Microarray analysis identified Puccinia striiformis f. sp. tritici genes involved in infection and sporulation.

USDA-ARS?s Scientific Manuscript database

Puccinia striiformis f. sp. tritici (Pst) causes stripe rust, one of the most important diseases of wheat worldwide. To identify Pst genes involved in infection and sporulation, a custom oligonucleotide Genechip was made using sequences of 442 genes selected from Pst cDNA libraries. Microarray analy...

Automated detection and quantitation of bacterial RNA by using electrical microarrays.

PubMed

Elsholz, B; Wörl, R; Blohm, L; Albers, J; Feucht, H; Grunwald, T; Jürgen, B; Schweder, T; Hintsche, Rainer

2006-07-15

Low-density electrical 16S rRNA specific oligonucleotide microarrays and an automated analysis system have been developed for the identification and quantitation of pathogens. The pathogens are Escherichia coli, Pseudomonas aeruginosa, Enterococcus faecalis, Staphylococcus aureus, and Staphylococcus epidermidis, which are typically involved in urinary tract infections. Interdigitated gold array electrodes (IDA-electrodes), which have structures in the nanometer range, have been used for very sensitive analysis. Thiol-modified oligonucleotides are immobilized on the gold IDA as capture probes. They mediate the specific recognition of the target 16S rRNA by hybridization. Additionally three unlabeled oligonucleotides are hybridized in close proximity to the capturing site. They are supporting molecules, because they improve the RNA hybridization at the capturing site. A biotin labeled detector oligonucleotide is also allowed to hybridize to the captured RNA sequence. The biotin labels enable the binding of avidin alkaline phophatase conjugates. The phosphatase liberates the electrochemical mediator p-aminophenol from its electrically inactive phosphate derivative. The electrical signals were generated by amperometric redox cycling and detected by a unique multipotentiostat. The read out signals of the microarray are position specific current and change over time in proportion to the analyte concentration. If two additional biotins are introduced into the affinity binding complex via the supporting oligonucleotides, the sensitivity of the assays increase more than 60%. The limit of detection of Escherichia coli total RNA has been determined to be 0.5 ng/microL. The control of fluidics for variable assay formats as well as the multichannel electrical read out and data handling have all been fully automated. The fast and easy procedure does not require any amplification of the targeted nucleic acids by PCR.

Analysis of mutations in oral poliovirus vaccine by hybridization with generic oligonucleotide microchips.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Proudnikov, D.; Kirillov, E.; Chumakov, K.

2000-01-01

This paper describes use of a new technology of hybridization with a micro-array of immobilized oligonucleotides for detection and quantification of neurovirulent mutants in Oral Poliovirus Vaccine (OPV). We used a micro-array consisting of three-dimensional gel-elements containing all possible hexamers (total of 4096 probes). Hybridization of fluorescently labelled viral cDNA samples with such microchips resulted in a pattern of spots that was registered and quantified by a computer-linked CCD camera, so that the sequence of the original cDNA could be deduced. The method could reliably identify single point mutations, since each of them affected fluorescence intensity of 12 micro-array elements.more » Micro-array hybridization of DNA mixtures with varying contents of point mutants demonstrated that the method can detect as little as 10% of revertants in a population of vaccine virus. This new technology should be useful for quality control of live viral vaccines, as well as for other applications requiring identification and quantification of point mutations.« less

[Oligonucleotide microarray for subtyping avian influenza virus].

PubMed

Xueqing, Han; Xiangmei, Lin; Yihong, Hou; Shaoqiang, Wu; Jian, Liu; Lin, Mei; Guangle, Jia; Zexiao, Yang

2008-09-01

Avian influenza viruses are important human and animal respiratory pathogens and rapid diagnosis of novel emerging avian influenza viruses is vital for effective global influenza surveillance. We developed an oligonucleotide microarray-based method for subtyping all avian influenza virus (16 HA and 9 NA subtypes). In total 25 pairs of primers specific for different subtypes and 1 pair of universal primers were carefully designed based on the genomic sequences of influenza A viruses retrieved from GenBank database. Several multiplex RT-PCR methods were then developed, and the target cDNAs of 25 subtype viruses were amplified by RT-PCR or overlapping PCR for evaluating the microarray. Further 52 oligonucleotide probes specific for all 25 subtype viruses were designed according to published gene sequences of avian influenza viruses in amplified target cDNAs domains, and a microarray for subtyping influenza A virus was developed. Then its specificity and sensitivity were validated by using different subtype strains and 2653 samples from 49 different areas. The results showed that all the subtypes of influenza virus could be identified simultaneously on this microarray with high sensitivity, which could reach to 2.47 pfu/mL virus or 2.5 ng target DNA. Furthermore, there was no cross reaction with other avian respiratory virus. An oligonucleotide microarray-based strategy for detection of avian influenza viruses has been developed. Such a diagnostic microarray will be useful in discovering and identifying all subtypes of avian influenza virus.

Cambridge Healthtech Institute's Third Annual Conference on Lab-on-a-Chip and Microarrays. 22-24 January 2001, Zurich, Switzerland.

PubMed

Jain, K K

2001-02-01

Cambridge Healthtech Institute's Third Annual Conference on Lab-on-a-Chip and Microarray technology covered the latest advances in this technology and applications in life sciences. Highlights of the meetings are reported briefly with emphasis on applications in genomics, drug discovery and molecular diagnostics. There was an emphasis on microfluidics because of the wide applications in laboratory and drug discovery. The lab-on-a-chip provides the facilities of a complete laboratory in a hand-held miniature device. Several microarray systems have been used for hybridisation and detection techniques. Oligonucleotide scanning arrays provide a versatile tool for the analysis of nucleic acid interactions and provide a platform for improving the array-based methods for investigation of antisense therapeutics. A method for analysing combinatorial DNA arrays using oligonucleotide-modified gold nanoparticle probes and a conventional scanner has considerable potential in molecular diagnostics. Various applications of microarray technology for high-throughput screening in drug discovery and single nucleotide polymorphisms (SNP) analysis were discussed. Protein chips have important applications in proteomics. With the considerable amount of data generated by the different technologies using microarrays, it is obvious that the reading of the information and its interpretation and management through the use of bioinformatics is essential. Various techniques for data analysis were presented. Biochip and microarray technology has an essential role to play in the evolving trends in healthcare, which integrate diagnosis with prevention/treatment and emphasise personalised medicines.

sigReannot: an oligo-set re-annotation pipeline based on similarities with the Ensembl transcripts and Unigene clusters.

PubMed

Casel, Pierrot; Moreews, François; Lagarrigue, Sandrine; Klopp, Christophe

2009-07-16

Microarray is a powerful technology enabling to monitor tens of thousands of genes in a single experiment. Most microarrays are now using oligo-sets. The design of the oligo-nucleotides is time consuming and error prone. Genome wide microarray oligo-sets are designed using as large a set of transcripts as possible in order to monitor as many genes as possible. Depending on the genome sequencing state and on the assembly state the knowledge of the existing transcripts can be very different. This knowledge evolves with the different genome builds and gene builds. Once the design is done the microarrays are often used for several years. The biologists working in EADGENE expressed the need of up-to-dated annotation files for the oligo-sets they share including information about the orthologous genes of model species, the Gene Ontology, the corresponding pathways and the chromosomal location. The results of SigReannot on a chicken micro-array used in the EADGENE project compared to the initial annotations show that 23% of the oligo-nucleotide gene annotations were not confirmed, 2% were modified and 1% were added. The interest of this up-to-date annotation procedure is demonstrated through the analysis of real data previously published. SigReannot uses the oligo-nucleotide design procedure criteria to validate the probe-gene link and the Ensembl transcripts as reference for annotation. It therefore produces a high quality annotation based on reference gene sets.

ASSESSMENT OF THE SWINE PROTEIN-ANNOTATED OLIGONUCLEOTIDE MICROARRAY AND UTILITY OF THE ARRAYS FOR EQTL AND TRANSCRIPTIONAL PROFILING STUDIES

USDA-ARS?s Scientific Manuscript database

We have evaluated the new Swine Protein-Annotated Oligonucleotide Microarray (http://www.pigoligoarray.org) by analyzing transcriptional profiles for longissimus dorsi muscle (LD), Bronchial lymph node (BLN) and Lung. Four LD samples were used to assess the stringency of hybridization conditions com...

Particle-Based Microarrays of Oligonucleotides and Oligopeptides.

PubMed

Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F Ralf; Breitling, Frank; Loeffler, Felix F

2014-10-28

In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches.

Particle-Based Microarrays of Oligonucleotides and Oligopeptides

PubMed Central

Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K.; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F. Ralf; Breitling, Frank; Loeffler, Felix F.

2014-01-01

In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches. PMID:27600347

Microarray-Based Mapping for the Detection of Molecular Markers in Response to Aspergillus flavus Infection in Susceptible and Resistant Maize Lines

USDA-ARS?s Scientific Manuscript database

The objectives of this study were (1) to evaluate differential gene expression levels for resistance to A. flavus kernel infection in susceptible (Va35) and resistant (Mp313E) maize lines using Oligonucleotide and cDNA microarray analysis, (2) to evaluate differences in A. flavus accumulation betwee...

Differentiation of the seven major lyssavirus species by oligonucleotide microarray.

PubMed

Xi, Jin; Guo, Huancheng; Feng, Ye; Xu, Yunbin; Shao, Mingfu; Su, Nan; Wan, Jiayu; Li, Jiping; Tu, Changchun

2012-03-01

An oligonucleotide microarray, LyssaChip, has been developed and verified as a highly specific diagnostic tool for differentiation of the 7 major lyssavirus species. As with conventional typing microarray methods, the LyssaChip relies on sequence differences in the 371-nucleotide region coding for the nucleoprotein. This region was amplified using nested reverse transcription-PCR primers that bind to the 7 major lyssaviruses. The LyssaChip includes 57 pairs of species typing and corresponding control oligonucleotide probes (oligoprobes) immobilized on glass slides, and it can analyze 12 samples on a single slide within 8 h. Analysis of 111 clinical brain specimens (65 from animals with suspected rabies submitted to the laboratory and 46 of butchered dog brain tissues collected from restaurants) showed that the chip method was 100% sensitive and highly consistent with the "gold standard," a fluorescent antibody test (FAT). The chip method could detect rabies virus in highly decayed brain tissues, whereas the FAT did not, and therefore the chip test may be more applicable to highly decayed brain tissues than the FAT. LyssaChip may provide a convenient and inexpensive alternative for diagnosis and differentiation of rabies and rabies-related diseases.

Curation of microarray oligonucleotides and corresponding ESTs/cDNAs used for gene expression analysis in zebra finches.

PubMed

Lovell, Peter V; Huizinga, Nicole A; Getachew, Abel; Mees, Brianna; Friedrich, Samantha R; Wirthlin, Morgan; Mello, Claudio V

2018-05-18

Zebra finches are a major model organism for investigating mechanisms of vocal learning, a trait that enables spoken language in humans. The development of cDNA collections with expressed sequence tags (ESTs) and microarrays has allowed for extensive molecular characterizations of circuitry underlying vocal learning and production. However, poor database curation can lead to errors in transcriptome and bioinformatics analyses, limiting the impact of these resources. Here we used genomic alignments and synteny analysis for orthology verification to curate and reannotate ~ 35% of the oligonucleotides and corresponding ESTs/cDNAs that make-up Agilent microarrays for gene expression analysis in finches. We found that: (1) 5475 out of 43,084 oligos (a) failed to align to the zebra finch genome, (b) aligned to multiple loci, or (c) aligned to Chr_un only, and thus need to be flagged until a better genome assembly is available, or (d) reflect cloning artifacts; (2) Out of 9635 valid oligos examined further, 3120 were incorrectly named, including 1533 with no known orthologs; and (3) 2635 oligos required name update. The resulting curated dataset provides a reference for correcting gene identification errors in previous finch microarrays studies, and avoiding such errors in future studies.

The detection and differentiation of canine respiratory pathogens using oligonucleotide microarrays.

PubMed

Wang, Lih-Chiann; Kuo, Ya-Ting; Chueh, Ling-Ling; Huang, Dean; Lin, Jiunn-Horng

2017-05-01

Canine respiratory diseases are commonly seen in dogs along with co-infections with multiple respiratory pathogens, including viruses and bacteria. Virus infections in even vaccinated dogs were also reported. The clinical signs caused by different respiratory etiological agents are similar, which makes differential diagnosis imperative. An oligonucleotide microarray system was developed in this study. The wild type and vaccine strains of canine distemper virus (CDV), influenza virus, canine herpesvirus (CHV), Bordetella bronchiseptica and Mycoplasma cynos were detected and differentiated simultaneously on a microarray chip. The detection limit is 10, 10, 100, 50 and 50 copy numbers for CDV, influenza virus, CHV, B. bronchiseptica and M. cynos, respectively. The clinical test results of nasal swab samples showed that the microarray had remarkably better efficacy than the multiplex PCR-agarose gel method. The positive detection rate of microarray and agarose gel was 59.0% (n=33) and 41.1% (n=23) among the 56 samples, respectively. CDV vaccine strain and pathogen co-infections were further demonstrated by the microarray but not by the multiplex PCR-agarose gel. The oligonucleotide microarray provides a highly efficient diagnosis alternative that could be applied to clinical usage, greatly assisting in disease therapy and control. Copyright © 2017 Elsevier B.V. All rights reserved.

Spotting and validation of a genome wide oligonucleotide chip with duplicate measurement of each gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja

2006-06-16

The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips wasmore » three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation.« less

In situ oligonucleotide synthesis on poly(dimethylsiloxane): a flexible substrate for microarray fabrication

PubMed Central

Moorcroft, Matthew J.; Meuleman, Wouter R. A.; Latham, Steven G.; Nicholls, Thomas J.; Egeland, Ryan D.; Southern, Edwin M.

2005-01-01

In this paper, we demonstrate in situ synthesis of oligonucleotide probes on poly(dimethylsiloxane) (PDMS) microchannels through use of conventional phosphoramidite chemistry. PDMS polymer was moulded into a series of microchannels using standard soft lithography (micro-moulding), with dimensions <100 μm. The surface of the PDMS was derivatized by exposure to ultraviolet/ozone followed by vapour phase deposition of glycidoxypropyltrimethoxysilane and reaction with poly(ethylene glycol) spacer, resulting in a reactive surface for oligonucleotide coupling. High, reproducible yields were achieved for both 6mer and 21mer probes as assessed by hybridization to fluorescent oligonucleotides. Oligonucleotide surface density was comparable with that obtained on glass substrates. These results suggest PDMS as a stable and flexible alternative to glass as a suitable substrate in the fabrication and synthesis of DNA microarrays. PMID:15870385

Synthesis of 3'-, or 5'-, or internal methacrylamido-modified oligonucleotides

DOEpatents

Golova, Julia B.; Chernov, Boris K.

2010-04-27

New modifiers were synthesized for incorporation of a methacrylic function in 3'-, 5'- and internal positions of oligonucleotides during solid phase synthesis. A modifier was used for synthesis of 5'-methacrylated oligonucleotides for preparation of microarrays by a co-polymerization method.

Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

NASA Technical Reports Server (NTRS)

Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.

2003-01-01

The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.

Ethical issues raised by genetic testing with oligonucleotide microarrays.

PubMed

Grody, Wayne W

2003-02-01

Because genes and alterations within them determine the identity, characteristics, and inheritance of every individual, the application of genetic science to humans has long been surrounded by apprehension, controversy, and real or perceived potential for abuse. Crude eugenics practices of the past now find a theoretical rebirth and transformation through the use of modern molecular genetic technologies for mutation detection, predictive and prenatal diagnosis, and, ultimately, gene replacement. The advent of oligonucleotide microarray analysis, in which hundreds or thousands of genes and mutations can be tested in parallel, offers tremendous promise for more accurate, sensitive, and efficient genetic testing. At the same time, however, this powerful technology dramatically increases the number and scope of ethical concerns accompanying each individual test request. This article considers the evolution and implications of these concerns, from the initial ordering of a microarray test by the physician to such issues as informed consent, privacy, confidentiality, clinical utility, discrimination, stigmatization, ethnic and population impact, and reimbursement.

Fiber-optic microarray for simultaneous detection of multiple harmful algal bloom species.

PubMed

Ahn, Soohyoun; Kulis, David M; Erdner, Deana L; Anderson, Donald M; Walt, David R

2006-09-01

Harmful algal blooms (HABs) are a serious threat to coastal resources, causing a variety of impacts on public health, regional economies, and ecosystems. Plankton analysis is a valuable component of many HAB monitoring and research programs, but the diversity of plankton poses a problem in discriminating toxic from nontoxic species using conventional detection methods. Here we describe a sensitive and specific sandwich hybridization assay that combines fiber-optic microarrays with oligonucleotide probes to detect and enumerate the HAB species Alexandrium fundyense, Alexandrium ostenfeldii, and Pseudo-nitzschia australis. Microarrays were prepared by loading oligonucleotide probe-coupled microspheres (diameter, 3 mum) onto the distal ends of chemically etched imaging fiber bundles. Hybridization of target rRNA from HAB cells to immobilized probes on the microspheres was visualized using Cy3-labeled secondary probes in a sandwich-type assay format. We applied these microarrays to the detection and enumeration of HAB cells in both cultured and field samples. Our study demonstrated a detection limit of approximately 5 cells for all three target organisms within 45 min, without a separate amplification step, in both sample types. We also developed a multiplexed microarray to detect the three HAB species simultaneously, which successfully detected the target organisms, alone and in combination, without cross-reactivity. Our study suggests that fiber-optic microarrays can be used for rapid and sensitive detection and potential enumeration of HAB species in the environment.

DNA Microarray-based Ecotoxicological Biomarker Discovery in a Small Fish Model Species

EPA Science Inventory

This paper addresses several issues critical to use of zebrafish oligonucleotide microarrays for computational toxicology research on endocrine disrupting chemicals using small fish models, and more generally, the use of microarrays in aquatic toxicology.

Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays

PubMed Central

Jin, Lian-Qun; Li, Jun-Wen; Wang, Sheng-Qi; Chao, Fu-Huan; Wang, Xin-Wei; Yuan, Zheng-Quan

2005-01-01

AIM: To detect the common intestinal pathogenic bacteria quickly and accurately. METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays. RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified. CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, Proteus sp., Bacillus cereus, Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range, and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost. PMID:16437687

The Use of Atomic Force Microscopy for 3D Analysis of Nucleic Acid Hybridization on Microarrays.

PubMed

Dubrovin, E V; Presnova, G V; Rubtsova, M Yu; Egorov, A M; Grigorenko, V G; Yaminsky, I V

2015-01-01

Oligonucleotide microarrays are considered today to be one of the most efficient methods of gene diagnostics. The capability of atomic force microscopy (AFM) to characterize the three-dimensional morphology of single molecules on a surface allows one to use it as an effective tool for the 3D analysis of a microarray for the detection of nucleic acids. The high resolution of AFM offers ways to decrease the detection threshold of target DNA and increase the signal-to-noise ratio. In this work, we suggest an approach to the evaluation of the results of hybridization of gold nanoparticle-labeled nucleic acids on silicon microarrays based on an AFM analysis of the surface both in air and in liquid which takes into account of their three-dimensional structure. We suggest a quantitative measure of the hybridization results which is based on the fraction of the surface area occupied by the nanoparticles.

Analysis of large-scale gene expression data.

PubMed

Sherlock, G

2000-04-01

The advent of cDNA and oligonucleotide microarray technologies has led to a paradigm shift in biological investigation, such that the bottleneck in research is shifting from data generation to data analysis. Hierarchical clustering, divisive clustering, self-organizing maps and k-means clustering have all been recently used to make sense of this mass of data.

Linear model for fast background subtraction in oligonucleotide microarrays.

PubMed

Kroll, K Myriam; Barkema, Gerard T; Carlon, Enrico

2009-11-16

One important preprocessing step in the analysis of microarray data is background subtraction. In high-density oligonucleotide arrays this is recognized as a crucial step for the global performance of the data analysis from raw intensities to expression values. We propose here an algorithm for background estimation based on a model in which the cost function is quadratic in a set of fitting parameters such that minimization can be performed through linear algebra. The model incorporates two effects: 1) Correlated intensities between neighboring features in the chip and 2) sequence-dependent affinities for non-specific hybridization fitted by an extended nearest-neighbor model. The algorithm has been tested on 360 GeneChips from publicly available data of recent expression experiments. The algorithm is fast and accurate. Strong correlations between the fitted values for different experiments as well as between the free-energy parameters and their counterparts in aqueous solution indicate that the model captures a significant part of the underlying physical chemistry.

Transcript copy number estimation using a mouse whole-genome oligonucleotide microarray

PubMed Central

Carter, Mark G; Sharov, Alexei A; VanBuren, Vincent; Dudekula, Dawood B; Carmack, Condie E; Nelson, Charlie; Ko, Minoru SH

2005-01-01

The ability to quantitatively measure the expression of all genes in a given tissue or cell with a single assay is an exciting promise of gene-expression profiling technology. An in situ-synthesized 60-mer oligonucleotide microarray designed to detect transcripts from all mouse genes was validated, as well as a set of exogenous RNA controls derived from the yeast genome (made freely available without restriction), which allow quantitative estimation of absolute endogenous transcript abundance. PMID:15998450

The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

PubMed Central

2013-01-01

Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

[Differential gene expression in incompatible interaction between Lilium regale Wilson and Fusarium oxysporum f. sp. lilii revealed by combined SSH and microarray analysis].

PubMed

Rao, J; Liu, D; Zhang, N; He, H; Ge, F; Chen, C

2014-01-01

Fusarium wilt, caused by a soilborne pathogen Fusarium oxysporum f. sp. lilii, is the major disease of lily (Lilium L.). In order to isolate the genes differentially expressed in a resistant reaction to F. oxysporum in L. regale Wilson, a cDNA library was constructed with L. regale root during F. oxysporum infection using the suppression subtractive hybridization (SSH), and a total of 585 unique expressed sequence tags (ESTs) were obtained. Furthermore, the gene expression profiles in the incompatible interaction between L. regale and F. oxysporum were revealed by oligonucleotide microarray analysis of 585 unique ESTs comparison to the compatible interaction between a susceptible Lilium Oriental Hybrid 'Siberia' and F. oxysporum. The result of expression profile analysis indicated that the genes encoding pathogenesis-related proteins (PRs), antioxidative stress enzymes, secondary metabolism enzymes, transcription factors, signal transduction proteins as well as a large number of unknown genes were involved in early defense response of L. regale to F. oxysporum infection. Moreover, the following quantitative reverse transcription PCR (QRT-PCR) analysis confirmed reliability of the oligonucleotide microarray data. In the present study, isolation of differentially expressed genes in L. regale during response to F. oxysporum helped to uncover the molecular mechanism associated with the resistance of L. regale against F. oxysporum.

Drop drying on surfaces determines chemical reactivity - the specific case of immobilization of oligonucleotides on microarrays

PubMed Central

2013-01-01

Background Drop drying is a key factor in a wide range of technical applications, including spotted microarrays. The applied nL liquid volume provides specific reaction conditions for the immobilization of probe molecules to a chemically modified surface. Results We investigated the influence of nL and μL liquid drop volumes on the process of probe immobilization and compare the results obtained to the situation in liquid solution. In our data, we observe a strong relationship between drop drying effects on immobilization and surface chemistry. In this work, we present results on the immobilization of dye labeled 20mer oligonucleotides with and without an activating 5′-aminoheptyl linker onto a 2D epoxysilane and a 3D NHS activated hydrogel surface. Conclusions Our experiments identified two basic processes determining immobilization. First, the rate of drop drying that depends on the drop volume and the ambient relative humidity. Oligonucleotides in a dried spot react unspecifically with the surface and long reaction times are needed. 3D hydrogel surfaces allow for immobilization in a liquid environment under diffusive conditions. Here, oligonucleotide immobilization is much faster and a specific reaction with the reactive linker group is observed. Second, the effect of increasing probe concentration as a result of drop drying. On a 3D hydrogel, the increasing concentration of probe molecules in nL spotting volumes accelerates immobilization dramatically. In case of μL volumes, immobilization depends on whether the drop is allowed to dry completely. At non-drying conditions, very limited immobilization is observed due to the low oligonucleotide concentration used in microarray spotting solutions. The results of our study provide a general guideline for microarray assay development. They allow for the initial definition and further optimization of reaction conditions for the immobilization of oligonucleotides and other probe molecule classes to different surfaces in dependence of the applied spotting and reaction volume. PMID:23758982

Universal Oligonucleotide Microarray for Sub-Typing of Influenza A Virus

PubMed Central

Ryabinin, Vladimir A.; Kostina, Elena V.; Maksakova, Galiya A.; Neverov, Alexander A.; Chumakov, Konstantin M.; Sinyakov, Alexander N.

2011-01-01

A universal microchip was developed for genotyping Influenza A viruses. It contains two sets of oligonucleotide probes allowing viruses to be classified by the subtypes of hemagglutinin (H1–H13, H15, H16) and neuraminidase (N1–N9). Additional sets of probes are used to detect H1N1 swine influenza viruses. Selection of probes was done in two steps. Initially, amino acid sequences specific to each subtype were identified, and then the most specific and representative oligonucleotide probes were selected. Overall, between 19 and 24 probes were used to identify each subtype of hemagglutinin (HA) and neuraminidase (NA). Genotyping included preparation of fluorescently labeled PCR amplicons of influenza virus cDNA and their hybridization to microarrays of specific oligonucleotide probes. Out of 40 samples tested, 36 unambiguously identified HA and NA subtypes of Influenza A virus. PMID:21559081

PCR amplification on microarrays of gel immobilized oligonucleotides

DOEpatents

Strizhkov, Boris; Tillib, Sergei; Mikhailovich, Vladimir; Mirzabekov, Andrei

2003-11-04

The invention relates two general methods for performing PCR amplification, combined with the detection and analysis of the PCR products on a microchip. In the first method, the amplification occurs both outside and within a plurality of gel pads on a microchip, with at least one oligonucleotide primer immobilized in a gel pad. In the second method, PCR amplification also takes place within gel pads on a microchip, but the pads are surrounded by a hydrophobic liquid such as that which separates the individual gel pads into environments which resemble micro-miniaturized test tubes.

Microelectroporation device for genomic screening

DOEpatents

Perroud, Thomas D.; Renzi, Ronald F.; Negrete, Oscar; Claudnic, Mark R.

2014-09-09

We have developed an microelectroporation device that combines microarrays of oligonucleotides, microfluidic channels, and electroporation for cell transfection and high-throughput screening applications (e.g. RNA interference screens). Microarrays allow the deposition of thousands of different oligonucleotides in microscopic spots. Microfluidic channels and microwells enable efficient loading of cells into the device and prevent cross-contamination between different oligonucleotides spots. Electroporation allows optimal transfection of nucleic acids into cells (especially hard-to-transfect cells such as primary cells) by minimizing cell death while maximizing transfection efficiency. This invention has the advantage of a higher throughput and lower cost, while preventing cross-contamination compared to conventional screening technologies. Moreover, this device does not require bulky robotic liquid handling equipment and is inherently safer given that it is a closed system.

Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process

PubMed Central

LeProust, Emily M.; Peck, Bill J.; Spirin, Konstantin; McCuen, Heather Brummel; Moore, Bridget; Namsaraev, Eugeni; Caruthers, Marvin H.

2010-01-01

We have achieved the ability to synthesize thousands of unique, long oligonucleotides (150mers) in fmol amounts using parallel synthesis of DNA on microarrays. The sequence accuracy of the oligonucleotides in such large-scale syntheses has been limited by the yields and side reactions of the DNA synthesis process used. While there has been significant demand for libraries of long oligos (150mer and more), the yields in conventional DNA synthesis and the associated side reactions have previously limited the availability of oligonucleotide pools to lengths <100 nt. Using novel array based depurination assays, we show that the depurination side reaction is the limiting factor for the synthesis of libraries of long oligonucleotides on Agilent Technologies’ SurePrint® DNA microarray platform. We also demonstrate how depurination can be controlled and reduced by a novel detritylation process to enable the synthesis of high quality, long (150mer) oligonucleotide libraries and we report the characterization of synthesis efficiency for such libraries. Oligonucleotide libraries prepared with this method have changed the economics and availability of several existing applications (e.g. targeted resequencing, preparation of shRNA libraries, site-directed mutagenesis), and have the potential to enable even more novel applications (e.g. high-complexity synthetic biology). PMID:20308161

Mining microarrays for metabolic meaning: nutritional regulation of hypothalamic gene expression.

PubMed

Mobbs, Charles V; Yen, Kelvin; Mastaitis, Jason; Nguyen, Ha; Watson, Elizabeth; Wurmbach, Elisa; Sealfon, Stuart C; Brooks, Andrew; Salton, Stephen R J

2004-06-01

DNA microarray analysis has been used to investigate relative changes in the level of gene expression in the CNS, including changes that are associated with disease, injury, psychiatric disorders, drug exposure or withdrawal, and memory formation. We have used oligonucleotide microarrays to identify hypothalamic genes that respond to nutritional manipulation. In addition to commonly used microarray analysis based on criteria such as fold-regulation, we have also found that simply carrying out multiple t tests then sorting by P value constitutes a highly reliable method to detect true regulation, as assessed by real-time polymerase chain reaction (PCR), even for relatively low abundance genes or relatively low magnitude of regulation. Such analyses directly suggested novel mechanisms that mediate effects of nutritional state on neuroendocrine function and are being used to identify regulated gene products that may elucidate the metabolic pathology of obese ob/ob, lean Vgf-/Vgf-, and other models with profound metabolic impairments.

DEVELOPMENT AND VALIDATION OF A 2,000 GENE MICROARRAY FOR THE FATHEAD MINNOW, PIMEPHALES PROMELAS

EPA Science Inventory

The development of the gene microarray has provided the field of ecotoxicology a new tool to identify modes of action (MOA) of chemicals and chemical mixtures. Herein we describe the development and application of a 2,000 gene oligonucleotide microarray for the fathead minnow (P...

nuID: a universal naming scheme of oligonucleotides for Illumina, Affymetrix, and other microarrays

PubMed Central

Du, Pan; Kibbe, Warren A; Lin, Simon M

2007-01-01

Background Oligonucleotide probes that are sequence identical may have different identifiers between manufacturers and even between different versions of the same company's microarray; and sometimes the same identifier is reused and represents a completely different oligonucleotide, resulting in ambiguity and potentially mis-identification of the genes hybridizing to that probe. Results We have devised a unique, non-degenerate encoding scheme that can be used as a universal representation to identify an oligonucleotide across manufacturers. We have named the encoded representation 'nuID', for nucleotide universal identifier. Inspired by the fact that the raw sequence of the oligonucleotide is the true definition of identity for a probe, the encoding algorithm uniquely and non-degenerately transforms the sequence itself into a compact identifier (a lossless compression). In addition, we added a redundancy check (checksum) to validate the integrity of the identifier. These two steps, encoding plus checksum, result in an nuID, which is a unique, non-degenerate, permanent, robust and efficient representation of the probe sequence. For commercial applications that require the sequence identity to be confidential, we have an encryption schema for nuID. We demonstrate the utility of nuIDs for the annotation of Illumina microarrays, and we believe it has universal applicability as a source-independent naming convention for oligomers. Reviewers This article was reviewed by Itai Yanai, Rong Chen (nominated by Mark Gerstein), and Gregory Schuler (nominated by David Lipman). PMID:17540033

Homogeneous versus heterogeneous probes for microbial ecological microarrays.

PubMed

Bae, Jin-Woo; Park, Yong-Ha

2006-07-01

Microbial ecological microarrays have been developed for investigating the composition and functions of microorganism communities in environmental niches. These arrays include microbial identification microarrays, which use oligonucleotides, gene fragments or microbial genomes as probes. In this article, the advantages and disadvantages of each type of probe are reviewed. Oligonucleotide probes are currently useful for probing uncultivated bacteria that are not amenable to gene fragment probing, whereas the functional gene fragments amplified randomly from microbial genomes require phylogenetic and hierarchical categorization before use as microbial identification probes, despite their high resolution for both specificity and sensitivity. Until more bacteria are sequenced and gene fragment probes are thoroughly validated, heterogeneous bacterial genome probes will provide a simple, sensitive and quantitative tool for exploring the ecosystem structure.

[Research progress of probe design software of oligonucleotide microarrays].

PubMed

Chen, Xi; Wu, Zaoquan; Liu, Zhengchun

2014-02-01

DNA microarray has become an essential medical genetic diagnostic tool for its high-throughput, miniaturization and automation. The design and selection of oligonucleotide probes are critical for preparing gene chips with high quality. Several sets of probe design software have been developed and are available to perform this work now. Every set of the software aims to different target sequences and shows different advantages and limitations. In this article, the research and development of these sets of software are reviewed in line with three main criteria, including specificity, sensitivity and melting temperature (Tm). In addition, based on the experimental results from literatures, these sets of software are classified according to their applications. This review will be helpful for users to choose an appropriate probe-design software. It will also reduce the costs of microarrays, improve the application efficiency of microarrays, and promote both the research and development (R&D) and commercialization of high-performance probe design software.

Development of the first oligonucleotide microarray for global gene expression profiling in guinea pigs: defining the transcription signature of infectious diseases.

PubMed

Jain, Ruchi; Dey, Bappaditya; Tyagi, Anil K

2012-10-02

The Guinea pig (Cavia porcellus) is one of the most extensively used animal models to study infectious diseases. However, despite its tremendous contribution towards understanding the establishment, progression and control of a number of diseases in general and tuberculosis in particular, the lack of fully annotated guinea pig genome sequence as well as appropriate molecular reagents has severely hampered detailed genetic and immunological analysis in this animal model. By employing the cross-species hybridization technique, we have developed an oligonucleotide microarray with 44,000 features assembled from different mammalian species, which to the best of our knowledge is the first attempt to employ microarray to study the global gene expression profile in guinea pigs. To validate and demonstrate the merit of this microarray, we have studied, as an example, the expression profile of guinea pig lungs during the advanced phase of M. tuberculosis infection. A significant upregulation of 1344 genes and a marked down regulation of 1856 genes in the lungs identified a disease signature of pulmonary tuberculosis infection. We report the development of first comprehensive microarray for studying the global gene expression profile in guinea pigs and validation of its usefulness with tuberculosis as a case study. An important gap in the area of infectious diseases has been addressed and a valuable molecular tool is provided to optimally harness the potential of guinea pig model to develop better vaccines and therapies against human diseases.

EvOligo: A Novel Software to Design and Group Libraries of Oligonucleotides Applicable for Nucleic Acid-Based Experiments.

PubMed

Milewski, Marek C; Kamel, Karol; Kurzynska-Kokorniak, Anna; Chmielewski, Marcin K; Figlerowicz, Marek

2017-10-01

Experimental methods based on DNA and RNA hybridization, such as multiplex polymerase chain reaction, multiplex ligation-dependent probe amplification, or microarray analysis, require the use of mixtures of multiple oligonucleotides (primers or probes) in a single test tube. To provide an optimal reaction environment, minimal self- and cross-hybridization must be achieved among these oligonucleotides. To address this problem, we developed EvOligo, which is a software package that provides the means to design and group DNA and RNA molecules with defined lengths. EvOligo combines two modules. The first module performs oligonucleotide design, and the second module performs oligonucleotide grouping. The software applies a nearest-neighbor model of nucleic acid interactions coupled with a parallel evolutionary algorithm to construct individual oligonucleotides, and to group the molecules that are characterized by the weakest possible cross-interactions. To provide optimal solutions, the evolutionary algorithm sorts oligonucleotides into sets, preserves preselected parts of the oligonucleotides, and shapes their remaining parts. In addition, the oligonucleotide sets can be designed and grouped based on their melting temperatures. For the user's convenience, EvOligo is provided with a user-friendly graphical interface. EvOligo was used to design individual oligonucleotides, oligonucleotide pairs, and groups of oligonucleotide pairs that are characterized by the following parameters: (1) weaker cross-interactions between the non-complementary oligonucleotides and (2) more uniform ranges of the oligonucleotide pair melting temperatures than other available software products. In addition, in contrast to other grouping algorithms, EvOligo offers time-efficient sorting of paired and unpaired oligonucleotides based on various parameters defined by the user.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andersen, G.L.; He, Z.; DeSantis, T.Z.

Microarrays have proven to be a useful and high-throughput method to provide targeted DNA sequence information for up to many thousands of specific genetic regions in a single test. A microarray consists of multiple DNA oligonucleotide probes that, under high stringency conditions, hybridize only to specific complementary nucleic acid sequences (targets). A fluorescent signal indicates the presence and, in many cases, the abundance of genetic regions of interest. In this chapter we will look at how microarrays are used in microbial ecology, especially with the recent increase in microbial community DNA sequence data. Of particular interest to microbial ecologists, phylogeneticmore » microarrays are used for the analysis of phylotypes in a community and functional gene arrays are used for the analysis of functional genes, and, by inference, phylotypes in environmental samples. A phylogenetic microarray that has been developed by the Andersen laboratory, the PhyloChip, will be discussed as an example of a microarray that targets the known diversity within the 16S rRNA gene to determine microbial community composition. Using multiple, confirmatory probes to increase the confidence of detection and a mismatch probe for every perfect match probe to minimize the effect of cross-hybridization by non-target regions, the PhyloChip is able to simultaneously identify any of thousands of taxa present in an environmental sample. The PhyloChip is shown to reveal greater diversity within a community than rRNA gene sequencing due to the placement of the entire gene product on the microarray compared with the analysis of up to thousands of individual molecules by traditional sequencing methods. A functional gene array that has been developed by the Zhou laboratory, the GeoChip, will be discussed as an example of a microarray that dynamically identifies functional activities of multiple members within a community. The recent version of GeoChip contains more than 24,000 50mer oligonucleotide probes and covers more than 10,000 gene sequences in 150 gene categories involved in carbon, nitrogen, sulfur, and phosphorus cycling, metal resistance and reduction, and organic contaminant degradation. GeoChip can be used as a generic tool for microbial community analysis, and also link microbial community structure to ecosystem functioning. Examples of the application of both arrays in different environmental samples will be described in the two subsequent sections.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Farahani, Poupak; Chiu, Sally; Bowlus, Christopher L.

Obesity is a complex disease. To date, over 100 chromosomal loci for body weight, body fat, regional white adipose tissue weight, and other obesity-related traits have been identified in humans and in animal models. For most loci, the underlying genes are not yet identified; some of these chromosomal loci will be alleles of known obesity genes, whereas many will represent alleles of unknown genes. Microarray analysis allows simultaneous multiple gene and pathway discovery. cDNA and oligonucleotide arrays are commonly used to identify differentially expressed genes by surveys of large numbers of known and unnamed genes. Two papers previously identified genesmore » differentially expressed in adipose tissue of mouse models of obesity and diabetes by analysis of hybridization to Affymetrix oligonucleotide chips.« less

Oligonucleotide Microarray for 16S rRNA Gene-Based Detection of All Recognized Lineages of Sulfate-Reducing Prokaryotes in the Environment

PubMed Central

Loy, Alexander; Lehner, Angelika; Lee, Natuschka; Adamczyk, Justyna; Meier, Harald; Ernst, Jens; Schleifer, Karl-Heinz; Wagner, Michael

2002-01-01

For cultivation-independent detection of sulfate-reducing prokaryotes (SRPs) an oligonucleotide microarray consisting of 132 16S rRNA gene-targeted oligonucleotide probes (18-mers) having hierarchical and parallel (identical) specificity for the detection of all known lineages of sulfate-reducing prokaryotes (SRP-PhyloChip) was designed and subsequently evaluated with 41 suitable pure cultures of SRPs. The applicability of SRP-PhyloChip for diversity screening of SRPs in environmental and clinical samples was tested by using samples from periodontal tooth pockets and from the chemocline of a hypersaline cyanobacterial mat from Solar Lake (Sinai, Egypt). Consistent with previous studies, SRP-PhyloChip indicated the occurrence of Desulfomicrobium spp. in the tooth pockets and the presence of Desulfonema- and Desulfomonile-like SRPs (together with other SRPs) in the chemocline of the mat. The SRP-PhyloChip results were confirmed by several DNA microarray-independent techniques, including specific PCR amplification, cloning, and sequencing of SRP 16S rRNA genes and the genes encoding the dissimilatory (bi)sulfite reductase (dsrAB). PMID:12324358

Oligonucleotide microarray for subtyping of influenza A viruses

NASA Astrophysics Data System (ADS)

Klotchenko, S. A.; Vasin, A. V.; Sandybaev, N. T.; Plotnikova, M. A.; Chervyakova, O. V.; Smirnova, E. A.; Kushnareva, E. V.; Strochkov, V. M.; Taylakova, E. T.; Egorov, V. V.; Koshemetov, J. K.; Kiselev, O. I.; Sansyzbay, A. R.

2012-02-01

Influenza is one of the most widespread respiratory viral diseases, infecting humans, horses, pigs, poultry and some other animal populations. Influenza A viruses (IAV) are classified into subtypes on the basis of the surface hemagglutinin (H1 to H16) and neuraminidase (N1 to N9) glycoproteins. The correct determination of IAV subtype is necessary for clinical and epidemiological studies. In this article we propose an oligonucleotide microarray for subtyping of IAV using universal one-step multisegment RT-PCR fluorescent labeling of viral gene segments. It showed to be an advanced approach for fast detection and identification of IAV.

Quantitative multiplex quantum dot in-situ hybridisation based gene expression profiling in tissue microarrays identifies prognostic genes in acute myeloid leukaemia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tholouli, Eleni; MacDermott, Sarah; Hoyland, Judith

2012-08-24

Highlights: Black-Right-Pointing-Pointer Development of a quantitative high throughput in situ expression profiling method. Black-Right-Pointing-Pointer Application to a tissue microarray of 242 AML bone marrow samples. Black-Right-Pointing-Pointer Identification of HOXA4, HOXA9, Meis1 and DNMT3A as prognostic markers in AML. -- Abstract: Measurement and validation of microarray gene signatures in routine clinical samples is problematic and a rate limiting step in translational research. In order to facilitate measurement of microarray identified gene signatures in routine clinical tissue a novel method combining quantum dot based oligonucleotide in situ hybridisation (QD-ISH) and post-hybridisation spectral image analysis was used for multiplex in-situ transcript detection inmore » archival bone marrow trephine samples from patients with acute myeloid leukaemia (AML). Tissue-microarrays were prepared into which white cell pellets were spiked as a standard. Tissue microarrays were made using routinely processed bone marrow trephines from 242 patients with AML. QD-ISH was performed for six candidate prognostic genes using triplex QD-ISH for DNMT1, DNMT3A, DNMT3B, and for HOXA4, HOXA9, Meis1. Scrambled oligonucleotides were used to correct for background staining followed by normalisation of expression against the expression values for the white cell pellet standard. Survival analysis demonstrated that low expression of HOXA4 was associated with poorer overall survival (p = 0.009), whilst high expression of HOXA9 (p < 0.0001), Meis1 (p = 0.005) and DNMT3A (p = 0.04) were associated with early treatment failure. These results demonstrate application of a standardised, quantitative multiplex QD-ISH method for identification of prognostic markers in formalin-fixed paraffin-embedded clinical samples, facilitating measurement of gene expression signatures in routine clinical samples.« less

Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays

PubMed Central

2011-01-01

Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062

Immune and inflammatory gene signature in rat cerebrum in subarachnoid hemorrhage with microarray analysis.

PubMed

Lee, Chu-I; Chou, An-Kuo; Lin, Ching-Chih; Chou, Chia-Hua; Loh, Joon-Khim; Lieu, Ann-Shung; Wang, Chih-Jen; Huang, Chi-Ying F; Howng, Shen-Long; Hong, Yi-Ren

2012-01-01

Cerebral vasospasm following subarachnoid hemorrhage (SAH) has been studied in terms of a contraction of the major cerebral arteries, but the effect of cerebrum tissue in SAH is not yet well understood. To gain insight into the biology of SAH-expressing cerebrum, we employed oligonucleotide microarrays to characterize the gene expression profiles of cerebrum tissue at the early stage of SAH. Functional gene expression in the cerebrum was analyzed 2 h following stage 1-hemorrhage in Sprague-Dawley rats. mRNA was investigated by performing microarray and quantitative real-time PCR analyses, and protein expression was determined by Western blot analysis. In this study, 18 upregulated and 18 downregulated genes displayed at least a 1.5-fold change. Five genes were verified by real-time PCR, including three upregulated genes [prostaglandin E synthase (PGES), CD14 antigen, and tissue inhibitor of metalloproteinase 1 (TIMP1)] as well as two downregulated genes [KRAB-zinc finger protein-2 (KZF-2) and γ-aminobutyric acid B receptor 1 (GABA B receptor)]. Notably, there were functional implications for the three upregulated genes involved in the inflammatory SAH process. However, the mechanisms leading to decreased KZF-2 and GABA B receptor expression in SAH have never been characterized. We conclude that oligonucleotide microarrays have the potential for use as a method to identify candidate genes associated with SAH and to provide novel investigational targets, including genes involved in the immune and inflammatory response. Furthermore, understanding the regulation of MMP9/TIMP1 during the early stages of SAH may elucidate the pathophysiological mechanisms in SAH rats.

High-density fiber optic biosensor arrays

NASA Astrophysics Data System (ADS)

Epstein, Jason R.; Walt, David R.

2002-02-01

Novel approaches are required to coordinate the immense amounts of information derived from diverse genomes. This concept has influenced the expanded role of high-throughput DNA detection and analysis in the biological sciences. A high-density fiber optic DNA biosensor was developed consisting of oligonucleotide-functionalized, 3.1 mm diameter microspheres deposited into the etched wells on the distal face of a 500 micrometers imaging fiber bundle. Imaging fiber bundles containing thousands of optical fibers, each associated with a unique oligonucleotide probe sequence, were the foundation for an optically connected, individually addressable DNA detection platform. Different oligonucleotide-functionalized microspheres were combined in a stock solution, and randomly dispersed into the etched wells. Microsphere positions were registered from optical dyes incorporated onto the microspheres. The distribution process provided an inherent redundancy that increases the signal-to-noise ratio as the square root of the number of sensors examined. The representative amount of each probe-type in the array was dependent on their initial stock solution concentration, and as other sequences of interest arise, new microsphere elements can be added to arrays without altering the existing detection capabilities. The oligonucleotide probe sequences hybridize to fluorescently-labeled, complementary DNA target solutions. Fiber optic DNA microarray research has included DNA-protein interaction profiles, microbial strain differentiation, non-labeled target interrogation with molecular beacons, and single cell-based assays. This biosensor array is proficient in DNA detection linked to specific disease states, single nucleotide polymorphism (SNP's) discrimination, and gene expression analysis. This array platform permits multiple detection formats, provides smaller feature sizes, and enables sensor design flexibility. High-density fiber optic microarray biosensors provide a fast, reversible format with the detection limit of a few hundred molecules.

An Undergraduate Laboratory Exercise to Study the Effect of Darkness on Plant Gene Expression Using DNA Microarray

ERIC Educational Resources Information Center

Chang, Ming-Mei; Briggs, George M.

2007-01-01

DNA microarrays are microscopic arrays on a solid surface, typically a glass slide, on which DNA oligonucleotides are deposited or synthesized in a high-density matrix with a predetermined spatial order. Several types of DNA microarrays have been developed and used for various biological studies. Here, we developed an undergraduate laboratory…

ASSESSING THE USE OF OLIGONUCLEOTIDE MICROARRAYS FOR FATHEAD MINNOW (PIMEPHALES PROMELAS) TO EXAMINE EXPOSURE VARIABLES

EPA Science Inventory

Microarray technology has proven to be a useful tool for analyzing the transcriptome of various organisms representing conditions such as disease states, developmental stages, and responses to chemical exposure. Although most commercially available arrays are limited to organism...

Oligonucleotide microarray for the identification of potential mycotoxigenic fungi

PubMed Central

2010-01-01

Background Mycotoxins are secondary metabolites which are produced by numerous fungi and pose a continuous challenge to the safety and quality of food commodities in South Africa. These toxins have toxicologically relevant effects on humans and animals that eat contaminated foods. In this study, a diagnostic DNA microarray was developed for the identification of the most common food-borne fungi, as well as the genes leading to toxin production. Results A total of 40 potentially mycotoxigenic fungi isolated from different food commodities, as well as the genes that are involved in the mycotoxin synthetic pathways, were analyzed. For fungal identification, oligonucleotide probes were designed by exploiting the sequence variations of the elongation factor 1-alpha (EF-1 α) coding regions and the internal transcribed spacer (ITS) regions of the rRNA gene cassette. For the detection of fungi able to produce mycotoxins, oligonucleotide probes directed towards genes leading to toxin production from different fungal strains were identified in data available in the public domain. The probes selected for fungal identification and the probes specific for toxin producing genes were spotted onto microarray slides. Conclusions The diagnostic microarray developed can be used to identify single pure strains or cultures of potentially mycotoxigenic fungi as well as genes leading to toxin production in both laboratory samples and maize-derived foods offering an interesting potential for microbiological laboratories. PMID:20307326

Methylation oligonucleotide microarray: a novel tool to analyze methylation patterns

NASA Astrophysics Data System (ADS)

Hou, Peng; Ji, Meiju; He, Nongyao; Lu, Zuhong

2003-04-01

A new technique to analyze methylation patterns in several adjacent CpG sites was developed and reported here. We selected a 336bp segment of the 5"-untranslated region and the first exon of the p16Ink4a gene, which include the most densely packed CpG fragment of the islands containing 32 CpG dinucleotides, as the investigated target. The probes that include all types of methylation patterns were designed to fabricate a DNA microarray to determine the methylation patterns of seven adjacent CpG dinucleotides sites. High accuracy and reproducibility were observed in several parallel experiments. The results led us to the conclusion that the methylation oligonucleotide microarray can be applied as a novel and powerful tool to map methylation patterns and changes in multiple CpG island loci in a variety of tumors.

Extending Immunological Profiling in the Gilthead Sea Bream, Sparus aurata, by Enriched cDNA Library Analysis, Microarray Design and Initial Studies upon the Inflammatory Response to PAMPs.

PubMed

Boltaña, Sebastian; Castellana, Barbara; Goetz, Giles; Tort, Lluis; Teles, Mariana; Mulero, Victor; Novoa, Beatriz; Figueras, Antonio; Goetz, Frederick W; Gallardo-Escarate, Cristian; Planas, Josep V; Mackenzie, Simon

2017-02-03

This study describes the development and validation of an enriched oligonucleotide-microarray platform for Sparus aurata (SAQ) to provide a platform for transcriptomic studies in this species. A transcriptome database was constructed by assembly of gilthead sea bream sequences derived from public repositories of mRNA together with reads from a large collection of expressed sequence tags (EST) from two extensive targeted cDNA libraries characterizing mRNA transcripts regulated by both bacterial and viral challenge. The developed microarray was further validated by analysing monocyte/macrophage activation profiles after challenge with two Gram-negative bacterial pathogen-associated molecular patterns (PAMPs; lipopolysaccharide (LPS) and peptidoglycan (PGN)). Of the approximately 10,000 EST sequenced, we obtained a total of 6837 EST longer than 100 nt, with 3778 and 3059 EST obtained from the bacterial-primed and from the viral-primed cDNA libraries, respectively. Functional classification of contigs from the bacterial- and viral-primed cDNA libraries by Gene Ontology (GO) showed that the top five represented categories were equally represented in the two libraries: metabolism (approximately 24% of the total number of contigs), carrier proteins/membrane transport (approximately 15%), effectors/modulators and cell communication (approximately 11%), nucleoside, nucleotide and nucleic acid metabolism (approximately 7.5%) and intracellular transducers/signal transduction (approximately 5%). Transcriptome analyses using this enriched oligonucleotide platform identified differential shifts in the response to PGN and LPS in macrophage-like cells, highlighting responsive gene-cassettes tightly related to PAMP host recognition. As observed in other fish species, PGN is a powerful activator of the inflammatory response in S. aurata macrophage-like cells. We have developed and validated an oligonucleotide microarray (SAQ) that provides a platform enriched for the study of gene expression in S. aurata with an emphasis upon immunity and the immune response.

Impact of point-mutations on the hybridization affinity of surface-bound DNA/DNA and RNA/DNA oligonucleotide-duplexes: Comparison of single base mismatches and base bulges

PubMed Central

Naiser, Thomas; Ehler, Oliver; Kayser, Jona; Mai, Timo; Michel, Wolfgang; Ott, Albrecht

2008-01-01

Background The high binding specificity of short 10 to 30 mer oligonucleotide probes enables single base mismatch (MM) discrimination and thus provides the basis for genotyping and resequencing microarray applications. Recent experiments indicate that the underlying principles governing DNA microarray hybridization – and in particular MM discrimination – are not completely understood. Microarrays usually address complex mixtures of DNA targets. In order to reduce the level of complexity and to study the problem of surface-based hybridization with point defects in more detail, we performed array based hybridization experiments in well controlled and simple situations. Results We performed microarray hybridization experiments with short 16 to 40 mer target and probe lengths (in situations without competitive hybridization) in order to systematically investigate the impact of point-mutations – varying defect type and position – on the oligonucleotide duplex binding affinity. The influence of single base bulges and single base MMs depends predominantly on position – it is largest in the middle of the strand. The position-dependent influence of base bulges is very similar to that of single base MMs, however certain bulges give rise to an unexpectedly high binding affinity. Besides the defect (MM or bulge) type, which is the second contribution in importance to hybridization affinity, there is also a sequence dependence, which extends beyond the defect next-neighbor and which is difficult to quantify. Direct comparison between binding affinities of DNA/DNA and RNA/DNA duplexes shows, that RNA/DNA purine-purine MMs are more discriminating than corresponding DNA/DNA MMs. In DNA/DNA MM discrimination the affected base pair (C·G vs. A·T) is the pertinent parameter. We attribute these differences to the different structures of the duplexes (A vs. B form). Conclusion We have shown that DNA microarrays can resolve even subtle changes in hybridization affinity for simple target mixtures. We have further shown that the impact of point defects on oligonucleotide stability can be broken down to a hierarchy of effects. In order to explain our observations we propose DNA molecular dynamics – in form of zipping of the oligonucleotide duplex – to play an important role. PMID:18477387

Emerging Use of Gene Expression Microarrays in Plant Physiology

DOE PAGES

Wullschleger, Stan D.; Difazio, Stephen P.

2003-01-01

Microarrays have become an important technology for the global analysis of gene expression in humans, animals, plants, and microbes. Implemented in the context of a well-designed experiment, cDNA and oligonucleotide arrays can provide highthroughput, simultaneous analysis of transcript abundance for hundreds, if not thousands, of genes. However, despite widespread acceptance, the use of microarrays as a tool to better understand processes of interest to the plant physiologist is still being explored. To help illustrate current uses of microarrays in the plant sciences, several case studies that we believe demonstrate the emerging application of gene expression arrays in plant physiology weremore » selected from among the many posters and presentations at the 2003 Plant and Animal Genome XI Conference. Based on this survey, microarrays are being used to assess gene expression in plants exposed to the experimental manipulation of air temperature, soil water content and aluminium concentration in the root zone. Analysis often includes characterizing transcript profiles for multiple post-treatment sampling periods and categorizing genes with common patterns of response using hierarchical clustering techniques. In addition, microarrays are also providing insights into developmental changes in gene expression associated with fibre and root elongation in cotton and maize, respectively. Technical and analytical limitations of microarrays are discussed and projects attempting to advance areas of microarray design and data analysis are highlighted. Finally, although much work remains, we conclude that microarrays are a valuable tool for the plant physiologist interested in the characterization and identification of individual genes and gene families with potential application in the fields of agriculture, horticulture and forestry.« less

BioconductorBuntu: a Linux distribution that implements a web-based DNA microarray analysis server.

PubMed

Geeleher, Paul; Morris, Dermot; Hinde, John P; Golden, Aaron

2009-06-01

BioconductorBuntu is a custom distribution of Ubuntu Linux that automatically installs a server-side microarray processing environment, providing a user-friendly web-based GUI to many of the tools developed by the Bioconductor Project, accessible locally or across a network. System installation is via booting off a CD image or by using a Debian package provided to upgrade an existing Ubuntu installation. In its current version, several microarray analysis pipelines are supported including oligonucleotide, dual-or single-dye experiments, including post-processing with Gene Set Enrichment Analysis. BioconductorBuntu is designed to be extensible, by server-side integration of further relevant Bioconductor modules as required, facilitated by its straightforward underlying Python-based infrastructure. BioconductorBuntu offers an ideal environment for the development of processing procedures to facilitate the analysis of next-generation sequencing datasets. BioconductorBuntu is available for download under a creative commons license along with additional documentation and a tutorial from (http://bioinf.nuigalway.ie).

Multi-Gene Detection and Identification of Mosquito-Borne RNA Viruses Using an Oligonucleotide Microarray

PubMed Central

Grubaugh, Nathan D.; McMenamy, Scott S.; Turell, Michael J.; Lee, John S.

2013-01-01

Background Arthropod-borne viruses are important emerging pathogens world-wide. Viruses transmitted by mosquitoes, such as dengue, yellow fever, and Japanese encephalitis viruses, infect hundreds of millions of people and animals each year. Global surveillance of these viruses in mosquito vectors using molecular based assays is critical for prevention and control of the associated diseases. Here, we report an oligonucleotide DNA microarray design, termed ArboChip5.1, for multi-gene detection and identification of mosquito-borne RNA viruses from the genera Flavivirus (family Flaviviridae), Alphavirus (Togaviridae), Orthobunyavirus (Bunyaviridae), and Phlebovirus (Bunyaviridae). Methodology/Principal Findings The assay utilizes targeted PCR amplification of three genes from each virus genus for electrochemical detection on a portable, field-tested microarray platform. Fifty-two viruses propagated in cell-culture were used to evaluate the specificity of the PCR primer sets and the ArboChip5.1 microarray capture probes. The microarray detected all of the tested viruses and differentiated between many closely related viruses such as members of the dengue, Japanese encephalitis, and Semliki Forest virus clades. Laboratory infected mosquitoes were used to simulate field samples and to determine the limits of detection. Additionally, we identified dengue virus type 3, Japanese encephalitis virus, Tembusu virus, Culex flavivirus, and a Quang Binh-like virus from mosquitoes collected in Thailand in 2011 and 2012. Conclusions/Significance We demonstrated that the described assay can be utilized in a comprehensive field surveillance program by the broad-range amplification and specific identification of arboviruses from infected mosquitoes. Furthermore, the microarray platform can be deployed in the field and viral RNA extraction to data analysis can occur in as little as 12 h. The information derived from the ArboChip5.1 microarray can help to establish public health priorities, detect disease outbreaks, and evaluate control programs. PMID:23967358

OY-TES-1 may regulate the malignant behavior of liver cancer via NANOG, CD9, CCND2 and CDCA3: a bioinformatic analysis combine with RNAi and oligonucleotide microarray.

PubMed

Hu, Qiping; Fu, Jun; Luo, Bin; Huang, Miao; Guo, Wenwen; Lin, Yongda; Xie, Xiaoxun; Xiao, Shaowen

2015-04-01

Given its tumor-specific expression, including liver cancer, OY-TES-1 is a potential molecular marker for the diagnosis and immunotherapy of liver cancers. However, investigations of the mechanisms and the role of OY-TES-1 in liver cancer are rare. In the present study, based on a comprehensive bioinformatic analysis combined with RNA interference (RNAi) and oligonucleotide microarray, we report for the first time that downregulation of OY-TES-1 resulted in significant changes in expression of NANOG, CD9, CCND2 and CDCA3 in the liver cancer cell line BEL-7404. NANOG, CD9, CCND2 and CDCA3 may be involved in cell proliferation, migration, invasion and apoptosis, yet also may be functionally related to each other and OY-TES-1. Among these molecules, we identified that NANOG, containing a Kazal-2 binding motif and homeobox, may be the most likely candidate protein interacting with OY-TES-1 in liver cancer. Thus, the present study may provide important information for further investigation of the roles of OY-TES-1 in liver cancer.

Design and evaluation of Actichip, a thematic microarray for the study of the actin cytoskeleton

PubMed Central

Muller, Jean; Mehlen, André; Vetter, Guillaume; Yatskou, Mikalai; Muller, Arnaud; Chalmel, Frédéric; Poch, Olivier; Friederich, Evelyne; Vallar, Laurent

2007-01-01

Background The actin cytoskeleton plays a crucial role in supporting and regulating numerous cellular processes. Mutations or alterations in the expression levels affecting the actin cytoskeleton system or related regulatory mechanisms are often associated with complex diseases such as cancer. Understanding how qualitative or quantitative changes in expression of the set of actin cytoskeleton genes are integrated to control actin dynamics and organisation is currently a challenge and should provide insights in identifying potential targets for drug discovery. Here we report the development of a dedicated microarray, the Actichip, containing 60-mer oligonucleotide probes for 327 genes selected for transcriptome analysis of the human actin cytoskeleton. Results Genomic data and sequence analysis features were retrieved from GenBank and stored in an integrative database called Actinome. From these data, probes were designed using a home-made program (CADO4MI) allowing sequence refinement and improved probe specificity by combining the complementary information recovered from the UniGene and RefSeq databases. Actichip performance was analysed by hybridisation with RNAs extracted from epithelial MCF-7 cells and human skeletal muscle. Using thoroughly standardised procedures, we obtained microarray images with excellent quality resulting in high data reproducibility. Actichip displayed a large dynamic range extending over three logs with a limit of sensitivity between one and ten copies of transcript per cell. The array allowed accurate detection of small changes in gene expression and reliable classification of samples based on the expression profiles of tissue-specific genes. When compared to two other oligonucleotide microarray platforms, Actichip showed similar sensitivity and concordant expression ratios. Moreover, Actichip was able to discriminate the highly similar actin isoforms whereas the two other platforms did not. Conclusion Our data demonstrate that Actichip is a powerful alternative to commercial high density microarrays for cytoskeleton gene profiling in normal or pathological samples. Actichip is available upon request. PMID:17727702

Application of HLA-DRB1 genotyping by oligonucleotide micro-array technology in forensic medicine.

PubMed

Jiang, Bin; Li, Yao; Wu, Hai; He, Xianmin; Li, Chengtao; Li, Li; Tang, Rong; Xie, Yi; Mao, Yumin

2006-10-16

The human leukocyte antigen (HLA) system is known to be the most complex polymorphic system in the human genome. Among all of the HLA loci, HLA-DRB1 has the second largest number of alleles. The purpose of this study is to develop an oligonucleotide micro-array based HLA-DRB1 typing system for use in forensic identification, anthropology, tissue transplantation, and other genetic research fields. The system was developed by analyzing the HLA-DRB1 (DRB1) genotypes in 1198 unrelated healthy Chinese Han individuals originating from various parts of China and residing in Shanghai, China. Polymerase chain reaction (PCR) coupled with the oligonucleotide micro-array technology was used to detect and type HLA-DRB1 alleles of the sample individuals. The reliability, sensitivity, consistency and specificity were evaluated for use in forensic identification. Furthermore, a meta-analysis was carried out by comparing the allele frequencies of the HLA-DRB1 locus with those of other Chinese Han groups, Chinese minorities and other ethnic populations. All the DNA samples yielded a 273 bp amplification product, with no other amplification products in this length range. The minimum quantity of DNA detected by this method is 15 ng in a PCR reaction system of 25 microl. The population studied appeared to be not in Hardy-Weinberg equilibrium. Observed heterozygosity (Ho), expected heterozygosity (He), expected probability of exclusion (PE), polymorphic information content (PIC), and discrimination power (DP) of the HLA-DRB1 locus from the Shanghai Han ethnic group were evaluated to be 0.8022, 0.8870, 0.7741, 0.8771, 0.9750, respectively. A total of 25 HLA-DRB1 alleles were identified. HLA-DRB1*09XX, *04XX, *12XX and *15XX were the most frequent DRB1 alleles, which were observed in 58.76% of the sample. One hundred and sixteen genotypes were found. The five most frequent genotypes were: *04XX/*04XX (0.0626), *09XX/*09XX (0.0593), *04XX/*09XX (0.0551), *09XX/*15XX (0.0384) and *08XX/*12XX (0.0351). The meta-analysis showed that there were uniquely distributed features of DRB1 alleles among various ethnic populations and among the studied population groups from various regions with the same ethnic origin. An HLA-DRB1 genotyping system has been developed and established based on the oligonucleotide micro-array technology. The HLA-DRB1 typing of the Han population in Shanghai has revealed a relatively high heterogeneity. Information obtained in this study will be useful for medical and forensic applications as well as in anthropology research. Large-scale micro-array detection is highly accurate and reliable for DNA-based HLA-DRB1 genotyping. These results suggest that HLA-DRB1 DNA polymorphisms and the database of the Shanghai Han group have useful applications in processing forensic casework (as personal identification, paternity test), tracing population migration and genetic diagnosis.

Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

PubMed

Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

2015-06-01

Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

Microarray Technology for the Diagnosis of Fetal Chromosomal Aberrations: Which Platform Should We Use?

PubMed Central

Karampetsou, Evangelia; Morrogh, Deborah; Chitty, Lyn

2014-01-01

The advantage of microarray (array) over conventional karyotype for the diagnosis of fetal pathogenic chromosomal anomalies has prompted the use of microarrays in prenatal diagnostics. In this review we compare the performance of different array platforms (BAC, oligonucleotide CGH, SNP) and designs (targeted, whole genome, whole genome, and targeted, custom) and discuss their advantages and disadvantages in relation to prenatal testing. We also discuss the factors to consider when implementing a microarray testing service for the diagnosis of fetal chromosomal aberrations. PMID:26237396

Oligonucleotide microarray analysis reveals dysregulation of energy-related metabolism in insulin-sensitive tissues of type 2 diabetes patients.

PubMed

Wang, M; Wang, X C; Zhao, L; Zhang, Y; Yao, L L; Lin, Y; Peng, Y D; Hu, R M

2014-06-17

Impaired insulin action within skeletal muscle, adipose tissue, and the liver is an important characteristic of type 2 diabetes (T2D). In order to identify common underlying defects in insulin-sensitive tissues that may be involved in the pathogenesis of T2D, the gene expression profiles of skeletal muscle, visceral adipose tissue, and liver from autopsy donors with or without T2D were examined using oligonucleotide microarrays and quantitative reverse transcriptase-PCR. Compared with controls, 691 genes were commonly dysregulated in these three insulin-sensitive tissues of humans with T2D. These co-expressed genes were enriched within the mitochondrion, with suggested involvement in energy metabolic processes such as glycolysis and gluconeogenesis, fatty acid beta oxidative, tricarboxylic acid cycle, and electron transport. Genes related to energy metabolism were mostly downregulated in diabetic skeletal muscle and visceral adipose tissue, while they were upregulated in the diabetic liver. This observed dysregulation in energy-related metabolism may be the underlying factor leading to the molecular mechanisms responsible for the insulin resistance of patients with T2D.

Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization

PubMed Central

Girard, Laurie D.; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G.

2014-01-01

The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have a high complexity cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotidesequence-dependent segment and a unique “target sequence-independent” 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design of lab-on-chip microfluidic devices, while also reducing consumable costs. At term, it will allow the cost-effective automation of highly multiplexed assays for detection and identification of genetic targets. PMID:25489607

Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization.

PubMed

Girard, Laurie D; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G

2015-02-07

The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have high complexity and cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotide sequence-dependent segment and a unique "target sequence-independent" 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design of lab-on-chip microfluidic devices, while also reducing consumable costs. At term, it will allow the cost-effective automation of highly multiplexed assays for detection and identification of genetic targets.

Evolution of the MIDTAL microarray: the adaption and testing of oligonucleotide 18S and 28S rDNA probes and evaluation of subsequent microarray generations with Prymnesium spp. cultures and field samples.

PubMed

McCoy, Gary R; Touzet, Nicolas; Fleming, Gerard T A; Raine, Robin

2015-07-01

The toxic microalgal species Prymnesium parvum and Prymnesium polylepis are responsible for numerous fish kills causing economic stress on the aquaculture industry and, through the consumption of contaminated shellfish, can potentially impact on human health. Monitoring of toxic phytoplankton is traditionally carried out by light microscopy. However, molecular methods of identification and quantification are becoming more common place. This study documents the optimisation of the novel Microarrays for the Detection of Toxic Algae (MIDTAL) microarray from its initial stages to the final commercial version now available from Microbia Environnement (France). Existing oligonucleotide probes used in whole-cell fluorescent in situ hybridisation (FISH) for Prymnesium species from higher group probes to species-level probes were adapted and tested on the first-generation microarray. The combination and interaction of numerous other probes specific for a whole range of phytoplankton taxa also spotted on the chip surface caused high cross reactivity, resulting in false-positive results on the microarray. The probe sequences were extended for the subsequent second-generation microarray, and further adaptations of the hybridisation protocol and incubation temperatures significantly reduced false-positive readings from the first to the second-generation chip, thereby increasing the specificity of the MIDTAL microarray. Additional refinement of the subsequent third-generation microarray protocols with the addition of a poly-T amino linker to the 5' end of each probe further enhanced the microarray performance but also highlighted the importance of optimising RNA labelling efficiency when testing with natural seawater samples from Killary Harbour, Ireland.

AccuTyping: new algorithms for automated analysis of data from high-throughput genotyping with oligonucleotide microarrays

PubMed Central

Hu, Guohong; Wang, Hui-Yun; Greenawalt, Danielle M.; Azaro, Marco A.; Luo, Minjie; Tereshchenko, Irina V.; Cui, Xiangfeng; Yang, Qifeng; Gao, Richeng; Shen, Li; Li, Honghua

2006-01-01

Microarray-based analysis of single nucleotide polymorphisms (SNPs) has many applications in large-scale genetic studies. To minimize the influence of experimental variation, microarray data usually need to be processed in different aspects including background subtraction, normalization and low-signal filtering before genotype determination. Although many algorithms are sophisticated for these purposes, biases are still present. In the present paper, new algorithms for SNP microarray data analysis and the software, AccuTyping, developed based on these algorithms are described. The algorithms take advantage of a large number of SNPs included in each assay, and the fact that the top and bottom 20% of SNPs can be safely treated as homozygous after sorting based on their ratios between the signal intensities. These SNPs are then used as controls for color channel normalization and background subtraction. Genotype calls are made based on the logarithms of signal intensity ratios using two cutoff values, which were determined after training the program with a dataset of ∼160 000 genotypes and validated by non-microarray methods. AccuTyping was used to determine >300 000 genotypes of DNA and sperm samples. The accuracy was shown to be >99%. AccuTyping can be downloaded from . PMID:16982644

Detection and genotyping of Entamoeba histolytica, Entamoeba dispar, Giardia lamblia, and Cryptosporidium parvum by oligonucleotide microarray.

PubMed

Wang, Zheng; Vora, Gary J; Stenger, David A

2004-07-01

Entamoeba histolytica, Giardia lamblia, and Cryptosporidium parvum are the most frequently identified protozoan parasites causing waterborne disease outbreaks. The morbidity and mortality associated with these intestinal parasitic infections warrant the development of rapid and accurate detection and genotyping methods to aid public health efforts aimed at preventing and controlling outbreaks. In this study, we describe the development of an oligonucleotide microarray capable of detecting and discriminating between E. histolytica, Entamoeba dispar, G. lamblia assemblages A and B, and C. parvum types 1 and 2 in a single assay. Unique hybridization patterns for each selected protozoan were generated by amplifying six to eight diagnostic sequences/organism by multiplex PCR; fluorescent labeling of the amplicons via primer extension; and subsequent hybridization to a set of genus-, species-, and subtype-specific covalently immobilized oligonucleotide probes. The profile-based specificity of this methodology not only permitted for the unequivocal identification of the six targeted species and subtypes, but also demonstrated its potential in identifying related species such as Cryptosporidium meleagridis and Cryptosporidium muris. In addition, sensitivity assays demonstrated lower detection limits of five trophozoites of G. lamblia. Taken together, the specificity and sensitivity of the microarray-based approach suggest that this methodology may provide a promising tool to detect and genotype protozoa from clinical and environmental samples.

A Unique Procedure to Identify Cell Surface Markers Through a Spherical Self-Organizing Map Applied to DNA Microarray Analysis.

PubMed

Sugii, Yuh; Kasai, Tomonari; Ikeda, Masashi; Vaidyanath, Arun; Kumon, Kazuki; Mizutani, Akifumi; Seno, Akimasa; Tokutaka, Heizo; Kudoh, Takayuki; Seno, Masaharu

2016-01-01

To identify cell-specific markers, we designed a DNA microarray platform with oligonucleotide probes for human membrane-anchored proteins. Human glioma cell lines were analyzed using microarray and compared with normal and fetal brain tissues. For the microarray analysis, we employed a spherical self-organizing map, which is a clustering method suitable for the conversion of multidimensional data into two-dimensional data and displays the relationship on a spherical surface. Based on the gene expression profile, the cell surface characteristics were successfully mirrored onto the spherical surface, thereby distinguishing normal brain tissue from the disease model based on the strength of gene expression. The clustered glioma-specific genes were further analyzed by polymerase chain reaction procedure and immunocytochemical staining of glioma cells. Our platform and the following procedure were successfully demonstrated to categorize the genes coding for cell surface proteins that are specific to glioma cells. Our assessment demonstrates that a spherical self-organizing map is a valuable tool for distinguishing cell surface markers and can be employed in marker discovery studies for the treatment of cancer.

Nucleic acid sequence detection using multiplexed oligonucleotide PCR

DOEpatents

Nolan, John P [Santa Fe, NM; White, P Scott [Los Alamos, NM

2006-12-26

Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

Regulation of the activity of the promoter of RNA-induced silencing, C3PO.

PubMed

Sahu, Shriya; Williams, Leo; Perez, Alberto; Philip, Finly; Caso, Giuseppe; Zurawsky, Walter; Scarlata, Suzanne

2017-09-01

RNA-induced silencing is a process which allows cells to regulate the synthesis of specific proteins. RNA silencing is promoted by the protein C3PO (component 3 of RISC). We have previously found that phospholipase Cβ, which increases intracellular calcium levels in response to specific G protein signals, inhibits C3PO activity towards certain genes. Understanding the parameters that control C3PO activity and which genes are impacted by G protein activation would help predict which genes are more vulnerable to downregulation. Here, using a library of 10 18 oligonucleotides, we show that C3PO binds oligonucleotides with structural specificity but little sequence specificity. Alternately, C3PO hydrolyzes oligonucleotides with a rate that is sensitive to substrate stability. Importantly, we find that oligonucleotides with higher Tm values are inhibited by bound PLCβ. This finding is supported by microarray analysis in cells over-expressing PLCβ1. Taken together, this study allows predictions of the genes whose post-transcriptional regulation is responsive to the G protein/phospholipase Cβ/calcium signaling pathway. © 2017 The Protein Society.

Detection and discrimination of orthopoxviruses using microarrays of immobilized oligonucleotides.

PubMed

Laassri, Majid; Chizhikov, Vladimir; Mikheev, Maxim; Shchelkunov, Sergei; Chumakov, Konstantin

2003-09-01

Variola virus (VARV), causing smallpox, is a potential biological weapon. Methods to detect VARV rapidly and to differentiate it from other viruses causing similar clinical syndromes are needed urgently. We have developed a new microarray-based method that detects simultaneously and discriminates four orthopoxvirus (OPV) species pathogenic for humans (variola, monkeypox, cowpox, and vaccinia viruses) and distinguishes them from chickenpox virus (varicella-zoster virus or VZV). The OPV gene C23L/B29R, encoding the CC-chemokine binding protein, was sequenced for 41 strains of seven species of orthopox viruses obtained from different geographical regions. Those C23L/B29R sequences and the ORF 62 sequences from 13 strains of VZV (selected from GenBank) were used to design oligonucleotide probes that were immobilized on an aldehyde-coated glass surface (a total of 57 probes). The microchip contained several unique 13-21 bases long oligonucleotide probes specific to each virus species to ensure redundancy and robustness of the assay. A region approximately 1100 bases long was amplified from samples of viral DNA and fluorescently labeled with Cy5-modified dNTPs, and single-stranded DNA was prepared by strand separation. Hybridization was carried out under plastic coverslips, resulting in a fluorescent pattern that was quantified using a confocal laser scanner. 49 known and blinded samples of OPV DNA, representing different OPV species, and two VZV strains were tested. The oligonucleotide microarray hybridization technique identified reliably and correctly all samples. This new procedure takes only 3 h, and it can be used for parallel testing of multiple samples.

Development and assessment of whole-genome oligonucleotide microarrays to analyze an anaerobic microbial community and its responses to oxidative stress.

PubMed

Scholten, Johannes C M; Culley, David E; Nie, Lei; Munn, Kyle J; Chow, Lely; Brockman, Fred J; Zhang, Weiwen

2007-06-29

The application of DNA microarray technology to investigate multiple-species microbial communities presents great challenges. In this study, we reported the design and quality assessment of four whole genome oligonucleotide microarrays for two syntroph bacteria, Desulfovibrio vulgaris and Syntrophobacter fumaroxidans, and two archaeal methanogens, Methanosarcina barkeri, and Methanospirillum hungatei, and their application to analyze global gene expression in a four-species microbial community in response to oxidative stress. In order to minimize the possibility of cross-hybridization, cross-genome comparison was performed to assure all probes unique to each genome so that the microarrays could provide species-level resolution. Microarray quality was validated by the good reproducibility of experimental measurements of multiple biological and analytical replicates. This study showed that S. fumaroxidans and M. hungatei responded to the oxidative stress with up-regulation of several genes known to be involved in reactive oxygen species (ROS) detoxification, such as catalase and rubrerythrin in S. fumaroxidans and thioredoxin and heat shock protein Hsp20 in M. hungatei. However, D. vulgaris seemed to be less sensitive to the oxidative stress as a member of a four-species community, since no gene involved in ROS detoxification was up-regulated. Our work demonstrated the successful application of microarrays to a multiple-species microbial community, and our preliminary results indicated that this approach could provide novel insights on the metabolism within microbial communities.

Single molecule fluorescence microscopy for ultra-sensitive RNA expression profiling

NASA Astrophysics Data System (ADS)

Hesse, Jan; Jacak, Jaroslaw; Regl, Gerhard; Eichberger, Thomas; Aberger, Fritz; Schlapak, Robert; Howorka, Stefan; Muresan, Leila; Frischauf, Anna-Maria; Schütz, Gerhard J.

2007-02-01

We developed a microarray analysis platform for ultra-sensitive RNA expression profiling of minute samples. It utilizes a novel scanning system for single molecule fluorescence detection on cm2 size samples in combination with specialized biochips, optimized for low autofluorescence and weak unspecific adsorption. 20 μg total RNA was extracted from 10 6 cells of a human keratinocyte cell line (HaCaT) and reversely transcribed in the presence of Alexa647-aha-dUTP. 1% of the resulting labeled cDNA was used for complex hybridization to a custom-made oligonucleotide microarray representing a set of 125 different genes. For low abundant genes, individual cDNA molecules hybridized to the microarray spots could be resolved. Single cDNA molecules hybridized to the chip surface appeared as diffraction limited features in the fluorescence images. The à trous wavelet method was utilized for localization and counting of the separated cDNA signals. Subsequently, the degree of labeling of the localized cDNA molecules was determined by brightness analysis for the different genes. Variations by factors up to 6 were found, which in conventional microarray analysis would result in a misrepresentation of the relative abundance of mRNAs.

Genome-wide profiling of gene expression in the epididymis of alpha-chlorohydrin-induced infertile rats using an oligonucleotide microarray

PubMed Central

2010-01-01

Background As one of the chlorinated antifertility compounds, alpha-chlorohydrin (ACH) can inhibit glyceraldehyde-3-phosphate dehydrogenase (G3PDH) activity in epididymal sperm and affect sperm energy metabolism, maturation and fertilization, eventually leading to male infertility. Further studies demonstrated that the inhibitory effect of ACH on G3PDH is not only confined to epididymal sperm but also to the epididymis. Moreover, little investigation on gene expression changes in the epididymis after ACH treatment has been conducted. Therefore, gene expression studies may indicate new epididymal targets related to sperm maturation and fertility through the analysis of ACH-treated infertile animals. Methods Rats were treated with ACH for ten consecutive days, and then each male rat copulated with two female rats in proestrus. Then sperm maturation and other fertility parameters were analyzed. Furthermore, we identified epididymal-specific genes that are associated with fertility between control and ACH groups using an Affymetrix Rat 230 2.0 oligo-microarray. Finally, we performed RT-PCR analysis for several differentially expressed genes to validate the alteration in gene expression observed by oligonucleotide microarray. Results Among all the differentially expressed genes, we analyzed and screened the down-regulated genes associated with metabolism processes, which are considered the major targets of ACH action. Simultaneously, the genes that were up-regulated by chlorohydrin were detected. The genes that negatively regulate sperm maturation and fertility include apoptosis and immune-related genes and have not been reported previously. The overall results of PCR analysis for selected genes were consistent with the array data. Conclusions In this study, we have described the genome-wide profiles of gene expression in the epididymides of infertile rats induced by ACH, which could become potential epididymal specific targets for male contraception and infertility treatment. PMID:20409345

Genome-wide profiling of gene expression in the epididymis of alpha-chlorohydrin-induced infertile rats using an oligonucleotide microarray.

PubMed

Xie, Shuwu; Zhu, Yan; Ma, Li; Lu, Yingying; Zhou, Jieyun; Gui, Youlun; Cao, Lin

2010-04-22

As one of the chlorinated antifertility compounds, alpha-chlorohydrin (ACH) can inhibit glyceraldehyde-3-phosphate dehydrogenase (G3PDH) activity in epididymal sperm and affect sperm energy metabolism, maturation and fertilization, eventually leading to male infertility. Further studies demonstrated that the inhibitory effect of ACH on G3PDH is not only confined to epididymal sperm but also to the epididymis. Moreover, little investigation on gene expression changes in the epididymis after ACH treatment has been conducted. Therefore, gene expression studies may indicate new epididymal targets related to sperm maturation and fertility through the analysis of ACH-treated infertile animals. Rats were treated with ACH for ten consecutive days, and then each male rat copulated with two female rats in proestrus. Then sperm maturation and other fertility parameters were analyzed. Furthermore, we identified epididymal-specific genes that are associated with fertility between control and ACH groups using an Affymetrix Rat 230 2.0 oligo-microarray. Finally, we performed RT-PCR analysis for several differentially expressed genes to validate the alteration in gene expression observed by oligonucleotide microarray. Among all the differentially expressed genes, we analyzed and screened the down-regulated genes associated with metabolism processes, which are considered the major targets of ACH action. Simultaneously, the genes that were up-regulated by chlorohydrin were detected. The genes that negatively regulate sperm maturation and fertility include apoptosis and immune-related genes and have not been reported previously. The overall results of PCR analysis for selected genes were consistent with the array data. In this study, we have described the genome-wide profiles of gene expression in the epididymides of infertile rats induced by ACH, which could become potential epididymal specific targets for male contraception and infertility treatment.

Data-adaptive test statistics for microarray data.

PubMed

Mukherjee, Sach; Roberts, Stephen J; van der Laan, Mark J

2005-09-01

An important task in microarray data analysis is the selection of genes that are differentially expressed between different tissue samples, such as healthy and diseased. However, microarray data contain an enormous number of dimensions (genes) and very few samples (arrays), a mismatch which poses fundamental statistical problems for the selection process that have defied easy resolution. In this paper, we present a novel approach to the selection of differentially expressed genes in which test statistics are learned from data using a simple notion of reproducibility in selection results as the learning criterion. Reproducibility, as we define it, can be computed without any knowledge of the 'ground-truth', but takes advantage of certain properties of microarray data to provide an asymptotically valid guide to expected loss under the true data-generating distribution. We are therefore able to indirectly minimize expected loss, and obtain results substantially more robust than conventional methods. We apply our method to simulated and oligonucleotide array data. By request to the corresponding author.

Double stranded nucleic acid biochips

DOEpatents

Chernov, Boris; Golova, Julia

2006-05-23

This invention describes a new method of constructing double-stranded DNA (dsDNA) microarrays based on the use of pre-synthesized or natural DNA duplexes without a stem-loop structure. The complementary oligonucleotide chains are bonded together by a novel connector that includes a linker for immobilization on a matrix. A non-enzymatic method for synthesizing double-stranded nucleic acids with this novel connector enables the construction of inexpensive and robust dsDNA/dsRNA microarrays. DNA-DNA and DNA-protein interactions are investigated using the microarrays.

Molecular Biology and Prevention of Endometrial Cancer

DTIC Science & Technology

2009-07-01

us time to complete the study. Aim 2: To analyze vaginal and cervical adenocarcinomas , that have arisen in women exposed to DES in- utero , for...therapy. Methods: 1) Oligonucleotide microarray analysis was performed on a panel of endometrial cancers. 2) A subset of adenocarcinoma cases...from the International DES Registry (IDESR) was analyzed for MSI 3) A case-control study of the CASH database was performed to evaluate the

Optimised laser microdissection of the human ocular surface epithelial regions for microarray studies

PubMed Central

2013-01-01

Background The most important challenge of performing insitu transcriptional profiling of the human ocular surface epithelial regions is obtaining samples in sufficient amounts, without contamination from adjacent tissue, as the region of interest is microscopic and closely apposed to other tissues regions. We have effectively collected ocular surface (OS) epithelial tissue samples from the Limbal Epithelial Crypt (LEC), limbus, cornea and conjunctiva of post-mortem cadaver eyes with laser microdissection (LMD) technique for gene expression studies with spotted oligonucleotide microarrays and Gene 1.0 ST arrays. Methods Human donor eyes (4 pairs for spotted oligonucleotide microarrays, 3 pairs for Gene 1.0 ST arrays) consented for research were included in this study with due ethical approval of the Nottingham Research Ethics Committee. Eye retrieval was performed within 36 hours of post-mortem period. The dissected corneoscleral buttons were immersed in OCT media and frozen in liquid nitrogen and stored at −80°C till further use. Microscopic tissue sections of interest were taken on PALM slides and stained with Toluidine Blue for laser microdissection with PALM microbeam systems. Optimisation of the laser microdissection technique was crucial for efficient and cost effective sample collection. Results The starting concentration of RNA as stipulated by the protocol of microarray platforms was taken as the cut-off concentration of RNA samples in our studies. The area of LMD tissue processed for spotted oligonucleotide microarray study ranged from 86,253 μm2 in LEC to 392,887 μm2 in LEC stroma. The RNA concentration of the LMD samples ranged from 22 to 92 pg/μl. The recommended starting concentration of the RNA samples used for Gene 1.0 ST arrays was 6 ng/5 μl. To achieve the desired RNA concentration the area of ocular surface epithelial tissue sample processed for the Gene 1.0 ST array experiments was approximately 100,0000 μm2 to 130,0000 μm2. RNA concentration of these samples ranged from 10.88 ng/12 μl to 25.8 ng/12 μl, with the RNA integrity numbers (RIN) for these samples from 3.3 to 7.9. RNA samples with RIN values below 2, that had failed to amplify satisfactorily were discarded. Conclusions The optimised protocol for sample collection and laser microdissection improved the RNA yield of the insitu ocular surface epithelial regions for effective microarray studies on spotted oligonucleotide and affymetrix platforms. PMID:24160452

Soft Lithography for Oligonucleotide Arrays Fabrication

DTIC Science & Technology

2001-10-25

adenosine; Abbreviated T, C, G, A respectively), the other synthesis reagents and solvents except oxidation agent (seen in Table 1) were purchased...dried by cold blowing before hybridization. Oligonucleotide arrays were hybridized in 200 nM 3’-TCC TCC GAT TCA GAG AGT CC- HEX (PE Biosystems... citrate buffer), 0.1% SDS in 0.1xSSC respectively. The probe array was scanned on the Scanarray Microarray Systems (Packard Biochip Technologies, USA

Selection of optimal oligonucleotide probes for microarrays usingmultiple criteria, global alignment and parameter estimation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Xingyuan; He, Zhili; Zhou, Jizhong

2005-10-30

The oligonucleotide specificity for microarray hybridizationcan be predicted by its sequence identity to non-targets, continuousstretch to non-targets, and/or binding free energy to non-targets. Mostcurrently available programs only use one or two of these criteria, whichmay choose 'false' specific oligonucleotides or miss 'true' optimalprobes in a considerable proportion. We have developed a software tool,called CommOligo using new algorithms and all three criteria forselection of optimal oligonucleotide probes. A series of filters,including sequence identity, free energy, continuous stretch, GC content,self-annealing, distance to the 3'-untranslated region (3'-UTR) andmelting temperature (Tm), are used to check each possibleoligonucleotide. A sequence identity is calculated based onmore » gapped globalalignments. A traversal algorithm is used to generate alignments for freeenergy calculation. The optimal Tm interval is determined based on probecandidates that have passed all other filters. Final probes are pickedusing a combination of user-configurable piece-wise linear functions andan iterative process. The thresholds for identity, stretch and freeenergy filters are automatically determined from experimental data by anaccessory software tool, CommOligo_PE (CommOligo Parameter Estimator).The program was used to design probes for both whole-genome and highlyhomologous sequence data. CommOligo and CommOligo_PE are freely availableto academic users upon request.« less

Development of a high-throughput microfluidic integrated microarray for the detection of chimeric bioweapons.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheppod, Timothy; Satterfield, Brent; Hukari, Kyle W.

2006-10-01

The advancement of DNA cloning has significantly augmented the potential threat of a focused bioweapon assault, such as a terrorist attack. With current DNA cloning techniques, toxin genes from the most dangerous (but environmentally labile) bacterial or viral organism can now be selected and inserted into robust organism to produce an infinite number of deadly chimeric bioweapons. In order to neutralize such a threat, accurate detection of the expressed toxin genes, rather than classification on strain or genealogical decent of these organisms, is critical. The development of a high-throughput microarray approach will enable the detection of unknowns chimeric bioweapons. Themore » development of a high-throughput microarray approach will enable the detection of unknown bioweapons. We have developed a unique microfluidic approach to capture and concentrate these threat genes (mRNA's) upto a 30 fold concentration. These captured oligonucleotides can then be used to synthesize in situ oligonucleotide copies (cDNA probes) of the captured genes. An integrated microfluidic architecture will enable us to control flows of reagents, perform clean-up steps and finally elute nanoliter volumes of synthesized oligonucleotides probes. The integrated approach has enabled a process where chimeric or conventional bioweapons can rapidly be identified based on their toxic function, rather than being restricted to information that may not identify the critical nature of the threat.« less

Transcriptome analysis of salinity stress responses in common wheat using a 22k oligo-DNA microarray.

PubMed

Kawaura, Kanako; Mochida, Keiichi; Yamazaki, Yukiko; Ogihara, Yasunari

2006-04-01

In this study, we constructed a 22k wheat oligo-DNA microarray. A total of 148,676 expressed sequence tags of common wheat were collected from the database of the Wheat Genomics Consortium of Japan. These were grouped into 34,064 contigs, which were then used to design an oligonucleotide DNA microarray. Following a multistep selection of the sense strand, 21,939 60-mer oligo-DNA probes were selected for attachment on the microarray slide. This 22k oligo-DNA microarray was used to examine the transcriptional response of wheat to salt stress. More than 95% of the probes gave reproducible hybridization signals when targeted with RNAs extracted from salt-treated wheat shoots and roots. With the microarray, we identified 1,811 genes whose expressions changed more than 2-fold in response to salt. These included genes known to mediate response to salt, as well as unknown genes, and they were classified into 12 major groups by hierarchical clustering. These gene expression patterns were also confirmed by real-time reverse transcription-PCR. Many of the genes with unknown function were clustered together with genes known to be involved in response to salt stress. Thus, analysis of gene expression patterns combined with gene ontology should help identify the function of the unknown genes. Also, functional analysis of these wheat genes should provide new insight into the response to salt stress. Finally, these results indicate that the 22k oligo-DNA microarray is a reliable method for monitoring global gene expression patterns in wheat.

Parallel characterization of anaerobic toluene- and ethylbenzene-degrading microbial consortia by PCR-denaturing gradient gel electrophoresis, RNA-DNA membrane hybridization, and DNA microarray technology

NASA Technical Reports Server (NTRS)

Koizumi, Yoshikazu; Kelly, John J.; Nakagawa, Tatsunori; Urakawa, Hidetoshi; El-Fantroussi, Said; Al-Muzaini, Saleh; Fukui, Manabu; Urushigawa, Yoshikuni; Stahl, David A.

2002-01-01

A mesophilic toluene-degrading consortium (TDC) and an ethylbenzene-degrading consortium (EDC) were established under sulfate-reducing conditions. These consortia were first characterized by denaturing gradient gel electrophoresis (DGGE) fingerprinting of PCR-amplified 16S rRNA gene fragments, followed by sequencing. The sequences of the major bands (T-1 and E-2) belonging to TDC and EDC, respectively, were affiliated with the family Desulfobacteriaceae. Another major band from EDC (E-1) was related to an uncultured non-sulfate-reducing soil bacterium. Oligonucleotide probes specific for the 16S rRNAs of target organisms corresponding to T-1, E-1, and E-2 were designed, and hybridization conditions were optimized for two analytical formats, membrane and DNA microarray hybridization. Both formats were used to characterize the TDC and EDC, and the results of both were consistent with DGGE analysis. In order to assess the utility of the microarray format for analysis of environmental samples, oil-contaminated sediments from the coast of Kuwait were analyzed. The DNA microarray successfully detected bacterial nucleic acids from these samples, but probes targeting specific groups of sulfate-reducing bacteria did not give positive signals. The results of this study demonstrate the limitations and the potential utility of DNA microarrays for microbial community analysis.

Parallel Characterization of Anaerobic Toluene- and Ethylbenzene-Degrading Microbial Consortia by PCR-Denaturing Gradient Gel Electrophoresis, RNA-DNA Membrane Hybridization, and DNA Microarray Technology

PubMed Central

Koizumi, Yoshikazu; Kelly, John J.; Nakagawa, Tatsunori; Urakawa, Hidetoshi; El-Fantroussi, Saïd; Al-Muzaini, Saleh; Fukui, Manabu; Urushigawa, Yoshikuni; Stahl, David A.

2002-01-01

A mesophilic toluene-degrading consortium (TDC) and an ethylbenzene-degrading consortium (EDC) were established under sulfate-reducing conditions. These consortia were first characterized by denaturing gradient gel electrophoresis (DGGE) fingerprinting of PCR-amplified 16S rRNA gene fragments, followed by sequencing. The sequences of the major bands (T-1 and E-2) belonging to TDC and EDC, respectively, were affiliated with the family Desulfobacteriaceae. Another major band from EDC (E-1) was related to an uncultured non-sulfate-reducing soil bacterium. Oligonucleotide probes specific for the 16S rRNAs of target organisms corresponding to T-1, E-1, and E-2 were designed, and hybridization conditions were optimized for two analytical formats, membrane and DNA microarray hybridization. Both formats were used to characterize the TDC and EDC, and the results of both were consistent with DGGE analysis. In order to assess the utility of the microarray format for analysis of environmental samples, oil-contaminated sediments from the coast of Kuwait were analyzed. The DNA microarray successfully detected bacterial nucleic acids from these samples, but probes targeting specific groups of sulfate-reducing bacteria did not give positive signals. The results of this study demonstrate the limitations and the potential utility of DNA microarrays for microbial community analysis. PMID:12088997

Gene Expression Profiling of Gastric Cancer

PubMed Central

Marimuthu, Arivusudar; Jacob, Harrys K.C.; Jakharia, Aniruddha; Subbannayya, Yashwanth; Keerthikumar, Shivakumar; Kashyap, Manoj Kumar; Goel, Renu; Balakrishnan, Lavanya; Dwivedi, Sutopa; Pathare, Swapnali; Dikshit, Jyoti Bajpai; Maharudraiah, Jagadeesha; Singh, Sujay; Sameer Kumar, Ghantasala S; Vijayakumar, M.; Veerendra Kumar, Kariyanakatte Veeraiah; Premalatha, Chennagiri Shrinivasamurthy; Tata, Pramila; Hariharan, Ramesh; Roa, Juan Carlos; Prasad, T.S.K; Chaerkady, Raghothama; Kumar, Rekha Vijay; Pandey, Akhilesh

2015-01-01

Gastric cancer is the second leading cause of cancer death worldwide, both in men and women. A genomewide gene expression analysis was carried out to identify differentially expressed genes in gastric adenocarcinoma tissues as compared to adjacent normal tissues. We used Agilent’s whole human genome oligonucleotide microarray platform representing ~41,000 genes to carry out gene expression analysis. Two-color microarray analysis was employed to directly compare the expression of genes between tumor and normal tissues. Through this approach, we identified several previously known candidate genes along with a number of novel candidate genes in gastric cancer. Testican-1 (SPOCK1) was one of the novel molecules that was 10-fold upregulated in tumors. Using tissue microarrays, we validated the expression of testican-1 by immunohistochemical staining. It was overexpressed in 56% (160/282) of the cases tested. Pathway analysis led to the identification of several networks in which SPOCK1 was among the topmost networks of interacting genes. By gene enrichment analysis, we identified several genes involved in cell adhesion and cell proliferation to be significantly upregulated while those corresponding to metabolic pathways were significantly downregulated. The differentially expressed genes identified in this study are candidate biomarkers for gastric adenoacarcinoma. PMID:27030788

A New Oligonucleotide Microarray for Detection of Pathogenic and Non-Pathogenic Legionella spp.

PubMed Central

Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

2014-01-01

Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp. PMID:25469776

A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.

PubMed

Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

2014-01-01

Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.

Gene expression analysis of the biocontrol fungus Trichoderma harzianum in the presence of tomato plants, chitin, or glucose using a high-density oligonucleotide microarray.

PubMed

Samolski, Ilanit; de Luis, Alberto; Vizcaíno, Juan Antonio; Monte, Enrique; Suárez, M Belén

2009-10-13

It has recently been shown that the Trichoderma fungal species used for biocontrol of plant diseases are capable of interacting with plant roots directly, behaving as symbiotic microorganisms. With a view to providing further information at transcriptomic level about the early response of Trichoderma to a host plant, we developed a high-density oligonucleotide (HDO) microarray encompassing 14,081 Expressed Sequence Tag (EST)-based transcripts from eight Trichoderma spp. and 9,121 genome-derived transcripts of T. reesei, and we have used this microarray to examine the gene expression of T. harzianum either alone or in the presence of tomato plants, chitin, or glucose. Global microarray analysis revealed 1,617 probe sets showing differential expression in T. harzianum mycelia under at least one of the culture conditions tested as compared with one another. Hierarchical clustering and heat map representation showed that the expression patterns obtained in glucose medium clustered separately from the expression patterns observed in the presence of tomato plants and chitin. Annotations using the Blast2GO suite identified 85 of the 257 transcripts whose probe sets afforded up-regulated expression in response to tomato plants. Some of these transcripts were predicted to encode proteins related to Trichoderma-host (fungus or plant) associations, such as Sm1/Elp1 protein, proteases P6281 and PRA1, enchochitinase CHIT42, or QID74 protein, although previously uncharacterized genes were also identified, including those responsible for the possible biosynthesis of nitric oxide, xenobiotic detoxification, mycelium development, or those related to the formation of infection structures in plant tissues. The effectiveness of the Trichoderma HDO microarray to detect different gene responses under different growth conditions in the fungus T. harzianum strongly indicates that this tool should be useful for further assays that include different stages of plant colonization, as well as for expression studies in other Trichoderma spp. represented on it. Using this microarray, we have been able to define a number of genes probably involved in the transcriptional response of T. harzianum within the first hours of contact with tomato plant roots, which may provide new insights into the mechanisms and roles of this fungus in the Trichoderma-plant interaction.

Gene expression analysis of the biocontrol fungus Trichoderma harzianum in the presence of tomato plants, chitin, or glucose using a high-density oligonucleotide microarray

PubMed Central

2009-01-01

Background It has recently been shown that the Trichoderma fungal species used for biocontrol of plant diseases are capable of interacting with plant roots directly, behaving as symbiotic microorganisms. With a view to providing further information at transcriptomic level about the early response of Trichoderma to a host plant, we developed a high-density oligonucleotide (HDO) microarray encompassing 14,081 Expressed Sequence Tag (EST)-based transcripts from eight Trichoderma spp. and 9,121 genome-derived transcripts of T. reesei, and we have used this microarray to examine the gene expression of T. harzianum either alone or in the presence of tomato plants, chitin, or glucose. Results Global microarray analysis revealed 1,617 probe sets showing differential expression in T. harzianum mycelia under at least one of the culture conditions tested as compared with one another. Hierarchical clustering and heat map representation showed that the expression patterns obtained in glucose medium clustered separately from the expression patterns observed in the presence of tomato plants and chitin. Annotations using the Blast2GO suite identified 85 of the 257 transcripts whose probe sets afforded up-regulated expression in response to tomato plants. Some of these transcripts were predicted to encode proteins related to Trichoderma-host (fungus or plant) associations, such as Sm1/Elp1 protein, proteases P6281 and PRA1, enchochitinase CHIT42, or QID74 protein, although previously uncharacterized genes were also identified, including those responsible for the possible biosynthesis of nitric oxide, xenobiotic detoxification, mycelium development, or those related to the formation of infection structures in plant tissues. Conclusion The effectiveness of the Trichoderma HDO microarray to detect different gene responses under different growth conditions in the fungus T. harzianum strongly indicates that this tool should be useful for further assays that include different stages of plant colonization, as well as for expression studies in other Trichoderma spp. represented on it. Using this microarray, we have been able to define a number of genes probably involved in the transcriptional response of T. harzianum within the first hours of contact with tomato plant roots, which may provide new insights into the mechanisms and roles of this fungus in the Trichoderma-plant interaction. PMID:19825185

Towards MRI microarrays.

PubMed

Hall, Andrew; Mundell, Victoria J; Blanco-Andujar, Cristina; Bencsik, Martin; McHale, Glen; Newton, Michael I; Cave, Gareth W V

2010-04-14

Superparamagnetic iron oxide nanometre scale particles have been utilised as contrast agents to image staked target binding oligonucleotide arrays using MRI to correlate the signal intensity and T(2)* relaxation times in different NMR fluids.

Molecular classification of benign prostatic hyperplasia: A gene expression profiling study in a rat model.

PubMed

Hata, Junya; Satoh, Yuichi; Akaihata, Hidenori; Hiraki, Hiroyuki; Ogawa, Soichiro; Haga, Nobuhiro; Ishibashi, Kei; Aikawa, Ken; Kojima, Yoshiyuki

2016-07-01

To characterize the molecular features of benign prostatic hyperplasia by carrying out a gene expression profiling analysis in a rat model. Fetal urogenital sinus isolated from 20-day-old male rat embryo was implanted into a pubertal male rat ventral prostate. The implanted urogenital sinus grew time-dependently, and the pathological findings at 3 weeks after implantation showed epithelial hyperplasia as well as stromal hyperplasia. Whole-genome oligonucleotide microarray analysis utilizing approximately 30 000 oligonucleotide probes was carried out using prostate specimens during the prostate growth process (3 weeks after implantation). Microarray analyses showed 926 upregulated (>2-fold change, P < 0.01) and 3217 downregulated genes (<0.5-fold change, P < 0.01) in benign prostatic hyperplasia specimens compared with normal prostate. Gene ontology analyses of upregulated genes showed predominant genetic themes of involvement in development (162 genes, P = 2.01 × 10(-4) ), response to stimulus (163 genes, P = 7.37 × 10(-13) ) and growth (32 genes, P = 1.93 × 10(-5) ). When we used both normal prostate and non-transplanted urogenital sinuses as controls to identify benign prostatic hyperplasia-specific genes, 507 and 406 genes were upregulated and downregulated, respectively. Functional network and pathway analyses showed that genes associated with apoptosis modulation by heat shock protein 70, interleukin-1, interleukin-2 and interleukin-5 signaling pathways, KIT signaling pathway, and secretin-like G-protein-coupled receptors, class B, were relatively activated during the growth process in the benign prostatic hyperplasia specimens. In contrast, genes associated with cholesterol biosynthesis were relatively inactivated. Our microarray analyses of the benign prostatic hyperplasia model rat might aid in clarifying the molecular mechanism of benign prostatic hyperplasia progression, and identifying molecular targets for benign prostatic hyperplasia treatment. © 2016 The Japanese Urological Association.

Oligonucleotide microarray analysis of gene expression profiles followed by real-time reverse-transcriptase polymerase chain reaction assay in chronic active Epstein-Barr virus infection.

PubMed

Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi

2008-03-01

Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.

Development of oligonucleotide microarrays for simultaneous multi-species identification of Phellinus tree-pathogenic fungi.

PubMed

Tzean, Yuh; Shu, Po-Yao; Liou, Ruey-Fen; Tzean, Shean-Shong

2016-03-01

Polyporoid Phellinus fungi are ubiquitously present in the environment and play an important role in shaping forest ecology. Several species of Phellinus are notorious pathogens that can affect a broad variety of tree species in forest, plantation, orchard and urban habitats; however, current detection methods are overly complex and lack the sensitivity required to identify these pathogens at the species level in a timely fashion for effective infestation control. Here, we describe eight oligonucleotide microarray platforms for the simultaneous and specific detection of 17 important Phellinus species, using probes generated from the internal transcribed spacer regions unique to each species. The sensitivity, robustness and efficiency of this Phellinus microarray system was subsequently confirmed against template DNA from two key Phellinus species, as well as field samples collected from tree roots, trunks and surrounding soil. This system can provide early, specific and convenient detection of Phellinus species for forestry, arboriculture and quarantine inspection, and could potentially help to mitigate the environmental and economic impact of Phellinus-related diseases. © 2015 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Optimization of oligonucleotide arrays and RNA amplification protocols for analysis of transcript structure and alternative splicing.

PubMed

Castle, John; Garrett-Engele, Phil; Armour, Christopher D; Duenwald, Sven J; Loerch, Patrick M; Meyer, Michael R; Schadt, Eric E; Stoughton, Roland; Parrish, Mark L; Shoemaker, Daniel D; Johnson, Jason M

2003-01-01

Microarrays offer a high-resolution means for monitoring pre-mRNA splicing on a genomic scale. We have developed a novel, unbiased amplification protocol that permits labeling of entire transcripts. Also, hybridization conditions, probe characteristics, and analysis algorithms were optimized for detection of exons, exon-intron edges, and exon junctions. These optimized protocols can be used to detect small variations and isoform mixtures, map the tissue specificity of known human alternative isoforms, and provide a robust, scalable platform for high-throughput discovery of alternative splicing.

Optimization of oligonucleotide arrays and RNA amplification protocols for analysis of transcript structure and alternative splicing

PubMed Central

Castle, John; Garrett-Engele, Phil; Armour, Christopher D; Duenwald, Sven J; Loerch, Patrick M; Meyer, Michael R; Schadt, Eric E; Stoughton, Roland; Parrish, Mark L; Shoemaker, Daniel D; Johnson, Jason M

2003-01-01

Microarrays offer a high-resolution means for monitoring pre-mRNA splicing on a genomic scale. We have developed a novel, unbiased amplification protocol that permits labeling of entire transcripts. Also, hybridization conditions, probe characteristics, and analysis algorithms were optimized for detection of exons, exon-intron edges, and exon junctions. These optimized protocols can be used to detect small variations and isoform mixtures, map the tissue specificity of known human alternative isoforms, and provide a robust, scalable platform for high-throughput discovery of alternative splicing. PMID:14519201

Single-feature polymorphism discovery in the barley transcriptome

PubMed Central

Rostoks, Nils; Borevitz, Justin O; Hedley, Peter E; Russell, Joanne; Mudie, Sharon; Morris, Jenny; Cardle, Linda; Marshall, David F; Waugh, Robbie

2005-01-01

A probe-level model for analysis of GeneChip gene-expression data is presented which identified more than 10,000 single-feature polymorphisms (SFP) between two barley genotypes. The method has good sensitivity, as 67% of known single-nucleotide polymorphisms (SNP) were called as SFPs. This method is applicable to all oligonucleotide microarray data, accounts for SNP effects in gene-expression data and represents an efficient and versatile approach for highly parallel marker identification in large genomes. PMID:15960806

Strategies for comparing gene expression profiles from different microarray platforms: application to a case-control experiment.

PubMed

Severgnini, Marco; Bicciato, Silvio; Mangano, Eleonora; Scarlatti, Francesca; Mezzelani, Alessandra; Mattioli, Michela; Ghidoni, Riccardo; Peano, Clelia; Bonnal, Raoul; Viti, Federica; Milanesi, Luciano; De Bellis, Gianluca; Battaglia, Cristina

2006-06-01

Meta-analysis of microarray data is increasingly important, considering both the availability of multiple platforms using disparate technologies and the accumulation in public repositories of data sets from different laboratories. We addressed the issue of comparing gene expression profiles from two microarray platforms by devising a standardized investigative strategy. We tested this procedure by studying MDA-MB-231 cells, which undergo apoptosis on treatment with resveratrol. Gene expression profiles were obtained using high-density, short-oligonucleotide, single-color microarray platforms: GeneChip (Affymetrix) and CodeLink (Amersham). Interplatform analyses were carried out on 8414 common transcripts represented on both platforms, as identified by LocusLink ID, representing 70.8% and 88.6% of annotated GeneChip and CodeLink features, respectively. We identified 105 differentially expressed genes (DEGs) on CodeLink and 42 DEGs on GeneChip. Among them, only 9 DEGs were commonly identified by both platforms. Multiple analyses (BLAST alignment of probes with target sequences, gene ontology, literature mining, and quantitative real-time PCR) permitted us to investigate the factors contributing to the generation of platform-dependent results in single-color microarray experiments. An effective approach to cross-platform comparison involves microarrays of similar technologies, samples prepared by identical methods, and a standardized battery of bioinformatic and statistical analyses.

A dynamic bead-based microarray for parallel DNA detection

NASA Astrophysics Data System (ADS)

Sochol, R. D.; Casavant, B. P.; Dueck, M. E.; Lee, L. P.; Lin, L.

2011-05-01

A microfluidic system has been designed and constructed by means of micromachining processes to integrate both microfluidic mixing of mobile microbeads and hydrodynamic microbead arraying capabilities on a single chip to simultaneously detect multiple bio-molecules. The prototype system has four parallel reaction chambers, which include microchannels of 18 × 50 µm2 cross-sectional area and a microfluidic mixing section of 22 cm length. Parallel detection of multiple DNA oligonucleotide sequences was achieved via molecular beacon probes immobilized on polystyrene microbeads of 16 µm diameter. Experimental results show quantitative detection of three distinct DNA oligonucleotide sequences from the Hepatitis C viral (HCV) genome with single base-pair mismatch specificity. Our dynamic bead-based microarray offers an effective microfluidic platform to increase parallelization of reactions and improve microbead handling for various biological applications, including bio-molecule detection, medical diagnostics and drug screening.

Gene ARMADA: an integrated multi-analysis platform for microarray data implemented in MATLAB.

PubMed

Chatziioannou, Aristotelis; Moulos, Panagiotis; Kolisis, Fragiskos N

2009-10-27

The microarray data analysis realm is ever growing through the development of various tools, open source and commercial. However there is absence of predefined rational algorithmic analysis workflows or batch standardized processing to incorporate all steps, from raw data import up to the derivation of significantly differentially expressed gene lists. This absence obfuscates the analytical procedure and obstructs the massive comparative processing of genomic microarray datasets. Moreover, the solutions provided, heavily depend on the programming skills of the user, whereas in the case of GUI embedded solutions, they do not provide direct support of various raw image analysis formats or a versatile and simultaneously flexible combination of signal processing methods. We describe here Gene ARMADA (Automated Robust MicroArray Data Analysis), a MATLAB implemented platform with a Graphical User Interface. This suite integrates all steps of microarray data analysis including automated data import, noise correction and filtering, normalization, statistical selection of differentially expressed genes, clustering, classification and annotation. In its current version, Gene ARMADA fully supports 2 coloured cDNA and Affymetrix oligonucleotide arrays, plus custom arrays for which experimental details are given in tabular form (Excel spreadsheet, comma separated values, tab-delimited text formats). It also supports the analysis of already processed results through its versatile import editor. Besides being fully automated, Gene ARMADA incorporates numerous functionalities of the Statistics and Bioinformatics Toolboxes of MATLAB. In addition, it provides numerous visualization and exploration tools plus customizable export data formats for seamless integration by other analysis tools or MATLAB, for further processing. Gene ARMADA requires MATLAB 7.4 (R2007a) or higher and is also distributed as a stand-alone application with MATLAB Component Runtime. Gene ARMADA provides a highly adaptable, integrative, yet flexible tool which can be used for automated quality control, analysis, annotation and visualization of microarray data, constituting a starting point for further data interpretation and integration with numerous other tools.

arrayCGHbase: an analysis platform for comparative genomic hybridization microarrays

PubMed Central

Menten, Björn; Pattyn, Filip; De Preter, Katleen; Robbrecht, Piet; Michels, Evi; Buysse, Karen; Mortier, Geert; De Paepe, Anne; van Vooren, Steven; Vermeesch, Joris; Moreau, Yves; De Moor, Bart; Vermeulen, Stefan; Speleman, Frank; Vandesompele, Jo

2005-01-01

Background The availability of the human genome sequence as well as the large number of physically accessible oligonucleotides, cDNA, and BAC clones across the entire genome has triggered and accelerated the use of several platforms for analysis of DNA copy number changes, amongst others microarray comparative genomic hybridization (arrayCGH). One of the challenges inherent to this new technology is the management and analysis of large numbers of data points generated in each individual experiment. Results We have developed arrayCGHbase, a comprehensive analysis platform for arrayCGH experiments consisting of a MIAME (Minimal Information About a Microarray Experiment) supportive database using MySQL underlying a data mining web tool, to store, analyze, interpret, compare, and visualize arrayCGH results in a uniform and user-friendly format. Following its flexible design, arrayCGHbase is compatible with all existing and forthcoming arrayCGH platforms. Data can be exported in a multitude of formats, including BED files to map copy number information on the genome using the Ensembl or UCSC genome browser. Conclusion ArrayCGHbase is a web based and platform independent arrayCGH data analysis tool, that allows users to access the analysis suite through the internet or a local intranet after installation on a private server. ArrayCGHbase is available at . PMID:15910681

Replication dynamics of the yeast genome.

PubMed

Raghuraman, M K; Winzeler, E A; Collingwood, D; Hunt, S; Wodicka, L; Conway, A; Lockhart, D J; Davis, R W; Brewer, B J; Fangman, W L

2001-10-05

Oligonucleotide microarrays were used to map the detailed topography of chromosome replication in the budding yeast Saccharomyces cerevisiae. The times of replication of thousands of sites across the genome were determined by hybridizing replicated and unreplicated DNAs, isolated at different times in S phase, to the microarrays. Origin activations take place continuously throughout S phase but with most firings near mid-S phase. Rates of replication fork movement vary greatly from region to region in the genome. The two ends of each of the 16 chromosomes are highly correlated in their times of replication. This microarray approach is readily applicable to other organisms, including humans.

Design and verification of a pangenome microarray oligonucleotide probe set for Dehalococcoides spp.

PubMed

Hug, Laura A; Salehi, Maryam; Nuin, Paulo; Tillier, Elisabeth R; Edwards, Elizabeth A

2011-08-01

Dehalococcoides spp. are an industrially relevant group of Chloroflexi bacteria capable of reductively dechlorinating contaminants in groundwater environments. Existing Dehalococcoides genomes revealed a high level of sequence identity within this group, including 98 to 100% 16S rRNA sequence identity between strains with diverse substrate specificities. Common molecular techniques for identification of microbial populations are often not applicable for distinguishing Dehalococcoides strains. Here we describe an oligonucleotide microarray probe set designed based on clustered Dehalococcoides genes from five different sources (strain DET195, CBDB1, BAV1, and VS genomes and the KB-1 metagenome). This "pangenome" probe set provides coverage of core Dehalococcoides genes as well as strain-specific genes while optimizing the potential for hybridization to closely related, previously unknown Dehalococcoides strains. The pangenome probe set was compared to probe sets designed independently for each of the five Dehalococcoides strains. The pangenome probe set demonstrated better predictability and higher detection of Dehalococcoides genes than strain-specific probe sets on nontarget strains with <99% average nucleotide identity. An in silico analysis of the expected probe hybridization against the recently released Dehalococcoides strain GT genome and additional KB-1 metagenome sequence data indicated that the pangenome probe set performs more robustly than the combined strain-specific probe sets in the detection of genes not included in the original design. The pangenome probe set represents a highly specific, universal tool for the detection and characterization of Dehalococcoides from contaminated sites. It has the potential to become a common platform for Dehalococcoides-focused research, allowing meaningful comparisons between microarray experiments regardless of the strain examined.

Assessment of a direct hybridization microarray strategy for comprehensive monitoring of genetically modified organisms (GMOs).

PubMed

Turkec, Aydin; Lucas, Stuart J; Karacanli, Burçin; Baykut, Aykut; Yuksel, Hakki

2016-03-01

Detection of GMO material in crop and food samples is the primary step in GMO monitoring and regulation, with the increasing number of GM events in the world market requiring detection solutions with high multiplexing capacity. In this study, we test the suitability of a high-density oligonucleotide microarray platform for direct, quantitative detection of GMOs found in the Turkish feed market. We tested 1830 different 60nt probes designed to cover the GM cassettes from 12 different GM cultivars (3 soya, 9 maize), as well as plant species-specific and contamination controls, and developed a data analysis method aiming to provide maximum throughput and sensitivity. The system was able specifically to identify each cultivar, and in 10/12 cases was sensitive enough to detect GMO DNA at concentrations of ⩽1%. These GMOs could also be quantified using the microarray, as their fluorescence signals increased linearly with GMO concentration. Copyright © 2015 Elsevier Ltd. All rights reserved.

Oligonucleotide microarray analysis of apoptosis induced by 15-methoxypinusolidic acid in microglial BV2 cells

PubMed Central

Choi, Y; Lim, SY; Jeong, HS; Koo, KA; Sung, SH; Kim, YC

2009-01-01

Background and purpose: We conducted a genome wide gene expression analysis to explore the biological aspects of 15-methoxypinusolidic acid (15-MPA) isolated from Biota orientalis and tried to confirm the suitability of 15-MPA as a therapeutic candidate for CNS injuries focusing on microglia. Experimental approach: Murine microglial BV2 cells were treated with 15-MPA, and their transcriptome was analysed by using oligonucleotide microarrays. Genes differentially expressed upon 15-MPA treatment were selected for RT-PCR (reverse transcription-polymerase chain reaction) analysis to confirm the gene expression. Inhibition of cell proliferation and induction of apoptosis by 15-MPA were examined by bromodeoxyuridine assay, Western blot analysis of poly-ADP-ribose polymerase and flow cytometry. Key results: A total of 514 genes were differentially expressed by 15-MPA treatment. Biological pathway analysis revealed that 15-MPA induced significant changes in expression of genes in the cell cycle pathway. Genes involved in growth arrest and DNA damage [gadd45α, gadd45γ and ddit3 (DNA damage-inducible transcript 3)] and cyclin-dependent kinase inhibitor (cdkn2b) were up-regulated, whereas genes involved in cell cycle progression (ccnd1, ccnd3 and ccne1), DNA replication (mcm4, orc1l and cdc6) and cell proliferation (fos and jun) were down-regulated. RT-PCR analysis for representative genes confirmed the expression levels. 15-MPA significantly reduced bromodeoxyuridine incorporation, increased poly-ADP-ribose polymerase cleavage and the number of apoptotic cells, indicating that 15-MPA induces apoptosis in BV2 cells. Conclusion and implications: 15-MPA induced apoptosis in murine microglial cells, presumably via inhibition of the cell cycle progression. As microglial activation is detrimental in CNS injuries, these data suggest a strong therapeutic potential of 15-MPA. PMID:19466985

Microarray labeling extension values: laboratory signatures for Affymetrix GeneChips

PubMed Central

Lee, Yun-Shien; Chen, Chun-Houh; Tsai, Chi-Neu; Tsai, Chia-Lung; Chao, Angel; Wang, Tzu-Hao

2009-01-01

Interlaboratory comparison of microarray data, even when using the same platform, imposes several challenges to scientists. RNA quality, RNA labeling efficiency, hybridization procedures and data-mining tools can all contribute variations in each laboratory. In Affymetrix GeneChips, about 11–20 different 25-mer oligonucleotides are used to measure the level of each transcript. Here, we report that ‘labeling extension values (LEVs)’, which are correlation coefficients between probe intensities and probe positions, are highly correlated with the gene expression levels (GEVs) on eukayotic Affymetrix microarray data. By analyzing LEVs and GEVs in the publicly available 2414 cel files of 20 Affymetrix microarray types covering 13 species, we found that correlations between LEVs and GEVs only exist in eukaryotic RNAs, but not in prokaryotic ones. Surprisingly, Affymetrix results of the same specimens that were analyzed in different laboratories could be clearly differentiated only by LEVs, leading to the identification of ‘laboratory signatures’. In the examined dataset, GSE10797, filtering out high-LEV genes did not compromise the discovery of biological processes that are constructed by differentially expressed genes. In conclusion, LEVs provide a new filtering parameter for microarray analysis of gene expression and it may improve the inter- and intralaboratory comparability of Affymetrix GeneChips data. PMID:19295132

Chromosome r(10)(p15.3q26.12) in a newborn child: case report.

PubMed

Gunnarsson, Cecilia; Graffmann, Barbara; Jonasson, Jon

2009-12-07

Ring chromosome 10 is a rare cytogenetic finding. Of the less than 10 reported cases we have found in the literature, none was characterized using high-resolution microarray analysis. Ring chromosomes are frequently unstable due to sister chromatid exchanges and mitotic failures. When mosaicism is present, the interpretation of genotype-phenotype correlations becomes extremely difficult. We report on a newborn girl with growth retardation, microcephaly, congenital heart defects, dysmorphic features and psychomotor retardation. Karyotyping revealed a non-mosaic apparently stable ring chromosome 10 replacing one of the normal homologues in all analyzed metaphases. High-resolution oligonucleotide microarray analysis showed a de novo approximately 12.5 Mb terminal deletion 10q26.12 -> qter and a corresponding 285 kb terminal deletion of 10pter -> p15.3. This case demonstrates that an increased nuchal translucency thickness detected by early ultrasonography should preferably lead to not only QF-PCR for the diagnosis of Down syndrome but also karyotyping. In the future, microarray analysis, which needs further evaluation, might become the method of choice. The clinical phenotype of our patient was in agreement with that of patients with a terminal 10q deletion. For the purpose of genotype-phenotype analysis, there seems to be no need for a "ring syndrome" concept.

Mapping of transcription factor binding regions in mammalian cells by ChIP: Comparison of array- and sequencing-based technologies

PubMed Central

Euskirchen, Ghia M.; Rozowsky, Joel S.; Wei, Chia-Lin; Lee, Wah Heng; Zhang, Zhengdong D.; Hartman, Stephen; Emanuelsson, Olof; Stolc, Viktor; Weissman, Sherman; Gerstein, Mark B.; Ruan, Yijun; Snyder, Michael

2007-01-01

Recent progress in mapping transcription factor (TF) binding regions can largely be credited to chromatin immunoprecipitation (ChIP) technologies. We compared strategies for mapping TF binding regions in mammalian cells using two different ChIP schemes: ChIP with DNA microarray analysis (ChIP-chip) and ChIP with DNA sequencing (ChIP-PET). We first investigated parameters central to obtaining robust ChIP-chip data sets by analyzing STAT1 targets in the ENCODE regions of the human genome, and then compared ChIP-chip to ChIP-PET. We devised methods for scoring and comparing results among various tiling arrays and examined parameters such as DNA microarray format, oligonucleotide length, hybridization conditions, and the use of competitor Cot-1 DNA. The best performance was achieved with high-density oligonucleotide arrays, oligonucleotides ≥50 bases (b), the presence of competitor Cot-1 DNA and hybridizations conducted in microfluidics stations. When target identification was evaluated as a function of array number, 80%–86% of targets were identified with three or more arrays. Comparison of ChIP-chip with ChIP-PET revealed strong agreement for the highest ranked targets with less overlap for the low ranked targets. With advantages and disadvantages unique to each approach, we found that ChIP-chip and ChIP-PET are frequently complementary in their relative abilities to detect STAT1 targets for the lower ranked targets; each method detected validated targets that were missed by the other method. The most comprehensive list of STAT1 binding regions is obtained by merging results from ChIP-chip and ChIP-sequencing. Overall, this study provides information for robust identification, scoring, and validation of TF targets using ChIP-based technologies. PMID:17568005

Genomic Analysis of Vaccine-Derived Poliovirus Strains in Stool Specimens by Combination of Full-Length PCR and Oligonucleotide Microarray Hybridization

PubMed Central

Laassri, Majid; Dragunsky, Eugenia; Enterline, Joan; Eremeeva, Tatiana; Ivanova, Olga; Lottenbach, Kathleen; Belshe, Robert; Chumakov, Konstantin

2005-01-01

Sabin strains of poliovirus used in the manufacture of oral poliovirus vaccine (OPV) are prone to genetic variations that occur during growth in cell cultures and the organisms of vaccine recipients. Such derivative viruses often have increased neurovirulence and transmissibility, and in some cases they can reestablish chains of transmission in human populations. Monitoring for vaccine-derived polioviruses is an important part of the worldwide campaign to eradicate poliomyelitis. Analysis of vaccine-derived polioviruses requires, as a first step, their isolation in cell cultures, which takes significant time and may yield viral stocks that are not fully representative of the strains present in the original sample. Here we demonstrate that full-length viral cDNA can be PCR amplified directly from stool samples and immediately subjected to genomic analysis by oligonucleotide microarray hybridization and nucleotide sequencing. Most fecal samples from healthy children who received OPV were found to contain variants of Sabin vaccine viruses. Sequence changes in the 5′ untranslated region were common, as were changes in the VP1-coding region, including changes in a major antigenic site. Analysis of stool samples taken from cases of acute flaccid paralysis revealed the presence of mixtures of recombinant polioviruses, in addition to the emergence of new sequence variants. Avoiding the need for cell culture isolation dramatically shortened the time needed for identification and analysis of vaccine-derived polioviruses and could be useful for preliminary screening of clinical samples. The amplified full-length viral cDNA can be archived and used to recover live virus for further virological studies. PMID:15956413

Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

PubMed Central

Narihiro, Takashi; Sekiguchi, Yuji

2011-01-01

Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

Toward a new paradigm of DNA writing using a massively parallel sequencing platform and degenerate oligonucleotide

PubMed Central

Hwang, Byungjin; Bang, Duhee

2016-01-01

All synthetic DNA materials require prior programming of the building blocks of the oligonucleotide sequences. The development of a programmable microarray platform provides cost-effective and time-efficient solutions in the field of data storage using DNA. However, the scalability of the synthesis is not on par with the accelerating sequencing capacity. Here, we report on a new paradigm of generating genetic material (writing) using a degenerate oligonucleotide and optomechanical retrieval method that leverages sequencing (reading) throughput to generate the desired number of oligonucleotides. As a proof of concept, we demonstrate the feasibility of our concept in digital information storage in DNA. In simulation, the ability to store data is expected to exponentially increase with increase in degenerate space. The present study highlights the major framework change in conventional DNA writing paradigm as a sequencer itself can become a potential source of making genetic materials. PMID:27876825

Toward a new paradigm of DNA writing using a massively parallel sequencing platform and degenerate oligonucleotide.

PubMed

Hwang, Byungjin; Bang, Duhee

2016-11-23

All synthetic DNA materials require prior programming of the building blocks of the oligonucleotide sequences. The development of a programmable microarray platform provides cost-effective and time-efficient solutions in the field of data storage using DNA. However, the scalability of the synthesis is not on par with the accelerating sequencing capacity. Here, we report on a new paradigm of generating genetic material (writing) using a degenerate oligonucleotide and optomechanical retrieval method that leverages sequencing (reading) throughput to generate the desired number of oligonucleotides. As a proof of concept, we demonstrate the feasibility of our concept in digital information storage in DNA. In simulation, the ability to store data is expected to exponentially increase with increase in degenerate space. The present study highlights the major framework change in conventional DNA writing paradigm as a sequencer itself can become a potential source of making genetic materials.

An oligonucleotide microarray to characterize multidrug resistant plasmids

USDA-ARS?s Scientific Manuscript database

Bacteria plasmids are fragments of extra-chromosomal double stranded deoxyribonucleic acid (DNA) that can contain a variety of genes beneficial to the host organism like antibiotic drug resistance. Many of the Enterobacteriaceae carry multiple drug resistance (MDR) genes on large plasmids of replic...

A microarray-based genotyping and genetic mapping approach for highly heterozygous outcrossing species enables localization of a large fraction of the unassembled Populus trichocarpa genome sequence.

PubMed

Drost, Derek R; Novaes, Evandro; Boaventura-Novaes, Carolina; Benedict, Catherine I; Brown, Ryan S; Yin, Tongming; Tuskan, Gerald A; Kirst, Matias

2009-06-01

Microarrays have demonstrated significant power for genome-wide analyses of gene expression, and recently have also revolutionized the genetic analysis of segregating populations by genotyping thousands of loci in a single assay. Although microarray-based genotyping approaches have been successfully applied in yeast and several inbred plant species, their power has not been proven in an outcrossing species with extensive genetic diversity. Here we have developed methods for high-throughput microarray-based genotyping in such species using a pseudo-backcross progeny of 154 individuals of Populus trichocarpa and P. deltoides analyzed with long-oligonucleotide in situ-synthesized microarray probes. Our analysis resulted in high-confidence genotypes for 719 single-feature polymorphism (SFP) and 1014 gene expression marker (GEM) candidates. Using these genotypes and an established microsatellite (SSR) framework map, we produced a high-density genetic map comprising over 600 SFPs, GEMs and SSRs. The abundance of gene-based markers allowed us to localize over 35 million base pairs of previously unplaced whole-genome shotgun (WGS) scaffold sequence to putative locations in the genome of P. trichocarpa. A high proportion of sampled scaffolds could be verified for their placement with independently mapped SSRs, demonstrating the previously un-utilized power that high-density genotyping can provide in the context of map-based WGS sequence reassembly. Our results provide a substantial contribution to the continued improvement of the Populus genome assembly, while demonstrating the feasibility of microarray-based genotyping in a highly heterozygous population. The strategies presented are applicable to genetic mapping efforts in all plant species with similarly high levels of genetic diversity.

Characterization of Antimicrobial Resistance Patterns and Detection of Virulence Genes in Campylobacter Isolates in Italy

PubMed Central

Di Giannatale, Elisabetta; Di Serafino, Gabriella; Zilli, Katiuscia; Alessiani, Alessandra; Sacchini, Lorena; Garofolo, Giuliano; Aprea, Giuseppe; Marotta, Francesca

2014-01-01

Campylobacter has developed resistance to several antimicrobial agents over the years, including macrolides, quinolones and fluoroquinolones, becoming a significant public health hazard. A total of 145 strains derived from raw milk, chicken faeces, chicken carcasses, cattle faeces and human faeces collected from various Italian regions, were screened for antimicrobial susceptibility, molecular characterization (SmaI pulsed-field gel electrophoresis) and detection of virulence genes (sequencing and DNA microarray analysis). The prevalence of C. jejuni and C. coli was 62.75% and 37.24% respectively. Antimicrobial susceptibility revealed a high level of resistance for ciprofloxacin (62.76%), tetracycline (55.86%) and nalidixic acid (55.17%). Genotyping of Campylobacter isolates using PFGE revealed a total of 86 unique SmaI patterns. Virulence gene profiles were determined using a new microbial diagnostic microarray composed of 70-mer oligonucleotide probes targeting genes implicated in Campylobacter pathogenicity. Correspondence between PFGE and microarray clusters was observed. Comparisons of PFGE and virulence profiles reflected the high genetic diversity of the strains examined, leading us to speculate different degrees of pathogenicity inside Campylobacter populations. PMID:24556669

Characterization of antimicrobial resistance patterns and detection of virulence genes in Campylobacter isolates in Italy.

PubMed

Di Giannatale, Elisabetta; Di Serafino, Gabriella; Zilli, Katiuscia; Alessiani, Alessandra; Sacchini, Lorena; Garofolo, Giuliano; Aprea, Giuseppe; Marotta, Francesca

2014-02-19

Campylobacter has developed resistance to several antimicrobial agents over the years, including macrolides, quinolones and fluoroquinolones, becoming a significant public health hazard. A total of 145 strains derived from raw milk, chicken faeces, chicken carcasses, cattle faeces and human faeces collected from various Italian regions, were screened for antimicrobial susceptibility, molecular characterization (SmaI pulsed-field gel electrophoresis) and detection of virulence genes (sequencing and DNA microarray analysis). The prevalence of C. jejuni and C. coli was 62.75% and 37.24% respectively. Antimicrobial susceptibility revealed a high level of resistance for ciprofloxacin (62.76%), tetracycline (55.86%) and nalidixic acid (55.17%). Genotyping of Campylobacter isolates using PFGE revealed a total of 86 unique SmaI patterns. Virulence gene profiles were determined using a new microbial diagnostic microarray composed of 70-mer oligonucleotide probes targeting genes implicated in Campylobacter pathogenicity. Correspondence between PFGE and microarray clusters was observed. Comparisons of PFGE and virulence profiles reflected the high genetic diversity of the strains examined, leading us to speculate different degrees of pathogenicity inside Campylobacter populations.

Parallel gene analysis with allele-specific padlock probes and tag microarrays

PubMed Central

Banér, Johan; Isaksson, Anders; Waldenström, Erik; Jarvius, Jonas; Landegren, Ulf; Nilsson, Mats

2003-01-01

Parallel, highly specific analysis methods are required to take advantage of the extensive information about DNA sequence variation and of expressed sequences. We present a scalable laboratory technique suitable to analyze numerous target sequences in multiplexed assays. Sets of padlock probes were applied to analyze single nucleotide variation directly in total genomic DNA or cDNA for parallel genotyping or gene expression analysis. All reacted probes were then co-amplified and identified by hybridization to a standard tag oligonucleotide array. The technique was illustrated by analyzing normal and pathogenic variation within the Wilson disease-related ATP7B gene, both at the level of DNA and RNA, using allele-specific padlock probes. PMID:12930977

OCaPPI-Db: an oligonucleotide probe database for pathogen identification through hybridization capture.

PubMed

Gasc, Cyrielle; Constantin, Antony; Jaziri, Faouzi; Peyret, Pierre

2017-01-01

The detection and identification of bacterial pathogens involved in acts of bio- and agroterrorism are essential to avoid pathogen dispersal in the environment and propagation within the population. Conventional molecular methods, such as PCR amplification, DNA microarrays or shotgun sequencing, are subject to various limitations when assessing environmental samples, which can lead to inaccurate findings. We developed a hybridization capture strategy that uses a set of oligonucleotide probes to target and enrich biomarkers of interest in environmental samples. Here, we present Oligonucleotide Capture Probes for Pathogen Identification Database (OCaPPI-Db), an online capture probe database containing a set of 1,685 oligonucleotide probes allowing for the detection and identification of 30 biothreat agents up to the species level. This probe set can be used in its entirety as a comprehensive diagnostic tool or can be restricted to a set of probes targeting a specific pathogen or virulence factor according to the user's needs. : http://ocappidb.uca.works. © The Author(s) 2017. Published by Oxford University Press.

SINGLE-BASE-PAIR MISMATCH DISCRIMINATION USING OLIGONUCLEOTIDE DNA MICROARRAYS AND MELTING PROFILES. (R829458C004)

EPA Science Inventory

The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

Gene expression analysis of hypersensitivity to mosquito bite, chronic active EBV infection and NK/T-lymphoma/leukemia.

PubMed

Washio, Kana; Oka, Takashi; Abdalkader, Lamia; Muraoka, Michiko; Shimada, Akira; Oda, Megumi; Sato, Hiaki; Takata, Katsuyoshi; Kagami, Yoshitoyo; Shimizu, Norio; Kato, Seiichi; Kimura, Hiroshi; Nishizaki, Kazunori; Yoshino, Tadashi; Tsukahara, Hirokazu

2017-11-01

The human herpes virus, Epstein-Barr virus (EBV), is a known oncogenic virus and plays important roles in life-threatening T/NK-cell lymphoproliferative disorders (T/NK-cell LPD) such as hypersensitivity to mosquito bite (HMB), chronic active EBV infection (CAEBV), and NK/T-cell lymphoma/leukemia. During the clinical courses of HMB and CAEBV, patients frequently develop malignant lymphomas and the diseases passively progress sequentially. In the present study, gene expression of CD16 (-) CD56 (+) -, EBV (+) HMB, CAEBV, NK-lymphoma, and NK-leukemia cell lines, which were established from patients, was analyzed using oligonucleotide microarrays and compared to that of CD56 bright CD16 dim/- NK cells from healthy donors. Principal components analysis showed that CAEBV and NK-lymphoma cells were relatively closely located, indicating that they had similar expression profiles. Unsupervised hierarchal clustering analyses of microarray data and gene ontology analysis revealed specific gene clusters and identified several candidate genes responsible for disease that can be used to discriminate each category of NK-LPD and NK-cell lymphoma/leukemia.

Genome Expression Pathway Analysis Tool – Analysis and visualization of microarray gene expression data under genomic, proteomic and metabolic context

PubMed Central

Weniger, Markus; Engelmann, Julia C; Schultz, Jörg

2007-01-01

Background Regulation of gene expression is relevant to many areas of biology and medicine, in the study of treatments, diseases, and developmental stages. Microarrays can be used to measure the expression level of thousands of mRNAs at the same time, allowing insight into or comparison of different cellular conditions. The data derived out of microarray experiments is highly dimensional and often noisy, and interpretation of the results can get intricate. Although programs for the statistical analysis of microarray data exist, most of them lack an integration of analysis results and biological interpretation. Results We have developed GEPAT, Genome Expression Pathway Analysis Tool, offering an analysis of gene expression data under genomic, proteomic and metabolic context. We provide an integration of statistical methods for data import and data analysis together with a biological interpretation for subsets of probes or single probes on the chip. GEPAT imports various types of oligonucleotide and cDNA array data formats. Different normalization methods can be applied to the data, afterwards data annotation is performed. After import, GEPAT offers various statistical data analysis methods, as hierarchical, k-means and PCA clustering, a linear model based t-test or chromosomal profile comparison. The results of the analysis can be interpreted by enrichment of biological terms, pathway analysis or interaction networks. Different biological databases are included, to give various information for each probe on the chip. GEPAT offers no linear work flow, but allows the usage of any subset of probes and samples as a start for a new data analysis. GEPAT relies on established data analysis packages, offers a modular approach for an easy extension, and can be run on a computer grid to allow a large number of users. It is freely available under the LGPL open source license for academic and commercial users at . Conclusion GEPAT is a modular, scalable and professional-grade software integrating analysis and interpretation of microarray gene expression data. An installation available for academic users can be found at . PMID:17543125

Microarray Genomic Systems Development

DTIC Science & Technology

2008-06-01

11 species), Escherichia coli TOP10 (7 strains), and Geobacillus stearothermophilus . Using standard molecular biology methods, we isolated genomic...comparisons. Results: Different species of bacteria, including Escherichia coli, Bacillus bacteria, and Geobacillus stearothermophilus produce qualitatively...oligonucleotides to labelled genomic DNA from a set of test samples, including eleven Bacillus species, Geobacillus stearothermophilus , and seven Escherichia

High-density, microsphere-based fiber optic DNA microarrays.

PubMed

Epstein, Jason R; Leung, Amy P K; Lee, Kyong Hoon; Walt, David R

2003-05-01

A high-density fiber optic DNA microarray has been developed consisting of oligonucleotide-functionalized, 3.1-microm-diameter microspheres randomly distributed on the etched face of an imaging fiber bundle. The fiber bundles are comprised of 6000-50000 fused optical fibers and each fiber terminates with an etched well. The microwell array is capable of housing complementary-sized microspheres, each containing thousands of copies of a unique oligonucleotide probe sequence. The array fabrication process results in random microsphere placement. Determining the position of microspheres in the random array requires an optical encoding scheme. This array platform provides many advantages over other array formats. The microsphere-stock suspension concentration added to the etched fiber can be controlled to provide inherent sensor redundancy. Examining identical microspheres has a beneficial effect on the signal-to-noise ratio. As other sequences of interest are discovered, new microsphere sensing elements can be added to existing microsphere pools and new arrays can be fabricated incorporating the new sequences without altering the existing detection capabilities. These microarrays contain the smallest feature sizes (3 microm) of any DNA array, allowing interrogation of extremely small sample volumes. Reducing the feature size results in higher local target molecule concentrations, creating rapid and highly sensitive assays. The microsphere array platform is also flexible in its applications; research has included DNA-protein interaction profiles, microbial strain differentiation, and non-labeled target interrogation with molecular beacons. Fiber optic microsphere-based DNA microarrays have a simple fabrication protocol enabling their expansion into other applications, such as single cell-based assays.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hsia, Chu Chieh; Chizhikov, Vladimir E.; Yang, Amy X.

Hepatitis B virus (HBV), hepatitis C virus (HCV), and human immunodeficiency virus type-1 (HIV-1) are transfusion-transmitted human pathogens that have a major impact on blood safety and public health worldwide. We developed a microarray multiplex assay for the simultaneous detection and discrimination of these three viruses. The microarray consists of 16 oligonucleotide probes, immobilized on a silylated glass slide. Amplicons from multiplex PCR were labeled with Cy-5 and hybridized to the microarray. The assay detected 1 International Unit (IU), 10 IU, 20 IU of HBV, HCV, and HIV-1, respectively, in a single multiplex reaction. The assay also detected and discriminatedmore » the presence of two or three of these viruses in a single sample. Our data represent a proof-of-concept for the possible use of highly sensitive multiplex microarray assay to screen and confirm the presence of these viruses in blood donors and patients.« less

Genotyping microarray (gene chip) for the ABCR (ABCA4) gene.

PubMed

Jaakson, K; Zernant, J; Külm, M; Hutchinson, A; Tonisson, N; Glavac, D; Ravnik-Glavac, M; Hawlina, M; Meltzer, M R; Caruso, R C; Testa, F; Maugeri, A; Hoyng, C B; Gouras, P; Simonelli, F; Lewis, R A; Lupski, J R; Cremers, F P M; Allikmets, R

2003-11-01

Genetic variation in the ABCR (ABCA4) gene has been associated with five distinct retinal phenotypes, including Stargardt disease/fundus flavimaculatus (STGD/FFM), cone-rod dystrophy (CRD), and age-related macular degeneration (AMD). Comparative genetic analyses of ABCR variation and diagnostics have been complicated by substantial allelic heterogeneity and by differences in screening methods. To overcome these limitations, we designed a genotyping microarray (gene chip) for ABCR that includes all approximately 400 disease-associated and other variants currently described, enabling simultaneous detection of all known ABCR variants. The ABCR genotyping microarray (the ABCR400 chip) was constructed by the arrayed primer extension (APEX) technology. Each sequence change in ABCR was included on the chip by synthesis and application of sequence-specific oligonucleotides. We validated the chip by screening 136 confirmed STGD patients and 96 healthy controls, each of whom we had analyzed previously by single strand conformation polymorphism (SSCP) technology and/or heteroduplex analysis. The microarray was >98% effective in determining the existing genetic variation and was comparable to direct sequencing in that it yielded many sequence changes undetected by SSCP. In STGD patient cohorts, the efficiency of the array to detect disease-associated alleles was between 54% and 78%, depending on the ethnic composition and degree of clinical and molecular characterization of a cohort. In addition, chip analysis suggested a high carrier frequency (up to 1:10) of ABCR variants in the general population. The ABCR genotyping microarray is a robust, cost-effective, and comprehensive screening tool for variation in one gene in which mutations are responsible for a substantial fraction of retinal disease. The ABCR chip is a prototype for the next generation of screening and diagnostic tools in ophthalmic genetics, bridging clinical and scientific research. Copyright 2003 Wiley-Liss, Inc.

Differences in X-chromosome transcriptional activity and cholesterol metabolism between placentae from swine breeds from asian and western origins

USDA-ARS?s Scientific Manuscript database

To gain insight into placental physiology differences between the Chinese Meishan and white composite (WC) swine breeds, short-oligonucleotide microarray gene expression profiles of gestational Day 25, 45, 65, 85, and 105 placental tissues were compared. Differential expression was determined by a ...

Characteristic Markers of the WNT Signaling Pathways Are Differentially Expressed in Osteoarthritic Cartilage

PubMed Central

Dehne, T.; Lindahl, A.; Brittberg, M.; Pruss, A.; Ringe, J.; Sittinger, M.; Karlsson, C.

2012-01-01

Objective: It is well known that expression of markers for WNT signaling is dysregulated in osteoarthritic (OA) bone. However, it is still not fully known if the expression of these markers also is affected in OA cartilage. The aim of this study was therefore to examine this issue. Methods: Human cartilage biopsies from OA and control donors were subjected to genome-wide oligonucleotide microarrays. Genes involved in WNT signaling were selected using the BioRetis database, KEGG pathway analysis was searched using DAVID software tools, and cluster analysis was performed using Genesis software. Results from the microarray analysis were verified using quantitative real-time PCR and immunohistochemistry. In order to study the impact of cytokines for the dysregulated WNT signaling, OA and control chondrocytes were stimulated with interleukin-1 and analyzed with real-time PCR for their expression of WNT-related genes. Results: Several WNT markers displayed a significantly altered expression in OA compared to normal cartilage. Interestingly, inhibitors of the canonical and planar cell polarity WNT signaling pathways displayed significantly increased expression in OA cartilage, while the Ca2+/WNT signaling pathway was activated. Both real-time PCR and immunohistochemistry verified the microarray results. Real-time PCR analysis demonstrated that interleukin-1 upregulated expression of important WNT markers. Conclusions: WNT signaling is significantly affected in OA cartilage. The result suggests that both the canonical and planar cell polarity WNT signaling pathways were partly inhibited while the Ca2+/WNT pathway was activated in OA cartilage. PMID:26069618

A functional genomics tool for the Pacific bluefin tuna: Development of a 44K oligonucleotide microarray from whole-genome sequencing data for global transcriptome analysis.

PubMed

Yasuike, Motoshige; Fujiwara, Atushi; Nakamura, Yoji; Iwasaki, Yuki; Nishiki, Issei; Sugaya, Takuma; Shimizu, Akio; Sano, Motohiko; Kobayashi, Takanori; Ototake, Mitsuru

2016-02-01

Bluefin tunas are one of the most important fishery resources worldwide. Because of high market values, bluefin tuna farming has been rapidly growing during recent years. At present, the most common form of the tuna farming is based on the stocking of wild-caught fish. Therefore, concerns have been raised about the negative impact of the tuna farming on wild stocks. Recently, the Pacific bluefin tuna (PBT), Thunnus orientalis, has succeeded in completing the reproduction cycle under aquaculture conditions, but production bottlenecks remain to be solved because of very little biological information on bluefin tunas. Functional genomics approaches promise to rapidly increase our knowledge on biological processes in the bluefin tuna. Here, we describe the development of the first 44K PBT oligonucleotide microarray (oligo-array), based on whole-genome shotgun (WGS) sequencing and large-scale expressed sequence tags (ESTs) data. In addition, we also introduce an initial 44K PBT oligo-array experiment using in vitro grown peripheral blood leukocytes (PBLs) stimulated with immunostimulants such as lipopolysaccharide (LPS: a cell wall component of Gram-negative bacteria) or polyinosinic:polycytidylic acid (poly I:C: a synthetic mimic of viral infection). This pilot 44K PBT oligo-array analysis successfully addressed distinct immune processes between LPS- and poly I:C- stimulated PBLs. Thus, we expect that this oligo-array will provide an excellent opportunity to analyze global gene expression profiles for a better understanding of diseases and stress, as well as for reproduction, development and influence of nutrition on tuna aquaculture production. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Single-base-pair discrimination of terminal mismatches by using oligonucleotide microarrays and neural network analyses

NASA Technical Reports Server (NTRS)

Urakawa, Hidetoshi; Noble, Peter A.; El Fantroussi, Said; Kelly, John J.; Stahl, David A.

2002-01-01

The effects of single-base-pair near-terminal and terminal mismatches on the dissociation temperature (T(d)) and signal intensity of short DNA duplexes were determined by using oligonucleotide microarrays and neural network (NN) analyses. Two perfect-match probes and 29 probes having a single-base-pair mismatch at positions 1 to 5 from the 5' terminus of the probe were designed to target one of two short sequences representing 16S rRNA. Nonequilibrium dissociation rates (i.e., melting profiles) of all probe-target duplexes were determined simultaneously. Analysis of variance revealed that position of the mismatch, type of mismatch, and formamide concentration significantly affected the T(d) and signal intensity. Increasing the concentration of formamide in the washing buffer decreased the T(d) and signal intensity, and it decreased the variability of the signal. Although T(d)s of probe-target duplexes with mismatches in the first or second position were not significantly different from one another, duplexes with mismatches in the third to fifth positions had significantly lower T(d)s than those with mismatches in the first or second position. The trained NNs predicted the T(d) with high accuracies (R(2) = 0.93). However, the NNs predicted the signal intensity only moderately accurately (R(2) = 0.67), presumably due to increased noise in the signal intensity at low formamide concentrations. Sensitivity analysis revealed that the concentration of formamide explained most (75%) of the variability in T(d)s, followed by position of the mismatch (19%) and type of mismatch (6%). The results suggest that position of the mismatch at or near the 5' terminus plays a greater role in determining the T(d) and signal intensity of duplexes than the type of mismatch.

NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs.

PubMed

Morisset, Dany; Dobnik, David; Hamels, Sandrine; Zel, Jana; Gruden, Kristina

2008-10-01

We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1-25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification.

NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs

PubMed Central

Morisset, Dany; Dobnik, David; Hamels, Sandrine; Žel, Jana; Gruden, Kristina

2008-01-01

We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1–25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification. PMID:18710880

Customized oligonucleotide microarray gene expression-based classification of neuroblastoma patients outperforms current clinical risk stratification.

PubMed

Oberthuer, André; Berthold, Frank; Warnat, Patrick; Hero, Barbara; Kahlert, Yvonne; Spitz, Rüdiger; Ernestus, Karen; König, Rainer; Haas, Stefan; Eils, Roland; Schwab, Manfred; Brors, Benedikt; Westermann, Frank; Fischer, Matthias

2006-11-01

To develop a gene expression-based classifier for neuroblastoma patients that reliably predicts courses of the disease. Two hundred fifty-one neuroblastoma specimens were analyzed using a customized oligonucleotide microarray comprising 10,163 probes for transcripts with differential expression in clinical subgroups of the disease. Subsequently, the prediction analysis for microarrays (PAM) was applied to a first set of patients with maximally divergent clinical courses (n = 77). The classification accuracy was estimated by a complete 10-times-repeated 10-fold cross validation, and a 144-gene predictor was constructed from this set. This classifier's predictive power was evaluated in an independent second set (n = 174) by comparing results of the gene expression-based classification with those of risk stratification systems of current trials from Germany, Japan, and the United States. The first set of patients was accurately predicted by PAM (cross-validated accuracy, 99%). Within the second set, the PAM classifier significantly separated cohorts with distinct courses (3-year event-free survival [EFS] 0.86 +/- 0.03 [favorable; n = 115] v 0.52 +/- 0.07 [unfavorable; n = 59] and 3-year overall survival 0.99 +/- 0.01 v 0.84 +/- 0.05; both P < .0001) and separated risk groups of current neuroblastoma trials into subgroups with divergent outcome (NB2004: low-risk 3-year EFS 0.86 +/- 0.04 v 0.25 +/- 0.15, P < .0001; intermediate-risk 1.00 v 0.57 +/- 0.19, P = .018; high-risk 0.81 +/- 0.10 v 0.56 +/- 0.08, P = .06). In a multivariate Cox regression model, the PAM predictor classified patients of the second set more accurately than risk stratification of current trials from Germany, Japan, and the United States (P < .001; hazard ratio, 4.756 [95% CI, 2.544 to 8.893]). Integration of gene expression-based class prediction of neuroblastoma patients may improve risk estimation of current neuroblastoma trials.

Dendrimeric coating of glass slides for sensitive DNA microarrays analysis

PubMed Central

Le Berre, Véronique; Trévisiol, Emmanuelle; Dagkessamanskaia, Adilia; Sokol, Serguei; Caminade, Anne-Marie; Majoral, Jean Pierre; Meunier, Bernard; François, Jean

2003-01-01

Successful use and reliability of microarray technology is highly dependent on several factors, including surface chemistry parameters and accessibility of cDNA targets to the DNA probes fixed onto the surface. Here, we show that functionalisation of glass slides with homemade dendrimers allow production of more sensitive and reliable DNA microarrays. The dendrimers are nanometric structures of size-controlled diameter with aldehyde function at their periphery. Covalent attachment of these spherical reactive chemical structures on amino-silanised glass slides generates a reactive ∼100 Å layer onto which amino-modified DNA probes are covalently bound. This new grafting chemistry leads to the formation of uniform and homogenous spots. More over, probe concentration before spotting could be reduced from 0.2 to 0.02 mg/ml with PCR products and from 20 to 5 µM with 70mer oligonucleotides without affecting signal intensities after hybridisation with Cy3- and Cy5-labelled targets. More interestingly, while the binding capacity of captured probes on dendrimer-activated glass surface (named dendrislides) is roughly similar to other functionalised glass slides from commercial sources, detection sensitivity was 2-fold higher than with other available DNA microarrays. This detection limit was estimated to 0.1 pM of cDNA targets. Altogether, these features make dendrimer-activated slides ideal for manufacturing cost-effective DNA arrays applicable for gene expression and detection of mutations. PMID:12907740

Detecting novel genes with sparse arrays

PubMed Central

Haiminen, Niina; Smit, Bart; Rautio, Jari; Vitikainen, Marika; Wiebe, Marilyn; Martinez, Diego; Chee, Christine; Kunkel, Joe; Sanchez, Charles; Nelson, Mary Anne; Pakula, Tiina; Saloheimo, Markku; Penttilä, Merja; Kivioja, Teemu

2014-01-01

Species-specific genes play an important role in defining the phenotype of an organism. However, current gene prediction methods can only efficiently find genes that share features such as sequence similarity or general sequence characteristics with previously known genes. Novel sequencing methods and tiling arrays can be used to find genes without prior information and they have demonstrated that novel genes can still be found from extensively studied model organisms. Unfortunately, these methods are expensive and thus are not easily applicable, e.g., to finding genes that are expressed only in very specific conditions. We demonstrate a method for finding novel genes with sparse arrays, applying it on the 33.9 Mb genome of the filamentous fungus Trichoderma reesei. Our computational method does not require normalisations between arrays and it takes into account the multiple-testing problem typical for analysis of microarray data. In contrast to tiling arrays, that use overlapping probes, only one 25mer microarray oligonucleotide probe was used for every 100 b. Thus, only relatively little space on a microarray slide was required to cover the intergenic regions of a genome. The analysis was done as a by-product of a conventional microarray experiment with no additional costs. We found at least 23 good candidates for novel transcripts that could code for proteins and all of which were expressed at high levels. Candidate genes were found to neighbour ire1 and cre1 and many other regulatory genes. Our simple, low-cost method can easily be applied to finding novel species-specific genes without prior knowledge of their sequence properties. PMID:20691772

SaDA: From Sampling to Data Analysis-An Extensible Open Source Infrastructure for Rapid, Robust and Automated Management and Analysis of Modern Ecological High-Throughput Microarray Data.

PubMed

Singh, Kumar Saurabh; Thual, Dominique; Spurio, Roberto; Cannata, Nicola

2015-06-03

One of the most crucial characteristics of day-to-day laboratory information management is the collection, storage and retrieval of information about research subjects and environmental or biomedical samples. An efficient link between sample data and experimental results is absolutely important for the successful outcome of a collaborative project. Currently available software solutions are largely limited to large scale, expensive commercial Laboratory Information Management Systems (LIMS). Acquiring such LIMS indeed can bring laboratory information management to a higher level, but most of the times this requires a sufficient investment of money, time and technical efforts. There is a clear need for a light weighted open source system which can easily be managed on local servers and handled by individual researchers. Here we present a software named SaDA for storing, retrieving and analyzing data originated from microorganism monitoring experiments. SaDA is fully integrated in the management of environmental samples, oligonucleotide sequences, microarray data and the subsequent downstream analysis procedures. It is simple and generic software, and can be extended and customized for various environmental and biomedical studies.

Rapid and reliable detection and identification of GM events using multiplex PCR coupled with oligonucleotide microarray.

PubMed

Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo

2005-05-18

To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.

DNA microarray-based detection and identification of Burkholderia mallei, Burkholderia pseudomallei and Burkholderia spp.

PubMed

Schmoock, Gernot; Ehricht, Ralf; Melzer, Falk; Rassbach, Astrid; Scholz, Holger C; Neubauer, Heinrich; Sachse, Konrad; Mota, Rinaldo Aparecido; Saqib, Muhammad; Elschner, Mandy

2009-01-01

We developed a rapid oligonucleotide microarray assay based on genetic markers for the accurate identification and differentiation of Burkholderia (B.) mallei and Burkholderia pseudomallei, the agents of glanders and melioidosis, respectively. These two agents were clearly identified using at least 4 independent genetic markers including 16S rRNA gene, fliC, motB and also by novel species-specific target genes, identified by in silico sequence analysis. Specific hybridization signal profiles allowed the detection and differentiation of up to 10 further Burkholderia spp., including the closely related species Burkholderia thailandensis and Burkholderia-like agents, such as Burkholderia cepacia, Burkholderia cenocepacia, Burkholderia vietnamiensis, Burkholderia ambifaria, and Burkholderia gladioli, which are often associated with cystic fibrosis (CF) lung disease. The assay was developed using the easy-to-handle and economical ArrayTube (AT) platform. A representative strain panel comprising 44 B. mallei, 32 B. pseudomallei isolates, and various Burkholderia type strains were examined to validate the test. Assay specificity was determined by examination of 40 non-Burkholderia strains.

A microarray analysis of potential genes underlying the neurosensitivity of mice to propofol.

PubMed

Lowes, Damon A; Galley, Helen F; Lowe, Peter R; Rikke, Brad A; Johnson, Thomas E; Webster, Nigel R

2005-09-01

Establishing the mechanism of action of general anesthetics at the molecular level is difficult because of the multiple targets with which these drugs are associated. Inbred short sleep (ISS) and long sleep (ILS) mice are differentially sensitive in response to ethanol and other sedative hypnotics and contain a single quantitative trait locus (Lorp1) that accounts for the genetic variance of loss-of-righting reflex in response to propofol (LORP). In this study, we used high-density oligonucleotide microarrays to identify global gene expression and candidate genes differentially expressed within the Lorp1 region that may give insight into the molecular mechanism underlying LORP. Microarray analysis was performed using Affymetrix MG-U74Av2 Genechips and a selection of differentially expressed genes was confirmed by semiquantitative reverse transcription-polymerase chain reaction. Global expression in the brains of ILS and ISS mice revealed 3423 genes that were significantly expressed, of which 139 (4%) were differentially expressed. Analysis of genes located within the Lorp1 region showed that 26 genes were significantly expressed and that just 2 genes (7%) were differentially expressed. These genes encoded for the proteins AWP1 (associated with protein kinase 1) and "BTB (POZ) domain containing 1," whose functions are largely uncharacterized. Genes differentially expressed outside Lorp1 included seven genes with previously characterized neuronal functions and thus stand out as additional candidate genes that may be involved in mediating the neurosensitivity differences between ISS and ILS.

Study of hepatitis B virus gene mutations with enzymatic colorimetry-based DNA microarray.

PubMed

Mao, Hailei; Wang, Huimin; Zhang, Donglei; Mao, Hongju; Zhao, Jianlong; Shi, Jian; Cui, Zhichu

2006-01-01

To establish a modified microarray method for detecting HBV gene mutations in the clinic. Site-specific oligonucleotide probes were immobilized to microarray slides and hybridized to biotin-labeled HBV gene fragments amplified from two-step PCR. Hybridized targets were transferred to nitrocellulose membranes, followed by intensity measurement using BCIP/NBT colorimetry. HBV genes from 99 Hepatitis B patients and 40 healthy blood donors were analyzed. Mutation frequencies of HBV pre-core/core and basic core promoter (BCP) regions were found to be significantly higher in the patient group (42%, 40% versus 2.5%, 5%, P < 0.01). Compared with a traditional fluorescence method, the colorimetry method exhibited the same level of sensitivity and reproducibility. An enzymatic colorimetry-based DNA microarray assay was successfully established to monitor HBV mutations. Pre-core/core and BCP mutations of HBV genes could be major causes of HBV infection in HBeAg-negative patients and could also be relevant to chronicity and aggravation of hepatitis B.

Construction of a robust microarray from a non-model species (largemouth bass) using pyrosequencing technology

PubMed Central

Garcia-Reyero, Natàlia; Griffitt, Robert J.; Liu, Li; Kroll, Kevin J.; Farmerie, William G.; Barber, David S.; Denslow, Nancy D.

2009-01-01

A novel custom microarray for largemouth bass (Micropterus salmoides) was designed with sequences obtained from a normalized cDNA library using the 454 Life Sciences GS-20 pyrosequencer. This approach yielded in excess of 58 million bases of high-quality sequence. The sequence information was combined with 2,616 reads obtained by traditional suppressive subtractive hybridizations to derive a total of 31,391 unique sequences. Annotation and coding sequences were predicted for these transcripts where possible. 16,350 annotated transcripts were selected as target sequences for the design of the custom largemouth bass oligonucleotide microarray. The microarray was validated by examining the transcriptomic response in male largemouth bass exposed to 17β-œstradiol. Transcriptomic responses were assessed in liver and gonad, and indicated gene expression profiles typical of exposure to œstradiol. The results demonstrate the potential to rapidly create the tools necessary to assess large scale transcriptional responses in non-model species, paving the way for expanded impact of toxicogenomics in ecotoxicology. PMID:19936325

Sex genes for genomic analysis in human brain: internal controls for comparison of probe level data extraction.

PubMed Central

Galfalvy, Hanga C; Erraji-Benchekroun, Loubna; Smyrniotopoulos, Peggy; Pavlidis, Paul; Ellis, Steven P; Mann, J John; Sibille, Etienne; Arango, Victoria

2003-01-01

Background Genomic studies of complex tissues pose unique analytical challenges for assessment of data quality, performance of statistical methods used for data extraction, and detection of differentially expressed genes. Ideally, to assess the accuracy of gene expression analysis methods, one needs a set of genes which are known to be differentially expressed in the samples and which can be used as a "gold standard". We introduce the idea of using sex-chromosome genes as an alternative to spiked-in control genes or simulations for assessment of microarray data and analysis methods. Results Expression of sex-chromosome genes were used as true internal biological controls to compare alternate probe-level data extraction algorithms (Microarray Suite 5.0 [MAS5.0], Model Based Expression Index [MBEI] and Robust Multi-array Average [RMA]), to assess microarray data quality and to establish some statistical guidelines for analyzing large-scale gene expression. These approaches were implemented on a large new dataset of human brain samples. RMA-generated gene expression values were markedly less variable and more reliable than MAS5.0 and MBEI-derived values. A statistical technique controlling the false discovery rate was applied to adjust for multiple testing, as an alternative to the Bonferroni method, and showed no evidence of false negative results. Fourteen probesets, representing nine Y- and two X-chromosome linked genes, displayed significant sex differences in brain prefrontal cortex gene expression. Conclusion In this study, we have demonstrated the use of sex genes as true biological internal controls for genomic analysis of complex tissues, and suggested analytical guidelines for testing alternate oligonucleotide microarray data extraction protocols and for adjusting multiple statistical analysis of differentially expressed genes. Our results also provided evidence for sex differences in gene expression in the brain prefrontal cortex, supporting the notion of a putative direct role of sex-chromosome genes in differentiation and maintenance of sexual dimorphism of the central nervous system. Importantly, these analytical approaches are applicable to all microarray studies that include male and female human or animal subjects. PMID:12962547

Sex genes for genomic analysis in human brain: internal controls for comparison of probe level data extraction.

PubMed

Galfalvy, Hanga C; Erraji-Benchekroun, Loubna; Smyrniotopoulos, Peggy; Pavlidis, Paul; Ellis, Steven P; Mann, J John; Sibille, Etienne; Arango, Victoria

2003-09-08

Genomic studies of complex tissues pose unique analytical challenges for assessment of data quality, performance of statistical methods used for data extraction, and detection of differentially expressed genes. Ideally, to assess the accuracy of gene expression analysis methods, one needs a set of genes which are known to be differentially expressed in the samples and which can be used as a "gold standard". We introduce the idea of using sex-chromosome genes as an alternative to spiked-in control genes or simulations for assessment of microarray data and analysis methods. Expression of sex-chromosome genes were used as true internal biological controls to compare alternate probe-level data extraction algorithms (Microarray Suite 5.0 [MAS5.0], Model Based Expression Index [MBEI] and Robust Multi-array Average [RMA]), to assess microarray data quality and to establish some statistical guidelines for analyzing large-scale gene expression. These approaches were implemented on a large new dataset of human brain samples. RMA-generated gene expression values were markedly less variable and more reliable than MAS5.0 and MBEI-derived values. A statistical technique controlling the false discovery rate was applied to adjust for multiple testing, as an alternative to the Bonferroni method, and showed no evidence of false negative results. Fourteen probesets, representing nine Y- and two X-chromosome linked genes, displayed significant sex differences in brain prefrontal cortex gene expression. In this study, we have demonstrated the use of sex genes as true biological internal controls for genomic analysis of complex tissues, and suggested analytical guidelines for testing alternate oligonucleotide microarray data extraction protocols and for adjusting multiple statistical analysis of differentially expressed genes. Our results also provided evidence for sex differences in gene expression in the brain prefrontal cortex, supporting the notion of a putative direct role of sex-chromosome genes in differentiation and maintenance of sexual dimorphism of the central nervous system. Importantly, these analytical approaches are applicable to all microarray studies that include male and female human or animal subjects.

Protein profiles associated with survival in lung adenocarcinoma

PubMed Central

Chen, Guoan; Gharib, Tarek G; Wang, Hong; Huang, Chiang-Ching; Kuick, Rork; Thomas, Dafydd G.; Shedden, Kerby A.; Misek, David E.; Taylor, Jeremy M. G.; Giordano, Thomas J.; Kardia, Sharon L. R.; Iannettoni, Mark D.; Yee, John; Hogg, Philip J.; Orringer, Mark B.; Hanash, Samir M.; Beer, David G.

2003-01-01

Morphologic assessment of lung tumors is informative but insufficient to adequately predict patient outcome. We previously identified transcriptional profiles that predict patient survival, and here we identify proteins associated with patient survival in lung adenocarcinoma. A total of 682 individual protein spots were quantified in 90 lung adenocarcinomas by using quantitative two-dimensional polyacrylamide gel electrophoresis analysis. A leave-one-out cross-validation procedure using the top 20 survival-associated proteins identified by Cox modeling indicated that protein profiles as a whole can predict survival in stage I tumor patients (P = 0.01). Thirty-three of 46 survival-associated proteins were identified by using mass spectrometry. Expression of 12 candidate proteins was confirmed as tumor-derived with immunohistochemical analysis and tissue microarrays. Oligonucleotide microarray results from both the same tumors and from an independent study showed mRNAs associated with survival for 11 of 27 encoded genes. Combined analysis of protein and mRNA data revealed 11 components of the glycolysis pathway as associated with poor survival. Among these candidates, phosphoglycerate kinase 1 was associated with survival in the protein study, in both mRNA studies and in an independent validation set of 117 adenocarcinomas and squamous lung tumors using tissue microarrays. Elevated levels of phosphoglycerate kinase 1 in the serum were also significantly correlated with poor outcome in a validation set of 107 patients with lung adenocarcinomas using ELISA analysis. These studies identify new prognostic biomarkers and indicate that protein expression profiles can predict the outcome of patients with early-stage lung cancer. PMID:14573703

Differential Transcriptional Response to Nonassociative and Associative Components of Classical Fear Conditioning in the Amygdala and Hippocampus

ERIC Educational Resources Information Center

Isiegas, Carolina; Stein, Joel; Hellman, Kevin; Hannenhalli, Sridhar; Abel, Ted; Keeley, Michael B.; Wood, Marcelo A.

2006-01-01

Classical fear conditioning requires the recognition of conditioned stimuli (CS) and the association of the CS with an aversive stimulus. We used Affymetrix oligonucleotide microarrays to characterize changes in gene expression compared to naive mice in both the amygdala and the hippocampus 30 min after classical fear conditioning and 30 min after…

Plant-pathogen interactions: what microarray tells about it?

PubMed

Lodha, T D; Basak, J

2012-01-01

Plant defense responses are mediated by elementary regulatory proteins that affect expression of thousands of genes. Over the last decade, microarray technology has played a key role in deciphering the underlying networks of gene regulation in plants that lead to a wide variety of defence responses. Microarray is an important tool to quantify and profile the expression of thousands of genes simultaneously, with two main aims: (1) gene discovery and (2) global expression profiling. Several microarray technologies are currently in use; most include a glass slide platform with spotted cDNA or oligonucleotides. Till date, microarray technology has been used in the identification of regulatory genes, end-point defence genes, to understand the signal transduction processes underlying disease resistance and its intimate links to other physiological pathways. Microarray technology can be used for in-depth, simultaneous profiling of host/pathogen genes as the disease progresses from infection to resistance/susceptibility at different developmental stages of the host, which can be done in different environments, for clearer understanding of the processes involved. A thorough knowledge of plant disease resistance using successful combination of microarray and other high throughput techniques, as well as biochemical, genetic, and cell biological experiments is needed for practical application to secure and stabilize yield of many crop plants. This review starts with a brief introduction to microarray technology, followed by the basics of plant-pathogen interaction, the use of DNA microarrays over the last decade to unravel the mysteries of plant-pathogen interaction, and ends with the future prospects of this technology.

eSensor®: A Microarray Technology Based on Electrochemical Detection of Nucleic Acids and Its Application to Cystic Fibrosis Carrier Screening

NASA Astrophysics Data System (ADS)

Reed, Michael R.; Coty, William A.

We have developed a test for identification of carriers for cystic fibrosis using the eSensor® DNA detection technology. Oligonucleotide probes are deposited within self-assembled monolayers on gold electrodes arrayed upon printed circuit boards. These probes allow sequence-specific capture of amplicons containing a panel of mutation sites associated with cystic fibrosis. DNA targets are detected and mutations genotyped using a “sandwich” assay methodology employing electrochemical detection of ferrocene-labeled oligonucleotides for discrimination of carrier and non-carrier alleles. Performance of the cystic fibrosis application demonstrates sufficient accuracy and reliability for clinical diagnostic use, and the procedure can be performed by trained medical technologists available in the hospital laboratory.

A general framework for optimization of probes for gene expression microarray and its application to the fungus Podospora anserina.

PubMed

Bidard, Frédérique; Imbeaud, Sandrine; Reymond, Nancie; Lespinet, Olivier; Silar, Philippe; Clavé, Corinne; Delacroix, Hervé; Berteaux-Lecellier, Véronique; Debuchy, Robert

2010-06-18

The development of new microarray technologies makes custom long oligonucleotide arrays affordable for many experimental applications, notably gene expression analyses. Reliable results depend on probe design quality and selection. Probe design strategy should cope with the limited accuracy of de novo gene prediction programs, and annotation up-dating. We present a novel in silico procedure which addresses these issues and includes experimental screening, as an empirical approach is the best strategy to identify optimal probes in the in silico outcome. We used four criteria for in silico probe selection: cross-hybridization, hairpin stability, probe location relative to coding sequence end and intron position. This latter criterion is critical when exon-intron gene structure predictions for intron-rich genes are inaccurate. For each coding sequence (CDS), we selected a sub-set of four probes. These probes were included in a test microarray, which was used to evaluate the hybridization behavior of each probe. The best probe for each CDS was selected according to three experimental criteria: signal-to-noise ratio, signal reproducibility, and representative signal intensities. This procedure was applied for the development of a gene expression Agilent platform for the filamentous fungus Podospora anserina and the selection of a single 60-mer probe for each of the 10,556 P. anserina CDS. A reliable gene expression microarray version based on the Agilent 44K platform was developed with four spot replicates of each probe to increase statistical significance of analysis.

Microarray Detection of Duplex and Triplex DNA Binders with DNA-Modified Gold Nanoparticles

PubMed Central

Lytton-Jean, Abigail K. R.; Han, Min Su; Mirkin, Chad A.

2008-01-01

We have designed a chip-based assay, using microarray technology, for determining the relative binding affinities of duplex and triplex DNA binders. This assay combines the high discrimination capabilities afforded by DNA-modified Au nanoparticles with the high-throughput capabilities of DNA microarrays. The detection and screening of duplex DNA binders are important because these molecules, in many cases, are potential anticancer agents as well as toxins. Triplex DNA binders are also promising drug candidates. These molecules, in conjunction with triplex forming oligonucleotides, could potentially be used to achieve control of gene expression by interfering with transcription factors that bind to DNA. Therefore, the ability to screen for these molecules in a high-throughput fashion could dramatically improve the drug screening process. The assay reported here provides excellent discrimination between strong, intermediate, and weak duplex and triplex DNA binders in a high-throughput fashion. PMID:17614366

Near-isogenic cotton germplasm lines that differ in fiber-bundle strength have temporal differences in fiber gene expression patterns as revealed by comparative high-throughput profiling.

PubMed

Hinchliffe, Doug J; Meredith, William R; Yeater, Kathleen M; Kim, Hee Jin; Woodward, Andrew W; Chen, Z Jeffrey; Triplett, Barbara A

2010-05-01

Gene expression profiles of developing cotton (Gossypium hirsutum L.) fibers from two near-isogenic lines (NILs) that differ in fiber-bundle strength, short-fiber content, and in fewer than two genetic loci were compared using an oligonucleotide microarray. Fiber gene expression was compared at five time points spanning fiber elongation and secondary cell wall (SCW) biosynthesis. Fiber samples were collected from field plots in a randomized, complete block design, with three spatially distinct biological replications for each NIL at each time point. Microarray hybridizations were performed in a loop experimental design that allowed comparisons of fiber gene expression profiles as a function of time between the two NILs. Overall, developmental expression patterns revealed by the microarray experiment agreed with previously reported cotton fiber gene expression patterns for specific genes. Additionally, genes expressed coordinately with the onset of SCW biosynthesis in cotton fiber correlated with gene expression patterns of other SCW-producing plant tissues. Functional classification and enrichment analysis of differentially expressed genes between the two NILs revealed that genes associated with SCW biosynthesis were significantly up-regulated in fibers of the high-fiber quality line at the transition stage of cotton fiber development. For independent corroboration of the microarray results, 15 genes were selected for quantitative reverse transcription PCR analysis of fiber gene expression. These analyses, conducted over multiple field years, confirmed the temporal difference in fiber gene expression between the two NILs. We hypothesize that the loci conferring temporal differences in fiber gene expression between the NILs are important regulatory sequences that offer the potential for more targeted manipulation of cotton fiber quality.

Hybrid genetic algorithm-neural network: feature extraction for unpreprocessed microarray data.

PubMed

Tong, Dong Ling; Schierz, Amanda C

2011-09-01

Suitable techniques for microarray analysis have been widely researched, particularly for the study of marker genes expressed to a specific type of cancer. Most of the machine learning methods that have been applied to significant gene selection focus on the classification ability rather than the selection ability of the method. These methods also require the microarray data to be preprocessed before analysis takes place. The objective of this study is to develop a hybrid genetic algorithm-neural network (GANN) model that emphasises feature selection and can operate on unpreprocessed microarray data. The GANN is a hybrid model where the fitness value of the genetic algorithm (GA) is based upon the number of samples correctly labelled by a standard feedforward artificial neural network (ANN). The model is evaluated by using two benchmark microarray datasets with different array platforms and differing number of classes (a 2-class oligonucleotide microarray data for acute leukaemia and a 4-class complementary DNA (cDNA) microarray dataset for SRBCTs (small round blue cell tumours)). The underlying concept of the GANN algorithm is to select highly informative genes by co-evolving both the GA fitness function and the ANN weights at the same time. The novel GANN selected approximately 50% of the same genes as the original studies. This may indicate that these common genes are more biologically significant than other genes in the datasets. The remaining 50% of the significant genes identified were used to build predictive models and for both datasets, the models based on the set of genes extracted by the GANN method produced more accurate results. The results also suggest that the GANN method not only can detect genes that are exclusively associated with a single cancer type but can also explore the genes that are differentially expressed in multiple cancer types. The results show that the GANN model has successfully extracted statistically significant genes from the unpreprocessed microarray data as well as extracting known biologically significant genes. We also show that assessing the biological significance of genes based on classification accuracy may be misleading and though the GANN's set of extra genes prove to be more statistically significant than those selected by other methods, a biological assessment of these genes is highly recommended to confirm their functionality. Copyright © 2011 Elsevier B.V. All rights reserved.

SaDA: From Sampling to Data Analysis—An Extensible Open Source Infrastructure for Rapid, Robust and Automated Management and Analysis of Modern Ecological High-Throughput Microarray Data

PubMed Central

Singh, Kumar Saurabh; Thual, Dominique; Spurio, Roberto; Cannata, Nicola

2015-01-01

One of the most crucial characteristics of day-to-day laboratory information management is the collection, storage and retrieval of information about research subjects and environmental or biomedical samples. An efficient link between sample data and experimental results is absolutely important for the successful outcome of a collaborative project. Currently available software solutions are largely limited to large scale, expensive commercial Laboratory Information Management Systems (LIMS). Acquiring such LIMS indeed can bring laboratory information management to a higher level, but most of the times this requires a sufficient investment of money, time and technical efforts. There is a clear need for a light weighted open source system which can easily be managed on local servers and handled by individual researchers. Here we present a software named SaDA for storing, retrieving and analyzing data originated from microorganism monitoring experiments. SaDA is fully integrated in the management of environmental samples, oligonucleotide sequences, microarray data and the subsequent downstream analysis procedures. It is simple and generic software, and can be extended and customized for various environmental and biomedical studies. PMID:26047146

Microarray-based determination of anti-inflammatory genes targeted by 6-(methylsulfinyl)hexyl isothiocyanate in macrophages.

PubMed

Chen, Jihua; Uto, Takuhiro; Tanigawa, Shunsuke; Yamada-Kato, Tomeo; Fujii, Makoto; Hou, DE-Xing

2010-01-01

6-(Methylsulfinyl)hexyl isothiocyanate (6-MSITC) is a bioactive ingredient of wasabi [Wasabia japonica (Miq.) Matsumura], which is a popular pungent spice of Japan. To evaluate the anti-inflammatory function and underlying genes targeted by 6-MSITC, gene expression profiling through DNA microarray was performed in mouse macrophages. Among 22,050 oligonucleotides, the expression levels of 406 genes were increased by ≥3-fold in lipopolysaccharide (LPS)-activated RAW264 cells, 238 gene signals of which were attenuated by 6-MSITC (≥2-fold). Expression levels of 717 genes were decreased by ≥3-fold in LPS-activated cells, of which 336 gene signals were restored by 6-MSITC (≥2-fold). Utilizing group analysis, 206 genes affected by 6-MSITC with a ≥2-fold change were classified into 35 categories relating to biological processes (81), molecular functions (108) and signaling pathways (17). The genes were further categorized as 'defense, inflammatory response, cytokine activities and receptor activities' and some were confirmed by real-time polymerase chain reaction. Ingenuity pathway analysis further revealed that wasabi 6-MSITC regulated the relevant networks of chemokines, interleukins and interferons to exert its anti-inflammatory function.

Microarray-based determination of anti-inflammatory genes targeted by 6-(methylsulfinyl)hexyl isothiocyanate in macrophages

PubMed Central

CHEN, JIHUA; UTO, TAKUHIRO; TANIGAWA, SHUNSUKE; YAMADA-KATO, TOMEO; FUJII, MAKOTO; HOU, DE-XING

2010-01-01

6-(Methylsulfinyl)hexyl isothiocyanate (6-MSITC) is a bioactive ingredient of wasabi [Wasabia japonica (Miq.) Matsumura], which is a popular pungent spice of Japan. To evaluate the anti-inflammatory function and underlying genes targeted by 6-MSITC, gene expression profiling through DNA microarray was performed in mouse macrophages. Among 22,050 oligonucleotides, the expression levels of 406 genes were increased by ≥3-fold in lipopolysaccharide (LPS)-activated RAW264 cells, 238 gene signals of which were attenuated by 6-MSITC (≥2-fold). Expression levels of 717 genes were decreased by ≥3-fold in LPS-activated cells, of which 336 gene signals were restored by 6-MSITC (≥2-fold). Utilizing group analysis, 206 genes affected by 6-MSITC with a ≥2-fold change were classified into 35 categories relating to biological processes (81), molecular functions (108) and signaling pathways (17). The genes were further categorized as ‘defense, inflammatory response, cytokine activities and receptor activities’ and some were confirmed by real-time polymerase chain reaction. Ingenuity pathway analysis further revealed that wasabi 6-MSITC regulated the relevant networks of chemokines, interleukins and interferons to exert its anti-inflammatory function. PMID:23136589

Akt/FOXO3a signaling modulates the endothelial stress response through regulation of heat shock protein 70 expression.

PubMed

Kim, Hyo-Soo; Skurk, Carsten; Maatz, Henrike; Shiojima, Ichiro; Ivashchenko, Yuri; Yoon, Suk-Won; Park, Young-Bae; Walsh, Kenneth

2005-06-01

To identify new antiapoptotic targets of the PI3K-Akt signaling pathway in endothelial cells, adenovirus-mediated Akt1 gene transfer and oligonucleotide microarrays were used to examine Akt-regulated transcripts. DNA microarray analysis revealed that HSP70 expression underwent the greatest fold activation of 12,532 transcripts examined in human umbilical vein endothelial cells (HUVEC) transduced with constitutively active Akt1. Akt1 gene transfer increased HSP70 transcript expression by 24.8-fold as determined by quantitative PCR and promoted a dose-dependent up-regulation of HSP70 protein as determined by Western immunoblot analysis. Gene transfer of FOXO3a, a downstream target of Akt in endothelial cells, significantly suppressed both basal and stress-induced HSP70 protein expression. FOXO3a induced caspase-9-dependent apoptosis in HUVEC, and cotransduction with Ad-HSP70 rescued endothelial cells from FOXO3a-induced apoptosis under basal and stress conditions. Our results identify HSP70 as a new antiapoptotic target of Akt-FOXO3a signaling in endothelial cells that controls viability through modulation of the stress-induced intrinsic cell death pathway.

Development of a low-cost detection method for miRNA microarray.

PubMed

Li, Wei; Zhao, Botao; Jin, Youxin; Ruan, Kangcheng

2010-04-01

MicroRNA (miRNA) microarray is a powerful tool to explore the expression profiling of miRNA. The current detection method used in miRNA microarray is mainly fluorescence based, which usually requires costly detection system such as laser confocal scanner of tens of thousands of dollars. Recently, we developed a low-cost yet sensitive detection method for miRNA microarray based on enzyme-linked assay. In this approach, the biotinylated miRNAs were captured by the corresponding oligonucleotide probes immobilized on microarray slide; and then the biotinylated miRNAs would capture streptavidin-conjugated alkaline phosphatase. A purple-black precipitation on each biotinylated miRNA spot was produced by the enzyme catalytic reaction. It could be easily detected by a charge-coupled device digital camera mounted on a microscope, which lowers the detection cost more than 100 fold compared with that of fluorescence method. Our data showed that signal intensity of the spot correlates well with the biotinylated miRNA concentration and the detection limit for miRNAs is at least 0.4 fmol and the detection dynamic range spans about 2.5 orders of magnitude, which is comparable to that of fluorescence method.

Global gene expression profiles of Phytophthora ramorum strain pr102 in response to plant host and tissue differentiation

Treesearch

Caroline M. Press; Niklaus J. Grunwald

2008-01-01

The release of the draft genome sequence of P. ramorum strain Pr102, enabled the construction of an oligonucleotide microarray of the entire genome of Pr102. The array contains 344,680 features (oligos) that represent the transcriptome of Pr102. P. ramorum RNA was extracted from mycelium and sporangia and used to compare gene...

Chromosomal microarray analysis of consecutive individuals with autism spectrum disorders or learning disability presenting for genetic services.

PubMed

Roberts, Jennifer L; Hovanes, Karine; Dasouki, Majed; Manzardo, Ann M; Butler, Merlin G

2014-02-01

Chromosomal microarray analysis is now commonly used in clinical practice to identify copy number variants (CNVs) in the human genome. We report our experience with the use of the 105 K and 180K oligonucleotide microarrays in 215 consecutive patients referred with either autism or autism spectrum disorders (ASD) or developmental delay/learning disability for genetic services at the University of Kansas Medical Center during the past 4 years (2009-2012). Of the 215 patients [140 males and 75 females (male/female ratio=1.87); 65 with ASD and 150 with learning disability], abnormal microarray results were seen in 45 individuals (21%) with a total of 49 CNVs. Of these findings, 32 represented a known diagnostic CNV contributing to the clinical presentation and 17 represented non-diagnostic CNVs (variants of unknown significance). Thirteen patients with ASD had a total of 14 CNVs, 6 CNVs recognized as diagnostic and 8 as non-diagnostic. The most common chromosome involved in the ASD group was chromosome 15. For those with a learning disability, 32 patients had a total of 35 CNVs. Twenty-six of the 35 CNVs were classified as a known diagnostic CNV, usually a deletion (n=20). Nine CNVs were classified as an unknown non-diagnostic CNV, usually a duplication (n=8). For the learning disability subgroup, chromosomes 2 and 22 were most involved. Thirteen out of 65 patients (20%) with ASD had a CNV compared with 32 out of 150 patients (21%) with a learning disability. The frequency of chromosomal microarray abnormalities compared by subject group or gender was not statistically different. A higher percentage of individuals with a learning disability had clinical findings of seizures, dysmorphic features and microcephaly, but not statistically significant. While both groups contained more males than females, a significantly higher percentage of males were present in the ASD group. © 2013 Elsevier B.V. All rights reserved.

DNA microarrays for identifying fishes.

PubMed

Kochzius, M; Nölte, M; Weber, H; Silkenbeumer, N; Hjörleifsdottir, S; Hreggvidsson, G O; Marteinsson, V; Kappel, K; Planes, S; Tinti, F; Magoulas, A; Garcia Vazquez, E; Turan, C; Hervet, C; Campo Falgueras, D; Antoniou, A; Landi, M; Blohm, D

2008-01-01

In many cases marine organisms and especially their diverse developmental stages are difficult to identify by morphological characters. DNA-based identification methods offer an analytically powerful addition or even an alternative. In this study, a DNA microarray has been developed to be able to investigate its potential as a tool for the identification of fish species from European seas based on mitochondrial 16S rDNA sequences. Eleven commercially important fish species were selected for a first prototype. Oligonucleotide probes were designed based on the 16S rDNA sequences obtained from 230 individuals of 27 fish species. In addition, more than 1200 sequences of 380 species served as sequence background against which the specificity of the probes was tested in silico. Single target hybridisations with Cy5-labelled, PCR-amplified 16S rDNA fragments from each of the 11 species on microarrays containing the complete set of probes confirmed their suitability. True-positive, fluorescence signals obtained were at least one order of magnitude stronger than false-positive cross-hybridisations. Single nontarget hybridisations resulted in cross-hybridisation signals at approximately 27% of the cases tested, but all of them were at least one order of magnitude lower than true-positive signals. This study demonstrates that the 16S rDNA gene is suitable for designing oligonucleotide probes, which can be used to differentiate 11 fish species. These data are a solid basis for the second step to create a "Fish Chip" for approximately 50 fish species relevant in marine environmental and fisheries research, as well as control of fisheries products.

Development of a rapid microarray-based DNA subtyping assay for the alleles of Shiga toxins 1 and 2 of Escherichia coli.

PubMed

Geue, Lutz; Stieber, Bettina; Monecke, Stefan; Engelmann, Ines; Gunzer, Florian; Slickers, Peter; Braun, Sascha D; Ehricht, Ralf

2014-08-01

In this study, we developed a new rapid, economic, and automated microarray-based genotyping test for the standardized subtyping of Shiga toxins 1 and 2 of Escherichia coli. The microarrays from Alere Technologies can be used in two different formats, the ArrayTube and the ArrayStrip (which enables high-throughput testing in a 96-well format). One microarray chip harbors all the gene sequences necessary to distinguish between all Stx subtypes, facilitating the identification of single and multiple subtypes within a single isolate in one experiment. Specific software was developed to automatically analyze all data obtained from the microarray. The assay was validated with 21 Shiga toxin-producing E. coli (STEC) reference strains that were previously tested by the complete set of conventional subtyping PCRs. The microarray results showed 100% concordance with the PCR results. Essentially identical results were detected when the standard DNA extraction method was replaced by a time-saving heat lysis protocol. For further validation of the microarray, we identified the Stx subtypes or combinations of the subtypes in 446 STEC field isolates of human and animal origin. In summary, this oligonucleotide array represents an excellent diagnostic tool that provides some advantages over standard PCR-based subtyping. The number of the spotted probes on the microarrays can be increased by additional probes, such as for novel alleles, species markers, or resistance genes, should the need arise. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

A DNA microarray for identification of selected Korean birds based on mitochondrial cytochrome c oxidase I gene sequences.

PubMed

Chung, In-Hyuk; Yoo, Hye Sook; Eah, Jae-Yong; Yoon, Hyun-Kyu; Jung, Jin-Wook; Hwang, Seung Yong; Kim, Chang-Bae

2010-10-01

DNA barcoding with the gene encoding cytochrome c oxidase I (COI) in the mitochondrial genome has been proposed as a standard marker to identify and discover animal species. Some migratory wild birds are suspected of transmitting avian influenza and pose a threat to aircraft safety because of bird strikes. We have previously reported the COI gene sequences of 92 Korean bird species. In the present study, we developed a DNA microarray to identify 17 selected bird species on the basis of nucleotide diversity. We designed and synthesized 19 specific oligonucleotide probes; these probes were arrayed on a silylated glass slide. The length of the probes was 19-24 bps. The COI sequences amplified from the tissues of the selected birds were labeled with a fluorescent probe for microarray hybridization, and unique hybridization patterns were detected for each selected species. These patterns may be considered diagnostic patterns for species identification. This microarray system will provide a sensitive and a high-throughput method for identification of Korean birds.

Calibration and assessment of channel-specific biases in microarray data with extended dynamical range.

PubMed

Bengtsson, Henrik; Jönsson, Göran; Vallon-Christersson, Johan

2004-11-12

Non-linearities in observed log-ratios of gene expressions, also known as intensity dependent log-ratios, can often be accounted for by global biases in the two channels being compared. Any step in a microarray process may introduce such offsets and in this article we study the biases introduced by the microarray scanner and the image analysis software. By scanning the same spotted oligonucleotide microarray at different photomultiplier tube (PMT) gains, we have identified a channel-specific bias present in two-channel microarray data. For the scanners analyzed it was in the range of 15-25 (out of 65,535). The observed bias was very stable between subsequent scans of the same array although the PMT gain was greatly adjusted. This indicates that the bias does not originate from a step preceding the scanner detector parts. The bias varies slightly between arrays. When comparing estimates based on data from the same array, but from different scanners, we have found that different scanners introduce different amounts of bias. So do various image analysis methods. We propose a scanning protocol and a constrained affine model that allows us to identify and estimate the bias in each channel. Backward transformation removes the bias and brings the channels to the same scale. The result is that systematic effects such as intensity dependent log-ratios are removed, but also that signal densities become much more similar. The average scan, which has a larger dynamical range and greater signal-to-noise ratio than individual scans, can then be obtained. The study shows that microarray scanners may introduce a significant bias in each channel. Such biases have to be calibrated for, otherwise systematic effects such as intensity dependent log-ratios will be observed. The proposed scanning protocol and calibration method is simple to use and is useful for evaluating scanner biases or for obtaining calibrated measurements with extended dynamical range and better precision. The cross-platform R package aroma, which implements all described methods, is available for free from http://www.maths.lth.se/bioinformatics/.

Global gene expression analysis of apple fruit development from the floral bud to ripe fruit

PubMed Central

Janssen, Bart J; Thodey, Kate; Schaffer, Robert J; Alba, Rob; Balakrishnan, Lena; Bishop, Rebecca; Bowen, Judith H; Crowhurst, Ross N; Gleave, Andrew P; Ledger, Susan; McArtney, Steve; Pichler, Franz B; Snowden, Kimberley C; Ward, Shayna

2008-01-01

Background Apple fruit develop over a period of 150 days from anthesis to fully ripe. An array representing approximately 13000 genes (15726 oligonucleotides of 45–55 bases) designed from apple ESTs has been used to study gene expression over eight time points during fruit development. This analysis of gene expression lays the groundwork for a molecular understanding of fruit growth and development in apple. Results Using ANOVA analysis of the microarray data, 1955 genes showed significant changes in expression over this time course. Expression of genes is coordinated with four major patterns of expression observed: high in floral buds; high during cell division; high when starch levels and cell expansion rates peak; and high during ripening. Functional analysis associated cell cycle genes with early fruit development and three core cell cycle genes are significantly up-regulated in the early stages of fruit development. Starch metabolic genes were associated with changes in starch levels during fruit development. Comparison with microarrays of ethylene-treated apple fruit identified a group of ethylene induced genes also induced in normal fruit ripening. Comparison with fruit development microarrays in tomato has been used to identify 16 genes for which expression patterns are similar in apple and tomato and these genes may play fundamental roles in fruit development. The early phase of cell division and tissue specification that occurs in the first 35 days after pollination has been associated with up-regulation of a cluster of genes that includes core cell cycle genes. Conclusion Gene expression in apple fruit is coordinated with specific developmental stages. The array results are reproducible and comparisons with experiments in other species has been used to identify genes that may play a fundamental role in fruit development. PMID:18279528

Global gene expression analysis of apple fruit development from the floral bud to ripe fruit.

PubMed

Janssen, Bart J; Thodey, Kate; Schaffer, Robert J; Alba, Rob; Balakrishnan, Lena; Bishop, Rebecca; Bowen, Judith H; Crowhurst, Ross N; Gleave, Andrew P; Ledger, Susan; McArtney, Steve; Pichler, Franz B; Snowden, Kimberley C; Ward, Shayna

2008-02-17

Apple fruit develop over a period of 150 days from anthesis to fully ripe. An array representing approximately 13000 genes (15726 oligonucleotides of 45-55 bases) designed from apple ESTs has been used to study gene expression over eight time points during fruit development. This analysis of gene expression lays the groundwork for a molecular understanding of fruit growth and development in apple. Using ANOVA analysis of the microarray data, 1955 genes showed significant changes in expression over this time course. Expression of genes is coordinated with four major patterns of expression observed: high in floral buds; high during cell division; high when starch levels and cell expansion rates peak; and high during ripening. Functional analysis associated cell cycle genes with early fruit development and three core cell cycle genes are significantly up-regulated in the early stages of fruit development. Starch metabolic genes were associated with changes in starch levels during fruit development. Comparison with microarrays of ethylene-treated apple fruit identified a group of ethylene induced genes also induced in normal fruit ripening. Comparison with fruit development microarrays in tomato has been used to identify 16 genes for which expression patterns are similar in apple and tomato and these genes may play fundamental roles in fruit development. The early phase of cell division and tissue specification that occurs in the first 35 days after pollination has been associated with up-regulation of a cluster of genes that includes core cell cycle genes. Gene expression in apple fruit is coordinated with specific developmental stages. The array results are reproducible and comparisons with experiments in other species has been used to identify genes that may play a fundamental role in fruit development.

Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation

PubMed Central

Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert

2009-01-01

Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344

A highly oriented hybrid microarray modified electrode fabricated by a template-free method for ultrasensitive electrochemical DNA recognition

NASA Astrophysics Data System (ADS)

Shi, Lei; Chu, Zhenyu; Dong, Xueliang; Jin, Wanqin; Dempsey, Eithne

2013-10-01

Highly oriented growth of a hybrid microarray was realized by a facile template-free method on gold substrates for the first time. The proposed formation mechanism involves an interfacial structure-directing force arising from self-assembled monolayers (SAMs) between gold substrates and hybrid crystals. Different SAMs and variable surface coverage of the assembled molecules play a critical role in the interfacial directing forces and influence the morphologies of hybrid films. A highly oriented hybrid microarray was formed on the highly aligned and vertical SAMs of 1,4-benzenedithiol molecules with rigid backbones, which afforded an intense structure-directing power for the oriented growth of hybrid crystals. Additionally, the density of the microarray could be adjusted by controlling the surface coverage of assembled molecules. Based on the hybrid microarray modified electrode with a large specific area (ca. 10 times its geometrical area), a label-free electrochemical DNA biosensor was constructed for the detection of an oligonucleotide fragment of the avian flu virus H5N1. The DNA biosensor displayed a significantly low detection limit of 5 pM (S/N = 3), a wide linear response from 10 pM to 10 nM, as well as excellent selectivity, good regeneration and high stability. We expect that the proposed template-free method can provide a new reference for the fabrication of a highly oriented hybrid array and the as-prepared microarray modified electrode will be a promising paradigm in constructing highly sensitive and selective biosensors.Highly oriented growth of a hybrid microarray was realized by a facile template-free method on gold substrates for the first time. The proposed formation mechanism involves an interfacial structure-directing force arising from self-assembled monolayers (SAMs) between gold substrates and hybrid crystals. Different SAMs and variable surface coverage of the assembled molecules play a critical role in the interfacial directing forces and influence the morphologies of hybrid films. A highly oriented hybrid microarray was formed on the highly aligned and vertical SAMs of 1,4-benzenedithiol molecules with rigid backbones, which afforded an intense structure-directing power for the oriented growth of hybrid crystals. Additionally, the density of the microarray could be adjusted by controlling the surface coverage of assembled molecules. Based on the hybrid microarray modified electrode with a large specific area (ca. 10 times its geometrical area), a label-free electrochemical DNA biosensor was constructed for the detection of an oligonucleotide fragment of the avian flu virus H5N1. The DNA biosensor displayed a significantly low detection limit of 5 pM (S/N = 3), a wide linear response from 10 pM to 10 nM, as well as excellent selectivity, good regeneration and high stability. We expect that the proposed template-free method can provide a new reference for the fabrication of a highly oriented hybrid array and the as-prepared microarray modified electrode will be a promising paradigm in constructing highly sensitive and selective biosensors. Electronic supplementary information (ESI) available: Four-probe method for determining the conductivity of the hybrid crystal (Fig. S1); stability comparisons of the hybrid films (Fig. S2); FESEM images of the hybrid microarray (Fig. S3); electrochemical characterizations of the hybrid films (Fig. S4); DFT simulations (Fig. S5); cross-sectional FESEM image of the hybrid microarray (Fig. S6); regeneration and stability tests of the DNA biosensor (Fig. S7). See DOI: 10.1039/c3nr03097k

GermOnline 4.0 is a genomics gateway for germline development, meiosis and the mitotic cell cycle.

PubMed

Lardenois, Aurélie; Gattiker, Alexandre; Collin, Olivier; Chalmel, Frédéric; Primig, Michael

2010-01-01

GermOnline 4.0 is a cross-species database portal focusing on high-throughput expression data relevant for germline development, the meiotic cell cycle and mitosis in healthy versus malignant cells. It is thus a source of information for life scientists as well as clinicians who are interested in gene expression and regulatory networks. The GermOnline gateway provides unlimited access to information produced with high-density oligonucleotide microarrays (3'-UTR GeneChips), genome-wide protein-DNA binding assays and protein-protein interaction studies in the context of Ensembl genome annotation. Samples used to produce high-throughput expression data and to carry out genome-wide in vivo DNA binding assays are annotated via the MIAME-compliant Multiomics Information Management and Annotation System (MIMAS 3.0). Furthermore, the Saccharomyces Genomics Viewer (SGV) was developed and integrated into the gateway. SGV is a visualization tool that outputs genome annotation and DNA-strand specific expression data produced with high-density oligonucleotide tiling microarrays (Sc_tlg GeneChips) which cover the complete budding yeast genome on both DNA strands. It facilitates the interpretation of expression levels and transcript structures determined for various cell types cultured under different growth and differentiation conditions. Database URL: www.germonline.org/

GermOnline 4.0 is a genomics gateway for germline development, meiosis and the mitotic cell cycle

PubMed Central

Lardenois, Aurélie; Gattiker, Alexandre; Collin, Olivier; Chalmel, Frédéric; Primig, Michael

2010-01-01

GermOnline 4.0 is a cross-species database portal focusing on high-throughput expression data relevant for germline development, the meiotic cell cycle and mitosis in healthy versus malignant cells. It is thus a source of information for life scientists as well as clinicians who are interested in gene expression and regulatory networks. The GermOnline gateway provides unlimited access to information produced with high-density oligonucleotide microarrays (3′-UTR GeneChips), genome-wide protein–DNA binding assays and protein–protein interaction studies in the context of Ensembl genome annotation. Samples used to produce high-throughput expression data and to carry out genome-wide in vivo DNA binding assays are annotated via the MIAME-compliant Multiomics Information Management and Annotation System (MIMAS 3.0). Furthermore, the Saccharomyces Genomics Viewer (SGV) was developed and integrated into the gateway. SGV is a visualization tool that outputs genome annotation and DNA-strand specific expression data produced with high-density oligonucleotide tiling microarrays (Sc_tlg GeneChips) which cover the complete budding yeast genome on both DNA strands. It facilitates the interpretation of expression levels and transcript structures determined for various cell types cultured under different growth and differentiation conditions. Database URL: www.germonline.org/ PMID:21149299

Gene expression profile of blood cells for the prediction of delayed cerebral ischemia after intracranial aneurysm rupture: a pilot study in humans.

PubMed

Baumann, Antoine; Devaux, Yvan; Audibert, Gérard; Zhang, Lu; Bracard, Serge; Colnat-Coulbois, Sophie; Klein, Olivier; Zannad, Faiez; Charpentier, Claire; Longrois, Dan; Mertes, Paul-Michel

2013-01-01

Delayed cerebral ischemia (DCI) is a potentially devastating complication after intracranial aneurysm rupture and its mechanisms remain poorly elucidated. Early identification of the patients prone to developing DCI after rupture may represent a major breakthrough in its prevention and treatment. The single gene approach of DCI has demonstrated interest in humans. We hypothesized that whole genome expression profile of blood cells may be useful for better comprehension and prediction of aneurysmal DCI. Over a 35-month period, 218 patients with aneurysm rupture were included in this study. DCI was defined as the occurrence of a new delayed neurological deficit occurring within 2 weeks after aneurysm rupture with evidence of ischemia either on perfusion-diffusion MRI, CT angiography or CT perfusion imaging, or with cerebral angiography. DCI patients were matched against controls based on 4 out of 5 criteria (age, sex, Fisher grade, aneurysm location and smoking status). Genome-wide expression analysis of blood cells obtained at admission was performed by microarrays. Transcriptomic analysis was performed using long oligonucleotide microarrays representing 25,000 genes. Quantitative PCR: 1 µg of total RNA extracted was reverse-transcribed, and the resulting cDNA was diluted 10-fold before performing quantitative PCR. Microarray data were first analyzed by 'Significance Analysis of Microarrays' software which includes the Benjamini correction for multiple testing. In a second step, microarray data fold change was compared using a two-tailed, paired t test. Analysis of receiver-operating characteristic (ROC) curves and the area under the ROC curves were used for prediction analysis. Logistic regression models were used to investigate the additive value of multiple biomarkers. A total of 16 patients demonstrated DCI. Significance Analysis of Microarrays software failed to retrieve significant genes, most probably because of the heterogeneity of the patients included in the microarray experiments and the small size of the DCI population sample. Standard two-tailed paired t test and C-statistic revealed significant associations between gene expression and the occurrence of DCI: in particular, the expression of neuroregulin 1 was 1.6-fold upregulated in patients with DCI (p = 0.01) and predicted DCI with an area under the ROC curve of 0.96. Logistic regression analyses revealed a significant association between neuroregulin 1 and DCI (odds ratio 1.46, 95% confidence interval 1.02-2.09, p = 0.02). This pilot study suggests that blood cells may be a reservoir of prognostic biomarkers of DCI in patients with intracranial aneurysm rupture. Despite an evident lack of power, this study elicited neuroregulin 1, a vasoreactivity-, inflammation- and angiogenesis-related gene, as a possible candidate predictor of DCI. Larger cohort studies are needed but genome-wide microarray-based studies are promising research tools for the understanding of DCI after intracranial aneurysm rupture. © 2013 S. Karger AG, Basel.

Oligonucleotide DNA microarray profiling of lung adenocarcinoma revealed significant downregulation and deletions of vasoactive intestinal peptide receptor 1.

PubMed

Mlakar, Vid; Strazisar, Mojca; Sok, Mihael; Glavac, Damjan

2010-06-01

The purpose of this study was to find novel gene(s) involved in the development of lung adenocarcinoma (AD). Using DNA microarrays, we identified 31 up-regulated and 8 downregulated genes in 12 AD. Real time PCR was used to measure expression of VIPR1 and SPP1 mRNA and possible losses or gains of genes in 32 AD. We describe significant upregulation of the SPP1 gene, downregulation of VIPR1, and losses of the VIPR1 gene. Our findings complement a proposed VIPR1 tumor suppressor role, in which deletions in the 3p22 chromosome region are an important mechanism leading to loss of the VIPR1 gene.

A general framework for optimization of probes for gene expression microarray and its application to the fungus Podospora anserina

PubMed Central

2010-01-01

Background The development of new microarray technologies makes custom long oligonucleotide arrays affordable for many experimental applications, notably gene expression analyses. Reliable results depend on probe design quality and selection. Probe design strategy should cope with the limited accuracy of de novo gene prediction programs, and annotation up-dating. We present a novel in silico procedure which addresses these issues and includes experimental screening, as an empirical approach is the best strategy to identify optimal probes in the in silico outcome. Findings We used four criteria for in silico probe selection: cross-hybridization, hairpin stability, probe location relative to coding sequence end and intron position. This latter criterion is critical when exon-intron gene structure predictions for intron-rich genes are inaccurate. For each coding sequence (CDS), we selected a sub-set of four probes. These probes were included in a test microarray, which was used to evaluate the hybridization behavior of each probe. The best probe for each CDS was selected according to three experimental criteria: signal-to-noise ratio, signal reproducibility, and representative signal intensities. This procedure was applied for the development of a gene expression Agilent platform for the filamentous fungus Podospora anserina and the selection of a single 60-mer probe for each of the 10,556 P. anserina CDS. Conclusions A reliable gene expression microarray version based on the Agilent 44K platform was developed with four spot replicates of each probe to increase statistical significance of analysis. PMID:20565839

Profiling cellular protein complexes by proximity ligation with dual tag microarray readout.

PubMed

Hammond, Maria; Nong, Rachel Yuan; Ericsson, Olle; Pardali, Katerina; Landegren, Ulf

2012-01-01

Patterns of protein interactions provide important insights in basic biology, and their analysis plays an increasing role in drug development and diagnostics of disease. We have established a scalable technique to compare two biological samples for the levels of all pairwise interactions among a set of targeted protein molecules. The technique is a combination of the proximity ligation assay with readout via dual tag microarrays. In the proximity ligation assay protein identities are encoded as DNA sequences by attaching DNA oligonucleotides to antibodies directed against the proteins of interest. Upon binding by pairs of antibodies to proteins present in the same molecular complexes, ligation reactions give rise to reporter DNA molecules that contain the combined sequence information from the two DNA strands. The ligation reactions also serve to incorporate a sample barcode in the reporter molecules to allow for direct comparison between pairs of samples. The samples are evaluated using a dual tag microarray where information is decoded, revealing which pairs of tags that have become joined. As a proof-of-concept we demonstrate that this approach can be used to detect a set of five proteins and their pairwise interactions both in cellular lysates and in fixed tissue culture cells. This paper provides a general strategy to analyze the extent of any pairwise interactions in large sets of molecules by decoding reporter DNA strands that identify the interacting molecules.

Automation of complex assays: pharmacogenetics of warfarin dosing.

PubMed

Wu, Whei-Kuo; Hujsak, Paul G; Kureshy, Fareed

2007-10-01

AutoGenomics, Inc. (Carlsbad, CA, USA) have developed a multiplex microarray assay for genotyping both VKORC1 and CYP2C9 using the INFINITI(™) Analyzer. Multiple alleles in each DNA sample are analyzed by polymerase chain reaction amplification, followed by detection primer extension using the INFINITI Analyzer. The INFINITI Analyzer performs single-nucleotide polymorphism (SNP) analysis using universal oligonucleotides immobilized on the biochip. To genotype broader ethnic groups, genomic DNA from whole blood was tested for nine SNPs for VKORC1 and six for CYP2C9 genotypes. Information related to all 15 SNPs is needed to determine dosing of population of diverse ethnic origin. The INFINITI system provides genotyping information for same day dosing of warfarin.

High density DNA loading on the M13 bacteriophage provides access to colorimetric and fluorescent protein microarray biosensors.

PubMed

Domaille, Dylan W; Lee, Ju Hun; Cha, Jennifer N

2013-02-28

We report the synthesis, characterization, and protein sensing capabilities of M13 bacteriophage-DNA bioconjugates. DNA oligonucleotides were conjugated to M13 through acyl hydrazone linkages. In one case, DNAzymes retained their catalytic ability when anchored to the virus coat, and in a separate study, the dynamic nature of the hydrazone allowed for liberation of DNA from the phage under mild conditions.

Gene expression profiling of human mesenchymal stem cells derived from bone marrow during expansion and osteoblast differentiation.

PubMed

Kulterer, Birgit; Friedl, Gerald; Jandrositz, Anita; Sanchez-Cabo, Fatima; Prokesch, Andreas; Paar, Christine; Scheideler, Marcel; Windhager, Reinhard; Preisegger, Karl-Heinz; Trajanoski, Zlatko

2007-03-12

Human mesenchymal stem cells (MSC) with the capacity to differentiate into osteoblasts provide potential for the development of novel treatment strategies, such as improved healing of large bone defects. However, their low frequency in bone marrow necessitate ex vivo expansion for further clinical application. In this study we asked if MSC are developing in an aberrant or unwanted way during ex vivo long-term cultivation and if artificial cultivation conditions exert any influence on their stem cell maintenance. To address this question we first developed human oligonucleotide microarrays with 30.000 elements and then performed large-scale expression profiling of long-term expanded MSC and MSC during differentiation into osteoblasts. The results showed that MSC did not alter their osteogenic differentiation capacity, surface marker profile, and the expression profiles of MSC during expansion. Microarray analysis of MSC during osteogenic differentiation identified three candidate genes for further examination and functional analysis: ID4, CRYAB, and SORT1. Additionally, we were able to reconstruct the three developmental phases during osteoblast differentiation: proliferation, matrix maturation, and mineralization, and illustrate the activation of the SMAD signaling pathways by TGF-beta2 and BMPs. With a variety of assays we could show that MSC represent a cell population which can be expanded for therapeutic applications.

A new normalizing algorithm for BAC CGH arrays with quality control metrics.

PubMed

Miecznikowski, Jeffrey C; Gaile, Daniel P; Liu, Song; Shepherd, Lori; Nowak, Norma

2011-01-01

The main focus in pin-tip (or print-tip) microarray analysis is determining which probes, genes, or oligonucleotides are differentially expressed. Specifically in array comparative genomic hybridization (aCGH) experiments, researchers search for chromosomal imbalances in the genome. To model this data, scientists apply statistical methods to the structure of the experiment and assume that the data consist of the signal plus random noise. In this paper we propose "SmoothArray", a new method to preprocess comparative genomic hybridization (CGH) bacterial artificial chromosome (BAC) arrays and we show the effects on a cancer dataset. As part of our R software package "aCGHplus," this freely available algorithm removes the variation due to the intensity effects, pin/print-tip, the spatial location on the microarray chip, and the relative location from the well plate. removal of this variation improves the downstream analysis and subsequent inferences made on the data. Further, we present measures to evaluate the quality of the dataset according to the arrayer pins, 384-well plates, plate rows, and plate columns. We compare our method against competing methods using several metrics to measure the biological signal. With this novel normalization algorithm and quality control measures, the user can improve their inferences on datasets and pinpoint problems that may arise in their BAC aCGH technology.

Visualizing Microbial Biogeochemistry: NanoSIMS and Stable Isotope Probing (Invited)

NASA Astrophysics Data System (ADS)

Pett-Ridge, J.; Weber, P. K.

2009-12-01

Linking phylogenetic information to function in microbial communities is a key challenge for microbial ecology. Isotope-labeling experiments provide a useful means to investigate the ecophysiology of microbial populations and cells in the environment and allow measurement of nutrient transfers between cell types, symbionts and consortia. The combination of Nano-Secondary Ion Mass Spectrometry (NanoSIMS) analysis, in situ labeling and high resolution microscopy allows isotopic analysis to be linked to phylogeny and morphology and holds great promise for fine-scale studies of microbial systems. In NanoSIMS analysis, samples are sputtered with an energetic primary beam (Cs+, O-) liberating secondary ions that are separated by the mass spectrometer and detected in a suite of electron multipliers. Five isotopic species may be analyzed concurrently with spatial resolution as fine as 50nm. A high sensitivity isotope ratio ‘map’ can then be generated for the analyzed area. NanoSIMS images of 13C, 15N and Mo (a nitrogenase co-factor) localization in diazotrophic cyanobacteria show how cells differentially allocate resources within filaments and allow calculation of nutrient uptake rates on a cell by cell basis. Images of AM fungal hyphae-root and cyanobacteria-rhizobia associations indicate the mobilization and sharing (stealing?) of newly fixed C and N. In a related technique, “El-FISH”, stable isotope labeled biomass is probed with oligonucleotide-elemental labels and then imaged by NanoSIMS. In microbial consortia and cyanobacterial mats, this technique helps link microbial structure and function simultaneously even in systems with unknown and uncultivated microbes. Finally, the combination of re-engineered universal 16S oligonucleotide microarrays with NanoSIMS analyses may allow microbial identity to be linked to functional roles in complex systems such as mats and cellulose degrading hindgut communities. These newly developed methods provide correlated oligonucleotide, functional enzyme and metabolic image data and should help unravel the metabolic processes of complex microbial communities in soils, biofilms and aquatic systems.

Genes Responsive to Low-Intensity Pulsed Ultrasound in MC3T3-E1 Preosteoblast Cells

PubMed Central

Tabuchi, Yoshiaki; Sugahara, Yuuki; Ikegame, Mika; Suzuki, Nobuo; Kitamura, Kei-ichiro; Kondo, Takashi

2013-01-01

Although low-intensity pulsed ultrasound (LIPUS) has been shown to enhance bone fracture healing, the underlying mechanism of LIPUS remains to be fully elucidated. Here, to better understand the molecular mechanism underlying cellular responses to LIPUS, we investigated gene expression profiles in mouse MC3T3-E1 preosteoblast cells exposed to LIPUS using high-density oligonucleotide microarrays and computational gene expression analysis tools. Although treatment of the cells with a single 20-min LIPUS (1.5 MHz, 30 mW/cm2) did not affect the cell growth or alkaline phosphatase activity, the treatment significantly increased the mRNA level of Bglap. Microarray analysis demonstrated that 38 genes were upregulated and 37 genes were downregulated by 1.5-fold or more in the cells at 24-h post-treatment. Ingenuity pathway analysis demonstrated that the gene network U (up) contained many upregulated genes that were mainly associated with bone morphology in the category of biological functions of skeletal and muscular system development and function. Moreover, the biological function of the gene network D (down), which contained downregulated genes, was associated with gene expression, the cell cycle and connective tissue development and function. These results should help to further clarify the molecular basis of the mechanisms of the LIPUS response in osteoblast cells. PMID:24252911

Methoxychlor affects multiple hormone signaling pathways in the largemouth bass (Micropterus salmoides) liver

PubMed Central

Martyniuk, Christopher J.; Spade, Daniel J.; Blum, Jason L.; Kroll, Kevin J.; Denslow, Nancy D.

2011-01-01

Methoxychlor (MXC) is an organochlorine pesticide that has been shown to have estrogenic activity by activating estrogen receptors and inducing vitellogenin production in male fish. Previous studies report that exposure to MXC induces changes in mRNA abundance of reproductive genes in the liver and testes of largemouth bass (Micropterus salmoides). The objective of the present study was to better characterize the mode of action of MXC by measuring the global transcriptomic response in the male largemouth liver using an oligonucleotide microarray. Microarray analysis identified highly significant changes in the expression of 37 transcripts (p<0.001) (20 induced and 17 decreased) in the liver after MXC injection and a total of 900 expression changes (p<0.05) in transcripts with high homology to known genes. Largemouth bass estrogen receptor alpha (esr1) and androgen receptor (ar) were among the transcripts that were increased in the liver after MXC treatment. Functional enrichment analysis identified the molecular functions of steroid binding and androgen receptor activity as well as steroid hormone receptor activity as being significantly over-represented gene ontology terms. Pathway analysis identified c-fos signaling as being putatively affected through both estrogen and androgen signaling. This study provides evidence that MXC elicits transcriptional effects through the estrogen receptor as well as androgen receptor-mediated pathways in the liver. PMID:21276474

Engineering Improvements in a Bacterial Therapeutic Delivery System for Breast Cancer

DTIC Science & Technology

2009-09-01

curve is observed on the other platform (Supplementary Figure 2H). Although it is not the object of this article to explore a physical explanation for...light-directed oligonucleotide microarrays using a digital micromirror array.. Nat Biotechnol, 17(10), 974–978. [12] Matveeva, O. V., Shabalina, S. A...Rouillard, J. M., Whittam, T. S., Gulari, E., Tiedje, J. M., and Hashsham, S. A. (2006) On- chip non-equilibrium dissociation curves and dissociation

Multiple primer extension by DNA polymerase on a novel plastic DNA array coated with a biocompatible polymer

PubMed Central

Kinoshita, Kenji; Fujimoto, Kentaro; Yakabe, Toru; Saito, Shin; Hamaguchi, Yuzo; Kikuchi, Takayuki; Nonaka, Ken; Murata, Shigenori; Masuda, Daisuke; Takada, Wataru; Funaoka, Sohei; Arai, Susumu; Nakanishi, Hisao; Yokoyama, Kanehisa; Fujiwara, Kazuhiko; Matsubara, Kenichi

2007-01-01

DNA microarrays are routinely used to monitor gene expression profiling and single nucleotide polymorphisms (SNPs). However, for practically useful high performance, the detection sensitivity is still not adequate, leaving low expression genes undetected. To resolve this issue, we have developed a new plastic S-BIO® PrimeSurface® with a biocompatible polymer; its surface chemistry offers an extraordinarily stable thermal property for a lack of pre-activated glass slide surface. The oligonucleotides immobilized on this substrate are robust in boiling water and show no significant loss of hybridization activity during dissociation treatment. This allowed us to hybridize the templates, extend the 3′ end of the immobilized DNA primers on the S-Bio® by DNA polymerase using deoxynucleotidyl triphosphates (dNTP) as extender units, release the templates by denaturalization and use the same templates for a second round of reactions similar to that of the PCR method. By repeating this cycle, the picomolar concentration range of the template oligonucleotide can be detected as stable signals via the incorporation of labeled dUTP into primers. This method of Multiple Primer EXtension (MPEX) could be further extended as an alternative route for producing DNA microarrays for SNP analyses via simple template preparation such as reverse transcript cDNA or restriction enzyme treatment of genome DNA. PMID:17135189

Genome-wide transcriptional analysis of flagellar regeneration in Chlamydomonas reinhardtii identifies orthologs of ciliary disease genes

NASA Technical Reports Server (NTRS)

Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Marshall, Wallace F.

2005-01-01

The important role that cilia and flagella play in human disease creates an urgent need to identify genes involved in ciliary assembly and function. The strong and specific induction of flagellar-coding genes during flagellar regeneration in Chlamydomonas reinhardtii suggests that transcriptional profiling of such cells would reveal new flagella-related genes. We have conducted a genome-wide analysis of RNA transcript levels during flagellar regeneration in Chlamydomonas by using maskless photolithography method-produced DNA oligonucleotide microarrays with unique probe sequences for all exons of the 19,803 predicted genes. This analysis represents previously uncharacterized whole-genome transcriptional activity profiling study in this important model organism. Analysis of strongly induced genes reveals a large set of known flagellar components and also identifies a number of important disease-related proteins as being involved with cilia and flagella, including the zebrafish polycystic kidney genes Qilin, Reptin, and Pontin, as well as the testis-expressed tubby-like protein TULP2.

Heterologous oligonucleotide microarrays for transcriptomics in a non-model species; a proof-of-concept study of drought stress in Musa

PubMed Central

Davey, Mark W; Graham, Neil S; Vanholme, Bartel; Swennen, Rony; May, Sean T; Keulemans, Johan

2009-01-01

Background 'Systems-wide' approaches such as microarray RNA-profiling are ideally suited to the study of the complex overlapping responses of plants to biotic and abiotic stresses. However, commercial microarrays are only available for a limited number of plant species and development costs are so substantial as to be prohibitive for most research groups. Here we evaluate the use of cross-hybridisation to Affymetrix oligonucleotide GeneChip® microarrays to profile the response of the banana (Musa spp.) leaf transcriptome to drought stress using a genomic DNA (gDNA)-based probe-selection strategy to improve the efficiency of detection of differentially expressed Musa transcripts. Results Following cross-hybridisation of Musa gDNA to the Rice GeneChip® Genome Array, ~33,700 gene-specific probe-sets had a sufficiently high degree of homology to be retained for transcriptomic analyses. In a proof-of-concept approach, pooled RNA representing a single biological replicate of control and drought stressed leaves of the Musa cultivar 'Cachaco' were hybridised to the Affymetrix Rice Genome Array. A total of 2,910 Musa gene homologues with a >2-fold difference in expression levels were subsequently identified. These drought-responsive transcripts included many functional classes associated with plant biotic and abiotic stress responses, as well as a range of regulatory genes known to be involved in coordinating abiotic stress responses. This latter group included members of the ERF, DREB, MYB, bZIP and bHLH transcription factor families. Fifty-two of these drought-sensitive Musa transcripts were homologous to genes underlying QTLs for drought and cold tolerance in rice, including in 2 instances QTLs associated with a single underlying gene. The list of drought-responsive transcripts also included genes identified in publicly-available comparative transcriptomics experiments. Conclusion Our results demonstrate that despite the general paucity of nucleotide sequence data in Musa and only distant phylogenetic relations to rice, gDNA probe-based cross-hybridisation to the Rice GeneChip® is a highly promising strategy to study complex biological responses and illustrates the potential of such strategies for gene discovery in non-model species. PMID:19758430

Assessing differential gene expression with small sample sizes in oligonucleotide arrays using a mean-variance model.

PubMed

Hu, Jianhua; Wright, Fred A

2007-03-01

The identification of the genes that are differentially expressed in two-sample microarray experiments remains a difficult problem when the number of arrays is very small. We discuss the implications of using ordinary t-statistics and examine other commonly used variants. For oligonucleotide arrays with multiple probes per gene, we introduce a simple model relating the mean and variance of expression, possibly with gene-specific random effects. Parameter estimates from the model have natural shrinkage properties that guard against inappropriately small variance estimates, and the model is used to obtain a differential expression statistic. A limiting value to the positive false discovery rate (pFDR) for ordinary t-tests provides motivation for our use of the data structure to improve variance estimates. Our approach performs well compared to other proposed approaches in terms of the false discovery rate.

Chromosomal microarray in clinical diagnosis: a study of 337 patients with congenital anomalies and developmental delays or intellectual disability.

PubMed

Sansović, Ivona; Ivankov, Ana-Maria; Bobinec, Adriana; Kero, Mijana; Barišić, Ingeborg

2017-06-14

To determine the diagnostic yield and criteria that could help to classify and interpret the copy number variations (CNVs) detected by chromosomal microarray (CMA) technique in patients with congenital and developmental abnormalities including dysmorphia, developmental delay (DD) or intellectual disability (ID), autism spectrum disorders (ASD) and congenital anomalies (CA). CMA analysis was performed in 337 patients with DD/ID with or without dysmorphism, ASD, and/or CA. In 30 of 337 patients, chromosomal imbalances had previously been detected by classical cytogenetic and molecular cytogenetic methods. In 73 of 337 patients, clinically relevant variants were detected and better characterized. Most of them were >1 Mb. Variants of unknown clinical significance (VOUS) were discovered in 35 patients. The most common VOUS size category was <300 kb (40.5%). Deletions and de novo imbalances were more frequent in pathogenic CNV than in VOUS category. CMA had a high diagnostic yield of 43/307, excluding patients previously detected by other methods. CMA was valuable in establishing the diagnosis in a high proportion of patients. Criteria for classification and interpretation of CNVs include CNV size and type, mode of inheritance, and genotype-phenotype correlation. Agilent ISCA v2 Human Genome 8x60 K oligonucleotide microarray format proved to be reasonable resolution for clinical use, particularly in the regions that are recommended by the International Standard Cytogenomic Array (ISCA) Consortium and associated with well-established syndromes.

Correction of Spatial Bias in Oligonucleotide Array Data

PubMed Central

Lemieux, Sébastien

2013-01-01

Background. Oligonucleotide microarrays allow for high-throughput gene expression profiling assays. The technology relies on the fundamental assumption that observed hybridization signal intensities (HSIs) for each intended target, on average, correlate with their target's true concentration in the sample. However, systematic, nonbiological variation from several sources undermines this hypothesis. Background hybridization signal has been previously identified as one such important source, one manifestation of which appears in the form of spatial autocorrelation. Results. We propose an algorithm, pyn, for the elimination of spatial autocorrelation in HSIs, exploiting the duality of desirable mutual information shared by probes in a common probe set and undesirable mutual information shared by spatially proximate probes. We show that this correction procedure reduces spatial autocorrelation in HSIs; increases HSI reproducibility across replicate arrays; increases differentially expressed gene detection power; and performs better than previously published methods. Conclusions. The proposed algorithm increases both precision and accuracy, while requiring virtually no changes to users' current analysis pipelines: the correction consists merely of a transformation of raw HSIs (e.g., CEL files for Affymetrix arrays). A free, open-source implementation is provided as an R package, compatible with standard Bioconductor tools. The approach may also be tailored to other platform types and other sources of bias. PMID:23573083

Androgen Metabolism in Progression to Androgen-Independent Prostate Cancer

DTIC Science & Technology

2009-06-01

transcripts (TMPRSS2 exon 2-ERG exon 4) in 11 of 29 cases. Affymetrix oligonucleotide microarray data on these tumors versus a group of 27...medium were treated with DHT and immunoblotted. B, RT-PCR for ERG ( exon 9/10), TMPRSS2 ( exon 5/6), and PSA mRNA after DHT stimulation. C, cells in...therapeutic index CYP3A4 substrates were excluded. The treatment was ketoconazole 400 mg po TID, hydrocortisone (30 mg in AM and 10 mg in PM) and

Altered gene expression in the brain and ovaries of zebrafish (Danio rerio) exposed to the aromatase inhibitor fadrozole: microarray analysis and hypothesis generation.

PubMed

Villeneuve, L; Wang, Rong-Lin; Bencic, David C; Biales, Adam D; Martinović, Dalma; Lazorchak, James M; Toth, Gregory; Ankley, Gerald T

2009-08-01

As part of a research effort examining system-wide responses of the hypothalamic-pituitary-gonadal (HPG) axis in fish to endocrine-active chemicals (EACs) with different modes of action, zebrafish (Danio rerio) were exposed to 25 or 100 microg/L of the aromatase inhibitor fadrozole for 24, 48, or 96 h. Global transcriptional response in brain and ovarian tissue of fish exposed to 25 microg/L of fadrozole was compared to that in control fish using a commercially available, 22,000-gene oligonucleotide microarray. Transcripts altered in brain were functionally linked to differentiation, development, DNA replication, and cell cycle. Additionally, multiple genes associated with the one-carbon pool by folate pathway (KEGG 00670) were significantly up-regulated. Transcripts altered in ovary were functionally linked to cell-cell adhesion, extracellular matrix, vasculogenesis, and development. Promoter motif analysis identified GATA-binding factor 2, Ikaros 2, alcohol dehydrogenase gene regulator 1, myoblast-determining factor, and several heat shock factors as being associated with coexpressed gene clusters that were differentially expressed following exposure to fadrozole. Based on the transcriptional changes observed, it was hypothesized that fadrozole elicits neurodegenerative stress in brain tissue and that fish cope with this stress through proliferation of radial glial cells. Additionally, it was hypothesized that changes of gene expression in the ovary of fadrozole-exposed zebrafish reflect disruption of oocyte maturation and ovulation because of impaired vitellogenesis. These hypotheses and others derived from the microarray results provide a foundation for future studies aimed at understanding responses of the HPG axis to EACs and other chemical stressors.

UniPROBE, update 2011: expanded content and search tools in the online database of protein-binding microarray data on protein-DNA interactions.

PubMed

Robasky, Kimberly; Bulyk, Martha L

2011-01-01

The Universal PBM Resource for Oligonucleotide-Binding Evaluation (UniPROBE) database is a centralized repository of information on the DNA-binding preferences of proteins as determined by universal protein-binding microarray (PBM) technology. Each entry for a protein (or protein complex) in UniPROBE provides the quantitative preferences for all possible nucleotide sequence variants ('words') of length k ('k-mers'), as well as position weight matrix (PWM) and graphical sequence logo representations of the k-mer data. In this update, we describe >130% expansion of the database content, incorporation of a protein BLAST (blastp) tool for finding protein sequence matches in UniPROBE, the introduction of UniPROBE accession numbers and additional database enhancements. The UniPROBE database is available at http://uniprobe.org.

DNA Microarray for Detection of Macrolide Resistance Genes

PubMed Central

Cassone, Marco; D'Andrea, Marco M.; Iannelli, Francesco; Oggioni, Marco R.; Rossolini, Gian Maria; Pozzi, Gianni

2006-01-01

A DNA microarray was developed to detect bacterial genes conferring resistance to macrolides and related antibiotics. A database containing 65 nonredundant genes selected from publicly available DNA sequences was constructed and used to design 100 oligonucleotide probes that could specifically detect and discriminate all 65 genes. Probes were spotted on a glass slide, and the array was reacted with DNA templates extracted from 20 reference strains of eight different bacterial species (Streptococcus pneumoniae, Streptococcus pyogenes, Enterococcus faecalis, Enterococcus faecium, Staphylococcus aureus, Staphylococcus haemolyticus, Escherichia coli, and Bacteroides fragilis) known to harbor 29 different macrolide resistance genes. Hybridization results showed that probes reacted with, and only with, the expected DNA templates and allowed discovery of three unexpected genes, including msr(SA) in B. fragilis, an efflux gene that has not yet been described for gram-negative bacteria. PMID:16723563

Microarray-based gene expression profiling to elucidate effectiveness of fermented Codonopsis lanceolata in mice.

PubMed

Choi, Woon Yong; Kim, Ji Seon; Park, Sung Jin; Ma, Choong Je; Lee, Hyeon Yong

2014-04-08

In this study, the effect of Codonopsis lanceolata fermented by lactic acid on controlling gene expression levels related to obesity was observed in an oligonucleotide chip microarray. Among 8170 genes, 393 genes were up regulated and 760 genes were down regulated in feeding the fermented C. lanceolata (FCL). Another 374 genes were up regulated and 527 genes down regulated without feeding the sample. The genes were not affected by the FCL sample. It was interesting that among those genes, Chytochrome P450, Dmbt1, LOC76487, and thyroid hormones, etc., were mostly up or down regulated. These genes are more related to lipid synthesis. We could conclude that the FCL possibly controlled the gene expression levels related to lipid synthesis, which resulted in reducing obesity. However, more detailed protein expression experiments should be carried out.

GeoChip 3.0: A High Throughput Tool for Analyzing Microbial Community, Composition, Structure, and Functional Activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Zhili; Deng, Ye; Nostrand, Joy Van

2010-05-17

Microarray-based genomic technology has been widely used for microbial community analysis, and it is expected that microarray-based genomic technologies will revolutionize the analysis of microbial community structure, function and dynamics. A new generation of functional gene arrays (GeoChip 3.0) has been developed, with 27,812 probes covering 56,990 gene variants from 292 functional gene families involved in carbon, nitrogen, phosphorus and sulfur cycles, energy metabolism, antibiotic resistance, metal resistance, and organic contaminant degradation. Those probes were derived from 2,744, 140, and 262 species for bacteria, archaea, and fungi, respectively. GeoChip 3.0 has several other distinct features, such as a common oligomore » reference standard (CORS) for data normalization and comparison, a software package for data management and future updating, and the gyrB gene for phylogenetic analysis. Our computational evaluation of probe specificity indicated that all designed probes had a high specificity to their corresponding targets. Also, experimental analysis with synthesized oligonucleotides and genomic DNAs showed that only 0.0036percent-0.025percent false positive rates were observed, suggesting that the designed probes are highly specific under the experimental conditions examined. In addition, GeoChip 3.0 was applied to analyze soil microbial communities in a multifactor grassland ecosystem in Minnesota, USA, which demonstrated that the structure, composition, and potential activity of soil microbial communities significantly changed with the plant species diversity. All results indicate that GeoChip 3.0 is a high throughput powerful tool for studying microbial community functional structure, and linking microbial communities to ecosystem processes and functioning. To our knowledge, GeoChip 3.0 is the most comprehensive microarrays currently available for studying microbial communities associated with geobiochemical cycling, global climate change, bioenergy, agricuture, land use, ecosystem management, environmental cleanup and restoration, bioreactor systems, and human health.« less

The GermOnline cross-species systems browser provides comprehensive information on genes and gene products relevant for sexual reproduction.

PubMed

Gattiker, Alexandre; Niederhauser-Wiederkehr, Christa; Moore, James; Hermida, Leandro; Primig, Michael

2007-01-01

We report a novel release of the GermOnline knowledgebase covering genes relevant for the cell cycle, gametogenesis and fertility. GermOnline was extended into a cross-species systems browser including information on DNA sequence annotation, gene expression and the function of gene products. The database covers eight model organisms and Homo sapiens, for which complete genome annotation data are available. The database is now built around a sophisticated genome browser (Ensembl), our own microarray information management and annotation system (MIMAS) used to extensively describe experimental data obtained with high-density oligonucleotide microarrays (GeneChips) and a comprehensive system for online editing of database entries (MediaWiki). The RNA data include results from classical microarrays as well as tiling arrays that yield information on RNA expression levels, transcript start sites and lengths as well as exon composition. Members of the research community are solicited to help GermOnline curators keep database entries on genes and gene products complete and accurate. The database is accessible at http://www.germonline.org/.

A low density microarray method for the identification of human papillomavirus type 18 variants.

PubMed

Meza-Menchaca, Thuluz; Williams, John; Rodríguez-Estrada, Rocío B; García-Bravo, Aracely; Ramos-Ligonio, Ángel; López-Monteon, Aracely; Zepeda, Rossana C

2013-09-26

We describe a novel microarray based-method for the screening of oncogenic human papillomavirus 18 (HPV-18) molecular variants. Due to the fact that sequencing methodology may underestimate samples containing more than one variant we designed a specific and sensitive stacking DNA hybridization assay. This technology can be used to discriminate between three possible phylogenetic branches of HPV-18. Probes were attached covalently on glass slides and hybridized with single-stranded DNA targets. Prior to hybridization with the probes, the target strands were pre-annealed with the three auxiliary contiguous oligonucleotides flanking the target sequences. Screening HPV-18 positive cell lines and cervical samples were used to evaluate the performance of this HPV DNA microarray. Our results demonstrate that the HPV-18's variants hybridized specifically to probes, with no detection of unspecific signals. Specific probes successfully reveal detectable point mutations in these variants. The present DNA oligoarray system can be used as a reliable, sensitive and specific method for HPV-18 variant screening. Furthermore, this simple assay allows the use of inexpensive equipment, making it accessible in resource-poor settings.

A Low Density Microarray Method for the Identification of Human Papillomavirus Type 18 Variants

PubMed Central

Meza-Menchaca, Thuluz; Williams, John; Rodríguez-Estrada, Rocío B.; García-Bravo, Aracely; Ramos-Ligonio, Ángel; López-Monteon, Aracely; Zepeda, Rossana C.

2013-01-01

We describe a novel microarray based-method for the screening of oncogenic human papillomavirus 18 (HPV-18) molecular variants. Due to the fact that sequencing methodology may underestimate samples containing more than one variant we designed a specific and sensitive stacking DNA hybridization assay. This technology can be used to discriminate between three possible phylogenetic branches of HPV-18. Probes were attached covalently on glass slides and hybridized with single-stranded DNA targets. Prior to hybridization with the probes, the target strands were pre-annealed with the three auxiliary contiguous oligonucleotides flanking the target sequences. Screening HPV-18 positive cell lines and cervical samples were used to evaluate the performance of this HPV DNA microarray. Our results demonstrate that the HPV-18's variants hybridized specifically to probes, with no detection of unspecific signals. Specific probes successfully reveal detectable point mutations in these variants. The present DNA oligoarray system can be used as a reliable, sensitive and specific method for HPV-18 variant screening. Furthermore, this simple assay allows the use of inexpensive equipment, making it accessible in resource-poor settings. PMID:24077317

Altered gene expression in conjunctival squamous cell carcinoma.

PubMed

Mahale, Alka; Alkatan, Hind; Alwadani, Saeed; Othman, Maha; Suarez, Maria J; Price, Antoinette; Al-Hussain, Hailah; Jastaneiah, Sabah; Yu, Wayne; Maktabi, Azza; Deepak, Edward P; Eberhart, Charles G; Asnaghi, Laura

2016-05-01

Conjunctival squamous cell carcinoma is a malignancy of the ocular surface. The molecular drivers responsible for the development and progression of this disease are not well understood. We therefore compared the transcriptional profiles of eight snap-frozen conjunctival squamous cell carcinomas and one in situ lesion with normal conjunctival specimens in order to identify diagnostic markers or therapeutic targets. RNA was analyzed using oligonucleotide microarrays, and a wide range of transcripts with altered expression identified, including many dysregulated in carcinomas arising at other sites. Among the upregulated genes, we observed more than 30-fold induction of the matrix metalloproteinases, MMP-9 and MMP-11, as well as a prominent increase in the mRNA level of a calcium-binding protein important for the intracellular calcium signaling, S100A2, which was induced over 20-fold in the tumor cohort. Clusterin was the most downregulated gene, with an approximately 180-fold reduction in the mRNA expression. These alterations were all confirmed by qPCR in the samples used for initial microarray analysis. In addition, immunohistochemical analysis confirmed the overexpression of MMP-11 and S100A2, as well as reductions in clusterin, in several independent in situ carcinomas of conjunctiva. These data identify a number of alterations, including upregulation of MMP-9, MMP-11, and S100A2, as well as downregulation of clusterin, associated with epithelial tumorigenesis in the ocular surface.

Functional characterization of MAT1-1-specific mating-type genes in the homothallic ascomycete Sordaria macrospora provides new insights into essential and nonessential sexual regulators.

PubMed

Klix, V; Nowrousian, M; Ringelberg, C; Loros, J J; Dunlap, J C; Pöggeler, S

2010-06-01

Mating-type genes in fungi encode regulators of mating and sexual development. Heterothallic ascomycete species require different sets of mating-type genes to control nonself-recognition and mating of compatible partners of different mating types. Homothallic (self-fertile) species also carry mating-type genes in their genome that are essential for sexual development. To analyze the molecular basis of homothallism and the role of mating-type genes during fruiting-body development, we deleted each of the three genes, SmtA-1 (MAT1-1-1), SmtA-2 (MAT1-1-2), and SmtA-3 (MAT1-1-3), contained in the MAT1-1 part of the mating-type locus of the homothallic ascomycete species Sordaria macrospora. Phenotypic analysis of deletion mutants revealed that the PPF domain protein-encoding gene SmtA-2 is essential for sexual reproduction, whereas the alpha domain protein-encoding genes SmtA-1 and SmtA-3 play no role in fruiting-body development. By means of cross-species microarray analysis using Neurospora crassa oligonucleotide microarrays hybridized with S. macrospora targets and quantitative real-time PCR, we identified genes expressed under the control of SmtA-1 and SmtA-2. Both genes are involved in the regulation of gene expression, including that of pheromone genes.

Functional Characterization of MAT1-1-Specific Mating-Type Genes in the Homothallic Ascomycete Sordaria macrospora Provides New Insights into Essential and Nonessential Sexual Regulators▿†

PubMed Central

Klix, V.; Nowrousian, M.; Ringelberg, C.; Loros, J. J.; Dunlap, J. C.; Pöggeler, S.

2010-01-01

Mating-type genes in fungi encode regulators of mating and sexual development. Heterothallic ascomycete species require different sets of mating-type genes to control nonself-recognition and mating of compatible partners of different mating types. Homothallic (self-fertile) species also carry mating-type genes in their genome that are essential for sexual development. To analyze the molecular basis of homothallism and the role of mating-type genes during fruiting-body development, we deleted each of the three genes, SmtA-1 (MAT1-1-1), SmtA-2 (MAT1-1-2), and SmtA-3 (MAT1-1-3), contained in the MAT1-1 part of the mating-type locus of the homothallic ascomycete species Sordaria macrospora. Phenotypic analysis of deletion mutants revealed that the PPF domain protein-encoding gene SmtA-2 is essential for sexual reproduction, whereas the α domain protein-encoding genes SmtA-1 and SmtA-3 play no role in fruiting-body development. By means of cross-species microarray analysis using Neurospora crassa oligonucleotide microarrays hybridized with S. macrospora targets and quantitative real-time PCR, we identified genes expressed under the control of SmtA-1 and SmtA-2. Both genes are involved in the regulation of gene expression, including that of pheromone genes. PMID:20435701

Rare genomic rearrangement in a boy with Williams-Beuren syndrome associated to XYY syndrome and intriguing behavior.

PubMed

Dutra, Roberta L; Piazzon, Flavia B; Zanardo, Évelin A; Costa, Thais Virginia Moura Machado; Montenegro, Marília M; Novo-Filho, Gil M; Dias, Alexandre T; Nascimento, Amom M; Kim, Chong Ae; Kulikowski, Leslie D

2015-12-01

Williams-Beuren syndrome (WBS) is caused by a hemizygous contiguous gene microdeletion of 1.55-1.84 Mb at 7q11.23 region. Approximately, 28 genes have been shown to contribute to classical phenotype of SWB with presence of dysmorphic facial features, supravalvular aortic stenosis (SVAS), intellectual disability, and overfriendliness. With the use of Microarray-based comparative genomic hybridization and other molecular cytogenetic techniques, is possible define with more accuracy partial or atypical deletion and refine the genotype-phenotype correlation. Here, we report on a rare genomic structural rearrangement in a boy with atypical deletion in 7q11.23 and XYY syndrome with characteristic clinical signs, but not sufficient for the diagnosis of WBS. Cytogenetic analysis of G-banding showed a karyotype 47,XYY. Analysis of DNA with the technique of MLPA (Multiplex Ligation-dependent Probe Amplification) using kits a combination of kits (P064, P036, P070, and P029) identified an atypical deletion on 7q11.23. In addition, high resolution SNP Oligonucleotide Microarray Analysis (SNP-array) confirmed the alterations found by MLPA and revealed others pathogenic CNVs, in the chromosomes 7 and X. The present report demonstrates an association not yet described in literature, between Williams-Beuren syndrome and 47,XYY. The identification of atypical deletion in 7q11.23 concomitant to additional pathogenic CNVs in others genomic regions allows a better comprehension of clinical consequences of atypical genomic rearrangements. © 2015 Wiley Periodicals, Inc.

Refinement of light-responsive transcript lists using rice oligonucleotide arrays: evaluation of gene-redundancy.

PubMed

Jung, Ki-Hong; Dardick, Christopher; Bartley, Laura E; Cao, Peijian; Phetsom, Jirapa; Canlas, Patrick; Seo, Young-Su; Shultz, Michael; Ouyang, Shu; Yuan, Qiaoping; Frank, Bryan C; Ly, Eugene; Zheng, Li; Jia, Yi; Hsia, An-Ping; An, Kyungsook; Chou, Hui-Hsien; Rocke, David; Lee, Geun Cheol; Schnable, Patrick S; An, Gynheung; Buell, C Robin; Ronald, Pamela C

2008-10-06

Studies of gene function are often hampered by gene-redundancy, especially in organisms with large genomes such as rice (Oryza sativa). We present an approach for using transcriptomics data to focus functional studies and address redundancy. To this end, we have constructed and validated an inexpensive and publicly available rice oligonucleotide near-whole genome array, called the rice NSF45K array. We generated expression profiles for light- vs. dark-grown rice leaf tissue and validated the biological significance of the data by analyzing sources of variation and confirming expression trends with reverse transcription polymerase chain reaction. We examined trends in the data by evaluating enrichment of gene ontology terms at multiple false discovery rate thresholds. To compare data generated with the NSF45K array with published results, we developed publicly available, web-based tools (www.ricearray.org). The Oligo and EST Anatomy Viewer enables visualization of EST-based expression profiling data for all genes on the array. The Rice Multi-platform Microarray Search Tool facilitates comparison of gene expression profiles across multiple rice microarray platforms. Finally, we incorporated gene expression and biochemical pathway data to reduce the number of candidate gene products putatively participating in the eight steps of the photorespiration pathway from 52 to 10, based on expression levels of putatively functionally redundant genes. We confirmed the efficacy of this method to cope with redundancy by correctly predicting participation in photorespiration of a gene with five paralogs. Applying these methods will accelerate rice functional genomics.

Parasite-specific immune response in adult Drosophila melanogaster: a genomic study

PubMed Central

Roxström-Lindquist, Katarina; Terenius, Olle; Faye, Ingrid

2004-01-01

Insects of the order Diptera are vectors for parasitic diseases such as malaria, sleeping sickness and leishmania. In the search for genes encoding proteins involved in the antiparasitic response, we have used the protozoan parasite Octosporea muscaedomesticae for oral infections of adult Drosophila melanogaster. To identify parasite-specific response molecules, other flies were exposed to virus, bacteria or fungi in parallel. Analysis of gene expression patterns after 24 h of microbial challenge, using Affymetrix oligonucleotide microarrays, revealed a high degree of microbe specificity. Many serine proteases, key intermediates in the induction of insect immune responses, were uniquely expressed following infection of the different organisms. Several lysozyme genes were induced in response to Octosporea infection, while in other treatments they were not induced or downregulated. This suggests that lysozymes are important in antiparasitic defence. PMID:14749722

Designing oligo libraries taking alternative splicing into account

NASA Astrophysics Data System (ADS)

Shoshan, Avi; Grebinskiy, Vladimir; Magen, Avner; Scolnicov, Ariel; Fink, Eyal; Lehavi, David; Wasserman, Alon

2001-06-01

We have designed sequences for DNA microarrays and oligo libraries, taking alternative splicing into account. Alternative splicing is a common phenomenon, occurring in more than 25% of the human genes. In many cases, different splice variants have different functions, are expressed in different tissues or may indicate different stages of disease. When designing sequences for DNA microarrays or oligo libraries, it is very important to take into account the sequence information of all the mRNA transcripts. Therefore, when a gene has more than one transcript (as a result of alternative splicing, alternative promoter sites or alternative poly-adenylation sites), it is very important to take all of them into account in the design. We have used the LEADS transcriptome prediction system to cluster and assemble the human sequences in GenBank and design optimal oligonucleotides for all the human genes with a known mRNA sequence based on the LEADS predictions.

SigReannot-mart: a query environment for expression microarray probe re-annotations.

PubMed

Moreews, François; Rauffet, Gaelle; Dehais, Patrice; Klopp, Christophe

2011-01-01

Expression microarrays are commonly used to study transcriptomes. Most of the arrays are now based on oligo-nucleotide probes. Probe design being a tedious task, it often takes place once at the beginning of the project. The oligo set is then used for several years. During this time period, the knowledge gathered by the community on the genome and the transcriptome increases and gets more precise. Therefore re-annotating the set is essential to supply the biologists with up-to-date annotations. SigReannot-mart is a query environment populated with regularly updated annotations for different oligo sets. It stores the results of the SigReannot pipeline that has mainly been used on farm and aquaculture species. It permits easy extraction in different formats using filters. It is used to compare probe sets on different criteria, to choose the set for a given experiment to mix probe sets in order to create a new one.

Biological data warehousing system for identifying transcriptional regulatory sites from gene expressions of microarray data.

PubMed

Tsou, Ann-Ping; Sun, Yi-Ming; Liu, Chia-Lin; Huang, Hsien-Da; Horng, Jorng-Tzong; Tsai, Meng-Feng; Liu, Baw-Juine

2006-07-01

Identification of transcriptional regulatory sites plays an important role in the investigation of gene regulation. For this propose, we designed and implemented a data warehouse to integrate multiple heterogeneous biological data sources with data types such as text-file, XML, image, MySQL database model, and Oracle database model. The utility of the biological data warehouse in predicting transcriptional regulatory sites of coregulated genes was explored using a synexpression group derived from a microarray study. Both of the binding sites of known transcription factors and predicted over-represented (OR) oligonucleotides were demonstrated for the gene group. The potential biological roles of both known nucleotides and one OR nucleotide were demonstrated using bioassays. Therefore, the results from the wet-lab experiments reinforce the power and utility of the data warehouse as an approach to the genome-wide search for important transcription regulatory elements that are the key to many complex biological systems.

Optimization of an oligonucleotide microchip for microbial identification studies: a non-equilibrium dissociation approach

NASA Technical Reports Server (NTRS)

Liu, W. T.; Mirzabekov, A. D.; Stahl, D. A.

2001-01-01

The utility of a high-density oligonucleotide microarray (microchip) for identifying strains of five closely related bacilli (Bacillus anthracis, Bacillus cereus, Bacillus mycoides, Bacillus medusa and Bacillus subtilis) was demonstrated using an approach that compares the non-equilibrium dissociation rates ('melting curves') of all probe-target duplexes simultaneously. For this study, a hierarchical set of 30 oligonucleotide probes targeting the 16S ribosomal RNA of these bacilli at multiple levels of specificity (approximate taxonomic ranks of domain, kingdom, order, genus and species) was designed and immobilized in a high-density matrix of gel pads on a glass slide. Reproducible melting curves for probes with different levels of specificity were obtained using an optimized salt concentration. Clear discrimination between perfect match (PM) and mismatch (MM) duplexes was achieved. By normalizing the signals to an internal standard (a universal probe), a more than twofold discrimination (> 2.4x) was achieved between PM and 1-MM duplexes at the dissociation temperature at which 50% of the probe-target duplexes remained intact. This provided excellent differentiation among representatives of different Bacillus species, both individually and in mixtures of two or three. The overall pattern of hybridization derived from this hierarchical probe set also provided a clear 'chip fingerprint' for each of these closely related Bacillus species.

Inhibition of connective tissue growth factor (CTGF/CCN2) expression decreases the survival and myogenic differentiation of human rhabdomyosarcoma cells.

PubMed

Croci, Stefania; Landuzzi, Lorena; Astolfi, Annalisa; Nicoletti, Giordano; Rosolen, Angelo; Sartori, Francesca; Follo, Matilde Y; Oliver, Noelynn; De Giovanni, Carla; Nanni, Patrizia; Lollini, Pier-Luigi

2004-03-01

Connective tissue growth factor (CTGF/CCN2), a cysteine-rich protein of the CCN (Cyr61, CTGF, Nov) family of genes, emerged from a microarray screen of genes expressed by human rhabdomyosarcoma cells. Rhabdomyosarcoma is a soft tissue sarcoma of childhood deriving from skeletal muscle cells. In this study, we investigated the role of CTGF in rhabdomyosarcoma. Human rhabdomyosarcoma cells of the embryonal (RD/12, RD/18, CCA) and the alveolar histotype (RMZ-RC2, SJ-RH4, SJ-RH30), rhabdomyosarcoma tumor specimens, and normal skeletal muscle cells expressed CTGF. To determine the function of CTGF, we treated rhabdomyosarcoma cells with a CTGF antisense oligonucleotide or with a CTGF small interfering RNA (siRNA). Both treatments inhibited rhabdomyosarcoma cell growth, suggesting the existence of a new autocrine loop based on CTGF. CTGF antisense oligonucleotide-mediated growth inhibition was specifically due to a significant increase in apoptosis, whereas cell proliferation was unchanged. CTGF antisense oligonucleotide induced a strong decrease in the level of myogenic differentiation of rhabdomyosarcoma cells, whereas the addition of recombinant CTGF significantly increased the proportion of myosin-positive cells. CTGF emerges as a survival and differentiation factor and could be a new therapeutic target in human rhabdomyosarcoma.

Revisiting adverse effects of cross-hybridization in Affymetrix gene expression data: do they matter for correlation analysis?

PubMed

Klebanov, Lev; Chen, Linlin; Yakovlev, Andrei

2007-11-07

This work was undertaken in response to a recently published paper by Okoniewski and Miller (BMC Bioinformatics 2006, 7: Article 276). The authors of that paper came to the conclusion that the process of multiple targeting in short oligonucleotide microarrays induces spurious correlations and this effect may deteriorate the inference on correlation coefficients. The design of their study and supporting simulations cast serious doubt upon the validity of this conclusion. The work by Okoniewski and Miller drove us to revisit the issue by means of experimentation with biological data and probabilistic modeling of cross-hybridization effects. We have identified two serious flaws in the study by Okoniewski and Miller: (1) The data used in their paper are not amenable to correlation analysis; (2) The proposed simulation model is inadequate for studying the effects of cross-hybridization. Using two other data sets, we have shown that removing multiply targeted probe sets does not lead to a shift in the histogram of sample correlation coefficients towards smaller values. A more realistic approach to mathematical modeling of cross-hybridization demonstrates that this process is by far more complex than the simplistic model considered by the authors. A diversity of correlation effects (such as the induction of positive or negative correlations) caused by cross-hybridization can be expected in theory but there are natural limitations on the ability to provide quantitative insights into such effects due to the fact that they are not directly observable. The proposed stochastic model is instrumental in studying general regularities in hybridization interaction between probe sets in microarray data. As the problem stands now, there is no compelling reason to believe that multiple targeting causes a large-scale effect on the correlation structure of Affymetrix gene expression data. Our analysis suggests that the observed long-range correlations in microarray data are of a biological nature rather than a technological flaw.

Decreased triadin and increased calstabin2 expression in Great Danes with dilated cardiomyopathy.

PubMed

Oyama, M A; Chittur, S V; Reynolds, C A

2009-01-01

Dilated cardiomyopathy (DCM) is a common cardiac disease of Great Dane dogs, yet very little is known about the underlying molecular abnormalities that contribute to disease. Discover a set of genes that are differentially expressed in Great Dane dogs with DCM as a way to identify candidate genes for further study as well as to better understand the molecular abnormalities that underlie the disease. Three Great Dane dogs with end-stage DCM and 3 large breed control dogs. Prospective study. Transcriptional activity of 42,869 canine DNA sequences was determined with a canine-specific oligonucleotide microarray. Genome expression patterns of left ventricular tissue samples from affected Great Dane dogs were evaluated by measuring the relative amount of complementary RNA hybridization to the microarray probes and comparing it with expression from large breed dogs with noncardiac disease. Three hundred and twenty-three transcripts were differentially expressed (> or = 2-fold change). The transcript with the greatest degree of upregulation (+61.3-fold) was calstabin2 (FKBP12.6), whereas the transcript with the greatest degree of downregulation (-9.07-fold) was triadin. Calstabin2 and triadin are both regulatory components of the cardiac ryanodine receptor (RyR2) and are critical to normal intracellular Ca2+ release and excitation-contraction coupling. Great Dane dogs with DCM demonstrate abnormal calstabin2 and triadin expression. These changes likely affect Ca2+ flux within cardiac cells and may contribute to the pathophysiology of disease. Microarray-based analysis identifies calstabin2, triadin, and RyR2 function as targets of future study.

Effect of (+)-usnic acid on mitochondrial functions as measured by mitochondria-specific oligonucleotide microarray in liver of B6C3F1 mice.

PubMed

Joseph, Ajay; Lee, Taewon; Moland, Carrie L; Branham, William S; Fuscoe, James C; Leakey, Julian E A; Allaben, William T; Lewis, Sherry M; Ali, Akhtar A; Desai, Varsha G

2009-04-01

Usnic acid is a lichen metabolite used as a weight-loss dietary supplement due to its uncoupling action on mitochondria. However, its use has been associated with severe liver disorders in some individuals. Animal studies conducted thus far evaluated the effects of usnic acid on mitochondria primarily by measuring the rate of oxygen consumption and/or ATP generation. To obtain further insight into usnic acid-mediated effects on mitochondria, we examined the expression levels of 542 genes associated with mitochondrial structure and functions in liver of B6C3F(1) female mice using a mitochondria-specific microarray. Beginning at 8 weeks of age, mice received usnic acid at 0, 60, 180, and 600 ppm in ground, irradiated 5LG6 diet for 14 days. Microarray analysis showed a significant effect of usnic acid on the expression of several genes only at the highest dose of 600 ppm. A prominent finding of the study was a significant induction of genes associated with complexes I through IV of the electron transport chain. Moreover, several genes involved in fatty acid oxidation, the Krebs cycle, apoptosis, and membrane transporters were over-expressed. Usnic acid is a lipophilic weak acid that can diffuse through mitochondrial membranes and cause a proton leak (uncoupling). The up-regulation of complexes I-IV may be a compensatory mechanism to maintain the proton gradient across the mitochondrial inner membrane. In addition, induction of fatty acid oxidation and the Krebs cycle may be an adaptive response to uncoupling of mitochondria.

DNA Microarray Profiling Highlights Nrf2-Mediated Chemoprevention Targeted by Wasabi-Derived Isothiocyanates in HepG2 Cells.

PubMed

Trio, Phoebe Zapanta; Kawahara, Atsuyoshi; Tanigawa, Shunsuke; Sakao, Kozue; Hou, De-Xing

2017-01-01

6-MSITC and 6-MTITC are sulforaphane (SFN) analogs found in Japanese Wasabi. As we reported previously, Wasabi isothiocyanates (ITCs) are activators of Nrf2-antioxidant response element pathway, and also inhibitors of pro-inflammatory cyclooxygenase-2. This study is the first to assess the global changes in transcript levels by Wasabi ITCs, comparing with SFN, in HepG2 cells. We performed comparative gene expression profiling by treating HepG2 cells with ITCs, followed by DNA microarray analyses using HG-U133 plus 2.0 oligonucleotide array. Partial array data on selected gene products were confirmed by RT-PCR and Western blotting. Ingenuity Pathway Analysis (IPA) was used to identify functional subsets of genes and biologically significant network pathways. 6-MTITC showed the highest number of differentially altered (≥2 folds) gene expression, of which 114 genes were upregulated and 75 were downregulated. IPA revealed that Nrf2-mediated pathway, together with glutamate metabolism, is the common significantly modulated pathway across treatments. Interestingly, 6-MSITC exhibited the most potent effect toward Nrf2-mediated pathway. Our data suggest that 6-MSITC could exert chemopreventive role against cancer through its underlying antioxidant activity via the activation of Nrf2-mediated subsequent induction of cytoprotective genes.

Robust diagnosis of non-Hodgkin lymphoma phenotypes validated on gene expression data from different laboratories.

PubMed

Bhanot, Gyan; Alexe, Gabriela; Levine, Arnold J; Stolovitzky, Gustavo

2005-01-01

A major challenge in cancer diagnosis from microarray data is the need for robust, accurate, classification models which are independent of the analysis techniques used and can combine data from different laboratories. We propose such a classification scheme originally developed for phenotype identification from mass spectrometry data. The method uses a robust multivariate gene selection procedure and combines the results of several machine learning tools trained on raw and pattern data to produce an accurate meta-classifier. We illustrate and validate our method by applying it to gene expression datasets: the oligonucleotide HuGeneFL microarray dataset of Shipp et al. (www.genome.wi.mit.du/MPR/lymphoma) and the Hu95Av2 Affymetrix dataset (DallaFavera's laboratory, Columbia University). Our pattern-based meta-classification technique achieves higher predictive accuracies than each of the individual classifiers , is robust against data perturbations and provides subsets of related predictive genes. Our techniques predict that combinations of some genes in the p53 pathway are highly predictive of phenotype. In particular, we find that in 80% of DLBCL cases the mRNA level of at least one of the three genes p53, PLK1 and CDK2 is elevated, while in 80% of FL cases, the mRNA level of at most one of them is elevated.

MALDI MS analysis of oligonucleotides: desalting by functional magnetite beads using microwave-assisted extraction.

PubMed

Chen, Wei-Yu; Chen, Yu-Chie

2007-11-01

The presence of alkali cation adductions of oligonucleotides commonly deteriorates matrix-assisted laser desorption/ionization (MALDI) mass spectra. Thus, desalting is required for oligonucleotide samples prior to MALDI MS analysis in order to prevent the mass spectra from developing poor quality. In this paper, we demonstrate a new approach to extract traces of oligonucleotides from aqueous solutions containing high concentrations of salts using microwave-assisted extraction. The C18-presenting magnetite beads, capable of absorbing microwave irradiation, are used as affinity probes for oligonucleotides with the addition of triethylammonium acetate as the counterions. This new microwave-assisted extraction approach using magnetite beads as the trapping agents and as microwave-absorbers has been demonstrated to be very effective in the selective binding of oligonucleotides from aqueous solutions. The extraction of oligonucleotides from solutions onto the C18-presenting magnetite beads takes only 30 s to enrich oligonucleotides in sufficient quantities for MALDI MS analysis. After using this desalting approach, alkali cation adductions of oligonucleotides are dramatically reduced in the MALDI mass spectra. The presence of saturated NaCl (approximately 6 M) in the oligonucleotide sample is tolerated without degrading the mass spectra. The detection limit for d(A)6 is approximately 2.8 fmol.

Detection of pathogenic Vibrio spp. in shellfish by using multiplex PCR and DNA microarrays.

PubMed

Panicker, Gitika; Call, Douglas R; Krug, Melissa J; Bej, Asim K

2004-12-01

This study describes the development of a gene-specific DNA microarray coupled with multiplex PCR for the comprehensive detection of pathogenic vibrios that are natural inhabitants of warm coastal waters and shellfish. Multiplex PCR with vvh and viuB for Vibrio vulnificus, with ompU, toxR, tcpI, and hlyA for V. cholerae, and with tlh, tdh, trh, and open reading frame 8 for V. parahaemolyticus helped to ensure that total and pathogenic strains, including subtypes of the three Vibrio spp., could be detected and discriminated. For DNA microarrays, oligonucleotide probes for these targeted genes were deposited onto epoxysilane-derivatized, 12-well, Teflon-masked slides by using a MicroGrid II arrayer. Amplified PCR products were hybridized to arrays at 50 degrees C and detected by using tyramide signal amplification with Alexa Fluor 546 fluorescent dye. Slides were imaged by using an arrayWoRx scanner. The detection sensitivity for pure cultures without enrichment was 10(2) to 10(3) CFU/ml, and the specificity was 100%. However, 5 h of sample enrichment followed by DNA extraction with Instagene matrix and multiplex PCR with microarray hybridization resulted in the detection of 1 CFU in 1 g of oyster tissue homogenate. Thus, enrichment of the bacterial pathogens permitted higher sensitivity in compliance with the Interstate Shellfish Sanitation Conference guideline. Application of the DNA microarray methodology to natural oysters revealed the presence of V. vulnificus (100%) and V. parahaemolyticus (83%). However, V. cholerae was not detected in natural oysters. An assay involving a combination of multiplex PCR and DNA microarray hybridization would help to ensure rapid and accurate detection of pathogenic vibrios in shellfish, thereby improving the microbiological safety of shellfish for consumers.

Detection of Pathogenic Vibrio spp. in Shellfish by Using Multiplex PCR and DNA Microarrays

PubMed Central

Panicker, Gitika; Call, Douglas R.; Krug, Melissa J.; Bej, Asim K.

2004-01-01

This study describes the development of a gene-specific DNA microarray coupled with multiplex PCR for the comprehensive detection of pathogenic vibrios that are natural inhabitants of warm coastal waters and shellfish. Multiplex PCR with vvh and viuB for Vibrio vulnificus, with ompU, toxR, tcpI, and hlyA for V. cholerae, and with tlh, tdh, trh, and open reading frame 8 for V. parahaemolyticus helped to ensure that total and pathogenic strains, including subtypes of the three Vibrio spp., could be detected and discriminated. For DNA microarrays, oligonucleotide probes for these targeted genes were deposited onto epoxysilane-derivatized, 12-well, Teflon-masked slides by using a MicroGrid II arrayer. Amplified PCR products were hybridized to arrays at 50°C and detected by using tyramide signal amplification with Alexa Fluor 546 fluorescent dye. Slides were imaged by using an arrayWoRx scanner. The detection sensitivity for pure cultures without enrichment was 102 to 103 CFU/ml, and the specificity was 100%. However, 5 h of sample enrichment followed by DNA extraction with Instagene matrix and multiplex PCR with microarray hybridization resulted in the detection of 1 CFU in 1 g of oyster tissue homogenate. Thus, enrichment of the bacterial pathogens permitted higher sensitivity in compliance with the Interstate Shellfish Sanitation Conference guideline. Application of the DNA microarray methodology to natural oysters revealed the presence of V. vulnificus (100%) and V. parahaemolyticus (83%). However, V. cholerae was not detected in natural oysters. An assay involving a combination of multiplex PCR and DNA microarray hybridization would help to ensure rapid and accurate detection of pathogenic vibrios in shellfish, thereby improving the microbiological safety of shellfish for consumers. PMID:15574946

Identification of transcribed sequences in Arabidopsis thaliana by using high-resolution genome tiling arrays

PubMed Central

Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Sethi, Himanshu; Liang, Shoudan; Nelson, David C.; Hegeman, Adrian; Nelson, Clark; Rancour, David; Bednarek, Sebastian; Ulrich, Eldon L.; Zhao, Qin; Wrobel, Russell L.; Newman, Craig S.; Fox, Brian G.; Phillips, George N.; Markley, John L.; Sussman, Michael R.

2005-01-01

Using a maskless photolithography method, we produced DNA oligonucleotide microarrays with probe sequences tiled throughout the genome of the plant Arabidopsis thaliana. RNA expression was determined for the complete nuclear, mitochondrial, and chloroplast genomes by tiling 5 million 36-mer probes. These probes were hybridized to labeled mRNA isolated from liquid grown T87 cells, an undifferentiated Arabidopsis cell culture line. Transcripts were detected from at least 60% of the nearly 26,330 annotated genes, which included 151 predicted genes that were not identified previously by a similar genome-wide hybridization study on four different cell lines. In comparison with previously published results with 25-mer tiling arrays produced by chromium masking-based photolithography technique, 36-mer oligonucleotide probes were found to be more useful in identifying intron–exon boundaries. Using two-dimensional HPLC tandem mass spectrometry, a small-scale proteomic analysis was performed with the same cells. A large amount of strongly hybridizing RNA was found in regions “antisense” to known genes. Similarity of antisense activities between the 25-mer and 36-mer data sets suggests that it is a reproducible and inherent property of the experiments. Transcription activities were also detected for many of the intergenic regions and the small RNAs, including tRNA, small nuclear RNA, small nucleolar RNA, and microRNA. Expression of tRNAs correlates with genome-wide amino acid usage. PMID:15755812

Salivary gland carcinosarcoma: oligonucleotide array CGH reveals similar genomic profiles in epithelial and mesenchymal components.

PubMed

Vékony, Hedy; Leemans, C René; Ylstra, Bauke; Meijer, Gerrit A; van der Waal, Isaäc; Bloemena, Elisabeth

2009-03-01

In this study, we present a case of parotid gland de novo carcinosarcoma. Salivary gland carcinosarcoma (or true malignant mixed tumor) is a rare biphasic neoplasm, composed of both malignant epithelial and malignant mesenchymal components. It is yet unclear whether these two phenotypes occur by collision of two independent tumors or if they are of clonal origin. To analyze the clonality of the different morphologic tumor components, oligonucleotide microarray-based comparative genomic hybridization (oaCGH) was performed on the carcinoma and the sarcoma entity separately. This technique enables a high-resolution, genome-wide overview of the chromosomal alterations in the distinct tumor elements. Analysis of both fractions showed a high number of DNA copy number changes. Losses were more prevalent than gains (82 and 49, respectively). The carcinomatous element displayed more chromosomal aberrations than the sarcomatous component. Specific amplifications of MUC20 (in mesenchymal element) and BMI-1 (in both elements) loci were observed. Overall homology between the two genomic profiles was 75%. DNA copy number profiles of the epithelial and mesenchymal components in this salivary gland carcinosarcoma displayed extensive overlap, indicating a monoclonal origin. Since losses are shared to a larger extent than gains, they seem to be more essential for initial oncogenic events. Furthermore, specific amplifications of a mucin and a Polycomb group gene imply these proteins in the tumorigenesis of carcinosarcomas.

Identification of transcribed sequences in Arabidopsis thaliana by using high-resolution genome tiling arrays

NASA Technical Reports Server (NTRS)

Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Sethi, Himanshu; Liang, Shoudan; Nelson, David C.; Hegeman, Adrian; Nelson, Clark; Rancour, David; Bednarek, Sebastian;

Identification of Escherichia coli O157 by Using a Novel Colorimetric Detection Method with DNA Microarrays

PubMed Central

Swimley, Michelle S.; Taylor, Amber W.; Dawson, Erica D.

2011-01-01

Abstract Shiga toxin–producing Escherichia coli O157 is a leading cause of foodborne illness worldwide. To evaluate better methods to rapidly detect and genotype E. coli O157 strains, the present study evaluated the use of ampliPHOX, a novel colorimetric detection method based on photopolymerization, for pathogen identification with DNA microarrays. A low-density DNA oligonucleotide microarray was designed to target stx1 and stx2 genes encoding Shiga toxin production, the eae gene coding for adherence membrane protein, and the per gene encoding the O157-antigen perosamine synthetase. Results from the validation experiments demonstrated that the use of ampliPHOX allowed the accurate genotyping of the tested E. coli strains, and positive hybridization signals were observed for only probes targeting virulence genes present in the reference strains. Quantification showed that the average signal-to-noise ratio values ranged from 47.73 ± 7.12 to 76.71 ± 8.33, whereas average signal-to-noise ratio values below 2.5 were determined for probes where no polymer was formed due to lack of specific hybridization. Sensitivity tests demonstrated that the sensitivity threshold for E. coli O157 detection was 100–1000 CFU/mL. Thus, the use of DNA microarrays in combination with photopolymerization allowed the rapid and accurate genotyping of E. coli O157 strains. PMID:21288130

A comprehensive transcript index of the human genome generated using microarrays and computational approaches

PubMed Central

Schadt, Eric E; Edwards, Stephen W; GuhaThakurta, Debraj; Holder, Dan; Ying, Lisa; Svetnik, Vladimir; Leonardson, Amy; Hart, Kyle W; Russell, Archie; Li, Guoya; Cavet, Guy; Castle, John; McDonagh, Paul; Kan, Zhengyan; Chen, Ronghua; Kasarskis, Andrew; Margarint, Mihai; Caceres, Ramon M; Johnson, Jason M; Armour, Christopher D; Garrett-Engele, Philip W; Tsinoremas, Nicholas F; Shoemaker, Daniel D

2004-01-01

Background Computational and microarray-based experimental approaches were used to generate a comprehensive transcript index for the human genome. Oligonucleotide probes designed from approximately 50,000 known and predicted transcript sequences from the human genome were used to survey transcription from a diverse set of 60 tissues and cell lines using ink-jet microarrays. Further, expression activity over at least six conditions was more generally assessed using genomic tiling arrays consisting of probes tiled through a repeat-masked version of the genomic sequence making up chromosomes 20 and 22. Results The combination of microarray data with extensive genome annotations resulted in a set of 28,456 experimentally supported transcripts. This set of high-confidence transcripts represents the first experimentally driven annotation of the human genome. In addition, the results from genomic tiling suggest that a large amount of transcription exists outside of annotated regions of the genome and serves as an example of how this activity could be measured on a genome-wide scale. Conclusions These data represent one of the most comprehensive assessments of transcriptional activity in the human genome and provide an atlas of human gene expression over a unique set of gene predictions. Before the annotation of the human genome is considered complete, however, the previously unannotated transcriptional activity throughout the genome must be fully characterized. PMID:15461792

Detecting and Genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Call, Douglas R.; Brockman, Fred J.; Chandler, Darrell P.

2000-12-01

Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification.more » The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFU ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.« less

Detecting and genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Call, Douglas R.; Brockman, Fred J.; Chandler, Darrell P.

2001-07-05

Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification.more » The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFUs ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.« less

An Efficient Covalent Coating on Glass Slides for Preparation of Optical Oligonucleotide Microarrays

PubMed Central

Pourjahed, Atefeh; Rabiee, Mohammad; Tahriri, Mohammadreza

2013-01-01

Objective(s): Microarrays are potential analyzing tools for genomics and proteomics researches, which is in needed of suitable substrate for coating and also hybridization of biomolecules. Materials and Methods: In this research, a thin film of oxidized agarose was prepared on the glass slides which previously coated with poly-L-lysine (PLL). Some of the aldehyde groups of the activated agarose linked covalently to PLL amine groups; also bound to the amino groups of biomolecules. These linkages were fixed by UV irradiation. The prepared substrates were compared to only agarose-coated and PLL-coated slides. Results: Results on atomic force microscope (AFM) demonstrated that agarose provided three-dimensional surface which had higher loading and bindig capacity for biomolecules than PLL-coated surface which had two-dimensional surface. In addition, the signal-to-noise ratio in hybridization reactions performed on the agarose-PLL coated substrates increased two fold and four fold compared to agarose and PLL coated substrates, respectively. Conclusion: The agarose-PLL microarrays had the highest signal (2546) and lowest background signal (205) in hybridization, suggesting that the prepared slides are suitable in analyzing wide concentration range of analytes. PMID:24570832

Significance of genomic instability in breast cancer in atomic bomb survivors: analysis of microarray-comparative genomic hybridization.

PubMed

Oikawa, Masahiro; Yoshiura, Koh-ichiro; Kondo, Hisayoshi; Miura, Shiro; Nagayasu, Takeshi; Nakashima, Masahiro

2011-12-07

It has been postulated that ionizing radiation induces breast cancers among atomic bomb (A-bomb) survivors. We have reported a higher incidence of HER2 and C-MYC oncogene amplification in breast cancers from A-bomb survivors. The purpose of this study was to clarify the effect of A-bomb radiation exposure on genomic instability (GIN), which is an important hallmark of carcinogenesis, in archival formalin-fixed paraffin-embedded (FFPE) tissues of breast cancer by using microarray-comparative genomic hybridization (aCGH). Tumor DNA was extracted from FFPE tissues of invasive ductal cancers from 15 survivors who were exposed at 1.5 km or less from the hypocenter and 13 calendar year-matched non-exposed patients followed by aCGH analysis using a high-density oligonucleotide microarray. The total length of copy number aberrations (CNA) was used as an indicator of GIN, and correlation with clinicopathological factors were statistically tested. The mean of the derivative log ratio spread (DLRSpread), which estimates the noise by calculating the spread of log ratio differences between consecutive probes for all chromosomes, was 0.54 (range, 0.26 to 1.05). The concordance of results between aCGH and fluorescence in situ hybridization (FISH) for HER2 gene amplification was 88%. The incidence of HER2 amplification and histological grade was significantly higher in the A-bomb survivors than control group (P = 0.04, respectively). The total length of CNA tended to be larger in the A-bomb survivors (P = 0.15). Correlation analysis of CNA and clinicopathological factors revealed that DLRSpread was negatively correlated with that significantly (P = 0.034, r = -0.40). Multivariate analysis with covariance revealed that the exposure to A-bomb was a significant (P = 0.005) independent factor which was associated with larger total length of CNA of breast cancers. Thus, archival FFPE tissues from A-bomb survivors are useful for genome-wide aCGH analysis. Our results suggested that A-bomb radiation may affect the increased amount of CNA as a hallmark of GIN and, subsequently, be associated with a higher histologic grade in breast cancer found in A-bomb survivors.

Significance of genomic instability in breast cancer in atomic bomb survivors: analysis of microarray-comparative genomic hybridization

PubMed Central

2011-01-01

Background It has been postulated that ionizing radiation induces breast cancers among atomic bomb (A-bomb) survivors. We have reported a higher incidence of HER2 and C-MYC oncogene amplification in breast cancers from A-bomb survivors. The purpose of this study was to clarify the effect of A-bomb radiation exposure on genomic instability (GIN), which is an important hallmark of carcinogenesis, in archival formalin-fixed paraffin-embedded (FFPE) tissues of breast cancer by using microarray-comparative genomic hybridization (aCGH). Methods Tumor DNA was extracted from FFPE tissues of invasive ductal cancers from 15 survivors who were exposed at 1.5 km or less from the hypocenter and 13 calendar year-matched non-exposed patients followed by aCGH analysis using a high-density oligonucleotide microarray. The total length of copy number aberrations (CNA) was used as an indicator of GIN, and correlation with clinicopathological factors were statistically tested. Results The mean of the derivative log ratio spread (DLRSpread), which estimates the noise by calculating the spread of log ratio differences between consecutive probes for all chromosomes, was 0.54 (range, 0.26 to 1.05). The concordance of results between aCGH and fluorescence in situ hybridization (FISH) for HER2 gene amplification was 88%. The incidence of HER2 amplification and histological grade was significantly higher in the A-bomb survivors than control group (P = 0.04, respectively). The total length of CNA tended to be larger in the A-bomb survivors (P = 0.15). Correlation analysis of CNA and clinicopathological factors revealed that DLRSpread was negatively correlated with that significantly (P = 0.034, r = -0.40). Multivariate analysis with covariance revealed that the exposure to A-bomb was a significant (P = 0.005) independent factor which was associated with larger total length of CNA of breast cancers. Conclusions Thus, archival FFPE tissues from A-bomb survivors are useful for genome-wide aCGH analysis. Our results suggested that A-bomb radiation may affect the increased amount of CNA as a hallmark of GIN and, subsequently, be associated with a higher histologic grade in breast cancer found in A-bomb survivors. PMID:22152285

Five omic technologies are concordant in differentiating the biochemical characteristics of the berries of five grapevine (Vitis vinifera L.) cultivars.

PubMed

Ghan, Ryan; Van Sluyter, Steven C; Hochberg, Uri; Degu, Asfaw; Hopper, Daniel W; Tillet, Richard L; Schlauch, Karen A; Haynes, Paul A; Fait, Aaron; Cramer, Grant R

2015-11-16

Grape cultivars and wines are distinguishable by their color, flavor and aroma profiles. Omic analyses (transcripts, proteins and metabolites) are powerful tools for assessing biochemical differences in biological systems. Berry skins of red- (Cabernet Sauvignon, Merlot, Pinot Noir) and white-skinned (Chardonnay, Semillon) wine grapes were harvested near optimum maturity (°Brix-to-titratable acidity ratio) from the same experimental vineyard. The cultivars were exposed to a mild, seasonal water-deficit treatment from fruit set until harvest in 2011. Identical sample aliquots were analyzed for transcripts by grapevine whole-genome oligonucleotide microarray and RNAseq technologies, proteins by nano-liquid chromatography-mass spectroscopy, and metabolites by gas chromatography-mass spectroscopy and liquid chromatography-mass spectroscopy. Principal components analysis of each of five Omic technologies showed similar results across cultivars in all Omic datasets. Comparison of the processed data of genes mapped in RNAseq and microarray data revealed a strong Pearson's correlation (0.80). The exclusion of probesets associated with genes with potential for cross-hybridization on the microarray improved the correlation to 0.93. The overall concordance of protein with transcript data was low with a Pearson's correlation of 0.27 and 0.24 for the RNAseq and microarray data, respectively. Integration of metabolite with protein and transcript data produced an expected model of phenylpropanoid biosynthesis, which distinguished red from white grapes, yet provided detail of individual cultivar differences. The mild water deficit treatment did not significantly alter the abundance of proteins or metabolites measured in the five cultivars, but did have a small effect on gene expression. The five Omic technologies were consistent in distinguishing cultivar variation. There was high concordance between transcriptomic technologies, but generally protein abundance did not correlate well with transcript abundance. The integration of multiple high-throughput Omic datasets revealed complex biochemical variation amongst five cultivars of an ancient and economically important crop species.

ASK1-dependent recruitment and activation of macrophages induce hair growth in skin wounds

PubMed Central

Osaka, Nao; Takahashi, Takumi; Murakami, Shiori; Matsuzawa, Atsushi; Noguchi, Takuya; Fujiwara, Takeshi; Aburatani, Hiroyuki; Moriyama, Keiji; Takeda, Kohsuke; Ichijo, Hidenori

2007-01-01

Apoptosis signal-regulating kinase 1 (ASK1) is a member of the mitogen-activated protein 3-kinase family that activates both c-Jun NH2-terminal kinase and p38 pathways in response to inflammatory cytokines and physicochemical stress. We report that ASK1 deficiency in mice results in dramatic retardation of wounding-induced hair regrowth in skin. Oligonucleotide microarray analysis revealed that expression of several chemotactic and activating factors for macrophages, as well as several macrophage-specific marker genes, was reduced in the skin wound area of ASK1-deficient mice. Intracutaneous transplantation of cytokine-activated bone marrow-derived macrophages strongly induced hair growth in both wild-type and ASK1-deficient mice. These findings indicate that ASK1 is required for wounding-induced infiltration and activation of macrophages, which play central roles in inflammation-dependent hair regrowth in skin. PMID:17389227

Ultrasensitive Label-free Electronic Chip for DNA Analysis Using Carbon Nanotube Nanoelectrode Arrays

NASA Technical Reports Server (NTRS)

Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Ye, Qi; Han, Jie; Meyyappan, M.

2004-01-01

There is a strong need for faster, cheaper, and simpler methods for nucleic acid analysis in today s clinical tests. Nanotechnologies can potentially provide solutions to these requirements by integrating nanomaterials with biofunctionalities. Dramatic improvement in the sensitivity and multiplexing can be achieved through the high-degree miniaturization. Here, we present our study in the development of an ultrasensitive label-free electronic chip for DNA/RNA analysis based on carbon nanotube nanoelectrode arrays. A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in a SiO2 matrix is fabricated using a bottom-up approach. Characteristic nanoelectrode behavior is observed with a low-density MWNT nanoelectrode array in measuring both the bulk and surface immobilized redox species. The open-end of MWNTs are found to present similar properties as graphite edge-plane electrodes, with a wide potential window, flexible chemical functionalities, and good biocompatibility. A BRCA1 related oligonucleotide probe with 18 bases is covalently functionalized at the open ends of the MWNTs and specifically hybridized with an oligonucleotide target as well as a PCR amplicon. The guanine bases in the target molecules are employed as the signal moieties for the electrochemical measurements. Ru(bpy)3(2+) mediator is used to further amplify the guanine oxidation signal. This technique has been employed for direct electrochemical detection of label-free PCR amplicon through specific hybridization with the BRCAl probe. The detection limit is estimated to be less than approximately 1000 DNA molecules, approaching the limit of the sensitivity by laser-based fluorescence techniques in DNA microarray. This system provides a general electronic platform for rapid molecular diagnostics in applications requiring ultrahigh sensitivity, high-degree of miniaturization, simple sample preparation, and low- cost operation.

Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

NASA Astrophysics Data System (ADS)

Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran

2016-03-01

Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.

Brain region-specific gene expression changes after chronic intermittent ethanol exposure and early withdrawal in C57BL/6J mice

PubMed Central

Melendez, Roberto I.; McGinty, Jacqueline F.; Kalivas, Peter W.; Becker, Howard C.

2014-01-01

Neuroadaptations that participate in the ontogeny of alcohol dependence are likely a result of altered gene expression in various brain regions. The present study investigated brain region-specific changes in the pattern and magnitude of gene expression immediately following chronic intermittent ethanol (CIE) exposure and 8 hours following final ethanol exposure [i.e. early withdrawal (EWD)]. High-density oligonucleotide microarrays (Affymetrix 430A 2.0, Affymetrix, Santa Clara, CA, USA) and bioinformatics analysis were used to characterize gene expression and function in the prefrontal cortex (PFC), hippocampus (HPC) and nucleus accumbens (NAc) of C57BL/6J mice (Jackson Laboratories, Bar Harbor, ME, USA). Gene expression levels were determined using gene chip robust multi-array average followed by statistical analysis of microarrays and validated by quantitative real-time reverse transcription polymerase chain reaction and Western blot analysis. Results indicated that immediately following CIE exposure, changes in gene expression were strikingly greater in the PFC (284 genes) compared with the HPC (16 genes) and NAc (32 genes). Bioinformatics analysis revealed that most of the transcriptionally responsive genes in the PFC were involved in Ras/MAPK signaling, notch signaling or ubiquitination. In contrast, during EWD, changes in gene expression were greatest in the HPC (139 genes) compared with the PFC (four genes) and NAc (eight genes). The most transcriptionally responsive genes in the HPC were involved in mRNA processing or actin dynamics. Of the few genes detected in the NAc, the most representatives were involved in circadian rhythms. Overall, these findings indicate that brain region-specific and time-dependent neuroadaptive alterations in gene expression play an integral role in the development of alcohol dependence and withdrawal. PMID:21812870

Functional Genomic Analysis of the Impact of Camelina (Camelina sativa) Meal on Atlantic Salmon (Salmo salar) Distal Intestine Gene Expression and Physiology.

PubMed

Brown, Tyler D; Hori, Tiago S; Xue, Xi; Ye, Chang Lin; Anderson, Derek M; Rise, Matthew L

2016-06-01

The inclusion of plant meals in diets of farmed Atlantic salmon can elicit inflammatory responses in the distal intestine (DI). For the present work, fish were fed a standard fish meal (FM) diet or a diet with partial replacement of FM with solvent-extracted camelina meal (CM) (8, 16, or 24 % CM inclusion) during a 16-week feeding trial. A significant decrease in growth performance was seen in fish fed all CM inclusion diets (Hixson et al. in Aquacult Nutr 22:615-630, 2016). A 4x44K oligonucleotide microarray experiment was carried out and significance analysis of microarrays (SAM) and rank products (RP) methods were used to identify differentially expressed genes between the DIs of fish fed the 24 % CM diet and those fed the FM diet. Twelve features representing six known transcripts and two unknowns were identified as CM responsive by both SAM and RP. The six known transcripts (including thioredoxin and ependymin), in addition to tgfb, mmp13, and GILT, were studied using qPCR with RNA templates from all four experimental diet groups. All six microarray-identified genes were confirmed to be CM responsive, as was tgfb and mmp13. Histopathological analyses identified signs of inflammation in the DI of salmon fed CM-containing diets, including lamina propria and sub-epithelial mucosa thickening, infiltration of eosinophilic granule cells, increased goblet cells and decreased enterocyte vacuolization. All of these were significantly altered in 24 % CM compared to all other diets, with the latter two also altered in 16 % CM compared with 8 % CM and control diet groups. Significant correlation was seen between histological parameters as well as between five of the qPCR analyzed genes and histological parameters. These molecular biomarkers of inflammation arising from long-term dietary CM exposure will be useful in the development of CM-containing diets that do not have deleterious effects on salmon growth or physiology.

Non-Small-Cell Lung Cancer Molecular Signatures Recapitulate Lung Developmental Pathways

PubMed Central

Borczuk, Alain C.; Gorenstein, Lyall; Walter, Kristin L.; Assaad, Adel A.; Wang, Liqun; Powell, Charles A.

2003-01-01

Current paradigms hold that lung carcinomas arise from pleuripotent stem cells capable of differentiation into one or several histological types. These paradigms suggest lung tumor cell ontogeny is determined by consequences of gene expression that recapitulate events important in embryonic lung development. Using oligonucleotide microarrays, we acquired gene profiles from 32 microdissected non-small-cell lung tumors. We determined the 100 top-ranked marker genes for adenocarcinoma, squamous cell, large cell, and carcinoid using nearest neighbor analysis. Results were validated by immunostaining for 11 selected proteins using a tissue microarray representing 80 tumors. Gene expression data of lung development were accessed from a publicly available dataset generated with the murine Mu11k genome microarray. Self-organized mapping identified two temporally distinct clusters of murine orthologues. Supervised clustering of lung development data showed large-cell carcinoma gene orthologues were in a cluster expressed in pseudoglandular and canalicular stages whereas adenocarcinoma homologues were predominantly in a cluster expressed later in the terminal sac and alveolar stages of murine lung development. Representative large-cell genes (E2F3, MYBL2, HDAC2, CDK4, PCNA) are expressed in the nucleus and are associated with cell cycle and proliferation. In contrast, adenocarcinoma genes are associated with lung-specific transcription pathways (SFTPB, TTF-1), cell adhesion, and signal transduction. In sum, non-small-cell lung tumors histology gene profiles suggest mechanisms relevant to ontogeny and clinical course. Adenocarcinoma genes are associated with differentiation and glandular formation whereas large-cell genes are associated with proliferation and differentiation arrest. The identification of developmentally regulated pathways active in tumorigenesis provides insights into lung carcinogenesis and suggests early steps may differ according to the eventual tumor morphology. PMID:14578194

The genomic transcriptional response of female fathead minnows (Pimephales promelas) to an acute exposure to the androgen, 17β-trenbolone

USGS Publications Warehouse

Dorts, Jennifer; Richter, Catherine A.; Wright-Osment, Maureen K.; Ellersieck, Mark R.; Carter, Barbara J.; Tillitt, Donald E.

2009-01-01

We investigated the genomic transcriptional response of female fathead minnows (Pimephales promelas) to an acute (4 days) exposure to 0.1 or 1.0 ??g/L of 17??-trenbolone (TB), the active metabolite of an anabolic androgenic steroid used as a growth promoter in cattle and a contaminant of concern in aquatic systems. Our objectives were to investigate the gene expression profile induced by TB, define biomarkers of exposure to TB, and increase our understanding of the mechanisms of adverse effects of TB on fish reproduction. In female gonad tissue, microarray analysis using a 22 K oligonucleotide microarray (EcoArray Inc., Gainesville, FL) showed 99 significantly upregulated genes and 741 significantly downregulated genes in response to 1 ??g TB/L. In particular, hydroxysteroid (17??) dehydrogenase 12a (hsd17b12a), zona pellucida glycoprotein 2.2 (zp2.2), and protein inhibitor of activated STAT, 2 (pias2) were all downregulated in gonad. Q-PCR measurements in a larger sample set were consistent with the microarray results in the direction and magnitude of these changes in gene expression. However, several novel potential biomarkers were verified by Q-PCR in the same samples, but could not be validated in independent samples. In liver, Q-PCR measurements showed a significant decrease in vitellogenin 1 (vtg1) mRNA expression. In brain, cytochrome P450, family 19, subfamily A, polypeptide 1b (cyp19a1b, previously known as aromatase B) transcript levels were significantly reduced following TB exposure. Our study provides a candidate gene involved in mediating the action of TB, hsd17b12a, and two potential biomarkers sensitive to acute TB exposure, hepatic vtg1 and brain cyp19a1b.

Development and validation of a mixed-tissue oligonucleotide DNA microarray for Atlantic bluefin tuna, Thunnus thynnus (Linnaeus, 1758).

PubMed

Trumbić, Željka; Bekaert, Michaël; Taggart, John B; Bron, James E; Gharbi, Karim; Mladineo, Ivona

2015-11-25

The largest of the tuna species, Atlantic bluefin tuna (Thunnus thynnus), inhabits the North Atlantic Ocean and the Mediterranean Sea and is considered to be an endangered species, largely a consequence of overfishing. T. thynnus aquaculture, referred to as fattening or farming, is a capture based activity dependent on yearly renewal from the wild. Thus, the development of aquaculture practices independent of wild resources can provide an important contribution towards ensuring security and sustainability of this species in the longer-term. The development of such practices is today greatly assisted by large scale transcriptomic studies. We have used pyrosequencing technology to sequence a mixed-tissue normalised cDNA library, derived from adult T. thynnus. A total of 976,904 raw sequence reads were assembled into 33,105 unique transcripts having a mean length of 893 bases and an N50 of 870. Of these, 33.4% showed similarity to known proteins or gene transcripts and 86.6% of them were matched to the congeneric Pacific bluefin tuna (Thunnus orientalis) genome, compared to 70.3% for the more distantly related Nile tilapia (Oreochromis niloticus) genome. Transcript sequences were used to develop a novel 15 K Agilent oligonucleotide DNA microarray for T. thynnus and comparative tissue gene expression profiles were inferred for gill, heart, liver, ovaries and testes. Functional contrasts were strongest between gills and ovaries. Gills were particularly associated with immune system, signal transduction and cell communication, while ovaries displayed signatures of glycan biosynthesis, nucleotide metabolism, transcription, translation, replication and repair. Sequence data generated from a novel mixed-tissue T. thynnus cDNA library provide an important transcriptomic resource that can be further employed for study of various aspects of T. thynnus ecology and genomics, with strong applications in aquaculture. Tissue-specific gene expression profiles inferred through the use of novel oligo-microarray can serve in the design of new and more focused transcriptomic studies for future research of tuna physiology and assessment of the welfare in a production environment.

Direct on-chip DNA synthesis using electrochemically modified gold electrodes as solid support

NASA Astrophysics Data System (ADS)

Levrie, Karen; Jans, Karolien; Schepers, Guy; Vos, Rita; Van Dorpe, Pol; Lagae, Liesbet; Van Hoof, Chris; Van Aerschot, Arthur; Stakenborg, Tim

2018-04-01

DNA microarrays have propelled important advancements in the field of genomic research by enabling the monitoring of thousands of genes in parallel. The throughput can be increased even further by scaling down the microarray feature size. In this respect, microelectronics-based DNA arrays are promising as they can leverage semiconductor processing techniques with lithographic resolutions. We propose a method that enables the use of metal electrodes for de novo DNA synthesis without the need for an insulating support. By electrochemically functionalizing gold electrodes, these electrodes can act as solid support for phosphoramidite-based synthesis. The proposed method relies on the electrochemical reduction of diazonium salts, enabling site-specific incorporation of hydroxyl groups onto the metal electrodes. An automated DNA synthesizer was used to couple phosphoramidite moieties directly onto the OH-modified electrodes to obtain the desired oligonucleotide sequence. Characterization was done via cyclic voltammetry and fluorescence microscopy. Our results present a valuable proof-of-concept for the integration of solid-phase DNA synthesis with microelectronics.

Identification of Cell Cycle-regulated Genes in Fission YeastD⃞

PubMed Central

Peng, Xu; Karuturi, R. Krishna Murthy; Miller, Lance D.; Lin, Kui; Jia, Yonghui; Kondu, Pinar; Wang, Long; Wong, Lim-Soon; Liu, Edison T.; Balasubramanian, Mohan K.; Liu, Jianhua

2005-01-01

Cell cycle progression is both regulated and accompanied by periodic changes in the expression levels of a large number of genes. To investigate cell cycle-regulated transcriptional programs in the fission yeast Schizosaccharomyces pombe, we developed a whole-genome oligonucleotide-based DNA microarray. Microarray analysis of both wild-type and cdc25 mutant cell cultures was performed to identify transcripts whose levels oscillated during the cell cycle. Using an unsupervised algorithm, we identified 747 genes that met the criteria for cell cycle-regulated expression. Peaks of gene expression were found to be distributed throughout the entire cell cycle. Furthermore, we found that four promoter motifs exhibited strong association with cell cycle phase-specific expression. Examination of the regulation of MCB motif-containing genes through the perturbation of DNA synthesis control/MCB-binding factor (DSC/MBF)-mediated transcription in arrested synchronous cdc10 mutant cell cultures revealed a subset of functional targets of the DSC/MBF transcription factor complex, as well as certain gene promoter requirements. Finally, we compared our data with those for the budding yeast Saccharomyces cerevisiae and found ∼140 genes that are cell cycle regulated in both yeasts, suggesting that these genes may play an evolutionarily conserved role in regulation of cell cycle-specific processes. Our complete data sets are available at http://giscompute.gis.a-star.edu.sg/~gisljh/CDC. PMID:15616197

Unusual Intron Conservation near Tissue-Regulated Exons Found by Splicing Microarrays

PubMed Central

Sugnet, Charles W; Srinivasan, Karpagam; Clark, Tyson A; O'Brien, Georgeann; Cline, Melissa S; Wang, Hui; Williams, Alan; Kulp, David; Blume, John E; Haussler, David; Ares, Manuel

2006-01-01

Alternative splicing contributes to both gene regulation and protein diversity. To discover broad relationships between regulation of alternative splicing and sequence conservation, we applied a systems approach, using oligonucleotide microarrays designed to capture splicing information across the mouse genome. In a set of 22 adult tissues, we observe differential expression of RNA containing at least two alternative splice junctions for about 40% of the 6,216 alternative events we could detect. Statistical comparisons identify 171 cassette exons whose inclusion or skipping is different in brain relative to other tissues and another 28 exons whose splicing is different in muscle. A subset of these exons is associated with unusual blocks of intron sequence whose conservation in vertebrates rivals that of protein-coding exons. By focusing on sets of exons with similar regulatory patterns, we have identified new sequence motifs implicated in brain and muscle splicing regulation. Of note is a motif that is strikingly similar to the branchpoint consensus but is located downstream of the 5′ splice site of exons included in muscle. Analysis of three paralogous membrane-associated guanylate kinase genes reveals that each contains a paralogous tissue-regulated exon with a similar tissue inclusion pattern. While the intron sequences flanking these exons remain highly conserved among mammalian orthologs, the paralogous flanking intron sequences have diverged considerably, suggesting unusually complex evolution of the regulation of alternative splicing in multigene families. PMID:16424921

An automated microfluidic DNA microarray platform for genetic variant detection in inherited arrhythmic diseases.

PubMed

Huang, Shu-Hong; Chang, Yu-Shin; Juang, Jyh-Ming Jimmy; Chang, Kai-Wei; Tsai, Mong-Hsun; Lu, Tzu-Pin; Lai, Liang-Chuan; Chuang, Eric Y; Huang, Nien-Tsu

2018-03-12

In this study, we developed an automated microfluidic DNA microarray (AMDM) platform for point mutation detection of genetic variants in inherited arrhythmic diseases. The platform allows for automated and programmable reagent sequencing under precise conditions of hybridization flow and temperature control. It is composed of a commercial microfluidic control system, a microfluidic microarray device, and a temperature control unit. The automated and rapid hybridization process can be performed in the AMDM platform using Cy3 labeled oligonucleotide exons of SCN5A genetic DNA, which produces proteins associated with sodium channels abundant in the heart (cardiac) muscle cells. We then introduce a graphene oxide (GO)-assisted DNA microarray hybridization protocol to enable point mutation detection. In this protocol, a GO solution is added after the staining step to quench dyes bound to single-stranded DNA or non-perfectly matched DNA, which can improve point mutation specificity. As proof-of-concept we extracted the wild-type and mutant of exon 12 and exon 17 of SCN5A genetic DNA from patients with long QT syndrome or Brugada syndrome by touchdown PCR and performed a successful point mutation discrimination in the AMDM platform. Overall, the AMDM platform can greatly reduce laborious and time-consuming hybridization steps and prevent potential contamination. Furthermore, by introducing the reciprocating flow into the microchannel during the hybridization process, the total assay time can be reduced to 3 hours, which is 6 times faster than the conventional DNA microarray. Given the automatic assay operation, shorter assay time, and high point mutation discrimination, we believe that the AMDM platform has potential for low-cost, rapid and sensitive genetic testing in a simple and user-friendly manner, which may benefit gene screening in medical practice.

A Novel Pan-Flavivirus Detection and Identification Assay Based on RT-qPCR and Microarray

PubMed Central

Sachse, Konrad; Ziegler, Ute; Keller, Markus

2017-01-01

The genus Flavivirus includes arthropod-borne viruses responsible for a large number of infections in humans and economically important animals. While RT-PCR protocols for specific detection of most Flavivirus species are available, there has been also a demand for a broad-range Flavivirus assay covering all members of the genus. It is particularly challenging to balance specificity at genus level with equal sensitivity towards each target species. In the present study, a novel assay combining a SYBR Green-based RT-qPCR with a low-density DNA microarray has been developed. Validation experiments confirmed that the RT-qPCR exhibited roughly equal sensitivity of detection and quantification for all flaviviruses tested. These PCR products are subjected to hybridization on a microarray carrying 84 different oligonucleotide probes that represent all known Flavivirus species. This assay has been used as a screening and confirmation tool for Flavivirus presence in laboratory and field samples, and it performed successfully in international External Quality Assessment of NAT studies. Twenty-six Flavivirus strains were tested with the assay, showing equivalent or superior characteristics compared with the original or even with species-specific RT-PCRs. As an example, test results on West Nile virus detection in a panel of 340 mosquito pool samples from Greece are presented. PMID:28626758

Expression of HOXB2, a retinoic acid signaling target in pancreatic cancer and pancreatic intraepithelial neoplasia.

PubMed

Segara, Davendra; Biankin, Andrew V; Kench, James G; Langusch, Catherine C; Dawson, Amanda C; Skalicky, David A; Gotley, David C; Coleman, Maxwell J; Sutherland, Robert L; Henshall, Susan M

2005-05-01

Despite significant progress in understanding the molecular pathology of pancreatic cancer and its precursor lesion: pancreatic intraepithelial neoplasia (PanIN), there remain no molecules with proven clinical utility as prognostic or therapeutic markers. Here, we used oligonucleotide microarrays to interrogate mRNA expression of pancreatic cancer tissue and normal pancreas to identify novel molecular pathways dysregulated in the development and progression of pancreatic cancer. RNA was hybridized to Affymetrix Genechip HG-U133 oligonucleotide microarrays. A relational database integrating data from publicly available resources was created to identify candidate genes potentially relevant to pancreatic cancer. The protein expression of one candidate, homeobox B2 (HOXB2), in PanIN and pancreatic cancer was assessed using immunohistochemistry. We identified aberrant expression of several components of the retinoic acid (RA) signaling pathway (RARalpha, MUC4, Id-1, MMP9, uPAR, HB-EGF, HOXB6, and HOXB2), many of which are known to be aberrantly expressed in pancreatic cancer and PanIN. HOXB2, a downstream target of RA, was up-regulated 6.7-fold in pancreatic cancer compared with normal pancreas. Immunohistochemistry revealed ectopic expression of HOXB2 in 15% of early PanIN lesions and 48 of 128 (38%) pancreatic cancer specimens. Expression of HOXB2 was associated with nonresectable tumors and was an independent predictor of poor survival in resected tumors. We identified aberrant expression of RA signaling components in pancreatic cancer, including HOXB2, which was expressed in a proportion of PanIN lesions. Ectopic expression of HOXB2 was associated with a poor prognosis for all patients with pancreatic cancer and was an independent predictor of survival in patients who underwent resection.

Under the influence of the active deodorant ingredient 4-hydroxy-3-methoxybenzyl alcohol, the skin bacterium Corynebacterium jeikeium moderately responds with differential gene expression.

PubMed

Brune, Iris; Becker, Anke; Paarmann, Daniel; Albersmeier, Andreas; Kalinowski, Jörn; Pühler, Alfred; Tauch, Andreas

2006-12-15

A 70mer oligonucleotide microarray was constructed to analyze genome-wide expression profiles of Corynebacterium jeikeium, a skin bacterium that is predominantly present in the human axilla and involved in axillary odor formation. Oligonucleotides representing 100% of the predicted coding regions of the C. jeikeium K411 genome were designed and spotted in quadruplicate onto epoxy-coated glass slides. The quality of the printed microarray was demonstrated by co-hybridization with fluorescently labeled cDNA probes obtained from exponentially growing C. jeikeium cultures. Accordingly, genes detected with different intensities resulting in log(2) transformed ratios greater than 0.8 or smaller than -0.8 can be regarded as differentially expressed with a confidence level greater than 99%. In an application example, we measured global changes of gene expression during growth of C. jeikeium in the presence of different concentrations of the deodorant component 4-hydroxy-3-methoxybenzyl alcohol that is active in preventing body odor formation. Global expression profiling revealed that low concentrations of 4-hydroxy-3-methoxybenzyl alcohol (0.5 and 2.5mg/ml) had almost no detectable effect on the transcriptome of C. jeikeium. A slightly higher concentration of 4-hydroxy-3-methoxybenzyl alcohol (5mg/ml) resulted in differential expression of 95 genes, 86 of which showed an enhanced expression when compared to a control culture. Besides many genes encoding proteins that apparently participate in transcription and translation, the drug resistance determinant cmx and the predicted virulence factors sapA and sapD showed significantly enhanced expression levels. Differential expression of relevant genes was validated by real-time reverse transcription PCR assays.

Comparison of three microarray probe annotation pipelines: differences in strategies and their effect on downstream analysis

PubMed Central

Neerincx, Pieter BT; Casel, Pierrot; Prickett, Dennis; Nie, Haisheng; Watson, Michael; Leunissen, Jack AM; Groenen, Martien AM; Klopp, Christophe

2009-01-01

Background Reliable annotation linking oligonucleotide probes to target genes is essential for functional biological analysis of microarray experiments. We used the IMAD, OligoRAP and sigReannot pipelines to update the annotation for the ARK-Genomics Chicken 20 K array as part of a joined EADGENE/SABRE workshop. In this manuscript we compare their annotation strategies and results. Furthermore, we analyse the effect of differences in updated annotation on functional analysis for an experiment involving Eimeria infected chickens and finally we propose guidelines for optimal annotation strategies. Results IMAD, OligoRAP and sigReannot update both annotation and estimated target specificity. The 3 pipelines can assign oligos to target specificity categories although with varying degrees of resolution. Target specificity is judged based on the amount and type of oligo versus target-gene alignments (hits), which are determined by filter thresholds that users can adjust based on their experimental conditions. Linking oligos to annotation on the other hand is based on rigid rules, which differ between pipelines. For 52.7% of the oligos from a subset selected for in depth comparison all pipelines linked to one or more Ensembl genes with consensus on 44.0%. In 31.0% of the cases none of the pipelines could assign an Ensembl gene to an oligo and for the remaining 16.3% the coverage differed between pipelines. Differences in updated annotation were mainly due to different thresholds for hybridisation potential filtering of oligo versus target-gene alignments and different policies for expanding annotation using indirect links. The differences in updated annotation packages had a significant effect on GO term enrichment analysis with consensus on only 67.2% of the enriched terms. Conclusion In addition to flexible thresholds to determine target specificity, annotation tools should provide metadata describing the relationships between oligos and the annotation assigned to them. These relationships can then be used to judge the varying degrees of reliability allowing users to fine-tune the balance between reliability and coverage. This is important as it can have a significant effect on functional microarray analysis as exemplified by the lack of consensus on almost one third of the terms found with GO term enrichment analysis based on updated IMAD, OligoRAP or sigReannot annotation. PMID:19615109

Comparison of three microarray probe annotation pipelines: differences in strategies and their effect on downstream analysis.

PubMed

Neerincx, Pieter Bt; Casel, Pierrot; Prickett, Dennis; Nie, Haisheng; Watson, Michael; Leunissen, Jack Am; Groenen, Martien Am; Klopp, Christophe

2009-07-16

Reliable annotation linking oligonucleotide probes to target genes is essential for functional biological analysis of microarray experiments. We used the IMAD, OligoRAP and sigReannot pipelines to update the annotation for the ARK-Genomics Chicken 20 K array as part of a joined EADGENE/SABRE workshop. In this manuscript we compare their annotation strategies and results. Furthermore, we analyse the effect of differences in updated annotation on functional analysis for an experiment involving Eimeria infected chickens and finally we propose guidelines for optimal annotation strategies. IMAD, OligoRAP and sigReannot update both annotation and estimated target specificity. The 3 pipelines can assign oligos to target specificity categories although with varying degrees of resolution. Target specificity is judged based on the amount and type of oligo versus target-gene alignments (hits), which are determined by filter thresholds that users can adjust based on their experimental conditions. Linking oligos to annotation on the other hand is based on rigid rules, which differ between pipelines.For 52.7% of the oligos from a subset selected for in depth comparison all pipelines linked to one or more Ensembl genes with consensus on 44.0%. In 31.0% of the cases none of the pipelines could assign an Ensembl gene to an oligo and for the remaining 16.3% the coverage differed between pipelines. Differences in updated annotation were mainly due to different thresholds for hybridisation potential filtering of oligo versus target-gene alignments and different policies for expanding annotation using indirect links. The differences in updated annotation packages had a significant effect on GO term enrichment analysis with consensus on only 67.2% of the enriched terms. In addition to flexible thresholds to determine target specificity, annotation tools should provide metadata describing the relationships between oligos and the annotation assigned to them. These relationships can then be used to judge the varying degrees of reliability allowing users to fine-tune the balance between reliability and coverage. This is important as it can have a significant effect on functional microarray analysis as exemplified by the lack of consensus on almost one third of the terms found with GO term enrichment analysis based on updated IMAD, OligoRAP or sigReannot annotation.

Identifying Fishes through DNA Barcodes and Microarrays.

PubMed

Kochzius, Marc; Seidel, Christian; Antoniou, Aglaia; Botla, Sandeep Kumar; Campo, Daniel; Cariani, Alessia; Vazquez, Eva Garcia; Hauschild, Janet; Hervet, Caroline; Hjörleifsdottir, Sigridur; Hreggvidsson, Gudmundur; Kappel, Kristina; Landi, Monica; Magoulas, Antonios; Marteinsson, Viggo; Nölte, Manfred; Planes, Serge; Tinti, Fausto; Turan, Cemal; Venugopal, Moleyur N; Weber, Hannes; Blohm, Dietmar

2010-09-07

International fish trade reached an import value of 62.8 billion Euro in 2006, of which 44.6% are covered by the European Union. Species identification is a key problem throughout the life cycle of fishes: from eggs and larvae to adults in fisheries research and control, as well as processed fish products in consumer protection. This study aims to evaluate the applicability of the three mitochondrial genes 16S rRNA (16S), cytochrome b (cyt b), and cytochrome oxidase subunit I (COI) for the identification of 50 European marine fish species by combining techniques of "DNA barcoding" and microarrays. In a DNA barcoding approach, neighbour Joining (NJ) phylogenetic trees of 369 16S, 212 cyt b, and 447 COI sequences indicated that cyt b and COI are suitable for unambiguous identification, whereas 16S failed to discriminate closely related flatfish and gurnard species. In course of probe design for DNA microarray development, each of the markers yielded a high number of potentially species-specific probes in silico, although many of them were rejected based on microarray hybridisation experiments. None of the markers provided probes to discriminate the sibling flatfish and gurnard species. However, since 16S-probes were less negatively influenced by the "position of label" effect and showed the lowest rejection rate and the highest mean signal intensity, 16S is more suitable for DNA microarray probe design than cty b and COI. The large portion of rejected COI-probes after hybridisation experiments (>90%) renders the DNA barcoding marker as rather unsuitable for this high-throughput technology. Based on these data, a DNA microarray containing 64 functional oligonucleotide probes for the identification of 30 out of the 50 fish species investigated was developed. It represents the next step towards an automated and easy-to-handle method to identify fish, ichthyoplankton, and fish products.

Open-target sparse sensing of biological agents using DNA microarray

PubMed Central

2011-01-01

Background Current biosensors are designed to target and react to specific nucleic acid sequences or structural epitopes. These 'target-specific' platforms require creation of new physical capture reagents when new organisms are targeted. An 'open-target' approach to DNA microarray biosensing is proposed and substantiated using laboratory generated data. The microarray consisted of 12,900 25 bp oligonucleotide capture probes derived from a statistical model trained on randomly selected genomic segments of pathogenic prokaryotic organisms. Open-target detection of organisms was accomplished using a reference library of hybridization patterns for three test organisms whose DNA sequences were not included in the design of the microarray probes. Results A multivariate mathematical model based on the partial least squares regression (PLSR) was developed to detect the presence of three test organisms in mixed samples. When all 12,900 probes were used, the model correctly detected the signature of three test organisms in all mixed samples (mean(R2)) = 0.76, CI = 0.95), with a 6% false positive rate. A sampling algorithm was then developed to sparsely sample the probe space for a minimal number of probes required to capture the hybridization imprints of the test organisms. The PLSR detection model was capable of correctly identifying the presence of the three test organisms in all mixed samples using only 47 probes (mean(R2)) = 0.77, CI = 0.95) with nearly 100% specificity. Conclusions We conceived an 'open-target' approach to biosensing, and hypothesized that a relatively small, non-specifically designed, DNA microarray is capable of identifying the presence of multiple organisms in mixed samples. Coupled with a mathematical model applied to laboratory generated data, and sparse sampling of capture probes, the prototype microarray platform was able to capture the signature of each organism in all mixed samples with high sensitivity and specificity. It was demonstrated that this new approach to biosensing closely follows the principles of sparse sensing. PMID:21801424

A limited innate immune response is induced by a replication-defective herpes simplex virus vector following delivery to the murine central nervous system

PubMed Central

Zeier, Zane; Aguilar, J Santiago; Lopez, Cecilia M; Devi-Rao, G B; Watson, Zachary L; Baker, Henry V; Wagner, Edward K; Bloom, David C

2010-01-01

Herpes simplex virus type 1 (HSV-1)–based vectors readily transduce neurons and have a large payload capacity, making them particularly amenable to gene therapy applications within the central nervous system (CNS). Because aspects of the host responses to HSV-1 vectors in the CNS are largely unknown, we compared the host response of a nonreplicating HSV-1 vector to that of a replication-competent HSV-1 virus using microarray analysis. In parallel, HSV-1 gene expression was tracked using HSV-specific oligonucleotide-based arrays in order to correlate viral gene expression with observed changes in host response. Microarray analysis was performed following stereotactic injection into the right hippocampal formation of mice with either a replication-competent HSV-1 or a nonreplicating recombinant of HSV-1, lacking the ICP4 gene (ICP4−). Genes that demonstrated a significant change (P < .001) in expression in response to the replicating HSV-1 outnumbered those that changed in response to mock or nonreplicating vector by approximately 3-fold. Pathway analysis revealed that both the replicating and nonreplicating vectors induced robust antigen presentation but only mild interferon, chemokine, and cytokine signaling responses. The ICP4− vector was restricted in several of the Toll-like receptor-signaling pathways, indicating reduced stimulation of the innate immune response. These array analyses suggest that although the nonreplicating vector induces detectable activation of immune response pathways, the number and magnitude of the induced response is dramatically restricted compared to the replicating vector, and with the exception of antigen presentation, host gene expression induced by the non-replicating vector largely resembles mock infection. PMID:20095947

ALDH isozymes downregulation affects cell growth, cell motility and gene expression in lung cancer cells.

PubMed

Moreb, Jan S; Baker, Henry V; Chang, Lung-Ji; Amaya, Maria; Lopez, M Cecilia; Ostmark, Blanca; Chou, Wayne

2008-11-24

Aldehyde dehydrogenase isozymes ALDH1A1 and ALDH3A1 are highly expressed in non small cell lung cancer. Neither the mechanisms nor the biologic significance for such over expression have been studied. We have employed oligonucleotide microarrays to analyze changes in gene profiles in A549 lung cancer cell line in which ALDH activity was reduced by up to 95% using lentiviral mediated expression of siRNA against both isozymes (Lenti 1+3). Stringent analysis methods were used to identify gene expression patterns that are specific to the knock down of ALDH activity and significantly different in comparison to wild type A549 cells (WT) or cells similarly transduced with green fluorescent protein (GFP) siRNA. We confirmed significant and specific down regulation of ALDH1A1 and ALDH3A1 in Lenti 1+3 cells and in comparison to 12 other ALDH genes detected. The results of the microarray analysis were validated by real time RT-PCR on RNA obtained from Lenti 1+3 or WT cells treated with ALDH activity inhibitors. Detailed functional analysis was performed on 101 genes that were significantly different (P < 0.001) and their expression changed by > or = 2 folds in the Lenti 1+3 group versus the control groups. There were 75 down regulated and 26 up regulated genes. Protein binding, organ development, signal transduction, transcription, lipid metabolism, and cell migration and adhesion were among the most affected pathways. These molecular effects of the ALDH knock-down are associated with in vitro functional changes in the proliferation and motility of these cells and demonstrate the significance of ALDH enzymes in cell homeostasis with a potentially significant impact on the treatment of lung cancer.

Ammonia-oxidizing bacterial community composition in estuarine and oceanic environments assessed using a functional gene microarray

USGS Publications Warehouse

Ward, B.B.; Eveillard, D.; Kirshtein, J.D.; Nelson, J.D.; Voytek, M.A.; Jackson, G.A.

2007-01-01

The relationship between environmental factors and functional gene diversity of ammonia-oxidizing bacteria (AOB) was investigated across a transect from the freshwater portions of the Chesapeake Bay and Choptank River out into the Sargasso Sea. Oligonucleotide probes (70-bp) designed to represent the diversity of ammonia monooxygenase (amoA) genes from Chesapeake Bay clone libraries and cultivated AOB were used to construct a glass slide microarray. Hybridization patterns among the probes in 14 samples along the transect showed clear variations in amoA community composition. Probes representing uncultivated members of the Nitrosospira-like AOB dominated the probe signal, especially in the more marine samples. Of the cultivated species, only Nitrosospira briensis was detected at appreciable levels. Discrimination analysis of hybridization signals detected two guilds. Guild 1 was dominated by the marine Nitrosospira-like probe signal, and Guild 2???s largest contribution was from upper bay (freshwater) sediment probes. Principal components analysis showed that Guild 1 was positively correlated with salinity, temperature and chlorophyll a concentration, while Guild 2 was positively correlated with concentrations of oxygen, dissolved organic carbon, and particulate nitrogen and carbon, suggesting that different amoA sequences represent organisms that occupy different ecological niches within the estuarine/marine environment. The trend from most diversity of AOB in the upper estuary towards dominance of a single type in the polyhaline region of the Bay is consistent with the declining importance of AOB with increasing salinity, and with the idea that AO-Archaea are the more important ammonia oxidizers in the ocean. ?? 2007 The Authors.

Human neural stem cell-derived cultures in three-dimensional substrates form spontaneously functional neuronal networks.

PubMed

Smith, Imogen; Silveirinha, Vasco; Stein, Jason L; de la Torre-Ubieta, Luis; Farrimond, Jonathan A; Williamson, Elizabeth M; Whalley, Benjamin J

2017-04-01

Differentiated human neural stem cells were cultured in an inert three-dimensional (3D) scaffold and, unlike two-dimensional (2D) but otherwise comparable monolayer cultures, formed spontaneously active, functional neuronal networks that responded reproducibly and predictably to conventional pharmacological treatments to reveal functional, glutamatergic synapses. Immunocytochemical and electron microscopy analysis revealed a neuronal and glial population, where markers of neuronal maturity were observed in the former. Oligonucleotide microarray analysis revealed substantial differences in gene expression conferred by culturing in a 3D vs a 2D environment. Notable and numerous differences were seen in genes coding for neuronal function, the extracellular matrix and cytoskeleton. In addition to producing functional networks, differentiated human neural stem cells grown in inert scaffolds offer several significant advantages over conventional 2D monolayers. These advantages include cost savings and improved physiological relevance, which make them better suited for use in the pharmacological and toxicological assays required for development of stem cell-based treatments and the reduction of animal use in medical research. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

Research and development of biochip technologies in Taiwan

NASA Astrophysics Data System (ADS)

Ting, Solomon J.; Chiou, Arthur E. T.

2000-07-01

Recent advancements in several genome-sequencing projects have stimulated an enormous interest in microarray DNA chip technology, especially in the biomedical sciences and pharmaceutical industries. The DNA chips facilitated the miniaturization of conventional nucleic acid hybridizations, by either robotically spotting thousands of library cDNAs or in situ synthesis of high-density oligonucleotides onto solid supports. These innovations have found a wide range of applications in molecular biology, especially in studying gene expression and discovering new genes from the global view of genomic analysis. The research and development of this powerful tool has also received great attentions in Taiwan. In this paper, we report the current progresses of our DNA chip project, along with the current status of other biochip projects in Taiwan, such as protein chip, PCR chip, electrophoresis chip, olfactory chip, etc. The new development of biochip technologies integrates the biotechnology with the semiconductor processing, the micro- electro-mechanical, optoelectronic, and digital signal processing technologies. Most of these biochip technologies utilitze optical detection methods for data acquisition and analysis. The strengths and advantages of different approaches are compared and discussed in this report.

Assessing the impact of Benzo[a]pyrene on Marine Mussels: Application of a novel targeted low density microarray complementing classical biomarker responses

PubMed Central

Sforzini, Susanna; Arlt, Volker M.; Barranger, Audrey; Dallas, Lorna J.; Oliveri, Caterina; Aminot, Yann; Pacchioni, Beniamina; Millino, Caterina; Lanfranchi, Gerolamo; Readman, James W.; Moore, Michael N.; Viarengo, Aldo; Jha, Awadhesh N.

2017-01-01

Despite the increasing use of mussels in environmental monitoring and ecotoxicological studies, their genomes and gene functions have not been thoroughly explored. Several cDNA microarrays were recently proposed for Mytilus spp., but putatively identified partial transcripts have rendered the generation of robust transcriptional responses difficult in terms of pathway identification. We developed a new low density oligonucleotide microarray with 465 probes covering the same number of genes. Target genes were selected to cover most of the well-known biological processes in the stress response documented over the last decade in bivalve species at the cellular and tissue levels. Our new ‘STressREsponse Microarray’ (STREM) platform consists of eight sub-arrays with three replicates for each target in each sub-array. To assess the potential use of the new array, we tested the effect of the ubiquitous environmental pollutant benzo[a]pyrene (B[a]P) at 5, 50, and 100 μg/L on two target tissues, the gills and digestive gland, of Mytilus galloprovincialis exposed invivo for three days. Bioaccumulation of B[a]P was also determined demonstrating exposure in both tissues. In addition to the well-known effects of B[a]P on DNA metabolism and oxidative stress, the new array data provided clues about the implication of other biological processes, such as cytoskeleton, immune response, adhesion to substrate, and mitochondrial activities. Transcriptional data were confirmed using qRT-PCR. We further investigated cellular functions and possible alterations related to biological processes highlighted by the microarray data using oxidative stress biomarkers (Lipofuscin content) and the assessment of genotoxicity. DNA damage, as measured by the alkaline comet assay, increased as a function of dose.DNA adducts measurements using 32P-postlabeling method also showed the presence of bulky DNA adducts (i.e. dG-N2-BPDE). Lipofiscin content increased significantly in B[a]P exposed mussels. Immunohistochemical analysis of tubulin and actin showed changes in cytoskeleton organisation. Our results adopting an integrated approach confirmed that the combination of newly developed transcriptomic approcah, classical biomarkers along with chemical analysis of water and tissue samples should be considered for environmental bioimonitoring and ecotoxicological studies to obtain holistic information to assess the impact of contaminants on the biota. PMID:28651000

Cell cloning-based transcriptome analysis in Rett patients: relevance to the pathogenesis of Rett syndrome of new human MeCP2 target genes.

PubMed

Nectoux, J; Fichou, Y; Rosas-Vargas, H; Cagnard, N; Bahi-Buisson, N; Nusbaum, P; Letourneur, F; Chelly, J; Bienvenu, T

2010-07-01

More than 90% of Rett syndrome (RTT) patients have heterozygous mutations in the X-linked methyl-CpG binding protein 2 (MECP2) gene that encodes the methyl-CpG-binding protein 2, a transcriptional modulator. Because MECP2 is subjected to X chromosome inactivation (XCI), girls with RTT either express the wild-type or mutant allele in each individual cell. To test the consequences of MECP2 mutations resulting from a genome-wide transcriptional dysregulation and to identify its target genes in a system that circumvents the functional mosaicism resulting from XCI, we carried out gene expression profiling of clonal populations derived from fibroblast primary cultures expressing exclusively either the wild-type or the mutant MECP2 allele. Clonal cultures were obtained from skin biopsy of three RTT patients carrying either a non-sense or a frameshift MECP2 mutation. For each patient, gene expression profiles of wild-type and mutant clones were compared by oligonucleotide expression microarray analysis. Firstly, clustering analysis classified the RTT patients according to their genetic background and MECP2 mutation. Secondly, expression profiling by microarray analysis and quantitative RT-PCR indicated four up-regulated genes and five down-regulated genes significantly dysregulated in all our statistical analysis, including excellent potential candidate genes for the understanding of the pathophysiology of this neurodevelopmental disease. Thirdly, chromatin immunoprecipitation analysis confirmed MeCP2 binding to respective CpG islands in three out of four up-regulated candidate genes and sequencing of bisulphite-converted DNA indicated that MeCP2 preferentially binds to methylated-DNA sequences. Most importantly, the finding that at least two of these genes (BMCC1 and RNF182) were shown to be involved in cell survival and/or apoptosis may suggest that impaired MeCP2 function could alter the survival of neurons thus compromising brain function without inducing cell death.

Oligonucleotide arrays vs. metaphase-comparative genomic hybridisation and BAC arrays for single-cell analysis: first applications to preimplantation genetic diagnosis for Robertsonian translocation carriers.

PubMed

Ramos, Laia; del Rey, Javier; Daina, Gemma; García-Aragonés, Manel; Armengol, Lluís; Fernandez-Encinas, Alba; Parriego, Mònica; Boada, Montserrat; Martinez-Passarell, Olga; Martorell, Maria Rosa; Casagran, Oriol; Benet, Jordi; Navarro, Joaquima

2014-01-01

Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH) and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈ 20 kb). Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14)(q10;q10). Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers.

Oligonucleotide Arrays vs. Metaphase-Comparative Genomic Hybridisation and BAC Arrays for Single-Cell Analysis: First Applications to Preimplantation Genetic Diagnosis for Robertsonian Translocation Carriers

PubMed Central

Ramos, Laia; del Rey, Javier; Daina, Gemma; García-Aragonés, Manel; Armengol, Lluís; Fernandez-Encinas, Alba; Parriego, Mònica; Boada, Montserrat; Martinez-Passarell, Olga; Martorell, Maria Rosa; Casagran, Oriol; Benet, Jordi; Navarro, Joaquima

2014-01-01

Comprehensive chromosome analysis techniques such as metaphase-Comparative Genomic Hybridisation (CGH) and array-CGH are available for single-cell analysis. However, while metaphase-CGH and BAC array-CGH have been widely used for Preimplantation Genetic Diagnosis, oligonucleotide array-CGH has not been used in an extensive way. A comparison between oligonucleotide array-CGH and metaphase-CGH has been performed analysing 15 single fibroblasts from aneuploid cell-lines and 18 single blastomeres from human cleavage-stage embryos. Afterwards, oligonucleotide array-CGH and BAC array-CGH were also compared analysing 16 single blastomeres from human cleavage-stage embryos. All three comprehensive analysis techniques provided broadly similar cytogenetic profiles; however, non-identical profiles appeared when extensive aneuploidies were present in a cell. Both array techniques provided an optimised analysis procedure and a higher resolution than metaphase-CGH. Moreover, oligonucleotide array-CGH was able to define extra segmental imbalances in 14.7% of the blastomeres and it better determined the specific unbalanced chromosome regions due to a higher resolution of the technique (≈20 kb). Applicability of oligonucleotide array-CGH for Preimplantation Genetic Diagnosis has been demonstrated in two cases of Robertsonian translocation carriers 45,XY,der(13;14)(q10;q10). Transfer of euploid embryos was performed in both cases and pregnancy was achieved by one of the couples. This is the first time that an oligonucleotide array-CGH approach has been successfully applied to Preimplantation Genetic Diagnosis for balanced chromosome rearrangement carriers. PMID:25415307

Method of identifying hairpin DNA probes by partial fold analysis

DOEpatents

Miller, Benjamin L [Penfield, NY; Strohsahl, Christopher M [Saugerties, NY

2009-10-06

Method of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

Method of identifying hairpin DNA probes by partial fold analysis

DOEpatents

Miller, Benjamin L.; Strohsahl, Christopher M.

2008-10-28

Methods of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

Development of a genotyping microarray for Usher syndrome.

PubMed

Cremers, Frans P M; Kimberling, William J; Külm, Maigi; de Brouwer, Arjan P; van Wijk, Erwin; te Brinke, Heleen; Cremers, Cor W R J; Hoefsloot, Lies H; Banfi, Sandro; Simonelli, Francesca; Fleischhauer, Johannes C; Berger, Wolfgang; Kelley, Phil M; Haralambous, Elene; Bitner-Glindzicz, Maria; Webster, Andrew R; Saihan, Zubin; De Baere, Elfride; Leroy, Bart P; Silvestri, Giuliana; McKay, Gareth J; Koenekoop, Robert K; Millan, Jose M; Rosenberg, Thomas; Joensuu, Tarja; Sankila, Eeva-Marja; Weil, Dominique; Weston, Mike D; Wissinger, Bernd; Kremer, Hannie

2007-02-01

Usher syndrome, a combination of retinitis pigmentosa (RP) and sensorineural hearing loss with or without vestibular dysfunction, displays a high degree of clinical and genetic heterogeneity. Three clinical subtypes can be distinguished, based on the age of onset and severity of the hearing impairment, and the presence or absence of vestibular abnormalities. Thus far, eight genes have been implicated in the syndrome, together comprising 347 protein-coding exons. To improve DNA diagnostics for patients with Usher syndrome, we developed a genotyping microarray based on the arrayed primer extension (APEX) method. Allele-specific oligonucleotides corresponding to all 298 Usher syndrome-associated sequence variants known to date, 76 of which are novel, were arrayed. Approximately half of these variants were validated using original patient DNAs, which yielded an accuracy of >98%. The efficiency of the Usher genotyping microarray was tested using DNAs from 370 unrelated European and American patients with Usher syndrome. Sequence variants were identified in 64/140 (46%) patients with Usher syndrome type I, 45/189 (24%) patients with Usher syndrome type II, 6/21 (29%) patients with Usher syndrome type III and 6/20 (30%) patients with atypical Usher syndrome. The chip also identified two novel sequence variants, c.400C>T (p.R134X) in PCDH15 and c.1606T>C (p.C536S) in USH2A. The Usher genotyping microarray is a versatile and affordable screening tool for Usher syndrome. Its efficiency will improve with the addition of novel sequence variants with minimal extra costs, making it a very useful first-pass screening tool.

Development of a genotyping microarray for Usher syndrome

PubMed Central

Cremers, Frans P M; Kimberling, William J; Külm, Maigi; de Brouwer, Arjan P; van Wijk, Erwin; te Brinke, Heleen; Cremers, Cor W R J; Hoefsloot, Lies H; Banfi, Sandro; Simonelli, Francesca; Fleischhauer, Johannes C; Berger, Wolfgang; Kelley, Phil M; Haralambous, Elene; Bitner‐Glindzicz, Maria; Webster, Andrew R; Saihan, Zubin; De Baere, Elfride; Leroy, Bart P; Silvestri, Giuliana; McKay, Gareth J; Koenekoop, Robert K; Millan, Jose M; Rosenberg, Thomas; Joensuu, Tarja; Sankila, Eeva‐Marja; Weil, Dominique; Weston, Mike D; Wissinger, Bernd; Kremer, Hannie

2007-01-01

Background Usher syndrome, a combination of retinitis pigmentosa (RP) and sensorineural hearing loss with or without vestibular dysfunction, displays a high degree of clinical and genetic heterogeneity. Three clinical subtypes can be distinguished, based on the age of onset and severity of the hearing impairment, and the presence or absence of vestibular abnormalities. Thus far, eight genes have been implicated in the syndrome, together comprising 347 protein‐coding exons. Methods: To improve DNA diagnostics for patients with Usher syndrome, we developed a genotyping microarray based on the arrayed primer extension (APEX) method. Allele‐specific oligonucleotides corresponding to all 298 Usher syndrome‐associated sequence variants known to date, 76 of which are novel, were arrayed. Results Approximately half of these variants were validated using original patient DNAs, which yielded an accuracy of >98%. The efficiency of the Usher genotyping microarray was tested using DNAs from 370 unrelated European and American patients with Usher syndrome. Sequence variants were identified in 64/140 (46%) patients with Usher syndrome type I, 45/189 (24%) patients with Usher syndrome type II, 6/21 (29%) patients with Usher syndrome type III and 6/20 (30%) patients with atypical Usher syndrome. The chip also identified two novel sequence variants, c.400C>T (p.R134X) in PCDH15 and c.1606T>C (p.C536S) in USH2A. Conclusion The Usher genotyping microarray is a versatile and affordable screening tool for Usher syndrome. Its efficiency will improve with the addition of novel sequence variants with minimal extra costs, making it a very useful first‐pass screening tool. PMID:16963483

Human Leukocyte Antigen Typing Using a Knowledge Base Coupled with a High-Throughput Oligonucleotide Probe Array Analysis

PubMed Central

Zhang, Guang Lan; Keskin, Derin B.; Lin, Hsin-Nan; Lin, Hong Huang; DeLuca, David S.; Leppanen, Scott; Milford, Edgar L.; Reinherz, Ellis L.; Brusic, Vladimir

2014-01-01

Human leukocyte antigens (HLA) are important biomarkers because multiple diseases, drug toxicity, and vaccine responses reveal strong HLA associations. Current clinical HLA typing is an elimination process requiring serial testing. We present an alternative in situ synthesized DNA-based microarray method that contains hundreds of thousands of probes representing a complete overlapping set covering 1,610 clinically relevant HLA class I alleles accompanied by computational tools for assigning HLA type to 4-digit resolution. Our proof-of-concept experiment included 21 blood samples, 18 cell lines, and multiple controls. The method is accurate, robust, and amenable to automation. Typing errors were restricted to homozygous samples or those with very closely related alleles from the same locus, but readily resolved by targeted DNA sequencing validation of flagged samples. High-throughput HLA typing technologies that are effective, yet inexpensive, can be used to analyze the world’s populations, benefiting both global public health and personalized health care. PMID:25505899

Genes Involved in the Balance between Neuronal Survival and Death during Inflammation

PubMed Central

Glezer, Isaias; Chernomoretz, Ariel; David, Samuel; Plante, Marie-Michèle; Rivest, Serge

2007-01-01

Glucocorticoids are potent regulators of the innate immune response, and alteration in this inhibitory feedback has detrimental consequences for the neural tissue. This study profiled and investigated functionally candidate genes mediating this switch between cell survival and death during an acute inflammatory reaction subsequent to the absence of glucocorticoid signaling. Oligonucleotide microarray analysis revealed that following lipopolysaccharide (LPS) intracerebral administration at striatum level, more modulated genes presented transcription impairment than exacerbation upon glucocorticoid receptor blockage. Among impaired genes we identified ceruloplasmin (Cp), which plays a key role in iron metabolism and is implicated in a neurodegenative disease. Microglial and endothelial induction of Cp is a natural neuroprotective mechanism during inflammation, because Cp-deficient mice exhibited increased iron accumulation and demyelination when exposed to LPS and neurovascular reactivity to pneumococcal meningitis. This study has identified genes that can play a critical role in programming the innate immune response, helping to clarify the mechanisms leading to protection or damage during inflammatory conditions in the CNS. PMID:17375196

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeung, Y.-S.; Yip, C.-W.; Hon, C.-C.

We have previously demonstrated that over-expression of spike protein (S) of severe acute respiratory syndrome coronavirus (SARS-CoV) or its C-terminal subunit (S2) is sufficient to induce apoptosis in vitro. To further investigate the possible roles of S2 in SARS-CoV-induced apoptosis and pathogenesis of SARS, we characterized the host expression profiles induced upon S2 over-expression in Vero E6 cells by oligonucleotide microarray analysis. Possible activation of mitochondrial apoptotic pathway in S2 expressing cells was suggested, as evidenced by the up-regulation of cytochrome c and down-regulation of the Bcl-2 family anti-apoptotic members. Inhibition of Bcl-2-related anti-apoptotic pathway was further supported by themore » diminution of S2-induced apoptosis in Vero E6 cells over-expressing Bcl-xL. In addition, modulation of CCN E2 and CDKN 1A implied the possible control of cell cycle arrest at G1/S phase. This study is expected to extend our understanding on the pathogenesis of SARS at a molecular level.« less

Coordinated transcriptional regulation patterns associated with infertility phenotypes in men

PubMed Central

Ellis, Peter J I; Furlong, Robert A; Conner, Sarah J; Kirkman‐Brown, Jackson; Afnan, Masoud; Barratt, Christopher; Griffin, Darren K; Affara, Nabeel A

2007-01-01

Introduction Microarray gene‐expression profiling is a powerful tool for global analysis of the transcriptional consequences of disease phenotypes. Understanding the genetic correlates of particular pathological states is important for more accurate diagnosis and screening of patients, and thus for suggesting appropriate avenues of treatment. As yet, there has been little research describing gene‐expression profiling of infertile and subfertile men, and thus the underlying transcriptional events involved in loss of spermatogenesis remain unclear. Here we present the results of an initial screen of 33 patients with differing spermatogenic phenotypes. Methods Oligonucleotide array expression profiling was performed on testis biopsies for 33 patients presenting for testicular sperm extraction. Significantly regulated genes were selected using a mixed model analysis of variance. Principle components analysis and hierarchical clustering were used to interpret the resulting dataset with reference to the patient history, clinical findings and histological composition of the biopsies. Results Striking patterns of coordinated gene expression were found. The most significant contains multiple germ cell‐specific genes and corresponds to the degree of successful spermatogenesis in each patient, whereas a second pattern corresponds to inflammatory activity within the testis. Smaller‐scale patterns were also observed, relating to unique features of the individual biopsies. PMID:17496197

Development and Use of Integrated Microarray-Based Genomic Technologies for Assessing Microbial Community Composition and Dynamics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, J.; Wu, L.; Gentry, T.

2006-04-05

To effectively monitor microbial populations involved in various important processes, a 50-mer-based oligonucleotide microarray was developed based on known genes and pathways involved in: biodegradation, metal resistance and reduction, denitrification, nitrification, nitrogen fixation, methane oxidation, methanogenesis, carbon polymer decomposition, and sulfate reduction. This array contains approximately 2000 unique and group-specific probes with <85% similarity to their non-target sequences. Based on artificial probes, our results showed that at hybridization conditions of 50 C and 50% formamide, the 50-mer microarray hybridization can differentiate sequences having <88% similarity. Specificity tests with representative pure cultures indicated that the designed probes on the arrays appearedmore » to be specific to their corresponding target genes. Detection limits were about 5-10ng genomic DNA in the absence of background DNA, and 50-100ng ({approx}1.3{sup o} 10{sup 7} cells) in the presence background DNA. Strong linear relationships between signal intensity and target DNA and RNA concentration were observed (r{sup 2} = 0.95-0.99). Application of this microarray to naphthalene-amended enrichments and soil microcosms demonstrated that composition of the microflora varied depending on incubation conditions. While the naphthalene-degrading genes from Rhodococcus-type microorganisms were dominant in enrichments, the genes involved in naphthalene degradation from Gram-negative microorganisms such as Ralstonia, Comamonas, and Burkholderia were most abundant in the soil microcosms (as well as those for polyaromatic hydrocarbon and nitrotoluene degradation). Although naphthalene degradation is widely known and studied in Pseudomonas, Pseudomonas genes were not detected in either system. Real-time PCR analysis of 4 representative genes was consistent with microarray-based quantification (r{sup 2} = 0.95). Currently, we are also applying this microarray to the study of several different microbial communities and processes at the NABIR-FRC in Oak Ridge, TN. One project involves the monitoring of the development and dynamics of the microbial community of a fluidized bed reactor (FBR) used for reducing nitrate and the other project monitors microbial community responses to stimulation of uranium reducing populations via ethanol donor additions in situ and in a model system. Additionally, we are developing novel strategies for increasing microarray hybridization sensitivity. Finally, great improvements to our methods of probe design were made by the development of a new computer program, CommOligo. CommOligo designs unique and group-specific oligo probes for whole-genomes, metagenomes, and groups of environmental sequences and uses a new global alignment algorithm to design single or multiple probes for each gene or group. We are now using this program to design a more comprehensive functional gene array for environmental studies. Overall, our results indicate that the 50mer-based microarray technology has potential as a specific and quantitative tool to reveal the composition of microbial communities and their dynamics important to processes within contaminated environments.« less

Protective effect of bicyclol against bile duct ligation-induced hepatic fibrosis in rats.

PubMed

Zhen, Yong-Zhan; Li, Na-Ren; He, Hong-Wei; Zhao, Shuang-Shuang; Zhang, Guang-Ling; Hao, Xiao-Fang; Shao, Rong-Guang

2015-06-21

To evaluate the protective effect of bicyclol against bile duct ligation (BDL)-induced hepatic fibrosis in rats. Sprague-Dawley male rats underwent BDL and sham-operated animals were used as healthy controls. The BDL rats were divided into two groups which received sterilized PBS or bicyclol (100 mg/kg per day) orally for two consecutive weeks. Serum, urine and bile were collected for biochemical determinations. Liver tissues were collected for histological analysis and a whole genome oligonucleotide microarray assay. Reverse transcription-polymerase chain reaction and Western blotting were used to verify the expression of liver fibrosis-related genes. Treatment with bicyclol significantly reduced liver fibrosis and bile duct proliferation after BDL. The levels of alanine aminotransferase (127.7 ± 72.3 vs 230.4 ± 69.6, P < 0.05) and aspartate aminotransferase (696.8 ± 232.6 vs 1032.6 ± 165.8, P < 0.05) were also decreased by treatment with bicyclol in comparison to PBS. The expression changes of 45 fibrogenic genes and several fibrogenesis-related pathways were reversed by bicyclol in the microarray assay. Bicyclol significantly reduced liver mRNA and/or protein expression levels of collagen 1a1, matrix metalloproteinase 2, tumor necrosis factor, tissue inhibitors of metalloproteinases 2, transforming growth factor-β1 and α-smooth muscle actin. Bicyclol significantly attenuates BDL-induced liver fibrosis by reversing fibrogenic gene expression. These findings suggest that bicyclol might be an effective anti-fibrotic drug for the treatment of cholestatic liver disease.

Alteration of Gene Expression Profile in Kidney of Spontaneously Hypertensive Rats Treated with Protein Hydrolysate of Blue Mussel (Mytilus edulis) by DNA Microarray Analysis

PubMed Central

Feng, Junli; Dai, Zhiyuan; Zhang, Yanping; Meng, Lu; Ye, Jian; Ma, Xuting

2015-01-01

Marine organisms are rich sources of bioactive components, which are often reported to have antihypertensive effects. However, the underlying mechanisms have yet to be fully identified. The aim of this study was to investigate the antihypertensive effect of enzymatic hydrolysis of blue mussel protein (HBMP) in rats. Peptides with in vitro ACE inhibitory activity were purified from HBMP by ultrafiltration, gel filtration chromatography and reversed-phase high performance liquid chromatography. And the amino acid sequences of isolated peptides were estimated to be Val-Trp, Leu-Gly-Trp, and Met-Val-Trp-Thr. To study its in vivo action, spontaneously hypertensive rats (SHRs) were orally administration with high- or low-dose of HBMP for 28 days. Major components of the renin-angiotensin (RAS) system in serum of SHRs from different groups were analyzed, and gene expression profiling were performed in the kidney of SHRs, using the Whole Rat Genome Oligonucleotide Microarray. Results indicated although genes involved in RAS system were not significantly altered, those related to blood coagulation system, cytokine and growth factor, and fatty acids metabolism were remarkablely changed. Several genes which were seldom reported to be implicated in pathogenesis of hypertension also showed significant expression alterations after oral administration of HBMP. These data provided valuable information for our understanding of the molecular mechanisms that underlie the potential antihypertensive activities of HBMP, and will contribute towards increased value-added utilization of blue mussel protein. PMID:26517713

Francisella tularensis alters human neutrophil gene expression: insights into the molecular basis of delayed neutrophil apoptosis

PubMed Central

Schwartz, Justin T.; Bandyopadhyay, Sarmistha; Kobayashi, Scott D.; McCracken, Jenna; Whitney, Adeline R.; DeLeo, Frank R.; Allen, Lee-Ann H.

2013-01-01

We demonstrated recently that Francisella tularensis profoundly impairs human neutrophil apoptosis, but how this is achieved is largely unknown. Herein we used human oligonucleotide microarrays to test the hypothesis that changes in neutrophil gene expression contribute to this phenotype, and now demonstrate that F. tularensis live vaccine strain (LVS) caused significant changes in neutrophil gene expression over a 24 h time period relative to the uninfected controls. Of ~47,000 genes analyzed, 3,435 were significantly up- or down-regulated by LVS, including 365 unique genes associated with apoptosis and cell survival. Specific targets in this category included genes associated with the intrinsic and extrinsic apoptotic pathways (CFLAR, TNFAIP3, TNFRSF10D, SOD2, BCL2A1, BIRC4, PIM2, TNFSF10, TNFRSF10C, CASP2, and CASP8) and genes that act via the NF B pathway and other mechanisms to prolong cell viability (NFKB1, NFKB2, and RELA, IL1B, CAST, CDK2, GADD45B, BCL3, BIRC3, CDK2, IL1A, PBEF1, IL6, CXCL1, CCL4 and VEGF). The microarray data were confirmed by qPCR and pathway analysis. Moreover, we demonstrate that X-linked inhibitor of apoptosis (XIAP) protein remained abundant in PMNs over 48 h of LVS infection, whereas BAX mRNA and protein were progressively down-regulated. These data strongly suggest that antiapoptotic and pro-survival mechanisms collaborate to sustain the viability of F. tularensis infected neutrophils. PMID:22986450

Electrochemical detection of synthetic DNA and native 16S rRNA fragments on a microarray using a biotinylated intercalator as coupling site for an enzyme label.

PubMed

Zimdars, Andreas; Gebala, Magdalena; Hartwich, Gerhard; Neugebauer, Sebastian; Schuhmann, Wolfgang

2015-10-01

The direct electrochemical detection of synthetic DNA and native 16S rRNA fragments isolated from Escherichia coli is described. Oligonucleotides are detected via selective post-labeling of double stranded DNA and DNA-RNA duplexes with a biotinylated intercalator that enables high-specific binding of a streptavidin/alkaline phosphatase conjugate. The alkaline phosphatase catalyzes formation of p-aminophenol that is subsequently oxidized at the underlying gold electrode and hence enables the detection of complementary hybridization of the DNA capture strands due to the enzymatic signal amplification. The hybridization assay was performed on microarrays consisting of 32 individually addressable gold microelectrodes. Synthetic DNA strands with sequences representing six different pathogens which are important for the diagnosis of urinary tract infections could be detected at concentrations of 60 nM. Native 16S rRNA isolated from the different pathogens could be detected at a concentration of 30 fM. Optimization of the sensing surface is described and influences on the assay performance are discussed. Copyright © 2015 Elsevier B.V. All rights reserved.

Microarray Я US: a user-friendly graphical interface to Bioconductor tools that enables accurate microarray data analysis and expedites comprehensive functional analysis of microarray results.

PubMed

Dai, Yilin; Guo, Ling; Li, Meng; Chen, Yi-Bu

2012-06-08

Microarray data analysis presents a significant challenge to researchers who are unable to use the powerful Bioconductor and its numerous tools due to their lack of knowledge of R language. Among the few existing software programs that offer a graphic user interface to Bioconductor packages, none have implemented a comprehensive strategy to address the accuracy and reliability issue of microarray data analysis due to the well known probe design problems associated with many widely used microarray chips. There is also a lack of tools that would expedite the functional analysis of microarray results. We present Microarray Я US, an R-based graphical user interface that implements over a dozen popular Bioconductor packages to offer researchers a streamlined workflow for routine differential microarray expression data analysis without the need to learn R language. In order to enable a more accurate analysis and interpretation of microarray data, we incorporated the latest custom probe re-definition and re-annotation for Affymetrix and Illumina chips. A versatile microarray results output utility tool was also implemented for easy and fast generation of input files for over 20 of the most widely used functional analysis software programs. Coupled with a well-designed user interface, Microarray Я US leverages cutting edge Bioconductor packages for researchers with no knowledge in R language. It also enables a more reliable and accurate microarray data analysis and expedites downstream functional analysis of microarray results.

Description of a local cardiac adiponectin system and its deregulation in dilated cardiomyopathy.

PubMed

Skurk, Carsten; Wittchen, Frank; Suckau, Lennart; Witt, Henning; Noutsias, Michael; Fechner, Henry; Schultheiss, Heinz-Peter; Poller, Wolfgang

2008-05-01

Despite recent advances in medical therapy, heart failure remains a leading cause for cardiovascular mortality, and its complex pathogenesis is incompletely understood. This study was performed to identify possible new therapeutic targets in dilated cardiomyopathy (DCM). Oligonucleotide microarray analysis was performed on endomyocardial biopsies (EMBs) from patients with early DCM (LVEDD > or = 55 mm, LVEF < or = 55%, n = 5) and control subjects (LVEDD < 55 mm, LVEF > 60%, no cardiac pathology, n = 4). Adiponectin, an adipocytokine involved in cellular metabolism, survival, and immunmodulation, was six-fold downregulated in DCM patients. Microarray data for adiponectin were confirmed by TaqMan-PCR (9.2-fold downregulation, control n= 9 vs. DCM n= 9, respectively, P < 0.05). Immunohistological analysis of EMBs showed significant downregulation of cardiac adiponectin protein expression independent of serum adiponectin (P = 0.36, ns) or serum TNFalpha concentrations (P = 0.46, ns). Neither the adiponectin receptor 1 (adipo-R1) nor adipo-R2 was deregulated in early DCM. Adiponectin mRNA and protein downregulation were confirmed in explanted hearts of patients with advanced DCM (LVEF < 25%, n= 8). In vitro, adiponectin incubation of neonatal rat ventricular myocytes led to activation of the pro-survival kinase PKB/Akt, increased eNOS-phosphorylation, and prevented stress-induced apoptosis of cardiomyocytes in an Akt-dependent manner. Moreover, inhibition of adiponectin secretion was accompanied by an increase in the expression of the cytokine and its receptors. These data indicate the existence of a local cardiac adiponectin system regulated independent of adiponectin and TNFalpha serum levels and its disturbance in cardiac pathology. The study suggests a role for adiponectin in the pathogenesis of DCM and implicates the adipocytokine as a possible future therapeutic target in DCM.

Mechanical stretch is a highly selective regulator of gene expression in human bladder smooth muscle cells.

PubMed

Adam, Rosalyn M; Eaton, Samuel H; Estrada, Carlos; Nimgaonkar, Ashish; Shih, Shu-Ching; Smith, Lois E H; Kohane, Isaac S; Bägli, Darius; Freeman, Michael R

2004-12-15

Application of mechanical stimuli has been shown to alter gene expression in bladder smooth muscle cells (SMC). To date, only a limited number of "stretch-responsive" genes in this cell type have been reported. We employed oligonucleotide arrays to identify stretch-sensitive genes in primary culture human bladder SMC subjected to repetitive mechanical stimulation for 4 h. Differential gene expression between stretched and nonstretched cells was assessed using Significance Analysis of Microarrays (SAM). Expression of 20 out of 11,731 expressed genes ( approximately 0.17%) was altered >2-fold following stretch, with 19 genes induced and one gene (FGF-9) repressed. Using real-time RT-PCR, we tested independently the responsiveness of 15 genes to stretch and to platelet-derived growth factor-BB (PDGF-BB), another hypertrophic stimulus for bladder SMC. In response to both stimuli, expression of 13 genes increased, 1 gene (FGF-9) decreased, and 1 gene was unchanged. Six transcripts (HB-EGF, BMP-2, COX-2, LIF, PAR-2, and FGF-9) were evaluated using an ex vivo rat model of bladder distension. HB-EGF, BMP-2, COX-2, LIF, and PAR-2 increased with bladder stretch ex vivo, whereas FGF-9 decreased, consistent with expression changes observed in vitro. In silico analysis of microarray data using the FIRED algorithm identified c-jun, AP-1, ATF-2, and neurofibromin-1 (NF-1) as potential transcriptional mediators of stretch signals. Furthermore, the promoters of 9 of 13 stretch-responsive genes contained AP-1 binding sites. These observations identify stretch as a highly selective regulator of gene expression in bladder SMC. Moreover, they suggest that mechanical and growth factor signals converge on common transcriptional regulators that include members of the AP-1 family.

Microbial distributions detected by an oligonucleotide microarray across geochemical zones associated with methane in marine sediments from the Ulleung Basin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Briggs, Brandon R; Graw, Michael; Brodie, Eoin L

2013-11-01

The biogeochemical processes that occur in marine sediments on continental margins are complex; however, from one perspective they can be considered with respect to three geochemical zones based on the presence and form of methane: sulfate–methane transition (SMTZ), gas hydrate stability zone (GHSZ), and free gas zone (FGZ). These geochemical zones may harbor distinct microbial communities that are important in biogeochemical carbon cycles. The objective of this study was to describe the microbial communities in sediments from the SMTZ, GHSZ, and FGZ using molecular ecology methods (i.e. PhyloChip microarray analysis and terminal restriction fragment length polymorphism (T-RFLP)) and examining themore » results in the context of non-biological parameters in the sediments. Non-metric multidimensional scaling and multi-response permutation procedures were used to determine whether microbial community compositions were significantly different in the three geochemical zones and to correlate samples with abiotic characteristics of the sediments. This analysis indicated that microbial communities from all three zones were distinct from one another and that variables such as sulfate concentration, hydrate saturation of the nearest gas hydrate layer, and depth (or unmeasured variables associated with depth e.g. temperature, pressure) were correlated to differences between the three zones. The archaeal anaerobic methanotrophs typically attributed to performing anaerobic oxidation of methane were not detected in the SMTZ; however, the marine benthic group-B, which is often found in SMTZ, was detected. Within the GHSZ, samples that were typically closer to layers that contained higher hydrate saturation had indicator sequences related to Vibrio-type taxa. These results suggest that the biogeographic patterns of microbial communities in marine sediments are distinct based on geochemical zones defined by methane.« less

A novel 4p16.3 microduplication distal to WHSC1 and WHSC2 characterized by oligonucleotide array with new phenotypic features.

PubMed

Cyr, Andrew B; Nimmakayalu, Manjunath; Longmuir, Susannah Q; Patil, Shivanand R; Keppler-Noreuil, Kim M; Shchelochkov, Oleg A

2011-09-01

Larger imbalances on chromosome 4p in the form of deletions associated with Wolf-Hirschhorn syndrome (WHS) and duplications of chromosome 4p have a defined clinical phenotype. The critical region for both these clinical disorders has been narrowed based on the genotype-phenotype correlations. However, cryptic rearrangements in this region have been reported infrequently. We report on a male patient with a microduplication of chromosome 4p, who presents with findings of macrocephaly, irregular iris pigmentation-heterochromia, and preserved linear growth in addition to overlapping features of trisomy 4p such as seizures, delayed psychomotor development, and dysmorphic features including prominent glabella, low-set ears, and short neck. Using a high-density oligonucleotide microarray, we have identified a novel submicroscopic duplication involving dosage sensitive genes TACC3, FGFR3, and LETM1. The microduplication did not involve WHSC1 and WHSC2 which are considered in the critical region for WHS and trisomy 4p. This patient's presentation and genomic findings help further delineate clinical significance of re-arrangements in the 4p16 region without the involvement of WHS critical region. Copyright © 2011 Wiley-Liss, Inc.

Identification of differentially regulated transcripts in mouse striatum following methamphetamine treatment--an oligonucleotide microarray approach.

PubMed

Thomas, David M; Francescutti-Verbeem, Dina M; Liu, Xiuli; Kuhn, Donald M

2004-01-01

Methamphetamine is an addictive drug of abuse that can produce neurotoxic effects in dopamine nerve endings of the striatum. The purpose of this study was to identify new genes that may play a role in the highly complex cascade of events associated with methamphetamine intoxication. Using Affymetrix oligonucleotide arrays, 12 488 genes were simultaneously interrogated and there were 152 whose expression levels were changed following methamphetamine treatment. The genes are grouped into broad functional categories with inflammatory/immune response elements, receptor/signal transduction components and ion channel/transport proteins among the most populated. Many genes within these categories can be linked to ion regulation and apoptosis, both of which have been implicated in methamphetamine toxicity, and numerous factors associated with microglial activation emerged with significant changes in expression. For example, brain-derived neurotrophic factor (BDNF), chemokine (C-C) receptor 6 (CCr6) and numerous chemokine transcripts were increased or decreased in expression more than 2.8-fold. These results point to activated microglia as a potential source of the reactive oxygen/nitrogen species and cytokines that have been previously associated with methamphetamine toxicity and other neurotoxic conditions.

Transcriptome changes favoring intramuscular fat deposition in the longissimus muscle following castration of bulls.

PubMed

Jeong, J; Bong, J; Kim, G D; Joo, S T; Lee, H-J; Baik, M

2013-10-01

Castration increases intramuscular fat (IMF) deposition, improving beef quality in cattle. The present study was performed to determine the global transcriptome changes following castration of bulls and to identify genes associated with IMF deposition in the longissimus dorsi (LM) of Korean cattle. A customized bovine CombiMatrix oligonucleotide microarray was constructed, and transcriptome changes following castration were determined by microarray hybridization. Transcriptome comparison between bulls and steers indicated that 428 of 8,407 genes were differentially expressed in the LM by greater than two fold (P < 0.05). Gene expression profiling indicated alterations in several pathways, including adipogenesis, fatty acid oxidation, tricarboxylic acid (TCA) cycle, and oxidative phosphorylation (OP), following castration. Castration upregulated transcription of adipogenic perilipin 2 (PLIN2) and visfatin, lipogenic fatty acid synthase, fatty acid esterification 1-acylglycerol-3-phosphate O-acyltransferase 5, and many fatty acid oxidation-related genes. Many TCA cycle and OP genes were also transcriptionally upregulated. Correlation analysis indicated that the IMF content in the LM was highly correlated with mRNA levels of PLIN2 (r = 0.70, P < 0.001), adenosine triphosphatase (ATPase), H(+)-transporting, lysosomal 42 kDa, V1 subunit C1 (ATP6V1C1: r = 0.66, P < 0.001), and cytochrome c oxidase assembly homolog 11 (COX11: r = 0.72, P < 0.001) genes in a pooled animal group of steers plus bulls, and significant correlations in the steer-alone group were maintained in the 3 genes, PLIN2 (r = 0.47, P < 0.05), ATP6V1C1 (r = 0.50, P < 0.05), and COX11 (r = 0.60, P < 0.01). In conclusion, our study provided evidence that castration shifts transcription of lipid metabolism genes, favoring IMF deposition by increasing adipogenesis, lipogenesis, and triglyceride synthesis. This study also indicated that castration increases transcription of genes involved in fatty acid oxidation and subsequent energy production (TCA and OP genes). Our microarray analysis provided novel information that castration alters the transcriptome associated with lipid/energy metabolism, favoring IMF deposition in the LM.

Development and application of a 6.5 million feature Affymetrix Genechip® for massively parallel discovery of single position polymorphisms in lettuce (Lactuca spp.)

PubMed Central

2012-01-01

Background High-resolution genetic maps are needed in many crops to help characterize the genetic diversity that determines agriculturally important traits. Hybridization to microarrays to detect single feature polymorphisms is a powerful technique for marker discovery and genotyping because of its highly parallel nature. However, microarrays designed for gene expression analysis rarely provide sufficient gene coverage for optimal detection of nucleotide polymorphisms, which limits utility in species with low rates of polymorphism such as lettuce (Lactuca sativa). Results We developed a 6.5 million feature Affymetrix GeneChip® for efficient polymorphism discovery and genotyping, as well as for analysis of gene expression in lettuce. Probes on the microarray were designed from 26,809 unigenes from cultivated lettuce and an additional 8,819 unigenes from four related species (L. serriola, L. saligna, L. virosa and L. perennis). Where possible, probes were tiled with a 2 bp stagger, alternating on each DNA strand; providing an average of 187 probes covering approximately 600 bp for each of over 35,000 unigenes; resulting in up to 13 fold redundancy in coverage per nucleotide. We developed protocols for hybridization of genomic DNA to the GeneChip® and refined custom algorithms that utilized coverage from multiple, high quality probes to detect single position polymorphisms in 2 bp sliding windows across each unigene. This allowed us to detect greater than 18,000 polymorphisms between the parental lines of our core mapping population, as well as numerous polymorphisms between cultivated lettuce and wild species in the lettuce genepool. Using marker data from our diversity panel comprised of 52 accessions from the five species listed above, we were able to separate accessions by species using both phylogenetic and principal component analyses. Additionally, we estimated the diversity between different types of cultivated lettuce and distinguished morphological types. Conclusion By hybridizing genomic DNA to a custom oligonucleotide array designed for maximum gene coverage, we were able to identify polymorphisms using two approaches for pair-wise comparisons, as well as a highly parallel method that compared all 52 genotypes simultaneously. PMID:22583801

Development and application of a 6.5 million feature Affymetrix Genechip® for massively parallel discovery of single position polymorphisms in lettuce (Lactuca spp.).

PubMed

Stoffel, Kevin; van Leeuwen, Hans; Kozik, Alexander; Caldwell, David; Ashrafi, Hamid; Cui, Xinping; Tan, Xiaoping; Hill, Theresa; Reyes-Chin-Wo, Sebastian; Truco, Maria-Jose; Michelmore, Richard W; Van Deynze, Allen

2012-05-14

High-resolution genetic maps are needed in many crops to help characterize the genetic diversity that determines agriculturally important traits. Hybridization to microarrays to detect single feature polymorphisms is a powerful technique for marker discovery and genotyping because of its highly parallel nature. However, microarrays designed for gene expression analysis rarely provide sufficient gene coverage for optimal detection of nucleotide polymorphisms, which limits utility in species with low rates of polymorphism such as lettuce (Lactuca sativa). We developed a 6.5 million feature Affymetrix GeneChip® for efficient polymorphism discovery and genotyping, as well as for analysis of gene expression in lettuce. Probes on the microarray were designed from 26,809 unigenes from cultivated lettuce and an additional 8,819 unigenes from four related species (L. serriola, L. saligna, L. virosa and L. perennis). Where possible, probes were tiled with a 2 bp stagger, alternating on each DNA strand; providing an average of 187 probes covering approximately 600 bp for each of over 35,000 unigenes; resulting in up to 13 fold redundancy in coverage per nucleotide. We developed protocols for hybridization of genomic DNA to the GeneChip® and refined custom algorithms that utilized coverage from multiple, high quality probes to detect single position polymorphisms in 2 bp sliding windows across each unigene. This allowed us to detect greater than 18,000 polymorphisms between the parental lines of our core mapping population, as well as numerous polymorphisms between cultivated lettuce and wild species in the lettuce genepool. Using marker data from our diversity panel comprised of 52 accessions from the five species listed above, we were able to separate accessions by species using both phylogenetic and principal component analyses. Additionally, we estimated the diversity between different types of cultivated lettuce and distinguished morphological types. By hybridizing genomic DNA to a custom oligonucleotide array designed for maximum gene coverage, we were able to identify polymorphisms using two approaches for pair-wise comparisons, as well as a highly parallel method that compared all 52 genotypes simultaneously.

Identification of sequence motifs in oligonucleotides whose presence is correlated with antisense activity

PubMed Central

Matveeva, O. V.; Tsodikov, A. D.; Giddings, M.; Freier, S. M.; Wyatt, J. R.; Spiridonov, A. N.; Shabalina, S. A.; Gesteland, R. F.; Atkins, J. F.

2000-01-01

Design of antisense oligonucleotides targeting any mRNA can be much more efficient when several activity-enhancing motifs are included and activity-decreasing motifs are avoided. This conclusion was made after statistical analysis of data collected from >1000 experiments with phosphorothioate-modified oligonucleotides. Highly significant positive correlation between the presence of motifs CCAC, TCCC, ACTC, GCCA and CTCT in the oligonucleotide and its antisense efficiency was demonstrated. In addition, negative correlation was revealed for the motifs GGGG, ACTG, AAA and TAA. It was found that the likelihood of activity of an oligonucleotide against a desired mRNA target is sequence motif content dependent. PMID:10908347

Genome-wide polymorphisms and development of a microarray platform to detect genetic variations in Plasmodium yoelii.

PubMed

Nair, Sethu C; Pattaradilokrat, Sittiporn; Zilversmit, Martine M; Dommer, Jennifer; Nagarajan, Vijayaraj; Stephens, Melissa T; Xiao, Wenming; Tan, John C; Su, Xin-Zhuan

2014-01-01

The rodent malaria parasite Plasmodium yoelii is an important model for studying malaria immunity and pathogenesis. One approach for studying malaria disease phenotypes is genetic mapping, which requires typing a large number of genetic markers from multiple parasite strains and/or progeny from genetic crosses. Hundreds of microsatellite (MS) markers have been developed to genotype the P. yoelii genome; however, typing a large number of MS markers can be labor intensive, time consuming, and expensive. Thus, development of high-throughput genotyping tools such as DNA microarrays that enable rapid and accurate large-scale genotyping of the malaria parasite will be highly desirable. In this study, we sequenced the genomes of two P. yoelii strains (33X and N67) and obtained a large number of single nucleotide polymorphisms (SNPs). Based on the SNPs obtained, we designed sets of oligonucleotide probes to develop a microarray that could interrogate ∼11,000 SNPs across the 14 chromosomes of the parasite in a single hybridization. Results from hybridizations of DNA samples of five P. yoelii strains or cloned lines (17XNL, YM, 33X, N67 and N67C) and two progeny from a genetic cross (N67×17XNL) to the microarray showed that the array had a high call rate (∼97%) and accuracy (99.9%) in calling SNPs, providing a simple and reliable tool for typing the P. yoelii genome. Our data show that the P. yoelii genome is highly polymorphic, although isogenic pairs of parasites were also detected. Additionally, our results indicate that the 33X parasite is a progeny of 17XNL (or YM) and an unknown parasite. The highly accurate and reliable microarray developed in this study will greatly facilitate our ability to study the genetic basis of important traits and the disease it causes. Published by Elsevier B.V.

PhyloFlu, a DNA microarray for determining the phylogenetic origin of influenza A virus gene segments and the genomic fingerprint of viral strains.

PubMed

Paulin, Luis F; de los D Soto-Del Río, María; Sánchez, Iván; Hernández, Jesús; Gutiérrez-Ríos, Rosa M; López-Martínez, Irma; Wong-Chew, Rosa M; Parissi-Crivelli, Aurora; Isa, P; López, Susana; Arias, Carlos F

2014-03-01

Recent evidence suggests that most influenza A virus gene segments can contribute to the pathogenicity of the virus. In this regard, the hemagglutinin (HA) subtype of the circulating strains has been closely surveyed, but the reassortment of internal gene segments is usually not monitored as a potential source of an increased pathogenicity. In this work, an oligonucleotide DNA microarray (PhyloFlu) designed to determine the phylogenetic origins of the eight segments of the influenza virus genome was constructed and validated. Clades were defined for each segment and also for the 16 HA and 9 neuraminidase (NA) subtypes. Viral genetic material was amplified by reverse transcription-PCR (RT-PCR) with primers specific to the conserved 5' and 3' ends of the influenza A virus genes, followed by PCR amplification with random primers and Cy3 labeling. The microarray unambiguously determined the clades for all eight influenza virus genes in 74% (28/38) of the samples. The microarray was validated with reference strains from different animal origins, as well as from human, swine, and avian viruses from field or clinical samples. In most cases, the phylogenetic clade of each segment defined its animal host of origin. The genomic fingerprint deduced by the combined information of the individual clades allowed for the determination of the time and place that strains with the same genomic pattern were previously reported. PhyloFlu is useful for characterizing and surveying the genetic diversity and variation of animal viruses circulating in different environmental niches and for obtaining a more detailed surveillance and follow up of reassortant events that can potentially modify virus pathogenicity.

Targeted delivery of an antisense oligonucleotide in the retina: uptake, distribution, stability, and effect.

PubMed

Rakoczy, P E; Lai, M C; Watson, M; Seydel, U; Constable, I

1996-01-01

In this article, we describe the preliminary results of the development of an animal model that will enable us to study the effect of photoreceptor-derived debris accumulation on the normal function of the retina in vivo. An antisense oligonucleotide (Cat 5), saline, and two control oligonucleotides were injected into the vitreous of 7-week-old RCS-rdy+ rats. The uptake, distribution, and persistence of the antisense oligonucleotide in the retina was demonstrated by fluorescent confocal microscopy, and the stability of the oligonucleotide was shown by GeneScan analysis using a fluorescein-labeled derivative of Cat 5 (Cat 5F). The accumulation of photoreceptor-derived debris was monitored by the number of undigested phagosomes in the RPE layer by light microscopy. Following intravitreal injection of Cat 5F, penetration of the oligonucleotide was observed in the ganglion cell layer in 2 hours and in the photoreceptor and pigment epithelial layers 3 days later. However, at 7, 28, and 56 days postinjection, only the RPE layer had significant amounts of Cat 5F present. Using GeneScan analysis, it was demonstrated that the fluorescein-labeled oligonucleotide present in the RPE layer was not degraded and it retained its original 19-mer length. There was no statistically significant difference in the number of phagosomes found in the RPE layer of control uninjected, saline-injected, and two sense and two antisense oligonucleotides-injected animals at 7 and 28 days postinjection. In contrast, the number of phagosomes was significantly higher (p < 0.001) in the RPE layer of Cat 5 antisense oligonucleotide-injected animals at 7 and 28 days postinjection. This difference, however, disappeared by 56 days postinjection. The inner nuclear layers of the retina of control and experimental animals were not affected by the injections.

Chemical genomic screening for methylation-silenced genes in gastric cancer cell lines using 5-aza-2'-deoxycytidine treatment and oligonucleotide microarray.

PubMed

Yamashita, Satoshi; Tsujino, Yoshimi; Moriguchi, Kazuki; Tatematsu, Masae; Ushijima, Toshikazu

2006-01-01

To identify novel methylation-silenced genes in gastric cancers, we carried out a chemical genomic screening, a genome-wide search for genes upregulated by treatment with a demethylating agent, 5-aza-2'-deoxycytidine (5-aza-dC). After 5-aza-dC treatment of a gastric cancer cell line (AGS) 579 genes were upregulated 16-fold or more, using an oligonucleotide microarray with 39,000 genes. From these genes, we selected 44 known genes on autosomes whose silencing in gastric cancer has not been reported. Thirty-two of these had CpG islands (CGI) in their putative promoter regions, and all of the CGI were methylated in AGS, giving an estimated number of 421+/-75 (95% confidence interval) methylation-silenced genes. Additionally, we analyzed the methylation status of 16 potential tumor-related genes with promoter CGI that were upregulated four-fold or more, and 14 of these were methylated in AGS. Methylation status of the 32 randomly selected and 16 potential tumor-related genes was analyzed in 10 primary gastric cancers, and 42 genes (ABHD9, ADFP, ALDH1A3, ANXA5, AREG, BDNF, BMP7, CAV1, CDH2, CLDN3, CTSL, EEF1A2, F2R, FADS1, FSD1, FST, FYN, GPR54, GREM1, IGFBP3, IGFBP7, IRS2, KISS1, MARK1, MLF1, MSX1, MTSS1, NT5E, PAX6, PLAGL1, PLAU, PPIC, RBP4, RORA, SCRN1, TBX3, TFAP2C, TNFSF9, ULBP2, WIF1, ZNF177 and ZNF559) were methylated in at least one primary gastric cancer. A metastasis suppressor gene, MTSS1, was located in a genomic region with frequent loss of heterozygosity (8q22), and was expressed abundantly in the normal gastric mucosa, suggesting its role in gastric carcinogenesis. (Cancer Sci 2006; 97: 64 -71). (Cancer Sci 2006; 97: 64 -71).

Time-series oligonucleotide count to assign antiviral siRNAs with long utility fit in the big data era.

PubMed

Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T

2017-10-01

Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the 'awaiting-type oligonucleotide'; the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility.

Accurate and rapid modeling of iron-bleomycin-induced DNA damage using tethered duplex oligonucleotides and electrospray ionization ion trap mass spectrometric analysis.

PubMed

Harsch, A; Marzilli, L A; Bunt, R C; Stubbe, J; Vouros, P

2000-05-01

Bleomycin B(2)(BLM) in the presence of iron [Fe(II)] and O(2)catalyzes single-stranded (ss) and double-stranded (ds) cleavage of DNA. Electrospray ionization ion trap mass spectrometry was used to monitor these cleavage processes. Two duplex oligonucleotides containing an ethylene oxide tether between both strands were used in this investigation, allowing facile monitoring of all ss and ds cleavage events. A sequence for site-specific binding and cleavage by Fe-BLM was incorporated into each analyte. One of these core sequences, GTAC, is a known hot-spot for ds cleavage, while the other sequence, GGCC, is a hot-spot for ss cleavage. Incubation of each oligo-nucleotide under anaerobic conditions with Fe(II)-BLM allowed detection of the non-covalent ternary Fe-BLM/oligonucleotide complex in the gas phase. Cleavage studies were then performed utilizing O(2)-activated Fe(II)-BLM. No work-up or separation steps were required and direct MS and MS/MS analyses of the crude reaction mixtures confirmed sequence-specific Fe-BLM-induced cleavage. Comparison of the cleavage patterns for both oligonucleotides revealed sequence-dependent preferences for ss and ds cleavages in accordance with previously established gel electrophoresis analysis of hairpin oligonucleotides. This novel methodology allowed direct, rapid and accurate determination of cleavage profiles of model duplex oligonucleotides after exposure to activated Fe-BLM.

Single-Cell in Situ RNA Analysis With Switchable Fluorescent Oligonucleotides.

PubMed

Xiao, Lu; Guo, Jia

2018-01-01

Comprehensive RNA analyses in individual cells in their native spatial contexts promise to transform our understanding of normal physiology and disease pathogenesis. Here we report a single-cell in situ RNA analysis approach using switchable fluorescent oligonucleotides (SFO). In this method, transcripts are first hybridized by pre-decoding oligonucleotides. These oligonucleotides subsequently recruit SFO to stain their corresponding RNA targets. After fluorescence imaging, all the SFO in the whole specimen are simultaneously removed by DNA strand displacement reactions. Through continuous cycles of target staining, fluorescence imaging, and SFO removal, a large number of different transcripts can be identified by unique fluorophore sequences and visualized at the optical resolution. To demonstrate the feasibility of this approach, we show that the hybridized SFO can be efficiently stripped by strand displacement reactions within 30 min. We also demonstrate that this SFO removal process maintains the integrity of the RNA targets and the pre-decoding oligonucleotides, and keeps them hybridized. Applying this approach, we show that transcripts can be restained in at least eight hybridization cycles with high analysis accuracy, which theoretically would enable the whole transcriptome to be quantified at the single molecule sensitivity in individual cells. This in situ RNA analysis technology will have wide applications in systems biology, molecular diagnosis, and targeted therapies.

Analysis of High-Throughput ELISA Microarray Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, Amanda M.; Daly, Don S.; Zangar, Richard C.

Our research group develops analytical methods and software for the high-throughput analysis of quantitative enzyme-linked immunosorbent assay (ELISA) microarrays. ELISA microarrays differ from DNA microarrays in several fundamental aspects and most algorithms for analysis of DNA microarray data are not applicable to ELISA microarrays. In this review, we provide an overview of the steps involved in ELISA microarray data analysis and how the statistically sound algorithms we have developed provide an integrated software suite to address the needs of each data-processing step. The algorithms discussed are available in a set of open-source software tools (http://www.pnl.gov/statistics/ProMAT).

EzArray: A web-based highly automated Affymetrix expression array data management and analysis system

PubMed Central

Zhu, Yuerong; Zhu, Yuelin; Xu, Wei

2008-01-01

Background Though microarray experiments are very popular in life science research, managing and analyzing microarray data are still challenging tasks for many biologists. Most microarray programs require users to have sophisticated knowledge of mathematics, statistics and computer skills for usage. With accumulating microarray data deposited in public databases, easy-to-use programs to re-analyze previously published microarray data are in high demand. Results EzArray is a web-based Affymetrix expression array data management and analysis system for researchers who need to organize microarray data efficiently and get data analyzed instantly. EzArray organizes microarray data into projects that can be analyzed online with predefined or custom procedures. EzArray performs data preprocessing and detection of differentially expressed genes with statistical methods. All analysis procedures are optimized and highly automated so that even novice users with limited pre-knowledge of microarray data analysis can complete initial analysis quickly. Since all input files, analysis parameters, and executed scripts can be downloaded, EzArray provides maximum reproducibility for each analysis. In addition, EzArray integrates with Gene Expression Omnibus (GEO) and allows instantaneous re-analysis of published array data. Conclusion EzArray is a novel Affymetrix expression array data analysis and sharing system. EzArray provides easy-to-use tools for re-analyzing published microarray data and will help both novice and experienced users perform initial analysis of their microarray data from the location of data storage. We believe EzArray will be a useful system for facilities with microarray services and laboratories with multiple members involved in microarray data analysis. EzArray is freely available from . PMID:18218103

A microarray for assessing transcription from pelagic marine microbial taxa

PubMed Central

Shilova, Irina N; Robidart, Julie C; James Tripp, H; Turk-Kubo, Kendra; Wawrik, Boris; Post, Anton F; Thompson, Anne W; Ward, Bess; Hollibaugh, James T; Millard, Andy; Ostrowski, Martin; J Scanlan, David; Paerl, Ryan W; Stuart, Rhona; Zehr, Jonathan P

2014-01-01

Metagenomic approaches have revealed unprecedented genetic diversity within microbial communities across vast expanses of the world's oceans. Linking this genetic diversity with key metabolic and cellular activities of microbial assemblages is a fundamental challenge. Here we report on a collaborative effort to design MicroTOOLs (Microbiological Targets for Ocean Observing Laboratories), a high-density oligonucleotide microarray that targets functional genes of diverse taxa in pelagic and coastal marine microbial communities. MicroTOOLs integrates nucleotide sequence information from disparate data types: genomes, PCR-amplicons, metagenomes, and metatranscriptomes. It targets 19 400 unique sequences over 145 different genes that are relevant to stress responses and microbial metabolism across the three domains of life and viruses. MicroTOOLs was used in a proof-of-concept experiment that compared the functional responses of microbial communities following Fe and P enrichments of surface water samples from the North Pacific Subtropical Gyre. We detected transcription of 68% of the gene targets across major taxonomic groups, and the pattern of transcription indicated relief from Fe limitation and transition to N limitation in some taxa. Prochlorococcus (eHLI), Synechococcus (sub-cluster 5.3) and Alphaproteobacteria SAR11 clade (HIMB59) showed the strongest responses to the Fe enrichment. In addition, members of uncharacterized lineages also responded. The MicroTOOLs microarray provides a robust tool for comprehensive characterization of major functional groups of microbes in the open ocean, and the design can be easily amended for specific environments and research questions. PMID:24477198

Detection of microbial communities in continuous and discontinuous membrane bioreactor using high-density oligonucleotide Microarray

NASA Astrophysics Data System (ADS)

Duan, Liang; Song, Yonghui; Xia, Siqing; Hermanowicz, Slawomir W.

2010-11-01

This study compared the whole composition of microbial communities in continuous-flow (MBR) and batch-fed (discontinuous) (MSBR) aerobic membrane bioreactors using high-density universal 16S rRNA Microarray. The array includes 506,944 probes targeted to 8935 clusters in 16S rRNA gene sequences. The Microarray results showed that both MBR and MSBR had high microbial diversity. 1126 and 1002 bacterial subfamilies were detected and can separate as 37 and 32 phyla in MBR and MSBR, respectively. Proteobacteria was the predominant phylum, 703 and 597 subfamilies were found in two systems, which constituted 62.4% and 59.6% of the whole bacteria. Gamma- and Alpha-were the dominant classes in Proteobacteria. It occupied 38.1% and 26.3%, 31.2% and 39.2% for MBR and MSBR, respectively. Bacteroidetes, Firmicutes and Actinobacteria were the subdominant groups, occupying around 9.4% and 7.6%, 6.1% and 6.5%, 6.0% and 9.0% of the total bacteria in two reactors. Some bacterial groups such as Acidobacteria, Chloroflexi, Cyanobacteria, Verrucomicrobia and Spirochaetes also found more than 15 subfamilies. All the results indicated that the MBR system had more bacteria community diversity than MSBR's. Moreover, it was very interested that MBR and MSBR had almost the same bacterial composition except Enterobacteriaceae. 63 OTUs of Enterobacteriaceae were detected in MBR, while just 10 OTUs were found in MSBR. That's one of the reasons leading to the difference of the bacterial diversity between two bioreactors.

Genome-Wide Requirements for Resistance to Functionally Distinct DNA-Damaging Agents

PubMed Central

Proctor, Michael; Flaherty, Patrick; Jordan, Michael I; Arkin, Adam P; Davis, Ronald W; Nislow, Corey; Giaever, Guri

2005-01-01

The mechanistic and therapeutic differences in the cellular response to DNA-damaging compounds are not completely understood, despite intense study. To expand our knowledge of DNA damage, we assayed the effects of 12 closely related DNA-damaging agents on the complete pool of ~4,700 barcoded homozygous deletion strains of Saccharomyces cerevisiae. In our protocol, deletion strains are pooled together and grown competitively in the presence of compound. Relative strain sensitivity is determined by hybridization of PCR-amplified barcodes to an oligonucleotide array carrying the barcode complements. These screens identified genes in well-characterized DNA-damage-response pathways as well as genes whose role in the DNA-damage response had not been previously established. High-throughput individual growth analysis was used to independently confirm microarray results. Each compound produced a unique genome-wide profile. Analysis of these data allowed us to determine the relative importance of DNA-repair modules for resistance to each of the 12 profiled compounds. Clustering the data for 12 distinct compounds uncovered both known and novel functional interactions that comprise the DNA-damage response and allowed us to define the genetic determinants required for repair of interstrand cross-links. Further genetic analysis allowed determination of epistasis for one of these functional groups. PMID:16121259

Current genetic methodologies in the identification of disaster victims and in forensic analysis.

PubMed

Ziętkiewicz, Ewa; Witt, Magdalena; Daca, Patrycja; Zebracka-Gala, Jadwiga; Goniewicz, Mariusz; Jarząb, Barbara; Witt, Michał

2012-02-01

This review presents the basic problems and currently available molecular techniques used for genetic profiling in disaster victim identification (DVI). The environmental conditions of a mass disaster often result in severe fragmentation, decomposition and intermixing of the remains of victims. In such cases, traditional identification based on the anthropological and physical characteristics of the victims is frequently inconclusive. This is the reason why DNA profiling became the gold standard for victim identification in mass-casualty incidents (MCIs) or any forensic cases where human remains are highly fragmented and/or degraded beyond recognition. The review provides general information about the sources of genetic material for DNA profiling, the genetic markers routinely used during genetic profiling (STR markers, mtDNA and single-nucleotide polymorphisms [SNP]) and the basic statistical approaches used in DNA-based disaster victim identification. Automated technological platforms that allow the simultaneous analysis of a multitude of genetic markers used in genetic identification (oligonucleotide microarray techniques and next-generation sequencing) are also presented. Forensic and population databases containing information on human variability, routinely used for statistical analyses, are discussed. The final part of this review is focused on recent developments, which offer particularly promising tools for forensic applications (mRNA analysis, transcriptome variation in individuals/populations and genetic profiling of specific cells separated from mixtures).

Protective effect of bicyclol against bile duct ligation-induced hepatic fibrosis in rats

PubMed Central

Zhen, Yong-Zhan; Li, Na-Ren; He, Hong-Wei; Zhao, Shuang-Shuang; Zhang, Guang-Ling; Hao, Xiao-Fang; Shao, Rong-Guang

2015-01-01

AIM: To evaluate the protective effect of bicyclol against bile duct ligation (BDL)-induced hepatic fibrosis in rats. METHODS: Sprague-Dawley male rats underwent BDL and sham-operated animals were used as healthy controls. The BDL rats were divided into two groups which received sterilized PBS or bicyclol (100 mg/kg per day) orally for two consecutive weeks. Serum, urine and bile were collected for biochemical determinations. Liver tissues were collected for histological analysis and a whole genome oligonucleotide microarray assay. Reverse transcription-polymerase chain reaction and Western blotting were used to verify the expression of liver fibrosis-related genes. RESULTS: Treatment with bicyclol significantly reduced liver fibrosis and bile duct proliferation after BDL. The levels of alanine aminotransferase (127.7 ± 72.3 vs 230.4 ± 69.6, P < 0.05) and aspartate aminotransferase (696.8 ± 232.6 vs 1032.6 ± 165.8, P < 0.05) were also decreased by treatment with bicyclol in comparison to PBS. The expression changes of 45 fibrogenic genes and several fibrogenesis-related pathways were reversed by bicyclol in the microarray assay. Bicyclol significantly reduced liver mRNA and/or protein expression levels of collagen 1a1, matrix metalloproteinase 2, tumor necrosis factor, tissue inhibitors of metalloproteinases 2, transforming growth factor-β1 and α-smooth muscle actin. CONCLUSION: Bicyclol significantly attenuates BDL-induced liver fibrosis by reversing fibrogenic gene expression. These findings suggest that bicyclol might be an effective anti-fibrotic drug for the treatment of cholestatic liver disease. PMID:26109801

Dynamic of active microorganisms inhabiting a bioleaching industrial heap of low‐grade copper sulfide ore monitored by real‐time PCR and oligonucleotide prokaryotic acidophile microarray

PubMed Central

Remonsellez, Francisco; Galleguillos, Felipe; Moreno‐Paz, Mercedes; Parro, Víctor; Acosta, Mauricio; Demergasso, Cecilia

2009-01-01

Summary The bioleaching of metal sulfide has developed into a very important industrial process and understanding the microbial dynamic is key to advancing commercial bioleaching operations. Here we report the first quantitative description of the dynamic of active communities in an industrial bioleaching heap. Acidithiobacillus ferrooxidans was the most abundant during the first part of the leaching cycle, while the abundance of Leptospirillum ferriphilum and Ferroplasma acidiphilum increased with age of the heap. Acidithiobacillus thiooxidans kept constant throughout the leaching cycle, and Firmicutes group showed a low and a patchy distribution in the heap. The Acidiphilium‐like bacteria reached their highest abundance corresponding to the amount of autotrophs. The active microorganisms in the leaching system were determined using two RNA‐based sensitive techniques. In most cases, the 16S rRNA copy numbers of At. ferrooxidans, L. ferriphilum, At. thiooxidans and F. acidiphilum, was concomitant with the DNA copy numbers, whereas Acidiphilium‐like bacteria and some Firmicutes members did not show a clear correlation between 16S rRNA accumulation and DNA copy numbers. However, the prokaryotic acidophile microarray (PAM) analysis showed active members of Alphaproteobacteria in all samples and of Sulfobacillus genus in older ones. Also, new active groups such as Actinobacteria and Acidobacterium genus were detected by PAM. The results suggest that changes during the leaching cycle in chemical and physical conditions, such as pH and Fe3+/Fe2+ ion rate, are primary factors shaping the microbial dynamic in the heap. PMID:21255296

Microarray hybridization for assessment of the genetic stability of chimeric West Nile/dengue 4 virus.

PubMed

Laassri, Majid; Bidzhieva, Bella; Speicher, James; Pletnev, Alexander G; Chumakov, Konstantin

2011-05-01

Genetic stability is an important characteristic of live viral vaccines because an accumulation of mutants can cause reversion to a virulent phenotype as well as a loss of immunogenic properties. This study was aimed at evaluating the genetic stability of a live attenuated West Nile (WN) virus vaccine candidate that was generated by replacing the pre-membrane and envelope protein genes of dengue 4 virus with those from WN. Chimeric virus was serially propagated in Vero, SH-SY5Y human neuroblastoma and HeLa cells and screened for point mutations using hybridization with microarrays of overlapping oligonucleotide probes covering the entire genome. The analysis revealed several spontaneous mutations that led to amino acid changes, most of which were located in the envelope (E) and non-structural NS4A, NS4B, and NS5 proteins. Viruses passaged in Vero and SH-SY5Y cells shared two common mutations: G(2337) C (Met(457) Ile) in the E gene and A(6751) G (Lys(125) Arg) in the NS4A gene. Quantitative assessment of the contents of these mutants in viral stocks indicated that they accumulated independently with different kinetics during propagation in cell cultures. Mutant viruses grew better in Vero cells compared to the parental virus, suggesting that they have a higher fitness. When tested in newborn mice, the cell culture-passaged viruses did not exhibit increased neurovirulence. The approach described in this article could be useful for monitoring the molecular consistency and quality control of vaccine strains. Copyright © 2011 Wiley-Liss, Inc.

Microarray analysis sheds light on the dedifferentiating role of agouti signal protein in murine melanocytes via the Mc1r

PubMed Central

Le Pape, Elodie; Passeron, Thierry; Giubellino, Alessio; Valencia, Julio C.; Wolber, Rainer; Hearing, Vincent J.

2009-01-01

The melanocortin-1 receptor (MC1R) is a key regulator of pigmentation in mammals and is tightly linked to an increased risk of skin cancers, including melanoma, in humans. Physiologically activated by α-melanocyte stimulating hormone (αMSH), MC1R function can be antagonized by a secreted factor, agouti signal protein (ASP), which is responsible for the lighter phenotypes in mammals (including humans), and is also associated with increased risk of skin cancer. It is therefore of great interest to characterize the molecular effects elicited by those MC1R ligands. In this study, we determined the gene expression profiles of murine melan-a melanocytes treated with ASP or αMSH over a 4-day time course using genome-wide oligonucleotide microarrays. As expected, there were significant reductions in expression of numerous melanogenic proteins elicited by ASP, which correlates with its inhibition of pigmentation. ASP also unexpectedly modulated the expression of genes involved in various other cellular pathways, including glutathione synthesis and redox metabolism. Many genes up-regulated by ASP are involved in morphogenesis (especially in nervous system development), cell adhesion, and extracellular matrix-receptor interactions. Concomitantly, ASP enhanced the migratory potential and the invasiveness of melanocytic cells in vitro. These results demonstrate the role of ASP in the dedifferentiation of melanocytes, identify pigment-related genes targeted by ASP and by αMSH, and provide insights into the pleiotropic molecular effects of MC1R signaling that may function during development and may affect skin cancer risk. PMID:19174519

Microarray Hybridization for Assessment of the Genetic Stability of Chimeric West Nile/Dengue 4 Virus

PubMed Central

Laassri, Majid; Bidzhieva, Bella; Speicher, James; Pletnev, Alexander G.; Chumakov, Konstantin

2012-01-01

Genetic stability is an important characteristic of live viral vaccines because an accumulation of mutants can cause reversion to a virulent phenotype as well as a loss of immunogenic properties. This study was aimed at evaluating the genetic stability of a live attenuated West Nile (WN) virus vaccine candidate that was generated by replacing the pre-membrane and envelope protein genes of dengue 4 virus with those from WN. Chimeric virus was serially propagated in Vero, SH-SY5Y human neuroblastoma and HeLa cells and screened for point mutations using hybridization with microarrays of overlapping oligonucleotide probes covering the entire genome. The analysis revealed several spontaneous mutations that led to amino acid changes, most of which were located in the envelope (E) and non-structural NS4A, NS4B, and NS5 proteins. Viruses passaged in Vero and SH-SY5Y cells shared two common mutations: G2337C (Met457Ile) in the E gene and A6751G (Lys125Arg) in the NS4A gene. Quantitative assessment of the contents of these mutants in viral stocks indicated that they accumulated independently with different kinetics during propagation in cell cultures. Mutant viruses grew better in Vero cells compared to the parental virus, suggesting that they have a higher fitness. When tested in newborn mice, the cell culture-passaged viruses did not exhibit increased neurovirulence. The approach described in this paper could be useful for monitoring the molecular consistency and quality control of vaccine strains. PMID:21360544

Combinations of bacterial species associated with symptomatic endodontic infections in a Chinese population.

PubMed

Qi, Z; Cao, H; Jiang, H; Zhao, J; Tang, Z

2016-01-01

To use microarrays to detect 11 selected bacteria in infected root canals, revealing bacterial combinations that are associated with clinical symptoms and signs of primary endodontic infections in a Chinese population. DNA was extracted from 90 samples collected from the root canals of teeth with primary endodontic infections in a Chinese population, and the 16S rRNA gene was amplified by polymerase chain reaction (PCR). The PCR products were hybridized to microarrays containing specific oligonucleotide probes targeting 11 species, and the arrays were screened with a confocal laser scanner. Pearson's chi-squared test and cluster analysis were performed to investigate the associations between the bacterial combinations and clinical symptoms and signs using SAS 8.02. Seventy-seven samples (86%) yielded at least one of the 11 target species. Parvimonas micra (56%), Porphyromonas endodontalis (51%), Tannerella forsythia (48%), Prevotella intermedia (44%) and Porphyromonas gingivalis (37%) were the most prevalent taxa and were often concomitant. The following positive associations were found between the bacterial combinations and clinical features: P. endodontalis and T. forsythia with abscess; P. gingivalis and P. micra with sinus tract; P. gingivalis and P. endodontalis or P. micra and P. endodontalis with abscess and sinus tract; and the combination of P. endodontalis, P. micra, T. forsythia and P. gingivalis with sinus tract (P < 0.05). Various combinations of P. micra, P. endodontalis, T. forsythia and P. gingivalis may contribute to abscesses or sinus tracts of endodontic origin with bacterial synergism in a Chinese population. © 2015 International Endodontic Journal. Published by John Wiley & Sons Ltd.

Chemiluminescence microarrays in analytical chemistry: a critical review.

PubMed

Seidel, Michael; Niessner, Reinhard

2014-09-01

Multi-analyte immunoassays on microarrays and on multiplex DNA microarrays have been described for quantitative analysis of small organic molecules (e.g., antibiotics, drugs of abuse, small molecule toxins), proteins (e.g., antibodies or protein toxins), and microorganisms, viruses, and eukaryotic cells. In analytical chemistry, multi-analyte detection by use of analytical microarrays has become an innovative research topic because of the possibility of generating several sets of quantitative data for different analyte classes in a short time. Chemiluminescence (CL) microarrays are powerful tools for rapid multiplex analysis of complex matrices. A wide range of applications for CL microarrays is described in the literature dealing with analytical microarrays. The motivation for this review is to summarize the current state of CL-based analytical microarrays. Combining analysis of different compound classes on CL microarrays reduces analysis time, cost of reagents, and use of laboratory space. Applications are discussed, with examples from food safety, water safety, environmental monitoring, diagnostics, forensics, toxicology, and biosecurity. The potential and limitations of research on multiplex analysis by use of CL microarrays are discussed in this review.

Genome-wide comparison of paired fresh frozen and formalin-fixed paraffin-embedded gliomas by custom BAC and oligonucleotide array comparative genomic hybridization: facilitating analysis of archival gliomas.

PubMed

Mohapatra, Gayatry; Engler, David A; Starbuck, Kristen D; Kim, James C; Bernay, Derek C; Scangas, George A; Rousseau, Audrey; Batchelor, Tracy T; Betensky, Rebecca A; Louis, David N

2011-04-01

Array comparative genomic hybridization (aCGH) is a powerful tool for detecting DNA copy number alterations (CNA). Because diffuse malignant gliomas are often sampled by small biopsies, formalin-fixed paraffin-embedded (FFPE) blocks are often the only tissue available for genetic analysis; FFPE tissues are also needed to study the intratumoral heterogeneity that characterizes these neoplasms. In this paper, we present a combination of evaluations and technical advances that provide strong support for the ready use of oligonucleotide aCGH on FFPE diffuse gliomas. We first compared aCGH using bacterial artificial chromosome (BAC) arrays in 45 paired frozen and FFPE gliomas, and demonstrate a high concordance rate between FFPE and frozen DNA in an individual clone-level analysis of sensitivity and specificity, assuring that under certain array conditions, frozen and FFPE DNA can perform nearly identically. However, because oligonucleotide arrays offer advantages to BAC arrays in genomic coverage and practical availability, we next developed a method of labeling DNA from FFPE tissue that allows efficient hybridization to oligonucleotide arrays. To demonstrate utility in FFPE tissues, we applied this approach to biphasic anaplastic oligoastrocytomas and demonstrate CNA differences between DNA obtained from the two components. Therefore, BAC and oligonucleotide aCGH can be sensitive and specific tools for detecting CNAs in FFPE DNA, and novel labeling techniques enable the routine use of oligonucleotide arrays for FFPE DNA. In combination, these advances should facilitate genome-wide analysis of rare, small and/or histologically heterogeneous gliomas from FFPE tissues.

Genomic analysis of wig-1 pathways.

PubMed

Sedaghat, Yalda; Mazur, Curt; Sabripour, Mahyar; Hung, Gene; Monia, Brett P

2012-01-01

Wig-1 is a transcription factor regulated by p53 that can interact with hnRNP A2/B1, RNA Helicase A, and dsRNAs, which plays an important role in RNA and protein stabilization. in vitro studies have shown that wig-1 binds p53 mRNA and stabilizes it by protecting it from deadenylation. Furthermore, p53 has been implicated as a causal factor in neurodegenerative diseases based in part on its selective regulatory function on gene expression, including genes which, in turn, also possess regulatory functions on gene expression. In this study we focused on the wig-1 transcription factor as a downstream p53 regulated gene and characterized the effects of wig-1 down regulation on gene expression in mouse liver and brain. Antisense oligonucleotides (ASOs) were identified that specifically target mouse wig-1 mRNA and produce a dose-dependent reduction in wig-1 mRNA levels in cell culture. These wig-1 ASOs produced marked reductions in wig-1 levels in liver following intraperitoneal administration and in brain tissue following ASO administration through a single striatal bolus injection in FVB and BACHD mice. Wig-1 suppression was well tolerated and resulted in the reduction of mutant Htt protein levels in BACHD mouse brain but had no effect on normal Htt protein levels nor p53 mRNA or protein levels. Expression microarray analysis was employed to determine the effects of wig-1 suppression on genome-wide expression in mouse liver and brain. Reduction of wig-1 caused both down regulation and up regulation of several genes, and a number of wig-1 regulated genes were identified that potentially links wig-1 various signaling pathways and diseases. Antisense oligonucleotides can effectively reduce wig-1 levels in mouse liver and brain, which results in specific changes in gene expression for pathways relevant to both the nervous system and cancer.

Gene expression profiling of anti-GBM glomerulonephritis model: the role of NF-kappaB in immune complex kidney disease.

PubMed

Kim, Ju Han; Ha, Il Soo; Hwang, Chang-Il; Lee, Young-Ju; Kim, Jihoon; Yang, Seung-Hee; Kim, Yon Su; Cao, Yun Anna; Choi, Sangdun; Park, Woong-Yang

2004-11-01

Immune complexes may cause an irreversible onset of chronic renal disease. Most patients with chronic renal disease undergo a final common pathway, marked by glomerulosclerosis and interstitial fibrosis. We attempted to draw a molecular map of anti-glomerular basement membrane (GBM) glomerulonephritis in mice using oligonucleotide microarray technology. Kidneys were harvested at days 1, 3, 7, 11, and 16 after inducing glomerulonephritis by using anti-GBM antibody. In parallel with examining the biochemical and histologic changes, gene expression profiles were acquired against five pooled control kidneys. Gene expression levels were cross-validated by either reverse transcription-polymerase chain reaction (RT-PCR), real-time PCR, or immunohistochemistry. Pathologic changes in anti-GBM glomerulonephritis were confirmed in both BALB/c and C57BL/6 strains. Among the 13,680 spotted 65mer oligonucleotides, 1112 genes showing significant temporal patterns by permutation analysis of variance (ANOVA) with multiple testing correction [false discovery ratio (FDR) < 0.05] were chosen for cluster analysis. From the expression profile, acute inflammatory reactions characterized by the elevation of various cytokines, including interleukin (IL)-1 and IL-6, were identified within 3 days of disease onset. After 7 days, tissue remodeling response was prominent with highly induced extracellular-matrix (ECM) genes. Although cytokines related to lymphocyte activation were not detected, monocyte or mesangial cell proliferation-related genes were increased. Tumor necrosis factor-alpha (TNF-alpha) and nuclear factor-kappaB (NF-kappaB) pathway were consistently activated along the entire disease progression, inducing various target genes like complement 3, IL-1b, IL-6, Traf1, and Saa1. We made a large-scale gene expression time table for mouse anti-GBM glomerulonephritis model, providing a comprehensive overview on the mechanism governing the initiation and the progression of inflammatory renal disease.

Genomic Analysis of wig-1 Pathways

PubMed Central

Sedaghat, Yalda; Mazur, Curt; Sabripour, Mahyar; Hung, Gene; Monia, Brett P.

2012-01-01

Background Wig-1 is a transcription factor regulated by p53 that can interact with hnRNP A2/B1, RNA Helicase A, and dsRNAs, which plays an important role in RNA and protein stabilization. in vitro studies have shown that wig-1 binds p53 mRNA and stabilizes it by protecting it from deadenylation. Furthermore, p53 has been implicated as a causal factor in neurodegenerative diseases based in part on its selective regulatory function on gene expression, including genes which, in turn, also possess regulatory functions on gene expression. In this study we focused on the wig-1 transcription factor as a downstream p53 regulated gene and characterized the effects of wig-1 down regulation on gene expression in mouse liver and brain. Methods and Results Antisense oligonucleotides (ASOs) were identified that specifically target mouse wig-1 mRNA and produce a dose-dependent reduction in wig-1 mRNA levels in cell culture. These wig-1 ASOs produced marked reductions in wig-1 levels in liver following intraperitoneal administration and in brain tissue following ASO administration through a single striatal bolus injection in FVB and BACHD mice. Wig-1 suppression was well tolerated and resulted in the reduction of mutant Htt protein levels in BACHD mouse brain but had no effect on normal Htt protein levels nor p53 mRNA or protein levels. Expression microarray analysis was employed to determine the effects of wig-1 suppression on genome-wide expression in mouse liver and brain. Reduction of wig-1 caused both down regulation and up regulation of several genes, and a number of wig-1 regulated genes were identified that potentially links wig-1 various signaling pathways and diseases. Conclusion Antisense oligonucleotides can effectively reduce wig-1 levels in mouse liver and brain, which results in specific changes in gene expression for pathways relevant to both the nervous system and cancer. PMID:22347364

Multiclass cancer diagnosis using tumor gene expression signatures

DOE PAGES

Ramaswamy, S.; Tamayo, P.; Rifkin, R.; ...

2001-12-11

The optimal treatment of patients with cancer depends on establishing accurate diagnoses by using a complex combination of clinical and histopathological data. In some instances, this task is difficult or impossible because of atypical clinical presentation or histopathology. To determine whether the diagnosis of multiple common adult malignancies could be achieved purely by molecular classification, we subjected 218 tumor samples, spanning 14 common tumor types, and 90 normal tissue samples to oligonucleotide microarray gene expression analysis. The expression levels of 16,063 genes and expressed sequence tags were used to evaluate the accuracy of a multiclass classifier based on a supportmore » vector machine algorithm. Overall classification accuracy was 78%, far exceeding the accuracy of random classification (9%). Poorly differentiated cancers resulted in low-confidence predictions and could not be accurately classified according to their tissue of origin, indicating that they are molecularly distinct entities with dramatically different gene expression patterns compared with their well differentiated counterparts. Taken together, these results demonstrate the feasibility of accurate, multiclass molecular cancer classification and suggest a strategy for future clinical implementation of molecular cancer diagnostics.« less

Toll-like receptor 6 and connective tissue growth factor are significantly upregulated in mitomycin-C-treated urothelial carcinoma cells under hydrostatic pressure stimulation.

PubMed

Chen, Shao-Kuan; Chung, Chih-Ang; Cheng, Yu-Che; Huang, Chi-Jung; Chen, Wen-Yih; Ruaan, Ruoh-Chyu; Li, Chuan; Tsao, Chia-Wen; Hu, Wei-Wen; Chien, Chih-Cheng

2014-06-01

Urothelial carcinoma (UC) is the most common histologic subtype of bladder cancer. The administration of mitomycin C (MMC) into the bladder after transurethral resection of the bladder tumor (TURBT) is a common treatment strategy for preventing recurrence after surgery. We previously applied hydrostatic pressure combined with MMC in UC cells and found that hydrostatic pressure synergistically enhanced MMC-induced UC cell apoptosis through the Fas/FasL pathways. To understand the alteration of gene expressions in UC cells caused by hydrostatic pressure and MMC, oligonucleotide microarray was used to explore all the differentially expressed genes. After bioinformatics analysis and gene annotation, Toll-like receptor 6 (TLR6) and connective tissue growth factor (CTGF) showed significant upregulation among altered genes, and their gene and protein expressions with each treatment of UC cells were validated by quantitative real-time PCR and immunoblotting. Under treatment with MMC and hydrostatic pressure, UC cells showed increasing apoptosis using extrinsic pathways through upregulation of TLR6 and CTGF.

SARS-CoV Regulates Immune Function-Related Gene Expression in Human Monocytic Cells

PubMed Central

Hu, Wanchung; Yen, Yu-Ting; Singh, Sher; Kao, Chuan-Liang

2012-01-01

Abstract Severe acute respiratory syndrome (SARS) is characterized by acute respiratory distress syndrome (ARDS) and pulmonary fibrosis, and monocytes/macrophages are the key players in the pathogenesis of SARS. In this study, we compared the transcriptional profiles of SARS coronavirus (SARS-CoV)-infected monocytic cells against that infected by coronavirus 229E (CoV-229E). Total RNA was extracted from infected DC-SIGN-transfected monocytes (THP-1-DC-SIGN) at 6 and 24 h after infection, and the gene expression was profiled in oligonucleotide-based microarrays. Analysis of immune-related gene expression profiles showed that at 24 h after SARS-CoV infection: (1) IFN-α/β-inducible and cathepsin/proteasome genes were downregulated; (2) hypoxia/hyperoxia-related genes were upregulated; and (3) TLR/TLR-signaling, cytokine/cytokine receptor-related, chemokine/chemokine receptor-related, lysosome-related, MHC/chaperon-related, and fibrosis-related genes were differentially regulated. These results elucidate that SARS-CoV infection regulates immune-related genes in monocytes/macrophages, which may be important to the pathogenesis of SARS. PMID:22876772

SARS-CoV regulates immune function-related gene expression in human monocytic cells.

PubMed

Hu, Wanchung; Yen, Yu-Ting; Singh, Sher; Kao, Chuan-Liang; Wu-Hsieh, Betty A

2012-08-01

Severe acute respiratory syndrome (SARS) is characterized by acute respiratory distress syndrome (ARDS) and pulmonary fibrosis, and monocytes/macrophages are the key players in the pathogenesis of SARS. In this study, we compared the transcriptional profiles of SARS coronavirus (SARS-CoV)-infected monocytic cells against that infected by coronavirus 229E (CoV-229E). Total RNA was extracted from infected DC-SIGN-transfected monocytes (THP-1-DC-SIGN) at 6 and 24 h after infection, and the gene expression was profiled in oligonucleotide-based microarrays. Analysis of immune-related gene expression profiles showed that at 24 h after SARS-CoV infection: (1) IFN-α/β-inducible and cathepsin/proteasome genes were downregulated; (2) hypoxia/hyperoxia-related genes were upregulated; and (3) TLR/TLR-signaling, cytokine/cytokine receptor-related, chemokine/chemokine receptor-related, lysosome-related, MHC/chaperon-related, and fibrosis-related genes were differentially regulated. These results elucidate that SARS-CoV infection regulates immune-related genes in monocytes/macrophages, which may be important to the pathogenesis of SARS.

Animal Viruses Probe dataset (AVPDS) for microarray-based diagnosis and identification of viruses.

PubMed

Yadav, Brijesh S; Pokhriyal, Mayank; Vasishtha, Dinesh P; Sharma, Bhaskar

2014-03-01

AVPDS (Animal Viruses Probe dataset) is a dataset of virus-specific and conserve oligonucleotides for identification and diagnosis of viruses infecting animals. The current dataset contain 20,619 virus specific probes for 833 viruses and their subtypes and 3,988 conserved probes for 146 viral genera. Dataset of virus specific probe has been divided into two fields namely virus name and probe sequence. Similarly conserved probes for virus genera table have genus, and subgroup within genus name and probe sequence. The subgroup within genus is artificially divided subgroups with no taxonomic significance and contains probes which identifies viruses in that specific subgroup of the genus. Using this dataset we have successfully diagnosed the first case of Newcastle disease virus in sheep and reported a mixed infection of Bovine viral diarrhea and Bovine herpesvirus in cattle. These dataset also contains probes which cross reacts across species experimentally though computationally they meet specifications. These probes have been marked. We hope that this dataset will be useful in microarray-based detection of viruses. The dataset can be accessed through the link https://dl.dropboxusercontent.com/u/94060831/avpds/HOME.html.

UniPROBE, update 2015: new tools and content for the online database of protein-binding microarray data on protein-DNA interactions.

PubMed

Hume, Maxwell A; Barrera, Luis A; Gisselbrecht, Stephen S; Bulyk, Martha L

2015-01-01

The Universal PBM Resource for Oligonucleotide Binding Evaluation (UniPROBE) serves as a convenient source of information on published data generated using universal protein-binding microarray (PBM) technology, which provides in vitro data about the relative DNA-binding preferences of transcription factors for all possible sequence variants of a length k ('k-mers'). The database displays important information about the proteins and displays their DNA-binding specificity data in terms of k-mers, position weight matrices and graphical sequence logos. This update to the database documents the growth of UniPROBE since the last update 4 years ago, and introduces a variety of new features and tools, including a new streamlined pipeline that facilitates data deposition by universal PBM data generators in the research community, a tool that generates putative nonbinding (i.e. negative control) DNA sequences for one or more proteins and novel motifs obtained by analyzing the PBM data using the BEEML-PBM algorithm for motif inference. The UniPROBE database is available at http://uniprobe.org. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

ChIP-chip.

PubMed

Kim, Tae Hoon; Dekker, Job

2018-05-01

ChIP-chip can be used to analyze protein-DNA interactions in a region-wide and genome-wide manner. DNA microarrays contain PCR products or oligonucleotide probes that are designed to represent genomic sequences. Identification of genomic sites that interact with a specific protein is based on competitive hybridization of the ChIP-enriched DNA and the input DNA to DNA microarrays. The ChIP-chip protocol can be divided into two main sections: Amplification of ChIP DNA and hybridization of ChIP DNA to arrays. A large amount of DNA is required to hybridize to DNA arrays, and hybridization to a set of multiple commercial arrays that represent the entire human genome requires two rounds of PCR amplifications. The relative hybridization intensity of ChIP DNA and that of the input DNA is used to determine whether the probe sequence is a potential site of protein-DNA interaction. Resolution of actual genomic sites bound by the protein is dependent on the size of the chromatin and on the genomic distance between the probes on the array. As with expression profiling using gene chips, ChIP-chip experiments require multiple replicates for reliable statistical measure of protein-DNA interactions. © 2018 Cold Spring Harbor Laboratory Press.

cn.FARMS: a latent variable model to detect copy number variations in microarray data with a low false discovery rate.

PubMed

Clevert, Djork-Arné; Mitterecker, Andreas; Mayr, Andreas; Klambauer, Günter; Tuefferd, Marianne; De Bondt, An; Talloen, Willem; Göhlmann, Hinrich; Hochreiter, Sepp

2011-07-01

Cost-effective oligonucleotide genotyping arrays like the Affymetrix SNP 6.0 are still the predominant technique to measure DNA copy number variations (CNVs). However, CNV detection methods for microarrays overestimate both the number and the size of CNV regions and, consequently, suffer from a high false discovery rate (FDR). A high FDR means that many CNVs are wrongly detected and therefore not associated with a disease in a clinical study, though correction for multiple testing takes them into account and thereby decreases the study's discovery power. For controlling the FDR, we propose a probabilistic latent variable model, 'cn.FARMS', which is optimized by a Bayesian maximum a posteriori approach. cn.FARMS controls the FDR through the information gain of the posterior over the prior. The prior represents the null hypothesis of copy number 2 for all samples from which the posterior can only deviate by strong and consistent signals in the data. On HapMap data, cn.FARMS clearly outperformed the two most prevalent methods with respect to sensitivity and FDR. The software cn.FARMS is publicly available as a R package at http://www.bioinf.jku.at/software/cnfarms/cnfarms.html.

Method for widespread microRNA-155 inhibition prolongs survival in ALS-model mice

PubMed Central

Koval, Erica D.; Shaner, Carey; Zhang, Peter; du Maine, Xavier; Fischer, Kimberlee; Tay, Jia; Chau, B. Nelson; Wu, Gregory F.; Miller, Timothy M.

2013-01-01

microRNAs (miRNAs) are dysregulated in a variety of disease states, suggesting that this newly discovered class of gene expression repressors may be viable therapeutic targets. A microarray of miRNA changes in ALS-model superoxide dismutase 1 (SOD1)G93A rodents identified 12 miRNAs as significantly changed. Six miRNAs tested in human ALS tissues were confirmed increased. Specifically, miR-155 was increased 5-fold in mice and 2-fold in human spinal cords. To test miRNA inhibition in the central nervous system (CNS) as a potential novel therapeutic, we developed oligonucleotide-based miRNA inhibitors (anti-miRs) that could inhibit miRNAs throughout the CNS and in the periphery. Anti-miR-155 caused global derepression of targets in peritoneal macrophages and, following intraventricular delivery, demonstrated widespread functional distribution in the brain and spinal cord. After treating SOD1G93A mice with anti-miR-155, we significantly extended survival by 10 days and disease duration by 15 days (38%) while a scrambled control anti-miR did not significantly improve survival or disease duration. Therefore, antisense oligonucleotides may be used to successfully inhibit miRNAs throughout the brain and spinal cord, and miR-155 is a promising new therapeutic target for human ALS. PMID:23740943

cDNA microarray analysis of esophageal cancer: discoveries and prospects.

PubMed

Shimada, Yutaka; Sato, Fumiaki; Shimizu, Kazuharu; Tsujimoto, Gozoh; Tsukada, Kazuhiro

2009-07-01

Recent progress in molecular biology has revealed many genetic and epigenetic alterations that are involved in the development and progression of esophageal cancer. Microarray analysis has also revealed several genetic networks that are involved in esophageal cancer. However, clinical application of microarray techniques and use of microarray data have not yet occurred. In this review, we focus on the recent developments and problems with microarray analysis of esophageal cancer.

Review on investigations of antisense oligonucleotides with the use of mass spectrometry.

PubMed

Studzińska, Sylwia

2018-01-01

Antisense oligonucleotides have been investigated as potential drugs for years. They inhibit target gene or protein expression. The present review summarizes their modifications, modes of action, and applications of liquid chromatography coupled with mass spectrometry for qualitative and quantitative analysis of these compounds. The most recent reports on a given topic were given prominence, while some early studies were reviewed in order to provide a theoretical background. The present review covers the issues of using ion-exchange chromatography, ion-pair reversed-phase high performance liquid chromatography and hydrophilic interaction chromatography for the separation of antisense oligonucleotides. The application of mass spectrometry was described with regard to the ionization type used for the determination of these potential therapeutics. Moreover, the current approaches and applications of mass spectrometry for quantitative analysis of antisense oligonucleotides and their metabolites as well as their impurities during in vitro and in vivo studies were discussed. Finally, certain conclusions and perspectives on the determination of therapeutic oligonucleotides in various samples were briefly described. Copyright © 2017 Elsevier B.V. All rights reserved.

Importing MAGE-ML format microarray data into BioConductor.

PubMed

Durinck, Steffen; Allemeersch, Joke; Carey, Vincent J; Moreau, Yves; De Moor, Bart

2004-12-12

The microarray gene expression markup language (MAGE-ML) is a widely used XML (eXtensible Markup Language) standard for describing and exchanging information about microarray experiments. It can describe microarray designs, microarray experiment designs, gene expression data and data analysis results. We describe RMAGEML, a new Bioconductor package that provides a link between cDNA microarray data stored in MAGE-ML format and the Bioconductor framework for preprocessing, visualization and analysis of microarray experiments. http://www.bioconductor.org. Open Source.

2'-O-[2-[2-(N,N-Dimethylamino)ethoxy]ethyl] Modified Antisense Oligonucleotides: Symbiosis of Charge Interaction Factors and Stereoelectronic Effects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prhavc, M.; Prakash, T.P.; Minasov, G.

Oligonucleotides with a novel, 2'-O-[2-[2-(N,N-dimethylamino)ethoxy]ethyl] (2'-O-DMAEOE) modification have been synthesized. This modification, a cationic analogue of the 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, exhibits high binding affinity to target RNA (but not to DNA) and exceptional resistance to nuclease degradation. Analysis of the crystal structure of a self-complementary oligonucleotide containing a single 2'-O-DMAEOE modification explains the importance of charge factors and gauche effects on the observed antisense properties. 2'-O-DMAEOE modified oligonucleotides are ideal candidates for antisense drugs.

Time-series oligonucleotide count to assign antiviral siRNAs with long utility fit in the big data era

PubMed Central

Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T

2017-01-01

Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the ‘awaiting-type oligonucleotide’ the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility. PMID:28905886

Preparation and Analysis of Oligonucleotides Containing the C4′-Oxidized Abasic Site and Related Mechanistic Probes

PubMed Central

Kim, Jaeseung; Kreller, Cortney R.; Greenberg, Marc M.

2005-01-01

The C4′-oxidized abasic site (C4-AP) is produced by a variety of DNA damaging agents. This alkali labile lesion can exist in up to four diastereomeric cyclic forms, in addition to the acyclic keto-aldehyde. Synthetic oligonucleotides containing the lesion were prepared from a stable photochemical precursor. Chemical integrity of the lesion containing oligonucleotides was probed using phosphodiesterase lability. Analysis of the 3′,5′-phosphate diester of the monomeric lesion released from single diastereomers of photolabile precursors by 1H NMR indicates that isomerization of the hemiacetal and/or hemiketal is rapid. The syntheses and characterization of oligonucleotides containing configurationally stable analogues of C4-AP, which serve as mechanistic probes for deciphering the structural basis of the biochemical and biological effects of the C4′-oxidized abasic lesion, are also described. PMID:16277338

Enzymatic production of single-molecule FISH and RNA capture probes.

PubMed

Gaspar, Imre; Wippich, Frank; Ephrussi, Anne

2017-10-01

Arrays of singly labeled short oligonucleotides that hybridize to a specific target revolutionized RNA biology, enabling quantitative, single-molecule microscopy analysis and high-efficiency RNA/RNP capture. Here, we describe a simple and efficient method that allows flexible functionalization of inexpensive DNA oligonucleotides by different fluorescent dyes or biotin using terminal deoxynucleotidyl transferase and custom-made functional group conjugated dideoxy-UTP. We show that (i) all steps of the oligonucleotide labeling-including conjugation, enzymatic synthesis, and product purification-can be performed in a standard biology laboratory, (ii) the process yields >90%, often >95% labeled product with minimal carryover of impurities, and (iii) the oligonucleotides can be labeled with different dyes or biotin, allowing single-molecule FISH, RNA affinity purification, and Northern blot analysis to be performed. © 2017 Gaspar et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

The Longhorn Array Database (LAD): An Open-Source, MIAME compliant implementation of the Stanford Microarray Database (SMD)

PubMed Central

Killion, Patrick J; Sherlock, Gavin; Iyer, Vishwanath R

2003-01-01

Background The power of microarray analysis can be realized only if data is systematically archived and linked to biological annotations as well as analysis algorithms. Description The Longhorn Array Database (LAD) is a MIAME compliant microarray database that operates on PostgreSQL and Linux. It is a fully open source version of the Stanford Microarray Database (SMD), one of the largest microarray databases. LAD is available at Conclusions Our development of LAD provides a simple, free, open, reliable and proven solution for storage and analysis of two-color microarray data. PMID:12930545

Gene expression profiling of Listeria monocytogenes strain F2365 during growth in ultrahigh-temperature-processed skim milk.

PubMed

Liu, Yanhong; Ream, Amy

2008-11-01

To study how Listeria monocytogenes survives and grows in ultrahigh-temperature-processed (UHT) skim milk, microarray technology was used to monitor the gene expression profiles of strain F2365 in UHT skim milk. Total RNA was isolated from strain F2365 in UHT skim milk after 24 h of growth at 4 degrees C, labeled with fluorescent dyes, and hybridized to "custom-made" commercial oligonucleotide (35-mers) microarray chips containing the whole genome of L. monocytogenes strain F2365. Compared to L. monocytogenes grown in brain heart infusion (BHI) broth for 24 h at 4 degrees C, 26 genes were upregulated (more-than-twofold increase) in UHT skim milk, whereas 14 genes were downregulated (less-than-twofold decrease). The upregulated genes included genes encoding transport and binding proteins, transcriptional regulators, proteins in amino acid biosynthesis and energy metabolism, protein synthesis, cell division, and hypothetical proteins. The downregulated genes included genes that encode transport and binding proteins, protein synthesis, cellular processes, cell envelope, energy metabolism, a transcriptional regulator, and an unknown protein. The gene expression changes determined by microarray assays were confirmed by real-time reverse transcriptase PCR analyses. Furthermore, cells grown in UHT skim milk displayed the same sensitivity to hydrogen peroxide as cells grown in BHI, demonstrating that the elevated levels of expression of genes encoding manganese transporter complexes in UHT skim milk did not result in changes in the oxidative stress sensitivity. To our knowledge, this report represents a novel study of global transcriptional gene expression profiling of L. monocytogenes in a liquid food.

Genome-wide expression analysis of human in vivo irritated epidermis: differential profiles induced by sodium lauryl sulfate and nonanoic acid.

PubMed

Clemmensen, Anders; Andersen, Klaus E; Clemmensen, Ole; Tan, Qihua; Petersen, Thomas K; Kruse, Torben A; Thomassen, Mads

2010-09-01

The pathogenesis of irritant contact dermatitis (ICD) is poorly understood, and genes participating in the epidermal response to chemical irritants are only partly known. It is commonly accepted that different irritants have different mechanisms of action in the development of ICD. To define the differential molecular events induced in the epidermis by different irritants, we collected sequential biopsies ((1/2), 4, and 24 hours after a single exposure and at day 11 after repeated exposure) from human volunteers exposed to either sodium lauryl sulfate (SLS) or nonanoic acid (NON). Gene expression analysis using high-density oligonucleotide microarrays (representing 47,000 transcripts) revealed essentially different pathway responses (1/2)hours after exposure: NON transiently induced the IL-6 pathway as well as a number of mitogen-activated signaling cascades including extracellular signal-regulated kinase and growth factor receptor signaling, whereas SLS transiently downregulated cellular energy metabolism pathways. Differential expression of the cyclooxygenase-2 and matrix metalloproteinase 3 transcripts was confirmed immunohistochemically. After cumulative exposure, 883 genes were differentially expressed, whereas we identified 23 suggested common biomarkers for ICD. In conclusion, we bring new insights into two hitherto less well-elucidated phases of skin irritancy: the very initial as well as the late phase after single and cumulative mild exposures, respectively.

Functional Analysis of the Trichoderma harzianum nox1 Gene, Encoding an NADPH Oxidase, Relates Production of Reactive Oxygen Species to Specific Biocontrol Activity against Pythium ultimum▿†

PubMed Central

Montero-Barrientos, M.; Hermosa, R.; Cardoza, R. E.; Gutiérrez, S.; Monte, E.

2011-01-01

The synthesis of reactive oxygen species (ROS) is one of the first events following pathogenic interactions in eukaryotic cells, and NADPH oxidases are involved in the formation of such ROS. The nox1 gene of Trichoderma harzianum was cloned, and its role in antagonism against phytopathogens was analyzed in nox1-overexpressed transformants. The increased levels of nox1 expression in these transformants were accompanied by an increase in ROS production during their direct confrontation with Pythium ultimum. The transformants displayed an increased hydrolytic pattern, as determined by comparing protease, cellulase, and chitinase activities with those for the wild type. In confrontation assays against P. ultimum the nox1-overexpressed transformants were more effective than the wild type, but not in assays against Botrytis cinerea or Rhizoctonia solani. A transcriptomic analysis using a Trichoderma high-density oligonucleotide (HDO) microarray also showed that, compared to gene expression for the interaction of wild-type T. harzianum and P. ultimum, genes related to protease, cellulase, and chitinase activities were differentially upregulated in the interaction of a nox1-overexpressed transformant with this pathogen. Our results show that nox1 is involved in T. harzianum ROS production and antagonism against P. ultimum. PMID:21421791

Gene Expression Profiling Reveals a Massive, Aneuploidy-Dependent Transcriptional Deregulation and Distinct Differences between Lymph Node–Negative and Lymph Node–Positive Colon Carcinomas

PubMed Central

Grade, Marian; Hörmann, Patrick; Becker, Sandra; Hummon, Amanda B.; Wangsa, Danny; Varma, Sudhir; Simon, Richard; Liersch, Torsten; Becker, Heinz; Difilippantonio, Michael J.; Ghadimi, B. Michael; Ried, Thomas

2016-01-01

To characterize patterns of global transcriptional deregulation in primary colon carcinomas, we did gene expression profiling of 73 tumors [Unio Internationale Contra Cancrum stage II (n = 33) and stage III (n = 40)] using oligonucleotide microarrays. For 30 of the tumors, expression profiles were compared with those from matched normal mucosa samples. We identified a set of 1,950 genes with highly significant deregulation between tumors and mucosa samples (P < 1e–7). A significant proportion of these genes mapped to chromosome 20 (P = 0.01). Seventeen genes had a >5-fold average expression difference between normal colon mucosa and carcinomas, including up-regulation of MYC and of HMGA1, a putative oncogene. Furthermore, we identified 68 genes that were significantly differentially expressed between lymph node–negative and lymph node–positive tumors (P < 0.001), the functional annotation of which revealed a preponderance of genes that play a role in cellular immune response and surveillance. The microarray-derived gene expression levels of 20 deregulated genes were validated using quantitative real-time reverse transcription-PCR in >40 tumor and normal mucosa samples with good concordance between the techniques. Finally, we established a relationship between specific genomic imbalances, which were mapped for 32 of the analyzed colon tumors by comparative genomic hybridization, and alterations of global transcriptional activity. Previously, we had conducted a similar analysis of primary rectal carcinomas. The systematic comparison of colon and rectal carcinomas revealed a significant overlap of genomic imbalances and transcriptional deregulation, including activation of the Wnt/β-catenin signaling cascade, suggesting similar pathogenic pathways. PMID:17210682

Gene expression profiling reveals a massive, aneuploidy-dependent transcriptional deregulation and distinct differences between lymph node-negative and lymph node-positive colon carcinomas.

PubMed

Grade, Marian; Hörmann, Patrick; Becker, Sandra; Hummon, Amanda B; Wangsa, Danny; Varma, Sudhir; Simon, Richard; Liersch, Torsten; Becker, Heinz; Difilippantonio, Michael J; Ghadimi, B Michael; Ried, Thomas

2007-01-01

To characterize patterns of global transcriptional deregulation in primary colon carcinomas, we did gene expression profiling of 73 tumors [Unio Internationale Contra Cancrum stage II (n = 33) and stage III (n = 40)] using oligonucleotide microarrays. For 30 of the tumors, expression profiles were compared with those from matched normal mucosa samples. We identified a set of 1,950 genes with highly significant deregulation between tumors and mucosa samples (P < 1e-7). A significant proportion of these genes mapped to chromosome 20 (P = 0.01). Seventeen genes had a >5-fold average expression difference between normal colon mucosa and carcinomas, including up-regulation of MYC and of HMGA1, a putative oncogene. Furthermore, we identified 68 genes that were significantly differentially expressed between lymph node-negative and lymph node-positive tumors (P < 0.001), the functional annotation of which revealed a preponderance of genes that play a role in cellular immune response and surveillance. The microarray-derived gene expression levels of 20 deregulated genes were validated using quantitative real-time reverse transcription-PCR in >40 tumor and normal mucosa samples with good concordance between the techniques. Finally, we established a relationship between specific genomic imbalances, which were mapped for 32 of the analyzed colon tumors by comparative genomic hybridization, and alterations of global transcriptional activity. Previously, we had conducted a similar analysis of primary rectal carcinomas. The systematic comparison of colon and rectal carcinomas revealed a significant overlap of genomic imbalances and transcriptional deregulation, including activation of the Wnt/beta-catenin signaling cascade, suggesting similar pathogenic pathways.

High Quality Genomic Copy Number Data from Archival Formalin-Fixed Paraffin-Embedded Leiomyosarcoma: Optimisation of Universal Linkage System Labelling

PubMed Central

Salawu, Abdulazeez; Ul-Hassan, Aliya; Hammond, David; Fernando, Malee; Reed, Malcolm; Sisley, Karen

2012-01-01

Most soft tissue sarcomas are characterized by genetic instability and frequent genomic copy number aberrations that are not subtype-specific. Oligonucleotide microarray-based Comparative Genomic Hybridisation (array CGH) is an important technique used to map genome-wide copy number aberrations, but the traditional requirement for high-quality DNA typically obtained from fresh tissue has limited its use in sarcomas. Although large archives of Formalin-fixed Paraffin-embedded (FFPE) tumour samples are available for research, the degradative effects of formalin on DNA from these tissues has made labelling and analysis by array CGH technically challenging. The Universal Linkage System (ULS) may be used for a one-step chemical labelling of such degraded DNA. We have optimised the ULS labelling protocol to perform aCGH on archived FFPE leiomyosarcoma tissues using the 180k Agilent platform. Preservation age of samples ranged from a few months to seventeen years and the DNA showed a wide range of degradation (when visualised on agarose gels). Consistently high DNA labelling efficiency and low microarray probe-to-probe variation (as measured by the derivative log ratio spread) was seen. Comparison of paired fresh and FFPE samples from identical tumours showed good correlation of CNAs detected. Furthermore, the ability to macro-dissect FFPE samples permitted the detection of CNAs that were masked in fresh tissue. Aberrations were visually confirmed using Fluorescence in situ Hybridisation. These results suggest that archival FFPE tissue, with its relative abundance and attendant clinical data may be used for effective mapping for genomic copy number aberrations in such rare tumours as leiomyosarcoma and potentially unravel clues to tumour origins, progression and ultimately, targeted treatment. PMID:23209738

Downstream effects of ROCK signaling in cultured human corneal stromal cells: microarray analysis of gene expression.

PubMed

Harvey, Stephen A K; Anderson, Susan C; SundarRaj, Nirmala

2004-07-01

Rho-associated coiled-coil-containing protein kinase (ROCK) is a downstream target of Rho GTPase signaling and regulates the assembly of stress fibers. Previous reports indicate that Rho/ROCK signaling is involved in the regulation of several cellular processes, some of which may be cell-type specific and are probably critical to corneal stromal cell activation. The present study identified ROCK-regulated gene expression in corneal stromal cells. Corneal stromal cells derived from eyes of three different donors were cultured to yield the following designated phenotypes: baseline fibroblasts (DMEM with 10% serum), activated fibroblasts (10% serum+bFGF+heparin), and myofibroblasts (1% serum+TGF-beta 1). Cells were exposed to the ROCK inhibitor Y-27632 or vehicle for 12 hours, and transcript levels altered by ROCK inhibition were identified with oligonucleotide microarrays (GeneChips; Affymetrix, Santa Clara, CA). In these phenotypes, Y-27632 caused marked (twofold or more) increases or decreases in 14/4, 12/3, and 15/10 transcripts. In both fibroblast groups Y-27632-treatment increased expression of endothelin receptors and of parathyroid hormone-like hormone. The upregulation of alpha-smooth muscle actin in myofibroblasts was attenuated by Y-27632. Combining data from all groups identified ROCK-supported (Y-27632 inhibitable) expression of 10 transcripts, including ribonucleotide reductase M2, the cyclin B1-CDC2-CKS2 system, and four mitotic spindle-associated proteins. ROCK inhibition causes broad inhibition of DNA synthesis and mitosis and causes changes that are different between (bFGF-activated) fibroblasts and (TGF-beta 1-induced) myofibroblasts. Thus, Rho/ROCK signaling regulates both common and distinct downstream events in corneal stromal cells activated (differentiated) to fibroblast or myofibroblast phenotype.

Differential transcriptomic responses of Biomphalaria glabrata (Gastropoda, Mollusca) to bacteria and metazoan parasites, Schistosoma mansoni and Echinostoma paraensei (Digenea, Platyhelminthes)

PubMed Central

Adema, Coen M; Hanington, Patrick C.; Lun, Cheng-Man; Rosenberg, George H.; Aragon, Anthony D; Stout, Barbara A; Richard, Mara L. Lennard; Gross, Paul S.; Loker, Eric S

2009-01-01

A 70-mer oligonucleotide-based microarray (1152 features) that emphasizes stress and immune responses factors was constructed to study transcriptomic responses of the snail Biomphalaria glabrata to different immune challenges. In addition to sequences with relevant putative ID and Gene Ontology (GO) annotation, the array features non-immune factors and unknown B. glabrata ESTs for functional gene discovery. The transcription profiles of B. glabrata (3 biological replicates, each a pool of 5 snails) were recorded at 12 hours post wounding, exposure to Gram negative or Gram positive bacteria (Escherichia coli and Micrococcus luteus, respectively), or infection with compatible trematode parasites (S. mansoni or E. paraensei, 20 miracidia/snail), relative to controls, using universal reference RNA. The data were subjected to Significance Analysis for Microarrays (SAM), with a false positive rate (FPR) ≤10%. Wounding yielded a modest differential expression profile (27 up/21 down) with affected features mostly dissimilar from other treatments. Partially overlapping, yet distinct expression profiles were recorded from snails challenged with E. coli (83 up/20 down) or M. luteus (120 up/42 down), mostly showing up-regulation of defense and stress-related features. Significantly altered expression of selected immune features indicates that B. glabrata detects and responds differently to compatible trematodes. Echinostoma paraensei infection was associated mostly with down regulation of many (immune-) transcripts (42 up/68 down), whereas S. mansoni exposure yielded a preponderance of up-regulated features (140 up/23 down), with only few known immune genes affected. These observations may reflect the divergent strategies developed by trematodes during their evolution as specialized pathogens of snails to negate host defense responses. Clearly, the immune defenses of B. glabrata distinguish and respond differently to various immune challenges. PMID:19962194

The Microarray Revolution: Perspectives from Educators

ERIC Educational Resources Information Center

Brewster, Jay L.; Beason, K. Beth; Eckdahl, Todd T.; Evans, Irene M.

2004-01-01

In recent years, microarray analysis has become a key experimental tool, enabling the analysis of genome-wide patterns of gene expression. This review approaches the microarray revolution with a focus upon four topics: 1) the early development of this technology and its application to cancer diagnostics; 2) a primer of microarray research,…

Tissue-Specific Transcriptomic Profiling of Sorghum propinquum using a Rice Genome Array

PubMed Central

Zhang, Ting; Zhao, Xiuqin; Huang, Liyu; Liu, Xiaoyue; Zong, Ying; Zhu, Linghua; Yang, Daichang; Fu, Binying

2013-01-01

Sorghum (Sorghum bicolor) is one of the world's most important cereal crops. S. propinquum is a perennial wild relative of S. bicolor with well-developed rhizomes. Functional genomics analysis of S. propinquum, especially with respect to molecular mechanisms related to rhizome growth and development, can contribute to the development of more sustainable grain, forage, and bioenergy cropping systems. In this study, we used a whole rice genome oligonucleotide microarray to obtain tissue-specific gene expression profiles of S. propinquum with special emphasis on rhizome development. A total of 548 tissue-enriched genes were detected, including 31 and 114 unique genes that were expressed predominantly in the rhizome tips (RT) and internodes (RI), respectively. Further GO analysis indicated that the functions of these tissue-enriched genes corresponded to their characteristic biological processes. A few distinct cis-elements, including ABA-responsive RY repeat CATGCA, sugar-repressive TTATCC, and GA-responsive TAACAA, were found to be prevalent in RT-enriched genes, implying an important role in rhizome growth and development. Comprehensive comparative analysis of these rhizome-enriched genes and rhizome-specific genes previously identified in Oryza longistaminata and S. propinquum indicated that phytohormones, including ABA, GA, and SA, are key regulators of gene expression during rhizome development. Co-localization of rhizome-enriched genes with rhizome-related QTLs in rice and sorghum generated functional candidates for future cloning of genes associated with rhizome growth and development. PMID:23536906

EMAAS: An extensible grid-based Rich Internet Application for microarray data analysis and management

PubMed Central

Barton, G; Abbott, J; Chiba, N; Huang, DW; Huang, Y; Krznaric, M; Mack-Smith, J; Saleem, A; Sherman, BT; Tiwari, B; Tomlinson, C; Aitman, T; Darlington, J; Game, L; Sternberg, MJE; Butcher, SA

2008-01-01

Background Microarray experimentation requires the application of complex analysis methods as well as the use of non-trivial computer technologies to manage the resultant large data sets. This, together with the proliferation of tools and techniques for microarray data analysis, makes it very challenging for a laboratory scientist to keep up-to-date with the latest developments in this field. Our aim was to develop a distributed e-support system for microarray data analysis and management. Results EMAAS (Extensible MicroArray Analysis System) is a multi-user rich internet application (RIA) providing simple, robust access to up-to-date resources for microarray data storage and analysis, combined with integrated tools to optimise real time user support and training. The system leverages the power of distributed computing to perform microarray analyses, and provides seamless access to resources located at various remote facilities. The EMAAS framework allows users to import microarray data from several sources to an underlying database, to pre-process, quality assess and analyse the data, to perform functional analyses, and to track data analysis steps, all through a single easy to use web portal. This interface offers distance support to users both in the form of video tutorials and via live screen feeds using the web conferencing tool EVO. A number of analysis packages, including R-Bioconductor and Affymetrix Power Tools have been integrated on the server side and are available programmatically through the Postgres-PLR library or on grid compute clusters. Integrated distributed resources include the functional annotation tool DAVID, GeneCards and the microarray data repositories GEO, CELSIUS and MiMiR. EMAAS currently supports analysis of Affymetrix 3' and Exon expression arrays, and the system is extensible to cater for other microarray and transcriptomic platforms. Conclusion EMAAS enables users to track and perform microarray data management and analysis tasks through a single easy-to-use web application. The system architecture is flexible and scalable to allow new array types, analysis algorithms and tools to be added with relative ease and to cope with large increases in data volume. PMID:19032776

An Introduction to MAMA (Meta-Analysis of MicroArray data) System.

PubMed

Zhang, Zhe; Fenstermacher, David

2005-01-01

Analyzing microarray data across multiple experiments has been proven advantageous. To support this kind of analysis, we are developing a software system called MAMA (Meta-Analysis of MicroArray data). MAMA utilizes a client-server architecture with a relational database on the server-side for the storage of microarray datasets collected from various resources. The client-side is an application running on the end user's computer that allows the user to manipulate microarray data and analytical results locally. MAMA implementation will integrate several analytical methods, including meta-analysis within an open-source framework offering other developers the flexibility to plug in additional statistical algorithms.

As Technologies for Nucleotide Therapeutics Mature, Products Emerge.

PubMed

Beierlein, Jennifer M; McNamee, Laura M; Ledley, Fred D

2017-12-15

The long path from initial research on oligonucleotide therapies to approval of antisense products is not unfamiliar. This lag resembles those encountered with monoclonal antibodies, gene therapies, and many biological targets and is consistent with studies of innovation showing that technology maturation is a critical determinant of product success. We previously described an analytical model for the maturation of biomedical research, demonstrating that the efficiency of targeted and biological development is connected to metrics of technology growth. The present work applies this model to characterize the advance of oligonucleotide therapeutics. We show that recent oligonucleotide product approvals incorporate technologies and targets that are past the established point of technology growth, as do most of the oligonucleotide products currently in phase 3. Less mature oligonucleotide technologies, such as miRNAs and some novel gene targets, have not passed the established point and have not yielded products. This analysis shows that oligonucleotide product development has followed largely predictable patterns of innovation. While technology maturation alone does not ensure success, these data show that many oligonucleotide technologies are sufficiently mature to be considered part of the arsenal for therapeutic development. These results demonstrate the importance of technology assessment in strategic management of biomedical technologies. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Gene expression profiling of mucolipidosis type IV fibroblasts reveals deregulation of genes with relevant functions in lysosome physiology.

PubMed

Bozzato, Andrea; Barlati, Sergio; Borsani, Giuseppe

2008-04-01

Mucolipidosis type IV (MLIV, MIM 252650) is an autosomal recessive lysosomal storage disorder that causes mental and motor retardation as well as visual impairment. The lysosomal storage defect in MLIV is consistent with abnormalities of membrane traffic and organelle dynamics in the late endocytic pathway. MLIV is caused by mutations in the MCOLN1 gene, which codes for mucolipin-1 (MLN1), a member of the large family of transient receptor potential (TRP) cation channels. Although a number of studies have been performed on mucolipin-1, the pathological mechanisms underlying MLIV are not fully understood. To identify genes that characterize pathogenic changes in mucolipidosis type IV, we compared the expression profiles of three MLIV and three normal skin fibroblasts cell lines using oligonucleotide microarrays. Genes that were differentially expressed in patients' cells were identified. 231 genes were up-regulated, and 116 down-regulated. Real-Time RT-PCR performed on selected genes in six independent MLIV fibroblasts cell lines was generally consistent with the microarray findings. This study allowed to evidence the modulation at the transcriptional level of a discrete number of genes relevant in biological processes which are altered in the disease such as endosome/lysosome trafficking, lysosome biogenesis, organelle acidification and lipid metabolism.

Successful Application of Microarray Technology to Microdissected Formalin-Fixed, Paraffin-Embedded Tissue

PubMed Central

Coudry, Renata A.; Meireles, Sibele I.; Stoyanova, Radka; Cooper, Harry S.; Carpino, Alan; Wang, Xianqun; Engstrom, Paul F.; Clapper, Margie L.

2007-01-01

The establishment of a reliable method for using RNA from formalin-fixed, paraffin-embedded (FFPE) tissue would provide an opportunity to obtain novel gene expression data from the vast amounts of archived tissue. A custom-designed 22,000 oligonucleotide array was used in the present study to compare the gene expression profile of colonic epithelial cells isolated by laser capture microdissection from FFPE-archived samples with that of the same cell population from matched frozen samples, the preferred source of RNA. Total RNA was extracted from FFPE tissues, amplified, and labeled using the Paradise Reagent System. The quality of the input RNA was assessed by the Bioanalyzer profile, reverse transcriptase-polymerase chain reaction, and agarose gel electrophoresis. The results demonstrate that it is possible to obtain reliable microarray data from FFPE samples using RNA acquired by laser capture microdissection. The concordance between matched FFPE and frozen samples was evaluated and expressed as a Pearson’s correlation coefficient, with values ranging from 0.80 to 0.97. The presence of ribosomal RNA peaks in FFPE-derived RNA was reflected by a high correlation with paired frozen samples. A set of practical recommendations for evaluating the RNA integrity and quality in FFPE samples is reported. PMID:17251338

Genomic expression patterns of cardiac tissues from dogs with dilated cardiomyopathy.

PubMed

Oyama, Mark A; Chittur, Sridar

2005-07-01

To evaluate global genome expression patterns of left ventricular tissues from dogs with dilated cardiomyopathy (DCM). Tissues obtained from the left ventricle of 2 Doberman Pinschers with end-stage DCM and 5 healthy control dogs. Transcriptional activities of 23,851 canine DNA sequences were determined by use of an oligonucleotide microarray. Genome expression patterns of DCM tissue were evaluated by measuring the relative amount of complementary RNA hybridization to the microarray probes and comparing it with gene expression for tissues from 5 healthy control dogs. 478 transcripts were differentially expressed (> or = 2.5-fold change). In DCM tissue, expression of 173 transcripts was upregulated and expression of 305 transcripts was downregulated, compared with expression for control tissues. Of the 478 transcripts, 167 genes could be specifically identified. These genes were grouped into 1 of 8 categories on the basis of their primary physiologic function. Grouping revealed that pathways involving cellular energy production, signaling and communication, and cell structure were generally downregulated, whereas pathways involving cellular defense and stress responses were upregulated. Many previously unreported genes that may contribute to the pathophysiologic aspects of heart disease were identified. Evaluation of global expression patterns provides a molecular portrait of heart failure, yields insights into the pathophysiologic aspects of DCM, and identifies intriguing genes and pathways for further study.

Increased expression of protein kinase A inhibitor alpha (PKI-alpha) and decreased PKA-regulated genes in chronic intermittent alcohol exposure.

PubMed

Repunte-Canonigo, Vez; Lutjens, Robert; van der Stap, Lena D; Sanna, Pietro Paolo

2007-03-23

Intermittent models of alcohol exposure that mimic human patterns of alcohol consumption produce profound physiological and biochemical changes and induce rapid increases in alcohol self-administration. We used high-density oligonucleotide microarrays to investigate gene expression changes during chronic intermittent alcohol exposure in three brain regions that receive mesocorticolimbic dopaminergic projections and that are believed to be involved in alcohol's reinforcing actions: the medial prefrontal cortex, the nucleus accumbens and the amygdala. An independent replication of the experiment was used for RT-PCR validation of the microarray results. The protein kinase A inhibitor alpha (PKI-alpha, Pkia), a member of the endogenous PKI family implicated in reducing nuclear PKA activity, was found to be increased in all three regions tested. Conversely, we observed a downregulation of the expression of several PKA-regulated transcripts in one or more of the brain regions studied, including the activity and neurotransmitter-regulated early gene (Ania) - 1, -3, -7, -8, the transcription factors Egr1 and NGFI-B (Nr4a1) and the neuropeptide NPY. Reduced expression of PKA-regulated genes in mesocorticolimbic projection areas may have motivational significance in the rapid increase in alcohol self-administration induced by intermittent alcohol exposure.

[Oligonucleotide derivatives in the nucleic acid hybridization analysis. III. Synthesis and investigation of properties of oligonucleotides, bearing bifunctional non-nucleotide insert].

PubMed

Kupriushkin, M S; Pyshnyĭ, D V

2012-01-01

Non-nucleotide phosporamidites were synthetized, having branched backbone with different position of functional groups. Obtained phosphoramidite monomers contain intercalator moiety--6-chloro-2-methoxyacridine, and additional hydroxyl residue protected with dimethoxytrityl group or with tert-butyldimethylsilyl group for post-synthetic modification. Synthesized oligothymidilates contain one or more modified units in different positions of sequence. Melting temperature and thermodynamic parameters of formation of complementary duplexes formed by modified oligonucleotides was defined (change in enthalpy and entropy). The introduction of intercalating residue causes a significant stabilization of DNA duplexes. It is shown that the efficiency of the fluorescence of acridine residue in the oligonucleotide conjugate significantly changes upon hybridization with DNA.

The occurrence of ESBL-producing Escherichia coli carrying aminoglycoside resistance genes in urinary tract infections in Saudi Arabia.

PubMed

Alyamani, Essam J; Khiyami, Anamil M; Booq, Rayan Y; Majrashi, Majed A; Bahwerth, Fayez S; Rechkina, Elena

2017-01-06

The infection and prevalence of extended-spectrum β-lactamases (ESBLs) is a worldwide problem, and the presence of ESBLs varies between countries. In this study, we investigated the occurrence of plasmid-mediated ESBL/AmpC/carbapenemase/aminoglycoside resistance gene expression in Escherichia coli using phenotypic and genotypic techniques. A total of 58 E. coli isolates were collected from hospitals in the city of Makkah and screened for the production of ESBL/AmpC/carbapenemase/aminoglycoside resistance genes. All samples were subjected to phenotypic and genotypic analyses. The antibiotic susceptibility of the E. coli isolates was determined using the Vitek-2 system and the minimum inhibitory concentration (MIC) assay. Antimicrobial agents tested using the Vitek 2 system and MIC assay included the expanded-spectrum (or third-generation) cephalosporins (e.g., cefoxitin, cefepime, aztreonam, cefotaxime, ceftriaxone, and ceftazidime) and carbapenems (meropenem and imipenem). Reported positive isolates were investigated using genotyping technology (oligonucleotide microarray-based assay and PCR). The genotyping investigation was focused on ESBL variants and the AmpC, carbapenemase and aminoglycoside resistance genes. E. coli was phylogenetically grouped, and the clonality of the isolates was studied using multilocus sequence typing (MLST). Our E. coli isolates exhibited different levels of resistance to ESBL drugs, including ampicillin (96.61%), cefoxitin (15.25%), ciprofloxacin (79.66%), cefepime (75.58%), aztreonam (89.83%), cefotaxime (76.27%), ceftazidime (81.36%), meropenem (0%) and imipenem (0%). Furthermore, the distribution of ESBL-producing E. coli was consistent with the data obtained using an oligonucleotide microarray-based assay and PCR genotyping against genes associated with β-lactam resistance. ST131 was the dominant sequence type lineage of the isolates and was the most uropathogenic E. coli lineage. The E. coli isolates also carried aminoglycoside resistance genes. The evolution and prevalence of ESBL-producing E. coli may be rapidly accelerating in Saudi Arabia due to the high visitation seasons (especially to the city of Makkah). The health authority in Saudi Arabia should monitor the level of drug resistance in all general hospitals to reduce the increasing trend of microbial drug resistance and the impact on patient therapy.

Analysis of new charge-neutral DNA/RNA analogues phosphoryl guanidine oligonucleotides (PGO) by gel electrophoresis.

PubMed

Fokina, Alesya; Wang, Meiling; Ilyina, Anna; Klabenkova, Kristina; Burakova, Ekaterina; Chelobanov, Boris; Stetsenko, Dmitry

2018-06-02

Analysis and isolation of new charge-neutral phosphoryl guanidine oligonucleotides (PGO) by vertical slab electrophoresis were tested at different pH values (3-11) or in the presence of SDS as a micelle-forming agent. The most convenient way to analyze and purify phosphoryl guanidine oligonucleotides was by denaturing PAGE (8 M urea) at pH 3. The mobility of PGO is dependent on their A + C content. To analyze PGO containing only G, T or U, denaturing PAGE at pH 11 can be used, although the conditions need to be optimized. Bands were visualized by UV shadowing or Coomassie Brilliant Blue staining. Copyright © 2018. Published by Elsevier Inc.

Expression profiling of cassava storage roots reveals an active process of glycolysis/gluconeogenesis.

PubMed

Yang, Jun; An, Dong; Zhang, Peng

2011-03-01

Mechanisms related to the development of cassava storage roots and starch accumulation remain largely unknown. To evaluate genome-wide expression patterns during tuberization, a 60 mer oligonucleotide microarray representing 20 840 cassava genes was designed to identify differentially expressed transcripts in fibrous roots, developing storage roots and mature storage roots. Using a random variance model and the traditional twofold change method for statistical analysis, 912 and 3 386 upregulated and downregulated genes related to the three developmental phases were identified. Among 25 significantly changed pathways identified, glycolysis/gluconeogenesis was the most evident one. Rate-limiting enzymes were identified from each individual pathway, for example, enolase, L-lactate dehydrogenase and aldehyde dehydrogenase for glycolysis/gluconeogenesis, and ADP-glucose pyrophosphorylase, starch branching enzyme and glucan phosphorylase for sucrose and starch metabolism. This study revealed that dynamic changes in at least 16% of the total transcripts, including transcription factors, oxidoreductases/transferases/hydrolases, hormone-related genes, and effectors of homeostasis. The reliability of these differentially expressed genes was verified by quantitative real-time reverse transcription-polymerase chain reaction. These studies should facilitate our understanding of the storage root formation and cassava improvement. © 2011 Institute of Botany, Chinese Academy of Sciences.

Genome scale transcriptomics of baculovirus-insect interactions.

PubMed

Nguyen, Quan; Nielsen, Lars K; Reid, Steven

2013-11-12

Baculovirus-insect cell technologies are applied in the production of complex proteins, veterinary and human vaccines, gene delivery vectors' and biopesticides. Better understanding of how baculoviruses and insect cells interact would facilitate baculovirus-based production. While complete genomic sequences are available for over 58 baculovirus species, little insect genomic information is known. The release of the Bombyx mori and Plutella xylostella genomes, the accumulation of EST sequences for several Lepidopteran species, and especially the availability of two genome-scale analysis tools, namely oligonucleotide microarrays and next generation sequencing (NGS), have facilitated expression studies to generate a rich picture of insect gene responses to baculovirus infections. This review presents current knowledge on the interaction dynamics of the baculovirus-insect system' which is relatively well studied in relation to nucleocapsid transportation, apoptosis, and heat shock responses, but is still poorly understood regarding responses involved in pro-survival pathways, DNA damage pathways, protein degradation, translation, signaling pathways, RNAi pathways, and importantly metabolic pathways for energy, nucleotide and amino acid production. We discuss how the two genome-scale transcriptomic tools can be applied for studying such pathways and suggest that proteomics and metabolomics can produce complementary findings to transcriptomic studies.

Identification of a novel fusion gene, IRF2BP2-RARA, in acute promyelocytic leukemia.

PubMed

Yin, C Cameron; Jain, Nitin; Mehrotra, Meenakshi; Zhagn, Jianhua; Protopopov, Alexei; Zuo, Zhuang; Pemmaraju, Naveen; DiNardo, Courtney; Hirsch-Ginsberg, Cheryl; Wang, Sa A; Medeiros, L Jeffrey; Chin, Lynda; Patel, Keyur P; Ravandi, Farhad; Futreal, Andrew; Bueso-Ramos, Carlos E

2015-01-01

Acute promyelocytic leukemia (APL) is characterized by the fusion of retinoic acid receptor alpha (RARA) with promyelocytic leukemia (PML) or, rarely, other gene partners. This report presents a patient with APL with a novel fusion between RARA and the interferon regulatory factor 2 binding protein 2 (IRF2BP2) genes. A bone marrow examination in a 19-year-old woman who presented with ecchymoses and epistaxis showed morphologic and immunophenotypic features consistent with APL. PML oncogenic domain antibody was positive. Results of fluorescence in situ hybridization, conventional cytogenetics, reverse transcription-polymerase chain reaction (RT-PCR), and oligonucleotide microarray for PML-RARA and common APL variant translocations were negative. Next-generation RNA-sequencing analysis followed by RT-PCR and direct sequencing revealed distinct breakpoints within IRF2BP2 exon 2 and RARA intron 2. The patient received all-trans retinoic acid, arsenic, and gemtuzumab ozogamicin, and achieved complete remission. However, the disease relapsed 10 months later, 2 months after consolidation therapy. This is the first report showing involvement of IRF2BP2 in APL, and it expands the list of novel RARA partners identified in APL. Copyright © 2015 by the National Comprehensive Cancer Network.

Assessing differential expression in two-color microarrays: a resampling-based empirical Bayes approach.

PubMed

Li, Dongmei; Le Pape, Marc A; Parikh, Nisha I; Chen, Will X; Dye, Timothy D

2013-01-01

Microarrays are widely used for examining differential gene expression, identifying single nucleotide polymorphisms, and detecting methylation loci. Multiple testing methods in microarray data analysis aim at controlling both Type I and Type II error rates; however, real microarray data do not always fit their distribution assumptions. Smyth's ubiquitous parametric method, for example, inadequately accommodates violations of normality assumptions, resulting in inflated Type I error rates. The Significance Analysis of Microarrays, another widely used microarray data analysis method, is based on a permutation test and is robust to non-normally distributed data; however, the Significance Analysis of Microarrays method fold change criteria are problematic, and can critically alter the conclusion of a study, as a result of compositional changes of the control data set in the analysis. We propose a novel approach, combining resampling with empirical Bayes methods: the Resampling-based empirical Bayes Methods. This approach not only reduces false discovery rates for non-normally distributed microarray data, but it is also impervious to fold change threshold since no control data set selection is needed. Through simulation studies, sensitivities, specificities, total rejections, and false discovery rates are compared across the Smyth's parametric method, the Significance Analysis of Microarrays, and the Resampling-based empirical Bayes Methods. Differences in false discovery rates controls between each approach are illustrated through a preterm delivery methylation study. The results show that the Resampling-based empirical Bayes Methods offer significantly higher specificity and lower false discovery rates compared to Smyth's parametric method when data are not normally distributed. The Resampling-based empirical Bayes Methods also offers higher statistical power than the Significance Analysis of Microarrays method when the proportion of significantly differentially expressed genes is large for both normally and non-normally distributed data. Finally, the Resampling-based empirical Bayes Methods are generalizable to next generation sequencing RNA-seq data analysis.

Transfection microarray and the applications.

PubMed

Miyake, Masato; Yoshikawa, Tomohiro; Fujita, Satoshi; Miyake, Jun

2009-05-01

Microarray transfection has been extensively studied for high-throughput functional analysis of mammalian cells. However, control of efficiency and reproducibility are the critical issues for practical use. By using solid-phase transfection accelerators and nano-scaffold, we provide a highly efficient and reproducible microarray-transfection device, "transfection microarray". The device would be applied to the limited number of available primary cells and stem cells not only for large-scale functional analysis but also reporter-based time-lapse cellular event analysis.

Rhodobase, a meta-analytical tool for reconstructing gene regulatory networks in a model photosynthetic bacterium.

PubMed

Moskvin, Oleg V; Bolotin, Dmitry; Wang, Andrew; Ivanov, Pavel S; Gomelsky, Mark

2011-02-01

We present Rhodobase, a web-based meta-analytical tool for analysis of transcriptional regulation in a model anoxygenic photosynthetic bacterium, Rhodobacter sphaeroides. The gene association meta-analysis is based on the pooled data from 100 of R. sphaeroides whole-genome DNA microarrays. Gene-centric regulatory networks were visualized using the StarNet approach (Jupiter, D.C., VanBuren, V., 2008. A visual data mining tool that facilitates reconstruction of transcription regulatory networks. PLoS ONE 3, e1717) with several modifications. We developed a means to identify and visualize operons and superoperons. We designed a framework for the cross-genome search for transcription factor binding sites that takes into account high GC-content and oligonucleotide usage profile characteristic of the R. sphaeroides genome. To facilitate reconstruction of directional relationships between co-regulated genes, we screened upstream sequences (-400 to +20bp from start codons) of all genes for putative binding sites of bacterial transcription factors using a self-optimizing search method developed here. To test performance of the meta-analysis tools and transcription factor site predictions, we reconstructed selected nodes of the R. sphaeroides transcription factor-centric regulatory matrix. The test revealed regulatory relationships that correlate well with the experimentally derived data. The database of transcriptional profile correlations, the network visualization engine and the optimized search engine for transcription factor binding sites analysis are available at http://rhodobase.org. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Methods of DNA sequencing by hybridization based on optimizing concentration of matrix-bound oligonucleotide and device for carrying out same

DOEpatents

Khrapko, Konstantin R [Moscow, RU; Khorlin, Alexandr A [Moscow, RU; Ivanov, Igor B [Moskovskaya, RU; Ershov, Gennady M [Moscow, RU; Lysov, Jury P [Moscow, RU; Florentiev, Vladimir L [Moscow, RU; Mirzabekov, Andrei D [Moscow, RU

1996-09-03

A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.

Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

PubMed

Kalendar, Ruslan; Lee, David; Schulman, Alan H

2011-08-01

The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

Microarray technology for major chemical contaminants analysis in food: current status and prospects.

PubMed

Zhang, Zhaowei; Li, Peiwu; Hu, Xiaofeng; Zhang, Qi; Ding, Xiaoxia; Zhang, Wen

2012-01-01

Chemical contaminants in food have caused serious health issues in both humans and animals. Microarray technology is an advanced technique suitable for the analysis of chemical contaminates. In particular, immuno-microarray approach is one of the most promising methods for chemical contaminants analysis. The use of microarrays for the analysis of chemical contaminants is the subject of this review. Fabrication strategies and detection methods for chemical contaminants are discussed in detail. Application to the analysis of mycotoxins, biotoxins, pesticide residues, and pharmaceutical residues is also described. Finally, future challenges and opportunities are discussed.

Detection of Porphyromonas endodontalis, Porphyromonas gingivalis and Prevotella intermedia in primary endodontic infections in a Chinese population.

PubMed

Cao, H; Qi, Z; Jiang, H; Zhao, J; Liu, Z; Tang, Z

2012-08-01

To assess the prevalence of three black-pigmented bacterial species (Porphyromonas endodontalis, Porphyromonas gingivalis and Prevotella intermedia) using microarray technology in root canals of teeth associated with primary endodontic infections in a Chinese population. Microbial samples were taken from root canals of 80 teeth with pulp necrosis and primary endodontic infections in a Chinese population. DNA extracted from the samples was amplified by PCR with universal bacterial primers based on 16S rRNA gene sequences, and the products hybridized with the microarrays in which the specific oligonucleotide probes were added. The results of hybridization were screened by a confocal laser scanner. Pearson chi-square test and the two-sided Fisher exact test were used to analyse whether a significant association existed between the species and symptoms as well as in co-existence of two target organisms by a statistical software package (SAS 8.02). The 16S rRNA gene microarray detected at least one of the three test species in 76% of the study teeth. P. endodontalis, P. gingivalis and P. intermedia were found in 50%, 33% and 45%, respectively. A significant association was found in the presence of the pair P. endodontalis / P. gingivalis (P < 0.005). Both P. endodontalis (P <0.05) and P. gingivalis (P <0.005) had a statistically significant association with the presence of a sinus tract. The simultaneous presence of P. endodontalis and P. gingivalis was also associated with the presence of a sinus tract (P<0.005) and abscess formation (P<0.05). The three black-pigmented bacteria were prevalent in teeth with pulp necrosis and primary endodontic infections in a Chinese population. P. gingivalis and P. endodontalis were associated with the presence of sinus tract and abscess formation. © 2012 International Endodontic Journal.

Construction and Validation of the Rhodobacter sphaeroides 2.4.1 DNA Microarray: Transcriptome Flexibility at Diverse Growth Modes

PubMed Central

Pappas, Christopher T.; Sram, Jakub; Moskvin, Oleg V.; Ivanov, Pavel S.; Mackenzie, R. Christopher; Choudhary, Madhusudan; Land, Miriam L.; Larimer, Frank W.; Kaplan, Samuel; Gomelsky, Mark

2004-01-01

A high-density oligonucleotide DNA microarray, a genechip, representing the 4.6-Mb genome of the facultative phototrophic proteobacterium, Rhodobacter sphaeroides 2.4.1, was custom-designed and manufactured by Affymetrix, Santa Clara, Calif. The genechip contains probe sets for 4,292 open reading frames (ORFs), 47 rRNA and tRNA genes, and 394 intergenic regions. The probe set sequences were derived from the genome annotation generated by Oak Ridge National Laboratory after extensive revision, which was based primarily upon codon usage characteristic of this GC-rich bacterium. As a result of the revision, numerous missing ORFs were uncovered, nonexistent ORFs were deleted, and misidentified start codons were corrected. To evaluate R. sphaeroides transcriptome flexibility, expression profiles for three diverse growth modes—aerobic respiration, anaerobic respiration in the dark, and anaerobic photosynthesis—were generated. Expression levels of one-fifth to one-third of the R. sphaeroides ORFs were significantly different in cells under any two growth modes. Pathways involved in energy generation and redox balance maintenance under three growth modes were reconstructed. Expression patterns of genes involved in these pathways mirrored known functional changes, suggesting that massive changes in gene expression are the major means used by R. sphaeroides in adaptation to diverse conditions. Differential expression was observed for genes encoding putative new participants in these pathways (additional photosystem genes, duplicate NADH dehydrogenase, ATP synthases), whose functionality has yet to be investigated. The DNA microarray data correlated well with data derived from quantitative reverse transcription-PCR, as well as with data from the literature, thus validating the R. sphaeroides genechip as a powerful and reliable tool for studying unprecedented metabolic versatility of this bacterium. PMID:15231807

The prevalence of chromosomal deletions relating to developmental delay and/or intellectual disability in human euploid blastocysts.

PubMed

He, Wenyin; Sun, Xiaofang; Liu, Lian; Li, Man; Jin, Hua; Wang, Wei-Hua

2014-01-01

Chromosomal anomalies in human embryos produced by in vitro fertilization are very common, which include numerical (aneuploidy) and structural (deletion, duplication or others) anomalies. Our previous study indicated that chromosomal deletion(s) is the most common structural anomaly accounting for approximately 8% of euploid blastocysts. It is still unknown if these deletions in human euploid blastocysts have clinical significance. In this study, we analyzed 15 previously diagnosed euploid blastocysts that had chromosomal deletion(s) using Agilent oligonucleotide DNA microarray platform and localized the gene location in each deletion. Then, we used OMIM gene map and phenotype database to investigate if these deletions are related with some important genes that cause genetic diseases, especially developmental delay or intellectual disability. As results, we found that the detectable chromosomal deletion size with Agilent microarray is above 2.38 Mb, while the deletions observed in human blastocysts are between 11.6 to 103 Mb. With OMIM gene map and phenotype database information, we found that deletions can result in loss of 81-464 genes. Out of these genes, 34-149 genes are related with known genetic problems. Furthermore, we found that 5 out of 15 samples lost genes in the deleted region, which were related to developmental delay and/or intellectual disability. In conclusion, our data indicates that all human euploid blastocysts with chromosomal deletion(s) are abnormal and transfer of these embryos may cause birth defects and/or developmental and intellectual disabilities. Therefore, the embryos with chromosomal deletion revealed by DNA microarray should not be transferred to the patients, or further gene map and/or phenotype seeking is necessary before making a final decision.

Contributions to Statistical Problems Related to Microarray Data

ERIC Educational Resources Information Center

Hong, Feng

2009-01-01

Microarray is a high throughput technology to measure the gene expression. Analysis of microarray data brings many interesting and challenging problems. This thesis consists three studies related to microarray data. First, we propose a Bayesian model for microarray data and use Bayes Factors to identify differentially expressed genes. Second, we…

Microarray platform for omics analysis

NASA Astrophysics Data System (ADS)

Mecklenburg, Michael; Xie, Bin

2001-09-01

Microarray technology has revolutionized genetic analysis. However, limitations in genome analysis has lead to renewed interest in establishing 'omic' strategies. As we enter the post-genomic era, new microarray technologies are needed to address these new classes of 'omic' targets, such as proteins, as well as lipids and carbohydrates. We have developed a microarray platform that combines self- assembling monolayers with the biotin-streptavidin system to provide a robust, versatile immobilization scheme. A hydrophobic film is patterned on the surface creating an array of tension wells that eliminates evaporation effects thereby reducing the shear stress to which biomolecules are exposed to during immobilization. The streptavidin linker layer makes it possible to adapt and/or develop microarray based assays using virtually any class of biomolecules including: carbohydrates, peptides, antibodies, receptors, as well as them ore traditional DNA based arrays. Our microarray technology is designed to furnish seamless compatibility across the various 'omic' platforms by providing a common blueprint for fabricating and analyzing arrays. The prototype microarray uses a microscope slide footprint patterned with 2 by 96 flat wells. Data on the microarray platform will be presented.

Microarrays in brain research: the good, the bad and the ugly.

PubMed

Mirnics, K

2001-06-01

Making sense of microarray data is a complex process, in which the interpretation of findings will depend on the overall experimental design and judgement of the investigator performing the analysis. As a result, differences in tissue harvesting, microarray types, sample labelling and data analysis procedures make post hoc sharing of microarray data a great challenge. To ensure rapid and meaningful data exchange, we need to create some order out of the existing chaos. In these ground-breaking microarray standardization and data sharing efforts, NIH agencies should take a leading role

Repression of anti-proliferative factor Tob1 in osteoarthritic cartilage

PubMed Central

Gebauer, Mathias; Saas, Joachim; Haag, Jochen; Dietz, Uwe; Takigawa, Masaharu; Bartnik, Eckart; Aigner, Thomas

2005-01-01

Osteoarthritis is the most common degenerative disorder of the modern world. However, many basic cellular features and molecular processes of the disease are poorly understood. In the present study we used oligonucleotide-based microarray analysis of genes of known or assumed relevance to the cellular phenotype to screen for relevant differences in gene expression between normal and osteoarthritic chondrocytes. Custom made oligonucleotide DNA arrays were used to screen for differentially expressed genes in normal (n = 9) and osteoarthritic (n = 10) cartilage samples. Real-time polymerase chain reaction (PCR) with gene-specific primers was used for quantification. Primary human adult articular chondrocytes and chondrosarcoma cell line HCS-2/8 were used to study changes in gene expression levels after stimulation with interleukin-1β and bone morphogenetic protein, as well as the dependence on cell differentiation. In situ hybridization with a gene-specific probe was applied to detect mRNA expression levels in fetal growth plate cartilage. Overall, more than 200 significantly regulated genes were detected between normal and osteoarthritic cartilage (P < 0.01). One of the significantly repressed genes, Tob1, encodes a protein belonging to a family involved in silencing cells in terms of proliferation and functional activity. The repression of Tob1 was confirmed by quantitative PCR and correlated to markers of chondrocyte activity and proliferation in vivo. Tob1 expression was also detected at a decreased level in isolated chondrocytes and in the chondrosarcoma cell line HCS-2/8. Again, in these cells it was negatively correlated with proliferative activity and positively with cellular differentiation. Altogether, the downregulation of the expression of Tob1 in osteoarthritic chondrocytes might be an important aspect of the cellular processes taking place during osteoarthritic cartilage degeneration. Activation, the reinitiation of proliferative activity and the loss of a stable phenotype are three major changes in osteoarthritic chondrocytes that are highly significantly correlated with the repression of Tob1 expression. PMID:15743474

HDBStat!: a platform-independent software suite for statistical analysis of high dimensional biology data.

PubMed

Trivedi, Prinal; Edwards, Jode W; Wang, Jelai; Gadbury, Gary L; Srinivasasainagendra, Vinodh; Zakharkin, Stanislav O; Kim, Kyoungmi; Mehta, Tapan; Brand, Jacob P L; Patki, Amit; Page, Grier P; Allison, David B

2005-04-06

Many efforts in microarray data analysis are focused on providing tools and methods for the qualitative analysis of microarray data. HDBStat! (High-Dimensional Biology-Statistics) is a software package designed for analysis of high dimensional biology data such as microarray data. It was initially developed for the analysis of microarray gene expression data, but it can also be used for some applications in proteomics and other aspects of genomics. HDBStat! provides statisticians and biologists a flexible and easy-to-use interface to analyze complex microarray data using a variety of methods for data preprocessing, quality control analysis and hypothesis testing. Results generated from data preprocessing methods, quality control analysis and hypothesis testing methods are output in the form of Excel CSV tables, graphs and an Html report summarizing data analysis. HDBStat! is a platform-independent software that is freely available to academic institutions and non-profit organizations. It can be downloaded from our website http://www.soph.uab.edu/ssg_content.asp?id=1164.

Gene expression analysis of a Helicobacter pylori-infected and high-salt diet-treated mouse gastric tumor model: identification of CD177 as a novel prognostic factor in patients with gastric cancer

PubMed Central

2013-01-01

Background Helicobacter pylori (H. pylori) infection and excessive salt intake are known as important risk factors for stomach cancer in humans. However, interactions of these two factors with gene expression profiles during gastric carcinogenesis remain unclear. In the present study, we investigated the global gene expression associated with stomach carcinogenesis and prognosis of human gastric cancer using a mouse model. Methods To find candidate genes involved in stomach carcinogenesis, we firstly constructed a carcinogen-induced mouse gastric tumor model combined with H. pylori infection and high-salt diet. C57BL/6J mice were given N-methyl-N-nitrosourea in their drinking water and sacrificed after 40 weeks. Animals of a combination group were inoculated with H. pylori and fed a high-salt diet. Gene expression profiles in glandular stomach of the mice were investigated by oligonucleotide microarray. Second, we examined an availability of the candidate gene as prognostic factor for human patients. Immunohistochemical analysis of CD177, one of the up-regulated genes, was performed in human advanced gastric cancer specimens to evaluate the association with prognosis. Results The multiplicity of gastric tumor in carcinogen-treated mice was significantly increased by combination of H. pylori infection and high-salt diet. In the microarray analysis, 35 and 31 more than two-fold up-regulated and down-regulated genes, respectively, were detected in the H. pylori-infection and high-salt diet combined group compared with the other groups. Quantitative RT-PCR confirmed significant over-expression of two candidate genes including Cd177 and Reg3g. On immunohistochemical analysis of CD177 in human advanced gastric cancer specimens, over-expression was evident in 33 (60.0%) of 55 cases, significantly correlating with a favorable prognosis (P = 0.0294). Multivariate analysis including clinicopathological factors as covariates revealed high expression of CD177 to be an independent prognostic factor for overall survival. Conclusions These results suggest that our mouse model combined with H. pylori infection and high-salt diet is useful for gene expression profiling in gastric carcinogenesis, providing evidence that CD177 is a novel prognostic factor for stomach cancer. This is the first report showing a prognostic correlation between CD177 expression and solid tumor behavior. PMID:23899160

Distinct types of primary cutaneous large B-cell lymphoma identified by gene expression profiling.

PubMed

Hoefnagel, Juliette J; Dijkman, Remco; Basso, Katia; Jansen, Patty M; Hallermann, Christian; Willemze, Rein; Tensen, Cornelis P; Vermeer, Maarten H

2005-05-01

In the European Organization for Research and Treatment of Cancer (EORTC) classification 2 types of primary cutaneous large B-cell lymphoma (PCLBCL) are distinguished: primary cutaneous follicle center cell lymphomas (PCFCCL) and PCLBCL of the leg (PCLBCL-leg). Distinction between both groups is considered important because of differences in prognosis (5-year survival > 95% and 52%, respectively) and the first choice of treatment (radiotherapy or systemic chemotherapy, respectively), but is not generally accepted. To establish a molecular basis for this subdivision in the EORTC classification, we investigated the gene expression profiles of 21 PCLBCLs by oligonucleotide microarray analysis. Hierarchical clustering based on a B-cell signature (7450 genes) classified PCLBCL into 2 distinct subgroups consisting of, respectively, 8 PCFCCLs and 13 PCLBCLsleg. PCLBCLs-leg showed increased expression of genes associated with cell proliferation; the proto-oncogenes Pim-1, Pim-2, and c-Myc; and the transcription factors Mum1/IRF4 and Oct-2. In the group of PCFCCL high expression of SPINK2 was observed. Further analysis suggested that PCFCCLs and PCLBCLs-leg have expression profiles similar to that of germinal center B-cell-like and activated B-cell-like diffuse large B-cell lymphoma, respectively. The results of this study suggest that different pathogenetic mechanisms are involved in the development of PCFCCLs and PCLBCLs-leg and provide molecular support for the subdivision used in the EORTC classification.

WebaCGH: an interactive online tool for the analysis and display of array comparative genomic hybridisation data.

PubMed

Frankenberger, Casey; Wu, Xiaolin; Harmon, Jerry; Church, Deanna; Gangi, Lisa M; Munroe, David J; Urzúa, Ulises

2006-01-01

Gene copy number variations occur both in normal cells and in numerous pathologies including cancer and developmental diseases. Array comparative genomic hybridisation (aCGH) is an emerging technology that allows detection of chromosomal gains and losses in a high-resolution format. When aCGH is performed on cDNA and oligonucleotide microarrays, the impact of DNA copy number on gene transcription profiles may be directly compared. We have created an online software tool, WebaCGH, that functions to (i) upload aCGH and gene transcription results from multiple experiments; (ii) identify significant aberrant regions using a local Z-score threshold in user-selected chromosomal segments subjected to smoothing with moving averages; and (iii) display results in a graphical format with full genome and individual chromosome views. In the individual chromosome display, data can be zoomed in/out in both dimensions (i.e. ratio and physical location) and plotted features can have 'mouse over' linking to outside databases to identify loci of interest. Uploaded data can be stored indefinitely for subsequent retrieval and analysis. WebaCGH was created as a Java-based web application using the open-source database MySQL. WebaCGH is freely accessible at http://129.43.22.27/WebaCGH/welcome.htm Xiaolin Wu (forestwu@mail.nih.gov) or Ulises Urzúa (uurzua@med.uchile.cl).

Expression profiling of Yersinia pestis during mouse pulmonary infection.

PubMed

Lawson, Jonathan N; Lyons, C Rick; Johnston, Stephen Albert

2006-11-01

Yersinia pestis, the causative agent of plague, can be transmitted by infected flea bite or inhaled aerosol. Both routes of infection have a high mortality rate, and pneumonic infections of Y. pestis represent a significant concern as a tool of bioterrorism. Understanding the transcriptional program of this pathogen during pulmonary infection should be valuable in understanding plague pathogenesis, as well as potentially offering insights into new vaccines and therapeutics. Toward this goal we developed a long oligonucleotide microarray to the plague bacillus and evaluated the expression profiles of Y. pestis in vitro and in the mouse pulmonary infection model in vivo. The in vitro analysis compared expression patterns at 27 versus 37 degrees C, as a surrogate of the transition from the flea to the mammalian host. The in vivo analysis used intranasal challenge to the mouse lung. By amplifying the Y. pestis RNA from individual mouse lungs we were able to map the transcriptional profile of plague at postinfection days 1 to 3. Our data present a very different transcriptional profile between in vivo and in vitro expression, suggesting Y. pestis responds to a variety of host signals during infection. Of note was the number of genes found in genomic regions with altered %GC content that are upregulated within the mouse lung environment. These data suggest these regions may provide particularly promising targets for both vaccines and therapeutics.

Response of human renal tubular cells to cyclosporine and sirolimus: A toxicogenomic study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pallet, Nicolas; Rabant, Marion; Xu-Dubois, Yi-Chun

The molecular mechanisms involved in the potentially nephrotoxic response of tubular cells to immunosuppressive drugs remain poorly understood. Transcriptional profiles of human proximal tubular cells exposed to cyclosporine A (CsA), sirolimus (SRL) or their combination, were established using oligonucleotide microarrays. Hierarchical clustering of genes implicated in fibrotic processes showed a clear distinction between expression profiles with CsA and CsA + SRL treatments on the one hand and SRL treatment on the other. Functional analysis found that CsA and CsA + SRL treatments preferentially alter biological processes located at the cell membrane, such as ion transport or signal transduction, whereas SRLmore » modifies biological processes within the nucleus and related to transcriptional activity. Genome wide expression analysis suggested that CsA may induce an endoplasmic reticulum (ER) stress in tubular cells in vitro. Moreover we found that CsA exposure in vivo is associated with the upregulation of the ER stress marker BIP in kidney transplant biopsies. In conclusion, this toxicogenomic study highlights the molecular interaction networks that may contribute to the tubular response to CsA and SRL. These results may also offer a new working hypothesis for future research in the field of CsA nephrotoxicity. Further studies are needed to evaluate if ER stress detection in tubular cells in human biopsies can predict CsA nephrotoxicity.« less

Oligonucleotide-arrayed TFT photosensor applicable for DNA chip technology.

PubMed

Tanaka, Tsuyoshi; Hatakeyama, Keiichi; Sawaguchi, Masahiro; Iwadate, Akihito; Mizutani, Yasushi; Sasaki, Kazuhiro; Tateishi, Naofumi; Takeyama, Haruko; Matsunaga, Tadashi

2006-09-05

A thin film transistor (TFT) photosensor fabricated by semiconductor integrated circuit (IC) technology was applied to DNA chip technology. The surface of the TFT photosensor was coated with TiO2 using a vapor deposition technique for the fabrication of optical filters. The immobilization of thiolated oligonucleotide probes onto a TiO2-coated TFT photosensor using gamma-aminopropyltriethoxysilane (APTES) and N-(gamma-maleimidobutyloxy) sulfosuccinimide ester (GMBS) was optimized. The coverage value of immobilized oligonucleotides reached a plateau at 33.7 pmol/cm2, which was similar to a previous analysis using radioisotope-labeled oligonucleotides. The lowest detection limits were 0.05 pmol/cm2 for quantum dot and 2.1 pmol/cm2 for Alexa Fluor 350. Furthermore, single nucleotide polymorphism (SNP) detection was examined using the oligonucleotide-arrayed TFT photosensor. A SNP present in the aldehyde dehydrogenase 2 (ALDH2) gene was used as a target. The SNPs in ALDH2*1 and ALDH2*2 target DNA were detected successfully using the TFT photosensor. DNA hybridization in the presence of both ALDH2*1 and ALDH2*2 target DNA was observed using both ALDH2*1 and ALDH2*2 detection oligonucleotides-arrayed TFT photosensor. Use of the TFT photosensor will allow the development of a disposable photodetecting device for DNA chip systems. (c) 2006 Wiley Periodicals, Inc.

Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

PubMed

Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

2007-04-10

For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

ArrayNinja: An Open Source Platform for Unified Planning and Analysis of Microarray Experiments.

PubMed

Dickson, B M; Cornett, E M; Ramjan, Z; Rothbart, S B

2016-01-01

Microarray-based proteomic platforms have emerged as valuable tools for studying various aspects of protein function, particularly in the field of chromatin biochemistry. Microarray technology itself is largely unrestricted in regard to printable material and platform design, and efficient multidimensional optimization of assay parameters requires fluidity in the design and analysis of custom print layouts. This motivates the need for streamlined software infrastructure that facilitates the combined planning and analysis of custom microarray experiments. To this end, we have developed ArrayNinja as a portable, open source, and interactive application that unifies the planning and visualization of microarray experiments and provides maximum flexibility to end users. Array experiments can be planned, stored to a private database, and merged with the imaged results for a level of data interaction and centralization that is not currently attainable with available microarray informatics tools. © 2016 Elsevier Inc. All rights reserved.

Evolution of thermophilic DNA polymerases for the recognition and amplification of C2ʹ-modified DNA

NASA Astrophysics Data System (ADS)

Chen, Tingjian; Hongdilokkul, Narupat; Liu, Zhixia; Adhikary, Ramkrishna; Tsuen, Shujian S.; Romesberg, Floyd E.

2016-06-01

The PCR amplification of oligonucleotides enables the evolution of sequences called aptamers that bind specific targets with antibody-like affinity. However, in many applications the use of these aptamers is limited by nuclease-mediated degradation. In contrast, oligonucleotides that are modified at their sugar C2ʹ positions with methoxy or fluorine substituents are stable to nucleases, but they cannot be synthesized by natural polymerases. Here we report the development of a polymerase-evolution system and its use to evolve thermostable polymerases that efficiently interconvert C2ʹ-OMe-modified oligonucleotides and their DNA counterparts via ‘transcription’ and ‘reverse transcription’ or, more importantly, that PCR-amplify partially C2ʹ-OMe- or C2ʹ-F-modified oligonucleotides. A mechanistic analysis demonstrates that the ability to amplify the modified oligonucleotides evolved by optimizing interdomain interactions that stabilize the catalytically competent closed conformation of the polymerase. The evolved polymerases should find practical applications and the developed evolution system should be a powerful tool for tailoring polymerases to have other types of novel function.

[Evaluation of transfection effectiveness using fluorescein-labelled oligonucleotides and entraster-R siRNA transfection into Plasmodium falciparum].

PubMed

Zhou, Hong-Chang; Gao, Yu-Hui; Shao, Sheng-Wen; Zhang, Hui; Zhang, Ting

2013-12-01

The cultured Plasmodium falciparum parasites were synchronized twice by 5% sorbitol treatment twice (8-hour window), and then incubated at 37 degrees C for 16 h. Parasites were transfected with fluorescein-labelled oligonucleotides (group A) or fluorescein-labelled oligonucleotides+Entranster-R siRNA transfection reagent (group B). After 5 h a part of parasites was evaluated by fluorescence microscopy and flow cytometry. The rest of parasites were washed with RPMI 1640 medium, and then incubated with 500 microl new medium containing 2% fresh erythrocytes for another 12 h, and detected by flow cytometry. The fluorescein-labelled oligonucleotides were localized in erythrocytes in group B, but nearly no fluorescence was observed for group A. Flow cytometry analysis indicated that the transfection efficiency of group B [(47.40 +/- 3.39)%] was higher than that of group A [(0.60 +/- 0.27)%]. In the second cell cycle, the transfection efficiency in group B was (26.85 +/- 2.90)%, while that of group A was nearly zero. The results indicated that Entranster-R siRNA transfection reagent may increase the oligonucleotides transfection efficiency.

A new arenavirus in a cluster of fatal transplant-associated diseases.

PubMed

Palacios, Gustavo; Druce, Julian; Du, Lei; Tran, Thomas; Birch, Chris; Briese, Thomas; Conlan, Sean; Quan, Phenix-Lan; Hui, Jeffrey; Marshall, John; Simons, Jan Fredrik; Egholm, Michael; Paddock, Christopher D; Shieh, Wun-Ju; Goldsmith, Cynthia S; Zaki, Sherif R; Catton, Mike; Lipkin, W Ian

2008-03-06

Three patients who received visceral-organ transplants from a single donor on the same day died of a febrile illness 4 to 6 weeks after transplantation. Culture, polymerase-chain-reaction (PCR) and serologic assays, and oligonucleotide microarray analysis for a wide range of infectious agents were not informative. We evaluated RNA obtained from the liver and kidney transplant recipients. Unbiased high-throughput sequencing was used to identify microbial sequences not found by means of other methods. The specificity of sequences for a new candidate pathogen was confirmed by means of culture and by means of PCR, immunohistochemical, and serologic analyses. High-throughput sequencing yielded 103,632 sequences, of which 14 represented an Old World arenavirus. Additional sequence analysis showed that this new arenavirus was related to lymphocytic choriomeningitis viruses. Specific PCR assays based on a unique sequence confirmed the presence of the virus in the kidneys, liver, blood, and cerebrospinal fluid of the recipients. Immunohistochemical analysis revealed arenavirus antigen in the liver and kidney transplants in the recipients. IgM and IgG antiviral antibodies were detected in the serum of the donor. Seroconversion was evident in serum specimens obtained from one recipient at two time points. Unbiased high-throughput sequencing is a powerful tool for the discovery of pathogens. The use of this method during an outbreak of disease facilitated the identification of a new arenavirus transmitted through solid-organ transplantation. Copyright 2008 Massachusetts Medical Society.

WebArray: an online platform for microarray data analysis

PubMed Central

Xia, Xiaoqin; McClelland, Michael; Wang, Yipeng

2005-01-01

Background Many cutting-edge microarray analysis tools and algorithms, including commonly used limma and affy packages in Bioconductor, need sophisticated knowledge of mathematics, statistics and computer skills for implementation. Commercially available software can provide a user-friendly interface at considerable cost. To facilitate the use of these tools for microarray data analysis on an open platform we developed an online microarray data analysis platform, WebArray, for bench biologists to utilize these tools to explore data from single/dual color microarray experiments. Results The currently implemented functions were based on limma and affy package from Bioconductor, the spacings LOESS histogram (SPLOSH) method, PCA-assisted normalization method and genome mapping method. WebArray incorporates these packages and provides a user-friendly interface for accessing a wide range of key functions of limma and others, such as spot quality weight, background correction, graphical plotting, normalization, linear modeling, empirical bayes statistical analysis, false discovery rate (FDR) estimation, chromosomal mapping for genome comparison. Conclusion WebArray offers a convenient platform for bench biologists to access several cutting-edge microarray data analysis tools. The website is freely available at . It runs on a Linux server with Apache and MySQL. PMID:16371165

Sieve-based device for MALDI sample preparation. I. Influence of sample deposition conditions in oligonucleotide analysis to achieve significant increases in both sensitivity and resolution.

PubMed

Molin, Laura; Cristoni, Simone; Crotti, Sara; Bernardi, Luigi Rossi; Seraglia, Roberta; Traldi, Pietro

2008-11-01

Spraying of oligonucleotide-matrix solutions through a stainless steel (ss) sieve (38 microm, 450 mesh) leads to the formation, on the matrix-assisted laser desorption/ionization (MALDI) sample holder, of uniformly distributed microcrystals, well separated from each other. When the resulting sample holder surface is irradiated by laser, abundant molecular species form, with a clear increase in both intensity and resolution with respect to values obtained by 'Dried Droplet', 'Double Layer', and 'Sandwich' deposition methods. In addition, unlike the usual situation, the sample is perfectly homogeneous, and identical spectra are obtained by irradiating different areas. On one hand, the data indicate that this method is highly effective for oligonucleotide MALDI analysis, and on the other, that it can be validly employed for fully automated MALDI procedures.

Response of Desulfovibrio vulgaris to Alkaline Stress▿ †

PubMed Central

Stolyar, Sergey; He, Qiang; Joachimiak, Marcin P.; He, Zhili; Yang, Zamin Koo; Borglin, Sharon E.; Joyner, Dominique C.; Huang, Katherine; Alm, Eric; Hazen, Terry C.; Zhou, Jizhong; Wall, Judy D.; Arkin, Adam P.; Stahl, David A.

2007-01-01

The response of exponentially growing Desulfovibrio vulgaris Hildenborough to pH 10 stress was studied using oligonucleotide microarrays and a study set of mutants with genes suggested by microarray data to be involved in the alkaline stress response deleted. The data showed that the response of D. vulgaris to increased pH is generally similar to that of Escherichia coli but is apparently controlled by unique regulatory circuits since the alternative sigma factors (sigma S and sigma E) contributing to this stress response in E. coli appear to be absent in D. vulgaris. Genes previously reported to be up-regulated in E. coli were up-regulated in D. vulgaris; these genes included three ATPase genes and a tryptophan synthase gene. Transcription of chaperone and protease genes (encoding ATP-dependent Clp and La proteases and DnaK) was also elevated in D. vulgaris. As in E. coli, genes involved in flagellum synthesis were down-regulated. The transcriptional data also identified regulators, distinct from sigma S and sigma E, that are likely part of a D. vulgaris Hildenborough-specific stress response system. Characterization of a study set of mutants with genes implicated in alkaline stress response deleted confirmed that there was protective involvement of the sodium/proton antiporter NhaC-2, tryptophanase A, and two putative regulators/histidine kinases (DVU0331 and DVU2580). PMID:17921288

Transcriptome remodeling associated with chronological aging in the dinoflagellate, Karenia brevis.

PubMed

Johnson, Jillian G; Morey, Jeanine S; Neely, Marion G; Ryan, James C; Van Dolah, Frances M

2012-03-01

The toxic dinoflagellate, Karenia brevis, forms dense blooms in the Gulf of Mexico that persist for many months in coastal waters, where they can cause extensive marine animal mortalities and human health impacts. The mechanisms that enable cell survival in high density, low growth blooms, and the mechanisms leading to often rapid bloom demise are not well understood. To gain an understanding of processes that underlie chronological aging in this dinoflagellate, a microarray study was carried out to identify changes in the global transcriptome that accompany the entry and maintenance of stationary phase up to the onset of cell death. The transcriptome of K. brevis was assayed using a custom 10,263 feature oligonucleotide microarray from mid-logarithmic growth to the onset of culture demise. A total of 2958 (29%) features were differentially expressed, with the mid-stationary phase timepoint demonstrating peak changes in expression. Gene ontology enrichment analyses identified a significant shift in transcripts involved in energy acquisition, ribosome biogenesis, gene expression, stress adaptation, calcium signaling, and putative brevetoxin biosynthesis. The extensive remodeling of the transcriptome observed in the transition into a quiescent non-dividing phase appears to be indicative of a global shift in the metabolic and signaling requirements and provides the basis from which to understand the process of chronological aging in a dinoflagellate. Published by Elsevier B.V.

Application of an oligonucleotide microarray-based nano-amplification technique for the detection of fungal pathogens.

PubMed

Lu, Weiping; Gu, Dayong; Chen, Xingyun; Xiong, Renping; Liu, Ping; Yang, Nan; Zhou, Yuanguo

2010-10-01

The traditional techniques for diagnosis of invasive fungal infections in the clinical microbiology laboratory need improvement. These techniques are prone to delay results due to their time-consuming process, or result in misidentification of the fungus due to low sensitivity or low specificity. The aim of this study was to develop a method for the rapid detection and identification of fungal pathogens. The internal transcribed spacer two fragments of fungal ribosomal DNA were amplified using a polymerase chain reaction for all samples. Next, the products were hybridized with the probes immobilized on the surface of a microarray. These species-specific probes were designed to detect nine different clinical pathogenic fungi including Candida albicans, Candida tropocalis, Candida glabrata, Candida parapsilosis, Candida krusei, Candida lusitaniae, Candida guilliermondii, Candida keyfr, and Cryptococcus neoformans. The hybridizing signals were enhanced with gold nanoparticles and silver deposition, and detected using a flatbed scanner or visually. Fifty-nine strains of fungal pathogens, including standard and clinically isolated strains, were correctly identified by this method. The sensitivity of the assay for Candida albicans was 10 cells/mL. Ten cultures from clinical specimens and 12 clinical samples spiked with fungi were also identified correctly. This technique offers a reliable alternative to conventional methods for the detection and identification of fungal pathogens. It has higher efficiency, specificity and sensitivity compared with other methods commonly used in the clinical laboratory.

Persistence and breakdown of strand symmetry in the human genome.

PubMed

Zhang, Shang-Hong

2015-04-07

Afreixo, V., Bastos, C.A.C., Garcia, S.P., Rodrigues, J.M.O.S., Pinho, A.J., Ferreira, P.J.S.G., 2013. The breakdown of the word symmetry in the human genome. J. Theor. Biol. 335, 153-159 analyzed the word symmetry (strand symmetry or the second parity rule) in the human genome. They concluded that strand symmetry holds for oligonucleotides up to 6 nt and is no longer statistically significant for oligonucleotides of higher orders. However, although they provided some new results for the issue, their interpretation would not be fully justified. Also, their conclusion needs to be further evaluated. Further analysis of their results, especially those of equivalence tests and word symmetry distance, shows that strand symmetry would persist for higher-order oligonucleotides up to 9 nt in the human genome, at least for its overall frequency framework (oligonucleotide frequency pattern). Copyright © 2015 Elsevier Ltd. All rights reserved.

Remediation of petroleum hydrocarbon-contaminated sites by DNA diagnosis-based bioslurping technology.

PubMed

Kim, Seungjin; Krajmalnik-Brown, Rosa; Kim, Jong-Oh; Chung, Jinwook

2014-11-01

The application of effective remediation technologies can benefit from adequate preliminary testing, such as in lab-scale and Pilot-scale systems. Bioremediation technologies have demonstrated tremendous potential with regards to cost, but they cannot be used for all contaminated sites due to limitations in biological activity. The purpose of this study was to develop a DNA diagnostic method that reduces the time to select contaminated sites that are good candidates for bioremediation. We applied an oligonucleotide microarray method to detect and monitor genes that lead to aliphatic and aromatic degradation. Further, the bioremediation of a contaminated site, selected based on the results of the genetic diagnostic method, was achieved successfully by applying bioslurping in field tests. This gene-based diagnostic technique is a powerful tool to evaluate the potential for bioremediation in petroleum hydrocarbon contaminated soil. Copyright © 2014 Elsevier B.V. All rights reserved.

Bioorthogonal in Situ Hydrogels Based on Polyether Polyols for New Biosensor Materials with High Sensitivity.

PubMed

Herrmann, Anna; Kaufmann, Lena; Dey, Pradip; Haag, Rainer; Schedler, Uwe

2018-04-04

Both noncovalent and covalent encapsulations of active biomolecules, for example, proteins and oligonucleotides, for a new biosensor matrix in an in situ bioorthogonal hydrogel formation via a strain-promoted azide-alkyne cycloaddition reaction were investigated. Unspecific interaction between the gel and the biomolecules as well as protein denaturation was prevented by the bioorthogonal gel components, which ensure a uniform aqueous environment in the hydrogel network. No leaching of the active biomolecules was observed. Additionally, a much higher and also adjustable loading of biomolecules in the hydrogel matrix was achieved compared to conventional biosensor surfaces, where the sensor molecules are immobilized on monolayers (2D surfaces) or brushlike structures (3D surfaces). Spotting experiments of the hydrogel confirm the possibility to use this new surface for microarray-based multiplex applications which require very high signal-to-noise ratios.

Multiplex amplification of large sets of human exons.

PubMed

Porreca, Gregory J; Zhang, Kun; Li, Jin Billy; Xie, Bin; Austin, Derek; Vassallo, Sara L; LeProust, Emily M; Peck, Bill J; Emig, Christopher J; Dahl, Fredrik; Gao, Yuan; Church, George M; Shendure, Jay

2007-11-01

A new generation of technologies is poised to reduce DNA sequencing costs by several orders of magnitude. But our ability to fully leverage the power of these technologies is crippled by the absence of suitable 'front-end' methods for isolating complex subsets of a mammalian genome at a scale that matches the throughput at which these platforms will routinely operate. We show that targeting oligonucleotides released from programmable microarrays can be used to capture and amplify approximately 10,000 human exons in a single multiplex reaction. Additionally, we show integration of this protocol with ultra-high-throughput sequencing for targeted variation discovery. Although the multiplex capture reaction is highly specific, we found that nonuniform capture is a key issue that will need to be resolved by additional optimization. We anticipate that highly multiplexed methods for targeted amplification will enable the comprehensive resequencing of human exons at a fraction of the cost of whole-genome resequencing.

Microfabricated Fountain Pens for High-Density DNA Arrays

PubMed Central

Reese, Matthew O.; van Dam, R. Michae; Scherer, Axel; Quake, Stephen R.

2003-01-01

We used photolithographic microfabrication techniques to create very small stainless steel fountain pens that were installed in place of conventional pens on a microarray spotter. Because of the small feature size produced by the microfabricated pens, we were able to print arrays with up to 25,000 spots/cm2, significantly higher than can be achieved by other deposition methods. This feature density is sufficiently large that a standard microscope slide can contain multiple replicates of every gene in a complex organism such as a mouse or human. We tested carryover during array printing with dye solution, labeled DNA, and hybridized DNA, and we found it to be indistinguishable from background. Hybridization also showed good sequence specificity to printed oligonucleotides. In addition to improved slide capacity, the microfabrication process offers the possibility of low-cost mass-produced pens and the flexibility to include novel pen features that cannot be machined with conventional techniques. PMID:12975313

Aberrant expression of the PHF14 gene in biliary tract cancer cells

PubMed Central

AKAZAWA, TAKAKO; YASUI, KOHICHIROH; GEN, YASUYUKI; YAMADA, NOBUHISA; TOMIE, AKIRA; DOHI, OSAMU; MITSUYOSHI, HIRONORI; YAGI, NOBUAKI; ITOH, YOSHITO; NAITO, YUJI; YOSHIKAWA, TOSHIKAZU

2013-01-01

DNA copy number aberrations in human biliary tract cancer (BTC) cell lines were investigated using a high-density oligonucleotide microarray. A novel homozygous deletion was detected at chromosomal region 7p21.3 in the OZ cell line. Further validation experiments using genomic PCR revealed a homozygous deletion of a single gene, plant homeodomain (PHD) finger protein 14 (PHF14). No PHF14 mRNA or protein expression was detected, thus demonstrating the absence of PHF14 expression in the OZ cell line. Although the PHD finger protein is considered to be involved in chromatin-mediated transcriptional regulation, little is known about the function of PHF14 in cancer. The present study observed that the knock down of PHF14 using small interfering RNA (siRNA) enhanced the growth of the BTC cells. These observations suggest that aberrant PHF14 expression may have a role in the tumorigenesis of BTC. PMID:23833654

Gene expression profiling in the hippocampus of learned helpless and nonhelpless rats.

PubMed

Kohen, R; Kirov, S; Navaja, G P; Happe, H Kevin; Hamblin, M W; Snoddy, J R; Neumaier, J F; Petty, F

2005-01-01

In the learned helplessness (LH) animal model of depression, failure to attempt escape from avoidable environmental stress, LH, indicates behavioral despair, whereas nonhelpless (NH) behavior reflects behavioral resilience to the effects of environmental stress. Comparing hippocampal gene expression with large-scale oligonucleotide microarrays, we found that stress-resilient (NH) rats, although behaviorally indistinguishable from controls, showed a distinct gene expression profile compared to LH, sham stressed, and naïve control animals. Genes that were confirmed as differentially expressed in the NH group by quantitative PCR strongly correlated in their levels of expression across all four animal groups. Differential expression could not be confirmed at the protein level. We identified several shared degenerate sequence motifs in the 3' untranslated region (3'UTR) of differentially expressed genes that could be a factor in this tight correlation of expression levels among differentially expressed genes.

The Development of Protein Microarrays and Their Applications in DNA-Protein and Protein-Protein Interaction Analyses of Arabidopsis Transcription Factors

PubMed Central

Gong, Wei; He, Kun; Covington, Mike; Dinesh-Kumar, S. P.; Snyder, Michael; Harmer, Stacey L.; Zhu, Yu-Xian; Deng, Xing Wang

2009-01-01

We used our collection of Arabidopsis transcription factor (TF) ORFeome clones to construct protein microarrays containing as many as 802 TF proteins. These protein microarrays were used for both protein-DNA and protein-protein interaction analyses. For protein-DNA interaction studies, we examined AP2/ERF family TFs and their cognate cis-elements. By careful comparison of the DNA-binding specificity of 13 TFs on the protein microarray with previous non-microarray data, we showed that protein microarrays provide an efficient and high throughput tool for genome-wide analysis of TF-DNA interactions. This microarray protein-DNA interaction analysis allowed us to derive a comprehensive view of DNA-binding profiles of AP2/ERF family proteins in Arabidopsis. It also revealed four TFs that bound the EE (evening element) and had the expected phased gene expression under clock-regulation, thus providing a basis for further functional analysis of their roles in clock regulation of gene expression. We also developed procedures for detecting protein interactions using this TF protein microarray and discovered four novel partners that interact with HY5, which can be validated by yeast two-hybrid assays. Thus, plant TF protein microarrays offer an attractive high-throughput alternative to traditional techniques for TF functional characterization on a global scale. PMID:19802365

Introduction on Using the FastPCR Software and the Related Java Web Tools for PCR and Oligonucleotide Assembly and Analysis.

PubMed

Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M

2017-01-01

This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .

Karyotype versus microarray testing for genetic abnormalities after stillbirth.

PubMed

Reddy, Uma M; Page, Grier P; Saade, George R; Silver, Robert M; Thorsten, Vanessa R; Parker, Corette B; Pinar, Halit; Willinger, Marian; Stoll, Barbara J; Heim-Hall, Josefine; Varner, Michael W; Goldenberg, Robert L; Bukowski, Radek; Wapner, Ronald J; Drews-Botsch, Carolyn D; O'Brien, Barbara M; Dudley, Donald J; Levy, Brynn

2012-12-06

Genetic abnormalities have been associated with 6 to 13% of stillbirths, but the true prevalence may be higher. Unlike karyotype analysis, microarray analysis does not require live cells, and it detects small deletions and duplications called copy-number variants. The Stillbirth Collaborative Research Network conducted a population-based study of stillbirth in five geographic catchment areas. Standardized postmortem examinations and karyotype analyses were performed. A single-nucleotide polymorphism array was used to detect copy-number variants of at least 500 kb in placental or fetal tissue. Variants that were not identified in any of three databases of apparently unaffected persons were then classified into three groups: probably benign, clinical significance unknown, or pathogenic. We compared the results of karyotype and microarray analyses of samples obtained after delivery. In our analysis of samples from 532 stillbirths, microarray analysis yielded results more often than did karyotype analysis (87.4% vs. 70.5%, P<0.001) and provided better detection of genetic abnormalities (aneuploidy or pathogenic copy-number variants, 8.3% vs. 5.8%; P=0.007). Microarray analysis also identified more genetic abnormalities among 443 antepartum stillbirths (8.8% vs. 6.5%, P=0.02) and 67 stillbirths with congenital anomalies (29.9% vs. 19.4%, P=0.008). As compared with karyotype analysis, microarray analysis provided a relative increase in the diagnosis of genetic abnormalities of 41.9% in all stillbirths, 34.5% in antepartum stillbirths, and 53.8% in stillbirths with anomalies. Microarray analysis is more likely than karyotype analysis to provide a genetic diagnosis, primarily because of its success with nonviable tissue, and is especially valuable in analyses of stillbirths with congenital anomalies or in cases in which karyotype results cannot be obtained. (Funded by the Eunice Kennedy Shriver National Institute of Child Health and Human Development.).

A genome-wide 20 K citrus microarray for gene expression analysis

PubMed Central

Martinez-Godoy, M Angeles; Mauri, Nuria; Juarez, Jose; Marques, M Carmen; Santiago, Julia; Forment, Javier; Gadea, Jose

2008-01-01

Background Understanding of genetic elements that contribute to key aspects of citrus biology will impact future improvements in this economically important crop. Global gene expression analysis demands microarray platforms with a high genome coverage. In the last years, genome-wide EST collections have been generated in citrus, opening the possibility to create new tools for functional genomics in this crop plant. Results We have designed and constructed a publicly available genome-wide cDNA microarray that include 21,081 putative unigenes of citrus. As a functional companion to the microarray, a web-browsable database [1] was created and populated with information about the unigenes represented in the microarray, including cDNA libraries, isolated clones, raw and processed nucleotide and protein sequences, and results of all the structural and functional annotation of the unigenes, like general description, BLAST hits, putative Arabidopsis orthologs, microsatellites, putative SNPs, GO classification and PFAM domains. We have performed a Gene Ontology comparison with the full set of Arabidopsis proteins to estimate the genome coverage of the microarray. We have also performed microarray hybridizations to check its usability. Conclusion This new cDNA microarray replaces the first 7K microarray generated two years ago and allows gene expression analysis at a more global scale. We have followed a rational design to minimize cross-hybridization while maintaining its utility for different citrus species. Furthermore, we also provide access to a website with full structural and functional annotation of the unigenes represented in the microarray, along with the ability to use this site to directly perform gene expression analysis using standard tools at different publicly available servers. Furthermore, we show how this microarray offers a good representation of the citrus genome and present the usefulness of this genomic tool for global studies in citrus by using it to catalogue genes expressed in citrus globular embryos. PMID:18598343

A Java-based tool for the design of classification microarrays.

PubMed

Meng, Da; Broschat, Shira L; Call, Douglas R

2008-08-04

Classification microarrays are used for purposes such as identifying strains of bacteria and determining genetic relationships to understand the epidemiology of an infectious disease. For these cases, mixed microarrays, which are composed of DNA from more than one organism, are more effective than conventional microarrays composed of DNA from a single organism. Selection of probes is a key factor in designing successful mixed microarrays because redundant sequences are inefficient and limited representation of diversity can restrict application of the microarray. We have developed a Java-based software tool, called PLASMID, for use in selecting the minimum set of probe sequences needed to classify different groups of plasmids or bacteria. The software program was successfully applied to several different sets of data. The utility of PLASMID was illustrated using existing mixed-plasmid microarray data as well as data from a virtual mixed-genome microarray constructed from different strains of Streptococcus. Moreover, use of data from expression microarray experiments demonstrated the generality of PLASMID. In this paper we describe a new software tool for selecting a set of probes for a classification microarray. While the tool was developed for the design of mixed microarrays-and mixed-plasmid microarrays in particular-it can also be used to design expression arrays. The user can choose from several clustering methods (including hierarchical, non-hierarchical, and a model-based genetic algorithm), several probe ranking methods, and several different display methods. A novel approach is used for probe redundancy reduction, and probe selection is accomplished via stepwise discriminant analysis. Data can be entered in different formats (including Excel and comma-delimited text), and dendrogram, heat map, and scatter plot images can be saved in several different formats (including jpeg and tiff). Weights generated using stepwise discriminant analysis can be stored for analysis of subsequent experimental data. Additionally, PLASMID can be used to construct virtual microarrays with genomes from public databases, which can then be used to identify an optimal set of probes.

Enhancing interdisciplinary mathematics and biology education: a microarray data analysis course bridging these disciplines.

PubMed

Tra, Yolande V; Evans, Irene M

2010-01-01

BIO2010 put forth the goal of improving the mathematical educational background of biology students. The analysis and interpretation of microarray high-dimensional data can be very challenging and is best done by a statistician and a biologist working and teaching in a collaborative manner. We set up such a collaboration and designed a course on microarray data analysis. We started using Genome Consortium for Active Teaching (GCAT) materials and Microarray Genome and Clustering Tool software and added R statistical software along with Bioconductor packages. In response to student feedback, one microarray data set was fully analyzed in class, starting from preprocessing to gene discovery to pathway analysis using the latter software. A class project was to conduct a similar analysis where students analyzed their own data or data from a published journal paper. This exercise showed the impact that filtering, preprocessing, and different normalization methods had on gene inclusion in the final data set. We conclude that this course achieved its goals to equip students with skills to analyze data from a microarray experiment. We offer our insight about collaborative teaching as well as how other faculty might design and implement a similar interdisciplinary course.

Enhancing Interdisciplinary Mathematics and Biology Education: A Microarray Data Analysis Course Bridging These Disciplines

PubMed Central

Evans, Irene M.

2010-01-01

BIO2010 put forth the goal of improving the mathematical educational background of biology students. The analysis and interpretation of microarray high-dimensional data can be very challenging and is best done by a statistician and a biologist working and teaching in a collaborative manner. We set up such a collaboration and designed a course on microarray data analysis. We started using Genome Consortium for Active Teaching (GCAT) materials and Microarray Genome and Clustering Tool software and added R statistical software along with Bioconductor packages. In response to student feedback, one microarray data set was fully analyzed in class, starting from preprocessing to gene discovery to pathway analysis using the latter software. A class project was to conduct a similar analysis where students analyzed their own data or data from a published journal paper. This exercise showed the impact that filtering, preprocessing, and different normalization methods had on gene inclusion in the final data set. We conclude that this course achieved its goals to equip students with skills to analyze data from a microarray experiment. We offer our insight about collaborative teaching as well as how other faculty might design and implement a similar interdisciplinary course. PMID:20810954

Chromosomal Microarray versus Karyotyping for Prenatal Diagnosis

PubMed Central

Wapner, Ronald J.; Martin, Christa Lese; Levy, Brynn; Ballif, Blake C.; Eng, Christine M.; Zachary, Julia M.; Savage, Melissa; Platt, Lawrence D.; Saltzman, Daniel; Grobman, William A.; Klugman, Susan; Scholl, Thomas; Simpson, Joe Leigh; McCall, Kimberly; Aggarwal, Vimla S.; Bunke, Brian; Nahum, Odelia; Patel, Ankita; Lamb, Allen N.; Thom, Elizabeth A.; Beaudet, Arthur L.; Ledbetter, David H.; Shaffer, Lisa G.; Jackson, Laird

2013-01-01

Background Chromosomal microarray analysis has emerged as a primary diagnostic tool for the evaluation of developmental delay and structural malformations in children. We aimed to evaluate the accuracy, efficacy, and incremental yield of chromosomal microarray analysis as compared with karyotyping for routine prenatal diagnosis. Methods Samples from women undergoing prenatal diagnosis at 29 centers were sent to a central karyotyping laboratory. Each sample was split in two; standard karyotyping was performed on one portion and the other was sent to one of four laboratories for chromosomal microarray. Results We enrolled a total of 4406 women. Indications for prenatal diagnosis were advanced maternal age (46.6%), abnormal result on Down’s syndrome screening (18.8%), structural anomalies on ultrasonography (25.2%), and other indications (9.4%). In 4340 (98.8%) of the fetal samples, microarray analysis was successful; 87.9% of samples could be used without tissue culture. Microarray analysis of the 4282 nonmosaic samples identified all the aneuploidies and unbalanced rearrangements identified on karyotyping but did not identify balanced translocations and fetal triploidy. In samples with a normal karyotype, microarray analysis revealed clinically relevant deletions or duplications in 6.0% with a structural anomaly and in 1.7% of those whose indications were advanced maternal age or positive screening results. Conclusions In the context of prenatal diagnostic testing, chromosomal microarray analysis identified additional, clinically significant cytogenetic information as compared with karyotyping and was equally efficacious in identifying aneuploidies and unbalanced rearrangements but did not identify balanced translocations and triploidies. (Funded by the Eunice Kennedy Shriver National Institute of Child Health and Human Development and others; ClinicalTrials.gov number, NCT01279733.) PMID:23215555

Insights into the innate immunity of the Mediterranean mussel Mytilus galloprovincialis

PubMed Central

2011-01-01

Background Sessile bivalves of the genus Mytilus are suspension feeders relatively tolerant to a wide range of environmental changes, used as sentinels in ecotoxicological investigations and marketed worldwide as seafood. Mortality events caused by infective agents and parasites apparently occur less in mussels than in other bivalves but the molecular basis of such evidence is unknown. The arrangement of Mytibase, interactive catalogue of 7,112 transcripts of M. galloprovincialis, offered us the opportunity to look for gene sequences relevant to the host defences, in particular the innate immunity related genes. Results We have explored and described the Mytibase sequence clusters and singletons having a putative role in recognition, intracellular signalling, and neutralization of potential pathogens in M. galloprovincialis. Automatically assisted searches of protein signatures and manually cured sequence analysis confirmed the molecular diversity of recognition/effector molecules such as the antimicrobial peptides and many carbohydrate binding proteins. Molecular motifs identifying complement C1q, C-type lectins and fibrinogen-like transcripts emerged as the most abundant in the Mytibase collection whereas, conversely, sequence motifs denoting the regulatory cytokine MIF and cytokine-related transcripts represent singular and unexpected findings. Using a cross-search strategy, 1,820 putatively immune-related sequences were selected to design oligonucleotide probes and define a species-specific Immunochip (DNA microarray). The Immunochip performance was tested with hemolymph RNAs from mussels injected with Vibrio splendidus at 3 and 48 hours post-treatment. A total of 143 and 262 differentially expressed genes exemplify the early and late hemocyte response of the Vibrio-challenged mussels, respectively, with AMP trends confirmed by qPCR and clear modulation of interrelated signalling pathways. Conclusions The Mytibase collection is rich in gene transcripts modulated in response to antigenic stimuli and represents an interesting window for looking at the mussel immunome (transcriptomes mediating the mussel response to non-self or abnormal antigens). On this basis, we have defined a new microarray platform, a mussel Immunochip, as a flexible tool for the experimental validation of immune-candidate sequences, and tested its performance on Vibrio-activated mussel hemocytes. The microarray platform and related expression data can be regarded as a step forward in the study of the adaptive response of the Mytilus species to an evolving microbial world. PMID:21269501

In vitro anti-plasmodial activity of Dicoma anomala subsp. gerrardii (Asteraceae): identification of its main active constituent, structure-activity relationship studies and gene expression profiling.

PubMed

Becker, John V W; van der Merwe, Marina M; van Brummelen, Anna C; Pillay, Pamisha; Crampton, Bridget G; Mmutlane, Edwin M; Parkinson, Chris; van Heerden, Fanie R; Crouch, Neil R; Smith, Peter J; Mancama, Dalu T; Maharaj, Vinesh J

2011-10-11

Anti-malarial drug resistance threatens to undermine efforts to eliminate this deadly disease. The resulting omnipresent requirement for drugs with novel modes of action prompted a national consortium initiative to discover new anti-plasmodial agents from South African medicinal plants. One of the plants selected for investigation was Dicoma anomala subsp. gerrardii, based on its ethnomedicinal profile. Standard phytochemical analysis techniques, including solvent-solvent extraction, thin-layer- and column chromatography, were used to isolate the main active constituent of Dicoma anomala subsp. gerrardii. The crystallized pure compound was identified using nuclear magnetic resonance spectroscopy, mass spectrometry and X-ray crystallography. The compound was tested in vitro on Plasmodium falciparum cultures using the parasite lactate dehydrogenase (pLDH) assay and was found to have anti-malarial activity. To determine the functional groups responsible for the activity, a small collection of synthetic analogues was generated - the aim being to vary features proposed as likely to be related to the anti-malarial activity and to quantify the effect of the modifications in vitro using the pLDH assay. The effects of the pure compound on the P. falciparum transcriptome were subsequently investigated by treating ring-stage parasites (alongside untreated controls), followed by oligonucleotide microarray- and data analysis. The main active constituent was identified as dehydrobrachylaenolide, a eudesmanolide-type sesquiterpene lactone. The compound demonstrated an in vitro IC50 of 1.865 μM against a chloroquine-sensitive strain (D10) of P. falciparum. Synthetic analogues of the compound confirmed an absolute requirement that the α-methylene lactone be present in the eudesmanolide before significant anti-malarial activity was observed. This feature is absent in the artemisinins and suggests a different mode of action. Microarray data analysis identified 572 unique genes that were differentially expressed as a result of the treatment and gene ontology analysis identified various biological processes and molecular functions that were significantly affected. Comparison of the dehydrobrachylaenolide treatment transcriptional dataset with a published artesunate (also a sesquiterpene lactone) dataset revealed little overlap. These results strengthen the notion that the isolated compound and the artemisinins have differentiated modes of action. The novel mode of action of dehydrobrachylaenolide, detected during these studies, will play an ongoing role in advancing anti-plasmodial drug discovery efforts.

Analysis of microarray leukemia data using an efficient MapReduce-based K-nearest-neighbor classifier.

PubMed

Kumar, Mukesh; Rath, Nitish Kumar; Rath, Santanu Kumar

2016-04-01

Microarray-based gene expression profiling has emerged as an efficient technique for classification, prognosis, diagnosis, and treatment of cancer. Frequent changes in the behavior of this disease generates an enormous volume of data. Microarray data satisfies both the veracity and velocity properties of big data, as it keeps changing with time. Therefore, the analysis of microarray datasets in a small amount of time is essential. They often contain a large amount of expression, but only a fraction of it comprises genes that are significantly expressed. The precise identification of genes of interest that are responsible for causing cancer are imperative in microarray data analysis. Most existing schemes employ a two-phase process such as feature selection/extraction followed by classification. In this paper, various statistical methods (tests) based on MapReduce are proposed for selecting relevant features. After feature selection, a MapReduce-based K-nearest neighbor (mrKNN) classifier is also employed to classify microarray data. These algorithms are successfully implemented in a Hadoop framework. A comparative analysis is done on these MapReduce-based models using microarray datasets of various dimensions. From the obtained results, it is observed that these models consume much less execution time than conventional models in processing big data. Copyright © 2016 Elsevier Inc. All rights reserved.

A High-throughput Assay for mRNA Silencing in Primary Cortical Neurons in vitro with Oligonucleotide Therapeutics.

PubMed

Alterman, Julia F; Coles, Andrew H; Hall, Lauren M; Aronin, Neil; Khvorova, Anastasia; Didiot, Marie-Cécile

2017-08-20

Primary neurons represent an ideal cellular system for the identification of therapeutic oligonucleotides for the treatment of neurodegenerative diseases. However, due to the sensitive nature of primary cells, the transfection of small interfering RNAs (siRNA) using classical methods is laborious and often shows low efficiency. Recent progress in oligonucleotide chemistry has enabled the development of stabilized and hydrophobically modified small interfering RNAs (hsiRNAs). This new class of oligonucleotide therapeutics shows extremely efficient self-delivery properties and supports potent and durable effects in vitro and in vivo . We have developed a high-throughput in vitro assay to identify and test hsiRNAs in primary neuronal cultures. To simply, rapidly, and accurately quantify the mRNA silencing of hundreds of hsiRNAs, we use the QuantiGene 2.0 quantitative gene expression assay. This high-throughput, 96-well plate-based assay can quantify mRNA levels directly from sample lysate. Here, we describe a method to prepare short-term cultures of mouse primary cortical neurons in a 96-well plate format for high-throughput testing of oligonucleotide therapeutics. This method supports the testing of hsiRNA libraries and the identification of potential therapeutics within just two weeks. We detail methodologies of our high throughput assay workflow from primary neuron preparation to data analysis. This method can help identify oligonucleotide therapeutics for treatment of various neurological diseases.

Stable Gene Targeting in Human Cells Using Single-Strand Oligonucleotides with Modified Bases

PubMed Central

Rios, Xavier; Briggs, Adrian W.; Christodoulou, Danos; Gorham, Josh M.; Seidman, Jonathan G.; Church, George M.

2012-01-01

Recent advances allow multiplexed genome engineering in E. coli, employing easily designed oligonucleotides to edit multiple loci simultaneously. A similar technology in human cells would greatly expedite functional genomics, both by enhancing our ability to test how individual variants such as single nucleotide polymorphisms (SNPs) are related to specific phenotypes, and potentially allowing simultaneous mutation of multiple loci. However, oligo-mediated targeting of human cells is currently limited by low targeting efficiencies and low survival of modified cells. Using a HeLa-based EGFP-rescue reporter system we show that use of modified base analogs can increase targeting efficiency, in part by avoiding the mismatch repair machinery. We investigate the effects of oligonucleotide toxicity and find a strong correlation between the number of phosphorothioate bonds and toxicity. Stably EGFP-corrected cells were generated at a frequency of ~0.05% with an optimized oligonucleotide design combining modified bases and reduced number of phosphorothioate bonds. We provide evidence from comparative RNA-seq analysis suggesting cellular immunity induced by the oligonucleotides might contribute to the low viability of oligo-corrected cells. Further optimization of this method should allow rapid and scalable genome engineering in human cells. PMID:22615794

The folding of the hepatitis C virus internal ribosome entry site depends on the 3′-end of the viral genome

PubMed Central

Romero-López, Cristina; Barroso-delJesus, Alicia; García-Sacristán, Ana; Briones, Carlos; Berzal-Herranz, Alfredo

2012-01-01

Hepatitis C virus (HCV) translation initiation is directed by an internal ribosome entry site (IRES) and regulated by distant regions at the 3′-end of the viral genome. Through a combination of improved RNA chemical probing methods, SHAPE structural analysis and screening of RNA accessibility using antisense oligonucleotide microarrays, here, we show that HCV IRES folding is fine-tuned by the genomic 3′-end. The essential IRES subdomains IIIb and IIId, and domain IV, adopted a different conformation in the presence of the cis-acting replication element and/or the 3′-untranslatable region compared to that taken up in their absence. Importantly, many of the observed changes involved significant decreases in the dimethyl sulfate or N-methyl-isatoic anhydride reactivity profiles at subdomains IIIb and IIId, while domain IV appeared as a more flexible element. These observations were additionally confirmed in a replication-competent RNA molecule. Significantly, protein factors are not required for these conformational differences to be made manifest. Our results suggest that a complex, direct and long-distance RNA–RNA interaction network plays an important role in the regulation of HCV translation and replication, as well as in the switching between different steps of the viral cycle. PMID:23066110

Conceptualizing adverse outcome pathways for ...

EPA Pesticide Factsheets

Cyclooxygenase (COX) inhibition is of concern in fish because COX inhibitors (e.g., ibuprofen) are ubiquitous in aquatic systems/fish tissues, and can disrupt synthesis of prostaglandins that modulate a variety of essential biological functions (e.g., reproduction). This study utilized newly generated high content (transcriptomic and metabolomic) empirical data in combination with existing high throughput (ACTOR, epa.gov) toxicity data to facilitate development of adverse outcome pathways (AOPs) for molecular initiating event (MIE) of COX inhibition. We examined effects of a waterborne, 96h exposure to three COX inhibitors (indomethacin (IN; 100 µg/L), ibuprofen (IB; 200 µg/L) and celecoxib (CX; 20 µg/L) on the liver metabolome and ovarian gene expression (using oligonucleotide microarray 4 x15K platform) in sexually mature fathead minnows (n=8). Differentially expressed genes were identified (t-test, p < 0.01), and functional analyses performed to determine enriched Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways (p < 0.05). Principal component analysis indicated that liver metabolomics profiles of IN, IB and CX were not significantly different from control or one another. When compared to control, exposure to IB and CX resulted in differential expression of comparable numbers of genes (IB = 433, CX= 545). In contrast, 2558 genes were differentially expressed in IN-treated fish. KEGG pathway analyses show that IN had extensive effects on oocyte meios

Activation of peroxisome proliferator-activated receptor δ induces fatty acid β-oxidation in skeletal muscle and attenuates metabolic syndrome

PubMed Central

Tanaka, Toshiya; Yamamoto, Joji; Iwasaki, Satoshi; Asaba, Hiroshi; Hamura, Hiroki; Ikeda, Yukio; Watanabe, Mitsuhiro; Magoori, Kenta; Ioka, Ryoichi X.; Tachibana, Keisuke; Watanabe, Yuichiro; Uchiyama, Yasutoshi; Sumi, Koichi; Iguchi, Haruhisa; Ito, Sadayoshi; Doi, Takefumi; Hamakubo, Takao; Naito, Makoto; Auwerx, Johan; Yanagisawa, Masashi; Kodama, Tatsuhiko; Sakai, Juro

2003-01-01

In this study, we defined the role of peroxisome proliferator-activated receptor β/δ (PPARδ) in metabolic homeostasis by using subtype selective agonists. Analysis of rat L6 myotubes treated with the PPARδ subtype-selective agonist, GW501516, by the Affymetrix oligonucleotide microarrays revealed that PPARδ controls fatty acid oxidation by regulating genes involved in fatty acid transport, β-oxidation, and mitochondrial respiration. Similar PPARδ-mediated gene activation was observed in the skeletal muscle of GW501516-treated mice. Accordingly, GW501516 treatment induced fatty acid β-oxidation in L6 myotubes as well as in mouse skeletal muscles. Administration of GW501516 to mice fed a high-fat diet ameliorated diet-induced obesity and insulin resistance, an effect accompanied by enhanced metabolic rate and fatty acid β-oxidation, proliferation of mitochondria, and a marked reduction of lipid droplets in skeletal muscles. Despite a modest body weight change relative to vehicle-treated mice, GW501516 treatment also markedly improved diabetes as revealed by the decrease in plasma glucose and blood insulin levels in genetically obese ob/ob mice. These data suggest that PPARδ is pivotal to control the program for fatty acid oxidation in the skeletal muscle, thereby ameliorating obesity and insulin resistance through its activation in obese animals. PMID:14676330

Expression Analysis of a Highly Adherent and Cytotoxic Small Colony Variant of Pseudomonas aeruginosa Isolated from a Lung of a Patient with Cystic Fibrosis†

PubMed Central

von Götz, Franz; Häussler, Susanne; Jordan, Doris; Saravanamuthu, Senthil Selvan; Wehmhöner, Dirk; Strüßmann, André; Lauber, Joerg; Attree, Ina; Buer, Jan; Tümmler, Burkhard; Steinmetz, Ivo

2004-01-01

The heterogeneous environment of the lung of the cystic fibrosis (CF) patient gives rise to Pseudomonas aeruginosa small colony variants (SCVs) with increased antibiotic resistance, autoaggregative growth behavior, and an enhanced ability to form biofilms. In this study, oligonucleotide DNA microarrays were used to perform a genome-wide expression study of autoaggregative and highly adherent P. aeruginosa SCV 20265 isolated from a CF patient's lung in comparison with its clonal wild type and a revertant generated in vitro from the SCV population. Most strikingly, SCV 20265 showed a pronounced upregulation of the type III protein secretion system (TTSS) and the respective effector proteins. This differential expression was shown to be biologically meaningful, as SCV 20265 and other hyperpiliated and autoaggregative SCVs with increased TTSS expression were significantly more cytotoxic for macrophages in vitro and were more virulent in a mouse model of respiratory tract infection than the wild type. The observed cytotoxicity and virulence of SCV 20265 required exsA, an important transcriptional activator of the TTSS. Thus, the prevailing assumption that P. aeruginosa is subject to selection towards reduced cytotoxicity and attenuated virulence during chronic CF lung infection might not apply to all clonal variants. PMID:15175297

Analysis of LDLR mutations in familial hypercholesterolemia patients in Greece by use of the NanoChip microelectronic array technology.

PubMed

Laios, Eleftheria; Drogari, Euridiki

2006-12-01

Three mutations in the low density lipoprotein receptor (LDLR) gene account for 49% of familial hypercholesterolemia (FH) cases in Greece. We used the microelectronic array technology of the NanoChip Molecular Biology Workstation to develop a multiplex method to analyze these single-nucleotide polymorphisms (SNPs). Primer pairs amplified the region encompassing each SNP. The biotinylated PCR amplicon was electronically addressed to streptavidin-coated microarray sites. Allele-specific fluorescently labeled oligonucleotide reporters were designed and used for detection of wild-type and SNP sequences. Genotypes were compared to PCR-restriction fragment length polymorphism (PCR-RFLP). We developed three monoplex assays (1 SNP/site) and an optimized multiplex assay (3SNPs/site). We performed 92 Greece II, 100 Genoa, and 98 Afrikaner-2 NanoChip monoplex assays (addressed to duplicate sites and analyzed separately). Of the 580 monoplex genotypings (290 samples), 579 agreed with RFLP. Duplicate sites of one sample were not in agreement with each other. Of the 580 multiplex genotypings, 576 agreed with the monoplex results. Duplicate sites of three samples were not in agreement with each other, indicating requirement for repetition upon which discrepancies were resolved. The multiplex assay detects common LDLR mutations in Greek FH patients and can be extended to accommodate additional mutations.

Direct labeling of serum proteins by fluorescent dye for antibody microarray.

PubMed

Klimushina, M V; Gumanova, N G; Metelskaya, V A

2017-05-06

Analysis of serum proteome by antibody microarray is used to identify novel biomarkers and to study signaling pathways including protein phosphorylation and protein-protein interactions. Labeling of serum proteins is important for optimal performance of the antibody microarray. Proper choice of fluorescent label and optimal concentration of protein loaded on the microarray ensure good quality of imaging that can be reliably scanned and processed by the software. We have optimized direct serum protein labeling using fluorescent dye Arrayit Green 540 (Arrayit Corporation, USA) for antibody microarray. Optimized procedure produces high quality images that can be readily scanned and used for statistical analysis of protein composition of the serum. Copyright © 2017 Elsevier Inc. All rights reserved.

Global gene expression and Ingenuity biological functions analysis on PCBs 153 and 138 induced human PBMC in vitro reveals differential mode(s) of action in developing toxicities.

PubMed

Ghosh, Somiranjan; Zang, Shizhu; Mitra, Partha S; Ghimbovschi, Svetlana; Hoffman, Eric P; Dutta, Sisir K

2011-07-01

Several reports have indicated that low level of polychlorinated biphenyl (PCB) exposure can adversely affect a multitude of physiological disorders and diseases in in vitro, in vivo, and as reported in epidemiological studies. This investigation is focused on the possible contribution of two most prevalent PCB congeners in vitro in developing toxicities. We used PCBs 138 and 153 at the human equivalence level as model agents to test their specificity in developing toxicities. We chose a global approach using oligonucleotide microarray technology to investigate modulated gene expression for biological effects, upon exposure of PCBs, followed by Ingenuity Pathway Analysis (IPA), to understand the underlying consequence in developing disease and disorders. We performed in vitro studies with human peripheral blood mononuclear cells (PBMC), where PBMC cells were exposed to respective PCBs for 48 h. Overall, our observation on gene expression indicated that PCB produces a unique signature affecting different pathways, specific for each congener. While analyzing these data through IPA, the prominent and interesting disease and disorders were neurological disease, cancer, cardiovascular disease, respiratory disease, as well as endocrine system disorders, genetic disorders, and reproductive system disease. They showed strong resemblances with in vitro, in vivo, and in the epidemiological studies. A distinct difference was observed in renal and urological diseases, organisimal injury and abnormalities, dental disease, ophthalmic disease, and psychological disorders, which are only revealed by PCB 138 exposure, but not in PCB 153. The present study emphasizes the challenges of global gene expression in vitro and was correlated with the results of exposed human population. The microarray results give a molecular mechanistic insight and functional effects, following PCB exposure. The extent of changes in genes related to several possible mode(s) of action highlights the changes in cellular functions and signaling pathways that play major roles. In addition to understanding the pathways related to mode of action for chemicals, these data could lead to the identification of genomic signatures that could be used for screening of chemicals for their potential to cause disease and developmental disorders. Copyright © 2011 Elsevier Ltd. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, Amanda M.; Daly, Don S.; Willse, Alan R.

The Automated Microarray Image Analysis (AMIA) Toolbox for MATLAB is a flexible, open-source microarray image analysis tool that allows the user to customize analysis of sets of microarray images. This tool provides several methods of identifying and quantify spot statistics, as well as extensive diagnostic statistics and images to identify poor data quality or processing. The open nature of this software allows researchers to understand the algorithms used to provide intensity estimates and to modify them easily if desired.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

ELISA-BASE: An Integrated Bioinformatics Tool for Analyzing and Tracking ELISA Microarray Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, Amanda M.; Collett, James L.; Seurynck-Servoss, Shannon L.

ELISA-BASE is an open-source database for capturing, organizing and analyzing protein enzyme-linked immunosorbent assay (ELISA) microarray data. ELISA-BASE is an extension of the BioArray Soft-ware Environment (BASE) database system, which was developed for DNA microarrays. In order to make BASE suitable for protein microarray experiments, we developed several plugins for importing and analyzing quantitative ELISA microarray data. Most notably, our Protein Microarray Analysis Tool (ProMAT) for processing quantita-tive ELISA data is now available as a plugin to the database.

Rearing Water Treatment Induces Microbial Selection Influencing the Microbiota and Pathogen Associated Transcripts of Cod (Gadus morhua) Larvae.

PubMed

Vestrum, Ragnhild I; Attramadal, Kari J K; Winge, Per; Li, Keshuai; Olsen, Yngvar; Bones, Atle M; Vadstein, Olav; Bakke, Ingrid

2018-01-01

We have previously shown that K-selection and microbial stability in the rearing water increases survival and growth of Atlantic cod ( Gadus morhua ) larvae, and that recirculating aquaculture systems (RAS) are compatible with this. Here, we have assessed how water treatment influenced the larval microbiota and host responses at the gene expression level. Cod larvae were reared with two different rearing water systems: a RAS and a flow-through system (FTS). The water microbiota was examined using a 16S rDNA PCR/DGGE strategy. RNA extracted from larvae at 8, 13, and 17 days post hatching was used for microbiota and microarray gene expression analysis. Bacterial cDNA was synthesized and used for 16S rRNA amplicon 454 pyrosequencing of larval microbiota. Both water and larval microbiota differed significantly between the systems, and the larval microbiota appeared to become more dissimilar between systems with time. In total 4 phyla were identified for all larvae: Actinobacteria, Bacteroidetes, Firmicutes, and Proteobacteria. The most profound difference in larval microbiota was a high abundance of Arcobacter (Epsilonproteobacteria) in FTS larvae (34 ± 9% of total reads). Arcobacter includes several species that are known pathogens for humans and animals. Cod larval transcriptome responses were investigated using an oligonucleotide gene expression microarray covering approximately 24,000 genes. Interestingly, FTS larvae transcriptional profiles revealed an overrepresentation of upregulated transcripts associated with responses to pathogens and infections, such as c1ql3-like , pglyrp-2-like and zg16, compared to RAS larvae. In conclusion, distinct water treatment systems induced differences in the larval microbiota. FTS larvae showed up-regulation of transcripts associated with responses to microbial stress. These results are consistent with the hypothesis that RAS promotes K-selection and microbial stability by maintaining a microbial load close to the carrying capacity of the system, and ensuring long retention times for both bacteria and water in the system.

Oligonucleotide Microarray Analysis of Dietary-Induced Hyperlipidemia Gene Expression Profiles in Miniature Pigs

PubMed Central

Takahashi, Junko; Waki, Shiori; Matsumoto, Rena; Odake, Junji; Miyaji, Takayuki; Tottori, Junichi; Iwanaga, Takehiro; Iwahashi, Hitoshi

2012-01-01

Background Hyperlipidemia animal models have been established, but complete gene expression profiles of the transition from normal lipid levels have not been obtained. Miniature pigs are useful model animals for gene expression studies on dietary-induced hyperlipidemia because they have a similar anatomy and digestive physiology to humans, and blood samples can be obtained from them repeatedly. Methodology Two typical dietary treatments were used for dietary-induced hyperlipidemia models, by using specific pathogen-free (SPF) Clawn miniature pigs. One was a high-fat and high-cholesterol diet (HFCD) and the other was a high-fat, high-cholesterol, and high-sucrose diet (HFCSD). Microarray analyses were conducted from whole blood samples during the dietary period and from white blood cells at the end of the dietary period to evaluate the transition of expression profiles of the two dietary models. Principal Findings Variations in whole blood gene expression intensity within the HFCD or the HFCSD group were in the same range as the controls provide with normal diet at all periods. This indicates uniformity of dietary-induced hyperlipidemia for our dietary protocols. Gene ontology- (GO) based functional analyses revealed that characteristics of the common changes between HFCD and HFCSD were involved in inflammatory responses and reproduction. The correlation coefficient between whole blood and white blood cell expression profiles at 27 weeks with the HFCSD diet was significantly lower than that of the control and HFCD diet groups. This may be due to the effects of RNA originating from the tissues and/or organs. Conclusions No statistically significant differences in fasting plasma lipids and glucose levels between the HFCD and HFCSD groups were observed. However, blood RNA analyses revealed different characteristics corresponding to the dietary protocols. In this study, whole blood RNA analyses proved to be a useful tool to evaluate transitions in dietary-induced hyperlipidemia gene expression profiles in miniature pigs. PMID:22662175

Rearing Water Treatment Induces Microbial Selection Influencing the Microbiota and Pathogen Associated Transcripts of Cod (Gadus morhua) Larvae

PubMed Central

Vestrum, Ragnhild I.; Attramadal, Kari J. K.; Winge, Per; Li, Keshuai; Olsen, Yngvar; Bones, Atle M.; Vadstein, Olav; Bakke, Ingrid

2018-01-01

We have previously shown that K-selection and microbial stability in the rearing water increases survival and growth of Atlantic cod (Gadus morhua) larvae, and that recirculating aquaculture systems (RAS) are compatible with this. Here, we have assessed how water treatment influenced the larval microbiota and host responses at the gene expression level. Cod larvae were reared with two different rearing water systems: a RAS and a flow-through system (FTS). The water microbiota was examined using a 16S rDNA PCR/DGGE strategy. RNA extracted from larvae at 8, 13, and 17 days post hatching was used for microbiota and microarray gene expression analysis. Bacterial cDNA was synthesized and used for 16S rRNA amplicon 454 pyrosequencing of larval microbiota. Both water and larval microbiota differed significantly between the systems, and the larval microbiota appeared to become more dissimilar between systems with time. In total 4 phyla were identified for all larvae: Actinobacteria, Bacteroidetes, Firmicutes, and Proteobacteria. The most profound difference in larval microbiota was a high abundance of Arcobacter (Epsilonproteobacteria) in FTS larvae (34 ± 9% of total reads). Arcobacter includes several species that are known pathogens for humans and animals. Cod larval transcriptome responses were investigated using an oligonucleotide gene expression microarray covering approximately 24,000 genes. Interestingly, FTS larvae transcriptional profiles revealed an overrepresentation of upregulated transcripts associated with responses to pathogens and infections, such as c1ql3-like, pglyrp-2-like and zg16, compared to RAS larvae. In conclusion, distinct water treatment systems induced differences in the larval microbiota. FTS larvae showed up-regulation of transcripts associated with responses to microbial stress. These results are consistent with the hypothesis that RAS promotes K-selection and microbial stability by maintaining a microbial load close to the carrying capacity of the system, and ensuring long retention times for both bacteria and water in the system. PMID:29765364

Glycoside hydrolase gene transcription by Alicyclobacillus acidocaldarius during growth on wheat arabinoxylan and monosaccharides: a proposed xylan hydrolysis mechanism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Brady D.; Apel, William A.; Sheridan, Peter P.

Background Metabolism of carbon bound in wheat arabinoxylan (WAX) polysaccharides by bacteria requires a number of glycoside hydrolases active toward different bonds between sugars and other molecules. Alicyclobacillus acidocaldarius is a Gram-positive thermoacidophilic bacterium capable of growth on a variety of mono-, di-, oligo-, and polysaccharides. Nineteen proposed glycoside hydrolases have been annotated in the A. acidocaldarius Type Strain ATCC27009/DSM 446 genome. Results Molecular analysis using high-density oligonucleotide microarrays was performed on A. acidocaldarius strain ATCC27009 when growing on WAX. When a culture growing exponentially at the expense of arabinoxylan saccharides was challenged with glucose or xylose, most glycoside hydrolasesmore » were down-regulated. Interestingly, regulation was more intense when xylose was added to the culture than when glucose was added, a clear departure from classical carbon catabolite repression demonstrated by many Gram-positive bacteria. In silico analyses of the regulated glycoside hydrolases, along with the results from the microarray analyses, yielded a potential mechanism for arabinoxylan metabolism by A. acidocaldarius. Glycoside hydrolases expressed by this strain may have broad substrate specificity, and initial hydrolysis is catalyzed by an extracellular xylanase, while subsequent steps are likely performed inside the growing cell. Conclusions Glycoside hydrolases, for the most part, appear to be found in clusters, throughout the A. acidocaldarius genome. Not all of the glycoside hydrolase genes found at loci within these clusters were regulated during the experiment, indicating that a specific subset of the 19 glycoside hydrolase genes found in A. acidocaldarius were used during metabolism of WAX. While specific functions of the glycoside hydrolases was not tested as part of the research discussed, many of the glycoside hydrolases found in the A. acidocaldarius Type Strain appear to have a broader substrate range than represented by the glycoside hydrolase family in which the enzymes were categorized.« less

Discovery and mapping of single feature polymorphisms in wheat using Affymetrix arrays

PubMed Central

Bernardo, Amy N; Bradbury, Peter J; Ma, Hongxiang; Hu, Shengwa; Bowden, Robert L; Buckler, Edward S; Bai, Guihua

2009-01-01

Background Wheat (Triticum aestivum L.) is a staple food crop worldwide. The wheat genome has not yet been sequenced due to its huge genome size (~17,000 Mb) and high levels of repetitive sequences; the whole genome sequence may not be expected in the near future. Available linkage maps have low marker density due to limitation in available markers; therefore new technologies that detect genome-wide polymorphisms are still needed to discover a large number of new markers for construction of high-resolution maps. A high-resolution map is a critical tool for gene isolation, molecular breeding and genomic research. Single feature polymorphism (SFP) is a new microarray-based type of marker that is detected by hybridization of DNA or cRNA to oligonucleotide probes. This study was conducted to explore the feasibility of using the Affymetrix GeneChip to discover and map SFPs in the large hexaploid wheat genome. Results Six wheat varieties of diverse origins (Ning 7840, Clark, Jagger, Encruzilhada, Chinese Spring, and Opata 85) were analyzed for significant probe by variety interactions and 396 probe sets with SFPs were identified. A subset of 164 unigenes was sequenced and 54% showed polymorphism within probes. Microarray analysis of 71 recombinant inbred lines from the cross Ning 7840/Clark identified 955 SFPs and 877 of them were mapped together with 269 simple sequence repeat markers. The SFPs were randomly distributed within a chromosome but were unevenly distributed among different genomes. The B genome had the most SFPs, and the D genome had the least. Map positions of a selected set of SFPs were validated by mapping single nucleotide polymorphism using SNaPshot and comparing with expressed sequence tags mapping data. Conclusion The Affymetrix array is a cost-effective platform for SFP discovery and SFP mapping in wheat. The new high-density map constructed in this study will be a useful tool for genetic and genomic research in wheat. PMID:19480702

Systematic study of association of four GABAergic genes: glutamic acid decarboxylase 1 gene, glutamic acid decarboxylase 2 gene, GABA(B) receptor 1 gene and GABA(A) receptor subunit beta2 gene, with schizophrenia using a universal DNA microarray.

PubMed

Zhao, Xu; Qin, Shengying; Shi, Yongyong; Zhang, Aiping; Zhang, Jing; Bian, Li; Wan, Chunling; Feng, Guoyin; Gu, Niufan; Zhang, Guangqi; He, Guang; He, Lin

2007-07-01

Several studies have suggested the dysfunction of the GABAergic system as a risk factor in the pathogenesis of schizophrenia. In the present study, case-control association analysis was conducted in four GABAergic genes: two glutamic acid decarboxylase genes (GAD1 and GAD2), a GABA(A) receptor subunit beta2 gene (GABRB2) and a GABA(B) receptor 1 gene (GABBR1). Using a universal DNA microarray procedure we genotyped a total of 20 SNPs on the above four genes in a study involving 292 patients and 286 controls of Chinese descent. Statistically significant differences were observed in the allelic frequencies of the rs187269C/T polymorphism in the GABRB2 gene (P=0.0450, chi(2)=12.40, OR=1.65) and the -292A/C polymorphism in the GAD1 gene (P=0.0450, chi(2)=14.64 OR=1.77). In addition, using an electrophoretic mobility shift assay (EMSA), we discovered differences in the U251 nuclear protein binding to oligonucleotides representing the -292 SNP on the GAD1 gene, which suggests that the -292C allele has reduced transcription factor binding efficiency compared with the 292A allele. Using the multifactor-dimensionality reduction method (MDR), we found that the interactions among the rs187269C/T polymorphism in the GABRB2 gene, the -243A/G polymorphism in the GAD2 gene and the 27379C/T and 661C/T polymorphisms in the GAD1 gene revealed a significant association with schizophrenia (P<0.001). These findings suggest that the GABRB2 and GAD1 genes alone and the combined effects of the polymorphisms in the four GABAergic system genes may confer susceptibility to the development of schizophrenia in the Chinese population.

DETECTING LOW-LEVEL SYNTHESIS IMPURITIES IN MODIFIED PHOSPHOROTHIOATE OLIGONUCLEOTIDES USING LIQUID CHROMATOGRAPHY – HIGH RESOLUTION MASS SPECTROMETRY

PubMed Central

Nikcevic, Irena; Wyrzykiewicz, Tadeusz K.; Limbach, Patrick A.

2010-01-01

Summary An LC-MS method based on the use of high resolution Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS) for profiling oligonucleotides synthesis impurities is described. Oligonucleotide phosphorothioatediesters (phosphorothioate oligonucleotides), in which one of the non-bridging oxygen atoms at each phosphorus center is replaced by a sulfur atom, are now one of the most popular oligonucleotide modifications due to their ease of chemical synthesis and advantageous pharmacokinetic properties. Despite significant progress in the solid-phase oligomerization chemistry used in the manufacturing of these oligonucleotides, multiple classes of low-level impurities always accompany synthetic oligonucleotides. Liquid chromatography-mass spectrometry has emerged as a powerful technique for the identification of these synthesis impurities. However, impurity profiling, where the entire complement of low-level synthetic impurities is identified in a single analysis, is more challenging. Here we present an LC-MS method based the use of high resolution-mass spectrometry, specifically Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS or FTMS). The optimal LC-FTMS conditions, including the stationary phase and mobile phases for the separation and identification of phosphorothioate oligonucleotides, were found. The characteristics of FTMS enable charge state determination from single m/z values of low-level impurities. Charge state information then enables more accurate modeling of the detected isotopic distribution for identification of the chemical composition of the detected impurity. Using this approach, a number of phosphorothioate impurities can be detected by LC-FTMS including failure sequences carrying 3′-terminal phosphate monoester and 3′-terminal phosphorothioate monoester, incomplete backbone sulfurization and desulfurization products, high molecular weight impurities, and chloral, isobutyryl, and N3 (2-cyanoethyl) adducts of the full length product. When compared with low resolution LC-MS, ~60% more impurities can be identified when charge state and isotopic distribution information is available and used for impurity profiling. PMID:21811394

Transcriptome analysis in non-model species: a new method for the analysis of heterologous hybridization on microarrays

PubMed Central

2010-01-01

Background Recent developments in high-throughput methods of analyzing transcriptomic profiles are promising for many areas of biology, including ecophysiology. However, although commercial microarrays are available for most common laboratory models, transcriptome analysis in non-traditional model species still remains a challenge. Indeed, the signal resulting from heterologous hybridization is low and difficult to interpret because of the weak complementarity between probe and target sequences, especially when no microarray dedicated to a genetically close species is available. Results We show here that transcriptome analysis in a species genetically distant from laboratory models is made possible by using MAXRS, a new method of analyzing heterologous hybridization on microarrays. This method takes advantage of the design of several commercial microarrays, with different probes targeting the same transcript. To illustrate and test this method, we analyzed the transcriptome of king penguin pectoralis muscle hybridized to Affymetrix chicken microarrays, two organisms separated by an evolutionary distance of approximately 100 million years. The differential gene expression observed between different physiological situations computed by MAXRS was confirmed by real-time PCR on 10 genes out of 11 tested. Conclusions MAXRS appears to be an appropriate method for gene expression analysis under heterologous hybridization conditions. PMID:20509979

A Human Lectin Microarray for Sperm Surface Glycosylation Analysis *

PubMed Central

Sun, Yangyang; Cheng, Li; Gu, Yihua; Xin, Aijie; Wu, Bin; Zhou, Shumin; Guo, Shujuan; Liu, Yin; Diao, Hua; Shi, Huijuan; Wang, Guangyu; Tao, Sheng-ce

2016-01-01

Glycosylation is one of the most abundant and functionally important protein post-translational modifications. As such, technology for efficient glycosylation analysis is in high demand. Lectin microarrays are a powerful tool for such investigations and have been successfully applied for a variety of glycobiological studies. However, most of the current lectin microarrays are primarily constructed from plant lectins, which are not well suited for studies of human glycosylation because of the extreme complexity of human glycans. Herein, we constructed a human lectin microarray with 60 human lectin and lectin-like proteins. All of the lectins and lectin-like proteins were purified from yeast, and most showed binding to human glycans. To demonstrate the applicability of the human lectin microarray, human sperm were probed on the microarray and strong bindings were observed for several lectins, including galectin-1, 7, 8, GalNAc-T6, and ERGIC-53 (LMAN1). These bindings were validated by flow cytometry and fluorescence immunostaining. Further, mass spectrometry analysis showed that galectin-1 binds several membrane-associated proteins including heat shock protein 90. Finally, functional assays showed that binding of galectin-8 could significantly enhance the acrosome reaction within human sperms. To our knowledge, this is the first construction of a human lectin microarray, and we anticipate it will find wide use for a range of human or mammalian studies, alone or in combination with plant lectin microarrays. PMID:27364157

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gentry, T.; Schadt, C.; Zhou, J.

Microarray technology has the unparalleled potential tosimultaneously determine the dynamics and/or activities of most, if notall, of the microbial populations in complex environments such as soilsand sediments. Researchers have developed several types of arrays thatcharacterize the microbial populations in these samples based on theirphylogenetic relatedness or functional genomic content. Several recentstudies have used these microarrays to investigate ecological issues;however, most have only analyzed a limited number of samples withrelatively few experiments utilizing the full high-throughput potentialof microarray analysis. This is due in part to the unique analyticalchallenges that these samples present with regard to sensitivity,specificity, quantitation, and data analysis. Thismore » review discussesspecific applications of microarrays to microbial ecology research alongwith some of the latest studies addressing the difficulties encounteredduring analysis of complex microbial communities within environmentalsamples. With continued development, microarray technology may ultimatelyachieve its potential for comprehensive, high-throughput characterizationof microbial populations in near real-time.« less

Fully automated analysis of multi-resolution four-channel micro-array genotyping data

NASA Astrophysics Data System (ADS)

Abbaspour, Mohsen; Abugharbieh, Rafeef; Podder, Mohua; Tebbutt, Scott J.

2006-03-01

We present a fully-automated and robust microarray image analysis system for handling multi-resolution images (down to 3-micron with sizes up to 80 MBs per channel). The system is developed to provide rapid and accurate data extraction for our recently developed microarray analysis and quality control tool (SNP Chart). Currently available commercial microarray image analysis applications are inefficient, due to the considerable user interaction typically required. Four-channel DNA microarray technology is a robust and accurate tool for determining genotypes of multiple genetic markers in individuals. It plays an important role in the state of the art trend where traditional medical treatments are to be replaced by personalized genetic medicine, i.e. individualized therapy based on the patient's genetic heritage. However, fast, robust, and precise image processing tools are required for the prospective practical use of microarray-based genetic testing for predicting disease susceptibilities and drug effects in clinical practice, which require a turn-around timeline compatible with clinical decision-making. In this paper we have developed a fully-automated image analysis platform for the rapid investigation of hundreds of genetic variations across multiple genes. Validation tests indicate very high accuracy levels for genotyping results. Our method achieves a significant reduction in analysis time, from several hours to just a few minutes, and is completely automated requiring no manual interaction or guidance.

A regenerated electrochemical biosensor for label-free detection of glucose and urea based on conformational switch of i-motif oligonucleotide probe.

PubMed

Gao, Zhong Feng; Chen, Dong Mei; Lei, Jing Lei; Luo, Hong Qun; Li, Nian Bing

2015-10-15

Improving the reproducibility of electrochemical signal remains a great challenge over the past decades. In this work, i-motif oligonucleotide probe-based electrochemical DNA (E-DNA) sensor is introduced for the first time as a regenerated sensing platform, which enhances the reproducibility of electrochemical signal, for label-free detection of glucose and urea. The addition of glucose or urea is able to activate glucose oxidase-catalyzed or urease-catalyzed reaction, inducing or destroying the formation of i-motif oligonucleotide probe. The conformational switch of oligonucleotide probe can be recorded by electrochemical impedance spectroscopy. Thus, the difference of electron transfer resistance is utilized for the quantitative determination of glucose and urea. We further demonstrate that the E-DNA sensor exhibits high selectivity, excellent stability, and remarkable regenerated ability. The human serum analysis indicates that this simple and regenerated strategy holds promising potential in future biosensing applications. Copyright © 2015 Elsevier B.V. All rights reserved.

Effect of Molecular Crowding and Ionic Strength on the Isothermal Hybridization of Oligonucleotides

PubMed Central

Markarian, Marie Z.; Schlenoff, Joseph B.

2010-01-01

The isothermal hybridization of complimentary oligonucleotides, 15-mer, 25-mer, 35-mer, and a molecular beacon, was investigated under varying conditions of molecular crowding and ionic strength, using hypochromicity to follow strand pairing and polyethylene glycol as a crowding agent. Thermodynamic analysis of the results revealed the addition of counterions to the oligonucleotide backbones, Δψ, to be dependent on the strand G-C content and the molecular crowding. A decrease in Δψ was observed with both increasing GC% and solution PEG content. In contrast, the number of bound water molecules depended on the activity of Na+, where two regimes were observed. At aNa+⟨0.05 and increasing molecular crowding, water molecules were released into the DNA solutions and oligonucleotide pairing was favored with both increasing hydrophobic forces, while at aNa+≥0.05, water molecules were bound to the strands and the extent of double strand formation decreased with increasing PEG wt%. PMID:20701389

Integrated Safety Assessment of 2′-O-Methoxyethyl Chimeric Antisense Oligonucleotides in NonHuman Primates and Healthy Human Volunteers

PubMed Central

Crooke, Stanley T; Baker, Brenda F; Kwoh, T Jesse; Cheng, Wei; Schulz, Dan J; Xia, Shuting; Salgado, Nelson; Bui, Huynh-Hoa; Hart, Christopher E; Burel, Sebastien A; Younis, Husam S; Geary, Richard S; Henry, Scott P; Bhanot, Sanjay

2016-01-01

The common chemical and biological properties of antisense oligonucleotides provide the opportunity to identify and characterize chemical class effects across species. The chemical class that has proven to be the most versatile and best characterized is the 2′-O-methoxyethyl chimeric antisense oligonucleotides. In this report we present an integrated safety assessment of data obtained from controlled dose-ranging studies in nonhuman primates (macaques) and healthy human volunteers for 12 unique 2′-O-methoxyethyl chimeric antisense oligonucleotides. Safety was assessed by the incidence of safety signals in standardized laboratory tests for kidney and liver function, hematology, and complement activation; as well as by the mean test results as a function of dose level over time. At high doses a number of toxicities were observed in nonhuman primates. However, no class safety effects were identified in healthy human volunteers from this integrated data analysis. Effects on complement in nonhuman primates were not observed in humans. Nonhuman primates predicted safe doses in humans, but over predicted risk of complement activation and effects on platelets. Although limited to a single chemical class, comparisons from this analysis are considered valid and accurate based on the carefully controlled setting for the specified study populations and within the total exposures studied. PMID:27357629

Resolving prokaryotic taxonomy without rRNA: longer oligonucleotide word lengths improve genome and metagenome taxonomic classification.

PubMed

Alsop, Eric B; Raymond, Jason

2013-01-01

Oligonucleotide signatures, especially tetranucleotide signatures, have been used as method for homology binning by exploiting an organism's inherent biases towards the use of specific oligonucleotide words. Tetranucleotide signatures have been especially useful in environmental metagenomics samples as many of these samples contain organisms from poorly classified phyla which cannot be easily identified using traditional homology methods, including NCBI BLAST. This study examines oligonucleotide signatures across 1,424 completed genomes from across the tree of life, substantially expanding upon previous work. A comprehensive analysis of mononucleotide through nonanucleotide word lengths suggests that longer word lengths substantially improve the classification of DNA fragments across a range of sizes of relevance to high throughput sequencing. We find that, at present, heptanucleotide signatures represent an optimal balance between prediction accuracy and computational time for resolving taxonomy using both genomic and metagenomic fragments. We directly compare the ability of tetranucleotide and heptanucleotide world lengths (tetranucleotide signatures are the current standard for oligonucleotide word usage analyses) for taxonomic binning of metagenome reads. We present evidence that heptanucleotide word lengths consistently provide more taxonomic resolving power, particularly in distinguishing between closely related organisms that are often present in metagenomic samples. This implies that longer oligonucleotide word lengths should replace tetranucleotide signatures for most analyses. Finally, we show that the application of longer word lengths to metagenomic datasets leads to more accurate taxonomic binning of DNA scaffolds and have the potential to substantially improve taxonomic assignment and assembly of metagenomic data.

Recommendations of the Oligonucleotide Safety Working Group's Formulated Oligonucleotide Subcommittee for the Safety Assessment of Formulated Oligonucleotide-Based Therapeutics.

PubMed

Marlowe, Jennifer L; Akopian, Violetta; Karmali, Priya; Kornbrust, Douglas; Lockridge, Jennifer; Semple, Sean

2017-08-01

The use of lipid formulations has greatly improved the ability to effectively deliver oligonucleotides and has been instrumental in the rapid expansion of therapeutic development programs using oligonucleotide drugs. However, the development of such complex multicomponent therapeutics requires the implementation of unique, scientifically sound approaches to the nonclinical development of these drugs, based upon a hybrid of knowledge and experiences drawn from small molecule, protein, and oligonucleotide therapeutic drug development. The relative paucity of directly applicable regulatory guidance documents for oligonucleotide therapeutics in general has resulted in the generation of multiple white papers from oligonucleotide drug development experts and members of the Oligonucleotide Safety Working Group (OSWG). The members of the Formulated Oligonucleotide Subcommittee of the OSWG have utilized their collective experience working with a variety of formulations and their associated oligonucleotide payloads, as well as their insights into regulatory considerations and expectations, to generate a series of consensus recommendations for the pharmacokinetic characterization and nonclinical safety assessment of this unique class of therapeutics. It should be noted that the focus of Subcommittee discussions was on lipid nanoparticle and other types of particulate formulations of therapeutic oligonucleotides and not on conjugates or other types of modifications of oligonucleotide structure intended to facilitate delivery.

Analysis of oligonucleotide photoproducts produced by UV-A light and a riboflavin photosensitizer

NASA Astrophysics Data System (ADS)

Gelhaus, Stacy L.; LaCourse, William R.

2004-12-01

DNA damage is caused by a variety of foreign and endogenous compounds. There are endogenous photosensitizers in cells, such as porphyrins and flavins, which may create damage in the presence of UV-A light. Typically, samples are analyzed by 32P-postlabelling and electrophoretic separation or by LC-MS separation and detection. Separation by HPLC is common; however, in all instances, the DNA sample is hydrolyzed down to nucleosides prior to analysis. It will be shown here that ion-pairing reversed phase high performance liquid chromatography (IP-RPLC) has the ability to provide biophysical information concerning the sites of UV-A induced photosensitizer damage on an intact oligonucleotide concurrent with the separation. IP-RPLC is less labor intensive and faster than electrophoretic methods and it is less costly than LC-MS. IP-RPLC can also be used to purify modified oligonucleotides for further use and analysis. This technique is sensitive to the charge, conformation, and sequence characteristics of the nucleic acid sample and may be used to determine the damage or modifications made to DNA by a variety of compounds.

Chemically functionalized gold nanoparticles: Synthesis, characterization, and applications

NASA Astrophysics Data System (ADS)

Daniel, Weston Lewis

This thesis focuses on the development and application of gold nanoparticle based detection systems and biomimetic structures. Each class of modified nanoparticle has properties that are defined by its chemical moieties that interface with solution and the gold nanoparticle core. In Chapter 2, a comparison of the biomolecular composition and binding properties of various preparations of antibody oligonucleotide gold nanoparticle conjugates is presented. These constructs differed significantly in terms of their structure and binding properties. Chapter 3 reports the use of electroless gold deposition as a light scattering signal enhancer in a multiplexed, microarray-based scanometric immunoassay using the gold nanoparticle probes evaluated in Chapter 2. The use of gold development results in greater signal enhancement than the typical silver development, and multiple rounds of metal development were found to increase the resulting signal compared to one development. Chapter 4 describes an amplified scanometric detection method for human telomerase activity. Gold nanoparticles functionalized with specific oligonucleotide sequences can efficiently capture telomerase enzymes and subsequently be elongated. Both the elongated and unmodified oligonucleotide sequences are simultaneously measured. At low telomerase concentrations, elongated strands cannot be detected, but the unmodified sequences, which come from the same probe particles, can be detected because their concentration is higher, providing a novel form of amplification. Chapter 5 reports the development of a novel colorimetric nitrite and nitrate ion assay based upon gold nanoparticle probes functionalized with Griess reaction reagents. This assay takes advantage of the distance-dependent plasmonic properties of the gold nanoparticles and the ability of nitrite ion to facilitate the cross coupling of novel nanoparticle probes. The assay works on the concept of a kinetic end point and can be triggered at the EPA limit for this ion in drinking water. Finally, Chapter 6 describes the synthesis of high density lipoprotein biomimetic nanoparticles capable of binding cholesterol. These structures use a gold nanoparticle core to template the assembly of a mixed phospholipid layer and the adsorption of apolipoprotein A-I. These synthesized structures have the general size and surface composition of natural HDL and bind free cholesterol with a Kd of 4 nM.

Inhibition of B cell proliferation by antisense DNA to both alpha and beta forms of Fc epsilon R II.

PubMed

Bhatti, L; Behle, K; Stevens, R H

1992-10-01

Epstein-Barr Virus (EBV) infection activates B lymphocyte proliferation through partially understood mechanisms, resulting in phenotypic changes, including the appearance of new antigens. One such antigen is Fc epsilon R II/CD-23 which may be relevant for B cell proliferation. We have used anti-sense oligonucleotides to study the importance of the two forms of this molecule for proliferation in the EBV-transformed, Fc epsilon R II +ve lymphoblastoid B cell line, RPMI 8866. Anti-sense oligodeoxynucleotides were generated to the two forms of Fc epsilon R II; Fc epsilon R IIa (alpha) and IIb (beta) which differ only in their intracytoplasmic domains. Addition of increasing concentrations of anti-sense oligonucleotides, ranging from 1 to 30 microM, significantly decreased cellular proliferation as measured by the incorporation of [3H]thymidine (inhibition range 8-88%). Optimum inhibition of cellular proliferation was apparent at 15 microM concentration of both anti-sense Fc epsilon R IIa and IIb (Fc epsilon R IIa, mean +/- SE = 75 +/- 7% inhibition, p less than 0.001; Fc epsilon R IIb, mean +/- SE = 71 +/- 7% inhibition, p less than 0.001). Anti-sense oligonucleotides complementary to the common part of Fc epsilon R II resulted in a similar inhibition of proliferation. Sense oligonucleotides did not induce significant inhibition. Preincubation of sense and anti-sense oligonucleotides resulted in an abrogation of proliferation inhibition. Moreover, none of these oligonucleotides had any effect on a Fc epsilon R II -ve cell line. Incubation with both anti-sense IIa and IIb resulted in additive, but not synergistic inhibition of proliferation. Addition of soluble Fc epsilon R II did not reverse inhibition of proliferation, suggesting that membrane-bound or intracellular rather than soluble Fc epsilon R II was important for the induced proliferation. Analysis of cell surface expression for Fc epsilon II indicated that while there was a pronounced effect on cell number following incubation with anti-sense oligonucleotides, surface expression of Fc epsilon R II was consistent as measured over different time points. PCR analysis revealed that while most cells expressed either the alpha or the beta form of Fc epsilon R II, EBV-transformed cell lines, particularly RPMI 8866, were found to express both alpha and beta forms simultaneously. This may constitute a mechanism whereby EBV infection confers an immortal state to the cell, resulting in its uncontrolled proliferation. Cell lines expressing only one receptor form, either alpha or beta, were unaffected after incubation with anti-sense oligonucleotides.(ABSTRACT TRUNCATED AT 400 WORDS)

The delivery of therapeutic oligonucleotides

PubMed Central

Juliano, Rudolph L.

2016-01-01

The oligonucleotide therapeutics field has seen remarkable progress over the last few years with the approval of the first antisense drug and with promising developments in late stage clinical trials using siRNA or splice switching oligonucleotides. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major issue. This review will describe the biological basis of oligonucleotide delivery including the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. It will then examine a variety of current approaches for enhancing the delivery of oligonucleotides. This includes molecular scale targeted ligand-oligonucleotide conjugates, lipid- and polymer-based nanoparticles, antibody conjugates and small molecules that improve oligonucleotide delivery. The merits and liabilities of these approaches will be discussed in the context of the underlying basic biology. PMID:27084936

Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

PubMed

Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

2002-12-01

Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

Bone morphogenetic protein antagonist gene NOG is involved in myeloproliferative disease associated with myelofibrosis.

PubMed

Andrieux, Joris; Roche-Lestienne, Catherine; Geffroy, Sandrine; Desterke, Christophe; Grardel, Nathalie; Plantier, Isabelle; Selleslag, Dominik; Demory, Jean-Loup; Laï, Jean-Luc; Leleu, Xavier; Le Bousse-Kerdiles, Caroline; Vandenberghe, Peter

2007-10-01

In a case with secondary myelofibrosis occurring after essential thrombocythemia, cytogenetic analysis revealed an isolated translocation t(X;17)(q27;q22) in all cells. We found that a bacterial artificial chromosome (BAC) encompassing the breakpoint on chromosome 17 long arm contained only one gene, NOG. We therefore investigated the occurrence of this rare breakpoint in myeloproliferative disorders (MPDs). We identified three more patients with a 17q abnormality in MPDs: myelofibrosis with myeloid metaplasia (MMM); chronic myeloid leukemia positive for t(9;22)(q34;q11) with additional t(4;17)(p15;q22) at diagnosis; and myelofibrosis complicating polycythemia vera. All three cases exhibited a split of BACs containing NOG. The protein encoded by NOG, noggin, acts as an antagonist to bone morphogenetic secreted protein 2 and 4 (BMP2 and BMP4). A comparative analysis of gene expression on Agilent 22K oligonucleotide microarrays in purified CD34+ cells from the blood of MMM patients showed significant downregulation of BMPR2, BMPR1B, BMP2, and BMP8; upregulation of BMP3 and BMP10; and a trend to lower expression of NOG. Thus, given that expression and release of BMPs are important in the induction of osteosclerosis and angiogenic activity, the observed BMP deregulations could be triggered by potential NOG genetic alterations in the four cases here described, and may contribute to the myelofibrotic process characterized by bone marrow stromal reaction including collagen fibrosis, osteosclerosis, and angiogenesis.

Cytotoxicity of flavones and flavonols to a human esophageal squamous cell carcinoma cell line (KYSE-510) by induction of G2/M arrest and apoptosis.

PubMed

Zhang, Qiang; Zhao, Xin-Huai; Wang, Zhu-Jun

2009-08-01

In this study, cytotoxic effects of structurally related flavones and flavonols on a human esophageal squamous cell carcinoma cell line (KYSE-510) were determined, and the molecular mechanisms responsible for their cytotoxic effects were studied. The results of MTT assay showed that flavones (luteolin, apigenin, chrysin) and flavonols (quercetin, kaempferol, myricetin) were able to induce cytotoxicity in KYSE-510 cells in a dose- and time-dependent manner, and the cytotoxic potency of these compounds was in the order of: luteolin>quercetin>chrysin>kaempferol>apigenin>myricetin. Flow cytometry and DNA fragmentation analysis indicated that the cytotoxicity induced by flavones and flavonols was mediated by G(2)/M cell cycle arrest and apoptosis. Furthermore, the expression of genes related to cell cycle arrest and apoptosis was assessed by oligonucleotide microarray, real-time RT-PCR and Western blot. It was shown that the treatment of KYSE-510 cells with these compounds caused G(2)/M arrest through up-regulation of p21(waf1) and down-regulation of cyclin B1 at the mRNA and protein levels, and induced p53-independent mitochondrial-mediated apoptosis through up-regulation of PIG3 and cleavage of caspase-9 and caspase-3. The results of western blot analysis further showed that increases of p63 and p73 protein translation or stability might be contributed to the regulation of p21(waf1), cyclin B1 and PIG3.

Characterization of a Genomic Signature of Pregnancy in the Breast

PubMed Central

Belitskaya-Lévy, Ilana; Zeleniuch-Jacquotte, Anne; Russo, Jose; Russo, Irma H.; Bordás, Pal; Åhman, Janet; Afanasyeva, Yelena; Johansson, Robert; Lenner, Per; Li, Xiaochun; de Cicco, Ricardo López; Peri, Suraj; Ross, Eric; Russo, Patricia A.; Santucci-Pereira, Julia; Sheriff, Fathima S.; Slifker, Michael; Hallmans, Göran; Toniolo, Paolo; Arslan, Alan A.

2012-01-01

The objective of the current study was to comprehensively compare the genomic profiles in the breast of parous and nulliparous postmenopausal women to identify genes that permanently change their expression following pregnancy. The study was designed as a two-phase approach. In the discovery phase, we compared breast genomic profiles of 37 parous with 18 nulliparous postmenopausal women. In the validation phase, confirmation of the genomic patterns observed in the discovery phase was sought in an independent set of 30 parous and 22 nulliparous postmenopausal women. RNA was hybridized to Affymetrix HG_U133 Plus 2.0 oligonucleotide arrays containing probes to 54,675 transcripts; scanned and the images analyzed using Affymetrix GCOS software. Surrogate variable analysis, logistic regression and significance analysis for microarrays were used to identify statistically significant differences in expression of genes. The False Discovery Rate (FDR) approach was used to control for multiple comparisons. We found that 208 genes (305 probe sets) were differentially expressed between parous and nulliparous women in both discovery and validation phases of the study at a FDR of 10% and with at least a 1.25-fold change. These genes are involved in regulation of transcription, centrosome organization, RNA splicing, cell cycle control, adhesion and differentiation. The results provide persuasive evidence that full-term pregnancy induces long-term genomic changes in the breast. The genomic signature of pregnancy could be used as an intermediate marker to assess potential chemopreventive interventions with hormones mimicking the effects of pregnancy for prevention of breast cancer. PMID:21622728

Seasonal Changes in Bacterial and Archaeal Gene Expression Patterns across Salinity Gradients in the Columbia River Coastal Margin

PubMed Central

Smith, Maria W.; Herfort, Lydie; Tyrol, Kaitlin; Suciu, Dominic; Campbell, Victoria; Crump, Byron C.; Peterson, Tawnya D.; Zuber, Peter; Baptista, Antonio M.; Simon, Holly M.

2010-01-01

Through their metabolic activities, microbial populations mediate the impact of high gradient regions on ecological function and productivity of the highly dynamic Columbia River coastal margin (CRCM). A 2226-probe oligonucleotide DNA microarray was developed to investigate expression patterns for microbial genes involved in nitrogen and carbon metabolism in the CRCM. Initial experiments with the environmental microarrays were directed toward validation of the platform and yielded high reproducibility in multiple tests. Bioinformatic and experimental validation also indicated that >85% of the microarray probes were specific for their corresponding target genes and for a few homologs within the same microbial family. The validated probe set was used to query gene expression responses by microbial assemblages to environmental variability. Sixty-four samples from the river, estuary, plume, and adjacent ocean were collected in different seasons and analyzed to correlate the measured variability in chemical, physical and biological water parameters to differences in global gene expression profiles. The method produced robust seasonal profiles corresponding to pre-freshet spring (April) and late summer (August). Overall relative gene expression was high in both seasons and was consistent with high microbial abundance measured by total RNA, heterotrophic bacterial production, and chlorophyll a. Both seasonal patterns involved large numbers of genes that were highly expressed relative to background, yet each produced very different gene expression profiles. April patterns revealed high differential gene expression in the coastal margin samples (estuary, plume and adjacent ocean) relative to freshwater, while little differential gene expression was observed along the river-to-ocean transition in August. Microbial gene expression profiles appeared to relate, in part, to seasonal differences in nutrient availability and potential resource competition. Furthermore, our results suggest that highly-active particle-attached microbiota in the Columbia River water column may perform dissimilatory nitrate reduction (both dentrification and DNRA) within anoxic particle microniches. PMID:20967204

Genomic resources for Myzus persicae: EST sequencing, SNP identification, and microarray design

PubMed Central

Ramsey, John S; Wilson, Alex CC; de Vos, Martin; Sun, Qi; Tamborindeguy, Cecilia; Winfield, Agnese; Malloch, Gaynor; Smith, Dawn M; Fenton, Brian; Gray, Stewart M; Jander, Georg

2007-01-01

Background The green peach aphid, Myzus persicae (Sulzer), is a world-wide insect pest capable of infesting more than 40 plant families, including many crop species. However, despite the significant damage inflicted by M. persicae in agricultural systems through direct feeding damage and by its ability to transmit plant viruses, limited genomic information is available for this species. Results Sequencing of 16 M. persicae cDNA libraries generated 26,669 expressed sequence tags (ESTs). Aphids for library construction were raised on Arabidopsis thaliana, Nicotiana benthamiana, Brassica oleracea, B. napus, and Physalis floridana (with and without Potato leafroll virus infection). The M. persicae cDNA libraries include ones made from sexual and asexual whole aphids, guts, heads, and salivary glands. In silico comparison of cDNA libraries identified aphid genes with tissue-specific expression patterns, and gene expression that is induced by feeding on Nicotiana benthamiana. Furthermore, 2423 genes that are novel to science and potentially aphid-specific were identified. Comparison of cDNA data from three aphid lineages identified single nucleotide polymorphisms that can be used as genetic markers and, in some cases, may represent functional differences in the protein products. In particular, non-conservative amino acid substitutions in a highly expressed gut protease may be of adaptive significance for M. persicae feeding on different host plants. The Agilent eArray platform was used to design an M. persicae oligonucleotide microarray representing over 10,000 unique genes. Conclusion New genomic resources have been developed for M. persicae, an agriculturally important insect pest. These include previously unknown sequence data, a collection of expressed genes, molecular markers, and a DNA microarray that can be used to study aphid gene expression. These resources will help elucidate the adaptations that allow M. persicae to develop compatible interactions with its host plants, complementing ongoing work illuminating plant molecular responses to phloem-feeding insects. PMID:18021414

Signaling Pathways Mediating the Induction of Apple Fruitlet Abscission1[C][W][OA

PubMed Central

Botton, Alessandro; Eccher, Giulia; Forcato, Claudio; Ferrarini, Alberto; Begheldo, Maura; Zermiani, Monica; Moscatello, Stefano; Battistelli, Alberto; Velasco, Riccardo; Ruperti, Benedetto; Ramina, Angelo

2011-01-01

Apple (Malus × domestica) represents an interesting model tree crop for studying fruit abscission. The physiological fruitlet drop occurring in this species can be easily magnified by using thinning chemicals, such as benzyladenine (BA), to obtain fruits with improved quality and marketability. Despite the economic importance of this process, the molecular determinants of apple fruitlet abscission are still unknown. In this research, BA was used to obtain fruitlet populations with different abscission potentials to be analyzed by means of a newly released 30K oligonucleotide microarray. RNAs were extracted from cortex and seed of apple fruitlets sampled over a 4-d time course, during which BA triggers fruit drop, and used for microarray hybridization. Transcriptomic profiles of persisting and abscising fruitlets were tested for statistical association with abscission potential, allowing us to identify molecular signatures strictly related to fruit destiny. A hypothetical model for apple fruitlet abscission was obtained by putting together available transcriptomic and metabolomic data. According to this model, BA treatment would establish a nutritional stress within the tree that is primarily perceived by the fruitlet cortex whose growth is blocked by resembling the ovary growth inhibition found in other species. In weaker fruits, this stress is soon visible also at the seed level, likely transduced via reactive oxygen species/sugar and hormones signaling cross talk, and followed by a block of embryogenesis and the consequent activation of the abscission zone. PMID:21037112

Transcriptional profiling of Epstein–Barr virus (EBV) genes and host cellular genes in nasal NK/T-cell lymphoma and chronic active EBV infection

PubMed Central

Zhang, Y; Ohyashiki, J H; Takaku, T; Shimizu, N; Ohyashiki, K

2006-01-01

Nasal NK/T-cell lymphoma is an aggressive subtype of non-Hodgkin lymphoma (NHL) that is closely associated with Epstein–Barr virus (EBV). The clonal expansion of EBV-infected NK or T cells is also seen in patients with chronic active EBV (CAEBV) infection, suggesting that two diseases might share a partially similar mechanism by which EBV affects host cellular gene expression. To understand the pathogenesis of EBV-associated NK/T-cell lymphoproliferative disorders (LPD) and design new therapies, we employed a novel EBV DNA microarray to compare patterns of EBV expression in six cell lines established from EBV-associated NK/T-cell LPD. We found that expression of BZLF1, which encodes the immediate-early gene product Zta, was expressed in SNK/T cells and the expression levels were preferentially high in cell lines from CAEBV infection. We also analyzsd the gene expression patterns of host cellular genes using a human oligonucleotide DNA microarray. We identified a subset of pathogenically and clinically relevant host cellular genes, including TNFRSF10D, CDK2, HSPCA, IL12A as a common molecular biological properties of EBV-associated NK/T-cell LPD and a subset of genes, such as PDCD4 as a putative contributor for disease progression. This study describes a novel approach from the aspects of viral and host gene expression, which could identify novel therapeutic targets in EBV-associated NK/T-cell LPD. PMID:16449999

A customized gene expression microarray reveals that the brittle stem phenotype fs2 of barley is attributable to a retroelement in the HvCesA4 cellulose synthase gene.

PubMed

Burton, Rachel A; Ma, Gang; Baumann, Ute; Harvey, Andrew J; Shirley, Neil J; Taylor, Jillian; Pettolino, Filomena; Bacic, Antony; Beatty, Mary; Simmons, Carl R; Dhugga, Kanwarpal S; Rafalski, J Antoni; Tingey, Scott V; Fincher, Geoffrey B

2010-08-01

The barley (Hordeum vulgare) brittle stem mutants, fs2, designated X054 and M245, have reduced levels of crystalline cellulose compared with their parental lines Ohichi and Shiroseto. A custom-designed microarray, based on long oligonucleotide technology and including genes involved in cell wall metabolism, revealed that transcript levels of very few genes were altered in the elongation zone of stem internodes, but these included a marked decrease in mRNA for the HvCesA4 cellulose synthase gene of both mutants. In contrast, the abundance of several hundred transcripts changed in the upper, maturation zones of stem internodes, which presumably reflected pleiotropic responses to a weakened cell wall that resulted from the primary genetic lesion. Sequencing of the HvCesA4 genes revealed the presence of a 964-bp solo long terminal repeat of a Copia-like retroelement in the first intron of the HvCesA4 genes of both mutant lines. The retroelement appears to interfere with transcription of the HvCesA4 gene or with processing of the mRNA, and this is likely to account for the lower crystalline cellulose content and lower stem strength of the mutants. The HvCesA4 gene maps to a position on chromosome 1H of barley that coincides with the previously reported position of fs2.

A Customized Gene Expression Microarray Reveals That the Brittle Stem Phenotype fs2 of Barley Is Attributable to a Retroelement in the HvCesA4 Cellulose Synthase Gene1[W][OA

PubMed Central

Burton, Rachel A.; Ma, Gang; Baumann, Ute; Harvey, Andrew J.; Shirley, Neil J.; Taylor, Jillian; Pettolino, Filomena; Bacic, Antony; Beatty, Mary; Simmons, Carl R.; Dhugga, Kanwarpal S.; Rafalski, J. Antoni; Tingey, Scott V.; Fincher, Geoffrey B.

2010-01-01

The barley (Hordeum vulgare) brittle stem mutants, fs2, designated X054 and M245, have reduced levels of crystalline cellulose compared with their parental lines Ohichi and Shiroseto. A custom-designed microarray, based on long oligonucleotide technology and including genes involved in cell wall metabolism, revealed that transcript levels of very few genes were altered in the elongation zone of stem internodes, but these included a marked decrease in mRNA for the HvCesA4 cellulose synthase gene of both mutants. In contrast, the abundance of several hundred transcripts changed in the upper, maturation zones of stem internodes, which presumably reflected pleiotropic responses to a weakened cell wall that resulted from the primary genetic lesion. Sequencing of the HvCesA4 genes revealed the presence of a 964-bp solo long terminal repeat of a Copia-like retroelement in the first intron of the HvCesA4 genes of both mutant lines. The retroelement appears to interfere with transcription of the HvCesA4 gene or with processing of the mRNA, and this is likely to account for the lower crystalline cellulose content and lower stem strength of the mutants. The HvCesA4 gene maps to a position on chromosome 1H of barley that coincides with the previously reported position of fs2. PMID:20530215

GeneXplorer: an interactive web application for microarray data visualization and analysis.

PubMed

Rees, Christian A; Demeter, Janos; Matese, John C; Botstein, David; Sherlock, Gavin

2004-10-01

When publishing large-scale microarray datasets, it is of great value to create supplemental websites where either the full data, or selected subsets corresponding to figures within the paper, can be browsed. We set out to create a CGI application containing many of the features of some of the existing standalone software for the visualization of clustered microarray data. We present GeneXplorer, a web application for interactive microarray data visualization and analysis in a web environment. GeneXplorer allows users to browse a microarray dataset in an intuitive fashion. It provides simple access to microarray data over the Internet and uses only HTML and JavaScript to display graphic and annotation information. It provides radar and zoom views of the data, allows display of the nearest neighbors to a gene expression vector based on their Pearson correlations and provides the ability to search gene annotation fields. The software is released under the permissive MIT Open Source license, and the complete documentation and the entire source code are freely available for download from CPAN http://search.cpan.org/dist/Microarray-GeneXplorer/.

Nanotechnology: moving from microarrays toward nanoarrays.

PubMed

Chen, Hua; Li, Jun

2007-01-01

Microarrays are important tools for high-throughput analysis of biomolecules. The use of microarrays for parallel screening of nucleic acid and protein profiles has become an industry standard. A few limitations of microarrays are the requirement for relatively large sample volumes and elongated incubation time, as well as the limit of detection. In addition, traditional microarrays make use of bulky instrumentation for the detection, and sample amplification and labeling are quite laborious, which increase analysis cost and delays the time for obtaining results. These problems limit microarray techniques from point-of-care and field applications. One strategy for overcoming these problems is to develop nanoarrays, particularly electronics-based nanoarrays. With further miniaturization, higher sensitivity, and simplified sample preparation, nanoarrays could potentially be employed for biomolecular analysis in personal healthcare and monitoring of trace pathogens. In this chapter, it is intended to introduce the concept and advantage of nanotechnology and then describe current methods and protocols for novel nanoarrays in three aspects: (1) label-free nucleic acids analysis using nanoarrays, (2) nanoarrays for protein detection by conventional optical fluorescence microscopy as well as by novel label-free methods such as atomic force microscopy, and (3) nanoarray for enzymatic-based assay. These nanoarrays will have significant applications in drug discovery, medical diagnosis, genetic testing, environmental monitoring, and food safety inspection.

A meta-data based method for DNA microarray imputation.

PubMed

Jörnsten, Rebecka; Ouyang, Ming; Wang, Hui-Yu

2007-03-29

DNA microarray experiments are conducted in logical sets, such as time course profiling after a treatment is applied to the samples, or comparisons of the samples under two or more conditions. Due to cost and design constraints of spotted cDNA microarray experiments, each logical set commonly includes only a small number of replicates per condition. Despite the vast improvement of the microarray technology in recent years, missing values are prevalent. Intuitively, imputation of missing values is best done using many replicates within the same logical set. In practice, there are few replicates and thus reliable imputation within logical sets is difficult. However, it is in the case of few replicates that the presence of missing values, and how they are imputed, can have the most profound impact on the outcome of downstream analyses (e.g. significance analysis and clustering). This study explores the feasibility of imputation across logical sets, using the vast amount of publicly available microarray data to improve imputation reliability in the small sample size setting. We download all cDNA microarray data of Saccharomyces cerevisiae, Arabidopsis thaliana, and Caenorhabditis elegans from the Stanford Microarray Database. Through cross-validation and simulation, we find that, for all three species, our proposed imputation using data from public databases is far superior to imputation within a logical set, sometimes to an astonishing degree. Furthermore, the imputation root mean square error for significant genes is generally a lot less than that of non-significant ones. Since downstream analysis of significant genes, such as clustering and network analysis, can be very sensitive to small perturbations of estimated gene effects, it is highly recommended that researchers apply reliable data imputation prior to further analysis. Our method can also be applied to cDNA microarray experiments from other species, provided good reference data are available.

Advanced surface-enhanced Raman gene probe systems and methods thereof

DOEpatents

Vo-Dinh, Tuan

2001-01-01

The subject invention is a series of methods and systems for using the Surface-Enhanced Raman (SER)-labeled Gene Probe for hybridization, detection and identification of SER-labeled hybridized target oligonucleotide material comprising the steps of immobilizing SER-labeled hybridized target oligonucleotide material on a support means, wherein the SER-labeled hybridized target oligonucleotide material comprise a SER label attached either to a target oligonucleotide of unknown sequence or to a gene probe of known sequence complementary to the target oligonucleotide sequence, the SER label is unique for the target oligonucleotide strands of a particular sequence wherein the SER-labeled oligonucleotide is hybridized to its complementary oligonucleotide strand, then the support means having the SER-labeled hybridized target oligonucleotide material adsorbed thereon is SERS activated with a SERS activating means, then the support means is analyzed.

BABAR: an R package to simplify the normalisation of common reference design microarray-based transcriptomic datasets

PubMed Central

2010-01-01

Background The development of DNA microarrays has facilitated the generation of hundreds of thousands of transcriptomic datasets. The use of a common reference microarray design allows existing transcriptomic data to be readily compared and re-analysed in the light of new data, and the combination of this design with large datasets is ideal for 'systems'-level analyses. One issue is that these datasets are typically collected over many years and may be heterogeneous in nature, containing different microarray file formats and gene array layouts, dye-swaps, and showing varying scales of log2- ratios of expression between microarrays. Excellent software exists for the normalisation and analysis of microarray data but many data have yet to be analysed as existing methods struggle with heterogeneous datasets; options include normalising microarrays on an individual or experimental group basis. Our solution was to develop the Batch Anti-Banana Algorithm in R (BABAR) algorithm and software package which uses cyclic loess to normalise across the complete dataset. We have already used BABAR to analyse the function of Salmonella genes involved in the process of infection of mammalian cells. Results The only input required by BABAR is unprocessed GenePix or BlueFuse microarray data files. BABAR provides a combination of 'within' and 'between' microarray normalisation steps and diagnostic boxplots. When applied to a real heterogeneous dataset, BABAR normalised the dataset to produce a comparable scaling between the microarrays, with the microarray data in excellent agreement with RT-PCR analysis. When applied to a real non-heterogeneous dataset and a simulated dataset, BABAR's performance in identifying differentially expressed genes showed some benefits over standard techniques. Conclusions BABAR is an easy-to-use software tool, simplifying the simultaneous normalisation of heterogeneous two-colour common reference design cDNA microarray-based transcriptomic datasets. We show BABAR transforms real and simulated datasets to allow for the correct interpretation of these data, and is the ideal tool to facilitate the identification of differentially expressed genes or network inference analysis from transcriptomic datasets. PMID:20128918

Comprehensive hydrophilic interaction and ion-pair reversed-phase liquid chromatography for analysis of di- to deca-oligonucleotides.

PubMed

Li, Qin; Lynen, Frédéric; Wang, Jian; Li, Hanlin; Xu, Guowang; Sandra, Pat

2012-09-14

A comprehensive two-dimensional HPLC approach with a high degree of orthogonality was developed for analysis of di- to deca-oligonucleotides (ONs). Hydrophilic interaction liquid chromatography (HILIC) was used in the first dimension, and ion-pair reversed-phase liquid chromatography (IP-RPLC) was employed in the second dimension. The two dimensions were connected via a ten-port valve interface equipped with octadecyl silica (ODS) traps to immobilize and focus the ONs eluting from the first dimension prior to IP-RPLC separation. An aqueous make-up flow was used for effective trapping. The comprehensive two-dimensional HPLC system was optimized with a mixture consisting of 27 oligonucleotide standards. An overall chromatographic peak capacity of 500 was obtained. The use of the volatile buffer triethylamine acetate in the second dimension allowed straightforward coupling to electrospray ionization mass spectrometry (ESI-MS) and detection of each ON in the negative ionization mode. Copyright © 2011 Elsevier B.V. All rights reserved.

Mass spectrometric detection of siRNA in plasma samples for doping control purposes.

PubMed

Kohler, Maxie; Thomas, Andreas; Walpurgis, Katja; Schänzer, Wilhelm; Thevis, Mario

2010-10-01

Small interfering ribonucleic acid (siRNA) molecules can effect the expression of any gene by inducing the degradation of mRNA. Therefore, these molecules can be of interest for illicit performance enhancement in sports by affecting different metabolic pathways. An example of an efficient performance-enhancing gene knockdown is the myostatin gene that regulates muscle growth. This study was carried out to provide a tool for the mass spectrometric detection of modified and unmodified siRNA from plasma samples. The oligonucleotides are purified by centrifugal filtration and the use of an miRNA purification kit, followed by flow-injection analysis using an Exactive mass spectrometer to yield the accurate masses of the sense and antisense strands. Although chromatography and sensitive mass spectrometric analysis of oligonucleotides are still challenging, a method was developed and validated that has adequate sensitivity (limit of detection 0.25-1 nmol mL(-1)) and performance (precision 11-21%, recovery 23-67%) for typical antisense oligonucleotides currently used in clinical studies.

The efficacy of microarray screening for autosomal recessive retinitis pigmentosa in routine clinical practice

PubMed Central

van Huet, Ramon A. C.; Pierrache, Laurence H.M.; Meester-Smoor, Magda A.; Klaver, Caroline C.W.; van den Born, L. Ingeborgh; Hoyng, Carel B.; de Wijs, Ilse J.; Collin, Rob W. J.; Hoefsloot, Lies H.

2015-01-01

Purpose To determine the efficacy of multiple versions of a commercially available arrayed primer extension (APEX) microarray chip for autosomal recessive retinitis pigmentosa (arRP). Methods We included 250 probands suspected of arRP who were genetically analyzed with the APEX microarray between January 2008 and November 2013. The mode of inheritance had to be autosomal recessive according to the pedigree (including isolated cases). If the microarray identified a heterozygous mutation, we performed Sanger sequencing of exons and exon–intron boundaries of that specific gene. The efficacy of this microarray chip with the additional Sanger sequencing approach was determined by the percentage of patients that received a molecular diagnosis. We also collected data from genetic tests other than the APEX analysis for arRP to provide a detailed description of the molecular diagnoses in our study cohort. Results The APEX microarray chip for arRP identified the molecular diagnosis in 21 (8.5%) of the patients in our cohort. Additional Sanger sequencing yielded a second mutation in 17 patients (6.8%), thereby establishing the molecular diagnosis. In total, 38 patients (15.2%) received a molecular diagnosis after analysis using the microarray and additional Sanger sequencing approach. Further genetic analyses after a negative result of the arRP microarray (n = 107) resulted in a molecular diagnosis of arRP (n = 23), autosomal dominant RP (n = 5), X-linked RP (n = 2), and choroideremia (n = 1). Conclusions The efficacy of the commercially available APEX microarray chips for arRP appears to be low, most likely caused by the limitations of this technique and the genetic and allelic heterogeneity of RP. Diagnostic yields up to 40% have been reported for next-generation sequencing (NGS) techniques that, as expected, thereby outperform targeted APEX analysis. PMID:25999674

[Study toward practical use of oligonucleotide therapeutics].

PubMed

Inoue, Takao; Yoshida, Tokuyuki

2014-01-01

Over the past decade, oligonucleotide-based therapeutics such as antisense oligonucleotides and small interfering RNAs (siRNAs) have been developed extensively. For example, mipomersen (Kynamro; ISIS Pharmaceuticals), which is a second-generation antisense oligonucleotide administered by subcutaneous injection, has recently been approved by the FDA for the treatment of homozygous familial hypercholesterolemia. On the other hands, methods for the evaluation of quality, efficacy and safety of oligonucleotide therapeutics have not been fully discussed. Furthermore, the regulatory guidance specific for oligonucleotide therapeutics has not been established yet. Under these circumstances, we started to collaborate with Osaka University and PMDA to discuss regulatory science focused on oligonucleotide therapeutics. Through the collaboration, we would like to propose the possible design of quality evaluation and preclinical safety-evaluation of oligonucleotide therapeutics.

Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides.

PubMed

Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M; Högberg, Björn

2013-07-01

Single-stranded oligonucleotides are important as research tools, as diagnostic probes, in gene therapy and in DNA nanotechnology. Oligonucleotides are typically produced via solid-phase synthesis, using polymer chemistries that are limited relative to what biological systems produce. The number of errors in synthetic DNA increases with oligonucleotide length, and the resulting diversity of sequences can be a problem. Here we present the 'monoclonal stoichiometric' (MOSIC) method for enzyme-mediated production of DNA oligonucleotides. We amplified oligonucleotides from clonal templates derived from single bacterial colonies and then digested cutter hairpins in the products, which released pools of oligonucleotides with precisely controlled relative stoichiometric ratios. We prepared 14-378-nucleotide MOSIC oligonucleotides either by in vitro rolling-circle amplification or by amplification of phagemid DNA in Escherichia coli. Analyses of the formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides.

Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides

PubMed Central

Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M.; Högberg, Björn

2013-01-01

Single-stranded oligonucleotides are important as research tools as probes for diagnostics and gene therapy. Today, production of oligonucleotides is done via solid-phase synthesis. However, the capabilities of current polymer chemistry are limited in comparison to what can be produced in biological systems. The errors in synthetic DNA increases with oligonucleotide length, and sequence diversity can often be a problem. Here, we present the Monoclonal Stoichiometric (MOSIC) method for enzymatic DNA oligonucleotide production. Using this method, we amplify oligonucleotides from clonal templates followed by digestion of a cutter-hairpin, resulting in pools of monoclonal oligonucleotides with precisely controlled relative stoichiometric ratios. We present data where MOSIC oligonucleotides, 14–378 nt long, were prepared either by in vitro rolling-circle amplification, or by amplification in Escherichia coli in the form of phagemid DNA. The formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides. PMID:23727986

Principles of gene microarray data analysis.

PubMed

Mocellin, Simone; Rossi, Carlo Riccardo

2007-01-01

The development of several gene expression profiling methods, such as comparative genomic hybridization (CGH), differential display, serial analysis of gene expression (SAGE), and gene microarray, together with the sequencing of the human genome, has provided an opportunity to monitor and investigate the complex cascade of molecular events leading to tumor development and progression. The availability of such large amounts of information has shifted the attention of scientists towards a nonreductionist approach to biological phenomena. High throughput technologies can be used to follow changing patterns of gene expression over time. Among them, gene microarray has become prominent because it is easier to use, does not require large-scale DNA sequencing, and allows for the parallel quantification of thousands of genes from multiple samples. Gene microarray technology is rapidly spreading worldwide and has the potential to drastically change the therapeutic approach to patients affected with tumor. Therefore, it is of paramount importance for both researchers and clinicians to know the principles underlying the analysis of the huge amount of data generated with microarray technology.

Support vector machine and principal component analysis for microarray data classification

NASA Astrophysics Data System (ADS)

Astuti, Widi; Adiwijaya

2018-03-01

Cancer is a leading cause of death worldwide although a significant proportion of it can be cured if it is detected early. In recent decades, technology called microarray takes an important role in the diagnosis of cancer. By using data mining technique, microarray data classification can be performed to improve the accuracy of cancer diagnosis compared to traditional techniques. The characteristic of microarray data is small sample but it has huge dimension. Since that, there is a challenge for researcher to provide solutions for microarray data classification with high performance in both accuracy and running time. This research proposed the usage of Principal Component Analysis (PCA) as a dimension reduction method along with Support Vector Method (SVM) optimized by kernel functions as a classifier for microarray data classification. The proposed scheme was applied on seven data sets using 5-fold cross validation and then evaluation and analysis conducted on term of both accuracy and running time. The result showed that the scheme can obtained 100% accuracy for Ovarian and Lung Cancer data when Linear and Cubic kernel functions are used. In term of running time, PCA greatly reduced the running time for every data sets.

Experimental Approaches to Microarray Analysis of Tumor Samples

ERIC Educational Resources Information Center

Furge, Laura Lowe; Winter, Michael B.; Meyers, Jacob I.; Furge, Kyle A.

2008-01-01

Comprehensive measurement of gene expression using high-density nucleic acid arrays (i.e. microarrays) has become an important tool for investigating the molecular differences in clinical and research samples. Consequently, inclusion of discussion in biochemistry, molecular biology, or other appropriate courses of microarray technologies has…

Multiplex cDNA quantification method that facilitates the standardization of gene expression data

PubMed Central

Gotoh, Osamu; Murakami, Yasufumi; Suyama, Akira

2011-01-01

Microarray-based gene expression measurement is one of the major methods for transcriptome analysis. However, current microarray data are substantially affected by microarray platforms and RNA references because of the microarray method can provide merely the relative amounts of gene expression levels. Therefore, valid comparisons of the microarray data require standardized platforms, internal and/or external controls and complicated normalizations. These requirements impose limitations on the extensive comparison of gene expression data. Here, we report an effective approach to removing the unfavorable limitations by measuring the absolute amounts of gene expression levels on common DNA microarrays. We have developed a multiplex cDNA quantification method called GEP-DEAN (Gene expression profiling by DCN-encoding-based analysis). The method was validated by using chemically synthesized DNA strands of known quantities and cDNA samples prepared from mouse liver, demonstrating that the absolute amounts of cDNA strands were successfully measured with a sensitivity of 18 zmol in a highly multiplexed manner in 7 h. PMID:21415008

Spot detection and image segmentation in DNA microarray data.

PubMed

Qin, Li; Rueda, Luis; Ali, Adnan; Ngom, Alioune

2005-01-01

Following the invention of microarrays in 1994, the development and applications of this technology have grown exponentially. The numerous applications of microarray technology include clinical diagnosis and treatment, drug design and discovery, tumour detection, and environmental health research. One of the key issues in the experimental approaches utilising microarrays is to extract quantitative information from the spots, which represent genes in a given experiment. For this process, the initial stages are important and they influence future steps in the analysis. Identifying the spots and separating the background from the foreground is a fundamental problem in DNA microarray data analysis. In this review, we present an overview of state-of-the-art methods for microarray image segmentation. We discuss the foundations of the circle-shaped approach, adaptive shape segmentation, histogram-based methods and the recently introduced clustering-based techniques. We analytically show that clustering-based techniques are equivalent to the one-dimensional, standard k-means clustering algorithm that utilises the Euclidean distance.

Split-plot microarray experiments: issues of design, power and sample size.

PubMed

Tsai, Pi-Wen; Lee, Mei-Ling Ting

2005-01-01

This article focuses on microarray experiments with two or more factors in which treatment combinations of the factors corresponding to the samples paired together onto arrays are not completely random. A main effect of one (or more) factor(s) is confounded with arrays (the experimental blocks). This is called a split-plot microarray experiment. We utilise an analysis of variance (ANOVA) model to assess differentially expressed genes for between-array and within-array comparisons that are generic under a split-plot microarray experiment. Instead of standard t- or F-test statistics that rely on mean square errors of the ANOVA model, we use a robust method, referred to as 'a pooled percentile estimator', to identify genes that are differentially expressed across different treatment conditions. We illustrate the design and analysis of split-plot microarray experiments based on a case application described by Jin et al. A brief discussion of power and sample size for split-plot microarray experiments is also presented.

Syntheses of prodrug-type phosphotriester oligonucleotides responsive to intracellular reducing environment for improvement of cell membrane permeability and nuclease resistance.

PubMed

Hayashi, Junsuke; Samezawa, Yusuke; Ochi, Yosuke; Wada, Shun-Ichi; Urata, Hidehito

2017-07-15

We synthesized prodrug-type phosphotriester (PTE) oligonucleotides containing the six-membered cyclic disulfide moiety by using phosphoramidite chemistry. Prodrug-type oligonucleotides named "Reducing-Environment-Dependent Uncatalyzed Chemical Transforming (REDUCT) PTE oligonucleotides" were converted into natural oligonucleotides under cytosol-mimetic reductive condition. Furthermore, the REDUCT PTE oligonucleotides were robust to nuclease digestion and exhibited good cell membrane permeability. Copyright © 2017 Elsevier Ltd. All rights reserved.

Detection of cryptic pathogenic copy number variations and constitutional loss of heterozygosity using high resolution SNP microarray analysis in 117 patients referred for cytogenetic analysis and impact on clinical practice.

PubMed

Bruno, D L; Ganesamoorthy, D; Schoumans, J; Bankier, A; Coman, D; Delatycki, M; Gardner, R J M; Hunter, M; James, P A; Kannu, P; McGillivray, G; Pachter, N; Peters, H; Rieubland, C; Savarirayan, R; Scheffer, I E; Sheffield, L; Tan, T; White, S M; Yeung, A; Bowman, Z; Ngo, C; Choy, K W; Cacheux, V; Wong, L; Amor, D J; Slater, H R

2009-02-01

Microarray genome analysis is realising its promise for improving detection of genetic abnormalities in individuals with mental retardation and congenital abnormality. Copy number variations (CNVs) are now readily detectable using a variety of platforms and a major challenge is the distinction of pathogenic from ubiquitous, benign polymorphic CNVs. The aim of this study was to investigate replacement of time consuming, locus specific testing for specific microdeletion and microduplication syndromes with microarray analysis, which theoretically should detect all known syndromes with CNV aetiologies as well as new ones. Genome wide copy number analysis was performed on 117 patients using Affymetrix 250K microarrays. 434 CNVs (195 losses and 239 gains) were found, including 18 pathogenic CNVs and 9 identified as "potentially pathogenic". Almost all pathogenic CNVs were larger than 500 kb, significantly larger than the median size of all CNVs detected. Segmental regions of loss of heterozygosity larger than 5 Mb were found in 5 patients. Genome microarray analysis has improved diagnostic success in this group of patients. Several examples of recently discovered "new syndromes" were found suggesting they are more common than previously suspected and collectively are likely to be a major cause of mental retardation. The findings have several implications for clinical practice. The study revealed the potential to make genetic diagnoses that were not evident in the clinical presentation, with implications for pretest counselling and the consent process. The importance of contributing novel CNVs to high quality databases for genotype-phenotype analysis and review of guidelines for selection of individuals for microarray analysis is emphasised.

Junctions between i-motif tetramers in supramolecular structures

PubMed Central

Guittet, Eric; Renciuk, Daniel; Leroy, Jean-Louis

2012-01-01

The symmetry of i-motif tetramers gives to cytidine-rich oligonucleotides the capacity to associate into supramolecular structures (sms). In order to determine how the tetramers are linked together in such structures, we have measured by gel filtration chromatography and NMR the formation and dissociation kinetics of sms built by oligonucleotides containing two short C stretches separated by a non-cytidine-base. We show that a stretch of only two cytidines either at the 3′- or 5′-end is long enough to link the tetramers into sms. The analysis of the properties of sms formed by oligonucleotides differing by the length of the oligo-C stretches, the sequence orientation and the nature of the non-C base provides a model of the junction connecting the tetramers in sms. PMID:22362739

A high-density transcript linkage map with 1,845 expressed genes positioned by microarray-based Single Feature Polymorphisms (SFP) in Eucalyptus

PubMed Central

2011-01-01

Background Technological advances are progressively increasing the application of genomics to a wider array of economically and ecologically important species. High-density maps enriched for transcribed genes facilitate the discovery of connections between genes and phenotypes. We report the construction of a high-density linkage map of expressed genes for the heterozygous genome of Eucalyptus using Single Feature Polymorphism (SFP) markers. Results SFP discovery and mapping was achieved using pseudo-testcross screening and selective mapping to simultaneously optimize linkage mapping and microarray costs. SFP genotyping was carried out by hybridizing complementary RNA prepared from 4.5 year-old trees xylem to an SFP array containing 103,000 25-mer oligonucleotide probes representing 20,726 unigenes derived from a modest size expressed sequence tags collection. An SFP-mapping microarray with 43,777 selected candidate SFP probes representing 15,698 genes was subsequently designed and used to genotype SFPs in a larger subset of the segregating population drawn by selective mapping. A total of 1,845 genes were mapped, with 884 of them ordered with high likelihood support on a framework map anchored to 180 microsatellites with average density of 1.2 cM. Using more probes per unigene increased by two-fold the likelihood of detecting segregating SFPs eventually resulting in more genes mapped. In silico validation showed that 87% of the SFPs map to the expected location on the 4.5X draft sequence of the Eucalyptus grandis genome. Conclusions The Eucalyptus 1,845 gene map is the most highly enriched map for transcriptional information for any forest tree species to date. It represents a major improvement on the number of genes previously positioned on Eucalyptus maps and provides an initial glimpse at the gene space for this global tree genome. A general protocol is proposed to build high-density transcript linkage maps in less characterized plant species by SFP genotyping with a concurrent objective of reducing microarray costs. HIgh-density gene-rich maps represent a powerful resource to assist gene discovery endeavors when used in combination with QTL and association mapping and should be especially valuable to assist the assembly of reference genome sequences soon to come for several plant and animal species. PMID:21492453

Application of a cholesterol stationary phase in the analysis of phosphorothioate oligonucleotides by means of ion pair chromatography coupled with tandem mass spectrometry.

PubMed

Studzińska, Sylwia; Krzemińska, Katarzyna; Szumski, Michał; Buszewski, Bogusław

2016-07-01

The main aim of this study was the investigation of the influence of several ion pair reagents towards both the retention and the mass spectrometry sensitivity of phosphorothioate oligonucleotides. A cholesterol stationary phase was applied for the first time in the analysis of this group of compounds. The mobile phase composition was modified by changing the concentration and the type of amines and acetates or 1,1,1,3,3,3-hexafluoroisopropanol. It has been shown that the increase of amines concentration results in the retention factor increase for each oligonucleotide, on each adsorbent. The only exception was the mobile phase composed of triethylamine and 1,1,1,3,3,3-hexafluoroisopropanol. This is a consequence of interactions taking place between a cholesterol molecule and an alcohol. This effect was convenient when the mass spectrometry detection was applied, since it allowed an increase in the sensitivity. Moreover, optimization of the mobile phase composition and its impact on the efficiency of ionization process and on the sensitivity in mass spectrometry were also presented. The optimization of this new method, based on cholesterol stationary phase coupled with mass spectrometry detection, was finally applied for the determination of phosphorothioate oligonucleotides impurity in a real sample. Copyright © 2016 Elsevier B.V. All rights reserved.

Receptor-Mediated Uptake of Phosphorothioate Antisense Oligonucleotides in Different Cell Types of the Liver.

PubMed

Miller, Colton M; Tanowitz, Michael; Donner, Aaron J; Prakash, Thazha P; Swayze, Eric E; Harris, Edward N; Seth, Punit P

2018-06-01

Oligonucleotide therapeutics have emerged as a third distinct platform for drug discovery within the pharmaceutical industry. Five oligonucleotide-based drugs have been approved by the US FDA and over 100 oligonucleotides drugs are currently at different stages of human trials. Several of these oligonucleotide drugs are modified using the phosphorothioate (PS) backbone modification where one of the nonbridging oxygen atoms of the phosphodiester linkage is replaced with sulfur. In this review, we summarize our knowledge on receptor-mediated uptake of PS antisense oligonucleotides (ASOs) within different cell types of the liver-a privileged organ for the discovery of oligonucleotide-based therapeutics.

Discrimination of heterogenous mRNAs encoding strychnine-sensitive glycine receptors in Xenopus oocytes by antisense oligonucleotides.

PubMed Central

Akagi, H; Patton, D E; Miledi, R

1989-01-01

Three synthetic oligodeoxynucleotides complementary to different parts of an RNA encoding a glycine receptor subunit were used to discriminate heterogenous mRNAs coding for glycine receptors in adult and neonatal rat spinal cord. Injection of the three antisense oligonucleotides into Xenopus oocytes specifically inhibited the expression of glycine receptors by adult spinal cord mRNA. In contrast, the antisense oligonucleotides were much less potent in inhibiting the expression of glycine receptors encoded by neonatal spinal cord mRNA. Northern blot analysis revealed that the oligonucleotides hybridized mostly to an adult cord transcript of approximately 10 kilobases in size. This band was also present in neonatal spinal cord mRNA but its density was about one-fourth of the adult cord message. There was no intense band in the low molecular weight position (approximately 2 kilobases), the existence of which was expected from electrophysiological studies with size-fractionated mRNA of neonatal spinal cord. Our results suggest that in the rat spinal cord there are at least three different types of mRNAs encoding functional strychnine-sensitive glycine receptors. Images PMID:2479016

Analytical Devices Based on Direct Synthesis of DNA on Paper.

PubMed

Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

2016-01-05

This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

Simplified Paper Format for Detecting HIV Drug Resistance in Clinical Specimens by Oligonucleotide Ligation

PubMed Central

Panpradist, Nuttada; Beck, Ingrid A.; Chung, Michael H.; Kiarie, James N.; Frenkel, Lisa M.; Lutz, Barry R.

2016-01-01

Human immunodeficiency virus (HIV) is a chronic infection that can be managed by antiretroviral treatment (ART). However, periods of suboptimal viral suppression during lifelong ART can select for HIV drug resistant (DR) variants. Transmission of drug resistant virus can lessen or abrogate ART efficacy. Therefore, testing of individuals for drug resistance prior to initiation of treatment is recommended to ensure effective ART. Sensitive and inexpensive HIV genotyping methods are needed in low-resource settings where most HIV infections occur. The oligonucleotide ligation assay (OLA) is a sensitive point mutation assay for detection of drug resistance mutations in HIV pol. The current OLA involves four main steps from sample to analysis: (1) lysis and/or nucleic acid extraction, (2) amplification of HIV RNA or DNA, (3) ligation of oligonucleotide probes designed to detect single nucleotide mutations that confer HIV drug resistance, and (4) analysis via oligonucleotide surface capture, denaturation, and detection (CDD). The relative complexity of these steps has limited its adoption in resource-limited laboratories. Here we describe a simplification of the 2.5-hour plate-format CDD to a 45-minute paper-format CDD that eliminates the need for a plate reader. Analysis of mutations at four HIV-1 DR codons (K103N, Y181C, M184V, and G190A) in 26 blood specimens showed a strong correlation of the ratios of mutant signal to total signal between the paper CDD and the plate CDD. The assay described makes the OLA easier to perform in low resource laboratories. PMID:26751207

MALDI-TOF mass spectrometry for quantitative gene expression analysis of acid responses in Staphylococcus aureus.

PubMed

Rode, Tone Mari; Berget, Ingunn; Langsrud, Solveig; Møretrø, Trond; Holck, Askild

2009-07-01

Microorganisms are constantly exposed to new and altered growth conditions, and respond by changing gene expression patterns. Several methods for studying gene expression exist. During the last decade, the analysis of microarrays has been one of the most common approaches applied for large scale gene expression studies. A relatively new method for gene expression analysis is MassARRAY, which combines real competitive-PCR and MALDI-TOF (matrix-assisted laser desorption/ionization time-of-flight) mass spectrometry. In contrast to microarray methods, MassARRAY technology is suitable for analysing a larger number of samples, though for a smaller set of genes. In this study we compare the results from MassARRAY with microarrays on gene expression responses of Staphylococcus aureus exposed to acid stress at pH 4.5. RNA isolated from the same stress experiments was analysed using both the MassARRAY and the microarray methods. The MassARRAY and microarray methods showed good correlation. Both MassARRAY and microarray estimated somewhat lower fold changes compared with quantitative real-time PCR (qRT-PCR). The results confirmed the up-regulation of the urease genes in acidic environments, and also indicated the importance of metal ion regulation. This study shows that the MassARRAY technology is suitable for gene expression analysis in prokaryotes, and has advantages when a set of genes is being analysed for an organism exposed to many different environmental conditions.

Microarray analysis of potential genes in the pathogenesis of recurrent oral ulcer.

PubMed

Han, Jingying; He, Zhiwei; Li, Kun; Hou, Lu

2015-01-01

Recurrent oral ulcer seriously threatens patients' daily life and health. This study investigated potential genes and pathways that participate in the pathogenesis of recurrent oral ulcer by high throughput bioinformatic analysis. RT-PCR and Western blot were applied to further verify screened interleukins effect. Recurrent oral ulcer related genes were collected from websites and papers, and further found out from Human Genome 280 6.0 microarray data. Each pathway of recurrent oral ulcer related genes were got through chip hybridization. RT-PCR was applied to test four recurrent oral ulcer related genes to verify the microarray data. Data transformation, scatter plot, clustering analysis, and expression pattern analysis were used to analyze recurrent oral ulcer related gene expression changes. Recurrent oral ulcer gene microarray was successfully established. Microarray showed that 551 genes involved in recurrent oral ulcer activity and 196 genes were recurrent oral ulcer related genes. Of them, 76 genes up-regulated, 62 genes down-regulated, and 58 genes up-/down-regulated. Total expression level up-regulated 752 times (60%) and down-regulated 485 times (40%). IL-2 plays an important role in the occurrence, development and recurrence of recurrent oral ulcer on the mRNA and protein levels. Gene microarray can be used to analyze potential genes and pathways in recurrent oral ulcer. IL-2 may be involved in the pathogenesis of recurrent oral ulcer.

A preliminary result of three-dimensional microarray technology to gene analysis with endoscopic ultrasound-guided fine-needle aspiration specimens and pancreatic juices

PubMed Central

2010-01-01

Background Analysis of gene expression and gene mutation may add information to be different from ordinary pathological tissue diagnosis. Since samples obtained endoscopically are very small, it is desired that more sensitive technology is developed for gene analysis. We investigated whether gene expression and gene mutation analysis by newly developed ultra-sensitive three-dimensional (3D) microarray is possible using small amount samples from endoscopic ultrasound-guided fine-needle aspiration (EUS-FNA) specimens and pancreatic juices. Methods Small amount samples from 17 EUS-FNA specimens and 16 pancreatic juices were obtained. After nucleic acid extraction, the samples were amplified with labeling and analyzed by the 3D microarray. Results The analyzable rate with the microarray was 46% (6/13) in EUS-FNA specimens of RNAlater® storage, and RNA degradations were observed in all the samples of frozen storage. In pancreatic juices, the analyzable rate was 67% (4/6) in frozen storage samples and 20% (2/10) in RNAlater® storage. EUS-FNA specimens were classified into cancer and non-cancer by gene expression analysis and K-ras codon 12 mutations were also detected using the 3D microarray. Conclusions Gene analysis from small amount samples obtained endoscopically was possible by newly developed 3D microarray technology. High quality RNA from EUS-FNA samples were obtained and remained in good condition only using RNA stabilizer. In contrast, high quality RNA from pancreatic juice samples were obtained only in frozen storage without RNA stabilizer. PMID:20416107

MAAMD: a workflow to standardize meta-analyses and comparison of affymetrix microarray data

PubMed Central

2014-01-01

Background Mandatory deposit of raw microarray data files for public access, prior to study publication, provides significant opportunities to conduct new bioinformatics analyses within and across multiple datasets. Analysis of raw microarray data files (e.g. Affymetrix CEL files) can be time consuming, complex, and requires fundamental computational and bioinformatics skills. The development of analytical workflows to automate these tasks simplifies the processing of, improves the efficiency of, and serves to standardize multiple and sequential analyses. Once installed, workflows facilitate the tedious steps required to run rapid intra- and inter-dataset comparisons. Results We developed a workflow to facilitate and standardize Meta-Analysis of Affymetrix Microarray Data analysis (MAAMD) in Kepler. Two freely available stand-alone software tools, R and AltAnalyze were embedded in MAAMD. The inputs of MAAMD are user-editable csv files, which contain sample information and parameters describing the locations of input files and required tools. MAAMD was tested by analyzing 4 different GEO datasets from mice and drosophila. MAAMD automates data downloading, data organization, data quality control assesment, differential gene expression analysis, clustering analysis, pathway visualization, gene-set enrichment analysis, and cross-species orthologous-gene comparisons. MAAMD was utilized to identify gene orthologues responding to hypoxia or hyperoxia in both mice and drosophila. The entire set of analyses for 4 datasets (34 total microarrays) finished in ~ one hour. Conclusions MAAMD saves time, minimizes the required computer skills, and offers a standardized procedure for users to analyze microarray datasets and make new intra- and inter-dataset comparisons. PMID:24621103

Gene Expression Browser: Large-Scale and Cross-Experiment Microarray Data Management, Search & Visualization

USDA-ARS?s Scientific Manuscript database

The amount of microarray gene expression data in public repositories has been increasing exponentially for the last couple of decades. High-throughput microarray data integration and analysis has become a critical step in exploring the large amount of expression data for biological discovery. Howeve...

Minimum probe length for unique identification of all open reading frames in a microbial genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sokhansanj, B A; Ng, J; Fitch, J P

2000-03-05

In this paper, we determine the minimum hybridization probe length to uniquely identify at least 95% of the open reading frame (ORF) in an organism. We analyze the whole genome sequences of 17 species, 11 bacteria, 4 archaea, and 2 eukaryotes. We also present a mathematical model for minimum probe length based on assuming that all ORFs are random, of constant length, and contain an equal distribution of bases. The model accurately predicts the minimum probe length for all species, but it incorrectly predicts that all ORFs may be uniquely identified. However, a probe length of just 9 bases ismore » adequate to identify over 95% of the ORFs for all 15 prokaryotic species we studied. Using a minimum probe length, while accepting that some ORFs may not be identified and that data will be lost due to hybridization error, may result in significant savings in microarray and oligonucleotide probe design.« less

Experimental annotation of the human genome using microarray technology.

PubMed

Shoemaker, D D; Schadt, E E; Armour, C D; He, Y D; Garrett-Engele, P; McDonagh, P D; Loerch, P M; Leonardson, A; Lum, P Y; Cavet, G; Wu, L F; Altschuler, S J; Edwards, S; King, J; Tsang, J S; Schimmack, G; Schelter, J M; Koch, J; Ziman, M; Marton, M J; Li, B; Cundiff, P; Ward, T; Castle, J; Krolewski, M; Meyer, M R; Mao, M; Burchard, J; Kidd, M J; Dai, H; Phillips, J W; Linsley, P S; Stoughton, R; Scherer, S; Boguski, M S

2001-02-15

The most important product of the sequencing of a genome is a complete, accurate catalogue of genes and their products, primarily messenger RNA transcripts and their cognate proteins. Such a catalogue cannot be constructed by computational annotation alone; it requires experimental validation on a genome scale. Using 'exon' and 'tiling' arrays fabricated by ink-jet oligonucleotide synthesis, we devised an experimental approach to validate and refine computational gene predictions and define full-length transcripts on the basis of co-regulated expression of their exons. These methods can provide more accurate gene numbers and allow the detection of mRNA splice variants and identification of the tissue- and disease-specific conditions under which genes are expressed. We apply our technique to chromosome 22q under 69 experimental condition pairs, and to the entire human genome under two experimental conditions. We discuss implications for more comprehensive, consistent and reliable genome annotation, more efficient, full-length complementary DNA cloning strategies and application to complex diseases.

Protein detection using biobarcodes.

PubMed

Müller, Uwe R

2006-10-01

Over the past 50 years the development of assays for the detection of protein analytes has been driven by continuing demands for higher levels of sensitivity and multiplexing. The result has been a progression of sandwich-type immunoassays, starting with simple radioisotopic, colorimetric, or fluorescent labeling systems to include various enzymatic or nanostructure-based signal amplification schemes, with a concomitant sensitivity increase of over 1 million fold. Multiplexing of samples and tests has been enabled by microplate and microarray platforms, respectively, or lately by various molecular barcoding systems. Two different platforms have emerged as the current front-runners by combining a nucleic acid amplification step with the standard two-sided immunoassay. In both, the captured protein analyte is replaced by a multiplicity of oligonucleotides that serve as surrogate targets. One of these platforms employs DNA or RNA polymerases for the amplification step, while detection is by fluorescence. The other is based on gold nanoparticles for both amplification as well as detection. The latter technology, now termed Biobarcode, is completely enzyme-free and offers potentially much higher multiplexing power.

Identification of human cell responses to benzene and benzene metabolites.

PubMed

Gillis, Bruce; Gavin, Igor M; Arbieva, Zarema; King, Stephen T; Jayaraman, Sundararajan; Prabhakar, Bellur S

2007-09-01

Benzene is a common air pollutant and confirmed carcinogen, especially in reference to the hematopoietic system. In the present study we analyzed cytokine/chemokine production by, and gene expression induction in, human peripheral blood mononuclear cells upon their exposure to the benzene metabolites catechol, hydroquinone, 1,2,4-benzenetriol, and p-benzoquinone. Protein profiling showed that benzene metabolites can stimulate the production of chemokines, the proinflammatory cytokines TNF-alpha and IL-6, and the Th2 cytokines IL-4 and IL-5. Activated cells showed concurrent suppression of anti-inflammatory cytokine IL-10 expression. We also identified changes in global gene expression patterns in response to benzene metabolite challenges by using high-density oligonucleotide microarrays. Treatment with 1,2,4-benzenetriol resulted in the suppression of genes related to the regulation of protein expression and a concomitant activation of genes that encode heat shock proteins and cytochrome P450 family members. Protein and gene expression profiling identified unique human cellular responses upon exposure to benzene and benzene metabolites.

Rapid synthesis of DNA-cysteine conjugates for expressed protein ligation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lovrinovic, Marina; Niemeyer, Christof M.

2005-09-30

We report a rapid method for the covalent modification of commercially available amino-modified DNA oligonucleotides with a cysteine moiety. The resulting DNA-cysteine conjugates are versatile reagents for the efficient preparation of covalent DNA-protein conjugates by means of expressed protein ligation (EPL). The EPL method allows for the site-specific coupling of cysteine-modified DNA oligomers with recombinant intein-fusion proteins, the latter of which contain a C-terminal thioester enabling the mild and highly specific reaction with N-terminal cysteine compounds. We prepared a cysteine-modifier reagent in a single-step reaction which allows for the rapid and near quantitative synthesis of cysteine-DNA conjugates. The latter weremore » ligated with the green fluorescent protein mutant EYFP, recombinantly expressed as an intein-fusion protein, allowing for the mild and selective formation of EYFP-DNA conjugates in high yields of about 60%. We anticipate many applications of our approach, ranging from protein microarrays to the arising field of nanobiotechnology.« less

Parallel, confocal, and complete spectrum imager for fluorescent detection of high-density microarray

NASA Astrophysics Data System (ADS)

Bogdanov, Valery L.; Boyce-Jacino, Michael

1999-05-01

Confined arrays of biochemical probes deposited on a solid support surface (analytical microarray or 'chip') provide an opportunity to analysis multiple reactions simultaneously. Microarrays are increasingly used in genetics, medicine and environment scanning as research and analytical instruments. A power of microarray technology comes from its parallelism which grows with array miniaturization, minimization of reagent volume per reaction site and reaction multiplexing. An optical detector of microarray signals should combine high sensitivity, spatial and spectral resolution. Additionally, low-cost and a high processing rate are needed to transfer microarray technology into biomedical practice. We designed an imager that provides confocal and complete spectrum detection of entire fluorescently-labeled microarray in parallel. Imager uses microlens array, non-slit spectral decomposer, and high- sensitive detector (cooled CCD). Two imaging channels provide a simultaneous detection of localization, integrated and spectral intensities for each reaction site in microarray. A dimensional matching between microarray and imager's optics eliminates all in moving parts in instrumentation, enabling highly informative, fast and low-cost microarray detection. We report theory of confocal hyperspectral imaging with microlenses array and experimental data for implementation of developed imager to detect fluorescently labeled microarray with a density approximately 103 sites per cm2.

Random oligonucleotide mutagenesis: application to a large protein coding sequence of a major histocompatibility complex class I gene, H-2DP.

PubMed Central

Murray, R; Pederson, K; Prosser, H; Muller, D; Hutchison, C A; Frelinger, J A

1988-01-01

We have used random oligonucleotide mutagenesis (or saturation mutagenesis) to create a library of point mutations in the alpha 1 protein domain of a Major Histocompatibility Complex (MHC) molecule. This protein domain is critical for T cell and B cell recognition. We altered the MHC class I H-2DP gene sequence such that synthetic mutant alpha 1 exons (270 bp of coding sequence), which contain mutations identified by sequence analysis, can replace the wild type alpha 1 exon. The synthetic exons were constructed from twelve overlapping oligonucleotides which contained an average of 1.3 random point mutations per intact exon. DNA sequence analysis of mutant alpha 1 exons has shown a point mutant distribution that fits a Poisson distribution, and thus emphasizes the utility of this mutagenesis technique to "scan" a large protein sequence for important mutations. We report our use of saturation mutagenesis to scan an entire exon of the H-2DP gene, a cassette strategy to replace the wild type alpha 1 exon with individual mutant alpha 1 exons, and analysis of mutant molecules expressed on the surface of transfected mouse L cells. Images PMID:2903482

Pyrophosphorolytic dismutation of oligodeoxy-nucleotides by terminal deoxynucleotidyltransferase.

PubMed Central

Anderson, R S; Bollum, F J; Beattie, K L

1999-01-01

Terminal transferase (TdT), when incubated with a purified(32)P-5"-end-labeled oligonucleotide of defined length in the presence of Co(2+), Mn(2+)or Mg(2+)and 2-mercaptoethanol in cacodylate or HEPES buffer, pH 7.2, exhibits the ability to remove a 3"-nucleotide from one oligonucleotide and add it to the 3"-end of another. When analyzed by urea-PAGE, this activity is observed as a disproportionation of the starting oligonucleotide into a ladder of shorter and longer oligonucleotides distributed around the starting material. Optimal metal ion concentration is 1-2 mM. All three metal ions support this activity with Co(2+)> Mn(2+) congruent with Mg(2+). Oligonucleotides p(dT) and p(dA) are more efficient substrates than p(dG) and p(dC) because the latter may form secondary structures. The dismutase activity is significant even in the presence of dNTP concentrations comparable to those that exist in the nucleus during the G(1)phase of the cell cycle. Using BetaScope image analysis the rate of pyrophosphorolytic dismutase activity was found to be only moderately slower than the poly-merization activity. These results may help explain the GC-richness of immunoglobulin gene segment joins (N regions) and the loss of bases that occur during gene rearrangements in pre-B and pre-T cells. PMID:10454617

Multiplexed Analysis of Serum Breast and Ovarian Cancer Markers by Means of Suspension Bead-quantum Dot Microarrays

NASA Astrophysics Data System (ADS)

Brazhnik, Kristina; Sokolova, Zinaida; Baryshnikova, Maria; Bilan, Regina; Nabiev, Igor; Sukhanova, Alyona

Multiplexed analysis of cancer markers is crucial for early tumor diagnosis and screening. We have designed lab-on-a-bead microarray for quantitative detection of three breast cancer markers in human serum. Quantum dots were used as bead-bound fluorescent tags for identifying each marker by means of flow cytometry. Antigen-specific beads reliably detected CA 15-3, CEA, and CA 125 in serum samples, providing clear discrimination between the samples with respect to the antigen levels. The novel microarray is advantageous over the routine single-analyte ones due to the simultaneous detection of various markers. Therefore the developed microarray is a promising tool for serum tumor marker profiling.

Construction of a cDNA microarray derived from the ascidian Ciona intestinalis.

PubMed

Azumi, Kaoru; Takahashi, Hiroki; Miki, Yasufumi; Fujie, Manabu; Usami, Takeshi; Ishikawa, Hisayoshi; Kitayama, Atsusi; Satou, Yutaka; Ueno, Naoto; Satoh, Nori

2003-10-01

A cDNA microarray was constructed from a basal chordate, the ascidian Ciona intestinalis. The draft genome of Ciona has been read and inferred to contain approximately 16,000 protein-coding genes, and cDNAs for transcripts of 13,464 genes have been characterized and compiled as the "Ciona intestinalis Gene Collection Release I". In the present study, we constructed a cDNA microarray of these 13,464 Ciona genes. A preliminary experiment with Cy3- and Cy5-labeled probes showed extensive differential gene expression between fertilized eggs and larvae. In addition, there was a good correlation between results obtained by the present microarray analysis and those from previous EST analyses. This first microarray of a large collection of Ciona intestinalis cDNA clones should facilitate the analysis of global gene expression and gene networks during the embryogenesis of basal chordates.

Implementation of GenePattern within the Stanford Microarray Database.

PubMed

Hubble, Jeremy; Demeter, Janos; Jin, Heng; Mao, Maria; Nitzberg, Michael; Reddy, T B K; Wymore, Farrell; Zachariah, Zachariah K; Sherlock, Gavin; Ball, Catherine A

2009-01-01

Hundreds of researchers across the world use the Stanford Microarray Database (SMD; http://smd.stanford.edu/) to store, annotate, view, analyze and share microarray data. In addition to providing registered users at Stanford access to their own data, SMD also provides access to public data, and tools with which to analyze those data, to any public user anywhere in the world. Previously, the addition of new microarray data analysis tools to SMD has been limited by available engineering resources, and in addition, the existing suite of tools did not provide a simple way to design, execute and share analysis pipelines, or to document such pipelines for the purposes of publication. To address this, we have incorporated the GenePattern software package directly into SMD, providing access to many new analysis tools, as well as a plug-in architecture that allows users to directly integrate and share additional tools through SMD. In this article, we describe our implementation of the GenePattern microarray analysis software package into the SMD code base. This extension is available with the SMD source code that is fully and freely available to others under an Open Source license, enabling other groups to create a local installation of SMD with an enriched data analysis capability.

Transcriptional and functional analysis of galactooligosaccharide uptake by lacS in Lactobacillus acidophilus

PubMed Central

Andersen, Joakim M.; Barrangou, Rodolphe; Abou Hachem, Maher; Lahtinen, Sampo; Goh, Yong Jun; Svensson, Birte; Klaenhammer, Todd R.

2011-01-01

Probiotic microbes rely on their ability to survive in the gastrointestinal tract, adhere to mucosal surfaces, and metabolize available energy sources from dietary compounds, including prebiotics. Genome sequencing projects have proposed models for understanding prebiotic catabolism, but mechanisms remain to be elucidated for many prebiotic substrates. Although β-galactooligosaccharides (GOS) are documented prebiotic compounds, little is known about their utilization by lactobacilli. This study aimed to identify genetic loci in Lactobacillus acidophilus NCFM responsible for the transport and catabolism of GOS. Whole-genome oligonucleotide microarrays were used to survey the differential global transcriptome during logarithmic growth of L. acidophilus NCFM using GOS or glucose as a sole source of carbohydrate. Within the 16.6-kbp gal-lac gene cluster, lacS, a galactoside-pentose-hexuronide permease-encoding gene, was up-regulated 5.1-fold in the presence of GOS. In addition, two β-galactosidases, LacA and LacLM, and enzymes in the Leloir pathway were also encoded by genes within this locus and up-regulated by GOS stimulation. Generation of a lacS-deficient mutant enabled phenotypic confirmation of the functional LacS permease not only for the utilization of lactose and GOS but also lactitol, suggesting a prominent role of LacS in the metabolism of a broad range of prebiotic β-galactosides, known to selectively modulate the beneficial gut microbiota. PMID:22006318

Array painting reveals a high frequency of balanced translocations in breast cancer cell lines that break in cancer-relevant genes

PubMed Central

Howarth, KD; Blood, KA; Ng, BL; Beavis, JC; Chua, Y; Cooke, SL; Raby, S; Ichimura, K; Collins, VP; Carter, NP; Edwards, PAW

2008-01-01

Chromosome translocations in the common epithelial cancers are abundant, yet little is known about them. They have been thought to be almost all unbalanced and therefore dismissed as mostly mediating tumour suppressor loss. We present a comprehensive analysis by array painting of the chromosome translocations of breast cancer cell lines HCC1806, HCC1187 and ZR-75-30. In array painting, chromosomes are isolated by flow cytometry, amplified and hybridized to DNA microarrays. A total of 200 breakpoints were identified and all were mapped to 1Mb resolution on BAC arrays, then 40 selected breakpoints, including all balanced breakpoints, were further mapped on tiling-path BAC arrays or to around 2kb resolution using oligonucleotide arrays. Many more of the translocations were balanced at 1Mb resolution than expected, either reciprocal (eight in total) or balanced for at least one participating chromosome (19 paired breakpoints). Secondly, many of the breakpoints were at genes that are plausible targets of oncogenic translocation, including balanced breaks at CTCF, EP300/p300, and FOXP4. Two gene fusions were demonstrated, TAX1BP1-AHCY and RIF1-PKD1L1. Our results support the idea that chromosome rearrangements may play an important role in common epithelial cancers such as breast cancer. PMID:18084325

DGEM--a microarray gene expression database for primary human disease tissues.

PubMed

Xia, Yuni; Campen, Andrew; Rigsby, Dan; Guo, Ying; Feng, Xingdong; Su, Eric W; Palakal, Mathew; Li, Shuyu

2007-01-01

Gene expression patterns can reflect gene regulations in human tissues under normal or pathologic conditions. Gene expression profiling data from studies of primary human disease samples are particularly valuable since these studies often span many years in order to collect patient clinical information and achieve a large sample size. Disease-to-Gene Expression Mapper (DGEM) provides a beneficial community resource to access and analyze these data; it currently includes Affymetrix oligonucleotide array datasets for more than 40 human diseases and 1400 samples. The data are normalized to the same scale and stored in a relational database. A statistical-analysis pipeline was implemented to identify genes abnormally expressed in disease tissues or genes whose expressions are associated with clinical parameters such as cancer patient survival. Data-mining results can be queried through a web-based interface at http://dgem.dhcp.iupui.edu/. The query tool enables dynamic generation of graphs and tables that are further linked to major gene and pathway resources that connect the data to relevant biology, including Entrez Gene and Kyoto Encyclopedia of Genes and Genomes (KEGG). In summary, DGEM provides scientists and physicians a valuable tool to study disease mechanisms, to discover potential disease biomarkers for diagnosis and prognosis, and to identify novel gene targets for drug discovery. The source code is freely available for non-profit use, on request to the authors.

Glycyrrhizin, silymarin, and ursodeoxycholic acid regulate a common hepatoprotective pathway in HepG2 cells.

PubMed

Hsiang, Chien-Yun; Lin, Li-Jen; Kao, Shung-Te; Lo, Hsin-Yi; Chou, Shun-Ting; Ho, Tin-Yun

2015-07-15

Glycyrrhizin, silymarin, and ursodeoxycholic acid are widely used hepatoprotectants for the treatment of liver disorders, such as hepatitis C virus infection, primary biliary cirrhosis, and hepatocellular carcinoma. The gene expression profiles of HepG2 cells responsive to glycyrrhizin, silymarin, and ursodeoxycholic acid were analyzed in this study. HepG2 cells were treated with 25 µM hepatoprotectants for 24 h. Gene expression profiles of hepatoprotectants-treated cells were analyzed by oligonucleotide microarray in triplicates. Nuclear factor-κB (NF-κB) activities were assessed by luciferase assay. Among a total of 30,968 genes, 252 genes were commonly regulated by glycyrrhizin, silymarin, and ursodeoxycholic acid. These compounds affected the expression of genes relevant various biological pathways, such as neurotransmission, and glucose and lipid metabolism. Genes involved in hepatocarcinogenesis, apoptosis, and anti-oxidative pathways were differentially regulated by all compounds. Moreover, interaction networks showed that NF-κB might play a central role in the regulation of gene expression. Further analysis revealed that these hepatoprotectants inhibited NF-κB activities in a dose-dependent manner. Our data suggested that glycyrrhizin, silymarin, and ursodeoxycholic acid regulated the expression of genes relevant to apoptosis and oxidative stress in HepG2 cells. Moreover, the regulation by these hepatoprotectants might be relevant to the suppression of NF-κB activities. Copyright © 2015 Elsevier GmbH. All rights reserved.

Blocked recombinase polymerase amplification for mutation analysis of PIK3CA gene.

PubMed

Martorell, Sara; Palanca, Sarai; Maquieira, Ángel; Tortajada-Genaro, Luis A

2018-03-01

A blocked recombinase polymerase amplification (blocked-RPA) approach has been developed for the enrichment of mutated templates in heterogeneous specimens as tumor tissues. This isothermal amplification technique opens alternative solutions for meeting the technological demand of physician office laboratories. Herein, the detection of mutations in PIK3CA gene, such as p.E545K, and p.H1047L, is presented. The main element was an oligonucleotide (dideoxycytidine functionalized at 3'-end) which matched with wild-type sequence in the target locus. The amplification was performed operating at 37 °C during 40 min. The results demonstrated that the competition between the upstream primer and the blocker reduced the percentage of amplified wild-type allele, making the detection of the present mutation easier. For mutation discrimination, a fast hybridization assay was performed in microarray format on plastic chip and colorimetric detection. This approach enabled the reliable discrimination of specific mutations against a background of up to 95% wild-type DNA. The applicability of the method, based on the combination of blocked-RPA and low-cost chip hybridization, was successfully proven for the genotyping of various cancer cell lines as well as tumor tissues. The assignations agreed with those provided by next-generation sequencing. Therefore, these investigations would support a personalized approach to patient care based on the molecular signature of human cancers. Copyright © 2017 Elsevier Inc. All rights reserved.

Pentopyranosyl Oligonucleotide Systems. Part 11: Systems with Shortened Backbones: D)-beta-Ribopyranosyl-(4 yields 3 )- and (L)-alpha - Lyxopyranosyl-(4 yields 3 )-oligonucleotides

NASA Technical Reports Server (NTRS)

Wippo, Harald; Reck, Folkert; Kudick, Rene; Ramaseshan, Mahesh; Ceulemans, Griet; Bolli, Martin; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

2001-01-01

The (L)-a-lyxopyranosyl-(4'yields 3')-oligonucleotide system-a member of a pentopyranosyl oligonucleotide family containing a shortened backbone-is capable of cooperative base-pairing and of cross-pairing with DNA and RNA. In contrast, corresponding (D)-beta-ribopyransoyl-(4' yields 3')-oligonucleotides do not show base-pairing under similar conditions. We conclude that oligonucleotide systems can violate the six-bonds-per-backbone-unit rule by having five bonds instead, if their vicinally bound phosphodiester bridges can assume an antiperiplanar conformation. An additional structural feature that seems relevant to the cross-pairing capability of the (L)-a-lyxopyranosyl-(4' yields 3')-oligonucleotide system is its (small) backbone/basepair axes inclination. An inclination which is similar to that in B-DNA seems to be a prerequisite for an oligonucleotide system s capability to cross-pair with DNA.

Genome-scale cluster analysis of replicated microarrays using shrinkage correlation coefficient.

PubMed

Yao, Jianchao; Chang, Chunqi; Salmi, Mari L; Hung, Yeung Sam; Loraine, Ann; Roux, Stanley J

2008-06-18

Currently, clustering with some form of correlation coefficient as the gene similarity metric has become a popular method for profiling genomic data. The Pearson correlation coefficient and the standard deviation (SD)-weighted correlation coefficient are the two most widely-used correlations as the similarity metrics in clustering microarray data. However, these two correlations are not optimal for analyzing replicated microarray data generated by most laboratories. An effective correlation coefficient is needed to provide statistically sufficient analysis of replicated microarray data. In this study, we describe a novel correlation coefficient, shrinkage correlation coefficient (SCC), that fully exploits the similarity between the replicated microarray experimental samples. The methodology considers both the number of replicates and the variance within each experimental group in clustering expression data, and provides a robust statistical estimation of the error of replicated microarray data. The value of SCC is revealed by its comparison with two other correlation coefficients that are currently the most widely-used (Pearson correlation coefficient and SD-weighted correlation coefficient) using statistical measures on both synthetic expression data as well as real gene expression data from Saccharomyces cerevisiae. Two leading clustering methods, hierarchical and k-means clustering were applied for the comparison. The comparison indicated that using SCC achieves better clustering performance. Applying SCC-based hierarchical clustering to the replicated microarray data obtained from germinating spores of the fern Ceratopteris richardii, we discovered two clusters of genes with shared expression patterns during spore germination. Functional analysis suggested that some of the genetic mechanisms that control germination in such diverse plant lineages as mosses and angiosperms are also conserved among ferns. This study shows that SCC is an alternative to the Pearson correlation coefficient and the SD-weighted correlation coefficient, and is particularly useful for clustering replicated microarray data. This computational approach should be generally useful for proteomic data or other high-throughput analysis methodology.

Fabrication of Carbohydrate Microarrays by Boronate Formation.

PubMed

Adak, Avijit K; Lin, Ting-Wei; Li, Ben-Yuan; Lin, Chun-Cheng

2017-01-01

The interactions between soluble carbohydrates and/or surface displayed glycans and protein receptors are essential to many biological processes and cellular recognition events. Carbohydrate microarrays provide opportunities for high-throughput quantitative analysis of carbohydrate-protein interactions. Over the past decade, various techniques have been implemented for immobilizing glycans on solid surfaces in a microarray format. Herein, we describe a detailed protocol for fabricating carbohydrate microarrays that capitalizes on the intrinsic reactivity of boronic acid toward carbohydrates to form stable boronate diesters. A large variety of unprotected carbohydrates ranging in structure from simple disaccharides and trisaccharides to considerably more complex human milk and blood group (oligo)saccharides have been covalently immobilized in a single step on glass slides, which were derivatized with high-affinity boronic acid ligands. The immobilized ligands in these microarrays maintain the receptor-binding activities including those of lectins and antibodies according to the structures of their pendant carbohydrates for rapid analysis of a number of carbohydrate-recognition events within 30 h. This method facilitates the direct construction of otherwise difficult to obtain carbohydrate microarrays from underivatized glycans.