem; Hernandez, Pilar; Dorado, Gabriel; Unver, Turgay

    2013-01-01

    The olive tree (Olea europaea L.) is widely known for its strong tendency for alternate bearing, which severely affects the fruit yield from year to year. Microarray based gene expression analysis using RNA from olive samples (on-off years leaves and ripe-unripe fruits) are particularly useful to understand the molecular mechanisms influencing the periodicity in the olive tree. Thus, we carried out genome wide transcriptome analyses involving different organs and temporal stages of the olive tree using the NimbleGen Array containing 136,628 oligonucleotide probe sets. Cluster analyses of the genes showed that cDNAs originated from different organs could be sorted into separate groups. The nutritional control had a particularly remarkable impact on the alternate bearing of olive, as shown by the differential expression of transcripts under different temporal phases and organs. Additionally, hormonal control and flowering processes also played important roles in this phenomenon. Our analyses provide further insights into the transcript changes between "on year" and "off year" leaves along with the changes from unrpipe to ripe fruits, which shed light on the molecular mechanisms underlying the olive tree alternate bearing. These findings have important implications for the breeding and agriculture of the olive tree and other crops showing periodicity. To our knowledge, this is the first study reporting the development and use of an olive array to document the gene expression profiling associated with the alternate bearing in olive tree.

  3. Nutrition Metabolism Plays an Important Role in the Alternate Bearing of the Olive Tree (Olea europaea L.)

    PubMed Central

    Turktas, Mine; Inal, Behcet; Okay, Sezer; Erkilic, Emine Gulden; Dundar, Ekrem; Hernandez, Pilar; Dorado, Gabriel; Unver, Turgay

    2013-01-01

    The olive tree (Olea europaea L.) is widely known for its strong tendency for alternate bearing, which severely affects the fruit yield from year to year. Microarray based gene expression analysis using RNA from olive samples (on-off years leaves and ripe-unripe fruits) are particularly useful to understand the molecular mechanisms influencing the periodicity in the olive tree. Thus, we carried out genome wide transcriptome analyses involving different organs and temporal stages of the olive tree using the NimbleGen Array containing 136,628 oligonucleotide probe sets. Cluster analyses of the genes showed that cDNAs originated from different organs could be sorted into separate groups. The nutritional control had a particularly remarkable impact on the alternate bearing of olive, as shown by the differential expression of transcripts under different temporal phases and organs. Additionally, hormonal control and flowering processes also played important roles in this phenomenon. Our analyses provide further insights into the transcript changes between ”on year” and “off year” leaves along with the changes from unrpipe to ripe fruits, which shed light on the molecular mechanisms underlying the olive tree alternate bearing. These findings have important implications for the breeding and agriculture of the olive tree and other crops showing periodicity. To our knowledge, this is the first study reporting the development and use of an olive array to document the gene expression profiling associated with the alternate bearing in olive tree. PMID:23555820

  4. Phylogenomics of nonavian reptiles and the structure of the ancestral amniote genome

    PubMed Central

    Shedlock, Andrew M.; Botka, Christopher W.; Zhao, Shaying; Shetty, Jyoti; Zhang, Tingting; Liu, Jun S.; Deschavanne, Patrick J.; Edwards, Scott V.

    2007-01-01

    We report results of a megabase-scale phylogenomic analysis of the Reptilia, the sister group of mammals. Large-scale end-sequence scanning of genomic clones of a turtle, alligator, and lizard reveals diverse, mammal-like landscapes of retroelements and simple sequence repeats (SSRs) not found in the chicken. Several global genomic traits, including distinctive phylogenetic lineages of CR1-like long interspersed elements (LINEs) and a paucity of A-T rich SSRs, characterize turtles and archosaur genomes, whereas higher frequencies of tandem repeats and a lower global GC content reveal mammal-like features in Anolis. Nonavian reptile genomes also possess a high frequency of diverse and novel 50-bp unit tandem duplications not found in chicken or mammals. The frequency distributions of ≈65,000 8-mer oligonucleotides suggest that rates of DNA-word frequency change are an order of magnitude slower in reptiles than in mammals. These results suggest a diverse array of interspersed and SSRs in the common ancestor of amniotes and a genomic conservatism and gradual loss of retroelements in reptiles that culminated in the minimalist chicken genome. PMID:17307883

  5. Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation

    PubMed Central

    Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert

    2009-01-01

    Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344

  6. Sensitive detection of unlabeled oligonucleotides using a paired surface plasma waves biosensor.

    PubMed

    Li, Ying-Chang; Chiou, Chiuan-Chian; Luo, Ji-Dung; Chen, Wei-Ju; Su, Li-Chen; Chang, Ying-Feng; Chang, Yu-Sun; Lai, Chao-Sung; Lee, Cheng-Chung; Chou, Chien

    2012-05-15

    Detection of unlabeled oligonucleotides using surface plasmon resonance (SPR) is difficult because of the oligonucleotides' relatively lower molecular weight compared with proteins. In this paper, we describe a method for detecting unlabeled oligonucleotides at low concentration using a paired surface plasma waves biosensor (PSPWB). The biosensor uses a sensor chip with an immobilized probe to detect a target oligonucleotide via sequence-specific hybridization. PSPWB measures the demodulated amplitude of the heterodyne signal in real time. In the meantime, the ratio of the amplitudes between the detected output signal and reference can reduce the excess noise from the laser intensity fluctuation. Also, the common-path propagation of p and s waves cancels the common phase noise induced by temperature variation. Thus, a high signal-to-noise ratio (SNR) of the heterodyne signal is detected. The sequence specificity of oligonucleotide hybridization ensures that the platform is precisely discriminating between target and non-target oligonucleotides. Under optimized experimental conditions, the detected heterodyne signal increases linearly with the logarithm of the concentration of target oligonucleotide over the range 0.5-500 pM. The detection limit is 0.5 pM in this experiment. In addition, the non-target oligonucleotide at concentrations of 10 pM and 10nM generated signals only slightly higher than background, indicating the high selectivity and specificity of this method. Different length of perfectly matched oligonucleotide targets at 10-mer, 15-mer and 20-mer were identified at the concentration of 150 pM. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun, Zhen; Department of Biochemistry and Molecular Biology, Program in Molecular Cell Biology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058; Xiang, Wenqing

    Highlights: {yields} LNA-modified oligonucleotides can pass through the plasma membrane of cultured cells even without using transfection machinery. {yields} LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. {yields} LNA-oligonucleotide designed to target nuclear HBV DNA efficiently suppresses HBV replication and transcription in cultured hepatic cells. -- Abstract: Silencing target genes with small regulatory RNAs is widely used to investigate gene function and therapeutic drug development. Recently, triplex-based approaches have provided another attractive means to achieve targeted gene regulation and gene manipulation at the molecular and cellular levels. Nuclear entry ofmore » oligonucleotides and enhancement of their affinity to the DNA targets are key points of such approaches. In this study, we developed lipid-based transport of a locked-nucleic-acid (LNA)-modified oligonucleotide for hepatitis B virus (HBV) DNA interference in human hepatocytes expressing HBV genomic DNA. In these cells, the LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. The oligonucleotide specifically targeting HBV DNA clearly interfered with HBV DNA transcription as shown by a block in pregenomic RNA (pgRNA) production. The HBV DNA-targeted oligonucleotide suppressed HBV DNA replication and HBV protein production more efficiently than small interfering RNAs directed to the pgRNA. These results demonstrate that fusion with lipid can carry LNA-modified oligonucleotides to the nucleus where they regulate gene expression. Interfering with HBV DNA transcription by LNA-modified oligonucleotides has strong potential as a new strategy for HBV inhibition.« less

  8. Oligonucleotide-based pharmaceuticals: Non-clinical and clinical safety signals and non-clinical testing strategies.

    PubMed

    Mustonen, Enni-Kaisa; Palomäki, Tiina; Pasanen, Markku

    2017-11-01

    Antisense oligonucleotides, short interfering RNAs (siRNAs) and aptamers are oligonucleotide-based pharmaceuticals with a promising role in targeted therapies. Currently, five oligonucleotide-based pharmaceuticals have achieved marketing authorization in Europe or USA and many more are undergoing clinical testing. However, several safety concerns have been raised in non-clinical and clinical studies. Oligonucleotides share properties with both chemical and biological pharmaceuticals and therefore they pose challenges also from the regulatory point of view. We have analyzed the safety data of oligonucleotides and evaluated the applicability of current non-clinical toxicological guidelines for assessing the safety of oligonucleotide-based pharmaceuticals. Oligonucleotide-based pharmaceuticals display a similar toxicological profile, exerting adverse effects on liver and kidney, evoking hematological alterations, as well as causing immunostimulation and prolonging the coagulation time. It is possible to extrapolate some of these effects from non-clinical studies to humans. However, evaluation strategies for genotoxicity testing of "non-natural" oligonucleotides should be revised. Additionally, the selective use of surrogates and prediction of clinical endpoints for non-clinically observed immunostimulation is complicated by its multiple potential manifestations, demanding improvements in the testing strategies. Utilizing more relevant and mechanistic-based approaches and taking better account of species differences, could possibly improve the prediction of relevant immunological/proinflammatory effects in humans. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. The chemical evolution of oligonucleotide therapies of clinical utility.

    PubMed

    Khvorova, Anastasia; Watts, Jonathan K

    2017-03-01

    After nearly 40 years of development, oligonucleotide therapeutics are nearing meaningful clinical productivity. One of the key advantages of oligonucleotide drugs is that their delivery and potency are derived primarily from the chemical structure of the oligonucleotide whereas their target is defined by the base sequence. Thus, as oligonucleotides with a particular chemical design show appropriate distribution and safety profiles for clinical gene silencing in a particular tissue, this will open the door to the rapid development of additional drugs targeting other disease-associated genes in the same tissue. To achieve clinical productivity, the chemical architecture of the oligonucleotide needs to be optimized with a combination of sugar, backbone, nucleobase, and 3'- and 5'-terminal modifications. A portfolio of chemistries can be used to confer drug-like properties onto the oligonucleotide as a whole, with minor chemical changes often translating into major improvements in clinical efficacy. One outstanding challenge in oligonucleotide chemical development is the optimization of chemical architectures to ensure long-term safety. There are multiple designs that enable effective targeting of the liver, but a second challenge is to develop architectures that enable robust clinical efficacy in additional tissues.

  10. miRNA-based therapies: Strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents

    PubMed Central

    Baumann, V; Winkler, J

    2015-01-01

    The discovery of microRNAs as important regulatory agents for gene expression has expanded the therapeutic opportunities for oligonucleotides. In contrast to siRNA, miRNA-targeted therapy is able to influence not only a single gene, but entire cellular pathways or processes. It is possible to supplement down regulated or non-functional miRNAs by synthetic oligonucleotides, as well as alleviating effects caused by overexpression of malignant miRNAs through artificial antagonists, either oligonucleotides or small molecules. Chemical oligonucleotide modifications together with an efficient delivery system seem to be mandatory for successful therapeutic application. While miRNA-based therapy benefits from the decades of research spent on other therapeutic oligonucleotides, there are some specific challenges associated with miRNA therapy, mainly caused by the short target sequence. The current status and recent progress of miRNA-targeted therapeutics is described and future challenges and potential applications in treatment of cancer and viral infections are discussed. PMID:25495987

  11. 2'-modified nucleosides for site-specific labeling of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Krider, Elizabeth S.; Miller, Jeremiah E.; Meade, Thomas J.

    2002-01-01

    We report the synthesis of 2'-modified nucleosides designed specifically for incorporating labels into oligonucleotides. Conversion of these nucleosides to phosphoramidite and solid support-bound derivatives proceeds in good yield. Large-scale synthesis of 11-mer oligonucleotides possessing the 2'-modified nucleosides is achieved using these derivatives. Thermal denaturation studies indicate that the presence of 2'-modified nucleosides in 11-mer duplexes has minimal destabilizing effects on the duplex structure when the nucleosides are placed at the duplex termini. The powerful combination of phosphoramidite and support-bound derivatives of 2'-modified nucleosides affords the large-scale preparation of an entirely new class of oligonucleotides. The ability to synthesize oligonucleotides containing label attachment sites at 3', intervening, and 5' locations of a duplex is a significant advance in the development of oligonucleotide conjugates.

  12. A nonviral transfection approach in vitro: the design of a gold nanoparticle vector joint with microelectromechanical systems.

    PubMed

    Jen, Chun-Ping; Chen, Yu-Hung; Fan, Chun-sheng; Yeh, Chen-Sheng; Lin, Yu-Cheng; Shieh, Dar-Bin; Wu, Chao-Ling; Chen, Dong-Hwang; Chou, Chen-Hsi

    2004-02-17

    Au nanoparticles modified with 21-base thiolated-oligonucleotides have been evaluated as delivery vehicles for the development of a nonviral transfection platform. The electromigration combined with electroporation for DNA delivery in an osteoblast like cell was employed to test on microchips. Electroporation introduces foreign materials into cells by applying impulses of electric field to induce multiple transient pores on the cell membrane through dielectric breakdown of the cell membrane. On the basis of the characteristic surface plasmon of the Au particles, UV-vis absorption was utilized to qualitatively judge the efficiency of delivery. Transmission electron microscopy images and atomic absorption measurements (quantitative analysis) provided evidence of the bare Au and Au/oligonucleotide nanoparticles before and after electroporation and electromigration function. The experiments demonstrated that electrophoretic migration followed by electroporation significantly enhanced the transportation efficiency of the nanoparticle-oligonucleotide complexes as compared with electroporation alone. Most interestingly, Au capped with oligonucleotides led to optimal performance. On the other hand, the bare Au colloidal suspensions resulted in aggregation, which might be an obstacle to the internalization process. In addition, analytical results demonstrated an increase in the local particle concentrations on the cell surface that provided additional support for the mechanism underlying the improved Au nanoparticle transportation into cells in the presence of electromigration function.

  13. Optical properties and electronic transitions of DNA oligonucleotides as a function of composition and stacking sequence.

    PubMed

    Schimelman, Jacob B; Dryden, Daniel M; Poudel, Lokendra; Krawiec, Katherine E; Ma, Yingfang; Podgornik, Rudolf; Parsegian, V Adrian; Denoyer, Linda K; Ching, Wai-Yim; Steinmetz, Nicole F; French, Roger H

    2015-02-14

    The role of base pair composition and stacking sequence in the optical properties and electronic transitions of DNA is of fundamental interest. We present and compare the optical properties of DNA oligonucleotides (AT)10, (AT)5(GC)5, and (AT-GC)5 using both ab initio methods and UV-vis molar absorbance measurements. Our data indicate a strong dependence of both the position and intensity of UV absorbance features on oligonucleotide composition and stacking sequence. The partial densities of states for each oligonucleotide indicate that the valence band edge arises from a feature associated with the PO4(3-) complex anion, and the conduction band edge arises from anti-bonding states in DNA base pairs. The results show a strong correspondence between the ab initio and experimentally determined optical properties. These results highlight the benefit of full spectral analysis of DNA, as opposed to reductive methods that consider only the 260 nm absorbance (A260) or simple purity ratios, such as A260/A230 or A260/A280, and suggest that the slope of the absorption edge onset may provide a useful metric for the degree of base pair stacking in DNA. These insights may prove useful for applications in biology, bioelectronics, and mesoscale self-assembly.

  14. Oligonucleotide microarray chip for the quantification of MS2, ΦX174, and adenoviruses on the multiplex analysis platform MCR 3.

    PubMed

    Lengger, Sandra; Otto, Johannes; Elsässer, Dennis; Schneider, Oliver; Tiehm, Andreas; Fleischer, Jens; Niessner, Reinhard; Seidel, Michael

    2014-05-01

    Pathogenic viruses are emerging contaminants in water which should be analyzed for water safety to preserve public health. A strategy was developed to quantify RNA and DNA viruses in parallel on chemiluminescence flow-through oligonucleotide microarrays. In order to show the proof of principle, bacteriophage MS2, ΦX174, and the human pathogenic adenovirus type 2 (hAdV2) were analyzed in spiked tap water samples on the analysis platform MCR 3. The chemiluminescence microarray imaging unit was equipped with a Peltier heater for a controlled heating of the flow cell. The efficiency and selectivity of DNA hybridization could be increased resulting in higher signal intensities and lower cross-reactivities of polymerase chain reaction (PCR) products from other viruses. The total analysis time for DNA/RNA extraction, cDNA synthesis for RNA viruses, polymerase chain reaction, single-strand separation, and oligonucleotide microarray analysis was performed in 4-4.5 h. The parallel quantification was possible in a concentration range of 9.6 × 10(5)-1.4 × 10(10) genomic units (GU)/mL for bacteriophage MS2, 1.4 × 10(5)-3.7 × 10(8) GU/mL for bacteriophage ΦX174, and 6.5 × 10(3)-1.2 × 10(5) for hAdV2, respectively, by using a measuring temperature of 40 °C. Detection limits could be calculated to 6.6 × 10(5) GU/mL for MS2, 5.3 × 10(3) GU/mL for ΦX174, and 1.5 × 10(2) GU/mL for hAdV2, respectively. Real samples of surface water and treated wastewater were tested. Generally, found concentrations of hAdV2, bacteriophage MS2, and ΦX174 were at the detection limit. Nevertheless, bacteriophages could be identified with similar results by means of quantitative PCR and oligonucleotide microarray analysis on the MCR 3.

  15. Ultra-high-throughput microarray generation and liquid dispensing using multiple disposable piezoelectric ejectors.

    PubMed

    Hsieh, Huangpin Ben; Fitch, John; White, Dave; Torres, Frank; Roy, Joy; Matusiak, Robert; Krivacic, Bob; Kowalski, Bob; Bruce, Richard; Elrod, Scott

    2004-03-01

    The authors have constructed an array of 12 piezoelectric ejectors for printing biological materials. A single-ejector footprint is 8 mm in diameter, standing 4 mm high with 2 reservoirs totaling 76 micro L. These ejectors have been tested by dispensing various fluids in several environmental conditions. Reliable drop ejection can be expected in both humidity-controlled and ambient environments over extended periods of time and in hot and cold room temperatures. In a prototype system, 12 ejectors are arranged in a rack, together with an X - Y stage, to allow printing any pattern desired. Printed arrays of features are created with a biological solution containing bovine serum albumin conjugated oligonucleotides, dye, and salty buffer. This ejector system is designed for the ultra-high-throughput generation of arrays on a variety of surfaces. These single or racked ejectors could be used as long-term storage vessels for materials such as small molecules, nucleic acids, proteins, or cell libraries, which would allow for efficient preprogrammed selection of individual clones and greatly reduce the chance of cross-contamination and loss due to transfer. A new generation of design ideas includes plastic injection molded ejectors that are inexpensive and disposable and handheld personal pipettes for liquid transfer in the nanoliter regime.

  16. Characterization of Deletions of the HBA and HBB Loci by Array Comparative Genomic Hybridization

    PubMed Central

    Sabath, Daniel E.; Bender, Michael A.; Sankaran, Vijay G.; Vamos, Esther; Kentsis, Alex; Yi, Hye-Son; Greisman, Harvey A.

    2017-01-01

    Thalassemia is among the most common genetic diseases worldwide. α-Thalassemia is usually caused by deletion of one or more of the duplicated HBA genes on chromosome 16. In contrast, most β-thalassemia results from point mutations that decrease or eliminate expression of the HBB gene on chromosome 11. Deletions within the HBB locus result in thalassemia or hereditary persistence of fetal Hb. Although routine diagnostic testing cannot distinguish thalassemia deletions from point mutations, deletional hereditary persistence of fetal Hb is notable for having an elevated HbF level with a normal mean corpuscular volume. A small number of deletions accounts for most α-thalassemias; in contrast, there are no predominant HBB deletions causing β-thalassemia. To facilitate the identification and characterization of deletions of the HBA and HBB globin loci, we performed array-based comparative genomic hybridization using a custom oligonucleotide microarray. We accurately mapped the breakpoints of known and previously uncharacterized HBB deletions defining previously uncharacterized deletion breakpoints by PCR amplification and sequencing. The array also successfully identified the common HBA deletions --SEA and --FIL. In summary, comparative genomic hybridization can be used to characterize deletions of the HBA and HBB loci, allowing high-resolution characterization of novel deletions that are not readily detected by PCR-based methods. PMID:26612711

  17. Assessing the impact of Benzo[a]pyrene on Marine Mussels: Application of a novel targeted low density microarray complementing classical biomarker responses

    PubMed Central

    Sforzini, Susanna; Arlt, Volker M.; Barranger, Audrey; Dallas, Lorna J.; Oliveri, Caterina; Aminot, Yann; Pacchioni, Beniamina; Millino, Caterina; Lanfranchi, Gerolamo; Readman, James W.; Moore, Michael N.; Viarengo, Aldo; Jha, Awadhesh N.

    2017-01-01

    Despite the increasing use of mussels in environmental monitoring and ecotoxicological studies, their genomes and gene functions have not been thoroughly explored. Several cDNA microarrays were recently proposed for Mytilus spp., but putatively identified partial transcripts have rendered the generation of robust transcriptional responses difficult in terms of pathway identification. We developed a new low density oligonucleotide microarray with 465 probes covering the same number of genes. Target genes were selected to cover most of the well-known biological processes in the stress response documented over the last decade in bivalve species at the cellular and tissue levels. Our new ‘STressREsponse Microarray’ (STREM) platform consists of eight sub-arrays with three replicates for each target in each sub-array. To assess the potential use of the new array, we tested the effect of the ubiquitous environmental pollutant benzo[a]pyrene (B[a]P) at 5, 50, and 100 μg/L on two target tissues, the gills and digestive gland, of Mytilus galloprovincialis exposed invivo for three days. Bioaccumulation of B[a]P was also determined demonstrating exposure in both tissues. In addition to the well-known effects of B[a]P on DNA metabolism and oxidative stress, the new array data provided clues about the implication of other biological processes, such as cytoskeleton, immune response, adhesion to substrate, and mitochondrial activities. Transcriptional data were confirmed using qRT-PCR. We further investigated cellular functions and possible alterations related to biological processes highlighted by the microarray data using oxidative stress biomarkers (Lipofuscin content) and the assessment of genotoxicity. DNA damage, as measured by the alkaline comet assay, increased as a function of dose.DNA adducts measurements using 32P-postlabeling method also showed the presence of bulky DNA adducts (i.e. dG-N2-BPDE). Lipofiscin content increased significantly in B[a]P exposed mussels. Immunohistochemical analysis of tubulin and actin showed changes in cytoskeleton organisation. Our results adopting an integrated approach confirmed that the combination of newly developed transcriptomic approcah, classical biomarkers along with chemical analysis of water and tissue samples should be considered for environmental bioimonitoring and ecotoxicological studies to obtain holistic information to assess the impact of contaminants on the biota. PMID:28651000

  18. Assessing the Interplay between the Physicochemical Parameters of Ion-Pairing Reagents and the Analyte Sequence on the Electrospray Desorption Process for Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Basiri, Babak; Murph, Mandi M.; Bartlett, Michael G.

    2017-08-01

    Alkylamines are widely used as ion-pairing agents during LC-MS of oligonucleotides. In addition to a better chromatographic separation, they also assist with the desorption of oligonucleotide ions into the gas phase, cause charge state reduction, and decrease cation adduction. However, the choice of such ion-pairing agents has considerable influence on the MS signal intensity of oligonucleotides as they can also cause significant ion suppression. Interestingly, optimal ion-pairing agents should be selected on a case by case basis as their choice is strongly influenced by the sequence of the oligonucleotide under investigation. Despite imposing major practical difficulties to analytical method development, such a highly variable system that responds very strongly to the nuances of the electrospray composition provides an excellent opportunity for a fundamental study of the electrospray ionization process. Our investigations using this system quantitatively revealed the major factors that influenced the ESI ionization efficiency of oligonucleotides. Parameters such as boiling point, proton affinity, partition coefficient, water solubility, and Henry's law constants for the ion-pairing reagents and the hydrophobic thymine content of the oligonucleotides were found to be the most significant contributors. Identification of these parameters also allowed for the development of a statistical predictive algorithm that can assist with the choice of an optimum IP agent for each particular oligonucleotide sequence. We believe that research in the field of oligonucleotide bioanalysis will significantly benefit from this algorithm (included in Supplementary Material) as it advocates for the use of lesser-known but more suitable ion-pair alternatives to TEA for many oligonucleotide sequences.

  19. Measuring the binding stoichiometry of HIV-1 Gag to very-low-density oligonucleotide surfaces using surface plasmon resonance spectroscopy.

    PubMed

    Stephen, Andrew G; Datta, Siddhartha A K; Worthy, Karen M; Bindu, Lakshman; Fivash, Matthew J; Turner, Kevin B; Fabris, Daniele; Rein, Alan; Fisher, Robert J

    2007-09-01

    The interaction of the HIV Gag polyprotein with nucleic acid is a critical step in the assembly of viral particles. The Gag polyprotein is composed of the matrix (MA), capsid (CA), and nucleocapsid (NC) domains. The NC domain is required for nucleic acid interactions, and the CA domain is required for Gag-Gag interactions. Previously, we have investigated the binding of the NC protein to d(TG)(n) oligonucleotides using surface plasmon resonance (SPR) spectroscopy. We found a single NC protein is able to bind to more than one immobilized oligonucleotide, provided that the oligonucleotides are close enough together. As NC is believed to be the nucleic acid binding domain of Gag, we might expect Gag to show the same complex behavior. We wished to analyze the stoichiometry of Gag binding to oligonucleotides without this complication due to tertiary complex formation. We have therefore analyzed Gag binding to extremely low oligonucleotide density on SPR chips. Such low densities of oligonucleotides are difficult to accurately quantitate. We have determined by Fourier transform ion cyclotron (FTICR) mass spectrometry that four molecules of NC bind to d(TG)(10) (a 20-base oligonucleotide). We developed a method of calibrating low-density surfaces using NC calibration injections. Knowing the maximal response and the stoichiometry of binding, we can precisely determine the amount of oligonucleotide immobilized at these very-low-density surfaces (<1 Response Unit). Using this approach, we have measured the binding of Gag to d(TG)(10). Gag binds to a 20-mer with a stoichiometry of greater than 4. This suggests that once Gag is bound to the immobilized oligonucleotide, additional Gag molecules can bind to this complex.

  20. RNA therapeutics: Beyond RNA interference and antisense oligonucleotides

    PubMed Central

    Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney

    2016-01-01

    Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036

  1. Modification of antisense phosphodiester oligodeoxynucleotides by a 5' cholesteryl moiety increases cellular association and improves efficacy.

    PubMed

    Krieg, A M; Tonkinson, J; Matson, S; Zhao, Q; Saxon, M; Zhang, L M; Bhanja, U; Yakubov, L; Stein, C A

    1993-02-01

    Phosphodiester oligodeoxynucleotides bearing a 5' cholesteryl (chol) modification bind to low density lipoprotein (LDL), apparently by partitioning the chol-modified oligonucleotides into the lipid layer. Both HL60 cells and primary mouse spleen T and B cells incubated with fluorescently labeled chol-modified oligonucleotide showed substantially increased cellular association by flow cytometry and increased internalization by confocal microscopy compared to an identical molecule not bearing the chol group. Cellular internalization of chol-modified oligonucleotide occurred at least partially through the LDL receptor; it was increased in mouse spleen cells by cell culture in lipoprotein-deficient medium and/or lovastatin, and it was decreased by culture in high serum medium. To determine whether chol-modified oligonucleotides are more potent antisense agents, we titered antisense unmodified phosphodiester and chol-modified oligonucleotides targeted against a mouse immunosuppressive protein. Murine spleen cells cultured with 20 microM phosphodiester antisense oligonucleotides had a 2-fold increase in RNA synthesis, indicating the expected lymphocyte activation. Antisense chol-modified oligonucleotides showed an 8-fold increase in relative potency: they caused a 2-fold increase in RNA synthesis at just 2.5 microM. The increased efficacy was blocked by heparin and was further increased by cell culture in 1% (vs. 10%) fetal bovine serum, suggesting that the effect may, at least in part, be mediated via the LDL receptor. Antisense chol-modified oligonucleotides are sequence specific and have increased potency as compared to unmodified oligonucleotides.

  2. Programmable DNA scaffolds for spatially-ordered protein assembly

    NASA Astrophysics Data System (ADS)

    Chandrasekaran, Arun Richard

    2016-02-01

    Ever since the notion of using DNA as a material was realized, it has been employed in the construction of complex structures that facilitate the assembly of nanoparticles or macromolecules with nanometer-scale precision. Specifically, tiles fashioned from DNA strands and DNA origami sheets have been shown to be suitable as scaffolds for immobilizing proteins with excellent control over their spatial positioning. Supramolecular assembly of proteins into periodic arrays in one or more dimensions is one of the most challenging aspects in the design of scaffolds for biomolecular investigations and macromolecular crystallization. This review provides a brief overview of how various biomolecular interactions with high degree of specificity such as streptavidin-biotin, antigen-antibody, and aptamer-protein interactions have been used to fabricate linear and multidimensional assemblies of structurally intact and functional proteins. The use of DNA-binding proteins as adaptors, polyamide recognition on DNA scaffolds and oligonucleotide linkers for protein assembly are also discussed.Ever since the notion of using DNA as a material was realized, it has been employed in the construction of complex structures that facilitate the assembly of nanoparticles or macromolecules with nanometer-scale precision. Specifically, tiles fashioned from DNA strands and DNA origami sheets have been shown to be suitable as scaffolds for immobilizing proteins with excellent control over their spatial positioning. Supramolecular assembly of proteins into periodic arrays in one or more dimensions is one of the most challenging aspects in the design of scaffolds for biomolecular investigations and macromolecular crystallization. This review provides a brief overview of how various biomolecular interactions with high degree of specificity such as streptavidin-biotin, antigen-antibody, and aptamer-protein interactions have been used to fabricate linear and multidimensional assemblies of structurally intact and functional proteins. The use of DNA-binding proteins as adaptors, polyamide recognition on DNA scaffolds and oligonucleotide linkers for protein assembly are also discussed. Dedicated to my advisor Ned Seeman on the occasion of his 70th birthday.

  3. Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs

    PubMed Central

    Lucchino, Marco

    2018-01-01

    RNA interference (RNAi) is a fundamental cellular process for the posttranscriptional regulation of gene expression. RNAi can exogenously be modulated by small RNA oligonucleotides, such as microRNAs (miRNAs) and small interfering RNAs (siRNAs), or by antisense oligonucleotides. These small oligonucleotides provided the scientific community with powerful and versatile tools to turn off the expression of genes of interest, and hold out the promise of new therapeutic solutions against a wide range of gene-associated pathologies. However, unmodified nucleic acids are highly instable in biological systems, and their weak interaction with plasma proteins confers an unfavorable pharmacokinetics. In this review, we first provide an overview of the most efficient chemical strategies that, over the past 30 years, have been used to significantly improve the therapeutic potential of oligonucleotides. Oligonucleotides targeting and delivery technologies are then presented, including covalent conjugates between oligonucleotides and targeting ligand, and noncovalent association with lipid or polymer nanoparticles. Finally, we specifically focus on the endosomal escape step, which represents a major stumbling block for the effective use of oligonucleotides as therapeutic agents. The need for approaches to quantitatively measure endosomal escape and cytosolic arrival of biomolecules is discussed in the context of the development of efficient oligonucleotide targeting and delivery vectors. PMID:29883296

  4. The Highly Robust Electrical Interconnects and Ultrasensitive Biosensors Based on Embedded Carbon Nanotube Arrays

    NASA Technical Reports Server (NTRS)

    Li, Jun; Cassell, Alan; Koehne, Jessica; Chen, Hua; Ng, Hou Tee; Ye, Qi; Stevens, Ramsey; Han, Jie; Meyyappan, M.

    2003-01-01

    We report on our recent breakthroughs in two different applications using well-aligned carbon nanotube (CNT) arrays on Si chips, including (1) a novel processing solution for highly robust electrical interconnects in integrated circuit manufacturing, and (2) the development of ultrasensitive electrochemical DNA sensors. Both of them rely on the invention of a bottom-up fabrication scheme which includes six steps, including: (a) lithographic patterning, (b) depositing bottom conducting contacts, (c) depositing metal catalysts, (d) CNT growth by plasma enhanced chemical vapor deposition (PECVD), (e) dielectric gap-filling, and (f) chemical mechanical polishing (CMP). Such processes produce a stable planarized surface with only the open end of CNTs exposed, whch can be further processed or modified for different applications. By depositing patterned top contacts, the CNT can serve as vertical interconnects between the two conducting layers. This method is fundamentally different fiom current damascene processes and avoids problems associated with etching and filling of high aspect ratio holes at nanoscales. In addition, multiwalled CNTs (MWCNTs) are highly robust and can carry a current density of 10(exp 9) A/square centimeters without degradation. It has great potential to help extending the current Si technology. The embedded MWCNT array without the top contact layer can be also used as a nanoelectrode array in electrochemical biosensors. The cell time-constant and sensitivity can be dramatically improved. By functionalizing the tube ends with specific oligonucleotide probes, specific DNA targets can be detected with electrochemical methods down to subattomoles.

  5. Oligonucleotide and Parylene Surface Coating of Polystyrene and ePTFE for Improved Endothelial Cell Attachment and Hemocompatibility

    PubMed Central

    Schleicher, Martina; Hansmann, Jan; Elkin, Bentsian; Kluger, Petra J.; Liebscher, Simone; Huber, Agnes J. T.; Fritze, Olaf; Schille, Christine; Müller, Michaela; Schenke-Layland, Katja; Seifert, Martina; Walles, Heike; Wendel, Hans-Peter; Stock, Ulrich A.

    2012-01-01

    In vivo self-endothelialization by endothelial cell adhesion on cardiovascular implants is highly desirable. DNA-oligonucleotides are an intriguing coating material with nonimmunogenic characteristics and the feasibility of easy and rapid chemical fabrication. The objective of this study was the creation of cell adhesive DNA-oligonucleotide coatings on vascular implant surfaces. DNA-oligonucleotides immobilized by adsorption on parylene (poly(monoaminomethyl-para-xylene)) coated polystyrene and ePTFE were resistant to high shear stress (9.5 N/m2) and human blood serum for up to 96 h. Adhesion of murine endothelial progenitor cells, HUVECs and endothelial cells from human adult saphenous veins as well as viability over a period of 14 days of HUVECs on oligonucleotide coated samples under dynamic culture conditions was significantly enhanced (P < 0.05). Oligonucleotide-coated surfaces revealed low thrombogenicity and excellent hemocompatibility after incubation with human blood. These properties suggest the suitability of immobilization of DNA-oligonucleotides for biofunctionalization of blood vessel substitutes for improved in vivo endothelialization. PMID:22481939

  6. Molecular Profile of Peripheral Blood Mononuclear Cells from Patients with Rheumatoid Arthritis

    PubMed Central

    Edwards, Christopher J; Feldman, Jeffrey L; Beech, Jonathan; Shields, Kathleen M; Stover, Jennifer A; Trepicchio, William L; Larsen, Glenn; Foxwell, Brian MJ; Brennan, Fionula M; Feldmann, Marc; Pittman, Debra D

    2007-01-01

    Rheumatoid arthritis (RA) is a chronic inflammatory arthritis. Currently, diagnosis of RA may take several weeks, and factors used to predict a poor prognosis are not always reliable. Gene expression in RA may consist of a unique signature. Gene expression analysis has been applied to synovial tissue to define molecularly distinct forms of RA; however, expression analysis of tissue taken from a synovial joint is invasive and clinically impractical. Recent studies have demonstrated that unique gene expression changes can be identified in peripheral blood mononuclear cells (PBMCs) from patients with cancer, multiple sclerosis, and lupus. To identify RA disease-related genes, we performed a global gene expression analysis. RNA from PBMCs of 9 RA patients and 13 normal volunteers was analyzed on an oligonucleotide array. Compared with normal PBMCs, 330 transcripts were differentially expressed in RA. The differentially regulated genes belong to diverse functional classes and include genes involved in calcium binding, chaperones, cytokines, transcription, translation, signal transduction, extracellular matrix, integral to plasma membrane, integral to intracellular membrane, mitochondrial, ribosomal, structural, enzymes, and proteases. A k-nearest neighbor analysis identified 29 transcripts that were preferentially expressed in RA. Ten genes with increased expression in RA PBMCs compared with controls mapped to a RA susceptibility locus, 6p21.3. These results suggest that analysis of RA PBMCs at the molecular level may provide a set of candidate genes that could yield an easily accessible gene signature to aid in early diagnosis and treatment. PMID:17515956

  7. Interaction of the E. coli DNA G:T-mismatch endonuclease (vsr protein) with oligonucleotides containing its target sequence.

    PubMed

    Turner, D P; Connolly, B A

    2000-12-15

    The Escherichia coli vsr endonuclease recognises G:T base-pair mismatches in double-stranded DNA and initiates a repair pathway by hydrolysing the phosphate group 5' to the incorrectly paired T. The enzyme shows a preference for G:T mismatches within a particular sequence context, derived from the recognition site of the E. coli dcm DNA-methyltransferase (CC[A/T]GG). Thus, the preferred substrate for the vsr protein is (CT[A/T]GG), where the underlined T is opposed by a dG base. This paper provides quantitative data for the interaction of the vsr protein with a number of oligonucleotides containing G:T mismatches. Evaluation of specificity constant (k(st)/K(D); k(st)=rate constant for single turnover, K(D)=equilibrium dissociation constant) confirms vsr's preference for a G:T mismatch within a hemi-methylated dcm sequence, i.e. the best substrate is a duplex (both strands written in the 5'-3' orientation) composed of CT[A/T]GG and C(5Me)C[T/A]GG. Conversion of the mispaired T (underlined) to dU or the d(5Me)C to dC gave poorer substrates. No interaction was observed with oligonucleotides that lacked a G:T mismatch or did not possess a dcm sequence. An analysis of the fraction of active protein, by "reverse-titration" (i.e. adding increasing amounts of DNA to a fixed amount of protein followed by gel-mobility shift analysis) showed that less than 1% of the vsr endonuclease was able to bind to the substrate. This was confirmed using "competitive titrations" (where competitor oligonucleotides are used to displace a (32)P-labelled nucleic acid from the vsr protein) and burst kinetic analysis. This result is discussed in the light of previous in vitro and in vivo data which indicate that the MutL protein may be needed for full vsr activity. Copyright 2000 Academic Press.

  8. Oligonucleotide assisted light-emitting Alq3 microrods: energy transfer effect with fluorescent dyes.

    PubMed

    Cui, Chunzhi; Park, Dong Hyuk; Kim, Jeongyong; Joo, Jinsoo; Ahn, Dong June

    2013-06-14

    Oligonucleotide assisted tri(8-hydroxyquinoline) aluminium (Alq3) microrods were prepared for the first time. When hybridized with oligonucleotide labeled by Cy3 fluorescent dye, a significant photoluminescence variation of the Alq3 microrods was observed due to Förster resonance energy transfer, unlike when Cy5-oligonucleotide was used. Versatile nucleotide manipulation would open up wider applications of Alq3-based materials, based on this fundamental observation.

  9. Decoy Oligonucleotide Rescues IGF1R Expression from MicroRNA-223 Suppression

    PubMed Central

    Wang, Rong; He, Bao Mei; Qi, Bing; Xu, Chang Jun; Wu, Xing Zhong

    2013-01-01

    A mature miRNA generally suppresses hundreds of mRNA targets. To evaluate the selective effect of synthetic oligonucleotide decoys on hsa-miR-223 activity, reporters containing 3’ untranslated regions (UTR) of IGF1R, FOXO1, POLR3G, FOXO3, CDC27, FBXW7 and PAXIP1 mRNAs were constructed for the luciferase assay. The oligonucleotide decoys were designed and synthesized according to mature miR-223 sequence and its target mRNA sequence. Quantitative RT-PCR & western analysis were used to measure miR-223-targeted mRNA expression, Interestingly, apart from the antisense oligonucleotide, decoy nucleotides which were complementary to the 5’, central or 3’ region of mature miR-223 suppressed miR-223 targeting the 3’UTR of IGF1R, FOXO1, FOXO3, CDC27, POLR3G, and FBXW7 mRNAs and rescued the expression of these genes to varying degrees from miR-223 suppression at both mRNA and protein levels. All decoys had no effect on PAXIP1 which was not targeted by miR-223. The decoy 1 that was based on the sequence of IGF1R 3’UTR rescued the expression of IGF1R more significantly than other decoy nucleotides except the antisense decoy 4. Decoy 1 also rescued the expression of FOXO3 and POLR3G of which their 3’UTRs have similar binding sites for miR-223 with IGF1R 3’UTR. However decoy 1 failed to recover Sp1, CDC27 and FBXW7 expression. These data support that the sequence-specific decoy oligonucleotides might represent exogenous competing RNA which selectively inhibits microRNA targeting. PMID:24324762

  10. Decoy oligonucleotide rescues IGF1R expression from MicroRNA-223 suppression.

    PubMed

    Wu, Li Hui; Cai, Qian Qian; Dong, Yi Wei; Wang, Rong; He, Bao Mei; Qi, Bing; Xu, Chang Jun; Wu, Xing Zhong

    2013-01-01

    A mature miRNA generally suppresses hundreds of mRNA targets. To evaluate the selective effect of synthetic oligonucleotide decoys on hsa-miR-223 activity, reporters containing 3' untranslated regions (UTR) of IGF1R, FOXO1, POLR3G, FOXO3, CDC27, FBXW7 and PAXIP1 mRNAs were constructed for the luciferase assay. The oligonucleotide decoys were designed and synthesized according to mature miR-223 sequence and its target mRNA sequence. Quantitative RT-PCR & western analysis were used to measure miR-223-targeted mRNA expression, Interestingly, apart from the antisense oligonucleotide, decoy nucleotides which were complementary to the 5', central or 3' region of mature miR-223 suppressed miR-223 targeting the 3'UTR of IGF1R, FOXO1, FOXO3, CDC27, POLR3G, and FBXW7 mRNAs and rescued the expression of these genes to varying degrees from miR-223 suppression at both mRNA and protein levels. All decoys had no effect on PAXIP1 which was not targeted by miR-223. The decoy 1 that was based on the sequence of IGF1R 3'UTR rescued the expression of IGF1R more significantly than other decoy nucleotides except the antisense decoy 4. Decoy 1 also rescued the expression of FOXO3 and POLR3G of which their 3'UTRs have similar binding sites for miR-223 with IGF1R 3'UTR. However decoy 1 failed to recover Sp1, CDC27 and FBXW7 expression. These data support that the sequence-specific decoy oligonucleotides might represent exogenous competing RNA which selectively inhibits microRNA targeting.

  11. Tissue-Specific Transcriptomic Profiling of Sorghum propinquum using a Rice Genome Array

    PubMed Central

    Zhang, Ting; Zhao, Xiuqin; Huang, Liyu; Liu, Xiaoyue; Zong, Ying; Zhu, Linghua; Yang, Daichang; Fu, Binying

    2013-01-01

    Sorghum (Sorghum bicolor) is one of the world's most important cereal crops. S. propinquum is a perennial wild relative of S. bicolor with well-developed rhizomes. Functional genomics analysis of S. propinquum, especially with respect to molecular mechanisms related to rhizome growth and development, can contribute to the development of more sustainable grain, forage, and bioenergy cropping systems. In this study, we used a whole rice genome oligonucleotide microarray to obtain tissue-specific gene expression profiles of S. propinquum with special emphasis on rhizome development. A total of 548 tissue-enriched genes were detected, including 31 and 114 unique genes that were expressed predominantly in the rhizome tips (RT) and internodes (RI), respectively. Further GO analysis indicated that the functions of these tissue-enriched genes corresponded to their characteristic biological processes. A few distinct cis-elements, including ABA-responsive RY repeat CATGCA, sugar-repressive TTATCC, and GA-responsive TAACAA, were found to be prevalent in RT-enriched genes, implying an important role in rhizome growth and development. Comprehensive comparative analysis of these rhizome-enriched genes and rhizome-specific genes previously identified in Oryza longistaminata and S. propinquum indicated that phytohormones, including ABA, GA, and SA, are key regulators of gene expression during rhizome development. Co-localization of rhizome-enriched genes with rhizome-related QTLs in rice and sorghum generated functional candidates for future cloning of genes associated with rhizome growth and development. PMID:23536906

  12. Direct fluorescence in situ hybridization on human metaphase chromosomes using quantum dot-platinum labeled DNA probes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hwang, Gyoyeon; Biological Chemistry, Korea University of Science and Technology, 217, Gajeong-ro, Yuseong-gu, Deajeon; Lee, Hansol

    The telomere shortening in chromosomes implies the senescence, apoptosis, or oncogenic transformation of cells. Since detecting telomeres in aging and diseases like cancer, is important, the direct detection of telomeres has been a very useful biomarker. We propose a telomere detection method using a newly synthesized quantum dot (QD) based probe with oligonucleotide conjugation and direct fluorescence in situ hybridization (FISH). QD-oligonucleotides were prepared with metal coordination bonding based on platinum-guanine binding reported in our previous work. The QD-oligonucleotide conjugation method has an advantage where any sequence containing guanine at the end can be easily bound to the starting QD-Ptmore » conjugate. A synthesized telomeric oligonucleotide was bound to the QD-Pt conjugate successfully and this probe hybridized specifically on the telomere of fabricated MV-4-11 and MOLT-4 chromosomes. Additionally, the QD-telomeric oligonucleotide probe successfully detected the telomeres on the CGH metaphase slide. Due to the excellent photostability and high quantum yield of QDs, the QD-oligonucleotide probe has high fluorescence intensity when compared to the organic dye-oligonucleotide probe. Our QD-oligonucleotide probe, conjugation method of this QD probe, and hybridization protocol with the chromosomes can be a useful tool for chromosome painting and FISH. - Highlights: • We prepared a probe linked between QD and telomeric oligonucleotide with platinum-guanine bonding. • Telomeres were detected by our new telomere probes successfully in three different human metaphase chromosomes. • QDPt-DNA probe has high fluorescence intensity in comparison with organic dye-DNA probe.« less

  13. Transcription factor mutations in myelodysplastic/myeloproliferative neoplasms

    PubMed Central

    Ernst, Thomas; Chase, Andrew; Zoi, Katerina; Waghorn, Katherine; Hidalgo-Curtis, Claire; Score, Joannah; Jones, Amy; Grand, Francis; Reiter, Andreas; Hochhaus, Andreas; Cross, Nicholas C.P.

    2010-01-01

    Background Aberrant activation of tyrosine kinases, caused by either mutation or gene fusion, is of major importance for the development of many hematologic malignancies, particularly myeloproliferative neoplasms. We hypothesized that hitherto unrecognized, cytogenetically cryptic tyrosine kinase fusions may be common in non-classical or atypical myeloproliferative neoplasms and related myelodysplastic/myeloproliferative neoplasms. Design and Methods To detect genomic copy number changes associated with such fusions, we performed a systematic search in 68 patients using custom designed, targeted, high-resolution array comparative genomic hybridization. Arrays contained 44,000 oligonucleotide probes that targeted 500 genes including all 90 tyrosine kinases plus downstream tyrosine kinase signaling components, other translocation targets, transcription factors, and other factors known to be important for myelopoiesis. Results No abnormalities involving tyrosine kinases were detected; however, nine cytogenetically cryptic copy number imbalances were detected in seven patients, including hemizygous deletions of RUNX1 or CEBPA in two cases with atypical chronic myeloid leukemia. Mutation analysis of the remaining alleles revealed non-mutated RUNX1 and a frameshift insertion within CEBPA. A further mutation screen of 187 patients with myelodysplastic/myeloproliferative neoplasms identified RUNX1 mutations in 27 (14%) and CEBPA mutations in seven (4%) patients. Analysis of other transcription factors known to be frequently mutated in acute myeloid leukemia revealed NPM1 mutations in six (3%) and WT1 mutations in two (1%) patients with myelodysplastic/myeloproliferative neoplasms. Univariate analysis indicated that patients with mutations had a shorter overall survival (28 versus 44 months, P=0.019) compared with patients without mutations, with the prognosis for cases with CEBPA, NPM1 or WT1 mutations being particularly poor. Conclusions We conclude that mutations of transcription and other nuclear factors are frequent in myelodysplastic/myeloproliferative neoplasms and are generally mutually exclusive. CEBPA, NPM1 or WT1 mutations may be associated with a poor prognosis, an observation that will need to be confirmed by detailed prospective studies. PMID:20421268

  14. Characterization and electrochemical response of DNA functionalized 2nm gold nanoparticles confined in a nanochannel array.

    PubMed

    Peinetti, Ana S; Ceretti, Helena; Mizrahi, Martín; González, Graciela A; Ramírez, Silvana A; Requejo, Félix G; Montserrat, Javier M; Battaglini, Fernando

    2018-06-01

    Polyvalent gold nanoparticle oligonucleotide conjugates are subject of intense research. Even though 2nm diameter AuNPs have been previously modified with DNA, little is known about their structure and electrochemical behavior. In this work, we examine the influence of different surface modification strategies on the interplay between the meso-organization and the molecular recognition properties of a 27-mer DNA strand. This DNA strand is functionalized with different sulfur-containing moieties and immobilized on 2nm gold nanoparticles confined on a nanoporous alumina, working the whole system as an electrode array. Surface coverages were determined by EXAFS and the performance as recognition elements for impedance-based sensors is evaluated. Our results prove that low DNA coverages on the confined nanoparticles prompt to a more sensitive response, showing the relevance in avoiding the DNA strand overcrowding. The system was able to determine a concentration as low as 100pM of the complementary strand, thus introducing the foundations for the construction of label-free genosensors at the nanometer scale. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Calibration and assessment of channel-specific biases in microarray data with extended dynamical range.

    PubMed

    Bengtsson, Henrik; Jönsson, Göran; Vallon-Christersson, Johan

    2004-11-12

    Non-linearities in observed log-ratios of gene expressions, also known as intensity dependent log-ratios, can often be accounted for by global biases in the two channels being compared. Any step in a microarray process may introduce such offsets and in this article we study the biases introduced by the microarray scanner and the image analysis software. By scanning the same spotted oligonucleotide microarray at different photomultiplier tube (PMT) gains, we have identified a channel-specific bias present in two-channel microarray data. For the scanners analyzed it was in the range of 15-25 (out of 65,535). The observed bias was very stable between subsequent scans of the same array although the PMT gain was greatly adjusted. This indicates that the bias does not originate from a step preceding the scanner detector parts. The bias varies slightly between arrays. When comparing estimates based on data from the same array, but from different scanners, we have found that different scanners introduce different amounts of bias. So do various image analysis methods. We propose a scanning protocol and a constrained affine model that allows us to identify and estimate the bias in each channel. Backward transformation removes the bias and brings the channels to the same scale. The result is that systematic effects such as intensity dependent log-ratios are removed, but also that signal densities become much more similar. The average scan, which has a larger dynamical range and greater signal-to-noise ratio than individual scans, can then be obtained. The study shows that microarray scanners may introduce a significant bias in each channel. Such biases have to be calibrated for, otherwise systematic effects such as intensity dependent log-ratios will be observed. The proposed scanning protocol and calibration method is simple to use and is useful for evaluating scanner biases or for obtaining calibrated measurements with extended dynamical range and better precision. The cross-platform R package aroma, which implements all described methods, is available for free from http://www.maths.lth.se/bioinformatics/.

  16. Intelligent nanomedicine integrating diagnosis and therapy

    NASA Technical Reports Server (NTRS)

    Li, Na (Inventor); Tan, Winny (Inventor)

    2012-01-01

    A method of controlling the activity of a biologically active compound. The method concerns an oligonucleotide-based compound, comprising a hairpin-forming oligonucleotide, an effector moiety physically associated with the oligonucleotide, where the effector moiety possesses a biological activity, and a regulating moiety physically associated with the oligonucleotide, where the regulating moiety controls the biological activity of the effector moiety by interacting with the effector moiety. The oligonucleotide can assume a hairpin configuration, where the effector and regulating moieties interact, or an open configuration, where the effector and regulating moieties fail to interact. Depending on the nature of the effector and regulating moieties, either configuration can result in the expression of the biological activity of the effector moiety.

  17. Oligonucleotide labeling methods. 3. Direct labeling of oligonucleotides employing a novel, non-nucleosidic, 2-aminobutyl-1,3-propanediol backbone.

    PubMed Central

    Nelson, P S; Kent, M; Muthini, S

    1992-01-01

    Novel CE-phosphoramidite (7a-e) and CPG (8a, c, d, e) reagents have been prepared from a unique 2-aminobutyl-1,3-propanediol backbone. The reagents have been used to directly label oligonucleotides with fluorescein, acridine, and biotin via automated DNA synthesis. The versatile 2-aminobutyl-1,3-propanediol backbone allows for labeling at any position (5', internal, and 3') during solid phase oligonucleotide synthesis. Multiple labels can be achieved by repetitive coupling cycles. Furthermore, the 3-carbon atom internucleotide phosphate distance is retained when inserted internally. Using this method, individual oligonucleotides possessing two and three different reporter molecules have been prepared. PMID:1475185

  18. Oligonucleotide gap-fill ligation for mutation detection and sequencing in situ

    PubMed Central

    Mignardi, Marco; Mezger, Anja; Qian, Xiaoyan; La Fleur, Linnea; Botling, Johan; Larsson, Chatarina; Nilsson, Mats

    2015-01-01

    In clinical diagnostics a great need exists for targeted in situ multiplex nucleic acid analysis as the mutational status can offer guidance for effective treatment. One well-established method uses padlock probes for mutation detection and multiplex expression analysis directly in cells and tissues. Here, we use oligonucleotide gap-fill ligation to further increase specificity and to capture molecular substrates for in situ sequencing. Short oligonucleotides are joined at both ends of a padlock gap probe by two ligation events and are then locally amplified by target-primed rolling circle amplification (RCA) preserving spatial information. We demonstrate the specific detection of the A3243G mutation of mitochondrial DNA and we successfully characterize a single nucleotide variant in the ACTB mRNA in cells by in situ sequencing of RCA products generated by padlock gap-fill ligation. To demonstrate the clinical applicability of our assay, we show specific detection of a point mutation in the EGFR gene in fresh frozen and formalin-fixed, paraffin-embedded (FFPE) lung cancer samples and confirm the detected mutation by in situ sequencing. This approach presents several advantages over conventional padlock probes allowing simpler assay design for multiplexed mutation detection to screen for the presence of mutations in clinically relevant mutational hotspots directly in situ. PMID:26240388

  19. Methods Of Using Chemical Libraries To Search For New Kinase Inhibitors

    DOEpatents

    Gray, Nathanael S. , Schultz, Peter , Wodicka, Lisa , Meijer, Laurent , Lockhart, David J.

    2003-06-03

    The generation of selective inhibitors for specific protein kinases would provide new tools for analyzing signal transduction pathways and possibly new therapeutic agents. We have invented an approach to the development of selective protein kinase inhibitors based on the unexpected binding mode of 2,6,9-trisubstituted purines to the ATP binding site of human CDK2. The most potent inhibitor, purvalanol B (IC.sub.50 =6 nM), binds with a 30-fold greater affinity than the known CDK2 inhibitor, flavopiridol. The cellular effects of this class of compounds were examined and compared to those of flavopiridol by monitoring changes in mRNA expression levels for all genes in treated cells of Saccharomyces cerevisiae using high-density oligonucleotide probe arrays.

  20. Evaluation of chronic lymphocytic leukemia by oligonucleotide-based microarray analysis uncovers novel aberrations not detected by FISH or cytogenetic analysis

    PubMed Central

    2011-01-01

    Background Cytogenetic evaluation is a key component of the diagnosis and prognosis of chronic lymphocytic leukemia (CLL). We performed oligonucleotide-based comparative genomic hybridization microarray analysis on 34 samples with CLL and known abnormal karyotypes previously determined by cytogenetics and/or fluorescence in situ hybridization (FISH). Results Using a custom designed microarray that targets >1800 genes involved in hematologic disease and other malignancies, we identified additional cryptic aberrations and novel findings in 59% of cases. These included gains and losses of genes associated with cell cycle regulation, apoptosis and susceptibility loci on 3p21.31, 5q35.2q35.3, 10q23.31q23.33, 11q22.3, and 22q11.23. Conclusions Our results show that microarray analysis will detect known aberrations, including microscopic and cryptic alterations. In addition, novel genomic changes will be uncovered that may become important prognostic predictors or treatment targets for CLL in the future. PMID:22087757

  1. [Oligonucleotide derivatives in the nucleic acid hybridization analysis. I. Covalent immobilization of oligonucleotide probes onto the nylon].

    PubMed

    Dmitrienko, E V; Pyshnaia, I A; Pyshnyĭ, D V

    2010-01-01

    The features of UV-induced immobilization of oligonucleotides on a nylon membranes and the effectiveness of enzymatic labeling of immobilized probes at heterophase detection of nucleic acids are studied. Short terminal oligothymidilate (up to 10 nt) sequences are suggested to attach to the probe via a flexible ethylene glycol based linker. The presence of such fragment enhances the intensity of immobilization and reduces UV-dependent degradation of the targeted (sequence-specific) part of the probe by reducing the dose needed for the immobilization of DNA. The optimum dose of UV-irradiation is determined to be ~0.4 J/cm(2) at the wavelength 254 nm. This dose provides high level of hybridization signal for immobilized probes with various nucleotide composition of the sequence specific moiety. The amide groups of the polyamide are shown to play the key role in the photoinduced immobilization of nucleic acids, whereas the primary amino groups in the structure of PA is not the center responsible for the covalent binding of DNA by UV-irradiation, as previously believed. Various additives in the soaking solution during the membrane of UV-dependent immobilization of probes are shown to influence its effectiveness. The use of alternative to UV-irradiation system of radical generation are shown to provide the immobilization of oligonucleotides onto the nylon membrane.

  2. Sequence selective capture, release and analysis of DNA using a magnetic microbead-assisted toehold-mediated DNA strand displacement reaction.

    PubMed

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Linacre, Adrian; Ellis, Amanda V

    2014-07-21

    This paper reports on the modification of magnetic beads with oligonucleotide capture probes with a specially designed pendant toehold (overhang) aimed specifically to capture double-stranded PCR products. After capture, the PCR products were selectively released from the magnetic beads by means of a toehold-mediated strand displacement reaction using short artificial oligonucleotide triggers and analysed using capillary electrophoresis. The approach was successfully shown on two genes widely used in human DNA genotyping, namely human c-fms (macrophage colony-stimulating factor) proto-oncogene for the CSF-1 receptor (CSF1PO) and amelogenin.

  3. Oligonucleotide (GTG)5 as an epidemiological tool in the study of nontuberculous mycobacteria.

    PubMed Central

    Cilliers, F J; Warren, R M; Hauman, J H; Wiid, I J; van Helden, P D

    1997-01-01

    Analysis of restriction fragment length polymorphisms in the genome of Mycobacterium tuberculosis (DNA fingerprinting) has proved to be a useful epidemiological tool in the study of tuberculosis within populations or communities. However, to date, no similar method has been developed to study the epidemiology of nontuberculous mycobacteria (NTM). In this communication, we report that a simple oligonucleotide repeat, (GTG)5, can be used to accurately genotype all species and strains of NTM tested. We suggest that this technology is an easily applied and accurate tool which can be used for the study of the epidemiology of NTM. PMID:9163479

  4. Alteration in oligonucleotide fingerprint patterns of the viral genome in poliovirus type 2 isolated from paralytic patients.

    PubMed Central

    Yoneyama, T; Hagiwara, A; Hara, M; Shimojo, H

    1982-01-01

    A close relationship was demonstrated by oligonucleotide fingerprinting between genomes of the poliovirus type 2 Sabin vaccine strain and recent isolates from paralytic cases associated with vaccination in Japan. The oligonucleotide maps of isolates from an agammaglobulinemic patient, who continued to excrete poliovirus type 2 for 3.5 years after the administration of oral vaccine, showed that the genomic alteration proceeded gradually, retaining the majority of the oligonucleotides characteristic of the vaccine strain for a long period, indicating vaccine origin for the isolates. The final isolate at month 41, however, lost the majority of these oligonucleotides. The heterologous antigenic relationship between the final isolate and the previous isolates was also observed. The serial alteration in electrophoretic mobility of the major structural proteins (VP1, VP2, and VP3) was observed throughout the excreting period. These results indicate that the population of the virus in this individual changed markedly during the last short period (about 3 months), in which the treatment with secretory immunoglobulin A was carried out. Genome comparisons in oligonucleotide maps show that some oligonucleotides in the genome of the vaccine strain are highly mutable after passage in humans. Images PMID:6179881

  5. Multiple primer extension by DNA polymerase on a novel plastic DNA array coated with a biocompatible polymer

    PubMed Central

    Kinoshita, Kenji; Fujimoto, Kentaro; Yakabe, Toru; Saito, Shin; Hamaguchi, Yuzo; Kikuchi, Takayuki; Nonaka, Ken; Murata, Shigenori; Masuda, Daisuke; Takada, Wataru; Funaoka, Sohei; Arai, Susumu; Nakanishi, Hisao; Yokoyama, Kanehisa; Fujiwara, Kazuhiko; Matsubara, Kenichi

    2007-01-01

    DNA microarrays are routinely used to monitor gene expression profiling and single nucleotide polymorphisms (SNPs). However, for practically useful high performance, the detection sensitivity is still not adequate, leaving low expression genes undetected. To resolve this issue, we have developed a new plastic S-BIO® PrimeSurface® with a biocompatible polymer; its surface chemistry offers an extraordinarily stable thermal property for a lack of pre-activated glass slide surface. The oligonucleotides immobilized on this substrate are robust in boiling water and show no significant loss of hybridization activity during dissociation treatment. This allowed us to hybridize the templates, extend the 3′ end of the immobilized DNA primers on the S-Bio® by DNA polymerase using deoxynucleotidyl triphosphates (dNTP) as extender units, release the templates by denaturalization and use the same templates for a second round of reactions similar to that of the PCR method. By repeating this cycle, the picomolar concentration range of the template oligonucleotide can be detected as stable signals via the incorporation of labeled dUTP into primers. This method of Multiple Primer EXtension (MPEX) could be further extended as an alternative route for producing DNA microarrays for SNP analyses via simple template preparation such as reverse transcript cDNA or restriction enzyme treatment of genome DNA. PMID:17135189

  6. Synthesis of 3'-, or 5'-, or internal methacrylamido-modified oligonucleotides

    DOEpatents

    Golova, Julia B.; Chernov, Boris K.

    2010-04-27

    New modifiers were synthesized for incorporation of a methacrylic function in 3'-, 5'- and internal positions of oligonucleotides during solid phase synthesis. A modifier was used for synthesis of 5'-methacrylated oligonucleotides for preparation of microarrays by a co-polymerization method.

  7. Repression of anti-proliferative factor Tob1 in osteoarthritic cartilage

    PubMed Central

    Gebauer, Mathias; Saas, Joachim; Haag, Jochen; Dietz, Uwe; Takigawa, Masaharu; Bartnik, Eckart; Aigner, Thomas

    2005-01-01

    Osteoarthritis is the most common degenerative disorder of the modern world. However, many basic cellular features and molecular processes of the disease are poorly understood. In the present study we used oligonucleotide-based microarray analysis of genes of known or assumed relevance to the cellular phenotype to screen for relevant differences in gene expression between normal and osteoarthritic chondrocytes. Custom made oligonucleotide DNA arrays were used to screen for differentially expressed genes in normal (n = 9) and osteoarthritic (n = 10) cartilage samples. Real-time polymerase chain reaction (PCR) with gene-specific primers was used for quantification. Primary human adult articular chondrocytes and chondrosarcoma cell line HCS-2/8 were used to study changes in gene expression levels after stimulation with interleukin-1β and bone morphogenetic protein, as well as the dependence on cell differentiation. In situ hybridization with a gene-specific probe was applied to detect mRNA expression levels in fetal growth plate cartilage. Overall, more than 200 significantly regulated genes were detected between normal and osteoarthritic cartilage (P < 0.01). One of the significantly repressed genes, Tob1, encodes a protein belonging to a family involved in silencing cells in terms of proliferation and functional activity. The repression of Tob1 was confirmed by quantitative PCR and correlated to markers of chondrocyte activity and proliferation in vivo. Tob1 expression was also detected at a decreased level in isolated chondrocytes and in the chondrosarcoma cell line HCS-2/8. Again, in these cells it was negatively correlated with proliferative activity and positively with cellular differentiation. Altogether, the downregulation of the expression of Tob1 in osteoarthritic chondrocytes might be an important aspect of the cellular processes taking place during osteoarthritic cartilage degeneration. Activation, the reinitiation of proliferative activity and the loss of a stable phenotype are three major changes in osteoarthritic chondrocytes that are highly significantly correlated with the repression of Tob1 expression. PMID:15743474

  8. Rapid and sensitive PCR-dipstick DNA chromatography for multiplex analysis of the oral microbiota.

    PubMed

    Tian, Lingyang; Sato, Takuichi; Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C R; Takahashi, Nobuhiro

    2014-01-01

    A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

  9. Rapid and Sensitive PCR-Dipstick DNA Chromatography for Multiplex Analysis of the Oral Microbiota

    PubMed Central

    Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C. R.; Takahashi, Nobuhiro

    2014-01-01

    A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases. PMID:25485279

  10. Oligonucleotide-based theranostic nanoparticles in cancer therapy

    PubMed Central

    Shahbazi, Reza; Ozpolat, Bulent; Ulubayram, Kezban

    2016-01-01

    Theranostic approaches, combining the functionality of both therapy and imaging, have shown potential in cancer nanomedicine. Oligonucleotides such as small interfering RNA and microRNA, which are powerful therapeutic agents, have been effectively employed in theranostic systems against various cancers. Nanoparticles are used to deliver oligonucleotides into tumors by passive or active targeting while protecting the oligonucleotides from nucleases in the extracellular environment. The use of quantum dots, iron oxide nanoparticles and gold nanoparticles and tagging with contrast agents, like fluorescent dyes, optical or magnetic agents and various radioisotopes, has facilitated early detection of tumors and evaluation of therapeutic efficacy. In this article, we review the advantages of theranostic applications in cancer therapy and imaging, with special attention to oligonucleotide-based therapeutics. PMID:27102380

  11. Derivatized versions of ligase enzymes for constructing DNA sequences

    DOEpatents

    Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Tucker, James D [Novi, MN; Dzenitis, John M [Livermore, CA; Papavasiliou, Alexandros P [Oakland, CA

    2006-08-15

    A method of making very long, double-stranded synthetic poly-nucleotides. A multiplicity of short oligonucleotides is provided. The short oligonucleotides are sequentially hybridized to each other. Enzymatic ligation of the oligonucleotides provides a contiguous piece of PCR-ready DNA of predetermined sequence.

  12. Voltage-gated calcium channel and antisense oligonucleotides thereto

    NASA Technical Reports Server (NTRS)

    Friedman, Peter A. (Inventor); Duncan, Randall L. (Inventor); Hruska, Keith A. (Inventor); Barry, Elizabeth L. R. (Inventor)

    1998-01-01

    An antisense oligonucleotide of 10 to 35 nucleotides in length that can hybridize with a region of the .alpha..sub.1 subunit of the SA-Cat channel gene DNA or mRNA is provided, together with pharmaceutical compositions containing and methods utilizing such antisense oligonucleotide.

  13. NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A-T phosphoramidite building blocks.

    PubMed

    Schmidtgall, Boris; Höbartner, Claudia; Ducho, Christian

    2015-01-01

    Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T-T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X-T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A-T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues.

  14. Synthesis and hybridization of a series of biotinylated oligonucleotides.

    PubMed Central

    Cook, A F; Vuocolo, E; Brakel, C L

    1988-01-01

    A series of oligonucleotides containing biotin-11-dUMP at various positions were synthesized and compared in quantitative, colorimetric hybridization-detection studies. A deoxyuridine phosphoramidite containing a protected allylamino sidearm was synthesized and used in standard, automated synthesis cycles to prepare oligonucleotides with allylamino residues at various positions within a standard 17-base sequence. Biotin substituents were subsequently attached to the allylamino sidearms by reaction with N-biotinyl-6-aminocaproic acid N-hydroxysuccinimide ester. These oligomers were hybridized to target DNA immobilized on microtiter wells (ELISA plates), and were detected with a streptavidin-biotinylated horseradish peroxidase complex using hydrogen peroxide as substrate and o-phenylenediamine as chromogen. We found that the sensitivity of detection of target DNA by biotin-labeled oligonucleotide probes was strongly dependent upon the position of the biotin label. Oligonucleotides containing biotin labels near or off the ends of the hybridizing sequence were more effective probes than oligonucleotides containing internal biotin labels. An additive effect of increasing numbers of biotin-dUMP residues was found for some labeling configurations. PMID:3375076

  15. Synthesis, properties, and NMR studies of a C8-phenylguanine modified oligonucleotide that preferentially adopts the Z DNA conformation.

    PubMed

    Gannett, Peter M; Heavner, Sue; Daft, Jonathan R; Shaughnessy, Kevin H; Epperson, Jon D; Greenbaum, Nancy L

    2003-10-01

    Carcinogenic aryl hydrazines produce C8-arylated purine adducts. The effect of these adducts on DNA conformation and their role in hydrazine carcinogenesis are unknown. Here, we describe a new synthetic route to produce these adducts that is also compatible with the synthesis of the corresponding phosphoramidites needed for oligonucleotide synthesis. Two oligonucleotides were prepared, an unmodified oligonucleotide, d((5)(')CGCGCGCGCG(3)(')), and a C8-phenylguanine modified oligonucleotide, d((5)(')CGCGCGCGCG(3)(')) (G = 8-phenylguanine). These oligonucleotides were compared using thermal denaturation, circular dichroism, NMR, and molecular modeling. The phenyl modification destabilizes the B DNA form and stabilizes the Z DNA form such that the B:Z ratio is near one under physiological conditions. In light of recent studies that show a role for Z DNA in gene expression and cell transformation, Z DNA stabilization by C8-arylguanine formation from aryl hydrazines may be relevant to their role in carcinogenesis.

  16. [Chromosome banding analysis of peripheral blood lymphocytes stimulated with IL2 and CpG oligonucleotide DSP30 in patients with chronic lymphocytic leukemia].

    PubMed

    Stěpanovská, K; Vaňková, G; Némethová, V; Tomášiková, L; Smuhařová, P; Divíšková, E; Vallová, V; Kuglík, P; Plevová, K; Oltová, A; Doubek, M; Pospíšilová, S; Mayer, J

    2013-01-01

    Chromosomal aberrations play an important role as prognostic factors in chronic lymphocytic leukemia (CLL). These aberrations are mostly detected by fluorescent in situ hybridization (FISH), as chromosomal banding analysis has been scarce due to low proliferative activity of malignant B-lymphocytes in vitro. In 2006, a new method using stimulation with IL-2 and CpG oligonucleotide DSP30 for metaphase generation in CLL was published [1]. The objective of our study was to verify the efficacy of stimulation and to evaluate if the method is suitable for routine diagnostics. In total, peripheral blood samples of 369 CLL patients were analyzed in parallel by chromosomal banding analysis and by FISH probes for 13q14, 11q22-23, CEP12 and 17p13. Out of 369 patients, 307 (83%) were successfully stimulated for metaphase generation. Chromosomal aberrations were detected in 243 (79%) out of 307 patients evaluated by chromosomal banding analysis. Other aberrations that are not included into standard FISH panel were detected in patients karyotypes, e.g. del(6q), del(14q), t(14;18)(q32;q21), t(11;14)(q13;q32) and t(18;22)(q21;q11). One hundred and three (42%) patients showed complex aberrant karyotype not detected by FISH analysis. Stimulation with IL-2 and oligonucleotide DSP30 is an efficient method how to induce proliferation of malignant B-lymphocytes and allows detection of a substantial number of chromosomal aberrations in addition to those detected by standard FISH panel. Using this method in routine diagnostics is helpful particularly in identification of patients with complex aberrant karyotype.

  17. Oligonucleotide recombination in corynebacteria without the expression of exogenous recombinases.

    PubMed

    Krylov, Alexander A; Kolontaevsky, Egor E; Mashko, Sergey V

    2014-10-01

    Brevibacterium lactofermentum and Corynebacterium glutamicum are important biotechnology species of the genus Corynebacterium. The single-strand DNA annealing protein (SSAP)-independent oligonucleotide-mediated recombination procedure was successfully applied to the commonly used wild-type strains B. lactofermentum AJ1511 and C. glutamicum ATCC13032. When the rpsL gene was used as a target, the optimized protocol yielded up to (1.4±0.3)×10(3) and (6.7±1.3)×10(3) streptomycin-resistant colonies per 10(8) viable cells for the corresponding strains. We tested the influence of several parameters that are known to enhance the efficiency of oligonucleotide-mediated recombination in other bacterial species. Among them, increasing the concentration of oligonucleotides and targeting the lagging strand of the chromosome have proven to have positive effects on both of the tested species. No difference in the efficiency of recombination was observed between the oligonucleotides phosphorothiorated at the 5' ends and the unmodified oligonucleotides or between the oligonucleotides with four mutated nucleotides and those with one mutated nucleotide. The described approach demonstrates that during the adaptation of the recombineering technique, testing SSAP-independent oligonucleotide-mediated recombination could be a good starting point. Such testing could decrease the probability of an incorrect interpretation of the effect of exogenous protein factors (such as SSAP and/or corresponding exonucleases) due to non-optimal experimental conditions. In addition, SSAP-independent recombination itself could be useful in combination with suitable selection/enrichment methods. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Degradation product characterization of therapeutic oligonucleotides using liquid chromatography mass spectrometry.

    PubMed

    Elzahar, N M; Magdy, N; El-Kosasy, Amira M; Bartlett, Michael G

    2018-05-01

    Synthetic antisense phosphorothioate oligonucleotides (PS) have undergone rapid development as novel therapeutic agents. The increasing significance of this class of drugs requires significant investment in the development of quality control methods. The determination of the many degradation pathways of such complex molecules presents a significant challenge. However, an understanding of the potential impurities that may arise is necessary to continue to advance these powerful new therapeutics. In this study, four different antisense oligonucleotides representing several generations of oligonucleotide therapeutic agents were evaluated under various stress conditions (pH, thermal, and oxidative stress) using ion-pairing reversed-phase liquid chromatography tandem mass spectrometry (IP-RPLC-MS/MS) to provide in-depth characterization and identification of the degradation products. The oligonucleotide samples were stressed under different pH values at 45 and 90 °C. The main degradation products were observed to be losses of nucleotide moieties from the 3'- and 5'-terminus, depurination, formation of terminal phosphorothioates, and production of ribose, ribophosphorothioates (Rp), and phosphoribophosphorothioates (pRp). Moreover, the effects of different concentrations of hydrogen peroxide were studied resulting in primarily extensive desulfurization and subsequent oxidation of the phosphorothioate linkage to produce the corresponding phosphodiester. The reaction kinetics for the degradation of the oligonucleotides under the different stress conditions were studied and were found to follow pseudo-first-order kinetics. Differences in rates exist even for oligonucleotides of similar length but consisting of different sequences. Graphical abstract Identification of degradation products across several generations of oligonucleotide therapeutics using LC-MS.

  19. 2′-O-[2-[(N,N-dimethylamino)oxy]ethyl]-modified oligonucleotides inhibit expression of mRNA in vitro and in vivo

    PubMed Central

    Prakash, Thazha P.; Johnston, Joseph F.; Graham, Mark J.; Condon, Thomas P.; Manoharan, Muthiah

    2004-01-01

    Synthesis and antisense activity of oligonucleotides modified with 2′-O-[2-[(N,N-dimethylamino)oxy] ethyl] (2′-O-DMAOE) are described. The 2′-O-DMAOE-modified oligonucleotides showed superior metabolic stability in mice. The phosphorothioate oligonucleotide ‘gapmers’, with 2′-O-DMAOE- modified nucleoside residues at the ends and 2′-deoxy nucleosides residues in the central region, showed dose-dependent inhibition of mRNA expression in cell culture for two targets. ‘Gapmer’ oligonucleotides have one or two 2′-O-modified regions and a 2′-deoxyoligonucleotide phosphorothioate region that allows RNase H digestion of target mRNA. To determine the in vivo potency and efficacy, BalbC mice were treated with 2′-O-DMAOE gapmers and a dose-dependent reduction in the targeted C-raf mRNA expression was observed. Oligonucleotides with 2′-O-DMAOE modifications throughout the sequences reduced the intercellular adhesion molecule-1 (ICAM-1) protein expression very efficiently in HUVEC cells with an IC50 of 1.8 nM. The inhibition of ICAM-1 protein expression by these uniformly modified 2′-O-DMAOE oligonucleotides may be due to selective interference with the formation of the translational initiation complex. These results demonstrate that 2′-O-DMAOE- modified oligonucleotides are useful for antisense-based therapeutics when either RNase H-dependent or RNase H-independent target reduction mechanisms are employed. PMID:14762210

  20. Derivation of Tissue-specific Functional Gene Sets to Aid Transcriptomic Analysis of Chemical Impacts on the Teleost Reproductive Axis.

    EPA Science Inventory

    Oligonucleotide microarrays are a powerful tool for unsupervised analysis of chemical impacts on biological systems. However, the lack of well annotated biological pathways for many aquatic organisms, including fish, and the poor power of microarray-based analyses to detect diffe...

  1. A fluorescent radioiodinated oligonucleotidic photoaffinity probe for protein labeling: synthesis and photolabeling of thrombin.

    PubMed

    Berens, C; Courtoy, P J; Sonveaux, E

    1999-01-01

    To study the interactions between oligonucleotides and proteins, an original photoaffinity radiolabeling probe has been synthesized. Starting with a 5'-pyridyldithio-3'-amino-oligonucleotide, the photophore benzophenone was first coupled to the 3' end, through acylation by an activated ester of benzoylbenzoic acid. A fluorescein molecule was grafted by alkylation of the free 5'-SH. This compound was finally radiolabeled with 125I using IodoBeads. The selective photolabeling of thrombin in a complex protein mixture by the radioiodinated probe validates this strategy to identify oligonucleotide-binding proteins.

  2. Synthesis of high quality phosphorothioate oligonucleotides as antisense drugs. Use of I-linker in the elimination of 3'-terminal phosphorothioate monoesters.

    PubMed

    Ravikumar, Vasulinga T; Kumar, R Krishna; Capaldi, Daniel C; Cole, Douglas L

    2003-01-01

    Detritylation of a 5'-O-DMT-2'-deoxyadenosine moiety attached to solid support under acidic condition leads to depurination during oligonucleotide synthesis. Deprotection followed by reversed phase HPLC purification leads to desired oligonucleotide contaminated with significant levels of 3'-terminal phosphorothiaote (3'-TPT) monoester (n-1)-mer. However, it is demonstrated that attachment of dA nucleoside through its exocyclic amino group to solid support leads to substantial reduction of 3'-TPT formation thereby improving the quality of oligonucleotide synthesized.

  3. The Use of Gel Electrophoresis to Study the Reactions of Activated Amino Acids with Oligonucleotides

    NASA Technical Reports Server (NTRS)

    Zieboll, Gerhard; Orgel, Leslie E.

    1994-01-01

    We have used gel electrophoresis to study the primary covalent addition of amino acids to oligonu-cleotides or their analogs and the subsequent addition of further molecules of the amino acids to generate peptides covalently linked to the oligonucleotides. We have surveyed the reactions of a variety of amino acids with the phosphoramidates derived from oligonucleotide 5 inches phosphates and ethylenediamine. We find that arginine and amino acids can interact with oligonucleotidesl through stacking interactions react most efficiently. D- and L-amino acids give indistinguishable families of products.

  4. Methods for immobilizing nucleic acids on a gel substrate

    DOEpatents

    Mirzabekov, Andrei Darievich; Proudnikov, Dimitri Y.; Timofeev, Edward N.; Kochetkova, Svetlana V.; Florentiev, Vladimir L.; Shick, Valentine V.

    1999-01-01

    A method for labeling oligonucleotide molecules, and for immobilizing oligonucleotide and DNA molecules is provided comprising modifying the molecules to create a chemically active group, and contacting activated fluorescent dyes to the region. A method for preparing an immobilization substrate is also provided comprising modifying a gel to contain desired functional groups which covalently interact with certain moieties of the oligonucleotide molecules. A method for immobilizing biomolecules and other molecules within a gel by copolymerization of allyl-substituted oligonucleotides, DNA and proteins with acrylamide is also provided.

  5. Method for promoting specific alignment of short oligonucleotides on nucleic acids

    DOEpatents

    Studier, F. William; Kieleczawa, Jan; Dunn, John J.

    1996-01-01

    Disclosed is a method for promoting specific alignment of short oligonucleotides on a nucleic acid polymer. The nucleic acid polymer is incubated in a solution containing a single-stranded DNA-binding protein and a plurality of oligonucleotides which are perfectly complementary to distinct but adjacent regions of a predetermined contiguous nucleotide sequence in the nucleic acid polymer. The plurality of oligonucleotides anneal to the nucleic acid polymer to form a contiguous region of double stranded nucleic acid. Specific application of the methods disclosed include priming DNA synthesis and template-directed ligation.

  6. Synthetic Method for Oligonucleotide Block by Using Alkyl-Chain-Soluble Support.

    PubMed

    Matsuno, Yuki; Shoji, Takao; Kim, Shokaku; Chiba, Kazuhiro

    2016-02-19

    A straightforward method for the synthesis of oligonucleotide blocks using a Cbz-type alkyl-chain-soluble support (Z-ACSS) attached to the 3'-OH group of 3'-terminal nucleosides was developed. The Z-ACSS allowed for the preparation of fully protected deoxyribo- and ribo-oligonucleotides without chromatographic purification and released dimer- to tetramer-size oligonucleotide blocks via hydrogenation using a Pd/C catalyst without significant loss or migration of protective groups such as 5'-end 4,4'-dimethoxtrityl, 2-cyanoethyl on internucleotide bonds, or 2'-TBS.

  7. Quantitative surface-enhanced resonance Raman scattering of phthalocyanine-labelled oligonucleotides

    PubMed Central

    Macaskill, A.; Chernonosov, A. A.; Koval, V. V.; Lukyanets, E. A.; Fedorova, O. S.; Smith, W. E.; Faulds, K.; Graham, D.

    2007-01-01

    The evaluation of phthalocyanine labels for the surface-enhanced resonance Raman scattering (SERRS) detection of oligonucleotides is reported. Three phthalocyanine-labelled oligonucleotides were assessed, each containing a different metal centre. Detection limits for each labelled oligonucleotide were determined using two excitation frequencies where possible. Limits of detection as low as 2.8 × 10−11 mol. dm−3 were obtained which are comparable to standard fluorescently labelled probes used in previous SERRS studies. The identification of two phthalocyanine-labelled oligonucleotides without separation was also demonstrated indicating their suitability for multiplexing. This study extends the range of labels suitable for quantitative surface-enhanced resonance Raman scattering with silver nanoparticles and offers more flexibility and choice when considering SERRS for quantitative DNA detection. PMID:17289751

  8. Oligonucleotide-based biosensors for in vitro diagnostics and environmental hazard detection.

    PubMed

    Jung, Il Young; Lee, Eun Hee; Suh, Ah Young; Lee, Seung Jin; Lee, Hyukjin

    2016-04-01

    Oligonucleotide-based biosensors have drawn much attention because of their broad applications in in vitro diagnostics and environmental hazard detection. They are particularly of interest to many researchers because of their high specificity as well as excellent sensitivity. Recently, oligonucleotide-based biosensors have been used to achieve not only genetic detection of targets but also the detection of small molecules, peptides, and proteins. This has further broadened the applications of these sensors in the medical and health care industry. In this review, we highlight various examples of oligonucleotide-based biosensors for the detection of diseases, drugs, and environmentally hazardous chemicals. Each example is provided with detailed schematics of the detection mechanism in addition to the supporting experimental results. Furthermore, future perspectives and new challenges in oligonucleotide-based biosensors are discussed.

  9. Specific Discrimination of Three Pathogenic Salmonella enterica subsp. enterica Serotypes by carB-Based Oligonucleotide Microarray

    PubMed Central

    Shin, Hwa Hui; Hwang, Byeong Hee; Seo, Jeong Hyun

    2014-01-01

    It is important to rapidly and selectively detect and analyze pathogenic Salmonella enterica subsp. enterica in contaminated food to reduce the morbidity and mortality of Salmonella infection and to guarantee food safety. In the present work, we developed an oligonucleotide microarray containing duplicate specific capture probes based on the carB gene, which encodes the carbamoyl phosphate synthetase large subunit, as a competent biomarker evaluated by genetic analysis to selectively and efficiently detect and discriminate three S. enterica subsp. enterica serotypes: Choleraesuis, Enteritidis, and Typhimurium. Using the developed microarray system, three serotype targets were successfully analyzed in a range as low as 1.6 to 3.1 nM and were specifically discriminated from each other without nonspecific signals. In addition, the constructed microarray did not have cross-reactivity with other common pathogenic bacteria and even enabled the clear discrimination of the target Salmonella serotype from a bacterial mixture. Therefore, these results demonstrated that our novel carB-based oligonucleotide microarray can be used as an effective and specific detection system for S. enterica subsp. enterica serotypes. PMID:24185846

  10. Specific discrimination of three pathogenic Salmonella enterica subsp. enterica serotypes by carB-based oligonucleotide microarray.

    PubMed

    Shin, Hwa Hui; Hwang, Byeong Hee; Seo, Jeong Hyun; Cha, Hyung Joon

    2014-01-01

    It is important to rapidly and selectively detect and analyze pathogenic Salmonella enterica subsp. enterica in contaminated food to reduce the morbidity and mortality of Salmonella infection and to guarantee food safety. In the present work, we developed an oligonucleotide microarray containing duplicate specific capture probes based on the carB gene, which encodes the carbamoyl phosphate synthetase large subunit, as a competent biomarker evaluated by genetic analysis to selectively and efficiently detect and discriminate three S. enterica subsp. enterica serotypes: Choleraesuis, Enteritidis, and Typhimurium. Using the developed microarray system, three serotype targets were successfully analyzed in a range as low as 1.6 to 3.1 nM and were specifically discriminated from each other without nonspecific signals. In addition, the constructed microarray did not have cross-reactivity with other common pathogenic bacteria and even enabled the clear discrimination of the target Salmonella serotype from a bacterial mixture. Therefore, these results demonstrated that our novel carB-based oligonucleotide microarray can be used as an effective and specific detection system for S. enterica subsp. enterica serotypes.

  11. Mode of inheritance and evidence for cistron heterogeneity of chloroplast 16S ribosomal RNA genes in Nicotiana.

    PubMed

    Vacek, A T; Bourque, D P

    1980-09-01

    Oligonucleotide maps (fingerprints) of T1 RNase digests of 125I-labeled 16 S chloroplast rRNA of Nicotiana tabacum and N. gossei revealed the presence of T1 oligonucleotide fragment 100 in the 16 S rRNA of N. gossei while N. tabacum 16 S rRNA had a unique T1 oligonucleotide (fragment 101) as well as some fragment 100. From the positions in the fingerprints and from fingerprints of secondary enzymatic digestion of the fragments, we conclude that fragments 100 and 101 are similar in sequence and size, but fragment 100 probably contains an extra uracil residue. This difference is shown to be maternally inherited, thus confirming the location of 16 S chloroplast rRNA genes on chloroplast DNA and ruling out the possibility of genetically active chloroplast rRNA genes in the nucleus. The presence of both fragments 100 and 101 in N. tabacum may indicate sequence heterogeneity between the two cistrons for 16 S chloroplast rRNA. These results demonstrate the feasibility of determining the inheritance of organelle genes by genetic analysis of their primary transcripts.

  12. Optimized synthesis of phosphorothioate oligodeoxyribonucleotides substituted with a 5′-protected thiol function and a 3′-amino group

    PubMed Central

    Aubert, Yves; Bourgerie, Sylvain; Meunier, Laurent; Mayer, Roger; Roche, Annie-Claude; Monsigny, Michel; Thuong, Nguyen T.; Asseline, Ulysse

    2000-01-01

    A new deprotection procedure enables a medium scale preparation of phosphodiester and phosphorothioate oligonucleotides substituted with a protected thiol function at their 5′-ends and an amino group at their 3′-ends in good yield (up to 72 OD units/µmol for a 19mer phosphorothioate). Syntheses of 3′-amino-substituted oligonucleotides were carried out on a modified support. A linker containing the thioacetyl moiety was manually coupled in two steps by first adding its phosphoramidite derivative in the presence of tetrazole followed by either oxidation or sulfurization to afford the bis-derivatized oligonucleotide bound to the support. Deprotection was achieved by treating the fully protected oligonucleotide with a mixture of 2,2′-dithiodipyridine and concentrated aqueous ammonia in the presence of phenol and methanol. This procedure enables (i) cleavage of the oligonucleotide from the support, releasing the oligonucleotide with a free amino group at its 3′-end, (ii) deprotection of the phosphate groups and the amino functions of the nucleic bases, as well as (iii) transformation of the 5′-terminal S-acetyl function into a dithiopyridyl group. The bis-derivatized phosphorothioate oligomer was further substituted through a two-step procedure: first, the 3′-amino group was reacted with fluorescein isothiocyanate to yield a fluoresceinylated oligonucleotide; the 5′-dithiopyridyl group was then quantitatively reduced to give a free thiol group which was then substituted by reaction with an Nα-bromoacetyl derivative of a signal peptide containing a KDEL sequence to afford a fluoresceinylated peptide–oligonucleotide conjugate. PMID:10637335

  13. STAT3 Oligonucleotide Inhibits Tumor Angiogenesis in Preclinical Models of Squamous Cell Carcinoma

    PubMed Central

    Klein, Jonah D.; Sano, Daisuke; Sen, Malabika; Myers, Jeffrey N.; Grandis, Jennifer R.; Kim, Seungwon

    2014-01-01

    Purpose Signal transducer and activator of transcription 3 (STAT3) has shown to play a critical role in head and neck squamous cell carcinoma (HNSCC) and we have recently completed clinical trials of STAT3 decoy oligonucleotide in patients with recurrent or metastatic HNSCC. However, there is limited understanding of the role of STAT3 in modulating other aspects of tumorigenesis such as angiogenesis. In this study, we aimed to examine the effects of STAT3 decoy oligonucleotide on tumor angiogenesis. Experimental Design A STAT3 decoy oligonucleotide and small interfering RNA (siRNA) were used to inhibit STAT3 in endothelial cells in vitro and in vivo. The biochemical effects of STAT3 inhibition were examined in conjunction with the consequences on proliferation, migration, apoptotic staining, and tubule formation. Additionally, we assessed the effects of STAT3 inhibition on tumor angiogenesis using murine xenograft models. Results STAT3 decoy oligonucleotide decreased proliferation, induces apoptosis, decreased migration, and decreased tubule formation of endothelial cells in vitro. The STAT3 decoy oligonucleotide also inhibited tumor angiogenesis in murine tumor xenografts. Lastly, our data suggest that the antiangiogenic effects of STAT3 decoy oligonucleotide were mediatedthrough the inhibition of both STAT3 and STAT1. Conclusions The STAT3 decoy oligonucleotidewas found to be an effective antiangiogenic agent, which is likely to contribute to the overall antitumor effects of this agent in solid tumors.Taken together with the previously demonstrated antitumor activity of this agent, STAT3 decoy oligonucleotide represents a promising single agent approach to targeting both the tumor and vascular compartments in various malignancies. PMID:24404126

  14. The identification and characterization of non-coding and coding RNAs and their modified nucleosides by mass spectrometry

    PubMed Central

    Gaston, Kirk W; Limbach, Patrick A

    2014-01-01

    The analysis of ribonucleic acids (RNA) by mass spectrometry has been a valuable analytical approach for more than 25 years. In fact, mass spectrometry has become a method of choice for the analysis of modified nucleosides from RNA isolated out of biological samples. This review summarizes recent progress that has been made in both nucleoside and oligonucleotide mass spectral analysis. Applications of mass spectrometry in the identification, characterization and quantification of modified nucleosides are discussed. At the oligonucleotide level, advances in modern mass spectrometry approaches combined with the standard RNA modification mapping protocol enable the characterization of RNAs of varying lengths ranging from low molecular weight short interfering RNAs (siRNAs) to the extremely large 23 S rRNAs. New variations and improvements to this protocol are reviewed, including top-down strategies, as these developments now enable qualitative and quantitative measurements of RNA modification patterns in a variety of biological systems. PMID:25616408

  15. Detection of target-probe oligonucleotide hybridization using synthetic nanopore resistive pulse sensing.

    PubMed

    Booth, Marsilea Adela; Vogel, Robert; Curran, James M; Harbison, SallyAnn; Travas-Sejdic, Jadranka

    2013-07-15

    Despite the plethora of DNA sensor platforms available, a portable, sensitive, selective and economic sensor able to rival current fluorescence-based techniques would find use in many applications. In this research, probe oligonucleotide-grafted particles are used to detect target DNA in solution through a resistive pulse nanopore detection technique. Using carbodiimide chemistry, functionalized probe DNA strands are attached to carboxylated dextran-based magnetic particles. Subsequent incubation with complementary target DNA yields a change in surface properties as the two DNA strands hybridize. Particle-by-particle analysis with resistive pulse sensing is performed to detect these changes. A variable pressure method allows identification of changes in the surface charge of particles. As proof-of-principle, we demonstrate that target hybridization is selectively detected at micromolar concentrations (nanomoles of target) using resistive pulse sensing, confirmed by fluorescence and phase analysis light scattering as complementary techniques. The advantages, feasibility and limitations of using resistive pulse sensing for sample analysis are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. The identification and characterization of non-coding and coding RNAs and their modified nucleosides by mass spectrometry.

    PubMed

    Gaston, Kirk W; Limbach, Patrick A

    2014-01-01

    The analysis of ribonucleic acids (RNA) by mass spectrometry has been a valuable analytical approach for more than 25 years. In fact, mass spectrometry has become a method of choice for the analysis of modified nucleosides from RNA isolated out of biological samples. This review summarizes recent progress that has been made in both nucleoside and oligonucleotide mass spectral analysis. Applications of mass spectrometry in the identification, characterization and quantification of modified nucleosides are discussed. At the oligonucleotide level, advances in modern mass spectrometry approaches combined with the standard RNA modification mapping protocol enable the characterization of RNAs of varying lengths ranging from low molecular weight short interfering RNAs (siRNAs) to the extremely large 23 S rRNAs. New variations and improvements to this protocol are reviewed, including top-down strategies, as these developments now enable qualitative and quantitative measurements of RNA modification patterns in a variety of biological systems.

  17. Improved strategies for postoligomerization synthesis of oligodeoxynucleotides bearing structurally defined adducts at the N2 position of deoxyguanosine.

    PubMed

    DeCorte, B L; Tsarouhtsis, D; Kuchimanchi, S; Cooper, M D; Horton, P; Harris, C M; Harris, T M

    1996-01-01

    Improved methodology has been developed for preparation of oligodeoxynucleotides bearing adducts on the N2 position of guanine in which the adduction reaction is carried out in homogeneous solution rather than while the oligonucleotide is immobilized on a solid matrix. The methodology utilizes a new synthon, 2-fluoro-O6-(trimethylsilylethyl)-2'-deoxyinosine (3). Nucleoside 3 is stable to the conditions of oligonucleotide synthesis, but the O6 protection is eliminated under very mild conditions following displacement of the 2-fluoro group by amine nucleophiles. Oligonucleotides containing 3 could be removed from the solid support by treatment with 0.1 M NaOH (8 h, rt) without disruption of 3. Reaction of the crude, partially deprotected oligonucleotide with (R)-2-amino-2-phenylethanol in homogeneous solution, followed by removal of the remaining protective groups with NH4OH (60 degrees C, 8 h) and then 0.1% acetic acid, gave the adducted oligonucleotide in good purity and yield. Alternatively, fully deprotected oligonucleotide containing 3 could be prepared by use of labile phenoxyacetyl-type protecting groups on the exocyclic amino groups.

  18. Detection with synthetic oligonucleotide probes of nucleotide sequence variations in the genes encoding enterotoxins of Escherichia coli.

    PubMed Central

    Nishibuchi, M; Murakami, A; Arita, M; Jikuya, H; Takano, J; Honda, T; Miwatani, T

    1989-01-01

    We examined variations in the genes encoding heat-stable enterotoxin (ST) and heat-labile enterotoxin (LT) in 88 strains of Escherichia coli isolated from individuals with traveler's diarrhea to find suitable sequences for use as oligonucleotide probes. Four oligonucleotide probes of the gene encoding ST of human origin (STIb or STh), one oligonucleotide probe of the gene encoding ST of porcine origin (STIa or STp), and three oligonucleotide probes of the gene encoding LT of human origin (LTIh) were used in DNA colony hybridization tests. In 15 of 22 strains possessing the STh gene and 28 of 42 strains producing LT, the sequences of all regions tested were identical to the published sequences. One region in the STh gene examined with a 18-mer probe was relatively well conserved and was shown to be closely associated with the enterotoxicity of the E. coli strains in suckling mice. This oligonucleotide, however, hybridized with strains of Vibrio cholerae O1, V. parahaemolyticus, and Yersinia enterocolitica that gave negative results in the suckling mouse assay. PMID:2685027

  19. Circular DNA by "Bis-Click" Ligation: Template-Independent Intramolecular Circularization of Oligonucleotides with Terminal Alkynyl Groups Utilizing Bifunctional Azides.

    PubMed

    Yang, Haozhe; Seela, Frank

    2016-01-22

    A highly effective and convenient "bis-click" strategy was developed for the template-independent circularization of single-stranded oligonucleotides by employing copper(I)-assisted azide-alkyne cycloaddition. Terminal triple bonds were incorporated at both ends of linear oligonucleotides. Alkynylated 7-deaza-2'-deoxyadenosine and 2'-deoxyuridine residues with different side chains were used in solid-phase synthesis with phosphoramidite chemistry. The bis-click ligation of linear 9- to 36-mer oligonucleotides with 1,4-bis(azidomethyl)benzene afforded circular DNA in a simple and selective way; azido modification of the oligonucleotide was not necessary. Short ethynyl side chains were compatible with the circularization of longer oligonucleotides, whereas octadiynyl residues were used for short 9-mers. Compared with linear duplexes, circular bis-click constructs exhibit a significantly increased duplex stability over their linear counterparts. The intramolecular bis-click ligation protocol is not limited to DNA, but may also be suitable for the construction of other macrocycles, such as circular RNAs, peptides, or polysaccharides. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. DNA - peptide polyelectrolyte complexes: Phase control by hybridization

    NASA Astrophysics Data System (ADS)

    Vieregg, Jeffrey; Lueckheide, Michael; Marciel, Amanda; Leon, Lorraine; Tirrell, Matthew

    DNA is one of the most highly-charged molecules known, and interacts strongly with charged molecules in the cell. Condensation of long double-stranded DNA is one of the classic problems of biophysics, but the polyelectrolyte behavior of short and/or single-stranded nucleic acids has attracted far less study despite its importance for both biological and engineered systems. We report here studies of DNA oligonucleotides complexed with cationic peptides and polyamines. As seen previously for longer sequences, double-stranded oligonucleotides form solid precipitates, but single-stranded oligonucleotides instead undergo liquid-liquid phase separation to form coacervate droplets. Complexed oligonucleotides remain competent for hybridization, and display sequence-dependent environmental response. We observe similar behavior for RNA oligonucleotides, and methylphosphonate substitution of the DNA backbone indicates that nucleic acid charge density controls whether liquid or solid complexes are formed. Liquid-liquid phase separations of this type have been implicated in formation of membraneless organelles in vivo, and have been suggested as protocells in early life scenarios; oligonucleotides offer an excellent method to probe the physics controlling these phenomena.

  1. Exploring optimization parameters to increase ssDNA recombineering in Lactococcus lactis and Lactobacillus reuteri

    PubMed Central

    van Pijkeren, Jan-Peter; Neoh, Kar Mun; Sirias, Denise; Findley, Anthony S.; Britton, Robert A.

    2012-01-01

    Single-stranded DNA (ssDNA) recombineering is a technology which is used to make subtle changes in the chromosome of several bacterial genera. Cells which express a single-stranded DNA binding protein (RecT or Bet) are transformed with an oligonucleotide which is incorporated via an annealing and replication-dependent mechanism. By in silico analysis we identified ssDNA binding protein homologs in the genus Lactobacillus and Lactococcus lactis. To assess whether we could further improve the recombineering efficiency in Lactobacillus reuteri ATCC PTA 6475 we expressed several RecT homologs in this strain. RecT derived from Enterococcus faecalis CRMEN 19 yielded comparable efficiencies compared with a native RecT protein, but none of the other proteins further increased the recombineering efficiency. We successfully improved recombineering efficiency 10-fold in L. lactis by increasing oligonucleotide concentration combined with the use of oligonucleotides containing phosphorothioate-linkages (PTOs). Surprisingly, neither increased oligonucleotide concentration nor PTO linkages enhanced recombineering in L. reuteri 6475. To emphasize the utility of this technology in improving probiotic features we modified six bases in a transcriptional regulatory element region of the pdu-operon of L. reuteri 6475, yielding a 3-fold increase in the production of the antimicrobial compound reuterin. Directed genetic modification of lactic acid bacteria through ssDNA recombineering will simplify strain improvement in a way that, when mutating a single base, is genetically indistinguishable from strains obtained through directed evolution. PMID:22750793

  2. Fundamental mechanisms of DNA radiosensitization: damage induced by low-energy electrons in brominated oligonucleotide trimers.

    PubMed

    Park, Yeunsoo; Polska, Katarzyna; Rak, Janusz; Wagner, J Richard; Sanche, Léon

    2012-08-16

    The replacement of nucleobases with brominated analogs enhances DNA radiosensitivity. We examine the chemistry of low-energy electrons (LEEs) in this sensitization process by experiments with thin films of the oligonucleotide trimers TBrXT, where BrX = 5-BrU (5-bromouracil), 5-BrC (5-bromocytosine), 8-BrA (8-bromoadenine), or 8-BrG (8-bromoguanine). The products induced from irradiation of thin (∼ 2.5 nm) oligonucleotide films, with 10 eV electrons, under ultrahigh vacuum (UHV) are analyzed by HPLC-UV. The number of damaged brominated trimers ranges from about 12 to 15 × 10(-3) molecules per incident electron, whereas under the identical conditions, these numbers drop to 4-7 × 10(-3) for the same, but nonbrominated oligonucleotides. The results of HPLC analysis show that the main degradation pathway of trinucleotides containing brominated bases involve debromination (i.e., loss of the bromine atom and its replacement with a hydrogen atom). The electron-induced sum of products upon bromination increases by factors of 2.1 for the pyrimidines and 3.2 for the purines. Thus, substitution of any native nucleobase with a brominated one in simple models of DNA increases LEE-induced damage to DNA and hence its radiosensitivity. Furthermore, besides the brominated pyrimidines that have already been tested in clinical trials, brominated purines not only appear to be promising sensitizers for radiotherapy, but could provide a higher degree of radiosensitization.

  3. Rapid method to detect duplex formation in sequencing by hybridization methods

    DOEpatents

    Mirzabekov, A.D.; Timofeev, E.N.; Florentiev, V.L.; Kirillov, E.V.

    1999-01-19

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided. A plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex. Each duplex facilitates intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface and exposing the light-sensitive fluid to a light pattern. This causes the fluid exposed to the light to coalesce into discrete units and adhere to the surface. This places each of the units in contact with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units. 13 figs.

  4. In situ oligonucleotide synthesis on poly(dimethylsiloxane): a flexible substrate for microarray fabrication

    PubMed Central

    Moorcroft, Matthew J.; Meuleman, Wouter R. A.; Latham, Steven G.; Nicholls, Thomas J.; Egeland, Ryan D.; Southern, Edwin M.

    2005-01-01

    In this paper, we demonstrate in situ synthesis of oligonucleotide probes on poly(dimethylsiloxane) (PDMS) microchannels through use of conventional phosphoramidite chemistry. PDMS polymer was moulded into a series of microchannels using standard soft lithography (micro-moulding), with dimensions <100 μm. The surface of the PDMS was derivatized by exposure to ultraviolet/ozone followed by vapour phase deposition of glycidoxypropyltrimethoxysilane and reaction with poly(ethylene glycol) spacer, resulting in a reactive surface for oligonucleotide coupling. High, reproducible yields were achieved for both 6mer and 21mer probes as assessed by hybridization to fluorescent oligonucleotides. Oligonucleotide surface density was comparable with that obtained on glass substrates. These results suggest PDMS as a stable and flexible alternative to glass as a suitable substrate in the fabrication and synthesis of DNA microarrays. PMID:15870385

  5. NMR of enzymatically synthesized uniformly 13C15N-labeled DNA oligonucleotides.

    PubMed Central

    Zimmer, D P; Crothers, D M

    1995-01-01

    A procedure for the enzymatic synthesis of uniformly 13C15N-labeled DNA oligonucleotides in milligram quantities for NMR studies is described. Deoxynucleotides obtained from microorganisms grown on 13C and 15N nutrient sources are enzymatically phosphorylated to dNTPs, and the dNTPs are incorporated into oligonucleotides using a 3'-5' exonuclease-deficient mutant of Klenow fragment of DNA polymerase I and an oligonucleotide template primer designed for efficient separation of labeled product DNA from unlabeled template. The labeling strategy has been used to uniformly label one or the other oligonucleotide strand in the DNA duplex dGGCAAAACGG.dCCGTTTTGCC in order to facilitate assignment and structure determination by NMR. Application of 15N and 13C heteronuclear NMR experiments to isotopically labeled DNA is presented. Images Fig. 2 Fig. 3 Fig. 4 PMID:7724521

  6. Rapid method to detect duplex formation in sequencing by hybridization methods

    DOEpatents

    Mirzabekov, Andrei Darievich; Timofeev, Edward Nikolaevich; Florentiev, Vladimer Leonidovich; Kirillov, Eugene Vladislavovich

    1999-01-01

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to coalesce into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

  7. Tritium labeling of antisense oligonucleotides by exchange with tritiated water.

    PubMed Central

    Graham, M J; Freier, S M; Crooke, R M; Ecker, D J; Maslova, R N; Lesnik, E A

    1993-01-01

    We describe a simple, efficient, procedure for labeling oligonucleotides to high specific activity (< 1 x 10(8) cpm/mumol) by hydrogen exchange with tritiated water at the C8 positions of purines in the presence of beta-mercaptoethanol, an effective radical scavenger. Approximately 90% of the starting material is recovered as intact, labeled oligonucleotide. The radiolabeled compounds are stable in biological systems; greater than 90% of the specific activity is retained after 72 hr incubation at 37 degrees C in serum-containing media. Data obtained from in vitro cellular uptake experiments using oligonucleotides labeled by this method are similar to those obtained using 35S or 14C-labeled compounds. Because this protocol is solely dependent upon the existence of purine residues, it should be useful for radiolabeling modified as well as unmodified phosphodiester oligonucleotides. Images PMID:8367289

  8. Cytogenetic analysis of CpG-oligonucleotide DSP30 plus Interleukin-2-Stimulated canine B-Cell lymphoma cells reveals the loss of one X Chromosome as the sole abnormality.

    PubMed

    Reimann-Berg, N; Murua Escobar, H; Kiefer, Y; Mischke, R; Willenbrock, S; Eberle, N; Nolte, I; Bullerdiek, J

    2011-01-01

    Human and canine lymphoid neoplasms are characterized by non-random cytogenetic abnormalities. However, due to the low mitotic activity of the B cells, cytogenetic analyses of B-cell lymphoid proliferations are difficult to perform. In the present study we stimulated canine B-cell lymphoma cells with the immunostimulatory CpG-oligonucleotide DSP30 in combination with interleukin-2 (IL-2) and obtained an adequate number of metaphases. Cytogenetic analyses revealed the loss of one X chromosome as the sole cytogenetic aberration. Chromosome analysis of the corresponding blood showed a normal female karyotype. Monosomy X as the sole clonal chromosomal abnormality is found in human hematopoietic malignancies as well, thus the dog may serve as a promising animal model. Copyright © 2011 S. Karger AG, Basel.

  9. Gallium-68-labelled NOTA-oligonucleotides: an optimized method for their preparation.

    PubMed

    Gijs, Marlies; Dammicco, Sylvestre; Warnier, Corentin; Aerts, An; Impens, Nathalie R E N; D'Huyvetter, Matthias; Léonard, Marc; Baatout, Sarah; Luxen, André

    2016-02-01

    One of the most essential aspects to the success of radiopharmaceuticals is an easy and reliable radiolabelling protocol to obtain pure and stable products. In this study, we optimized the bioconjugation and gallium-68 ((68) Ga) radiolabelling conditions for a single-stranded 40-mer DNA oligonucleotide, in order to obtain highly pure and stable radiolabelled oligonucleotides. Quantitative bioconjugation was obtained for a disulfide-functionalized oligonucleotide conjugated to the macrocylic bifunctional chelator MMA-NOTA (maleimido-mono-amide (1,4,7-triazanonane-1,4,7-triyl)triacetic acid). Next, this NOTA-oligonucleotide bioconjugate was radiolabelled at room temperature with purified and pre-concentrated (68) Ga with quantitative levels of radioactive incorporation and high radiochemical and chemical purity. In addition, high chelate stability was observed in physiological-like conditions (37 °C, PBS and serum), in the presence of a transchelator (EDTA) and transferrin. A specific activity of 51.1 MBq/nmol was reached using a 1470-fold molar excess bioconjugate over (68) Ga. This study presents a fast, straightforward and reliable protocol for the preparation of (68) Ga-radiolabelled DNA oligonucleotides under mild reaction conditions and without the use of organic solvents. The methodology herein developed will be applied to the preparation of oligonucleotidic sequences (aptamers) targeting the human epidermal growth factor receptor 2 (HER2) for cancer imaging. Copyright © 2015 John Wiley & Sons, Ltd.

  10. In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

    PubMed

    Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

    1996-03-01

    In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

  11. Angubindin-1 opens the blood-brain barrier in vivo for delivery of antisense oligonucleotide to the central nervous system.

    PubMed

    Zeniya, Satoshi; Kuwahara, Hiroya; Daizo, Kaiichi; Watari, Akihiro; Kondoh, Masuo; Yoshida-Tanaka, Kie; Kaburagi, Hidetoshi; Asada, Ken; Nagata, Tetsuya; Nagahama, Masahiro; Yagi, Kiyohito; Yokota, Takanori

    2018-05-17

    Within the field of RNA therapeutics, antisense oligonucleotide-based therapeutics are a potentially powerful means of treating intractable diseases. However, if these therapeutics are used for the treatment of neurological disorders, safe yet efficient methods of delivering antisense oligonucleotides across the blood-brain barrier to the central nervous system must be developed. Here, we examined the use of angubindin-1, a binder to the tricellular tight junction, to modulate paracellular transport between brain microvascular endothelial cells in the blood-brain barrier for the delivery of antisense oligonucleotides to the central nervous system. This proof-of-concept study demonstrated that intravenously injected angubindin-1 increased the permeability of the blood-brain barrier and enabled transient delivery of subsequently administered antisense oligonucleotides into the mouse brain and spinal cord, leading to silencing of a target RNA without any overt adverse effects. We also found that two bicellular tight junction modulators did not produce such a silencing effect, suggesting that the tricellular tight junction is likely a better target for the delivery of antisense oligonucleotides than the bicellular tight junction. Our delivery strategy of modulating the tricellular tight junction in the blood-brain barrier via angubindin-1 provides a novel avenue of research for the development of antisense oligonucleotide-based therapeutics for the treatment of neurological disorders. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  12. Analysis of large-scale gene expression data.

    PubMed

    Sherlock, G

    2000-04-01

    The advent of cDNA and oligonucleotide microarray technologies has led to a paradigm shift in biological investigation, such that the bottleneck in research is shifting from data generation to data analysis. Hierarchical clustering, divisive clustering, self-organizing maps and k-means clustering have all been recently used to make sense of this mass of data.

  13. A Graphical Systems Model and Tissue-specific Functional Gene Sets to Aid Transcriptomic Analysis of Chemical Impacts on the Female Teleost Reproductive Axis

    EPA Science Inventory

    Oligonucleotide microarrays and other ‘omics’ approaches are powerful tools for unsupervised analysis of chemical impacts on biological systems. However, the lack of well annotated biological pathways for many aquatic organisms, including fish, and the poor power of microarray-b...

  14. Gene Silencing by Gold Nanoshell-Mediated Delivery and Laser-Triggered Release of Antisense Oligonucleotide and siRNA

    PubMed Central

    Huschka, Ryan; Barhoumi, Aoune; Liu, Qing; Roth, Jack A.; Ji, Lin; Halas, Naomi J.

    2013-01-01

    The approach of RNA interference (RNAi)- using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein- is very useful in dissecting genetic function and holds significant promise as a molecular therapeutic. A major obstacle in achieving gene silencing with RNAi technology is the systemic delivery of therapeutic oligonucleotides. Here we demonstrate an engineered gold nanoshell (NS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer covalently attached to the NS surface (NS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotides, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. Controlled release of the captured therapeutic oligonucleotides in each case is accomplished by continuous wave NIR laser irradiation at 800 nm, near the resonance wavelength of the nanoshell. Fluorescently tagged oligonucleotides were used to monitor the time-dependent release process and light-triggered endosomal release. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and gene silencing mediated by the NS-PLL carrying GFP gene-specific single-stranded DNA antisense oligonucleotide (AON-GFP), or a double-stranded siRNA (siRNA-GFP), in vitro. Light-triggered delivery resulted in ∼ 47% and ∼49% downregulation of the targeted GFP expression by AON-GFP and siRNA-GFP, respectively. Cytotoxicity induced by both the NS-PLL delivery vector and by laser irradiation is minimal, as demonstrated by a XTT cell proliferation assay. PMID:22862291

  15. Kinetics and mechanism for platination of thione-containing nucleotides and oligonucleotides: evaluation of the salt dependence.

    PubMed

    Kjellström, Johan; Elmroth, Sofi K C

    2003-01-01

    Reactions of cis-[PtCl(NH(3))(CyNH(2))(OH(2))](+) (Cy=cyclohexyl) with thione-containing single-stranded oligonucleotides d(T(8)XT(8)) and d(XT(16)) (X=(s6)I or (s4)U) and the mononucleotides 4-thiouridine ((s4)UMP) and 6-mercaptoinosine ((s6)IMP) have been studied in aqueous solution at pH 4.1. The reaction kinetics was followed using HPLC methodology as a function of ionic strength in the interval 5.0 mM

  16. Rapid method to detect duplex formation in sequencing by hybridization methods, a method for constructing containment structures for reagent interaction

    DOEpatents

    Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moiseyevich; Guschin, Dmitry Yuryevich; Gemmell, Margaret Anne; Shick, Valentine V.; Proudnikov, Dmitri Y.; Timofeev, Edward N.

    2002-01-01

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to polymerize into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

  17. Oligonucleotides complementary to a promoter over the region -8...+2 as transcription primers for E. coli RNA polymerase.

    PubMed Central

    Grachev, M A; Zaychikov, E F; Ivanova, E M; Komarova, N I; Kutyavin, I V; Sidelnikova, N P; Frolova, I P

    1984-01-01

    Primer-dependent transcription by E. coli RNA polymerase on T7 promoter A2 has been studied. Synthetic deoxyribonucleotides complementary to the promoter over the region -8...+2 were taken as primers. A ribonucleoside residue was present at the 3'-end of some of these oligonucleotides. The octanucleotide complementary to the region -8...-1 appeared to be an active primer. Oligonucleotides having lengths from 3 to 6 nucleotide residues complementary to the promoter over the region -4...+2 also exhibited primer activity. The latter was some 5-10 times greater in the case of oligonucleotides having a ribonucleoside residue at the 3'-end. Oligonucleotides which on complementary binding do not reach the center of phosphodiester bond synthesis, as well as the decanucleotides (-8...+2) and octanucleotides (-6...+2) of both the ribo- and deoxyribo-series were inactive as primers. Images PMID:6390344

  18. Rare genomic rearrangement in a boy with Williams-Beuren syndrome associated to XYY syndrome and intriguing behavior.

    PubMed

    Dutra, Roberta L; Piazzon, Flavia B; Zanardo, Évelin A; Costa, Thais Virginia Moura Machado; Montenegro, Marília M; Novo-Filho, Gil M; Dias, Alexandre T; Nascimento, Amom M; Kim, Chong Ae; Kulikowski, Leslie D

    2015-12-01

    Williams-Beuren syndrome (WBS) is caused by a hemizygous contiguous gene microdeletion of 1.55-1.84 Mb at 7q11.23 region. Approximately, 28 genes have been shown to contribute to classical phenotype of SWB with presence of dysmorphic facial features, supravalvular aortic stenosis (SVAS), intellectual disability, and overfriendliness. With the use of Microarray-based comparative genomic hybridization and other molecular cytogenetic techniques, is possible define with more accuracy partial or atypical deletion and refine the genotype-phenotype correlation. Here, we report on a rare genomic structural rearrangement in a boy with atypical deletion in 7q11.23 and XYY syndrome with characteristic clinical signs, but not sufficient for the diagnosis of WBS. Cytogenetic analysis of G-banding showed a karyotype 47,XYY. Analysis of DNA with the technique of MLPA (Multiplex Ligation-dependent Probe Amplification) using kits a combination of kits (P064, P036, P070, and P029) identified an atypical deletion on 7q11.23. In addition, high resolution SNP Oligonucleotide Microarray Analysis (SNP-array) confirmed the alterations found by MLPA and revealed others pathogenic CNVs, in the chromosomes 7 and X. The present report demonstrates an association not yet described in literature, between Williams-Beuren syndrome and 47,XYY. The identification of atypical deletion in 7q11.23 concomitant to additional pathogenic CNVs in others genomic regions allows a better comprehension of clinical consequences of atypical genomic rearrangements. © 2015 Wiley Periodicals, Inc.

  19. Nanostructure-enhanced surface plasmon resonance imaging (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Špašková, Barbora; Lynn, Nicholas S.; Slabý, Jiří Bocková, Markéta; Homola, Jiří

    2017-06-01

    There remains a need for the multiplexed detection of biomolecules at extremely low concentrations in fields of medical diagnostics, food safety, and security. Surface plasmon resonance imaging is an established biosensing approach in which the measurement of the intensity of light across a sensor chip is correlated with the amount of target biomolecules captured by the respective areas on the chip. In this work, we present a new approach for this method allowing for enhanced bioanalytical performance via the introduction of nanostructured sensing chip and polarization contrast measurement, which enable the exploitation of both amplitude and phase properties of plasmonic resonances on the nanostructures. Here we will discuss a complex theoretical analysis of the sensor performance, whereby we investigate aspects related to both the optical performance as well as the transport of the analyte molecules to the functionalized surfaces. This analysis accounts for the geometrical parameters of the nanostructured sensing surface, the properties of functional coatings, and parameters related to the detection assay. Based on the results of the theoretical analysis, we fabricated sensing chips comprised of arrays of gold nanoparticles (by electron-beam lithography), which were modified by a biofunctional coating to allow for the selective capturing of the target biomolecules in the regions with high sensitivity. In addition, we developed a compact optical reader with an integrated microfluidic cell, allowing for the measurement from 50 independent sensing channels. The performance of this biosensor is demonstrated through the sensitive detection of short oligonucleotides down to the low picomolar level.

  20. GeoChip 3.0 as a high-thoughput tool for analyzing microbial community composition, structure, and functional activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He, Z.; Deng, Y.; Van Nostrand, J.D.

    A new generation of functional gene arrays (FGAs; GeoChip 3.0) has been developed, with {approx}28,000 probes covering approximately 57,000 gene variants from 292 functional gene families involved in carbon, nitrogen, phosphorus and sulfur cycles, energy metabolism, antibiotic resistance, metal resistance and organic contaminant degradation. GeoChip 3.0 also has several other distinct features, such as a common oligo reference standard (CORS) for data normalization and comparison, a software package for data management and future updating and the gyrB gene for phylogenetic analysis. Computational evaluation of probe specificity indicated that all designed probes would have a high specificity to their corresponding targets.more » Experimental analysis with synthesized oligonucleotides and genomic DNAs showed that only 0.0036-0.025% false-positive rates were observed, suggesting that the designed probes are highly specific under the experimental conditions examined. In addition, GeoChip 3.0 was applied to analyze soil microbial communities in a multifactor grassland ecosystem in Minnesota, USA, which showed that the structure, composition and potential activity of soil microbial communities significantly changed with the plant species diversity. As expected, GeoChip 3.0 is a high-throughput powerful tool for studying microbial community functional structure, and linking microbial communities to ecosystem processes and functioning.« less

  1. Non-nucleoside building blocks for copper-assisted and copper-free click chemistry for the efficient synthesis of RNA conjugates.

    PubMed

    Jayaprakash, K N; Peng, Chang Geng; Butler, David; Varghese, Jos P; Maier, Martin A; Rajeev, Kallanthottathil G; Manoharan, Muthiah

    2010-12-03

    Novel non-nucleoside alkyne monomers compatible with oligonucleotide synthesis were designed, synthesized, and efficiently incorporated into RNA and RNA analogues during solid-phase synthesis. These modifications allowed site-specific conjugation of ligands to the RNA oligonucleotides through copper-assisted (CuAAC) and copper-free strain-promoted azide-alkyne cycloaddition (SPAAC) reactions. The SPAAC click reactions of cyclooctyne-oligonucleotides with various classes of azido-functionalized ligands in solution phase and on solid phase were efficient and quantitative and occurred under mild reaction conditions. The SPAAC reaction provides a method for the synthesis of oligonucleotide-ligand conjugates uncontaminated with copper ions.

  2. Synthesis and biophysical properties of 5'-thio-2',4'-BNA/LNA oligonucleotide.

    PubMed

    Islam, Md Ariful; Fujisaka, Aki; Mori, Shohei; Ito, Kosuke Ramon; Yamaguchi, Takao; Obika, Satoshi

    2018-07-23

    Phosphorothioate modification of oligonucleotides is one of the most promising chemical modifications in nucleic acid therapeutics. Structurally similar 5'-thio or phosphorothiolate-modified nucleotides, in which the 5'-bridging oxygen atom is replaced with a sulfur atom, are attracting attention and gaining importance in oligonucleotide-based research. In our present study, we synthesized 5'-thio-2',4'-BNA/LNA monomers bearing thymine or 5-methylcytosine nucleobase. The 5'-thio-2',4'-BNA/LNA monomers were successfully incorporated into target oligonucleotides, and their nuclease stability and binding affinity with complementary strands were evaluated. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Oil-encapsulated nanodroplet array for bio-molecular detection.

    PubMed

    Qiao, Wen; Zhang, Tiantian; Yen, Tony; Ku, Ti-Hsuan; Song, Junlan; Lian, Ian; Lo, Yu-Hwa

    2014-09-01

    Detection of low abundance biomolecules is challenging for biosensors that rely on surface chemical reactions. For surface reaction based biosensors, it require to take hours or even days for biomolecules of diffusivities in the order of 10(-10-11) m2/s to reach the surface of the sensors by Brownian motion. In addition, often times the repelling Coulomb interactions between the molecules and the probes further defer the binding process, leading to undesirably long detection time for applications such as point-of-care in vitro diagnosis. In this work, we designed an oil encapsulated nanodroplet array microchip utilizing evaporation for pre-concentration of the targets to greatly shorten the reaction time and enhance the detection sensitivity. The evaporation process of the droplets is facilitated by the superhydrophilic surface and resulting nanodroplets are encapsulated by oil drops to form stable reaction chamber. Using this method, desirable droplet volumes, concentrations of target molecules, and reaction conditions (salt concentrations, reaction temperature, etc.) in favour of fast and sensitive detection are obtained. A linear response over 2 orders of magnitude in target concentration was achieved at 10 fM for protein targets and 100 fM for miRNA mimic oligonucleotides.

  4. Validation of the high-throughput marker technology DArT using the model plant Arabidopsis thaliana.

    PubMed

    Wittenberg, Alexander H J; van der Lee, Theo; Cayla, Cyril; Kilian, Andrzej; Visser, Richard G F; Schouten, Henk J

    2005-08-01

    Diversity Arrays Technology (DArT) is a microarray-based DNA marker technique for genome-wide discovery and genotyping of genetic variation. DArT allows simultaneous scoring of hundreds of restriction site based polymorphisms between genotypes and does not require DNA sequence information or site-specific oligonucleotides. This paper demonstrates the potential of DArT for genetic mapping by validating the quality and molecular basis of the markers, using the model plant Arabidopsis thaliana. Restriction fragments from a genomic representation of the ecotype Landsberg erecta (Ler) were amplified by PCR, individualized by cloning and spotted onto glass slides. The arrays were then hybridized with labeled genomic representations of the ecotypes Columbia (Col) and Ler and of individuals from an F(2) population obtained from a Col x Ler cross. The scoring of markers with specialized software was highly reproducible and 107 markers could unambiguously be ordered on a genetic linkage map. The marker order on the genetic linkage map coincided with the order on the DNA sequence map. Sequencing of the Ler markers and alignment with the available Col genome sequence confirmed that the polymorphism in DArT markers is largely a result of restriction site polymorphisms.

  5. Membrane-Assisted Growth of DNA Origami Nanostructure Arrays

    PubMed Central

    2015-01-01

    Biological membranes fulfill many important tasks within living organisms. In addition to separating cellular volumes, membranes confine the space available to membrane-associated proteins to two dimensions (2D), which greatly increases their probability to interact with each other and assemble into multiprotein complexes. We here employed two DNA origami structures functionalized with cholesterol moieties as membrane anchors—a three-layered rectangular block and a Y-shaped DNA structure—to mimic membrane-assisted assembly into hierarchical superstructures on supported lipid bilayers and small unilamellar vesicles. As designed, the DNA constructs adhered to the lipid bilayers mediated by the cholesterol anchors and diffused freely in 2D with diffusion coefficients depending on their size and number of cholesterol modifications. Different sets of multimerization oligonucleotides added to bilayer-bound origami block structures induced the growth of either linear polymers or two-dimensional lattices on the membrane. Y-shaped DNA origami structures associated into triskelion homotrimers and further assembled into weakly ordered arrays of hexagons and pentagons, which resembled the geometry of clathrin-coated pits. Our results demonstrate the potential to realize artificial self-assembling systems that mimic the hierarchical formation of polyhedral lattices on cytoplasmic membranes. PMID:25734977

  6. Membrane-assisted growth of DNA origami nanostructure arrays.

    PubMed

    Kocabey, Samet; Kempter, Susanne; List, Jonathan; Xing, Yongzheng; Bae, Wooli; Schiffels, Daniel; Shih, William M; Simmel, Friedrich C; Liedl, Tim

    2015-01-01

    Biological membranes fulfill many important tasks within living organisms. In addition to separating cellular volumes, membranes confine the space available to membrane-associated proteins to two dimensions (2D), which greatly increases their probability to interact with each other and assemble into multiprotein complexes. We here employed two DNA origami structures functionalized with cholesterol moieties as membrane anchors--a three-layered rectangular block and a Y-shaped DNA structure--to mimic membrane-assisted assembly into hierarchical superstructures on supported lipid bilayers and small unilamellar vesicles. As designed, the DNA constructs adhered to the lipid bilayers mediated by the cholesterol anchors and diffused freely in 2D with diffusion coefficients depending on their size and number of cholesterol modifications. Different sets of multimerization oligonucleotides added to bilayer-bound origami block structures induced the growth of either linear polymers or two-dimensional lattices on the membrane. Y-shaped DNA origami structures associated into triskelion homotrimers and further assembled into weakly ordered arrays of hexagons and pentagons, which resembled the geometry of clathrin-coated pits. Our results demonstrate the potential to realize artificial self-assembling systems that mimic the hierarchical formation of polyhedral lattices on cytoplasmic membranes.

  7. MEF2C haploinsufficiency caused by either microdeletion of the 5q14.3 region or mutation is responsible for severe mental retardation with stereotypic movements, epilepsy and/or cerebral malformations.

    PubMed

    Le Meur, N; Holder-Espinasse, M; Jaillard, S; Goldenberg, A; Joriot, S; Amati-Bonneau, P; Guichet, A; Barth, M; Charollais, A; Journel, H; Auvin, S; Boucher, C; Kerckaert, J-P; David, V; Manouvrier-Hanu, S; Saugier-Veber, P; Frébourg, T; Dubourg, C; Andrieux, J; Bonneau, D

    2010-01-01

    Over the last few years, array-comparative genomic hybridisation (CGH) has considerably improved our ability to detect cryptic unbalanced rearrangements in patients with syndromic mental retardation. Molecular karyotyping of six patients with syndromic mental retardation was carried out using whole-genome oligonucleotide array-CGH. 5q14.3 microdeletions ranging from 216 kb to 8.8 Mb were detected in five unrelated patients with the following phenotypic similarities: severe mental retardation with absent speech, hypotonia and stereotypic movements. Facial dysmorphic features, epilepsy and/or cerebral malformations were also present in most of these patients. The minimal common deleted region of these 5q14 microdeletions encompassed only MEF2C, the gene for a protein known to act in brain as a neurogenesis effector, which regulates excitatory synapse number. In a patient with a similar phenotype, an MEF2C nonsense mutation was subsequently identified. Taken together, these results strongly suggest that haploinsufficiency of MEF2C is responsible for severe mental retardation with stereotypic movements, seizures and/or cerebral malformations.

  8. Novel partial duplication of EYA1 causes branchiootic syndrome in a large Brazilian family.

    PubMed

    Dantas, Vitor G L; Freitas, Erika L; Della-Rosa, Valter A; Lezirovitz, Karina; de Moraes, Ana Maria S M; Ramos, Silvia B; Oiticica, Jeanne; Alves, Leandro U; Pearson, Peter L; Rosenberg, Carla; Mingroni-Netto, Regina C

    2015-01-01

    To identify novel genetic causes of syndromic hearing loss in Brazil. To map a candidate chromosomal region through linkage studies in an extensive Brazilian family and identify novel pathogenic variants using sequencing and array-CGH. Brazilian pedigree with individuals affected by BO syndrome characterized by deafness and malformations of outer, middle and inner ear, auricular and cervical fistulae, but no renal abnormalities. Whole genome microarray-SNP scanning on samples of 11 affected individuals detected a multipoint Lod score of 2.6 in the EYA1 gene region (chromosome 8). Sequencing of EYA1 in affected patients did not reveal pathogenic mutations. However, oligonucleotide-array-CGH detected a duplication of 71.8Kb involving exons 4 to 10 of EYA1 (heterozygous state). Real-time-PCR confirmed the duplication in fourteen of fifteen affected individuals and absence in 13 unaffected individuals. The exception involved a consanguineous parentage and was assumed to involve a different genetic mechanism. Our findings implicate this EYA1 partial duplication segregating with BO phenotype in a Brazilian pedigree and is the first description of a large duplication leading to the BOR/BO syndrome.

  9. Immunomodulatory oligonucleotide IMT504: Effects on mesenchymal stem cells as a first-in-class immunoprotective/immunoregenerative therapy

    PubMed Central

    Zorzopulos, Jorge; Opal, Steven M; Hernando-Insúa, Andrés; Rodriguez, Juan M; Elías, Fernanda; Fló, Juan; López, Ricardo A; Chasseing, Norma A; Lux-Lantos, Victoria A; Coronel, Maria F; Franco, Raul; Montaner, Alejandro D; Horn, David L

    2017-01-01

    The immune responses of humans and animals to insults (i.e., infections, traumas, tumoral transformation and radiation) are based on an intricate network of cells and chemical messengers. Abnormally high inflammation immediately after insult or abnormally prolonged pro-inflammatory stimuli bringing about chronic inflammation can lead to life-threatening or severely debilitating diseases. Mesenchymal stem cell (MSC) transplant has proved to be an effective therapy in preclinical studies which evaluated a vast diversity of inflammatory conditions. MSCs lead to resolution of inflammation, preparation for regeneration and actual regeneration, and then ultimate return to normal baseline or homeostasis. However, in clinical trials of transplanted MSCs, the expectations of great medical benefit have not yet been fulfilled. As a practical alternative to MSC transplant, a synthetic drug with the capacity to boost endogenous MSC expansion and/or activation may also be effective. Regarding this, IMT504, the prototype of a major class of immunomodulatory oligonucleotides, induces in vivo expansion of MSCs, resulting in a marked improvement in preclinical models of neuropathic pain, osteoporosis, diabetes and sepsis. IMT504 is easily manufactured and has an excellent preclinical safety record. In the small number of patients studied thus far, IMT504 has been well-tolerated, even at very high dosage. Further clinical investigation is necessary to demonstrate the utility of IMT504 for resolution of inflammation and regeneration in a broad array of human diseases that would likely benefit from an immunoprotective/immunoregenerative therapy. PMID:28396715

  10. Comparative performance of high-density oligonucleotide sequencing and dideoxynucleotide sequencing of HIV type 1 pol from clinical samples.

    PubMed

    Günthard, H F; Wong, J K; Ignacio, C C; Havlir, D V; Richman, D D

    1998-07-01

    The performance of the high-density oligonucleotide array methodology (GeneChip) in detecting drug resistance mutations in HIV-1 pol was compared with that of automated dideoxynucleotide sequencing (ABI) of clinical samples, viral stocks, and plasmid-derived NL4-3 clones. Sequences from 29 clinical samples (plasma RNA, n = 17; lymph node RNA, n = 5; lymph node DNA, n = 7) from 12 patients, from 6 viral stock RNA samples, and from 13 NL4-3 clones were generated by both methods. Editing was done independently by a different investigator for each method before comparing the sequences. In addition, NL4-3 wild type (WT) and mutants were mixed in varying concentrations and sequenced by both methods. Overall, a concordance of 99.1% was found for a total of 30,865 bases compared. The comparison of clinical samples (plasma RNA and lymph node RNA and DNA) showed a slightly lower match of base calls, 98.8% for 19,831 nucleotides compared (protease region, 99.5%, n = 8272; RT region, 98.3%, n = 11,316), than for viral stocks and NL4-3 clones (protease region, 99.8%; RT region, 99.5%). Artificial mixing experiments showed a bias toward calling wild-type bases by GeneChip. Discordant base calls are most likely due to differential detection of mixtures. The concordance between GeneChip and ABI was high and appeared dependent on the nature of the templates (directly amplified versus cloned) and the complexity of mixes.

  11. Antisense Oligonucleotides Used to Target the DUX4 mRNA as Therapeutic Approaches in FaciosScapuloHumeral Muscular Dystrophy (FSHD)

    PubMed Central

    Ansseau, Eugénie; Vanderplanck, Céline; Wauters, Armelle; Harper, Scott Q.; Coppée, Frédérique; Belayew, Alexandra

    2017-01-01

    FacioScapuloHumeral muscular Dystrophy (FSHD) is one of the most prevalent hereditary myopathies and is generally characterized by progressive muscle atrophy affecting the face, scapular fixators; upper arms and distal lower legs. The FSHD locus maps to a macrosatellite D4Z4 repeat array on chromosome 4q35. Each D4Z4 unit contains a DUX4 gene; the most distal of which is flanked by a polyadenylation site on FSHD-permissive alleles, which allows for production of stable DUX4 mRNAs. In addition, an open chromatin structure is required for DUX4 gene transcription. FSHD thus results from a gain of function of the toxic DUX4 protein that normally is only expressed in germ line and stem cells. Therapeutic strategies are emerging that aim to decrease DUX4 expression or toxicity in FSHD muscle cells. We review here the heterogeneity of DUX4 mRNAs observed in muscle and stem cells; and the use of antisense oligonucleotides (AOs) targeting the DUX4 mRNA to interfere either with transcript cleavage/polyadenylation or intron splicing. We show in primary cultures that DUX4-targeted AOs suppress the atrophic FSHD myotube phenotype; but do not improve the disorganized FSHD myotube phenotype which could be caused by DUX4c over-expression. Thus; DUX4c might constitute another therapeutic target in FSHD. PMID:28273791

  12. Effect of competing self-structure on triplex formation with purine-rich oligodeoxynucleotides containing GA repeats.

    PubMed Central

    Noonberg, S B; François, J C; Garestier, T; Hélène, C

    1995-01-01

    Competition between triplex formation with double-stranded DNA and oligonucleotide self-association was investigated in 23mer GA and GT oligonucleotides containing d(GA)5 or d(GT)5 repeats. Whereas triplex formation with GT oligonucleotides was diminished when temperature increased from 4 to 37 degrees C, triplex formation with GA oligonucleotides was enhanced when temperature increased within the same range due to the presence of competing intermolecular GA oligonucleotide self-structure. This self-structure was determined to be a homoduplex stabilized by the internal GA repeats. UV spectroscopy of these homoduplexes demonstrated a single sharp transition with rapid kinetics (Tm = 38.5-43.5 degrees C over strand concentrations of 0.5-4 microM, respectively, with transition enthalpy, delta H = -89 +/- 7 kcal/mol) in 10 mM MgCl2, 100 mM NaCl, pH 7.0. Homoduplex formation was strongly stabilized by multivalent cations (spermine > Mg2+ = Ca2+) and destabilized by low concentrations of monovalent cations (K+ = Li+ = Na+) in the presence of divalent cations. However, unlike GA or GT oligonucleotide-containing triplexes, the homoduplex formed even in the absence of multivalent cations, stabilized by only moderate concentrations of monovalent cations (Li+ > Na+ > K+). Through the development of multiple equilibrium states and the resulting depletion of free oligonucleotide, it was found that the presence of competing self-structure could decrease triplex formation under a variety of experimental conditions. Images PMID:7596824

  13. Selective Amplification of SPR Biosensor Signal for Recognition of rpoB Gene Fragments by Use of Gold Nanoparticles Modified by Thiolated DNA

    NASA Astrophysics Data System (ADS)

    Matsishin, M.; Rachkov, A.; Lopatynskyi, A.; Chegel, V.; Soldatkin, A.; El'skaya, A.

    2017-04-01

    An experimental approach for improving the sensitivity of the surface plasmon resonance (SPR) DNA hybridization sensor using gold nanoparticles (GNPs), modified by specific oligonucleotides, was elaborated. An influence of the ionic strength on the aggregation stability of unmodified GNPs and GNPs modified by the thiolated oligonucleotides was investigated by monitoring a value of light extinction at 520 nm that can be considered as a measure of a quantity of the non-aggregated GNPs. While the unmodified GNPs started to aggregate in 0.2 × saline-sodium citrate (SSC), GNPs modified by the negatively charged oligonucleotides were more stable at increasing ionic strength up to 0.5 × SSC. A bioselective element of the SPR DNA hybridization sensor was formed by immobilization on the gold sensor surface of the thiolated oligonucleotides P2, the sequence of which is a fragment of the rpoB gene of Mycobacterium tuberculosis. The injections into the measuring flow cell of the SPR spectrometer of various concentrations of GNPs modified by the complementary oligonucleotides T2-18m caused the pronounced concentration-dependent sequence-specific sensor responses. The magnitude of the sensor responses was much higher than in the case of the free standing complementary oligonucleotides. According to the obtained experimental data, the usage of GNPs modified by specific oligonucleotides can amplify the sensor response of the SPR DNA hybridization sensor in 1200 times.

  14. Effect on embryos of injection of phosphorothioate-modified oligonucleotides into pregnant mice.

    PubMed

    Gaudette, M F; Hampikian, G; Metelev, V; Agrawal, S; Crain, W R

    1993-01-01

    Phosphorothioate-modified oligonucleotides were injected into pregnant female mice to assess the effect on developing embryos. Injections were carried out during two different time periods, one when embryos were in preimplantation stages of development (about 3.5 days of development) and the other after implantation, when both a fetus and placenta are present (from days 9.5 to 11.5 of development). Three different phosphorothioate-modified oligonucleotides were injected. One, which had a sequence not present in the mouse genome, was used to ask whether nonspecific toxic or teratogenic effects on embryos result from treatment of the mother. A second was complementary to the mRNA of the testis-determining factor gene Sry and was used to ask whether a specific developmental pathway (i.e., sex determination) could be disrupted in embryos in vivo. The third was the complement of the anti-Sry sequence. None of these oligonucleotides reduced the frequency of successful pregnancy after mating or the average litter size from that observed in controls animals. Furthermore, examination of 291 pups or fetuses from all oligonucleotide-injected pregnant females revealed no developmental defects regardless of which sequence was used. It is concluded that injection of phosphorothioate-modified oligonucleotides into pregnant females according to the protocols described here is not toxic or teratogenic to embryos in a nonspecific way. Also, anti-Sry oligonucleotides did not influence sex determination in embryos, although there are several possible explanations for this.

  15. Heterologous oligonucleotide microarrays for transcriptomics in a non-model species; a proof-of-concept study of drought stress in Musa

    PubMed Central

    Davey, Mark W; Graham, Neil S; Vanholme, Bartel; Swennen, Rony; May, Sean T; Keulemans, Johan

    2009-01-01

    Background 'Systems-wide' approaches such as microarray RNA-profiling are ideally suited to the study of the complex overlapping responses of plants to biotic and abiotic stresses. However, commercial microarrays are only available for a limited number of plant species and development costs are so substantial as to be prohibitive for most research groups. Here we evaluate the use of cross-hybridisation to Affymetrix oligonucleotide GeneChip® microarrays to profile the response of the banana (Musa spp.) leaf transcriptome to drought stress using a genomic DNA (gDNA)-based probe-selection strategy to improve the efficiency of detection of differentially expressed Musa transcripts. Results Following cross-hybridisation of Musa gDNA to the Rice GeneChip® Genome Array, ~33,700 gene-specific probe-sets had a sufficiently high degree of homology to be retained for transcriptomic analyses. In a proof-of-concept approach, pooled RNA representing a single biological replicate of control and drought stressed leaves of the Musa cultivar 'Cachaco' were hybridised to the Affymetrix Rice Genome Array. A total of 2,910 Musa gene homologues with a >2-fold difference in expression levels were subsequently identified. These drought-responsive transcripts included many functional classes associated with plant biotic and abiotic stress responses, as well as a range of regulatory genes known to be involved in coordinating abiotic stress responses. This latter group included members of the ERF, DREB, MYB, bZIP and bHLH transcription factor families. Fifty-two of these drought-sensitive Musa transcripts were homologous to genes underlying QTLs for drought and cold tolerance in rice, including in 2 instances QTLs associated with a single underlying gene. The list of drought-responsive transcripts also included genes identified in publicly-available comparative transcriptomics experiments. Conclusion Our results demonstrate that despite the general paucity of nucleotide sequence data in Musa and only distant phylogenetic relations to rice, gDNA probe-based cross-hybridisation to the Rice GeneChip® is a highly promising strategy to study complex biological responses and illustrates the potential of such strategies for gene discovery in non-model species. PMID:19758430

  16. Routine HLA-B genotyping with PCR-sequence-specific oligonucleotides detects a B*52 variant (B*5206).

    PubMed

    Hoelsch, K; Lenggeler, I; Pfannes, W; Knabe, H; Klein, H-G; Woelpl, A

    2005-05-01

    A new human leukocyte antigen (HLA)-B allele was found during routine typing of samples for a German unrelated bone marrow donor registry, the "Aktion Knochenmarkspende Bayern". After first interpretation of data of two independent low-resolution sequence-specific oligonucleotide typing tests, a B*51 variant was suggested. Further analysis via sequence-based typing identified the sequence as new B*52 allele. This new allele officially assigned as B*5206 differs from HLA-B*520102 by one nucleotide exchange in exon 2. The mutation is located at nucleotide position 274, at which a cytosine is substituted by a thymine leading to an amino acid change at protein position 67 from serine (TCC) to phenylalanine (TTC).

  17. Molecular diversity, cultivation, and improved detection by fluorescent in situ hybridization of a dominant group of human gut bacteria related to Roseburia spp. or Eubacterium rectale.

    PubMed

    Aminov, Rustam I; Walker, Alan W; Duncan, Sylvia H; Harmsen, Hermie J M; Welling, Gjalt W; Flint, Harry J

    2006-09-01

    Phylogenetic analysis was used to compare 16S rRNA sequences from 19 cultured human gut strains of Roseburia and Eubacterium rectale with 356 related sequences derived from clone libraries. The cultured strains were found to represent five of the six phylotypes identified. A new oligonucleotide probe, Rrec584, and the previous group probe Rint623, when used in conjunction with a new helper oligonucleotide, each recognized an average of 7% of bacteria detected by the eubacterial probe Eub338 in feces from 10 healthy volunteers. Most of the diversity within this important group of butyrate-producing gut bacteria can apparently be retrieved through cultivation.

  18. Molecular Diversity, Cultivation, and Improved Detection by Fluorescent In Situ Hybridization of a Dominant Group of Human Gut Bacteria Related to Roseburia spp. or Eubacterium rectale

    PubMed Central

    Aminov, Rustam I.; Walker, Alan W.; Duncan, Sylvia H.; Harmsen, Hermie J. M.; Welling, Gjalt W.; Flint, Harry J.

    2006-01-01

    Phylogenetic analysis was used to compare 16S rRNA sequences from 19 cultured human gut strains of Roseburia and Eubacterium rectale with 356 related sequences derived from clone libraries. The cultured strains were found to represent five of the six phylotypes identified. A new oligonucleotide probe, Rrec584, and the previous group probe Rint623, when used in conjunction with a new helper oligonucleotide, each recognized an average of 7% of bacteria detected by the eubacterial probe Eub338 in feces from 10 healthy volunteers. Most of the diversity within this important group of butyrate-producing gut bacteria can apparently be retrieved through cultivation. PMID:16957265

  19. Oligonucleotides Containing Aminated 2'-Amino-LNA Nucleotides: Synthesis and Strong Binding to Complementary DNA and RNA.

    PubMed

    Lou, Chenguang; Samuelsen, Simone V; Christensen, Niels Johan; Vester, Birte; Wengel, Jesper

    2017-04-19

    Mono- and diaminated 2'-amino-LNA monomers were synthesized and introduced into oligonucleotides. Each modification imparts significant stabilization of nucleic acid duplexes and triplexes, excellent sequence selectivity, and significant nuclease resistance. Molecular modeling suggested that structural stabilization occurs via intrastrand electrostatic attraction between the protonated amino groups of the aminated 2'-amino-LNA monomers and the host oligonucleotide backbone.

  20. Phosphorothioate oligonucleotides inhibit the intrinsic tenase complex.

    PubMed

    Sheehan, J P; Lan, H C

    1998-09-01

    Systemic administration of ISIS 2302, a 20-mer antisense phosphorothioate oligonucleotide targeting human intercellular adhesion molecule-1 mRNA, causes prolongation of plasma clotting times in both monkey and human studies. The anticoagulant effects of ISIS 2302 were investigated with both in vitro coagulation assays in human plasma and purified enzyme systems. At high oligonucleotide plasma concentrations (>100 microgram/mL), prolongation of the prothrombin and thrombin times was observed. In a thrombin time assay using purified components, high concentrations of ISIS 2302 inhibited thrombin clotting activity both by stimulating inhibition by heparin cofactor II and directly competing with fibrinogen for binding to anion binding exosite I. In contrast, low concentrations of ISIS 2302 (<100 microgram/mL) showed a selective, linear prolongation of the activated partial thromboplastin time (PTT). The rate limiting effect of 50 microgram/mL ISIS 2302, which prolonged the PTT to 1.5 times control, was identified by sequential modification of the clotting assay. Delaying addition of oligonucleotide until after contact activation failed to correct prolongation of the PTT. The calcium-dependent steps of the intrinsic pathway were individually assessed by adding sufficient activated coagulation factor to correct the PTT in plasma deficient in that specific factor. Addition of factor XIa, IXa, VIIIa, or Va failed to correct the PTT in the presence of ISIS 2302. In contrast, 0.2 nmol/L factor Xa corrected prolongation of the PTT in factor X-deficient plasma with or without oligonucleotide present. ISIS 2302 (50 microgram/mL) did not prolong a modified Russel viper venom time, suggesting no significant inhibition of prothrombinase. Thus, 50 microgram/mL ISIS 2302 prolonged the PTT by selectively inhibiting intrinsic tenase activity. ISIS 2302 showed partial inhibition of intrinsic tenase activity (to approximately 35% of control) at clinically relevant oligonucleotide concentrations in a chromogenic assay. This activity was oligonucleotide sequence-independent but required the phosphorothioate backbone, suggesting that inhibition of intrinsic tenase is a general property of this class of oligonucleotides. These results are relevant to both the therapeutic use of phosphorothioate oligonucleotides and the potential design of inhibitors of the intrinsic tenase complex, a novel target for anticoagulation. Copyright 1998 by The American Society of Hematology.

  1. Comparative Analysis of Vertebrate Diurnal/Circadian Transcriptomes

    PubMed Central

    Boyle, Greg; Richter, Kerstin; Priest, Henry D.; Traver, David; Mockler, Todd C.; Chang, Jeffrey T.; Kay, Steve A.

    2017-01-01

    From photosynthetic bacteria to mammals, the circadian clock evolved to track diurnal rhythms and enable organisms to anticipate daily recurring changes such as temperature and light. It orchestrates a broad spectrum of physiology such as the sleep/wake and eating/fasting cycles. While we have made tremendous advances in our understanding of the molecular details of the circadian clock mechanism and how it is synchronized with the environment, we still have rudimentary knowledge regarding its connection to help regulate diurnal physiology. One potential reason is the sheer size of the output network. Diurnal/circadian transcriptomic studies are reporting that around 10% of the expressed genome is rhythmically controlled. Zebrafish is an important model system for the study of the core circadian mechanism in vertebrate. As Zebrafish share more than 70% of its genes with human, it could also be an additional model in addition to rodent for exploring the diurnal/circadian output with potential for translational relevance. Here we performed comparative diurnal/circadian transcriptome analysis with established mouse liver and other tissue datasets. First, by combining liver tissue sampling in a 48h time series, transcription profiling using oligonucleotide arrays and bioinformatics analysis, we profiled rhythmic transcripts and identified 2609 rhythmic genes. The comparative analysis revealed interesting features of the output network regarding number of rhythmic genes, proportion of tissue specific genes and the extent of transcription factor family expression. Undoubtedly, the Zebrafish model system will help identify new vertebrate outputs and their regulators and provides leads for further characterization of the diurnal cis-regulatory network. PMID:28076377

  2. Triplex-mediated analysis of cytosine methylation at CpA sites in DNA.

    PubMed

    Johannsen, Marie W; Gerrard, Simon R; Melvin, Tracy; Brown, Tom

    2014-01-18

    Modified triplex-forming oligonucleotides distinguish 5-methyl cytosine from unmethylated cytosine in DNA duplexes by differences in triplex melting temperatures. The discrimination is sequence-specific; dramatic differences in stabilisation are seen for CpA methylation, whereas CpG methylation is not detected. This direct detection of DNA methylation constitutes a new approach for epigenetic analysis.

  3. High Quality Genomic Copy Number Data from Archival Formalin-Fixed Paraffin-Embedded Leiomyosarcoma: Optimisation of Universal Linkage System Labelling

    PubMed Central

    Salawu, Abdulazeez; Ul-Hassan, Aliya; Hammond, David; Fernando, Malee; Reed, Malcolm; Sisley, Karen

    2012-01-01

    Most soft tissue sarcomas are characterized by genetic instability and frequent genomic copy number aberrations that are not subtype-specific. Oligonucleotide microarray-based Comparative Genomic Hybridisation (array CGH) is an important technique used to map genome-wide copy number aberrations, but the traditional requirement for high-quality DNA typically obtained from fresh tissue has limited its use in sarcomas. Although large archives of Formalin-fixed Paraffin-embedded (FFPE) tumour samples are available for research, the degradative effects of formalin on DNA from these tissues has made labelling and analysis by array CGH technically challenging. The Universal Linkage System (ULS) may be used for a one-step chemical labelling of such degraded DNA. We have optimised the ULS labelling protocol to perform aCGH on archived FFPE leiomyosarcoma tissues using the 180k Agilent platform. Preservation age of samples ranged from a few months to seventeen years and the DNA showed a wide range of degradation (when visualised on agarose gels). Consistently high DNA labelling efficiency and low microarray probe-to-probe variation (as measured by the derivative log ratio spread) was seen. Comparison of paired fresh and FFPE samples from identical tumours showed good correlation of CNAs detected. Furthermore, the ability to macro-dissect FFPE samples permitted the detection of CNAs that were masked in fresh tissue. Aberrations were visually confirmed using Fluorescence in situ Hybridisation. These results suggest that archival FFPE tissue, with its relative abundance and attendant clinical data may be used for effective mapping for genomic copy number aberrations in such rare tumours as leiomyosarcoma and potentially unravel clues to tumour origins, progression and ultimately, targeted treatment. PMID:23209738

  4. Serum protein profiling using an aptamer array predicts clinical outcomes of stage IIA colon cancer: A leave-one-out crossvalidation

    PubMed Central

    Huh, Jung Wook; Kim, Sung Chun; Sohn, Insuk; Jung, Sin-Ho; Kim, Hee Cheol

    2016-01-01

    Background In this study, we established and validated a model for predicting prognosis of stage IIA colon cancer patients based on expression profiles of aptamers in serum. Methods Bloods samples were collected from 227 consecutive patients with pathologic T3N0M0 (stage IIA) colon cancer. We incubated 1,149 serum molecule-binding aptamer pools of clinical significance with serum from patients to obtain aptamers bound to serum molecules, which were then amplified and marked. Oligonucleotide arrays were constructed with the base sequences of the 1,149 aptamers, and the marked products identified above were reacted with one another to produce profiles of the aptamers bound to serum molecules. These profiles were organized into low- and high-risk groups of colon cancer patients based on clinical information for the serum samples. Cox proportional hazards model and leave-one-out cross-validation (LOOCV) were used to evaluate predictive performance. Results During a median follow-up period of 5 years, 29 of the 227 patients (11.9%) experienced recurrence. There were 212 patients (93.4%) in the low-risk group and 15 patients (6.6%) in the high-risk group in our aptamer prognosis model. Postoperative recurrence significantly correlated with age and aptamer risk stratification (p = 0.046 and p = 0.001, respectively). In multivariate analysis, aptamer risk stratification (p < 0.001) was an independent predictor of recurrence. Disease-free survival curves calculated according to aptamer risk level predicted through a LOOCV procedure and age showed significant differences (p < 0.001 from permutations). Conclusion Aptamer risk stratification can be a valuable prognostic factor in stage II colon cancer patients. PMID:26908450

  5. Differentiation of the seven major lyssavirus species by oligonucleotide microarray.

    PubMed

    Xi, Jin; Guo, Huancheng; Feng, Ye; Xu, Yunbin; Shao, Mingfu; Su, Nan; Wan, Jiayu; Li, Jiping; Tu, Changchun

    2012-03-01

    An oligonucleotide microarray, LyssaChip, has been developed and verified as a highly specific diagnostic tool for differentiation of the 7 major lyssavirus species. As with conventional typing microarray methods, the LyssaChip relies on sequence differences in the 371-nucleotide region coding for the nucleoprotein. This region was amplified using nested reverse transcription-PCR primers that bind to the 7 major lyssaviruses. The LyssaChip includes 57 pairs of species typing and corresponding control oligonucleotide probes (oligoprobes) immobilized on glass slides, and it can analyze 12 samples on a single slide within 8 h. Analysis of 111 clinical brain specimens (65 from animals with suspected rabies submitted to the laboratory and 46 of butchered dog brain tissues collected from restaurants) showed that the chip method was 100% sensitive and highly consistent with the "gold standard," a fluorescent antibody test (FAT). The chip method could detect rabies virus in highly decayed brain tissues, whereas the FAT did not, and therefore the chip test may be more applicable to highly decayed brain tissues than the FAT. LyssaChip may provide a convenient and inexpensive alternative for diagnosis and differentiation of rabies and rabies-related diseases.

  6. Exploiting sequence similarity to validate the sensitivity of SNP arrays in detecting fine-scaled copy number variations.

    PubMed

    Wong, Gerard; Leckie, Christopher; Gorringe, Kylie L; Haviv, Izhak; Campbell, Ian G; Kowalczyk, Adam

    2010-04-15

    High-density single nucleotide polymorphism (SNP) genotyping arrays are efficient and cost effective platforms for the detection of copy number variation (CNV). To ensure accuracy in probe synthesis and to minimize production costs, short oligonucleotide probe sequences are used. The use of short probe sequences limits the specificity of binding targets in the human genome. The specificity of these short probeset sequences has yet to be fully analysed against a normal reference human genome. Sequence similarity can artificially elevate or suppress copy number measurements, and hence reduce the reliability of affected probe readings. For the purpose of detecting narrow CNVs reliably down to the width of a single probeset, sequence similarity is an important issue that needs to be addressed. We surveyed the Affymetrix Human Mapping SNP arrays for probeset sequence similarity against the reference human genome. Utilizing sequence similarity results, we identified a collection of fine-scaled putative CNVs between gender from autosomal probesets whose sequence matches various loci on the sex chromosomes. To detect these variations, we utilized our statistical approach, Detecting REcurrent Copy number change using rank-order Statistics (DRECS), and showed that its performance was superior and more stable than the t-test in detecting CNVs. Through the application of DRECS on the HapMap population datasets with multi-matching probesets filtered, we identified biologically relevant SNPs in aberrant regions across populations with known association to physical traits, such as height, covered by the span of a single probe. This provided empirical confirmation of the existence of naturally occurring narrow CNVs as well as the sensitivity of the Affymetrix SNP array technology in detecting them. The MATLAB implementation of DRECS is available at http://ww2.cs.mu.oz.au/ approximately gwong/DRECS/index.html.

  7. Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli

    PubMed Central

    El-Sagheer, Afaf H.; Sanzone, A. Pia; Gao, Rachel; Tavassoli, Ali; Brown, Tom

    2011-01-01

    A triazole mimic of a DNA phosphodiester linkage has been produced by templated chemical ligation of oligonucleotides functionalized with 5′-azide and 3′-alkyne. The individual azide and alkyne oligonucleotides were synthesized by standard phosphoramidite methods and assembled using a straightforward ligation procedure. This highly efficient chemical equivalent of enzymatic DNA ligation has been used to assemble a 300-mer from three 100-mer oligonucleotides, demonstrating the total chemical synthesis of very long oligonucleotides. The base sequences of the DNA strands containing this artificial linkage were copied during PCR with high fidelity and a gene containing the triazole linker was functional in Escherichia coli. PMID:21709264

  8. Chemoselective covalent coupling of oligonucleotide probes to self-assembled monolayers.

    PubMed

    Devaraj, Neal K; Miller, Gregory P; Ebina, Wataru; Kakaradov, Boyko; Collman, James P; Kool, Eric T; Chidsey, Christopher E D

    2005-06-22

    A chemoselective route to routinely and rapidly attach oligonucleotide probes to well-defined surfaces is presented. Cu(I) tris(benzyltriazolylmethyl)amine-catalyzed coupling of terminal acetylenes to azides on a self-assembled monolayer is used instead of traditional nucleophilic-electrophilic coupling reactions. The reaction proceeds well even in the presence of purposely introduced nucleophilic and electrophilic impurities. The density of oligonucleotide probes can be controlled by controlling the amount of azide functionality. Although most of our work was done on gold surfaces, this technique should be readily applicable to any surface on which an azide-containing monolayer can be assembled as we have preliminarily demonstrated by derivatizing azidotrimethoxysilane-modified glass slides with fluorescein-containing oligonucleotides.

  9. A statistical learning approach to the modeling of chromatographic retention of oligonucleotides incorporating sequence and secondary structure data

    PubMed Central

    Sturm, Marc; Quinten, Sascha; Huber, Christian G.; Kohlbacher, Oliver

    2007-01-01

    We propose a new model for predicting the retention time of oligonucleotides. The model is based on ν support vector regression using features derived from base sequence and predicted secondary structure of oligonucleotides. Because of the secondary structure information, the model is applicable even at relatively low temperatures where the secondary structure is not suppressed by thermal denaturing. This makes the prediction of oligonucleotide retention time for arbitrary temperatures possible, provided that the target temperature lies within the temperature range of the training data. We describe different possibilities of feature calculation from base sequence and secondary structure, present the results and compare our model to existing models. PMID:17567619

  10. Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs

    PubMed Central

    Shen, Xiulong; Corey, David R

    2018-01-01

    Abstract RNA plays a central role in the expression of all genes. Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease. The two primary antisense approaches for regulating expression through recognition of cellular RNAs are single-stranded antisense oligonucleotides and duplex RNAs. This review will discuss the chemical modifications and molecular mechanisms that make synthetic nucleic acid drugs possible. Lessons learned from recent clinical trials will be summarized. Ongoing clinical trials are likely to decisively test the adequacy of our current generation of antisense nucleic acid technologies and highlight areas where more basic research is needed. PMID:29240946

  11. Development of a rapid microarray-based DNA subtyping assay for the alleles of Shiga toxins 1 and 2 of Escherichia coli.

    PubMed

    Geue, Lutz; Stieber, Bettina; Monecke, Stefan; Engelmann, Ines; Gunzer, Florian; Slickers, Peter; Braun, Sascha D; Ehricht, Ralf

    2014-08-01

    In this study, we developed a new rapid, economic, and automated microarray-based genotyping test for the standardized subtyping of Shiga toxins 1 and 2 of Escherichia coli. The microarrays from Alere Technologies can be used in two different formats, the ArrayTube and the ArrayStrip (which enables high-throughput testing in a 96-well format). One microarray chip harbors all the gene sequences necessary to distinguish between all Stx subtypes, facilitating the identification of single and multiple subtypes within a single isolate in one experiment. Specific software was developed to automatically analyze all data obtained from the microarray. The assay was validated with 21 Shiga toxin-producing E. coli (STEC) reference strains that were previously tested by the complete set of conventional subtyping PCRs. The microarray results showed 100% concordance with the PCR results. Essentially identical results were detected when the standard DNA extraction method was replaced by a time-saving heat lysis protocol. For further validation of the microarray, we identified the Stx subtypes or combinations of the subtypes in 446 STEC field isolates of human and animal origin. In summary, this oligonucleotide array represents an excellent diagnostic tool that provides some advantages over standard PCR-based subtyping. The number of the spotted probes on the microarrays can be increased by additional probes, such as for novel alleles, species markers, or resistance genes, should the need arise. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  12. Human telomeres that contain (CTAGGG)n repeats show replication dependent instability in somatic cells and the male germline

    PubMed Central

    Mendez-Bermudez, Aaron; Hills, Mark; Pickett, Hilda A.; Phan, Anh Tuân; Mergny, Jean-Louis; Riou, Jean-François; Royle, Nicola J.

    2009-01-01

    A number of different processes that impact on telomere length dynamics have been identified but factors that affect the turnover of repeats located proximally within the telomeric DNA are poorly defined. We have identified a particular repeat type (CTAGGG) that is associated with an extraordinarily high mutation rate (20% per gamete) in the male germline. The mutation rate is affected by the length and sequence homogeneity of the (CTAGGG)n array. This level of instability was not seen with other sequence-variant repeats, including the TCAGGG repeat type that has the same composition. Telomeres carrying a (CTAGGG)n array are also highly unstable in somatic cells with the mutation process resulting in small gains or losses of repeats that also occasionally result in the deletion of the whole (CTAGGG)n array. These sequences are prone to quadruplex formation in vitro but adopt a different topology from (TTAGGG)n (see accompanying article). Interestingly, short (CTAGGG)2 oligonucleotides induce a DNA damage response (γH2AX foci) as efficiently as (TTAGGG)2 oligos in normal fibroblast cells, suggesting they recruit POT1 from the telomere. Moreover, in vitro assays show that (CTAGGG)n repeats bind POT1 more efficiently than (TTAGGG)n or (TCAGGG)n. We estimate that 7% of human telomeres contain (CTAGGG)n repeats and when present, they create additional problems that probably arise during telomere replication. PMID:19656953

  13. Microarray analysis of genes associated with cell surface NIS protein levels in breast cancer.

    PubMed

    Beyer, Sasha J; Zhang, Xiaoli; Jimenez, Rafael E; Lee, Mei-Ling T; Richardson, Andrea L; Huang, Kun; Jhiang, Sissy M

    2011-10-11

    Na+/I- symporter (NIS)-mediated iodide uptake allows radioiodine therapy for thyroid cancer. NIS is also expressed in breast tumors, raising potential for radionuclide therapy of breast cancer. However, NIS expression in most breast cancers is low and may not be sufficient for radionuclide therapy. We aimed to identify biomarkers associated with NIS expression such that mechanisms underlying NIS modulation in human breast tumors may be elucidated. Published oligonucleotide microarray data within the National Center for Biotechnology Information Gene Expression Omnibus database were analyzed to identify gene expression tightly correlated with NIS mRNA level among human breast tumors. NIS immunostaining was performed in a tissue microarray composed of 28 human breast tumors which had corresponding oligonucleotide microarray data available for each tumor such that gene expression associated with cell surface NIS protein level could be identified. NIS mRNA levels do not vary among breast tumors or when compared to normal breast tissues when detected by Affymetrix oligonucleotide microarray platforms. Cell surface NIS protein levels are much more variable than their corresponding NIS mRNA levels. Despite a limited number of breast tumors examined, our analysis identified cysteinyl-tRNA synthetase as a biomarker that is highly associated with cell surface NIS protein levels in the ER-positive breast cancer subtype. Further investigation on genes associated with cell surface NIS protein levels within each breast cancer molecular subtype may lead to novel targets for selectively increasing NIS expression/function in a subset of breast cancers patients.

  14. Cellular Internalization of Therapeutic Oligonucleotides by Peptide Amphiphile Nanofibers and Nanospheres.

    PubMed

    Mumcuoglu, Didem; Sardan Ekiz, Melis; Gunay, Gokhan; Tekinay, Turgay; Tekinay, Ayse B; Guler, Mustafa O

    2016-05-11

    Oligonucleotides are promising drug candidates due to the exceptionally high specificity they exhibit toward their target DNA and RNA sequences. However, their poor pharmacokinetic and pharmacodynamic properties, in conjunction with problems associated with their internalization by cells, necessitates their delivery through specialized carrier systems for efficient therapy. Here, we investigate the effects of carrier morphology on the cellular internalization mechanisms of oligonucleotides by using self-assembled fibrous or spherical peptide nanostructures. Size and geometry were both found to be important parameters for the oligonucleotide internalization process; direct penetration was determined to be the major mechanism for the internalization of nanosphere carriers, whereas nanofibers were internalized by clathrin- and dynamin-dependent endocytosis pathways. We further showed that glucose conjugation to carrier nanosystems improved cellular internalization in cancer cells due to the enhanced glucose metabolism associated with oncogenesis, and the internalization of the glucose-conjugated peptide/oligonucleotide complexes was found to be dependent on glucose transporters present on the surface of the cell membrane.

  15. A facile inhibitor screening of SARS coronavirus N protein using nanoparticle-based RNA oligonucleotide.

    PubMed

    Roh, Changhyun

    2012-01-01

    Hundreds of million people worldwide have been infected with severe acute respiratory syndrome (SARS), and the rate of global death from SARS has remarkably increased. Hence, the development of efficient drug treatments for the biological effects of SARS is highly needed. We have previously shown that quantum dots (QDs)-conjugated RNA oligonucleotide is sensitive to the specific recognition of the SARS-associated coronavirus (SARS-CoV) nucleocapsid (N) protein. In this study, we found that a designed biochip could analyze inhibitors of the SARS-CoV N protein using nanoparticle-based RNA oligonucleotide. Among the polyphenolic compounds examined, (-)-catechin gallate and (-)-gallocatechin gallate demonstrated a remarkable inhibition activity on SARS-CoV N protein. (-)-catechin gallate and (-)-gallocatechin gallate attenuated the binding affinity in a concentrated manner as evidenced by QDs-conjugated RNA oligonucleotide on a designed biochip. At a concentration of 0.05 μg mL(-1), (-)-catechin gallate and (-)-gallocatechin gallate showed more than 40% inhibition activity on a nanoparticle-based RNA oligonucleotide biochip system.

  16. Antisense phosphorothioate oligonucleotides: selective killing of the intracellular parasite Leishmania amazonensis.

    PubMed

    Ramazeilles, C; Mishra, R K; Moreau, S; Pascolo, E; Toulmé, J J

    1994-08-16

    We targeted the mini-exon sequence, present at the 5' end of every mRNA of the protozoan parasite Leishmania amazonensis, by phosphorothioate oligonucleotides. A complementary 16-mer (16PS) was able to kill amastigotes--the intracellular stage of the parasite--in murine macrophages in culture. After 24 hr of incubation with 10 microM 16PS, about 30% infected macrophages were cured. The oligomer 16PS acted through antisense hybridization in a sequence-dependent way; no effect on parasites was observed with noncomplementary phosphorothioate oligonucleotides. The antisense oligonucleotide 16PS was a selective killer of the protozoans without any detrimental effect to the host macrophage. Using 16PS linked to a palmitate chain, which enabled it to complex with low density lipoproteins, improved the leishmanicidal efficiency on intracellular amastigotes, probably due to increased endocytosis. Phosphorothioate oligonucleotides complementary to the intron part of the mini-exon pre-RNA were also effective, suggesting that antisense oligomers could prevent trans-splicing in these parasites.

  17. Incorporation of an aldehyde function in oligonucleotides.

    PubMed

    Tilquin, J M; Dechamps, M; Sonveaux, E

    2001-01-01

    A nucleotide-like phosphoramidite building block that has the nucleic base replaced by the tert-butyldimethylsilyl-protected styrene glycol was synthesized. After the automatic synthesis of an oligonucleotide incorporating this synthon, the benzaldehyde function was generated by fluoride deprotection and oxidation by sodium periodate. In a similar manner, an oligonucleotide where a nucleic base was replaced by the (CH2)8CH=O chain was synthesized and conjugated with biotin derivatives.

  18. Efficient self-assembly of DNA-functionalized fluorophores and gold nanoparticles with DNA functionalized silicon surfaces: the effect of oligomer spacers

    PubMed Central

    Milton, James A.; Patole, Samson; Yin, Huabing; Xiao, Qiang; Brown, Tom; Melvin, Tracy

    2013-01-01

    Although strategies for the immobilization of DNA oligonucleotides onto surfaces for bioanalytical and top-down bio-inspired nanobiofabrication approaches are well developed, the effect of introducing spacer molecules between the surface and the DNA oligonucleotide for the hybridization of nanoparticle–DNA conjugates has not been previously assessed in a quantitative manner. The hybridization efficiency of DNA oligonucleotides end-labelled with gold nanoparticles (1.4 or 10 nm diameter) with DNA sequences conjugated to silicon surfaces via hexaethylene glycol phosphate diester oligomer spacers (0, 1, 2, 6 oligomers) was found to be independent of spacer length. To quantify both the density of DNA strands attached to the surfaces and hybridization with the surface-attached DNA, new methodologies have been developed. Firstly, a simple approach based on fluorescence has been developed for determination of the immobilization density of DNA oligonucleotides. Secondly, an approach using mass spectrometry has been created to establish (i) the mean number of DNA oligonucleotides attached to the gold nanoparticles and (ii) the hybridization density of nanoparticle–oligonucleotide conjugates with the silicon surface–attached complementary sequence. These methods and results will be useful for application with nanosensors, the self-assembly of nanoelectronic devices and the attachment of nanoparticles to biomolecules for single-molecule biophysical studies. PMID:23361467

  19. A Novel Bioinformatics Strategy to Analyze Microbial Big Sequence Data for Efficient Knowledge Discovery: Batch-Learning Self-Organizing Map (BLSOM).

    PubMed

    Iwasaki, Yuki; Abe, Takashi; Wada, Kennosuke; Wada, Yoshiko; Ikemura, Toshimichi

    2013-11-20

    With the remarkable increase of genomic sequence data of microorganisms, novel tools are needed for comprehensive analyses of the big sequence data available. The self-organizing map (SOM) is an effective tool for clustering and visualizing high-dimensional data, such as oligonucleotide composition on one map. By modifying the conventional SOM, we developed batch-learning SOM (BLSOM), which allowed classification of sequence fragments (e.g., 1 kb) according to phylotypes, solely depending on oligonucleotide composition. Metagenomics studies of uncultivable microorganisms in clinical and environmental samples should allow extensive surveys of genes important in life sciences. BLSOM is most suitable for phylogenetic assignment of metagenomic sequences, because fragmental sequences can be clustered according to phylotypes, solely depending on oligonucleotide composition. We first constructed oligonucleotide BLSOMs for all available sequences from genomes of known species, and by mapping metagenomic sequences on these large-scale BLSOMs, we can predict phylotypes of individual metagenomic sequences, revealing a microbial community structure of uncultured microorganisms, including viruses. BLSOM has shown that influenza viruses isolated from humans and birds clearly differ in oligonucleotide composition. Based on this host-dependent oligonucleotide composition, we have proposed strategies for predicting directional changes of virus sequences and for surveilling potentially hazardous strains when introduced into humans from non-human sources.

  20. Charge-induced geometrical reorganization of DNA oligonucleotides studied by tandem mass spectrometry and ion mobility.

    PubMed

    Ickert, Stefanie; Hofmann, Johanna; Riedel, Jens; Beck, Sebastian; Pagel, Kevin; Linscheid, Michael W

    2018-04-01

    Mass spectrometry is applied as a tool for the elucidation of molecular structures. This premises that gas-phase structures reflect the original geometry of the analytes, while it requires a thorough understanding and investigation of the forces controlling and affecting the gas-phase structures. However, only little is known about conformational changes of oligonucleotides in the gas phase. In this study, a series of multiply charged DNA oligonucleotides (n = 15-40) has been subjected to a comprehensive tandem mass spectrometric study to unravel transitions between different ionic gas-phase structures. The nucleobase sequence and the chain length were varied to gain insights into their influence on the geometrical oligonucleotide organization. Altogether, 23 oligonucleotides were analyzed using collision-induced fragmentation. All sequences showed comparable correlation regarding the characteristic collision energy. This value that is also a measure for stability, strongly correlates with the net charge density of the precursor ions. With decreasing charge of the oligonucleotides, an increase in the fragmentation energy was observed. At a distinct charge density, a deviation from linearity was observed for all studied species, indicating a structural reorganization. To corroborate the proposed geometrical change, collisional cross-sections of the oligonucleotides at different charge states were determined using ion mobility-mass spectrometry. The results clearly indicate that an increase in charge density and thus Coulomb repulsion results in the transition from a folded, compact form to elongated structures of the precursor ions. Our data show this structural transition to depend mainly on the charge density, whereas sequence and size do not have an influence.

  1. Desulfurization of phosphorothioate oligonucleotides via the sulfur-by-oxygen replacement induced by the hydroxyl radical during negative electrospray ionization mass spectrometry.

    PubMed

    Wu, Lianming; White, David E; Ye, Connie; Vogt, Frederick G; Terfloth, Gerald J; Matsuhashi, Hayao

    2012-07-01

    While the occurrence of desulfurization of phosphorothioate oligonucleotides in solution is well established, this study represents the first attempt to investigate the basis of the unexpected desulfurization via the net sulfur-by-oxygen (S-O) replacement during negative electrospray ionization (ESI). The current work, facilitated by quantitative mass deconvolution, demonstrates that considerable desulfurization can take place even under common negative ESI operating conditions. The extent of desulfurization is dependent on the molar phosphorothioate oligonucleotide-to-hydroxyl radical ratio, which is consistent with the corona discharge-induced origin of the hydroxyl radical leading to the S-O replacement. This hypothesis is supported by the fact that an increase of the high-performance liquid chromatography (HPLC) flow rate and the on-column concentration of a phosphorothioate oligonucleotide, as well as a decrease of the electrospray voltage reduce the degree of desulfurization. Comparative LC-tandem mass spectrometry (MS/MS) sequencing of a phosphorothioate oligonucleotide and its corresponding desulfurization product revealed evidence that the S-O replacement occurs at multiple phosphorothioate internucleotide linkage sites. In practice, the most convenient and effective strategy for minimizing this P = O artifact is to increase the LC flow rate and the on-column concentration of phosphorothioate oligonucleotides. Another approach to mitigate possible detrimental effects of the undesired desulfurization is to operate the ESI source at a very low electrospray voltage to diminish the corona discharge; however this will significantly compromise sensitivity when analyzing the low-level P = O impurities in phosphorothioate oligonucleotides. Copyright © 2012 John Wiley & Sons, Ltd.

  2. A sense oligonucleotide to inducible nitric oxide synthase mRNA increases the survival rate of rats in septic shock.

    PubMed

    Okuyama, Tetsuya; Nakatake, Richi; Kaibori, Masaki; Okumura, Tadayoshi; Kon, Masanori; Nishizawa, Mikio

    2018-01-30

    Natural antisense transcripts (asRNAs) that do not encode proteins are transcribed from rat, mouse, and human genes, encoding inducible nitric oxide synthase (iNOS), which catalyzes the production of the inflammatory mediator nitric oxide (NO). In septic shock, NO is excessively produced in hepatocytes and macrophages. The iNOS asRNA interacts with and stabilizes iNOS mRNA. We found that single-stranded 'sense' oligonucleotides corresponding to the iNOS mRNA sequence reduced iNOS mRNA levels by interfering with the mRNA-asRNA interactions in rat hepatocytes. The iNOS sense oligonucleotides that were substituted with phosphorothioate bonds and locked nucleic acids efficiently decreased the levels of iNOS mRNA and iNOS protein. In this study, the gene expression patterns in the livers of two endotoxemia model rats with acute liver failure were compared. Next, we optimized the sequence and modification of the iNOS sense oligonucleotides in interleukin 1β-treated rat hepatocytes. When a sense oligonucleotide was simultaneously administered with d-galactosamine and bacterial lipopolysaccharide (LPS) to rats, their survival rate significantly increased compared to the rats administered d-galactosamine and LPS alone. In the livers of the sense oligonucleotide-administered rats, apoptosis in the hepatocytes markedly decreased. These results suggest that natural antisense transcript-targeted regulation technology using iNOS sense oligonucleotides may be used to treat human inflammatory diseases, such as sepsis and septic shock. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Tripathy, Sushant

    Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing oligonucleotides conjugated HDL NPs in regulating the expression and function of VEGFR2 in cultured endothelial cells. Finally, the efficacy of the conjugates in two animal models of angiogenesis is presented.

  4. A novel method for size uniform 200nm particles: multimetallic particles and in vitro gene delivery

    NASA Astrophysics Data System (ADS)

    Mair, Lamar; Ford, Kris; Superfine, Richard

    2008-10-01

    We report on the fabrication of arrays of mono- and multimetallic particles via metal evaporation onto lithographically patterned posts. Metal particles evaporated on cylindrical structures 0.20μm in diameter and 0.33μm tall are released via photoresist dissolution, resulting in freely suspended, shape defined particles. These Post-Particles have highly tunable composition, as demonstrated by our deposition of five different multimetallic particle blends. We calculate the susceptibility and magnetization of 200nm Fe particles in an applied 0.081T magnetic field. In order to evaluate their usefulness as magnetofection agents an antisense oligonucleotide designed to correct the aberrant splicing of enhanced green fluorescent protein mRNA was successfully attached to Fe Post-Particles via a polyethyleneimine linker and transfected into a modified HeLa cell line.

  5. DNA Microarray for Detection of Macrolide Resistance Genes

    PubMed Central

    Cassone, Marco; D'Andrea, Marco M.; Iannelli, Francesco; Oggioni, Marco R.; Rossolini, Gian Maria; Pozzi, Gianni

    2006-01-01

    A DNA microarray was developed to detect bacterial genes conferring resistance to macrolides and related antibiotics. A database containing 65 nonredundant genes selected from publicly available DNA sequences was constructed and used to design 100 oligonucleotide probes that could specifically detect and discriminate all 65 genes. Probes were spotted on a glass slide, and the array was reacted with DNA templates extracted from 20 reference strains of eight different bacterial species (Streptococcus pneumoniae, Streptococcus pyogenes, Enterococcus faecalis, Enterococcus faecium, Staphylococcus aureus, Staphylococcus haemolyticus, Escherichia coli, and Bacteroides fragilis) known to harbor 29 different macrolide resistance genes. Hybridization results showed that probes reacted with, and only with, the expected DNA templates and allowed discovery of three unexpected genes, including msr(SA) in B. fragilis, an efflux gene that has not yet been described for gram-negative bacteria. PMID:16723563

  6. Depletion of Unwanted Nucleic Acid Templates by Selective Cleavage: LNAzymes, Catalytically Active Oligonucleotides Containing Locked Nucleic Acids, Open a New Window for Detecting Rare Microbial Community Members

    PubMed Central

    Dolinšek, Jan; Dorninger, Christiane; Lagkouvardos, Ilias; Wagner, Michael

    2013-01-01

    Many studies of molecular microbial ecology rely on the characterization of microbial communities by PCR amplification, cloning, sequencing, and phylogenetic analysis of genes encoding rRNAs or functional marker enzymes. However, if the established clone libraries are dominated by one or a few sequence types, the cloned diversity is difficult to analyze by random clone sequencing. Here we present a novel approach to deplete unwanted sequence types from complex nucleic acid mixtures prior to cloning and downstream analyses. It employs catalytically active oligonucleotides containing locked nucleic acids (LNAzymes) for the specific cleavage of selected RNA targets. When combined with in vitro transcription and reverse transcriptase PCR, this LNAzyme-based technique can be used with DNA or RNA extracts from microbial communities. The simultaneous application of more than one specific LNAzyme allows the concurrent depletion of different sequence types from the same nucleic acid preparation. This new method was evaluated with defined mixtures of cloned 16S rRNA genes and then used to identify accompanying bacteria in an enrichment culture dominated by the nitrite oxidizer “Candidatus Nitrospira defluvii.” In silico analysis revealed that the majority of publicly deposited rRNA-targeted oligonucleotide probes may be used as specific LNAzymes with no or only minor sequence modifications. This efficient and cost-effective approach will greatly facilitate tasks such as the identification of microbial symbionts in nucleic acid preparations dominated by plastid or mitochondrial rRNA genes from eukaryotic hosts, the detection of contaminants in microbial cultures, and the analysis of rare organisms in microbial communities of highly uneven composition. PMID:23263968

  7. Epigenetic programming alterations in alligators from environmentally contaminated lakes

    PubMed Central

    Guillette, Louis J.; Parrott, Benjamin B.; Nilsson, Eric; Haque, M.M.; Skinner, Michael K.

    2016-01-01

    Previous studies examining the reproductive health of alligators in Florida lakes indicate that a variety of developmental and health impacts can be attributed to a combination of environmental quality and exposures to environmental contaminants. The majority of these environmental contaminants have been shown to disrupt normal endocrine signaling. The potential that these environmental conditions and contaminants may influence epigenetic status and correlate to the health abnormalities was investigated in the current study. The red blood cell (RBC) (erythrocyte) in the alligator is nucleated so was used as an easily purified marker cell to investigate epigenetic programming. RBCs were collected from adult male alligators captured at three sites in Florida, each characterized by varying degrees of contamination. While Lake Woodruff (WO) has remained relatively pristine, Lake Apopka (AP) and Merritt Island (MI) convey exposures to different suites of contaminants. DNA was isolated and methylated DNA immuno-precipitation (MeDIP) was used to isolate methylated DNA that was then analyzed in a competitive hybridization using a genome-wide alligator tiling array for a MeDIP-Chip analysis. Pairwise comparisons of alligators from AP and MI to WO revealed alterations in the DNA methylome. The AP vs. WO comparison identified 85 differential DNA methylation regions (DMRs) with ⩾3 adjacent oligonucleotide tiling array probes and 15,451 DMRs with a single oligo probe analysis. The MI vs. WO comparison identified 75 DMRs with the ⩾3 oligo probe and 17,411 DMRs with the single oligo probe analysis. There was negligible overlap between the DMRs identified in AP vs. WO and MI vs. WO comparisons. In both comparisons DMRs were primarily associated with CpG deserts which are regions of low CpG density (1–2 CpG/100 bp). Although the alligator genome is not fully annotated, gene associations were identified and correlated to major gene class functional categories and pathways of endocrine relevance. Observations demonstrate that environmental quality may be associated with epigenetic programming and health status in the alligator. The epigenetic alterations may provide biomarkers to assess the environmental exposures and health impacts on these populations of alligators. PMID:27080547

  8. A CpG Oligonucleotide Can Protect Mice From a Low Aerosol Challenge Dose of Burkholderia mallei

    DTIC Science & Technology

    2006-03-01

    may protect victims of a biological attack from glanders . Burkholderia mallei , the causative agent of glanders , natu- rally infects equines, but it can...attack from glanders . 15. SUBJECT TERMS Burkholderia mallei , glanders , oligonucleotides, CpG motif, efficacy, laboratory animals, mice 16...Society for Microbiology. All Rights Reserved. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei David M

  9. Fluorescence energy transfer as a probe for nucleic acid structures and sequences.

    PubMed Central

    Mergny, J L; Boutorine, A S; Garestier, T; Belloc, F; Rougée, M; Bulychev, N V; Koshkin, A A; Bourson, J; Lebedev, A V; Valeur, B

    1994-01-01

    The primary or secondary structure of single-stranded nucleic acids has been investigated with fluorescent oligonucleotides, i.e., oligonucleotides covalently linked to a fluorescent dye. Five different chromophores were used: 2-methoxy-6-chloro-9-amino-acridine, coumarin 500, fluorescein, rhodamine and ethidium. The chemical synthesis of derivatized oligonucleotides is described. Hybridization of two fluorescent oligonucleotides to adjacent nucleic acid sequences led to fluorescence excitation energy transfer between the donor and the acceptor dyes. This phenomenon was used to probe primary and secondary structures of DNA fragments and the orientation of oligodeoxynucleotides synthesized with the alpha-anomers of nucleoside units. Fluorescence energy transfer can be used to reveal the formation of hairpin structures and the translocation of genes between two chromosomes. PMID:8152922

  10. Preparation of a DNA matrix via an electrochemically directed copolymerization of pyrrole and oligonucleotides bearing a pyrrole group.

    PubMed Central

    Livache, T; Roget, A; Dejean, E; Barthet, C; Bidan, G; Téoule, R

    1994-01-01

    A new methodology for the preparation of addressed DNA matrices is described. The process includes an electrochemically directed copolymerization of pyrrole and oligonucleotides bearing on their 5' end a pyrrole moiety introduced by phosphoramidite chemistry. The electro-controlled synthesis of the copolymer (poly-pyrrole) gives, in one step, a solid conducting film deposited on the surface of an electrode. The resulting polymer consists of pyrrole chains bearing covalently linked oligonucleotide. The polymer growth is limited to the electrode surface, so that it is possible to prepare a DNA matrix on a multiple electrode device by successive copolymerizations. A support bearing four oligonucleotides was used to detect three ras mutations on a synthetic DNA fragment. PMID:8065902

  11. The Pharmaceutical Industry in 2016. An Analysis of FDA Drug Approvals from a Perspective of the Molecule Type.

    PubMed

    Torre, Beatriz G de la; Albericio, Fernando

    2017-02-27

    This is an analysis from a chemical point of view of the 22 drugs accepted by the FDA during 2016. The different drugs from the 2016 "harvest" have been classified according to their chemical structure: antibodies; TIDES (oligonucleotides and peptides); amino acids and natural products; drug combination; and small molecules.

  12. Spiky gold shells on magnetic particles for DNA biosensors.

    PubMed

    Bedford, Erin E; Boujday, Souhir; Pradier, Claire-Marie; Gu, Frank X

    2018-05-15

    Combined separation and detection of biomolecules has the potential to speed up and improve the sensitivity of disease detection, environmental testing, and biomolecular analysis. In this work, we synthesized magnetic particles coated with spiky nanostructured gold shells and used them to magnetically separate out and detect oligonucleotides using SERS. The distance dependence of the SERS signal was then harnessed to detect DNA hybridization using a Raman label bound to a hairpin probe. The distance of the Raman label from the surface increased upon complementary DNA hybridization, leading to a decrease in signal intensity. This work demonstrates the use of the particles for combined separation and detection of oligonucleotides without the use of an extrinsic tag or secondary hybridization step. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Monovalent Streptavidin that Senses Oligonucleotides**

    PubMed Central

    Wang, Jingxian; Kostic, Natasa; Stojanovic, Milan N.

    2013-01-01

    We report a straightforward chemical route to monovalent streptavidin, a valuable reagent for imaging. The one-step process is based on a (tris)biotinylated-oligonucleotide blocking three of streptavidin’s four biotin binding sites. Further, the complex is highly sensitive to single-base differences - whereby perfectly matched oligonucleotides trigger dissociation of the biotin-streptavidin interaction at higher rates than single-base mismatches. Unique properties and ease of synthesis open wide opportunities for practical applications in imaging and biosensing. PMID:23606329

  14. Ferrocene conjugated oligonucleotide for electrochemical detection of DNA base mismatch.

    PubMed

    Hasegawa, Yusuke; Takada, Tadao; Nakamura, Mitsunobu; Yamana, Kazushige

    2017-08-01

    We describe the synthesis, binding, and electrochemical properties of ferrocene-conjugated oligonucleotides (Fc-oligos). The key step for the preparation of Fc-oligos contains the coupling of vinylferrocene to 5-iododeoxyuridine via Heck reaction. The Fc-conjugated deoxyuridine phosphoramidite was used in the Fc-oligonucleotide synthesis. We show that thiol-modified Fc-oligos deposited onto gold electrodes possess potential ability in electrochemical detection of DNA base mismatch. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Systemic peptide-mediated oligonucleotide therapy improves long-term survival in spinal muscular atrophy

    PubMed Central

    Hazell, Gareth; Shabanpoor, Fazel; Saleh, Amer F.; Bowerman, Melissa; Meijboom, Katharina E.; Zhou, Haiyan; Muntoni, Francesco; Talbot, Kevin; Gait, Michael J.; Wood, Matthew J. A.

    2016-01-01

    The development of antisense oligonucleotide therapy is an important advance in the identification of corrective therapy for neuromuscular diseases, such as spinal muscular atrophy (SMA). Because of difficulties of delivering single-stranded oligonucleotides to the CNS, current approaches have been restricted to using invasive intrathecal single-stranded oligonucleotide delivery. Here, we report an advanced peptide-oligonucleotide, Pip6a-morpholino phosphorodiamidate oligomer (PMO), which demonstrates potent efficacy in both the CNS and peripheral tissues in severe SMA mice following systemic administration. SMA results from reduced levels of the ubiquitously expressed survival motor neuron (SMN) protein because of loss-of-function mutations in the SMN1 gene. Therapeutic splice-switching oligonucleotides (SSOs) modulate exon 7 splicing of the nearly identical SMN2 gene to generate functional SMN protein. Pip6a-PMO yields SMN expression at high efficiency in peripheral and CNS tissues, resulting in profound phenotypic correction at doses an order-of-magnitude lower than required by standard naked SSOs. Survival is dramatically extended from 12 d to a mean of 456 d, with improvement in neuromuscular junction morphology, down-regulation of transcripts related to programmed cell death in the spinal cord, and normalization of circulating insulin-like growth factor 1. The potent systemic efficacy of Pip6a-PMO, targeting both peripheral as well as CNS tissues, demonstrates the high clinical potential of peptide-PMO therapy for SMA. PMID:27621445

  16. Synthesis and fluorescence studies of multiple labeled oligonucleotides containing dansyl fluorophore covalently attached at 2'-terminus of cytidine via carbamate linkage.

    PubMed

    Misra, Arvind; Mishra, Satyendra; Misra, Krishna

    2004-01-01

    Synthesis of modified oligonucleotides in which the specific cytidine nucleoside analogues linked at 2'-OH position via a carbamate bond with an amino ethyl derivative of dansyl fluorophore is reported. For the multiple labeling of oligonucleotides, a strategy involving prelabeling at the monomeric level followed by solid phase assembly of oligonucleotides to obtain regiospecifically labeled probes has been described. The labeled monomer was phosphitylated using 2-cyanoethyl-N,N,N',N'-tetraisopropyl-phosphoramidite (Bis-reagent) and pyridiniumtrifluoro acetate (Py.TFA) as an activator. To ascertain the minimal number of labeled monomers required for a specific length of oligonucleotide for detection and also to assess the effect of carbamate linkage on hybridization, hexamer and 20-mer sequences were selected. Both were labeled with 1, 2, and 3 monomers at the 5'-end and hybridized with normal (unmodified) complementary sequences. As compared to midsequence or 3'-terminal labeling reported earlier, the 5'-terminal labeling has been found to have minimal contact-mediated quenching on duplex formation. This may be due to complementary deoxyguanosine (dG) rich oligonucleotide sequences or CG base pairs at a terminus that is known to yield stronger binding. This is one reason for selecting cytidine for labeling. The results may aid rational design of multiple fluorescent DNA probes for nonradioactive detection of nucleic acids.

  17. Requirement of the cyclic adenosine monophosphate response element-binding protein for hepatitis B virus replication.

    PubMed

    Kim, Bo Kyung; Lim, Seoung Ok; Park, Yun Gyu

    2008-08-01

    The cyclic adenosine monophosphate-response element (CRE)-transcription factor complex participates in the regulation of viral gene expression and pathologic processes caused by various viruses. The hepatitis B virus (HBV) enhancer I directs liver-specific transcription of viral genes and contains a CRE sequence (HBV-CRE); however, whether the HBV-CRE and CRE-binding protein (CREB) are required for the HBV life cycle remains to be determined. This study was designed to investigate the role of CREB in HBV replication and gene expression. Sequence-comparison analysis of 984 HBVs reported worldwide showed that the HBV-CRE sequence is highly conserved, indicating the possibility that it plays an important role in the HBV life cycle. The binding of CREB to the HBV-CRE site was markedly inhibited by oligonucleotides containing HBV-CRE and consensus CRE sequences in vitro and in vivo. The HBV promoter activity was demonstrated to be dependent upon the transactivation activity of CREB. Treatment with CRE decoy oligonucleotides reduced HBV promoter activity, and this was reversed by CREB overexpression. The levels of viral transcripts, DNA, and antigens were remarkably decreased in response to the overexpression of CREB mutants or treatment with the CRE decoy oligonucleotides, whereas enhancing CREB activity increased the levels of viral transcripts. In addition, introduction of a three-base mutation into the HBV-CRE led to a marked reduction in HBV messenger RNA synthesis. Taken together, our results demonstrate that both replication and gene expression of HBV require a functional CREB and HBV-CRE. We have also demonstrated that CRE decoy oligonucleotides and the overexpression of CREB mutants can effectively block the HBV life cycle, suggesting that interventions against CREB activity could provide a new avenue to treat HBV infection.

  18. Two cis elements collaborate to spatially repress transcription from a sea urchin promoter

    NASA Technical Reports Server (NTRS)

    Frudakis, T. N.; Wilt, F.

    1995-01-01

    The expression pattern of many territory-specific genes in metazoan embryos is maintained by an active process of negative spatial regulation. However, the mechanism of this strategy of gene regulation is not well understood in any system. Here we show that reporter constructs containing regulatory sequence for the SM30-alpha gene of Stronglyocentrotus purpuratus are expressed in a pattern congruent with that of the endogenous SM30 gene(s), largely as a result of active transcriptional repression in cell lineages in which the gene is not normally expressed. Chloramphenicol acetyl transferase assays of deletion constructs from the 2600-bp upstream region showed that repressive elements were present in the region from -1628 to -300. In situ hybridization analysis showed that the spatial fidelity of expression was severely compromised when the region from -1628 to -300 was deleted. Two highly repetitive sequence motifs, (G/A/C)CCCCT and (T/C)(T/A/C)CTTTT(T/A/C), are present in the -1628 to -300 region. Representatives of these elements were analyzed by gel mobility shift experiments and were found to interact specifically with protein in crude nuclear extracts. When oligonucleotides containing either sequence element were co-injected with a correctly regulated reporter as potential competitors, the reporter was expressed in inappropriate cells. When composite oligonucleotides, containing both sequence elements, were fused to a misregulated reporter, the expression of the reporter in inappropriate cells was suppressed. Comparison of composite oligonucleotides with oligonucleotides containing single constituent elements show that both sequence elements are required for effective spatial regulation. Thus, both individual elements are required, but only a composite element containing both elements is sufficient to function as a tissue-specific repressive element.

  19. A common cognitive, psychiatric, and dysmorphic phenotype in carriers of NRXN1 deletion

    PubMed Central

    Viñas-Jornet, Marina; Esteba-Castillo, Susanna; Gabau, Elisabeth; Ribas-Vidal, Núria; Baena, Neus; San, Joan; Ruiz, Anna; Coll, Maria Dolors; Novell, Ramon; Guitart, Miriam

    2014-01-01

    Deletions in the 2p16.3 region that includes the neurexin (NRXN1) gene are associated with intellectual disability and various psychiatric disorders, in particular, autism and schizophrenia. We present three unrelated patients, two adults and one child, in whom we identified an intragenic 2p16.3 deletion within the NRXN1 gene using an oligonucleotide comparative genomic hybridization array. The three patients presented dual diagnosis that consisted of mild intellectual disability and autism and bipolar disorder. Also, they all shared a dysmorphic phenotype characterized by a long face, deep set eyes, and prominent premaxilla. Genetic analysis of family members showed two inherited deletions. A comprehensive neuropsychological examination of the 2p16.3 deletion carriers revealed the same phenotype, characterized by anxiety disorder, borderline intelligence, and dysexecutive syndrome. The cognitive pattern of dysexecutive syndrome with poor working memory and reduced attention switching, mental flexibility, and verbal fluency was the same than those of the adult probands. We suggest that in addition to intellectual disability and psychiatric disease, NRXN1 deletion is a risk factor for a characteristic cognitive and dysmorphic profile. The new cognitive phenotype found in the 2p16.3 deletion carriers suggests that 2p16.3 deletions might have a wide variable expressivity instead of incomplete penetrance. PMID:25614873

  20. The spliced leader RNA gene array in phloem-restricted plant trypanosomatids (Phytomonas) partitions into two major groupings: epidemiological implications.

    PubMed

    Dollet, M; Sturm, N R; Campbell, D A

    2001-03-01

    The arbitrary genus Phytomonas includes a biologically diverse group of kinetoplastids that live in a wide variety of plant environments. To understand better the subdivisions within the phytomonads and the variability within groups, the exon, intron and non-transcribed spacer sequences of the spliced leader RNA gene were compared among isolates of the phloem-restricted members. A total of 29 isolates associated with disease in coconut, oil palm and red ginger (Alpinia purpurata, Zingibreaceae) were examined, all originating from plantations in South America and the Caribbean over a 12-year period. Analysis of non-transcribed spacer sequences revealed 2 main groups, I and II; group II could be further subdivided into 2 subgroups, IIa and Ilb. Three classes of spliced leader (SL) RNA gene were seen, with SLI corresponding to group I, SLIIa to group lIa, and SLIIb to group IIb. Two isolates showed some characteristics of both major groups. Group-specific oligonucleotide probes for hybridization studies were tested, and a multiplex amplification scheme was devised to allow direct differentiation between the 2 major groups of phloem-restricted Phytomonas. These results provide tools for diagnostic and molecular epidemiology of plant trypanosomes that are pathogenic for commercially important flowers and palms.

  1. Gain of GRHL2 is associated with early recurrence of hepatocellular carcinoma.

    PubMed

    Tanaka, Yasuo; Kanai, Fumihiko; Tada, Motohisa; Tateishi, Ryosuke; Sanada, Masashi; Nannya, Yasuhito; Ohta, Miki; Asaoka, Yoshinari; Seto, Motoko; Shiina, Shuichiro; Yoshida, Haruhiko; Kawabe, Takao; Yokosuka, Osamu; Ogawa, Seishi; Omata, Masao

    2008-11-01

    The aim of this study is to identify genomic changes that might be implicated in hepatocellular carcinoma (HCC) progression, and evaluate the associations with clinico-pathological features. The genomic DNA of 17 hepatoma cell lines was analyzed using Affymetrix GeneChip Human Mapping 50K high-density oligonucleotide arrays. We selected representative genes from recurrent amplified regions and measured the copy number of these genes in 70 HCC clinical samples. We found 10 recurrent high-grade gain regions spanning less than 3 Mb in at least two hepatoma cell lines, and selected 10 representative genes. The copy number was almost normal in non-cancerous tissue and frequently amplified in Edmondson grade II or III HCC compared to Edmondson grade I HCC. Gain of TAX1BP1 in 7p15.2-1 was associated with larger tumor size and positivity of HCV antibody, and gain of CCND1 in 11q13.2-3 was associated with larger tumor size by multivariate analysis. Furthermore, a gain of GRHL2 in 8q22.3 was associated with early recurrence of HCC, controlling for clinical parameters. Decreased GRHL2 expression by RNA interference inhibits the growth of hepatoma cells, suggesting its association with cell proliferation. A gain of GRHL2 might be a predictive marker for HCC recurrence.

  2. A reliable confirmation of the chemical structure of synthetic oligonucleotides: Detection of active protons in DNA oligomers by low-temperature FT infrared spectroscopy

    NASA Astrophysics Data System (ADS)

    Rozenberg, M.; Shoham, G.

    2009-01-01

    Cooling the samples allowed us to characterize solid oligonucleotides such as dimers, trimers and pentamers of cytidine, for the first time, in the IR range of the out-of-plane bending molecular modes (1000-400 cm -1) at 20 K. Especially interesting are the narrow IR bands of the out-of-plane bending ν4 NH 2 proton mode, which are apparently invisible at room temperature. This unequivocally defined and well-resolved NH 2 bending band should provide important information on the exact chemical form and hydrogen bonding interactions of cytidine amine groups. As such, this unique IR spectroscopy is suggested as a practical analytical tool to validate and characterize synthetic DNA bases and oligonucleotides. Using an approach of this type it was found that desalted oligonucleotide samples of the same nominal composition, but which had been produced by three different manufacturers, differ significantly in their IR spectra. These data suggest that the presumably identical oligonucleotides are in fact different, at least with respect to the content and nature of their NH protons.

  3. A reliable confirmation of the chemical structure of synthetic oligonucleotides: detection of active protons in DNA oligomers by low-temperature FT infrared spectroscopy.

    PubMed

    Rozenberg, M; Shoham, G

    2009-01-01

    Cooling the samples allowed us to characterize solid oligonucleotides such as dimers, trimers and pentamers of cytidine, for the first time, in the IR range of the out-of-plane bending molecular modes (1000-400 cm(-1)) at 20K. Especially interesting are the narrow IR bands of the out-of-plane bending nu(4) NH(2) proton mode, which are apparently invisible at room temperature. This unequivocally defined and well-resolved NH(2) bending band should provide important information on the exact chemical form and hydrogen bonding interactions of cytidine amine groups. As such, this unique IR spectroscopy is suggested as a practical analytical tool to validate and characterize synthetic DNA bases and oligonucleotides. Using an approach of this type it was found that desalted oligonucleotide samples of the same nominal composition, but which had been produced by three different manufacturers, differ significantly in their IR spectra. These data suggest that the presumably identical oligonucleotides are in fact different, at least with respect to the content and nature of their NH protons.

  4. Chimeric RNase H–Competent Oligonucleotides Directed to the HIV-1 Rev Response Element

    PubMed Central

    Prater, Chrissy E.; Saleh, Anthony D.; Wear, Maggie P.; Miller, Paul S.

    2007-01-01

    Chimeric oligo-2′-O-methylribonucleotides containing centrally located patches of contiguous 2′-deoxyribonucleotides and terminating in a nuclease resistant 3′-methylphosphonate internucleotide linkage were prepared. The oligonucleotides were targeted to the 3′-side of HIV Rev response element (RRE) stem-loop IIB RNA, which is adjacent to the high affinity Rev protein binding site and is critical to virus function. Thermal denaturation experiments showed that chimeric oligonucleotides form very stable duplexes with a complementary single-stranded RNA, and gel electrophoretic mobility shift assays (EMSA) showed that they bind with high affinity and specificity to RRE stem-loop II RNA (KD approximately 200 nM). The chimeric oligonucleotides promote RNase H-mediated hydrolysis of RRE stem-loop II RNA and have half lives exceeding 24 h when incubated in cell culture medium containing 10% fetal calf serum. One of the chimeric oligonucleotides inhibited RRE mediated expression of chloramphenicol acetyl transferase (CAT) approximately 60% at a concentration of 300 nM in HEK 293T cells co-transfected with p-RRE/CAT and p-Rev mammalian expression vectors. PMID:17566743

  5. Oligonucleotide-Gold Nanoparticle Networks for Detection of Cryptosporidium parvum Heat Shock Protein 70 mRNA ▿

    PubMed Central

    Javier, David J.; Castellanos-Gonzalez, Alejandro; Weigum, Shannon E.; White, A. Clinton; Richards-Kortum, Rebecca

    2009-01-01

    We report on a novel strategy for the detection of mRNA targets derived from Cryptosporidium parvum oocysts by the use of oligonucleotide-gold nanoparticles. Gold nanoparticles are functionalized with oligonucleotides which are complementary to unique sequences present on the heat shock protein 70 (HSP70) DNA/RNA target. The results indicate that the presence of HPS70 targets of increasing complexity causes the formation of oligonucleotide-gold nanoparticle networks which can be visually monitored via a simple colorimetric readout measured by a total internal reflection imaging setup. Furthermore, the induced expression of HSP70 mRNA in Cryptosporidium parvum oocysts via a simple heat shock process provides nonenzymatic amplification such that the HSP70 mRNA derived from as few as 5 × 103 purified C. parvum oocysts was successfully detected. Taken together, these results support the use of oligonucleotide-gold nanoparticles for the molecular diagnosis of cryptosporidiosis, offering new opportunities for the further development of point-of-care diagnostic assays with low-cost, robust reagents and simple colorimetric detection. PMID:19828740

  6. Safety of antisense oligonucleotide and siRNA-based therapeutics.

    PubMed

    Chi, Xuan; Gatti, Philip; Papoian, Thomas

    2017-05-01

    Oligonucleotide-based therapy is an active area of drug development designed to treat a variety of gene-specific diseases. Two of the more promising platforms are the antisense oligonucleotides (ASOs) and short interfering RNAs (siRNAs), both of which are often directed against similar targets. In light of recent reports on clinical trials of severe thrombocytopenia with two different ASO drugs and increased peripheral neuropathy with an siRNA drug, we compared and contrasted the specific safety characteristics of these two classes of oligonucleotide therapeutic. The objectives were to assess factors that could contribute to the specific toxicities observed with these two classes of promising drugs, and get a better understanding of the potential mechanism(s) responsible for these rare, but serious, adverse events. Published by Elsevier Ltd.

  7. Incorporation of terminal phosphorothioates into oligonucleotides.

    PubMed Central

    Alefelder, S; Patel, B K; Eckstein, F

    1998-01-01

    Considerable effort has been directed towards studying the structure and function of oligonucleotides and several approaches rely on the attachment of reporter groups to oligonucleotides. We report here the introduction of 3'- and 5'-terminal phosphorothioates into heptameric oligonucleotides and their post-synthetic modification with several reporter groups. The synthesis of terminal phosphorothioates is based on the coupling of a ribonucleoside phosphoramidite at the first or last nucleotide, respectively, which, after sulphurization, is removed by sequential oxidation of the vicinal hydroxyl groups and then beta-elimination. Product formation is of the order of 95%. The ratio of phosphorothioate- versus phosphate-terminated oligodeoxynucleotides as analysed by electrophoresis on a Hg2+gel is in general 85/15. Examples for the reactivity of the terminal phosphorothioates for conjugation with cholesterol, bimane and for sulphydryl exchange are described. PMID:9776763

  8. Targeted self-assembly of functionalized carbon nanotubes on tumors

    DOEpatents

    Scheinberg, David A.; McDevitt, Michael R.; Villa, Carlos H.; Mulvey, J. Justin

    2018-05-22

    Provided herein are methods for delivering a molecule in situ to a cell and for treating a cancer via the in situ delivery. The methods comprise contacting or administering to the cell, as two separate components, a morpholino oligonucleotide comprising a targeting moiety followed by a single wall nanotube construct comprising second morpholino oligonucleotides complementary to the first morpholino oligonucleotides and one or both of a therapeutic or diagnostic payload molecule linked to the single wall nanotube construct. Upon self-assembly of a single wall nanotube complex via hybridization of the first morpholino and second complementary morpholino oligonucleotides at the cell, the payload molecule is delivered. Also provided is the two component self-assembly single wall nanotube system and the single wall nanotube construct comprising the second component.

  9. A facile one-step fluorescence method for the quantitation of low-content single base deamination impurity in synthetic oligonucleotides.

    PubMed

    Su, Xiaoye; Liang, Ruiting; Stolee, Jessica A

    2018-06-05

    Oligonucleotides are being researched and developed as potential drug candidates for the treatment of a broad spectrum of diseases. The characterization of antisense oligonucleotide (ASO) impurities caused by base mutations (e.g. deamination) which are closely related to the target ASO is a significant analytical challenge. Herein, we describe a novel one-step method, utilizing a strategy that combines fluorescence-ON detection with competitive hybridization, to achieve single base mutation quantitation in extensively modified synthetic ASOs. Given that this method is highly specific and sensitive (LoQ = 4 nM), we envision that it will find utility for screening other impurities as well as sequencing modified oligonucleotides. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Pulsatile release of biomolecules from polydimethylsiloxane (PDMS) chips with hydrolytically degradable seals.

    PubMed

    Intra, Janjira; Glasgow, Justin M; Mai, Hoang Q; Salem, Aliasger K

    2008-05-08

    We demonstrate, for the first time, a robust novel polydimethylsiloxane (PDMS) chip that can provide controlled pulsatile release of DNA based molecules, proteins and oligonucleotides without external stimuli or triggers. The PDMS chip with arrays of wells was constructed by replica molding. Poly(lactic acid-co-glycolic acid) (PLGA) polymer films of varying composition and thickness were used as seals to the wells. The composition, molecular weight and thickness of the PLGA films were all parameters used to control the degradation rate of the seals and therefore the release profiles. Degradation of the films followed the PLGA composition order of 50:50 PLGA>75:25 PLGA>85:15 PLGA at all time-points beyond week 1. Scanning electron microscopy images showed that films were initially smooth, became porous and ruptured as the osmotic pressure pushed the degrading PLGA film outwards. Pulsatile release of DNA was controlled by the composition and thickness of the PLGA used to seal the well. Transfection experiments in a model Human Embryonic Kidney 293 (HEK293) cell line showed that plasmid DNA loaded in the wells was functional after pulsatile release in comparison to control plasmid DNA at all time-points. Thicker films degraded faster than thinner films and could be used to fine-tune the release of DNA over day length periods. Finally the PDMS chip was shown to provide repeated sequential release of CpG oligonucleotides and a model antigen, Ovalbumin (OVA), indicating significant potential for this device for vaccinations or applications that require defined complex release patterns of a variety of chemicals, drugs and biomolecules.

  11. Ultrasensitive Hybridization-Based ELISA Method for the Determination of Phosphorodiamidate Morpholino Oligonucleotides in Biological samples.

    PubMed

    Burki, Umar; Straub, Volker

    2017-01-01

    Determining the concentration of oligonucleotide in biological samples such as tissue lysate and serum is essential for determining the biodistribution and pharmacokinetic profile, respectively. ELISA-based assays have shown far greater sensitivities compared to other methods such as HPLC and LC/MS. Here, we describe a novel ultrasensitive hybridization-based ELISA method for quantitating morpholino oligonucleotides in mouse tissue lysate and serum samples. The assay has a linear detection range of 5-250 pM (R2 > 0.99).

  12. Horseradish peroxidase-labeled oligonucleotides and fluorescent tyramides for rapid detection of chromosome-specific repeat sequences.

    PubMed

    van Gijlswijk, R P; Wiegant, J; Vervenne, R; Lasan, R; Tanke, H J; Raap, A K

    1996-01-01

    We present a sensitive and rapid fluorescence in situ hybridization (FISH) strategy for detecting chromosome-specific repeat sequences. It uses horseradish peroxidase (HRP)-labeled oligonucleotide sequences in combination with fluorescent tyramide-based detection. After in situ hybridization, the HRP conjugated to the oligonucleotide probe is used to deposit fluorescently labeled tyramide molecules at the site of hybridization. The method features full chemical synthesis of probes, strong FISH signals, and short processing periods, as well as multicolor capabilities.

  13. VRP09 Reduction of Corneal Scarring Following Blast and Burn Injuries to Cornea Using siRNAs Targeting TGFb and CTGF

    DTIC Science & Technology

    2013-03-01

    oligonucleotide-based drug approaches (better than ribozymes, antisense oligonucleotides ( ASO ), or microRNAs). (4) To accomplish these objectives, we...negative control scrambled ASO (designated NC). The combination of siRNAs T1 and R1 produced a knockdown of ~80% of TGFb1 protein in the conditioned...sequences (antisense oligonucleotides, ASOs ) into rabbit corneal cells and found that technique was very effective in delivering ASOs into the stroma and

  14. VRP09 Reduction of Corneal Scarring Following Blast and Burn Injuries to Cornea Using siRNAs Targeting TGFb and CTGF

    DTIC Science & Technology

    2012-10-01

    selective of all gene-targeted, oligonucleotide-based drug approaches (better than ribozymes, antisense oligonucleotides ( ASO ), or microRNAs).(4) We will...respect to a scrambled siRNA control. For the migration assay, a circular region in the middle of the well was removed using a gel removal solution...oligonucleotides, ASOs ) into rabbit corneal cells and found that technique was very effective in delivering ASOs into the stroma and even into the endothelial cell

  15. Augmenter of liver regeneration: An important intracellular survival factor for hepatocytes☆

    PubMed Central

    Thirunavukkarasu, Chinnasamy; Wang, Lian Fu; Harvey, Stephen A.K.; Watkins, Simon C.; Chaillet, J. Richard; Prelich, John; Starzl, Thomas E.; Gandhi, Chandrashekhar R.

    2010-01-01

    Background/Aims Augmenter of liver regeneration (ALR), a protein synthesized and stored in hepatocytes, is associated with mitochondria, and possesses sulfhydryl oxidase and cytochrome c reductase activities. We sought to determine the effects of ALR depletion in hepatocytes by antisense oligonucleotide transfection. Methods Rat hepatocytes in primary culture were transfected with antisense oligonucleotide for ALR mRNA (ALR-AS) or scrambled oligonucleotide. Various analyses were performed at times up to 24 h after transfection. Results Treatment with ALR-AS caused a decrease in ALR mRNA, cellular depletion of ALR protein primarily from mitochondria, and decreased viability. Flow cytometric analysis of ALR-AS-transfected hepatocytes stained with annexin-Vcy3 and 7-aminoactinomycin D revealed apoptosis as the predominant cause of death up to 6 h; incubation beyond this time resulted in necrosis in addition to apoptosis. ALR-AS-transfection caused release of mitochondrial cytochrome c, activation of caspase-3, profound reduction in the ATP content, and cellular release of LDH. Inhibition of caspase-3 inhibited the early phase of ALR-AS-induced death but not the late phase that included ALR and LDH release. Conclusions These results suggest that ALR is critically important for the survival of hepatocytes by its association with mitochondria and regulation of ATP synthesis. PMID:18272248

  16. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays.

    PubMed

    Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

    2016-01-01

    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.

  17. Development of multiple W/O/W emulsions as dermal carrier system for oligonucleotides: effect of additives on emulsion stability.

    PubMed

    Schmidts, T; Dobler, D; Schlupp, P; Nissing, C; Garn, H; Runkel, F

    2010-10-15

    Multiple water-in-oil-in-water (W/O/W) emulsions are of major interest as potential skin delivery systems for water-soluble drugs like oligonucleotides due to their distinct encapsulation properties. However, multiple emulsions are highly sensitive in terms of variations of the individual components. The presence of osmotic active ingredients in the inner water phase is crucial for the generation of stable multiple emulsions. In order to stabilize the emulsions the influence of NaCl, MgSO(4), glucose and glycine and two cellulose derivatives was investigated. Briefly, multiple W/O/W emulsions using Span 80 as a lipophilic emulsifier and different hydrophilic emulsifiers (PEG-40/50 stearate, steareth-20 and polysorbate 80) were prepared. Stability of the emulsions was analyzed over a period of time using rheological measurements, droplet size observations and conductivity analysis. In this study we show that additives strongly influence the properties stability of multiple emulsions. By increasing the concentration of the osmotic active ingredients, smaller multiple droplets are formed and the viscosity is significantly increased. The thickening agents resulted in a slightly improved stability. The most promising emulsions were chosen and further evaluated for their suitability and compatibility to incorporate a DNAzyme oligonucleotide as active pharmaceutical ingredient. Copyright 2010 Elsevier B.V. All rights reserved.

  18. Next generation 1536-well oligonucleotide synthesizer with on-the-fly dispense.

    PubMed

    Jensen, Michael; Roberts, Lester; Johnson, Andrew; Fukushima, Marilyn; Davis, Ronald

    2014-02-10

    Here we report the development of our Next Generation Automated Multiplexed Oligonucleotide Synthesizer (NG-1536-AMOS), capable of producing 1536 samples in a single run using a multi-well filtered titer plate. With the potential to synthesize up to 3456 samples per plate, we converted the BioRAPTR Flying Reagent Dispenser into an open-well system where spent reagents are drained to waste under vacuum. During synthesis, reagents are delivered on-the-fly to each micro-titer well at volumes ≤5 μl with plate speeds up to 150 mm/s. Using gas-phase cleavage and deprotection, a full plate of 1536 60 mers may be processed with same-day turnaround with an average yield per well at 3.5 nmol. Final product at only $0.00277/base is eluted into a low-volume collection plate for immediate use in downstream application (e.g. Biomek FX for versatile sample handling). Also, crude oligonucleotide quality is comparable to that of commercial synthesis instrumentation, with an error rate on the NG-1536-AMOS platform of 1.53/717 bases. Furthermore, mass spectral analysis on strands synthesized up to 80 bases showed high purity with an average coupling efficiency of 99.5%. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. A target-triggered strand displacement reaction cycle: the design and application in adenosine triphosphate sensing.

    PubMed

    Cheng, Sheng; Zheng, Bin; Wang, Mozhen; Lam, Michael Hon-Wah; Ge, Xuewu

    2014-02-01

    A strand displacement reaction (SDR) system that runs solely on oligonucleotides has been developed for the amplification detection of adenosine triphosphate (ATP). It involves a target-induced SDR and an entropy-driven catalytic cycle of two SDRs with five oligonucleotides, denoted as substrate, fuel, catalyst, C-1, and C-2. Catalyst, released from the ATP aptamer-catalyst duplex by ATP molecule, catalyzes the SDRs to finally form the substrate-fuel duplex. All of the intermediates in the catalytic SDR processes have been identified by polyacrylamide gel electrophoresis (PAGE) analysis. The introduction of ATP into the SDR system will induce the ATP aptamer to form G-quadruplex conformation so as to release catalyst and trigger the SDR cycle. When the substrate and C-2 oligonucleotides were labeled with a carboxyfluorescein (FAM) fluorophore and a 4-([4-(dimethylamino)phenyl]azo)benzoic acid (DABCYL) quencher, this SDR catalytic system exhibited a "turn-on" response for ATP. The condition for detecting ATP, such as Mg²⁺ concentration, has been optimized to afford a detection limit of 20 nM. This work provides an enzyme-free biosensing strategy and has potential application in aptamer-based biosensing. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. Small-scale high-throughput sequencing-based identification of new therapeutic tools in cystic fibrosis.

    PubMed

    Bonini, Jennifer; Varilh, Jessica; Raynal, Caroline; Thèze, Corinne; Beyne, Emmanuelle; Audrezet, Marie-Pierre; Ferec, Claude; Bienvenu, Thierry; Girodon, Emmanuelle; Tuffery-Giraud, Sylvie; Des Georges, Marie; Claustres, Mireille; Taulan-Cadars, Magali

    2015-10-01

    Although 97-99% of CFTR mutations have been identified, great efforts must be made to detect yet-unidentified mutations. We developed a small-scale next-generation sequencing approach for reliably and quickly scanning the entire gene, including noncoding regions, to identify new mutations. We applied this approach to 18 samples from patients suffering from cystic fibrosis (CF) in whom only one mutation had hitherto been identified. Using an in-house bioinformatics pipeline, we could rapidly identify a second disease-causing CFTR mutation for 16 of 18 samples. Of them, c.1680-883A>G was found in three unrelated CF patients. Analysis of minigenes and patients' transcripts showed that this mutation results in aberrantly spliced transcripts because of the inclusion of a pseudoexon. It is located only three base pairs from the c.1680-886A>G mutation (1811+1.6kbA>G), the fourth most frequent mutation in southwestern Europe. We next tested the effect of antisense oligonucleotides targeting splice sites on these two mutations on pseudoexon skipping. Oligonucleotide transfection resulted in the restoration of the full-length, in-frame CFTR transcript, demonstrating the effect of antisense oligonucleotide-induced pseudoexon skipping in CF. Our data confirm the importance of analyzing noncoding regions to find unidentified mutations, which is essential to designing targeted therapeutic approaches.

  1. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays

    PubMed Central

    Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

    2016-01-01

    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download. PMID:26863543

  2. The use of (GTG)5 oligonucleotide as an RAPD primer to type Campylobacter concisus.

    PubMed

    Matsheka, M I; Lastovica, A J; Zappe, H; Elisha, B G

    2006-06-01

    DNA fingerprinting using (GTG)(5) oligonucleotide as a primer in a random amplified polymorphic DNA (RAPD) assay was assessed by typing isolates of Campylobacter concisus strains, collected over a period of 8 years. RAPD analysis using the (GTG)(5) oligonucleotide as a primer was used to type 100 isolates of C. concisus comprising mostly isolates from children with diarrhoea. Using this method, 86% of the isolates were found to be genotypically diverse. Of these heterogeneous isolates, 25 of the strains were also shown to be genetically distinct in a previous study using pulsed field gel electrophoresis. The remaining isolates (14) could be classified into five profile groups based on the DNA fingerprinting patterns. The assay successfully identified epidemiologically linked strains from the unrelated genetically diverse pool of strains. Laboratory RADP typing using the (GTG)(5) primer proved to be useful in distinguishing related strains of C. concisus from a large pool of unrelated strains of this organism. RAPD typing using (GTG)(5) is a simple method that could be used to investigate the epidemiology of C. concisus. The results suggest that homologous lineages of C. concisus may exist within an otherwise heterogeneous species complex. However, these data need to be confirmed using a more robust typing method.

  3. Sub-attomole oligonucleotide and p53 cDNA determinations via a high-resolution surface plasmon resonance combined with oligonucleotide-capped gold nanoparticle signal amplification.

    PubMed

    Yao, Xin; Li, Xin; Toledo, Freddy; Zurita-Lopez, Cecilia; Gutova, Margarita; Momand, Jamil; Zhou, Feimeng

    2006-07-15

    Oligonucleotide (ODN)-capped gold nanoparticles (Au-NPs) were used in a sandwich assay of ODN or polynucleotide by a flow injection surface plasmon resonance (SPR). A carboxylated dextran film was immobilized onto the SPR sensor surface to eliminate nonspecific adsorption of ODN-capped Au-NPs. The tandem use of signal amplification via the adlayer of the ODN-capped Au-NPs and the differential signal detection by the bicell detector on the SPR resulted in a remarkable DNA detection level. A 39-mer target at a quantity as low as 2.1 x 10(-20)mol, corresponding to 1.38 fM in a 15 microl solution, can be measured. To our knowledge, both the concentration and quantity detection levels are the lowest among all the gene analyses conducted with SPR to this point. The method is shown to be reproducible (relative standard deviation values <16%) and to possess high sequence specificity. It is also demonstrated to be viable for sequence-specific p53 cDNA analysis. The successful elimination of nonspecific adsorption of, and the signal amplification by, ODN-capped Au-NPs renders the SPR attractive for cases where the DNA concentration is extremely low and the sample availability is severely limited.

  4. Identification and analysis of recombineering functions from Gram-negative and Gram-positive bacteria and their phages

    PubMed Central

    Datta, Simanti; Costantino, Nina; Zhou, Xiaomei; Court, Donald L.

    2008-01-01

    We report the identification and functional analysis of nine genes from Gram-positive and Gram-negative bacteria and their phages that are similar to lambda (λ) bet or Escherichia coli recT. Beta and RecT are single-strand DNA annealing proteins, referred to here as recombinases. Each of the nine other genes when expressed in E. coli carries out oligonucleotide-mediated recombination. To our knowledge, this is the first study showing single-strand recombinase activity from diverse bacteria. Similar to bet and recT, most of these other recombinases were found to be associated with putative exonuclease genes. Beta and RecT in conjunction with their cognate exonucleases carry out recombination of linear double-strand DNA. Among four of these foreign recombinase/exonuclease pairs tested for recombination with double-strand DNA, three had activity, albeit barely detectable. Thus, although these recombinases can function in E. coli to catalyze oligonucleotide recombination, the double-strand DNA recombination activities with their exonuclease partners were inefficient. This study also demonstrated that Gam, by inhibiting host RecBCD nuclease activity, helps to improve the efficiency of λ Red-mediated recombination with linear double-strand DNA, but Gam is not absolutely essential. Thus, in other bacterial species where Gam analogs have not been identified, double-strand DNA recombination may still work in the absence of a Gam-like function. We anticipate that at least some of the recombineering systems studied here will potentiate oligonucleotide and double-strand DNA-mediated recombineering in their native or related bacteria. PMID:18230724

  5. Characterization of a Genomic Signature of Pregnancy in the Breast

    PubMed Central

    Belitskaya-Lévy, Ilana; Zeleniuch-Jacquotte, Anne; Russo, Jose; Russo, Irma H.; Bordás, Pal; Åhman, Janet; Afanasyeva, Yelena; Johansson, Robert; Lenner, Per; Li, Xiaochun; de Cicco, Ricardo López; Peri, Suraj; Ross, Eric; Russo, Patricia A.; Santucci-Pereira, Julia; Sheriff, Fathima S.; Slifker, Michael; Hallmans, Göran; Toniolo, Paolo; Arslan, Alan A.

    2012-01-01

    The objective of the current study was to comprehensively compare the genomic profiles in the breast of parous and nulliparous postmenopausal women to identify genes that permanently change their expression following pregnancy. The study was designed as a two-phase approach. In the discovery phase, we compared breast genomic profiles of 37 parous with 18 nulliparous postmenopausal women. In the validation phase, confirmation of the genomic patterns observed in the discovery phase was sought in an independent set of 30 parous and 22 nulliparous postmenopausal women. RNA was hybridized to Affymetrix HG_U133 Plus 2.0 oligonucleotide arrays containing probes to 54,675 transcripts; scanned and the images analyzed using Affymetrix GCOS software. Surrogate variable analysis, logistic regression and significance analysis for microarrays were used to identify statistically significant differences in expression of genes. The False Discovery Rate (FDR) approach was used to control for multiple comparisons. We found that 208 genes (305 probe sets) were differentially expressed between parous and nulliparous women in both discovery and validation phases of the study at a FDR of 10% and with at least a 1.25-fold change. These genes are involved in regulation of transcription, centrosome organization, RNA splicing, cell cycle control, adhesion and differentiation. The results provide persuasive evidence that full-term pregnancy induces long-term genomic changes in the breast. The genomic signature of pregnancy could be used as an intermediate marker to assess potential chemopreventive interventions with hormones mimicking the effects of pregnancy for prevention of breast cancer. PMID:21622728

  6. Line scanning system for direct digital chemiluminescence imaging of DNA sequencing blots

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karger, A.E.; Weiss, R.; Gesteland, R.F.

    A cryogenically cooled charge-coupled device (CCD) camera equipped with an area CCD array is used in a line scanning system for low-light-level imaging of chemiluminescent DNA sequencing blots. Operating the CCD camera in time-delayed integration (TDI) mode results in continuous data acquisition independent of the length of the CCD array. Scanning is possible with a resolution of 1.4 line pairs/mm at the 50% level of the modulation transfer function. High-sensitivity, low-light-level scanning of chemiluminescent direct-transfer electrophoresis (DTE) DNA sequencing blots is shown. The detection of DNA fragments on the blot involves DNA-DNA hybridization with oligonucleotide-alkaline phosphatase conjugate and 1,2-dioxetane-based chemiluminescence.more » The width of the scan allows the recording of up to four sequencing reactions (16 lanes) on one scan. The scan speed of 52 cm/h used for the sequencing blots corresponds to a data acquisition rate of 384 pixels/s. The chemiluminescence detection limit on the scanned images is 3.9 [times] 10[sup [minus]18] mol of plasmid DNA. A conditional median filter is described to remove spikes caused by cosmic ray events from the CCD images. 39 refs., 9 refs.« less

  7. Detection of Sub-fM DNA with Target Recycling and Self-Assembly Amplification on Graphene Field-Effect Biosensors

    PubMed Central

    2018-01-01

    All-electronic DNA biosensors based on graphene field-effect transistors (GFETs) offer the prospect of simple and cost-effective diagnostics. For GFET sensors based on complementary probe DNA, the sensitivity is limited by the binding affinity of the target oligonucleotide, in the nM range for 20 mer targets. We report a ∼20 000× improvement in sensitivity through the use of engineered hairpin probe DNA that allows for target recycling and hybridization chain reaction. This enables detection of 21 mer target DNA at sub-fM concentration and provides superior specificity against single-base mismatched oligomers. The work is based on a scalable fabrication process for biosensor arrays that is suitable for multiplexed detection. This approach overcomes the binding-affinity-dependent sensitivity of nucleic acid biosensors and offers a pathway toward multiplexed and label-free nucleic acid testing with high accuracy and selectivity. PMID:29768011

  8. SigReannot-mart: a query environment for expression microarray probe re-annotations.

    PubMed

    Moreews, François; Rauffet, Gaelle; Dehais, Patrice; Klopp, Christophe

    2011-01-01

    Expression microarrays are commonly used to study transcriptomes. Most of the arrays are now based on oligo-nucleotide probes. Probe design being a tedious task, it often takes place once at the beginning of the project. The oligo set is then used for several years. During this time period, the knowledge gathered by the community on the genome and the transcriptome increases and gets more precise. Therefore re-annotating the set is essential to supply the biologists with up-to-date annotations. SigReannot-mart is a query environment populated with regularly updated annotations for different oligo sets. It stores the results of the SigReannot pipeline that has mainly been used on farm and aquaculture species. It permits easy extraction in different formats using filters. It is used to compare probe sets on different criteria, to choose the set for a given experiment to mix probe sets in order to create a new one.

  9. Detection of Sub-fM DNA with Target Recycling and Self-Assembly Amplification on Graphene Field-Effect Biosensors.

    PubMed

    Gao, Zhaoli; Xia, Han; Zauberman, Jonathan; Tomaiuolo, Maurizio; Ping, Jinglei; Zhang, Qicheng; Ducos, Pedro; Ye, Huacheng; Wang, Sheng; Yang, Xinping; Lubna, Fahmida; Luo, Zhengtang; Ren, Li; Johnson, Alan T Charlie

    2018-06-13

    All-electronic DNA biosensors based on graphene field-effect transistors (GFETs) offer the prospect of simple and cost-effective diagnostics. For GFET sensors based on complementary probe DNA, the sensitivity is limited by the binding affinity of the target oligonucleotide, in the nM range for 20 mer targets. We report a ∼20 000× improvement in sensitivity through the use of engineered hairpin probe DNA that allows for target recycling and hybridization chain reaction. This enables detection of 21 mer target DNA at sub-fM concentration and provides superior specificity against single-base mismatched oligomers. The work is based on a scalable fabrication process for biosensor arrays that is suitable for multiplexed detection. This approach overcomes the binding-affinity-dependent sensitivity of nucleic acid biosensors and offers a pathway toward multiplexed and label-free nucleic acid testing with high accuracy and selectivity.

  10. Label-free CMOS bio sensor with on-chip noise reduction scheme for real-time quantitative monitoring of biomolecules.

    PubMed

    Seong-Jin Kim; Euisik Yoon

    2012-06-01

    We present a label-free CMOS field-effect transistor sensing array to detect the surface potential change affected by the negative charge in DNA molecules for real-time monitoring and quantification. The proposed CMOS bio sensor includes a new sensing pixel architecture implemented with correlated double sampling for reducing offset fixed pattern noise and 1/f noise of the sensing devices. We incorporated non-surface binding detection which allows real-time continuous monitoring of DNA concentrations without immobilizing them on the sensing surface. Various concentrations of 19-bp oligonucleotides solution can be discriminated using the prototype device fabricated in 1- μm double-poly double-metal standard CMOS process. The detection limit was measured as 1.1 ng/μl with a dynamic range of 40 dB and the transient response time was measured less than 20 seconds.

  11. Programmable DNA scaffolds for spatially-ordered protein assembly.

    PubMed

    Chandrasekaran, Arun Richard

    2016-02-28

    Ever since the notion of using DNA as a material was realized, it has been employed in the construction of complex structures that facilitate the assembly of nanoparticles or macromolecules with nanometer-scale precision. Specifically, tiles fashioned from DNA strands and DNA origami sheets have been shown to be suitable as scaffolds for immobilizing proteins with excellent control over their spatial positioning. Supramolecular assembly of proteins into periodic arrays in one or more dimensions is one of the most challenging aspects in the design of scaffolds for biomolecular investigations and macromolecular crystallization. This review provides a brief overview of how various biomolecular interactions with high degree of specificity such as streptavidin-biotin, antigen-antibody, and aptamer-protein interactions have been used to fabricate linear and multidimensional assemblies of structurally intact and functional proteins. The use of DNA-binding proteins as adaptors, polyamide recognition on DNA scaffolds and oligonucleotide linkers for protein assembly are also discussed.

  12. Therapeutic Oligonucleotides Targeting Liver Disease: TTR Amyloidosis.

    PubMed

    Niemietz, Christoph; Chandhok, Gursimran; Schmidt, Hartmut

    2015-09-30

    The liver has become an increasingly interesting target for oligonucleotide therapy. Mutations of the gene encoding transthyretin (TTR), expressed in vast amounts by the liver, result in a complex degenerative disease, termed familial amyloid polyneuropathy (FAP). Misfolded variants of TTR are linked to the establishment of extracellular protein deposition in various tissues, including the heart and the peripheral nervous system. Recent progress in the chemistry and formulation of antisense (ASO) and small interfering RNA (siRNA) designed for a knockdown of TTR mRNA in the liver has allowed to address the issue of gene-specific molecular therapy in a clinical setting of FAP. The two therapeutic oligonucleotides bind to RNA in a sequence specific manner but exploit different mechanisms. Here we describe major developments that have led to the advent of therapeutic oligonucleotides for treatment of TTR-related disease.

  13. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

    PubMed

    Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

    2015-06-01

    Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

  14. PNA-COMBO-FISH: From combinatorial probe design in silico to vitality compatible, specific labelling of gene targets in cell nuclei

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta

    Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes). Gene targets can be specifically labelled with atmore » least about 20 PNA-probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3D-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. - Highlights: • Denaturation free protocols preserve 3D architecture of chromosomes and nuclei. • Labelling sets are determined in silico for duplex and triplex binding. • Probes are produced chemically with freely chosen backbones and base variants. • Peptide nucleic acid backbones reduce hindering charge interactions. • Intercalating side chains stabilize binding of short oligonucleotides.« less

  15. Brain region-specific gene expression changes after chronic intermittent ethanol exposure and early withdrawal in C57BL/6J mice

    PubMed Central

    Melendez, Roberto I.; McGinty, Jacqueline F.; Kalivas, Peter W.; Becker, Howard C.

    2014-01-01

    Neuroadaptations that participate in the ontogeny of alcohol dependence are likely a result of altered gene expression in various brain regions. The present study investigated brain region-specific changes in the pattern and magnitude of gene expression immediately following chronic intermittent ethanol (CIE) exposure and 8 hours following final ethanol exposure [i.e. early withdrawal (EWD)]. High-density oligonucleotide microarrays (Affymetrix 430A 2.0, Affymetrix, Santa Clara, CA, USA) and bioinformatics analysis were used to characterize gene expression and function in the prefrontal cortex (PFC), hippocampus (HPC) and nucleus accumbens (NAc) of C57BL/6J mice (Jackson Laboratories, Bar Harbor, ME, USA). Gene expression levels were determined using gene chip robust multi-array average followed by statistical analysis of microarrays and validated by quantitative real-time reverse transcription polymerase chain reaction and Western blot analysis. Results indicated that immediately following CIE exposure, changes in gene expression were strikingly greater in the PFC (284 genes) compared with the HPC (16 genes) and NAc (32 genes). Bioinformatics analysis revealed that most of the transcriptionally responsive genes in the PFC were involved in Ras/MAPK signaling, notch signaling or ubiquitination. In contrast, during EWD, changes in gene expression were greatest in the HPC (139 genes) compared with the PFC (four genes) and NAc (eight genes). The most transcriptionally responsive genes in the HPC were involved in mRNA processing or actin dynamics. Of the few genes detected in the NAc, the most representatives were involved in circadian rhythms. Overall, these findings indicate that brain region-specific and time-dependent neuroadaptive alterations in gene expression play an integral role in the development of alcohol dependence and withdrawal. PMID:21812870

  16. Compaction of rolling circle amplification products increases signal integrity and signal-to-noise ratio

    PubMed Central

    Clausson, Carl-Magnus; Arngården, Linda; Ishaq, Omer; Klaesson, Axel; Kühnemund, Malte; Grannas, Karin; Koos, Björn; Qian, Xiaoyan; Ranefall, Petter; Krzywkowski, Tomasz; Brismar, Hjalmar; Nilsson, Mats; Wählby, Carolina; Söderberg, Ola

    2015-01-01

    Rolling circle amplification (RCA) for generation of distinct fluorescent signals in situ relies upon the self-collapsing properties of single-stranded DNA in commonly used RCA-based methods. By introducing a cross-hybridizing DNA oligonucleotide during rolling circle amplification, we demonstrate that the fluorophore-labeled RCA products (RCPs) become smaller. The reduced size of RCPs increases the local concentration of fluorophores and as a result, the signal intensity increases together with the signal-to-noise ratio. Furthermore, we have found that RCPs sometimes tend to disintegrate and may be recorded as several RCPs, a trait that is prevented with our cross-hybridizing DNA oligonucleotide. These effects generated by compaction of RCPs improve accuracy of visual as well as automated in situ analysis for RCA based methods, such as proximity ligation assays (PLA) and padlock probes. PMID:26202090

  17. Spherical Nucleic Acids: A New Form of DNA

    NASA Astrophysics Data System (ADS)

    Cutler, Joshua Isaac

    Spherical Nucleic Acids (SNAs) are a new class of nucleic acid-based nanomaterials that exhibit unique properties currently being explored in the contexts of gene-based cancer therapies and in the design of programmable nanoparticle-based materials. The properties of SNAs differ from canonical, linear nucleic acids by virtue of their dense packing into an oriented 3-dimensional array. SNAs can be synthesized from a number of useful nanoparticle templates, such as plasmonic gold and silver, magnetic oxides, luminescent semi-conductor quantum dots, and silica. In addition, by crosslinking the oligonucleotides and dissolving the core, they can be made in a hollow form as well. This dissertation describes the evolution of SNAs from initial studies of inorganic nanoparticle-based materials densely functionalized with oligonucleotides to the proving of a hypothesis that their unique properties can be observed in a core-less structure if the nucleic acids are densely packed and highly oriented. Chapter two describes the synthesis of densely functionalized polyvalent oligonucleotide superparamagnetic iron oxide nanoparticles using the copper-catalyzed azide-alkyne cycloaddition reaction. These particles are shown to exhibit cooperative binding in a density- and salt concentration-dependent fashion, with nearly identical behaviors to those of SNA-functionalized gold nanoparticles. Importantly, these particles are the first non-gold particles shown to be capable of entering cells in high numbers via the SNA-mediated cellular uptake pathway, and provided the first evidence that SNA-mediated cellular uptake is core-independent. In the third chapter, a gold nanoparticle catalyzed alkyne cross-linking reaction is described that is capable of forming hollow organic nanoparticles using polymers with alkyne-functionalized backbones. With this method, the alkyne-modified polymers adsorb to the particle surfaces, cross-link on the surface, allowing the gold nanoparticle to be subsequently dissolved oxidatively with KCN or Iodine. The reaction pathway is analyzed through characterization of the reaction progression and resulting products, and a mechanistic pathway is proposed. This is the first report of a gold nanoparticle catalyzed reaction involving the conversion of propargyl ethers to terminal alcohols, which can subsequently cross-link if densely arranged on a gold nanoparticle surface. Importantly, these structures can be synthesized using gold nanoparticles of a range of sizes, thereby providing control over the size and properties of the resulting crosslinked particle. Chapter four returns to the topic of SNAs and builds upon the chemistry of chapter three culminating in the synthesis of cross-linked hollow SNA nanoparticles. These structures are formed by the cross-linking of synthetically modified alkyne-bearing oligonucleotides through the pathway described in chapter three. When the gold core is dissolved, the resulting hollow SNAs exhibit nearly identical binding, nuclease resistance, cellular uptake, and gene regulation properties of SNA-gold nanoparticle conjugates. Indeed, this chapter demonstrates that the unique properties of SNA-nanoparticle conjugates are core-independent and stem solely from the dense ensemble of oligonucleotides arranged on their surfaces. The fifth chapter further asserts the synthetic achievements made in chapter four by showing how hollow SNAs can be substituted for SNA-gold nanoparticles in the context of DNA-programmable assembly. In this case, they can be used as building blocks within binary synthetic schemes to synthesize unique nanoparticle superlattices. It bolsters the design rules of DNA-programmable assembly by showing that the predicted structures form based on the behavior of SNA hybridization, and are universal for any SNA-functionalized nanoparticle.

  18. Comparison of small molecules and oligonucleotides that target a toxic, non-coding RNA.

    PubMed

    Costales, Matthew G; Rzuczek, Suzanne G; Disney, Matthew D

    2016-06-01

    Potential RNA targets for chemical probes and therapeutic modalities are pervasive in the transcriptome. Oligonucleotide-based therapeutics are commonly used to target RNA sequence. Small molecules are emerging as a modality to target RNA structures selectively, but their development is still in its infancy. In this work, we compare the activity of oligonucleotides and several classes of small molecules that target the non-coding r(CCUG) repeat expansion (r(CCUG)(exp)) that causes myotonic dystrophy type 2 (DM2), an incurable disease that is the second-most common cause of adult onset muscular dystrophy. Small molecule types investigated include monomers, dimers, and multivalent compounds synthesized on-site by using RNA-templated click chemistry. Oligonucleotides investigated include phosphorothioates that cleave their target and vivo-morpholinos that modulate target RNA activity via binding. We show that compounds assembled on-site that recognize structure have the highest potencies amongst small molecules and are similar in potency to a vivo-morpholino modified oligonucleotide that targets sequence. These studies are likely to impact the design of therapeutic modalities targeting other repeats expansions that cause fragile X syndrome and amyotrophic lateral sclerosis, for example. Copyright © 2016. Published by Elsevier Ltd.

  19. Chemical synthesis of oligonucleotides containing a free sulphydryl group and subsequent attachment of thiol specific probes.

    PubMed Central

    Connolly, B A; Rider, P

    1985-01-01

    Oligonucleotides containing a free sulphydryl group at their 5'-termini have been synthesised and further derivatised with thiol specific probes. The nucleotide sequence required is prepared using standard solid phase phosphoramidite techniques and an extra round of synthesis is then performed using the S-triphenylmethyl O-methoxymorpholinophosphite derivatives of 2-mercaptoethanol, 3-mercaptopropan (1) ol or 6-mercaptohexan (1) ol. After cleavage from the resin and removal of the phosphate and base protecting groups, this yields an oligonucleotide containing an S-triphenylmethyl group attached to the 5'-phosphate group via a two, three or six carbon chain. The triphenylmethyl group can be readily removed with silver nitrate to give the free thiol. With the three and six carbon chain oligonucleotides, this thiol can be used, at pH 8, for the attachment of thiol specific probes as illustrated by the reaction with fluorescent conjugates of iodoacetates and maleiimides. However, oligonucleotides containing a thiol attached to the 5'-phosphate group via a two carbon chain are unstable at pH 8 decomposing to the free 5'-phosphate and so are unsuitable for further derivatisation. PMID:4011448

  20. PNA-COMBO-FISH: From combinatorial probe design in silico to vitality compatible, specific labelling of gene targets in cell nuclei.

    PubMed

    Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta; Schmitt, Eberhard; Hausmann, Michael

    2016-07-01

    Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes) or TINA-DNA (Twisted Intercalating Nucleic Acids). Gene targets can be specifically labelled with at least about 20 probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3d-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. Copyright © 2016. Published by Elsevier Inc.

  1. Biological and molecular characterization of cellular differentiation in Tetrahymena vorax: a potential biocontrol protozoan.

    PubMed

    Green, M M; LeBoeuf, R D; Churchill, P F

    2000-01-01

    Tetrahymena vorax (T. vorax) is an indigenous fresh water protozoan with the natural biological potential to maintain a specific aquatic microbial flora by ingesting and eliminating specific microorganism. To investigate the molecular mechanisms controlling Tetrahymena vorax (T. vorax) cellular differentiation from a small-mouth vegetative cell to a voracious large-mouth carnivore capable of ingesting prey ciliates and bacteria from aquatic environments, we use DNA subtraction and gene discovery techniques to identify and isolate T. vorax differentiation-specific genes. The physiological necessity for one newly discovered gene, SUBII-TG, was determined in vivo using an antisense oligonucleotide directed against the 5' SUBII-TG DNA sequence. The barriers to delivering antisense oligonucleotides to the cytoplasm of T. vorax were circumvented by employing a new but simple procedure of processing the oligonucleotide with the differentiation stimulus, stomatin. In these studies, the antisense oligonucleotide down-regulated SUBII-TG mRNA expression, and blocked differentiation and ingestion of prey ciliates. The ability to down-regulate SUBII-TG expression with the antisense oligonucleotide suggests that the molecular mechanisms controlling the natural biological activities of T. vorax can be manipulated to further study its cellular differentiation and potential as a biocontrol microorganism.

  2. Correlating In Vitro Splice Switching Activity With Systemic In Vivo Delivery Using Novel ZEN-modified Oligonucleotides.

    PubMed

    Hammond, Suzan M; McClorey, Graham; Nordin, Joel Z; Godfrey, Caroline; Stenler, Sofia; Lennox, Kim A; Smith, C I Edvard; Jacobi, Ashley M; Varela, Miguel A; Lee, Yi; Behlke, Mark A; Wood, Matthew J A; Andaloussi, Samir E L

    2014-11-25

    Splice switching oligonucleotides (SSOs) induce alternative splicing of pre-mRNA and typically employ chemical modifications to increase nuclease resistance and binding affinity to target pre-mRNA. Here we describe a new SSO non-base modifier (a naphthyl-azo group, "ZEN™") to direct exon exclusion in mutant dystrophin pre-mRNA to generate functional dystrophin protein. The ZEN modifier is placed near the ends of a 2'-O-methyl (2'OMe) oligonucleotide, increasing melting temperature and potency over unmodified 2'OMe oligonucleotides. In cultured H2K cells, a ZEN-modified 2'OMe phosphorothioate (PS) oligonucleotide delivered by lipid transfection greatly enhanced dystrophin exon skipping over the same 2'OMePS SSO lacking ZEN. However, when tested using free gymnotic uptake in vitro and following systemic delivery in vivo in dystrophin deficient mdx mice, the same ZEN-modified SSO failed to enhance potency. Importantly, we show for the first time that in vivo activity of anionic SSOs is modelled in vitro only when using gymnotic delivery. ZEN is thus a novel modifier that enhances activity of SSOs in vitro but will require improved delivery methods before its in vivo clinical potential can be realized.

  3. 16S rRNA gene-based phylogenetic microarray for simultaneous identification of members of the genus Burkholderia.

    PubMed

    Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo

    2009-04-01

    For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.

  4. Oligonucleotides as antivirals: dream or realistic perspective?

    PubMed

    Van Aerschot, Arthur

    2006-09-01

    Many reports have been published on antiviral activity of synthetic oligonucleotides, targeted to act either by a true antisense effect or via non-sequence specific interactions. This short review will try to evaluate the current status of the field by focusing on the effects as reported for inhibition of either HSV-1, HCMV or HIV-1. Following an introduction with a historical background and a brief discussion on the different types of constructs and mechanisms of action, the therapeutic potential of antisense oligonucleotides as antivirals, as well as possible pitfalls upon their evaluation will be discussed.

  5. CD studies on ribonuclease A - oligonucleotides interactions.

    PubMed Central

    White, M D; Keren-Zur, M; Lapidot, Y

    1977-01-01

    The interaction of ApU, Aps4U, Aps4Up, ApAps4Up and Gps4U with RNase A was studied by CD difference spectroscopy. The use of 4-thiouridine (s4U) containing oligonucleotides enables to distinguish between the interaction of the different components of the ligand with the enzyme. The mode of binding of the oligonucleotides to the enzyme is described. From this mode of binding it is explained why Aps4U, for example, inhibits RNase A, while s4UpA serves as a substrate. PMID:866194

  6. Rapid purification of circular DNA by triplex-mediated affinity capture

    DOEpatents

    Ji, Huamin; Smith, Lloyd M.

    1997-01-01

    A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support.

  7. Customized oligonucleotide microchips that convert multiple genetic information to simple patterns, are portable and reusable

    DOEpatents

    Mirzabekov, Andrei; Guschin, Dmitry Y.; Chik, Valentine; Drobyshev, Aleksei; Fotin, Alexander; Yershov, Gennadiy; Lysov, Yuri

    2002-01-01

    This invention relates to using customized oligonucleotide microchips as biosensors for the detection and identification of nucleic acids specific for different genes, organisms and/or individuals in the environment, in food and in biological samples. The microchips are designed to convert multiple bits of genetic information into simpler patterns of signals that are interpreted as a unit. Because of an improved method of hybridizing oligonucleotides from samples to microchips, microchips are reusable and transportable. For field study, portable laser or bar code scanners are suitable.

  8. Functional regulation of RNA-induced silencing complex by photoreactive oligonucleotides.

    PubMed

    Matsuyama, Yohei; Yamayoshi, Asako; Kobori, Akio; Murakami, Akira

    2014-02-01

    We developed a novel method for regulation of RISC function by photoreactive oligonucleotides (Ps-Oligo) containing 2'-O-psoralenylmethoxyethyl adenosine (Aps). We observed that inhibitory effects of Ps-Oligos on RISC function were enhanced by UV-irradiation compared with 2'-O-methyl-oligonucleotide without Aps. These results suggest Ps-Oligo inhibited RISC function by cross-linking effect, and we propose that the concept described in this report may be promising and applicable one to regulate the small RNA-mediated post-transcriptional regulation. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  9. In Silico Screening Based on Predictive Algorithms as a Design Tool for Exon Skipping Oligonucleotides in Duchenne Muscular Dystrophy

    PubMed Central

    Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William

    2015-01-01

    The use of antisense ‘splice-switching’ oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2’O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R2 0.89) and 53 (R2 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each position of a target exon. PMID:25816009

  10. Voltammetric behaviour of free DNA bases, methylcytosine and oligonucleotides at disposable screen printed graphite electrode platforms.

    PubMed

    Brotons, Ariadna; Mas, Luis Alcaraz; Metters, Jonathan P; Banks, Craig E; Iniesta, Jesús

    2013-09-21

    Improvements in analytical methods for the determination and quantification of methylcytosine in DNA are vital since it has the potential to be used as a biomarker to detect different diseases in the first stage such as in the case of carcinomas and sterility. In this work we utilized screen printed graphite electrodes (SPGE) for studying the electrochemical response of all free DNA bases, methylcytosine and short oligonucleotides by cyclic voltammetry (CV) and square wave voltammetry (SWV). CV and SWV responses of free DNA bases and methylcytosine have been investigated by using SPGE platforms and the feasibility of detecting and quantifying cytosine and methylcytosine as free DNA moieties has been evaluated as a function of pH, concentration and the presence of the other free DNA bases in solution simultaneously. Repeatability of using SWV has been performed for the electrochemical behavior of both 250 μM cytosine and 250 μM methylcytosine in the presence of 25 μM guanine, with coefficient of variations of 6.9% and 2.6% respectively based upon peak current (N = 5). Six-mer oligonucleotides with a sequence 5'-XXXCGC-3', where the XXX motif corresponds to TTT, TTA, TAA and AAA have been performed using SWV in 0.1 M acetate buffer pH 5.0 to explore how the DNA base position effects the electrooxidation of guanine and cytosine into the oligonucleotide. Furthermore SWV comparisons of the electrooxidation of the oligonucleotides 5'-CGCGCG-3' and its methylated 5'-mCGmCGmCG-3' have been performed with concentrations in acetate buffer solutions, and the interaction of both oligonucleotides with the graphitic surface of the SPGE has been demonstrated by fitting well-known adsorption models such as Freundlich and Langmuir kinetics according to the SWV current response of guanine, cytosine and methylcytosine into the oligonucleotide.

  11. Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

    PubMed Central

    Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

    2011-01-01

    The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

  12. Use of continuous/contiguous stacking hybridization as a diagnostic tool

    DOEpatents

    Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moseyevich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Lysov, Yuri Petrovich

    1999-01-01

    A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates.

  13. Use of continuous/contiguous stacking hybridization as a diagnostic tool

    DOEpatents

    Mirzabekov, A.D.; Yershov, G.M.; Kirillov, E.V.; Parinov, S.V.; Barski, V.E.; Lysov, Y.P.

    1999-06-01

    A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. 5 figs.

  14. Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

    PubMed Central

    Narihiro, Takashi; Sekiguchi, Yuji

    2011-01-01

    Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

  15. Toward a new paradigm of DNA writing using a massively parallel sequencing platform and degenerate oligonucleotide

    PubMed Central

    Hwang, Byungjin; Bang, Duhee

    2016-01-01

    All synthetic DNA materials require prior programming of the building blocks of the oligonucleotide sequences. The development of a programmable microarray platform provides cost-effective and time-efficient solutions in the field of data storage using DNA. However, the scalability of the synthesis is not on par with the accelerating sequencing capacity. Here, we report on a new paradigm of generating genetic material (writing) using a degenerate oligonucleotide and optomechanical retrieval method that leverages sequencing (reading) throughput to generate the desired number of oligonucleotides. As a proof of concept, we demonstrate the feasibility of our concept in digital information storage in DNA. In simulation, the ability to store data is expected to exponentially increase with increase in degenerate space. The present study highlights the major framework change in conventional DNA writing paradigm as a sequencer itself can become a potential source of making genetic materials. PMID:27876825

  16. Toward a new paradigm of DNA writing using a massively parallel sequencing platform and degenerate oligonucleotide.

    PubMed

    Hwang, Byungjin; Bang, Duhee

    2016-11-23

    All synthetic DNA materials require prior programming of the building blocks of the oligonucleotide sequences. The development of a programmable microarray platform provides cost-effective and time-efficient solutions in the field of data storage using DNA. However, the scalability of the synthesis is not on par with the accelerating sequencing capacity. Here, we report on a new paradigm of generating genetic material (writing) using a degenerate oligonucleotide and optomechanical retrieval method that leverages sequencing (reading) throughput to generate the desired number of oligonucleotides. As a proof of concept, we demonstrate the feasibility of our concept in digital information storage in DNA. In simulation, the ability to store data is expected to exponentially increase with increase in degenerate space. The present study highlights the major framework change in conventional DNA writing paradigm as a sequencer itself can become a potential source of making genetic materials.

  17. Silver Nanoparticle Oligonucleotide Conjugates Based on DNA with Triple Cyclic Disulfide Moieties

    PubMed Central

    Lee, Jae-Seung; Lytton-Jean, Abigail K. R.; Hurst, Sarah J.; Mirkin, Chad A.

    2011-01-01

    We report a new strategy for preparing silver nanoparticle oligonucleotide conjugates that are based upon DNA with cyclic disulfide-anchoring groups. These particles are extremely stable and can withstand NaCl concentrations up to 1.0 M. When silver nanoparticles functionalized with complementary sequences are combined, they assemble to form DNA-linked nanoparticle networks. This assembly process is reversible with heating and is associated with a red-shifting of the particle surface plasmon resonance and a concomitant color change from yellow to pale red. Analogous to the oligonucleotide-functionalized gold nanoparticles, these particles also exhibit highly cooperative binding properties with extremely sharp melting transitions. This work is an important step towards being able to use silver nanoparticle oligonucleotide conjugates for a variety of purposes, including molecular diagnostic labels, synthons in programmable materials synthesis approaches, and functional components for nanoelectronic and plasmonic devices. PMID:17571909

  18. Secondary binding sites for heavily modified triplex forming oligonucleotides

    PubMed Central

    Cardew, Antonia S.; Brown, Tom; Fox, Keith R.

    2012-01-01

    In order to enhance DNA triple helix stability synthetic oligonucleotides have been developed that bear amino groups on the sugar or base. One of the most effective of these is bis-amino-U (B), which possesses 5-propargylamino and 2′-aminoethoxy modifications. Inclusion of this modified nucleotide not only greatly enhances triplex stability, but also increases the affinity for related sequences. We have used a restriction enzyme protection, selection and amplification assay (REPSA) to isolate sequences that are bound by the heavily modified 9-mer triplex-forming oligonucleotide B6CBT. The isolated sequences contain An tracts (n = 6), suggesting that the 5′-end of this TFO was responsible for successful triplex formation. DNase I footprinting with these sequences confirmed triple helix formation at these secondary targets and demonstrated no interaction with similar oligonucleotides containing T or 5-propargylamino-dU. PMID:22180535

  19. Gene silencing by siRNAs and antisense oligonucleotides in the laboratory and the clinic

    PubMed Central

    Watts, Jonathan K.; Corey, David R.

    2014-01-01

    Synthetic nucleic acids are commonly used laboratory tools for modulating gene expression and have the potential to be widely used in the clinic. Progress towards nucleic acid drugs, however, has been slow and many challenges remain to be overcome before their full impact on patient care can be understood. Antisense oligonucleotides (ASOs) and small interfering RNAs (siRNAs) are the two most widely used strategies for silencing gene expression. We first describe these two approaches and contrast their relative strengths and weaknesses for laboratory applications. We then review the choices faced during development of clinical candidates and the current state of clinical trials. Attitudes towards clinical development of nucleic acid silencing strategies have repeatedly swung from optimism to depression during the past twenty years. Our goal is to provide the information needed to design robust studies with oligonucleotides, making use of the strengths of each oligonucleotide technology. PMID:22069063

  20. Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard

    1996-11-01

    In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

  1. Universal Oligonucleotide Microarray for Sub-Typing of Influenza A Virus

    PubMed Central

    Ryabinin, Vladimir A.; Kostina, Elena V.; Maksakova, Galiya A.; Neverov, Alexander A.; Chumakov, Konstantin M.; Sinyakov, Alexander N.

    2011-01-01

    A universal microchip was developed for genotyping Influenza A viruses. It contains two sets of oligonucleotide probes allowing viruses to be classified by the subtypes of hemagglutinin (H1–H13, H15, H16) and neuraminidase (N1–N9). Additional sets of probes are used to detect H1N1 swine influenza viruses. Selection of probes was done in two steps. Initially, amino acid sequences specific to each subtype were identified, and then the most specific and representative oligonucleotide probes were selected. Overall, between 19 and 24 probes were used to identify each subtype of hemagglutinin (HA) and neuraminidase (NA). Genotyping included preparation of fluorescently labeled PCR amplicons of influenza virus cDNA and their hybridization to microarrays of specific oligonucleotide probes. Out of 40 samples tested, 36 unambiguously identified HA and NA subtypes of Influenza A virus. PMID:21559081

  2. Synthesis of nucleosides and oligonucleotides containing adducts of acrolein and vinyl chloride.

    PubMed

    Nechev, L V; Harris, C M; Harris, T M

    2000-05-01

    Vinyl chloride and acrolein are important industrial chemicals. Both form DNA adducts, vinyl chloride after enzymatic oxidation to chlorooxirane and acrolein by direct reaction. Reaction at the N(2) position of guanine is a major pathway. The resulting 2-oxoethyl and 3-oxopropyl adducts cyclize spontaneously to hydroxyethano and hydroxypropano derivatives, respectively. The two cyclic adducts have been detected in DNA exposed to these mutagens. A new method has been developed for the synthesis of deoxyguanosine adducts of chlorooxirane and acrolein, as well as oligonucleotides containing these adducts. Reaction of O(6)-[(trimethylsilyl)ethyl]-2-fluoro-2'-deoxyinosine with the appropriate aminodiol followed by oxidative cleavage of the diol with NaIO(4) gave the adducts in excellent yields. Reaction of oligonucleotides containing the halonucleoside with the aminodiols followed by NaIO(4) efficiently created the nucleosides in the oligonucleotides. Deoxyadenosine adducts were created similarly using 6-chloropurine 9-(2'-deoxyriboside).

  3. Microarray analysis identified Puccinia striiformis f. sp. tritici genes involved in infection and sporulation.

    USDA-ARS?s Scientific Manuscript database

    Puccinia striiformis f. sp. tritici (Pst) causes stripe rust, one of the most important diseases of wheat worldwide. To identify Pst genes involved in infection and sporulation, a custom oligonucleotide Genechip was made using sequences of 442 genes selected from Pst cDNA libraries. Microarray analy...

  4. Superiorities of time-correlated single-photon counting against standard fluorimetry in exploiting the potential of fluorochromized oligonucleotide probes for biomedical investigation

    NASA Astrophysics Data System (ADS)

    Lamperti, Marco; Nardo, Luca; Bondani, Maria

    2015-05-01

    Site-specific fluorescence-resonance-energy-transfer donor-acceptor dual-labelled oligonucleotide probes are widely used in state-of-art biotechnological applications. Such applications include their usage as primers in polymerase chain reaction. However, the steady-state fluorescence intensity signal emitted by these molecular tools strongly depends from the specificities of the probe conformation. For this reason, the information which can be reliably inferred by steady-state fluorimetry performed on such samples is forcedly confined to a semi-qualitative level. Namely, fluorescent emission is frequently used as ON/OFF indicator of the probe hybridization state, i.e. detection of fluorescence signals indicates either hybridization to or detachment from the template DNA of the probe. Nonetheless, a fully quantitative analysis of their fluorescence emission properties would disclose other exciting applications of dual-labelled probes in biosensing. Here we show how time-correlated single-photon counting can be applied to get rid of the technical limitations and interpretational ambiguities plaguing the intensity analysis, and to derive information on the template DNA reaching single-base.

  5. Molecular cloning and nucleotide sequence of the alpha and beta subunits of allophycocyanin from the cyanelle genome of Cyanophora paradoxa.

    PubMed Central

    Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E

    1985-01-01

    The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916

  6. Development and experimental validation of a 20K Atlantic cod (Gadus morhua) oligonucleotide microarray based on a collection of over 150,000 ESTs.

    PubMed

    Booman, Marije; Borza, Tudor; Feng, Charles Y; Hori, Tiago S; Higgins, Brent; Culf, Adrian; Léger, Daniel; Chute, Ian C; Belkaid, Anissa; Rise, Marlies; Gamperl, A Kurt; Hubert, Sophie; Kimball, Jennifer; Ouellette, Rodney J; Johnson, Stewart C; Bowman, Sharen; Rise, Matthew L

    2011-08-01

    The collapse of Atlantic cod (Gadus morhua) wild populations strongly impacted the Atlantic cod fishery and led to the development of cod aquaculture. In order to improve aquaculture and broodstock quality, we need to gain knowledge of genes and pathways involved in Atlantic cod responses to pathogens and other stressors. The Atlantic Cod Genomics and Broodstock Development Project has generated over 150,000 expressed sequence tags from 42 cDNA libraries representing various tissues, developmental stages, and stimuli. We used this resource to develop an Atlantic cod oligonucleotide microarray containing 20,000 unique probes. Selection of sequences from the full range of cDNA libraries enables application of the microarray for a broad spectrum of Atlantic cod functional genomics studies. We included sequences that were highly abundant in suppression subtractive hybridization (SSH) libraries, which were enriched for transcripts responsive to pathogens or other stressors. These sequences represent genes that potentially play an important role in stress and/or immune responses, making the microarray particularly useful for studies of Atlantic cod gene expression responses to immune stimuli and other stressors. To demonstrate its value, we used the microarray to analyze the Atlantic cod spleen response to stimulation with formalin-killed, atypical Aeromonas salmonicida, resulting in a gene expression profile that indicates a strong innate immune response. These results were further validated by quantitative PCR analysis and comparison to results from previous analysis of an SSH library. This study shows that the Atlantic cod 20K oligonucleotide microarray is a valuable new tool for Atlantic cod functional genomics research.

  7. Visualizing Microbial Biogeochemistry: NanoSIMS and Stable Isotope Probing (Invited)

    NASA Astrophysics Data System (ADS)

    Pett-Ridge, J.; Weber, P. K.

    2009-12-01

    Linking phylogenetic information to function in microbial communities is a key challenge for microbial ecology. Isotope-labeling experiments provide a useful means to investigate the ecophysiology of microbial populations and cells in the environment and allow measurement of nutrient transfers between cell types, symbionts and consortia. The combination of Nano-Secondary Ion Mass Spectrometry (NanoSIMS) analysis, in situ labeling and high resolution microscopy allows isotopic analysis to be linked to phylogeny and morphology and holds great promise for fine-scale studies of microbial systems. In NanoSIMS analysis, samples are sputtered with an energetic primary beam (Cs+, O-) liberating secondary ions that are separated by the mass spectrometer and detected in a suite of electron multipliers. Five isotopic species may be analyzed concurrently with spatial resolution as fine as 50nm. A high sensitivity isotope ratio ‘map’ can then be generated for the analyzed area. NanoSIMS images of 13C, 15N and Mo (a nitrogenase co-factor) localization in diazotrophic cyanobacteria show how cells differentially allocate resources within filaments and allow calculation of nutrient uptake rates on a cell by cell basis. Images of AM fungal hyphae-root and cyanobacteria-rhizobia associations indicate the mobilization and sharing (stealing?) of newly fixed C and N. In a related technique, “El-FISH”, stable isotope labeled biomass is probed with oligonucleotide-elemental labels and then imaged by NanoSIMS. In microbial consortia and cyanobacterial mats, this technique helps link microbial structure and function simultaneously even in systems with unknown and uncultivated microbes. Finally, the combination of re-engineered universal 16S oligonucleotide microarrays with NanoSIMS analyses may allow microbial identity to be linked to functional roles in complex systems such as mats and cellulose degrading hindgut communities. These newly developed methods provide correlated oligonucleotide, functional enzyme and metabolic image data and should help unravel the metabolic processes of complex microbial communities in soils, biofilms and aquatic systems.

  8. Poly(malic acid) nanoconjugates containing various antibodies and oligonucleotides for multitargeting drug delivery

    PubMed Central

    Fujita, Manabu; Ljubimov, Alexander V; Torchilin, Vladimir P; Black, Keith L; Holler, Eggehard

    2009-01-01

    Nanoconjugates are emerging as promising drug-delivery vehicles because of their multimodular structure enabling them to actively target discrete cells, pass through biological barriers and simultaneously carry multiple drugs of various chemical nature. Nanoconjugates have matured from simple devices to multifunctional, biodegradable, nontoxic and nonimmunogenic constructs, capable of delivering synergistically functioning drugs in vivo. This review mainly concerns the Polycefin family of natural-derived polymeric drug-delivery devices as an example. This type of vehicle is built by hierarchic conjugation of functional groups onto the backbone of poly(malic acid), an aliphatic polyester obtained from the microorganism Physarum polycephalum. Particular Polycefin variants target human brain and breast tumors implanted into animals specifically and actively and could be detected easily by noninvasive imaging analysis. Delivery of antisense oligonucleotides to a tumor-specific angiogenic marker using Polycefin resulted in significant inhibition of tumor angiogenesis and increase of animal survival. PMID:18373429

  9. Evidence for radical anion formation during liquid secondary ion mass spectrometry analysis of oligonucleotides and synthetic oligomeric analogues: a deconvolution algorithm for molecular ion region clusters.

    PubMed

    Laramée, J A; Arbogast, B; Deinzer, M L

    1989-10-01

    It is shown that one-electron reduction is a common process that occurs in negative ion liquid secondary ion mass spectrometry (LSIMS) of oligonucleotides and synthetic oligonucleosides and that this process is in competition with proton loss. Deconvolution of the molecular anion cluster reveals contributions from (M-2H).-, (M-H)-, M.-, and (M + H)-. A model based on these ionic species gives excellent agreement with the experimental data. A correlation between the concentration of species arising via one-electron reduction [M.- and (M + H)-] and the electron affinity of the matrix has been demonstrated. The relative intensity of M.- is mass-dependent; this is rationalized on the basis of base-stacking. Base sequence ion formation is theorized to arise from M.- radical anion among other possible pathways.

  10. Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

    PubMed Central

    Woods, D E; Edge, M D; Colten, H R

    1984-01-01

    Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718

  11. Adaptive resolution simulation of oligonucleotides

    NASA Astrophysics Data System (ADS)

    Netz, Paulo A.; Potestio, Raffaello; Kremer, Kurt

    2016-12-01

    Nucleic acids are characterized by a complex hierarchical structure and a variety of interaction mechanisms with other molecules. These features suggest the need of multiscale simulation methods in order to grasp the relevant physical properties of deoxyribonucleic acid (DNA) and RNA using in silico experiments. Here we report an implementation of a dual-resolution modeling of a DNA oligonucleotide in physiological conditions; in the presented setup only the nucleotide molecule and the solvent and ions in its proximity are described at the atomistic level; in contrast, the water molecules and ions far from the DNA are represented as computationally less expensive coarse-grained particles. Through the analysis of several structural and dynamical parameters, we show that this setup reliably reproduces the physical properties of the DNA molecule as observed in reference atomistic simulations. These results represent a first step towards a realistic multiscale modeling of nucleic acids and provide a quantitatively solid ground for their simulation using dual-resolution methods.

  12. RNA interference for performance enhancement and detection in doping control.

    PubMed

    Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario

    2011-10-01

    RNA interference represents a comparably new route of regulating and manipulating specific gene expression. Promising results were obtained in experimental therapies aim at the treatment of different kinds of diseases including cancer, diabetes mellitus or Dychenne muscular dystrophy. While studies on down-regulation efficiency are often performed by analyzing the regulated protein, the direct detection of small, interfering RNA molecules and antisense oligonucleotides is of great interest for the investigation of the metabolism and degradation and also for the detection of a putative misuse of these molecules in sports. Myostatin down-regulation was shown to result in increased performance and muscle growth and the regulation of several other proteins could be relevant for performance enhancement. This mini-review summarizes current approaches for the mass spectrometric analysis of siRNA and antisense oligonucleotides from biological matrices and the available data on biodistribution, metabolism, and half-life of relevant substances are discussed. Copyright © 2011 John Wiley & Sons, Ltd.

  13. Genome-wide inference of transcription factor-DNA binding specificity in cell regeneration using a combination strategy.

    PubMed

    Wang, Xiaofeng; Zhang, Aiqun; Ren, Weizheng; Chen, Caiyu; Dong, Jiahong

    2012-11-01

    The cell growth, development, and regeneration of tissue and organ are associated with a large number of gene regulation events, which are mediated in part by transcription factors (TFs) binding to cis-regulatory elements involved in the genome. Predicting the binding affinity and inferring the binding specificity of TF-DNA interactions at the genomic level would be fundamentally helpful for our understanding of the molecular mechanism and biological implication underlying sequence-specific TF-DNA recognition. In this study, we report the development of a combination method to characterize the interaction behavior of a 11-mer oligonucleotide segment and its mutations with the Gcn4p protein, a homodimeric, basic leucine zipper TF, and to predict the binding affinity and specificity of potential Gcn4p binders in the genome-wide scale. In this procedure, a position-mutated energy matrix is created based on molecular modeling analysis of native and mutated Gcn4p-DNA complex structures to describe the position-independent interaction energy profile of Gcn4p with different nucleotide types at each position of the oligonucleotide, and the energy terms extracted from the matrix and their interactives are then correlated with experimentally measured affinities of 19268 distinct oligonucleotides using statistical modeling methodology. Subsequently, the best one of built regression models is successfully applied to screen those of potential high-affinity Gcn4p binders from the complete genome. The findings arising from this study are briefly listed below: (i) The 11 positions of oligonucleotides are highly interactive and non-additive in contribution to Gcn4p-DNA binding affinity; (ii) Indirect conformational effects upon nucleotide mutations as well as associated subtle changes in interfacial atomic contacts, but not the direct nonbonded interactions, are primarily responsible for the sequence-specific recognition; (iii) The intrinsic synergistic effects among the sequence positions of oligonucleotides determine Gcn4p-DNA binding affinity and specificity; (iv) Linear regression models in conjunction with variable selection seem to perform fairly well in capturing the internal dependences hidden in the Gcn4p-DNA system, albeit ignoring nonlinear factors may lead the models to systematically underestimate and overestimate high- and low-affinity samples, respectively. © 2012 John Wiley & Sons A/S.

  14. Base-Pairing Systems Related to TNA: alpha-Threofuranosyl Oligonucleotides Containing Phosphoramidate Linkages

    NASA Technical Reports Server (NTRS)

    Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2002-01-01

    (3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.

  15. Validation of the Swine Protein-Annotated Oligonucleotide Microarray

    USDA-ARS?s Scientific Manuscript database

    The specificity and utility of the Swine Protein-Annotated Oligonucleotide Microarray, or Pigoligoarray (www.pigoligoarray.org), has been evaluated by profiling the expression of transcripts from four porcine tissues. Tools for comparative analyses of expression on the Pigoligoarray were developed i...

  16. Identifying members of the domain Archaea with rRNA-targeted oligonucleotide probes.

    PubMed

    Burggraf, S; Mayer, T; Amann, R; Schadhauser, S; Woese, C R; Stetter, K O

    1994-09-01

    Two 16S rRNA-targeted oligonucleotide probes were designed for the archaeal kingdoms Euryachaeota and Crenarchaeota. Probe specificities were evaluated by nonradioactive dot blot hybridization against selected reference organisms. The successful application of fluorescent-probe derivatives for whole-cell hybridization required organism-specific optimizations of fixation and hybridization conditions to assure probe penetration and morphological integrity of the cells. The probes allowed preliminary grouping of three new hyperthermophilic isolates. Together with other group-specific rRNA-targeted oligonucleotide probes, these probes will facilitate rapid in situ monitoring of the populations present in hydrothermal systems and support cultivation attempts.

  17. Nucleic acid amplification using modular branched primers

    DOEpatents

    Ulanovsky, Levy; Raja, Mugasimangalam C.

    2001-01-01

    Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

  18. Rapid purification of circular DNA by triplex-mediated affinity capture

    DOEpatents

    Ji, H.; Smith, L.M.

    1997-01-07

    A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

  19. Fluorescent triplex-forming DNA oligonucleotides labeled with a thiazole orange dimer unit

    PubMed Central

    Ikeda, Shuji; Yanagisawa, Hiroyuki; Yuki, Mizue; Okamoto, Akimitsu

    2013-01-01

    Fluorescent probes for the detection of a double-stranded DNA were prepared by labeling a triplex-forming DNA oligonucleotide with a thiazole orange (TO) dimer unit. They belong to ECHO (exciton-controlled hybridization-sensitive fluorescent oligonucleotide) probes which we have previously reported. The excitonic interaction between the two TO molecules was expected to effectively suppress the background fluorescence of the probes. The applicability of the ECHO probes for the detection of double-stranded DNA was confirmed by examining the thermal stability and photophysical and kinetic properties of the DNA triplexes formed by the ECHO probes. PMID:23445822

  20. Polynucleotides. XXXII. Further studies on the synthesis of oligonucleotides containing 8,2'-S-cycloadenosine.

    PubMed Central

    Ikehara, M; Tezuka, T

    1975-01-01

    A dinucleoside monophosphate, 8,2'-anhydro-8-mercapto-9-beta-D-arabinofuranosyladenine phosphoryl-(3'-5')-inosine (AspI) was synthesized by the condensation of protected 8-mercapto-adenosine 2',3'-cyclic phosphate and 2',3'-isopropylideneinosine with diphenylphosphorochloridate. 8-Mercaptoadenosine 2',3'-cyclic phosphate was polymerized by using tetraphenyl pyrophosphate as the condensing reagent. As oligonucleotides, thus obtained, contained some uncyclized 8-mercaptoadenosine residues and were cleaved at these sites with 0.3N KOH. As 5'-phosphate was synthesized and polymerized with DCC to give oligonucleotides with chain lengths 2 to 9. PMID:170595

Top